AU2021100508A4

AU2021100508A4 - A duck plague virus UL41 gene markerless deletion strain CHv-BAC-G-ΔUL41 and a construction method thereof

Info

Publication number: AU2021100508A4
Application number: AU2021100508A
Authority: AU
Inventors: Anchun CHENG; Tianqiong He; Mingshu Wang
Original assignee: Sichuan Agricultural University
Current assignee: Sichuan Agricultural University
Priority date: 2021-01-27
Filing date: 2021-01-27
Publication date: 2021-04-15
Anticipated expiration: 2029-01-27

Abstract

The present invention discloses a duck plague virus UL41 gene markerless deletion strain CHv BAC-G-AUL41 and a construction method thereof, belonging to the technical field of biology. According to the invention, GS1783 Escherichia coli strain and pEPKan-S plasmid are utilized to delete the UL41 gene of duck plague virus through two-step homologous recombination on the platform of a bacterial artificial chromosome recombination duck plague virus rescue system, and the construction of duck plague virus markerless deletion strain without exogenous base residue is completed for the first time. According to the invention, the problem of residual base at the deletion site when the duck plague virus gene is deleted is solved, and sufficient technical support is provided for accurately exploring the function of duck plague virus gene and constructing an attenuated live vaccine. -1/4 pEPkan-S 6288 bp -I (~ 17romoter CCAP binding sitel v (iac opraorr Fig. 1

Description

-1/4

pEPkan-S 6288 bp

-I (~ 17romoter

CCAP binding sitel v (iac opraorr

Fig. 1

A duck plague virus UL41 gene markerless deletion strain CHv-BAC-G-AUL41 and

a construction method thereof

TECHNICAL FIELD

The invention belongs to the field of biotechnology, and particularly relates to a duck

plague virus UL41 gene markerless deletion strain CHv-BAC-G-AUL41 and a construction

method thereof.

BACKGROUND

Bacterial artificial chromosome (BAC) is a cloning vector system carrying large DNA

fragments, which has been introduced into the research field of herpesvirus. Compared

with other vector systems, it has high transformation efficiency, few chimeras, easy

recovery of insert fragments, high coverage, strong stability, and easy separation and

operation.

Inserting complete virus genome DNA molecule into BAC vector to obtain molecular clone

virus, and combine with Escherichia coli gene localization modification technology to

realize the deletion of virus gene and the insertion of foreign gene in prokaryotic system.

At present, the commonly used gene localization modification technologies of Escherichia

coli mainly include Red/ET-mediated homologous recombination technology, RecA

protein-mediated homologous recombination technology, Cre/loxP-mediated homologous

recombination technology and Tn transposon-mediated random insertion and mutation

technology.

A mature platform of bacterial artificial chromosome duck plague virus rescue system has

been obtained by means of molecular cloning technology. At the same time, the deletion of duck plague virus gene and the insertion of foreign gene can be carried out on the platform of duck plague virus rescue system with Escherichia coli gene localization modification and Red/ET-mediated homologous recombination technology, which greatly promotes the research process of duck plague virus gene function.

Duck plague is an acute, febrile and septic infectious disease caused by duck plague virus

infecting Anseriformes birds, such as ducks, geese and swans. It has a high incidence and

strong pathogenicity, which often leads to serious morbidity and death, decreased egg

production of ducks and serious economic losses. Moreover, the disease is prevalent in

areas with developed duck industry in South China, Central China and East China, which

has caused serious economic losses to the duck industry in China. Therefore, it is

particularly important to understand the function of duck plague virus genes and strengthen

the research on duck plague to ensure the sustainable development of duck industry in

China.

Duck plague virus belongs to Alphaherpesvirinae subfamily, which has the typical

structure of herpesvirus. It is composed of DNA core, capsid, tegument and envelope. The

tegument is a protein layer with no fixed shape between nucleocapsid and envelope, which

is mainly composed of proteins and plays an important role in virus entry and viral

morphogenesis. When the viral envelope is fused with the cytoplasmic membrane, the

tegument and capsid proteins enter the cell and influence the maturation of virus particles,

the transportation of virus particles in cells, the assembly and release of virus, the

transcription and expression of virus or host genes, and the immune evasion in cells.

