AU2021106359A4

AU2021106359A4 - Neutralizing antigen epitope fusion protein of three kinds of porcine diarrhea-causing viruses and its construction method and application

Info

Publication number: AU2021106359A4
Application number: AU2021106359A
Authority: AU
Inventors: Wenjie JIN; Chen Ning; Kun QIAN; Aijian Qin; Hongxia Shao; Zijun Shen; Jian Wang; Jiao Wang; Qianqian Wang; Jiangao ZHENG; Tingfan Zhu
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2021-08-21
Filing date: 2021-08-21
Publication date: 2021-11-04
Anticipated expiration: 2029-08-21

Abstract

The invention relates to three porcine diarrhea-causing virus neutralizing antigen epitope fusion protein reconstructed bodies, and a preparation method and application thereof. In the present invention, the main neutralizing epitope genes of PEDV, TGEV and PoRV are selected and spliced, and then the tandem gene is expressed as a fusion protein through a recombinant baculovirus eukaryotic expression system. Immunizing mice with recombinant virus expressing tandem gene fusion protein by intraperitoneal injection can induce the body to produce an immune response and has strong immunogenicity. The invention provides a new method for preventing PEDV, TGEV, and PoRV infection, and also lays a foundation for the development of a new vaccine for porcine diarrhea virus.

Description

Neutralizing antigen epitope fusion protein of three kinds of porcine diarrhea-causing viruses and its construction method and application

TECHNICAL FIELD The invention belongs to the field of genetic engineering, in particular to a neutralizing antigen epitope fusion protein of three kinds of porcine diarrhea -causing viruses and a construction method and application thereof.

BACKGROUND Porcine diarrhea caused by porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV) and porcine rotavirus (PORV) is an acute and highly infectious intestinal disease seriously endangering the porcine industry.Porcine diarrhea is characterized by severe enteritis, vomiting and watery diarrhea, especially the high mortality of suckling piglets, which can cause significant economic losses, and has become an important problem in the porcine industry.Although the corresponding vaccine has been developed in recent years, the effect is not very ideal, and with the genetic variation of the virus, the protective effect of the vaccine is becoming more and more unstable. Therefore, for a long time, the infection of porcine diarrhea-like virus is still cannot be ignored in China's porcine industry. The development of related vaccines is also very difficult. For example, in the early stage, it was very difficult for researchers to obtain PEDV on cells in vitro. Most of the viruses were isolated from the feces and intestinal contents of porcinelets infected with primary cells of the small intestine. It was not until 1988 that Hofmann and WyLer reported for the first time that PEDV can be continuously subcultured on Vero cells. Viruses are difficult to isolate, difficult to subculture, and the existence of low virus content in subcultures has brought many challenges to the research and development of traditional vaccines. Moreover, according to the data obtained from our relevant epidemiological investigations, porcine diarrhea virus infections are mostly secondary infections, so the prevention and treatment of porcine diarrhea viruses should also be combined with drugs, but at present, the epidemic strains continue to mutate. Therefore, it is preferable to select conservative neutralizing epitope gene fragments in tandem for fusion protein expression to achieve stable and effective multiple prevention and control effects. However, during the construction of the neutralizing antigen epitope fusion protein, the protein expression level may not be high or the protein immunogenicity may be insufficient, or the porcines may not have a higher immune effect, and the purpose of protecting animals may not be achieved.

In terms of traditional vaccines versus genetic engineering vaccines, traditional vaccines have a long history of research and development. Most scientific researchers also have rich experience in related research and development, and the research and development costs are controllable, and the production process is mature. Traditional inactivated vaccines and attenuated vaccines are also available. It has been tested in the market and plays an indispensable role. However, the process of production, development and application of traditional vaccines may be accompanied by external virus contamination, and biological safety risks such as the return of virus virulence cannot be ignored. All human production and life have been improved simultaneously with the advancement of science and technology. Genetic engineering vaccines must be the development trend of future vaccines. As people become more detailed about the mechanism of virus infection and the mechanism of immune protection becomes clearer, we follow scientific research. The development of new and effective multiple genetically engineered vaccines is an inevitable way for vaccine research and development, and the market is the only choice to make corresponding improvements.

