NL2025748B1

NL2025748B1 - Duck Plague Virus gE-gI Double Gene Markerless Deletion Strain DPV CHVAgE+ AgI and Construction Method Thereof

Info

Publication number: NL2025748B1
Application number: NL2025748A
Authority: NL
Inventors: Cheng Anchun; Liu Tian; Wang Mingshu
Original assignee: Univ Sichuan Agricultural
Priority date: 2020-06-03
Filing date: 2020-06-03
Publication date: 2021-04-21

Abstract

The present invention provides a duck plague virus gE-gI double gene markerless deletion strain and a construction method thereof. By using the Escherichia coli strain GSl783 and the pEPkan-S plasmid, in the present invention, the gE gene and gI gene of duck plague virus were deleted by two homologous recombinations on the bacterial artificial chromosome recombinant duck plague virus rescue system platform, and then the MiniF element was deleted by intracellular spontaneous homologous recombination. The duck plague virus double gene deletion strain without exogenous base and MiniF element residues was first constructed by the present invention. The technical solution of the present invention solves the problem of residual bases at the deletion site when a duck plague virus gene is deleted and the MiniF element is deleted as well. The present invention provides sufficient technical support for accurately exploring the gene function of duck plague virus and the construction of live attenuated vaccine.

Description

-1- Duck Plague Virus gE-gl Double Gene Markerless Deletion Strain DPV CHyv- AgE+Agl and Construction Method Thereof Technical Field The present invention belongs to the technical field of genetic engineering, and more specifically, relates to a markerless deletion strain DPV CHv-AgE+AgI of duck plague virus gE-gl double genes and a construction method thereof.

Background Bacterial artificial chromosome (BAC) is a newly developed DNA vector system with the advantages of large capacity, stable hereditary capacity and easy to operate, which has been widely used in gene library construction and gene function analysis.

The deletion of a virus gene and the insertion of an exogenous gene in a prokaryotic system are realized by inserting the DNA molecule of a complete virus genome into a BAC vector, then using the vector to encode a minimal fertility factor replicon (Mini- F), and combining with mature gene mapping modification techniques in Escherichia coli.

At present, the commonly used Escherichia coli gene mapping modification techniques mainly include a Red/ET-mediated homologous recombination technique, a RecA protein-mediated homologous recombination technique, a Cre/loxP-mediated homologous recombination technique, and a Tn transposon-mediated random insertion and mutation technique.

A mature bacterial artificial chromosome duck plague virus rescue system platform has been developed by molecular cloning techniques.

Meanwhile, the Escherichia coli gene mapping modification Red/ET-mediated homologous recombination technique can be used to delete a duck plague virus gene and insert an exogenous gene on the bacterial artificial chromosome duck plague virus rescue system platform.

These achievements have greatly promoted the process of duck plague virus gene function research.

The Red/ET-mediated homologous recombination technique is based on homologous recombination targeting techniques of A-phage Red operon (Red o/Red P/Red y) and Rac phage RecE/RecT homologous recombination enzyme, which is simple, rapid and efficient, and is widely used in the work of gene deletion and

-2- mutation.

However, using this technique to carry out gene deletion or gene mutation will retain about 80bp of an exogenous base sequence (FRT site) at the deletion or mutation site, and the residue at this site will affect the accurate analysis of gene function.

The MiniF element, as a minimal fertility factor replicon to maintain the replication of BAC vector, is mainly composed of repE and repF genes for regulating the starting point of BAC replication, sopA and sopB genes for regulating the distribution of replicators, and sopC gene encoding a centromeric region.

To complete the screening of bacterial resistance and BAC markers, screening resistance genes and fluorescent marker genes are added to the MiniF element.

When the MiniF element is inserted into a virus genome, the length of the genome is increased, which has an uncertain effect on virus replication.

Moreover, the MiniF element, as a bacterial sequence, remains in the virus genome, which is not conducive to the development and licensing of live attenuated vaccines.