Therefore, it is very important to explore the role of tegument protein in the viral life cycle and immune evasion for further exploring the function of duck plague virus gene and carrying out the prevention and control of duck plague.

In the present technology using BAC as a platform to recombine duck plague virus genome

into a virus transfer vector containing BAC, and construct a bacterial artificial chromosome

recombination duck plague virus rescue system platform DPV CHv-BAC-G. At the same

time, combined with Red/ET modification technology, duck plague virus gene deletion and

foreign gene insertion were completed by gene manipulation in prokaryotic system.

However, when the duck plague virus gene is deleted on the platform of bacterial artificial

chromosome recombination duck plague virus rescue system by using the Red/ET

modification technology, two FRT sites will remain at the deleted site. The residue of FRT

exogenous sites has influence on the research of gene function and the development of live

attenuated vaccine.

SUMMARY

The purpose of the present invention is to provide a duck plague virus UL41 gene

markerless deletion strain CHv-BAC-G-AUL41 and a construction method thereof, so as

to solve the problem of residual base at the deletion site when the duck plague virus gene

is deleted in the present technology.

To achieve the above purpose, the present invention provides the following scheme:

The invention provides a construction method of duck plague virus UL41 gene markerless

deletion strain CHv-BAC-G-AUL41, which comprises the following steps:

1) Transforming pBAC-DPV plasmid into GS1783 Escherichia coli competence to obtain

GS1783-pBAC-DPV strain, and then preparing GS1783-pBAC-DPV competence.

2) With pEPKan-S as template and GS1783-BAC-AUL41-F and GS1783-BAC-AUL41-R

as primers, the base elements containing I_Scel restriction site and Kana element and the

target fragment ISceI-Kana-AUL41 with 40bp homologous arms upstream and

downstream of UL41 gene are amplified by PCR, operating gel extraction to obtain I_Scel

Kana-UL41 fragment.

3) Transforming ISceI-Kana-UL41 fragment into GS1783-pBAC-DPV competence, and

obtaining a positive clone GS1783-pBAC-DPV-UL41-Kana after screening and PCR

identification.

4) Removing the ISce-Kana fragment from the positive clone GS1783-pBAC-DPV

UL41-Kana, screening by antibiotics and PCR, sequencing and identifying to obtain the

positive clone GS1783-pBAC-DPV-AUL41.

) Extracting pBAC-DPV-AUL41 plasmid from the positive clone GS1783-pBAC-DPV

AUL41, and the DEFs are transfected with pBAC-DPV-AUL41 plasmid. After cloning and

screening, the markerless deletion strain CHv-BAC-G-AUL41 with deletion of UL41 gene

of duck plague virus is obtained.

Preferably, the PCR amplification system in step 2) is: ddH20 22L, Max DNA

Polymerase 25 L, upstream primer 1 L, downstream primer 1 L and template 1 L.

Preferably, the PCR amplification conditions in step 2) are as follows: pre-denaturation at

98°C for 2min, denaturation at 98°C for 10s, annealing at 55°C for 15s, extension at 72°C

for 5s, for 30 cycles in total, and extension at 72°C for 10min.

Preferably, the primer sequences in step 2) are shown as SEQ ID NO.1 and SEQ ID NO.2.

The present invention also provides a duck plague virus UL41 gene markerless deletion

strain CHv-BAC-G-AUL41 prepared by any one of the methods of the invention.

The invention discloses the following technical effect:

Based on the platform of bacterial artificial chromosome recombinant duck plague virus

rescue system, the invention utilizes Red-based modification technology, namely, utilizes

GS1783 Escherichia coli strain which can encode Red operon and I_Scel enzyme and

plasmid pEPKan-S which contains kanamycin-resistant and I_Scel enzyme cleavage site,

and deletes duck plague virus UL41 gene through two-step homologous recombination on

platform of bacterial artificial chromosome recombinant duck plague virus rescue system,

the construction of duck plague virus markerless deletion strain without exogenous base

residue was completed for the first time. The method solves the problem of residual base

at deletion site when duck plague virus gene is deleted, and provides sufficient technical

support for accurately exploring the duck plague virus gene function and constructing

attenuated live vaccine.

DESCRIPTION OF THE FIGURES

Fig. 1 is a plasmid profile of pEPKan-S.