SUMMARY The invention also discloses a preparation method of the said three porcine diarrhea-causing viruses PEDV, TGEV, and PoRV neutralizing antigen epitope fusion protein, which comprises the following steps: (a) Obtain PEDV-COE, TGEV-SA, PoRV-VP7 neutralizing epitope gene fusion protein recombinant gene fragments, and design 3 pairs of primers using PCR method as follows: PEDV-COE-F: 5'-CGGGATCCTTCTAGAAACCTTCTGAGTC-3', (SEQIDNO.3)

PEDV-COE-R : 5'-CGGAATTCATACTTGGTACACACAT-3', (SEQ ID NO.4)

TGEV-S-F :

5'-CGGAATTCGGTTCTGGATCAGGAGGTTCTGGATCAGGATACACACATACCATT 3', (SEQ IDNO.5)

TGEV-S-R : 5'-CCG CTCGAG TATAACAGCTGTGGCATCT-3', (SEQ ID NO.6)

PoRV-VP7-F :

5'-CCGCTCGAGGGTTCTGGATCAGGAGGTTCTGGATCAGGACCAAATGAAG CAGCTACAG-3', (SEQID NO.7)

PoRV-VP7-R : 5'-GG GGTACC GCAGCAGAATCTAAGG-3' ; (SEQ ID NO.8)

Using the nucleic acid extracted from the virus liquid as a template, perform RT-CR reaction to amplify the gene fragments of PEDV-COE, TGEV-SA, and PoRV-VP7; the reaction system is: Green

Taq Mix 12.5ptL, cDNA 2pL, Rnase FreedH 2 09 .5pL, lpL of upstream and downstream primers; reaction procedure: 95°C 5min, 95°C 1min, 61°C 1min, 72°C 1min, total 30 cycles; 72°C 10min; (b) introducing the coding PEDV, TGEV, PoRV neutralizing epitope of the fusion protein gene fragment PEDV-COE, TGEV-SA, PoRV-VP7 respectively connected to the pFastBac-HTA vector, the recombinant expression vector pFastBacHT-COE-SA -VP7; (c) Transpose the recombinant expression plasmid pFastBacHT-COE-SA-VP7 into DH10Bac competent cells, and the positive transposon obtained is identified as a positive colony by bacterial liquid PCR and gene sequencing, that is, it can express PEDV, TGEV, PoRV neutralizing antigen The recombinant baculovirus shuttle vector rBac-COE-SA-VP7 of epitope fusion protein. (3) Sf9 cells were transfected with rBac-COE-SA-VP7 containing PEDV, TGEV, and PoRV neutralizing epitope tandem genes to obtain recombinant virus P1, and cultured at 28°C for 72h-120h until the cells showed obvious lesions. The present invention further discloses the application of the three porcine diarrhea-causing viruses PEDV, TGEV, and PoRV neutralizing antigen epitope fusion protein in preparing medicines for preventing or treating porcinelet diarrhea caused by porcine epidemic diarrhea virus. The present invention selects and splices neutralizing epitope genes of three porcine diarrhea-causing viruses PEDV, TGEV and PoRV. The neutralizing epitopes are the COE gene of PEDV, the SA gene of TGEV, and the VP7 gene of PoRV, respectively. Then, the tandem gene is expressed as a fusion protein through the recombinant baculovirus eukaryotic expression system. Immunizing mice with recombinant virus expressing tandem gene fusion protein by intraperitoneal injection can induce the body to produce an immune response and has strong immunogenicity. Therefore, the present invention fusion expression of three porcine diarrhea-causing virus neutralizing epitope epitope genes provides a new method for preventing PEDV, TGEV, and PoRV infection, and also lays a foundation for the development of a new porcine diarrhea virus vaccine.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 is the pFastBacHTA empty vector plasmid map Figure 2 is a plasmid map of pFastBacHT-VP7. Figure 3 is a plasmid map of pFastBacHT-SA-VP7. Figure 4 is a plasmid map of pFastBacHT-COE-SA-VP7. Figure 5 is the plasmid restriction map of the recombinant plasmid pFastBacHT-COE-SA-VP7 1: BamHI, EcoRI digestion 2: EcoRI, XhoI digestion 3: XhoI, KpnI digestion 4: BamHI digestion :1Kb DNAMarker 6: BamHI digestion 7: BamHI, XhoI digestion 8: EcoRI, KpnI digestion 9 : BamHI,

KpnI digestion

Figure 6 is the M13-like PCR identification diagram for the construction of pFastBacHT-COE-SA VP7 recombinant baculovirus shuttle plasmid M: 1Kb DNA Marker 1: PCR amplification product of pFastBacHT-COE-SA-VP7 recombinant plasmid blue spot 2: PCR amplification product of pFastBacHT-COE-SA-VP7 recombinant plasmid white spot 3: PCR amplification product of pFastBacHTA empty vector recombinant plasmid white spot Amplification product Figure 7 shows the fluorescence of positive serum from PEDV, TGEV, and PoRV in SF9 cells infected with P3 recombinant baculovirus A: PEDV positive serum B: TGEV positive serum C: PoRV positive serum Figure 8 shows the indirect immunofluorescence detection of PEDV, TGEV and PoRV antibody titers in the serum of mice immunized with fusion protein A: Inoculate PEDV cell wells B: Inoculate TGEV cell wells C: Inoculate PoRV cell wells.