Therefore, solving the problem of base residues and removing MiniF elements to obtain markerless gene deletion strains have become the focus of developing methods for deleting duck plague virus genes.

Duck plague (DP) is an acute contagious and highly fatal infectious disease of duck, goose and other waterfowl caused by duck plague virus (DPV) in the o- herpesvirus subfamily.

This disease was first reported in Netherlands and then spread in South China, Central China, East China, etc., which caused serious economic losses to the duck industry in China.

Therefore, in-depth understanding the gene function of duck plague virus and strengthening the research of duck plague are especially significant to ensure the healthy and sustainable development of duck industry in China.

The genomic DNA of the duck plague virus DPV-CHv strain has a length of 162175 bp and contains 78 open reading frames encoding structural and non-structural proteins involved in the life cycle of duck plague virus.

The structural proteins mainly include capsid proteins, cortical proteins and envelope proteins.

The envelope proteins are glycosylated proteins, including gB, gC, gD, gE, gG, gH, gl, gJ, gK, gL, gM and aN.

Glycoproteins can mediate viruses to adsorb and enter sensitive cells, promote virus transmission between cells, and carry antigenic determinants, which can induce the immune system of animals to recognize viruses and cause tissue pathological damage.

Therefore, exploring the roles of envelope glycoproteins in the life cycle of

-3- duck plague virus is crucial for further researching the gene function of duck plague virus and the prevention and control work of duck plague virus.

In prior techniques, by virus molecular cloning techniques with BAC as the platform, a duck plague virus genome is recombined into a virus transfer vector containing BAC, and the bacterial artificial chromosome recombinant duck plague virus rescue system platform DPV CHv-BAC-G is constructed.

Meanwhile, combined with Red/ET modification techniques, the gene deletion and exogenous gene insertion in duck plague virus are completed by mature gene manipulation methods in a prokaryotic system.

However, after the gene deletion of duck plague virus on the DPV CHv-BAC-G by Red/ET modification techniques, two FRT sites and MiniF elements will be retained at the gene deletion place.

The residues of FRT exogenous sites and MiniF elements adversely affect the exploration of gene function and the development and licensing of live attenuated vaccines.

Summary For the problems existing in the prior art, the present invention provides a duck plague virus gE-gl double gene markerless deletion strain DPV CHv-AgE+Agl and a construction method thereof.

The construction method can effectively solve the problem of residual bases and MiniF elements at the deletion site when the duck plague virus gene is deleted.

To achieve the above objective, the technical solution used by the present invention to solve the technical problems is as follows.

A duck plague virus gE-gl double gene markerless deletion strain, belonging to the genus Mardivirus, 1s designated as duck plague virus gE-gl double gene markerless deletion strain DPV CHv-AgE+Agl, and was preserved in the China Center for Type Culture Collection (address: Wuhan University, Wuhan City, Hubei Province) on July 4, 2018, with a preservation number of CCTCC NO: V201841. A method for constructing the above-mentioned duck plague virus gE-gI double gene markerless deletion strain DPV CHv-AgE+Agl (i.e. duck plague virus gE-gl double deletion virus strain DPV CHv-AgE+Agl) includes the following steps:

-4-

(1) transforming a pBAC-DPV plasmid into competent cells of Escherichia coli strain GS1783 to obtain a GS1783-pBAC-DPV strain, and then preparing competent cells of the GS1783-pBAC-DPV strain;

(2) amplifying a I Scel-Kana-gE target fragment containing a base fragment including an I_Scel restriction site and a Kana element and both upstream and downstream 40-bp homologous sequences of gE gene by polymerase chain reaction (PCR) with pEPkan-S as a template and GS1783-BAC-AgE-F and GS1783-BAC-AgE- R as primers, and performing a gel extraction to obtain the I Scel-Kana-gE fragment;