Fig. 2 is an operation flow chart of UL41 gene deletion on the bacterial artificial

chromosome recombinant duck plague virus rescue system platform by using Red-Based

modification technology.

Fig. 3 is an identification diagram of positive clones transformed from I_SceI-Kana-UL41

target fragment into GS1783-pBAC-DPV competence by electric shock.

Fig. 4 is an identification diagram after removing the I_Sce-Kana fragment in the positive

clone GS1783-pBAC-DPV-UL41-Kana.

Fig. 5 is a diagram of fluorescent plaque after rescue of UL41 gene markerless deletion

strain CHv-BAC-G-AUL41 virus.

Fig. 6 is an identification diagram after extracting genomic DNA of CHv-BAC-G-AUL41

virus by PCR. Wherein Fig. 6a is an identification diagram of CHv-BAC-G-AUL41 virus

genome by PCR. Fig. 6b is an identification diagram of CHv-BAC-G virus genome by

PCR. DESCRIPTION OF THE INVENTION

Various exemplary embodiments of the present invention will be described in detail, which

should not be regarded as a limitation of the present invention, but rather as a more detailed

description of certain aspects, characteristics and embodiments of the present invention.

On the premise of not departing from the design spirit of the invention, various

modifications and improvements made by ordinary technicians in the field to the technical

scheme of the invention shall fall within the protection scope determined by the claims of

the invention.

The sources of materials and reagents used in the construction process of the invention are

as follows:

1. Experimental materials

1) Cells, strains, virus strains and plasmids

Primary duck embryo fibroblasts were prepared from 10 to 11-day-old non-immune

fertilized duck embryos by conventional method. GS1783 strains were preserved in

laboratory of Sichuan Agricultural University. pBAC-DPV plasmids were constructed and

preserved in laboratory of Sichuan Agricultural University. pEPKan-S plasmid was

preserved in laboratory of Sichuan Agricultural University.

2. Molecular biological reagents

TIANprep Mini Plasmid Kit was purchased from TIANGEN Company. The QIAGEN

Plasmid Midi Kit was purchased from QIAGEN company. The TIANgel Midi Purification

Kit was purchased from TIANGEN Company. PrimeSTAR Max DNA Polymerase was

purchased from TaKaRa company. TaKaRa MiniBEST Viral RNA/DNA Extraction Kit

Ver.5.0 was purchased from TaKaRa Company. Lipofectamine 3000 was purchased from

Invitrogen Company.

3. The culture medium used in the experiment and its preparation

LB liquid culture medium: lOg tryptone, 5g yeast extract and lOg sodium chloride are

dissolved in 800mL deionized water, fully stirred, making a constant volume to IL,

operating high temperature and high pressure sterilization.

LB solid culture medium: Adding 15g agar powder into LB liquid culture medium with a

constant volume of IL, sterilizing at high temperature and high pressure, cooling to about

°C, adding 1.5mL chloramphenicol (storage concentration 25mg/mL) or 1.5mL

kanamycin (storage concentration 50mg/mL), paving plate, and storing at 4°C after

solidification.

MEM: Dissolving 9.6g MEM dry powder and 2.2g sodium bicarbonate in 800mL

deionized water, fully stirred, adjusting the pH value to 7.4, making a constant volume of

IL, filtering and sterilizing, and storing at 4°C.

Embodiment 1

A duck plague virus UL41 gene markerless deletion strain CHv-BAC-G-AUL41 is

constructed, and the construction method comprises the following steps:

1. Preparing GS1783 electro-transformation competence and electro-transforming pBAC

DPV plasmid into GS1783 competence.

1) PlacingEscherichiacoli containing pBAC-DPV plasmid in LB solid medium containing

chloramphenicol for resuscitation, and culturing overnight at 37°C. Selecting single colony

and inculating it in the LB liquid medium containing chloramphenicol, and culturing

overnight at 37°C.

2) Extracting pBAC-DPV plasmid according to the instructions of QIAGEN Plasmid Midi

Kit (QIAGEN Company).

3) Resuscitating GS1783 cryopreserved bacteria in LB solid medium, and culturing

overnight at 30°C.

4) Selecting GS1783 single colony, inculating in 5mL LB liquid culture medium, and

culturing overnight at 30°C to obtain seed liquid.