DESCRIPTION OF THE INVENTION Example 1. To obtain the neutralizing antigen epitope genes of PEDV-COE, TGEV-SA, and PoRV VP7, three pairs of primers were designed by PCR as follows: PEDV-COE-F: 5'-CGGGATCCTTCTAGAAACCTTCTGAGTC-3', (SEQIDNO.3)

PEDV-COE-R : 5'-CGGAATTCATACTTGGTACACACAT-3', (SEQ ID NO.4)

TGEV-S-F :

5'-CGGAATTCGGTTCTGGATCAGGAGGTTCTGGATCAGGATACACACAT ACCATT 3', (SEQ IDNO.5)

TGEV-S-R : 5'-CCG CTCGAG TATAACAGCTGTGGCATCT-3', (SEQ ID NO.6)

PoRV-VP7-F :

5'-CCGCTCGAGGGTTCTGGATCAGGAGGTTCTGGATCAGGACCAAATGA AGCAGCTAC AG-3', (SEQ ID NO.7)

PoRV-VP7-R : 5'-GG GGTACC GCAGCAGAATCTAAGG-3' ; (SEQ ID NO.8)

The nucleic acid extracted from the virus liquid was used as a template, and the gene fragments of PEDV-COE, TGEV-SA and PoRV-VP7 were obtained by RT-CR reaction amplification; The PCR reaction system is: Green Taq Mix 12.5ptL, cDNA 22x 1Rnase Free dH20 9.5 dHee dHcDNcDNgments of PEDV-COE, TGEV-SA and PoRV-VP7 were obtainedn program: 95°C 5min, 95°C 1min, 61°C 1min, 72°C 1min, A total of 30 cycles; 72DV-COE, TGEV-SA andagarose gel electrophoresis was performed, the product recovered from the gel was ligated with the pGEM-T Easy vector (purchased from Promega, catalog number A1360), and transformed into DH5a, and the positive plasmid was screened and sent to