(3) transforming the I Scel-Kana-gE fragment into the competent cells of the

GS1783-pBAC-DPV strain, and screening to obtain a positive clone GS1783-pBAC- DPV-gE-Kana,

(4) removing the I Scel-Kana fragment in the positive clone GS1783-pBAC- DPV-gE-Kana to obtain a GS1783-pBAC-DPV-AgE strain, and preparing competent cells of the GS1783-pBAC-DPV-AgE strain;

(5) amplifying a I Scel-Kana-gl target fragment containing a base fragment including an I_Scel restriction site and a Kana element and both upstream and downstream 40-bp homologous sequences of gl gene by the PCR with pEPkan-S as a template and GS1783-BAC-AGI-F and GS1783-BAC-AGI-R as primers, and performing a gel extraction to obtain the I Scel-Kana-gl fragment;

(6) transforming the I Scel-Kana-gl fragment into the competent cells of the GS1783-pBAC-DPV-AgE, followed by an antibiotic screening and a PCR identification to obtain a positive clone GS1783-pBAC-DPV-AgE-gl-Kana;

(7) removing the I Scel-Kana fragment in the positive clone GS1783- pBAC- DPV-AgE-gl-Kana to obtain a GS1783-pBAC-DPV-AgE+Agl strain, and preparing competent cells of the GS1783-pBAC-DPV-AgE+AglI strain;

(8) amplifying a I Scel-Kana-MiniF fragment containing: a base fragment including an I_Scel restriction site and a Kana element, a downstream 240-bp homologous sequence of MiniF element ori2 gene, and a downstream 290-bp homologous sequence of the of MiniF element ori2 gene by the PCR with pEPkan-S as a template and GS1783-MiniF-F and GS1783-MiniF-R as primers, and performing a gel extraction to obtain the I _Scel-Kana-MiniF fragment;

-5- (9) amplifying a UL23-MiniF fragment containing: a UL23 gene, a downstream 25-bp homologous sequence of I Scel-Kana-MiniF, and a downstream 180-bp homologous sequence of the of MiniF element ori2 gene by the PCR with CHv genome as a template and CHv-UL23-F and CHv-UL23-R as primers, and performing a gel extraction to obtain the UL23-MiniF fragment; (10) performing a fusion PCR with the I Scel-Kana-MiniF fragment and the UL23-MiniF fragment as templates to obtain a fused fragment, and then performing a PCR amplification with GS1783-MiniF-F and CHv-UL23-R as primers to obtain an I Scel-Kana-MiniF-UL23 target fragment; (11) transforming the I Scel-Kana-MiniF-UL23 target fragment into the competent cells of the GS1783-pBAC-DPV-AgE+Agl strain, followed by an antibiotic screening and a PCR identification to obtain a positive clone GS1783-pBAC-DPV- AgE+Agl-UL23-Kana; (12) removing the I Scel-Kana fragment in the positive clone GS1783-pBAC- DPV-AgE+Agl-UL23-Kana to obtain a positive clone GS1783-pBAC-DPV-AgE+Agl- UL23; and (13) extracting pBAC-DPV-AgE+Agl-UL23 plasmids from the positive clone GS1783-pBAC-DPV-AgE+AgI-UL23, and transfecting the pPBAC-DPV-AgE+Agl- UL23 plasmids into DEF cells, followed by a clone screening to obtain the gE-gl double gene markerless deletion strain DPV CHv-AgE+Agl.

Further, PCR amplification systems in step (2), step (5), step (8), and step (9) include: 22 pL of ddH20, 25 pL of PrimeSTAR® Max DNA Polymerase, 1 uL of upstream primer, 1 uL of downstream primer, and 1 pL of the template; PCR amplification conditions include: performing a pre-denaturation at 98°C for 2 min, performing 30 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 15 s, and extension at 72°C for 5 s, and finally performing an extension at 72°C for 10 min.