) Adding 5mL seed liquid into lOOmL LB liquid culture medium, shaking at 30°C until

the OD600 value is between 0.5 and 0.7.

6) Immediately putting the bacterial solution obtained in the step 5) into an ice-water

mixture and cooling for 20min.

7) Taking the bacterial solution obtained in the step 6), centrifuging at 4°C and 4500xg for

min to remove supernatant.

8) Repeatedly clean that thallus precipitate in step 7) on ice with precool ultrapure water.

9) Adding ultrapure water into the thallus obtained in step 8) to make the volume of the

bacterial solution constant to 500L, and subpackaging 100OL of each tube to a precooled

EP tube to obtain GS1783 electro-transformation competence.

) Adding 20ng pBAC-DPV plasmid into 100OL GS1783 electro-transformation

competence, adding the competence and plasmid into the bottom of 2mm precooled electric

shock cup after mixing evenly, and conducting electric shock under the condition of

kV/cm.

11) Taking 100 L LB liquid culture medium to resuspend the shocked thallus. After

shaking the thallus at 30°C for 1h, operating 4500xg centrifugation the thallus for 2min,

discarding the supernatant, suspending and precipitating in 200 L LB liquid culture

medium, and coating on LB solid culture medium containing chloramphenicol, and

culturing at 30°C for 24h, thus obtaining the GS1783-pBAC-DPV strain.

2. Amplifying the target fragment of I_SceI-Kana-UL41

1) Placing Escherichia coli containing pEPKan-S plasmid in LB solid medium containing

kanamycin for resuscitation, and culturing at 37°C overnight. Selecting single colony,

inoculating it in LB liquid medium containing kanamycin, culturing at 37°C overnight, and extracting pEPKan-S plasmid with plasmid extraction kit. The plasmid profile of pEPKan

S is shown in Figure 1.

2) Using pEPKan-S plasmid as template, designing primers GS1783-BAC-AUL41-F and

GS1783-BAC-AUL41-R for PCR amplification, amplifying the base elements containing

I_Scel restriction site and Kana element, and upstream and downstream target fragment of

homologous arm I_SceI-Kana-UL41 40bp each, using TIANgel Midi Purification Kit

(TIANGEN Company) to purify the amplified fragment, thus obtaining I_SceI-Kana-UL41

fragment. The specific sequence of primers is as follows:

GS1783-BAC-AUL41-F:5'

ATTACGGGACAACAGCGCCGAAACGTAAGACGACAA

TACATAGGGATAACAGGGTAATCGATTT-3'(SEQ ID NO.1).

GS1783-BAC-AUL41-R:5'

CTATTAATAGTTTAAATAAAAACTCTTACAACAGTTA ATCTGTATTGTCGTCTTACGTTTCGGCGCTGTTGTCCCGTAATGCCAGTGTTAC

AACCAAT-3'(SEQ ID NO.2).

PCR amplification system: ddH20 22L, PrimeSTAR Max DNA Polymerase (Takara

Company) 25 L, upstream primer GS1783-BAC-AUL41-F 1 L, downstream primer

GS1783-BAC-AUL41-R 1 L, template pEPKan-S plasmid 1 L.

PCR amplification conditions: Pre-denaturation at 98°C for 2min, denaturation at 98°C for

s, annealing at 55°C for 15s, extension at 72°C for 5s, 30 cycles in total, extension at

72°C for 10min, and preservation at 16°C.

See Fig. 2 for the operation flow diagram of UL41 gene deletion on the bacterial artificial

modification technology, and the specific process includes steps 3 and 4.

3. Preparing GS1783-pBAC-DPV electro-transformation competence to target the target

segment.

1) The GS1783-pBAC-DPV cryopreserved bacteria cultured overnight in LB solid medium

containing chloramphenicol for resuscitation at 30°C.

2) Selecting a single colony of GS1783-pBAC-DPV, inoculating into 5mL LB liquid

culture medium containing chloramphenicol, and culturing overnight at 30°C to obtain seed

liquid.

3) Adding 5mL seed liquid into lOOmL LB liquid medium containing chloramphenicol,

and shaking at 30°C until ODoo reaches 0.5 and 0.7.

4) Culturing the bacterial solution obtained in step 3) at 42°C for 15min, and immediately

putting the bacterial solution into an ice-water mixture for cooling for 20min.