BGI Gene sequencing, the correct sequenced plasmids are named and stored as follows: pGEM-T-COE, pGEM-T-SA, pGEM-T-VP7. Example 2. Construction and identification of recombinant pFastBacHT-COE-SA-VP7 eukaryotic expression vector (1) Construction of recombinant pFastBacHT-COE-SA-VP7 eukaryotic expression vector Take the correctly identified pGEM-T-COE, pGEM-T-SA, pGEM-T-VP7 and the expression vector pFast-Bac-HTA (purchased from Invitrogen), and inoculate them at a ratio of 1:100 in 3mL containing Amp (100ptL/mL ) In the LB liquid medium, 37°C, 225 rpm, overnight. Take 2 mL of each bacterial solution according to the small extraction plasmid kit instructions to obtain the corresponding plasmids and save them for later use. Then pGEM-T-VP7 and pFast-Bac-HTA (see Figure 1) are respectively subjected to XhoI and KpnI double digestion, agarose The target fragment was recovered by gel electrophoresis and ligated by T4 DNA ligase to obtain the eukaryotic expression vector pFastBacHT VP7; then pGEM-T-SA and pFastBacHT-VP7 (see Figure 2) were digested with EcoRI and XhoI respectively, and lipoglycol gel The target fragment was recovered by electrophoresis and ligated by T4DNA ligase to obtain the eukaryotic expression vector pFastBacHT-SA-VP7 (see Figure 3); finally, pGEM-T-COE and pFastBacHT-SA-VP7 were double digested with BamHI and EcoRI and lipogelatinized The target fragment was recovered by gel electrophoresis, and the eukaryotic expression vector pFastBacHT-COE-SA-VP7 was obtained by ligation with T4 DNA ligase (see Figure 4). The positive plasmid was screened and sent to BGI for sequencing. The sequence obtained is shown in SEQ ID NO.1. The encoded protein sequence is shown in SEQ ID NO.2. (2) Identification of recombinant pFastBacHT-COE-SA-VP7 eukaryotic expression vector The obtained eukaryotic expression vector pFastBacHT-COE-SA-VP7 was digested and identified, and the recombinant plasmids were digested with BamHI, EcoRI, EcoRI, XhoI, XhoI, KpnI, BamHI, BamHI, XhoI Enzyme digestion, EcoRI, KpnI digestion, BamHI, KpnI digestion, the digestion system is 2pl of recombinant plasmid, 2pl of 1OxBuffer, 1Ilof each restriction enzyme, and ddH 2 0 to make up to 20pl. The result of restriction digestion is shown in Figure 5. Example 3. Construction and identification of recombinant baculovirus rBacmid-COE-SA-VP7 shuttle vector (1) Transposition of recombinant plasmid Take 5ansposition of recombinant plasmidectornt baculovirus rBacmid-COE-SA-Vt cells, ice bath for 30min; heat shock at 42°C for 45s, then immediately take out the ice bath for 2min; add 800d-COE SA-VP7 shuttle vector°C, Cultivate for 4 hours at 225 rpm; then take out the cultured bacterial solution, and dilute the culture to three concentrations with SOC liquid medium in turn, (200 pL bacterial culture and 800 pL SOC liquid medium): 10 -1, 10 -2, 10 -3 ; After dilution at 4 500rpm, centrifugation for 5min, discard the supernatant, then add 200pL SOC liquid medium to resuspend the bacterial pellet, spread it on the LA-BAC plate, and invert it in a 37C incubator for 24-48h until colonies appear. (2) Extraction of recombinant baculovirus shuttle vector Pick white clones and re-streak them on a fresh LA-BAC selective plate, incubate overnight at 37C, and purify them for two consecutive generations until they are all white spots; at the same time choose a blue spot as a negative control; inoculate positive clones to 4 mL containing Kanamycin (50secutive generations until they are all white clones to 4 mL contai°C, 225rpm shaker, overnight shaking, at the same time choose a blue spot as a negative control; On the next day, take 2mL of bacterial solution in a new 2mL centrifuge tube, discard the supernatant at 12000rpm, 1min; add 300qLSoLutionI (15mM Tris HCl, pH8.0, 10mM EDTA) to resuspend the bacteria; add 300; add 300d the bacteria; add 3011, mix upside down Homogenize and act at room temperature for 5min; slowly add SoLutionIII (3M potassium acetate, PH5.5), mix gently while adding until a uniform white precipitate is formed, ice bath for 5-10min; centrifuge at 4°C, 12,000rpm for 10min, at the same time beforehand Add 800entrifuge at 4y add SoLutioncontrol; Onfuge tube; transfer the supernatant to a centrifuge tube containing isopropanol, gently invert to mix, ice bath for 5-10min; centrifuge at 12,000rpm for 15min at room temperature, discard the supernatant; Add 500pL of 70% ethanol, mix upside down and centrifuge at 12,000rpm for 10min; discard the supernatant as much as possible; dry for 5-10min in an ultra-clean table until the alcohol is completely evaporated; finally dissolve in 30iscard the supernatant; Add 500pL of 70% ethano°C for later use; at the same time, set DH10Bac as a negative control, and the extraction method is the same as above. (3) Identification of recombinant baculovirus shuttle vector The recombinant baculovirus shuttle vector rBacmid-COE-SA-VP7 was identified by PCR using M13 universal primers. The PCR system was LA Taq enzyme 0.5pil, 10xLA Taq Buffer 5pl, dNTP Mix (2.5mM) 8pl, M13 primers F/R each 2pl, cDNA Ip, ddH 2 0 31.5pl. The PCR program is 94°C 3min, 94°C 30s, 55°C 30s, 72°C 3mim, 30cycles, 72°C 10min, 4°CoolOmin, 4cycles, 72 P The Phe Pl, cDNA 1p, ddH 2 0 31 Example 4. Preparation of recombinant baculovirus rBacmid-COE-SA-VP7 embodiment (1) Transfect Sf9 cells to obtain primary virus P1 The day before transfection, gently blow down the Sf9 cells in the logarithmic growth phase, and add lxl0 to 2mL Grace' complete medium containing double antibodies (50U/mL penicillin and 50pg/mL streptomycin) and 10% FBS 6 Sf9 cells. Gently blow the cells to make the cells evenly distributed on the 6-well plate; culture in a 28°C incubator for 24 hours. Take two 1.5mL centrifuge tubes and add 250pL of Grace' medium, then add Lipofectamine TM 3000 and 5pg of pFastBacHT-COE-SA-VP7 plasmid DNA into the 1.5mL centrifuge tubes respectively, mix gently; then centrifuge the two Mix the tube evenly and let it stand at room temperature for 15 minutes; gently aspirate the Sf9 cell culture supernatant, and wash gently with Grace' medium twice; add 750 ptLGrace'medium to the liposome 3000-DNA complex, and mix gently Then add ImL/well to Sf9 cells evenly, and incubate at 27C for 5h; aspirate the supernatant, add 2mL/well of Grace' complete medium, and incubate at 28°C for 72h-120h until the cells appear obvious lesions. BacmidDNA without rBacmid COE-SA-VP7 gene and blank were used as control, and the transfection process was the same as above. (2) Harvest and amplify recombinant baculovirus When the cells have obvious lesions, collect the cells and the culture supernatant, and store them in the dark at 4°C (it can also be stored at -70°C for a long time) to obtain the P1 generation recombinant virus. Infect sf9 cells in logarithmic growth phase with 50pLPI virus, and culture them in an incubator at 28°C for 5-7 days. When obvious lesions appear, collect the cells and the culture supernatant, and store them at 4°C in the dark (can also be stored at -70 Long-term preservation at C), the P2 generation recombinant virus is obtained. Amplify the P3 generation virus according to the above method. (3) Identification of recombinant baculovirus The obtained recombinant virus was identified by indirect immunofluorescence, using porcine derived PEDV, TGEV, and PoRV positive sera as the primary antibody, and FITC-labeled goat anti porcine antibody as the secondary antibody for indirect immunofluorescence identification, and the results were all positive. The identification results are shown in Figure 7. (4) Analysis of immune efficacy of recombinant protein The resulting recombinant virus was diluted to 10 5.0 TCID 50 / mL, ImL injected via the abdominal cavity of mice within 7 days, 21 days booster immunization after thefirst immunization, mice serum was collected every 7 days. PEDV TGEV by seeding the cells and PoRV indirect immunofluorescence experiments, with mouse serum tests showed high potency. The recombinant vector pFastBacHT-COE-SA-VP7 of the present invention can be expressed recombinant proteins, immunization of mice after miniprep 28d protein-specific antibody can be detected (see FIG. 8), the results of the present invention will PEDV, TGEV, PoRV triple genetically engineered vaccine research foundation, to provide new ideas.