Further, sequences of the primers in step (2) include: GS1783-BAC-AgE-F: 5’- ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggataacagggtaa tcgattt-3’; and

-6- GS1783-BAC-AgE-R: 5°-

TAACTATTTCACTAGTGAGTCATTAGTTCAACATCCATGACGTACCAATTGT TGAGGTTCCGTAGTCTGGCCGGCAGTATgccagtgttacaaccaat-3’.

Further, sequences of the primers in step (5) include: GS1783-BAC-Agl-F: 5’- GTGCGCCATATAGACGATATATTGAGTTTCAAAAATAGAAtagggataacagggtaa tegattt-37; and GS1783-BAC-Agl-R: 5’-

TCATAACAAAAACATTTACTTTTAGTCATACTGATGTGAATTCTATTTTTGA AACTCAATATATCGTCTATATGGCGCACgccagtgttacaaccaat-3’.

Further, sequences of the primers in step (8) include: GS1783-MiniF-F: $°-

TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCAT GATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3’; and GS1783-MiniF-R: 5’- ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTATtag ggataacagggtaatcgat-3’.

Further, sequences of the primers in step (9) include: CHv-UL23-F: S°-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg- 3’; and CHv-UL23-R: 5’-

CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGG CATATTCAACGGACATATTAAAAATTGA-3’.

Further, sequences of the primers in step (10) include: GS1783-MiniF-F: $°-

TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCAT GATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3’; and

-7- CHv-UL23-R: 5°-

Further, a PCR fusion system in step (10) includes: 8 uL of ddH20, 10 pL of PrimeSTAR® Max DNA Polymerase, and 1 pL of the I Scel-Kana-MiniF fragment and 1 pL of the UL23-MiniF fragment as templates; PCR fusion conditions include: performing a pre-denaturation at 95°C for 5 min, and then performing 5 cycles of denaturation at 95°C for 15 s, annealing at 55°C for 15 s, and extension at 72°C for 1 min.

Further, a PCR amplification system in step (10) includes: 20 pL of fusion template, 0.5 pL of the upstream primer GS1783-MiniF-F, and 0.5 uL of the downstream primer CHv-UL23-R; and PCR amplification conditions include: performing a pre-denaturation at 98°C for 2 min, performing 30 cycles of denaturation at 98°C for 10 s, annealing at 55°C for 15 s, and extension at 72°C for 5 s, and finally performing an extension at 72°C for 10 min.

The duck plague virus gE-gl double gene markerless deletion strain DPV CHv- AgE+Agl and the construction method thereof have the following advantages.

To obtain a duck plague virus gene deletion strain without exogenous base and MiniF element residues, on the basis of the bacterial artificial chromosome recombinant duck plague virus rescue system platform, the present invention uses a Red-based modification technique, that is, an Escherichia coli strain GS1783 containing Red operon and I_Scel enzyme gene sequence and a pEPkan-S plasmid containing a kanamycin resistance gene and a I_Scel restriction site are used. Firstly, the gE gene and gl gene of duck plague virus were deleted by two homologous recombinations on the bacterial artificial chromosome recombinant duck plague virus rescue system platform, and then the MiniF element was deleted by intracellular spontaneous homologous recombination. The duck plague virus double gene deletion strain without exogenous base and MiniF element residues was first constructed by the present invention. The technical solution of the present invention solves the problem of residual bases at the deletion site when a duck plague virus gene is deleted and the MiniF element is deleted as well. The present invention provides sufficient technical

-8- support for accurately exploring the gene function of duck plague virus and the construction of live attenuated vaccine. Brief Description of the Drawings FIG. 1 shows a plasmid map of pEPkan-S.

FIG. 2 shows a flow chart of performing a gene deletion by a Red-based modification technique on a bacterial artificial chromosome recombinant duck plague virus rescue system platform (taking the deletion of gE gene as an example).

Fig. 3 shows an operation flowchart of deleting a MiniF element by a Red-based modification technique and an intracellular spontaneous homologous recombination technique.