) Taking 5OmL of the bacterial solution obtained in step 4), centrifuging at 4°C for 4500xg

for 10min, and removing supernatant.

6) Repeatedly clean the thallus precipitate in step 5) on ice with precooled ultrapure water.

7) Adding ultrapure water into the thallus obtained in the step 6) to make the bacterial

solution constant to 500 L, and subpackaging 100 L per tube to precooled EP tubes to

obtain GS1783-pBAC-DPV electro-transformation competence.

8) Adding 200ng of I_SceI-Kana-UL41 target fragment to 100 L of electro-transformation

competence, mixing evenly, adding the competence and target fragment to the bottom of a

2mm precooled electric shock cup, and conducting electric shock at 15kV/cm.

9) Taking 100L LB liquid culture medium to resuspend the shocked thallus, and after

shaking the bacteria at 30°C for 1h, centrifuging the thallus at 4500xg for 2min. Discarding

the supernatant, suspending and precipitating the 200L LB liquid culture medium, coating

on LB solid culture medium containing kanamycin and chloramphenicol resistance, and

culturing at 30°C for 48h.

) Identifying the single colony obtained in step 9) by PCR to obtain a positive colony

GS1783-pBAC-DPV-UL41-Kana, identifying the positive colony by using the amplified

I_SceI-Kana-UL41 target fragment upstream primer (SEQ ID NO.1) and identifying UL41

gene downstream primer UL41-R, identifying the positive colony to obtain the positive

clone GS1783-pBAC-DPV-UL41-Kana (Fig. 3), the specific sequence of primers is as

follows:

UL41-R: 5'-TTCCCTCTGGCGTTTAT-3'(SEQ ID NO.3)

PCR amplification system: ddH20 22L, PrimeSTAR Max DNA Polymerase 25 L,

upstream primer GS1783-BAC-AUL41-F 1 L, downstream primer UL41-R 1 L, and the

template is the single colony resuspending in step 9)1L. PCR amplification conditions:

Pre-denaturation at 98°C for 2min, denaturation at 98°C for 10s, annealing at 55°C for 15s,

extension at 72°C for 5s, 30 cycles in total, extension at 72°C for 10min, and preservation

at 16°C.

4. Removing I_Sce-Kana fragment

1) Selecting single colony of GS1783-pBAC-DPV-UL41-Kana and inculating into 2mL

LB liquid culture medium containing chloramphenicol, culturing overnight at 30°C to

obtain seed liquid.

2) Taking 10tL of the seed liquid obtained in step 1) and inculating into 2mL LB liquid

culture medium containing chloramphenicol, and culture at 30°C for 2 hours until the

bacterial solution is slightly cloudy.

3) Adding 1mL LB liquid culture medium containing chloramphenicol and 5M L-arabinose

with a final concentration of 2% into the bacterial solution obtained in step 2), and culturing

at 30°C for 1h.

4) Immediately putting the bacterial solution obtained in step 3) into a 42°C water bath for

culturing for 30 minutes.

) Culturing the bacterial solution obtained in step 4) at 30°C for 2h, adding 1 L of the

bacterial solution into 200L LB of LB liquid culture medium, uniformly mixing, coating

on LB solid culture medium containing chloramphenicol, and culturing at 30°C for 24h

48h.

6) Selecting the single colony obtained in step 5) and performing parallel screening on the

LB solid medium containing chloramphenicol and kanamycin double resistance and the

LB solid medium containing chloramphenicol and kanamycin single resistance, wherein

the colony growing on the LB solid medium with chloramphenicol single resistance does

not grow, and the colony is identified by using UL41 gene identification primer (SEQ ID

NO.3) and UL41-F by PCR method to obtain positive clone GS1783-pBAC-DPV-AUL41

(Fig. 4). The primer sequences are as follows:

UL41-F: 5'-CAACTCTGGCTATTTAACC-3'(SEQ ID NO.4)

UL41-R: 5'-TTCCCTCTGGCGTTTAT-3'(SEQ ID NO.3)

PCR amplification system: ddH20 22L, PrimeSTAR Max DNA Polymerase 25 L,

upstream primer UL41-F 1 L, downstream primer UL41-R 1 L, and the template is single

colony resuspending in step 6) 1 L.

72°C for 10s, and preservation at 16°C.