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS: 1.The neutralizing antigen epitope fusion proteins of three Porcine diarrhea-causing viruses PEDV, TGEV and PORV are characterized in their amino acid sequences as shown in SEQ ID No.2.
2. A gene encoding the neutralizing antigen epitope fusion protein of the three porcine diarrhea causing viruses PEDV, TGEV, and PoRV according to claim 1, characterized in the sequence as shown in SEQ ID NO.1.
3. The preparation method of three porcine diarrhea-causing viruses PEDV, TGEV, and PoRV neutralizing antigen epitope fusion protein according to claim 1, characterized in that it comprises the following steps: 1) Obtain recombinant gene fragments containing PEDV, TGEV, PoRV neutralizing antigen epitope fusion protein: Design 3 pairs of primers using PCR method as follows: PEDV-COE-F: 5'-CGGGATCCTTCTAGAAACCTTCTGAGTC-3',

PEDV-COE-R: 5'-CGGAATTCATACTTGGTACACACAT-3',

TGEV-S-F : 5'-CG GAATTC

GGTTCTGGATCAGGAGGTTCTGGATCAGGATACACACATACCATT-3',

TGEV-S-R : 5'-CCG CTCGAG TATAACAGCTGTGGCATCT-3',

PoRV-VP7-F :

5'-CCG CTCGAG GGTTCTGGATCAGGAGGTTCTGGATCAGGACCAAATGAAGCAGCTACAG-3', PoRV-VP7-R : 5'-GG GGTACC GCAGCAGAATCTAAGG-3' ;