FIG. 4 is a diagram of a DPV CHv-AgE+AgI markerless deletion virus strain after Virus rescue.

FIG. 5 shows PCR detection results of a liver DNA extract of a duck 48 hours after performing an inoculation of DPV CHv-AgE+Agl to the duck.

FIG. 6 shows deletion virus contents in blood, spleen and liver of a duck obtained at different time points after performing an inoculation of DPV CHv-AgE+AglI to the duck.

Detailed Description of the Embodiments A duck plague virus gE-gI double gene markerless deletion strain is designated as duck plague virus gE-gl double gene markerless deletion strain DPV CHv-AgE+Agl, and is constructed with the following materials and reagents.

1. Experimental materials.

(1) cells, bacterial strains, virus strains, and plasmids Primary duck embryo fibroblasts were prepared from a non-immune fertilized duck embryo at an age of 10-11 days according to conventional methods. Escherichia coli strain GS1783 was preserved in a laboratory of Sichuan Agricultural University. pBAC-DPV plasmid was constructed and preserved in the laboratory of Sichuan

-9- Agricultural University. pEPkan-S plasmid was preserved in the laboratory of Sichuan Agricultural University. (2). Molecular biological reagents. A Mini Plasmid Kit was purchased from the TTANGEN company; a QIAGEN Plasmid Midi Kit was purchased from the QIAGEN company. A general agarose gel DNA recovery kit was purchased from the TITANGEN company. PrimeSTAR ®Max DNA Polymerase was purchased from the Takara company. A TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0 was purchased from the TaKaRa company. Lipofectamine 3000 was purchased from the Invitrogen company. A ready-to-use SABC immunohistochemical staining kit (rabbit IgG) was purchased from the Boster company. A DAB chromogenic kit (yellow) was purchased from the Boster company.

3. Solutions used in experiments and preparation thereof LB liquid medium: 10 g of tryptone, 5 g of yeast extract, and 10 g of sodium chloride were dissolved in 800 mL of deionized water, stirred fully, added with deionized water to reach a constant volume of 1 L, and sterilized at high temperature and high pressure.

LB solid medium: 15 g of agar powder was added to the LB liquid medium with a constant volume of 1 L, sterilized at high temperature and high pressure, cooled to about 60°C, then added with 1.5 mL of chloramphenicol (storage concentration of 25 mg/ml) or 1.5ml of kanamycin (storage concentration of 50 mg/mL), plated, and stored at 4°C after solidification.

MEM: 9.6 g of minimum Eagle’s medium (MEM) dry powder and 2.2 g of sodium bicarbonate were dissolved in 800 mL of deionized water, stirred fully, adjusted pH to 7.4, added with deionized water to reach a constant volume of 1 L, filtered to remove bacteria, and stored at 4°C.

Embodiment 1 preparation of duck plague virus gE-gI double gene markerless deletion strain DPV CHv-AgE+Agl A method for constructing the duck plague virus gE-gl double gene markerless deletion strain DPV CHv-AgE+ Agl included the following steps:

-10-

1. Preparation of GS1783 electrotransformation competent cells and electrotransformation of pBAC-DPV plasmid (1) An Escherichia coli strain with the pBAC-DPV plasmid was resuscitated in the LB solid medium containing chloramphenicol and cultured overnight at 37°C, and then single colonies were inoculated in the LB liquid medium containing chloramphenicol and cultured overnight at 37°C.

(2) The pBAC-DPV plasmid was extracted according to the operation instruction of the QIAGEN Plasmid Midi Kit.

(3) A cryopreserved GS1783 strain was resuscitated in the LB solid medium and cultured overnight at 30°C.

(4) Single colonies of the GS1783 strain were selected and inoculated in 5 mL of the LB liquid medium and cultured overnight at 30°C to obtain a seed solution.