5. Rescuing the virus

1) Putting GS1783-pBAC-DPV-AUL41 cryopreserved bacteria into LB solid medium

containing chloramphenicol for resuscitation and culturing overnight at 30°C.

2) Extracting pBAC-DPV-AUL41 plasmid according to the operation instructions of

QIAGEN Plasmid Midi Kit.

3) Preparing duck embryo fibroblasts (DEFs) and culturimg into a 12-wellplates, culturing

at 37°C in 5% CO2 for 24 hours, and then transfecting pBAC-DPV-AUL41 plasmid

according to the operating instructions of Lipofectamine 3000 (Invitrogen Company). After

72 hours, observing fluorescentplaque, collecting viruses, freezing and thawing for three

times, and then culturing in a 6-well plate full of DEFs. After 72 hours, observing

fluorescent plaque to obtain UL41 gene markerless deletion strain CHv-BAC-G-AUL41

(Fig. 5).

Embodiment 2

Genomic DNA characteristics of CHv-BAC-G-AUL41 virus

1) Preparing duck embryo fibroblasts (DEF) and culturing in a 6-well plate, culturing at

37°C in 5% C02 for 24 hours, and then infecting with DPV CHv-BAC-G and UL41 gene

seamless deletion strain CHv-BAC-G-AUL41 respectively. After incubation at 37°C in 5%

C02 for 2 hours, swapping to maintenance solution (2% new calf serum) to continue

culturing at 37°C in 5% C02 for 48 hours. Extracting virus genomic DNA in cells according

to the operation instructions of TaKaRa MiniBEST Viral RNA/DNA Extraction Kit

(Takara Company).

2) Using the above genomic DNA as template, PCR identification is carried out with DPV

gC upstream and downstream primers gC-F and gC-R, BAC element sopB, repE upstream

and downstream primers sopB-F, sopB-R, repE-F, repE-R, UL41 identification primers

(SEQ ID NO.3, SEQ ID NO.4) Operating PCR identification (Fig. 6, wherein Fig. 6a is a

PCR diagram of CHv-BAC-G-AUL41 virus genome. Fig. 6b is a PCR image of CHv-BAC

G virus genome). The specific sequences of primers are as follows:

gC-F:5'-CGGAATTCCAAAACGCCGCACAGATGAC-3'(SEQ ID NO.5)

gC-R:5'-CCCTCGAGGTATTCAAATAATATTGTCTGC-3'(SEQ ID NO.6)

sopB-F:5'-ATTCGTTAATTGCGCGCGTAGG-3'(SEQ ID NO.7)

sopB-R:5'-GAATATTCAGGCCAGTTATGCT-3'(SEQ ID NO.8)

repE-F:5'-CATGGCGGAAACAGCGGTTATC-3'(SEQ ID NO.9)

repE-R:5'-ATGTATGAGAGGCGCATTGGAG-3'(SEQ ID NO.10)

PCR amplification system: ddH20 22L, PrimeSTAR Max DNA Polymerase 25 L,

upstream primer UL41-F 1 L, downstream primer UL41-R 1 L, and the template is virus

genomic DNA 1 L extracted in step 1).

72°C for 10s, and preservation at 16°C.

Embodiment 3

Measurement of growth curve of markerless deletion strain CHv-BAC-G-AUL41

1. Measurement of one-step growth curve

Parent virus DPV CHv-BAC-G and UL41 gene markerless deletion strain CHv-BAC-G

AUL41 are inoculated into DEF cells with 2MOI respectively, and supernatant and cells

are collected at 6h, 12h, 18h and 24h after inculation, and repeated three times at each time

point. After complete collection, freeze-thaw is repeated twice, and the virus titers are

detected in 96-well plate. The results showed that the deletion of UL41 gene partially

affected the replication of DPV CHv virus.

2. Measurement of multi-step growth curve

Parent virus DPV CHv-BAC-G and UL41 gene markerless deletion strain CHv-BAC-G

AUL41 are inculated into DEF cells with 0.01MOI, respectively. Supernatant and cells are

collected at 12h, 24h, 48h and 72h after inculation, and repeated three times at each time

point. After complete collection, freeze-thaw is repeated twice, and the virus titers are detected in 96-well plate. The results showed that the deletion of UL41 gene significantly affected the proliferation of DPV CHv virus.