The gene fragments of PEDV-COE, TGEV-SA and PoRV-VP7 were amplified by RT-CR reaction; the reaction system was: Green Taq Mix 12.52.5gcDNA 2NA 2Rnase Free dH 209.5ee, each of the upstream and downstream primers 1V-VP7 wereaction program: 95°C5min, 95°Clmin, 61°Clmin, 72°Clmin, total 30 cycles; 72°ClOmin; 2) Obtain the recombinant expression plasmid pFastBacHT-COE-SA-VP7 containing the PEDV, TGEV, PoRV neutralizing antigen epitope fusion protein gene: the above-mentioned gene fragment PEDV-COE encoding the PEDV, TGEV, PoRV neutralizing antigen epitope fusion protein, TGEV-SA and PoRV-VP7 are connected to the pFastBac-HTA vector to obtain the recombinant expression vector pFastBacHT-COE-SA-VP7; 3) Construction of recombinant baculovirus shuttle vector: The recombinant expression plasmid pFastBacHT-COE-SA-VP7 was transposed into DH1OBac competent cells, and the positive transposon obtained was identified as a positive colony by bacterial liquid PCR and gene sequencing, that is, it can express PEDV, TGEV, PoRV neutralizing epitope in series Recombinant baculovirus shuttle vector of gene fusion protein; 4) Preparation of recombinant baculovirus rBac-COE-SA-VP7 Sf9 cells were transfected to obtain recombinant virus P1. The day before transfection, the Sf9 cells in the logarithmic growth phase were gently blown down, and the double antibody containing 50U/mL penicillin and 50pg/mL streptomycin and 10% FBS was applied. Add x106 Sf9 cells to 2mL Grace complete medium. Gently blow the cells to make the cells evenly distributed on the 6-well plate; culture in a 28°C incubator for 24 hours; add 250pL of Grace's medium to two 1.5mL centrifuge tubes, and then add LipofectamineTM 3000 and 5pg of LipofectamineTM 3000 to the 1.5mL centrifuge tubes. pFastBac-COE-SA-VP7 plasmid DNA, mix gently; then mix the two centrifuge tubes evenly and let stand at room temperature for 15 minutes; gently aspirate the supernatant of Sf9 cell culture, and wash gently with Grace medium twice; Add 750uLGrace medium to the liposome 3000-DNA complex, mix gently, and add 1mL/well to Sf9 cells evenly, and incubate at 27C for 5h; aspirate the supernatant and add 2mL/well of Grace to complete culture Cultivate at 28°C for 72h-120h until the cells have obvious lesions. At the same time, set BacmidDNA without rBac-COE-SA-VP7 gene and blank as controls. The transfection process is the same as above, and the harvest is the recombinant baculovirus rBac-COE SA-VP7. 5.The application of the neutralizing antigen epitope fusion protein of three Porcine diarrhea causing viruses PEDV, TGEV and PORV according to claim 1 in the preparation of medicine for preventing or treating porcinelet diarrhea caused by porcine epidemic diarrhea virus.

EDITORIAL NOTE 21 Aug 2021

2021106359

There are 5 pages of drawings only.

1 / 10

FIGURES 21 Aug 2021 2021106359

Figure 1 The pFastBacHTA empty vector plasmid map

Figure 2 The plasmid map of pFastBacHT-VP7

2 / 10 21 Aug 2021 2021106359

Figure 3 The plasmid map of pFastBacHT-SA-VP7

Figure 4 The plasmid map of pFastBacHT-COE-SA-VP7

3 / 10 21 Aug 2021 2021106359

Figure 5 The plasmid restriction map of the recombinant plasmid pFastBacHT-COE-SA-VP7 1: BamHI, EcoRI digestion 2: EcoRI, XhoI digestion 3: XhoI, KpnI digestion 4: BamHI digestion 5:1Kb DNAMarker 6: BamHI digestion 7: BamHI, XhoI digestion 8: EcoRI, KpnI digestion 9 ：BamHI, KpnI digestion

4 / 10 21 Aug 2021 2021106359

Figure 6 The M13-like PCR identification diagram for the construction of pFastBacHT-COE- SA-VP7 recombinant baculovirus shuttle plasmid M: 1Kb DNA Marker 1: PCR amplification product of pFastBacHT-COE-SA-VP7 recombinant plasmid blue spot 2: PCR amplification product of pFastBacHT-COE-SA-VP7 recombinant plasmid white spot 3: PCR amplification product of pFastBacHTA empty vector recombinant plasmid white spot Amplification product

5 / 10 21 Aug 2021 2021106359

Figure 7 shows the fluorescence of positive serum from PEDV, TGEV, and PoRV in SF9 cells infected with P3 recombinant baculovirus A: PEDV positive serum B: TGEV positive serum C: PoRV positive serum

Figure 8 shows the indirect immunofluorescence detection of PEDV, TGEV and PoRV antibody titers in the serum of mice immunized with fusion protein A: Inoculate PEDV cell wells B: Inoculate TGEV cell wells C: Inoculate PoRV cell wells.