(5) 5 mL of the seed solution was added to 100 mL of the LB liquid medium and shaken at 30°C until the OD600 value was between 0.5 and 0.7.

(6) The bacterial solution obtained in step (5) was immediately put into an ice- water mixture and cooled for 20 min.

(7) The bacterial solution obtained in step (6) was centrifuged at 4°C and 4500xg for 10 min to remove the supernatant.

(8) The bacterial precipitation obtained in step (7) was repeatedly washed with precooled ultra-pure water on ice.

(9) The bacteria obtained in step (8) was added with ultra-pure water to reach a constant volume of 500 pL of the bacterial solution. Then, the bacterial solution was sub-packed into precooled Eppendorf (EP) tubes with 100 pL in each tube to obtain the GS1783 electrotransformation competent cells.

(10) 20 ng of the plasmid pBAC-DPV was added to 100 pL of the GS1783 electrotransformation competent cells and mixed uniformly, and then was added to the bottom of a precooled 2 mm electroporation cuvette, and was electroporated at 15kV/cm.

(11) The electroporated bacteria was suspended with 100 uL of LB liquid medium, shaken at 30°C for 1 h, and centrifuged at 4500 x g for 2 min. Then, the supernatant

-11- was discarded. 200 uL of LB liquid medium was used for suspending the precipitation, and then coated on LB solid medium containing chloramphenicol and cultured at 30°C for 24 h. A GS1783-pBAC-DPV strain was obtained.

2. Amplification of I_Scel-Kana-gE target fragment (1) An Escherichia coli strain with pEPkan-S plasmid was resuscitated in LB solid medium containing kanamycin and cultured overnight at 37°C. Then, single colonies were inoculated in LB liquid medium containing kanamycin and cultured overnight at 37°C. The pEPkan-S plasmid was extracted by the Mini Plasmid Kit (see FIG. 1 for the plasmid map of pEPkan-S).

(2) The I Scel-Kana-gE target fragment was amplified with the pEPkan-S plasmid as a template and GS1783-BAC-AgE-F and GS1783-BAC-AgE-R as primers, and the amplified fragments were recovered with the general agarose gel DNA recovery kit.

GS1783-BAC-AgE-F: 5’- ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggataacagggtaa tegattt-3’(SEQ ID NO: 1) GS1783-BAC-AgE-R: 5’-

TAACTATTTCACTAGTGAGTCATTAGTTCAACATCCATGACGTACCAATTGT TGAGGTTCCGTAGTCTGGCCGGCAGTATgccagtgttacaaccaat-3’(SEQ ID NO: 2) PCR amplification system included: 22 pL of ddH2O0, 25 pL of PrimeSTAR® Max DNA Polymerase, 1 pL of the upstream primer GS1783-BAC-AgE-F, 1 uL of the downstream primer GS1783-BAC-AgE-R, and 1 uL of the template pEPkan-S plasmid.

PCR amplification conditions included: pre-denaturation at 98°C for 2 min, 30 cycles denaturation at 98°C for 10s, annealing at 55°C for 15s, and extension at 72°C for 5s, and final extension at 72°C for 10 min and storage at 16°C.

FIG. 2 shows a flow chart of performing a gene deletion by a Red-based modification technique on a bacterial artificial chromosome recombinant duck plague virus rescue system platform (taking the deletion of gE gene as an example). The specific process includes the following steps 3 and 4.

-12-

3. Preparation of GS1783-pBAC-DPV electrotransformation competent cells for target fragment (1) The frozen GS1783-pBAC-DPV strain was resuscitated in LB solid medium containing chloramphenicol and incubated at 30°C overnight.

(2) A single colony of the GS1783-pBAC-DPV strain was selected and inoculated in 5 mL of LB liquid medium containing chloramphenicol, and incubated at 30°C overnight to obtain seed liquid.

(3) 5 mL of the seed liquid was added to 100 mL of LB liquid medium containing chloramphenicol, and placed at 30°C and shaken to an ODsoo value of 0.5-0.7.