Embodiment 4

Experiment on plaque formation of markerless deletion strain CHv-BAC-G-AUL41

Parent virus DPV CHv-BAC-G and UL41 gene markerless deletion strain CHv-BAC-G

AUL41 are inoculated into 6-well plate filled with DEF cells with0.01MOI, respectively.

After adsorption at 37°C and 5% CO2 for 2h, supernatant is removed, 2mL of 1%

methylcellulose is added, and after incubation at 37°C and 5% CO2 for 48h, 1%

methylcellulose is removed and washed with PBS for three times, fixing with 4%

paraformaldehyde at 4°C overnight and washing with PBS for 3 times, culturing with H202

and methanol in a volume ratio of 1:50 at room temperature for 30min, washing with

distilled water for 3 times, blocking with5% BSA at room temperature for 30min, adding

rabbit anti-DPV, culturing at 4°C overnight, washing with PBS for 3 times, adding

biotinylated goat anti-rabbit antibody IgG, culturing at 37°C for 30min, washing with PBS

for 3 times, dropping SABC substrate, culturing at 37°C for 30min, washing with PBS for

3 times, the DAB chromogenic solution is developed in dark and sealed. The results

showed that the deletion of UL41 gene affected the proliferation and transmission of DPV

CHv virus in cells.

According to the invention, the genetic stability experiment of the duck plague virus UL41

gene markerless deletion strain CHv-BAC-G-AUL41 is also carried out.

Genetic stability: The duck plague virus UL41 gene markerless deletion strain CHv-BAC

G-AUL41 was passed on DEF cells for 20 generations, and all the plaques showed green fluorescence, which indicated that the duck plague virus UL41 gene markerless deletion strain CHv-BAC-G-AUL41 was inherited stably.

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS

1. A construction method of duck plague virus UL41 gene markerless deletion strain CHv

BAC-G-AUL41, characterized by comprising the following steps:

GS1783-pBAC-DPV strain, and then preparing GS1783-pBAC-DPV competence.

2) With pEPKan-S as template and GS1783-BAC-AUL41-F and GS1783-BAC-AUL41-R

target fragment ISceI-Kana-AUL41 with 40bp homologous arms upstream and

Kana-UL41 fragment.

3) Transforming ISceI-Kana-UL41 fragment into GS1783-pBAC-DPV competence, and

obtaining a positive clone GS1783-pBAC-DPV-UL41-Kana after screening and PCR

identification.

4) Removing the ISce-Kana fragment from the positive clone GS1783-pBAC-DPV

positive clone GS1783-pBAC-DPV-AUL41.

) Extracting pBAC-DPV-AUL41 plasmid from the positive clone GS1783-pBAC-DPV

AUL41, and the DEF cells are transfected with pBAC-DPV-AUL41 plasmid. After cloning

and screening, the markerless deletion strain CHv-BAC-G-AUL41 with deletion of UL41

gene of duck plague virus is obtained.

2. A construction method of duck plague virus UL41 gene markerless deletion strain CHv

BAC-G-AUL41, as stated in Claim 1, with the following characteristics: the PCR

amplification system in step 2) is: ddH20 22L, PrimeSTAR Max DNA Polymerase 25[L,

upstream primer 1 L, downstream primer 1 L and template 1 L.

3. A construction method of duck plague virus UL41 gene markerless deletion strain CHv

BAC-G-AUL41, as stated in Claim 1, with the following characteristics: the PCR

amplification conditions in step 2) are: pre-denaturation at 98°C for 2min, denaturation at

98°C for 10s, annealing at 55°C for 15s, extension at 72°C for 5s, 30 cycles in total, and

finally extension at 72°C for 10min.

4. A construction method of duck plague virus UL41 gene markerless deletion strain CHv

BAC-G-AUL41, as stated in any one of Claim 1-3, with the following characteristics: the

primer sequences in step 2) are shown in SEQ ID NO.1 and SEQ ID NO.2.

5. The duck plague virus UL41 gene markerless deletion strain CHv-BAC-G-AUL41

prepared by the method according to any one of Claim 1-4.

-1/4-

Fig. 1

-2/4-

Fig. 3 Fig. 2

-3/4-

Fig. 5 Fig. 4

-4/4-

Fig. 6