6 / 10 21 Aug 2021

SEQUENCE LISTING < 110 > Yangzhou University < 120 > neutralizing antigen epitope fusion protein of Three Porcine diarrhea viruses and its construction method and Application <130> <160> 8 2021106359

<170> PatentIn version 3.3 <210> 1 <211> 1557 <212> DNA < 213 > Artificial sequence <400> 1 atggatcctt ctagaaacct tctgagtcat gaacagccaa tttcttttgt tactttgcca 60 tcattcaatg atcattcttt tgttaatatt actgtctctg cggcttttgg tggtcatagt 120 ggtgccaacc tcattgcatc tgacactact atcaatgggt ttagttcttt ctgtgttgac 180 actagacaat ttaccattac actgttttat aacgttacaa acagttatgg ttatgtgtct 240 aagtcacagg atagtaattg ccctttcacc ttgcaatctg ttaatgatta cctgtctttt 300 agcaaatttt gtgtttcaac cagccttttg gctggtgctt gtaccataga tctttttggt 360 taccctgagt tcggtagtgg tgttaagttt acgtcccttt attttcaatt cacaaagggt 420 gagttgatta ctggcacgcc taaaccactt caaggtgtca cggacgtttc ttttatgact 480 ctggatgtgt gtaccaagta tgaattcggt tctggatcag gaggttctgg atcaggatac 540 acacatacca ttgttaacat aactattggt cttggtatga agcgtagtgg ttatggtcaa 600 cccatagcct cgacattaag taacatcaca ctaccaatgc aggatcacaa caccgatgtg 660 tactgtattc gttctgacca attttcagtt tatgttcatt ctacttgcaa aagtgtttta 720 tgggacaata tttttaagcg aaactgcacg gacgttttag atgccacagc tgttatactc 780 gagggttctg gatcaggagg ttctggatca ggaccaaatg aagcagctac agaaattgca 840 gatacaaaat ggacagaaac attgtcgcag ttgtttttaa caaaaggatg gccaacaggg 900 tcagtttatt ttaaaggata tgcagatatt gcgtcatttt ctgtagaacc gcagttatac 960 tgcgactata atattgtact aatgaaatat gatggaaatt tacagttaga catgtctgaa 1020 ttggctgatt taatattgaa tgaatggcta tgtaatccaa tggatataat gctatattat 1080 tatcagcaaa cagatgaagc taataaatgg atatcaatgg gtacatcatg tacgattaaa 1140 gtatgtcctc taaatacgca gactctcggg ataggatgtt cgactacaga cataaattca 1200 tttgaaacag tggccaatgc agagaaatta gctataactg atgttgtcga tggagtcaat 1260

7 / 10

cataaattag acgtaacaac gagtacatgt actataagaa attgtaaaaa acttggacca 1320 21 Aug 2021

agagaaaatg tcgctgtaat tcaggtagga ggtccaaaca tactcgacat aacagctgat 1380 ccaacaactg caccacaaac tgaaagaatg atgcgtataa attggaagag atggtggcaa 1440 gtcttttata caatagttga ttatgtcaat caaattgtac aagtcatgtc caagcgatca 1500 cgctccttag attctgctgc ggtaccaagc ttgtcgagaa gtactagagg atcataa 1557 <210> 2 <211> 518 2021106359

<212> PRT < 213 > Artificial sequence <400> 2 Met Asp Pro Ser Arg Asn Leu Leu Ser His Glu Gln Pro Ile Ser Phe 1 5 10 15 Val Thr Leu Pro Ser Phe Asn Asp His Ser Phe Val Asn Ile Thr Val 20 25 30 Ser Ala Ala Phe Gly Gly His Ser Gly Ala Asn Leu Ile Ala Ser Asp 35 40 45 Thr Thr Ile Asn Gly Phe Ser Ser Phe Cys Val Asp Thr Arg Gln Phe 50 55 60 Thr Ile Thr Leu Phe Tyr Asn Val Thr Asn Ser Tyr Gly Tyr Val Ser 65 70 75 80 Lys Ser Gln Asp Ser Asn Cys Pro Phe Thr Leu Gln Ser Val Asn Asp 85 90 95 Tyr Leu Ser Phe Ser Lys Phe Cys Val Ser Thr Ser Leu Leu Ala Gly 100 105 110 Ala Cys Thr Ile Asp Leu Phe Gly Tyr Pro Glu Phe Gly Ser Gly Val 115 120 125 Lys Phe Thr Ser Leu Tyr Phe Gln Phe Thr Lys Gly Glu Leu Ile Thr 130 135 140 Gly Thr Pro Lys Pro Leu Gln Gly Val Thr Asp Val Ser Phe Met Thr 145 150 155 160 Leu Asp Val Cys Thr Lys Tyr Glu Phe Gly Ser Gly Ser Gly Gly Ser 165 170 175 Gly Ser Gly Tyr Thr His Thr Ile Val Asn Ile Thr Ile Gly Leu Gly 180 185 190

8 / 10

Met Lys Arg Ser Gly Tyr Gly Gln Pro Ile Ala Ser Thr Leu Ser Asn 21 Aug 2021

195 200 205 Ile Thr Leu Pro Met Gln Asp His Asn Thr Asp Val Tyr Cys Ile Arg 210 215 220 Ser Asp Gln Phe Ser Val Tyr Val His Ser Thr Cys Lys Ser Val Leu 225 230 235 240 Trp Asp Asn Ile Phe Lys Arg Asn Cys Thr Asp Val Leu Asp Ala Thr 2021106359

245 250 255 Ala Val Ile Leu Glu Gly Ser Gly Ser Gly Gly Ser Gly Ser Gly Pro 260 265 270 Asn Glu Ala Ala Thr Glu Ile Ala Asp Thr Lys Trp Thr Glu Thr Leu 275 280 285 Ser Gln Leu Phe Leu Thr Lys Gly Trp Pro Thr Gly Ser Val Tyr Phe 290 295 300 Lys Gly Tyr Ala Asp Ile Ala Ser Phe Ser Val Glu Pro Gln Leu Tyr 305 310 315 320 Cys Asp Tyr Asn Ile Val Leu Met Lys Tyr Asp Gly Asn Leu Gln Leu 325 330 335 Asp Met Ser Glu Leu Ala Asp Leu Ile Leu Asn Glu Trp Leu Cys Asn 340 345 350 Pro Met Asp Ile Met Leu Tyr Tyr Tyr Gln Gln Thr Asp Glu Ala Asn 355 360 365 Lys Trp Ile Ser Met Gly Thr Ser Cys Thr Ile Lys Val Cys Pro Leu 370 375 380 Asn Thr Gln Thr Leu Gly Ile Gly Cys Ser Thr Thr Asp Ile Asn Ser 385 390 395 400 Phe Glu Thr Val Ala Asn Ala Glu Lys Leu Ala Ile Thr Asp Val Val 405 410 415 Asp Gly Val Asn His Lys Leu Asp Val Thr Thr Ser Thr Cys Thr Ile 420 425 430 Arg Asn Cys Lys Lys Leu Gly Pro Arg Glu Asn Val Ala Val Ile Gln 435 440 445 Val Gly Gly Pro Asn Ile Leu Asp Ile Thr Ala Asp Pro Thr Thr Ala 450 455 460

9 / 10

Pro Gln Thr Glu Arg Met Met Arg Ile Asn Trp Lys Arg Trp Trp Gln 21 Aug 2021

465 470 475 480 Val Phe Tyr Thr Ile Val Asp Tyr Val Asn Gln Ile Val Gln Val Met 485 490 495 Ser Lys Arg Ser Arg Ser Leu Asp Ser Ala Ala Val Pro Ser Leu Ser 500 505 510 Arg Ser Thr Arg Gly Ser 2021106359

515 <210> 3 <211> 28 <212> DNA < 213 > Artificial sequence <400> 3 cgggatcctt ctagaaacct tctgagtc 28 <210> 4 <211> 25 <212> DNA < 213 > Artificial sequence <400> 4 cggaattcat acttggtaca cacat 25 <210> 5 <211> 53 <212> DNA < 213 > Artificial sequence <400> 5 cggaattcgg ttctggatca ggaggttctg gatcaggata cacacatacc att 53 <210> 6 <211> 28 <212> DNA < 213 > Artificial sequence <400> 6 ccgctcgagt ataacagctg tggcatct 28 <210> 7 <211> 58

10 / 10

<212> DNA 21 Aug 2021

< 213 > Artificial sequence <400> 7 ccgctcgagg gttctggatc aggaggttct ggatcaggac caaatgaagc agctacag 58 <210> 8 <211> 24 <212> DNA 2021106359

< 213 > Artificial sequence <400> 8 ggggtaccgc agcagaatct aagg 24