(4) The bactenal solution obtained in step (3) was incubated at 42°C for 15 min and then immediately put in an ice-water mixture to cool for 20 min.

(5) 50 mL of the bacterial solution obtained in step (4) was centrifuged at 4500 x g for 10 min at 4°C, and the supernatant was removed.

(6) The bacterial precipitation obtained in step (5) was repeatedly washed with precooled ultra-pure water on ice.

(7) The bacteria obtained in step 6) were added with ultra-pure water to reach a constant volume of 500 uL of the bacterial solution. Then, the bacterial solution was sub-packed into precooled EP tubes with 100 pL in each tube to obtain the GS1783- pBAC-DPV electrotransformation competent cells.

(8) 200 ng of the I Scel-Kana-gE target fragments were added to 100 pL of the electrotransformation competent cells and mixed uniformly, and then was added to the bottom of a precooled 2 mm electroporation cuvette, and was electroporated at 15kV/cm.

(9) The electroporated bacteria was suspended with 100 uL of LB liquid medium, shaken at 30°C for 1 h, and centrifuged at 4500 x g for 2 min. Then, the supernatant was discarded. 200 pL. of LB liquid medium was used for suspending the precipitation, and then coated on LB solid medium containing kanamycin and chloramphenicol and cultured at 30°C for 48 h.

(10) Single colonies obtained in step (9) were subjected to a PCR identification to obtain a positive colony GS178-pBAC-DPV-gE-Kana, including: using the

-13- resuspension solution of each of the single colonies obtained in step (9) as templates, GS1783-BAC-AgE-F for amplifying I Scel-Kana-gE target fragment as an upstream primer, and the gE-R for identifying gE gene as a downstream primer to identify positive colonies. The positive clone GS1783-pBAC-DPV-gE-Kana was obtained.

GS1783-BAC-AgE-F: 5’- ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggataacagggtaa tcgattt-3’(SEQ ID NO: 1) gE-R: 5’-AGCGAGTACTTCTCTGCGTC-3’(SEQ ID NO: 3) PCR amplification system included: 22 pL of ddH20O, 25 uL of PrimeSTAR® Max DNA Polymerase, 1 pL of the upstream primer GS1783-BAC-AgE-F, 1 uL of the downstream primer gE-R, and 1 uL of the resuspension solution of each of the single colonies obtained in step (9) as the template.

4. Removal of I Scel-Kana fragment (1) A single colony of the positive clone GS1783-pBAC-DPV-gE-Kana was selected and inoculated in 2mL of LB liquid medium containing chloramphenicol, and cultured at 30°C overnight to obtain seed liquid; (2) 10 pL of the seed solution obtained in step (1) was inoculated in 2 mL of LB liquid medium containing chloramphenicol, and cultured at 30°C for 2 hours until the bacterial solution had cloudy appearance.

(3) 1 mL of LB liquid medium containing chloramphenicol and 5M of L-arabinose with a final concentration of 2% by weight were added to the bacterial solution obtained in step (2), and incubated at 30°C for 1 h.

(4) The bacterial solution obtained in step (3) was immediately put into a 42°C water bath and incubated for 30 min.

(5) The bacterial solution obtained in step (4) was cultured at 30°C for 2 h. Subsequently, 1uL of the bacterial solution was added into 200 pL of LB liquid

-14- medium and mixed uniformly, and then coated on LB solid medium containing chloramphenicol and incubated at 30°C for 24 h-48 h; (6) Single colonies obtained in step (5) were subjected to a parallel screening on both the LB solid medium containing chloramphenicol and kanamycin and the LB solid medium containing chloramphenicol. The colonies growing on the LB solid medium containing chloramphenicol but not the LB solid medium containing chloramphenicol and kanamycin were identified by PCR with the gE gene identification primers. A positive clone GS1783-pBAC-DPV-AgE was obtained.

gE-F: S’-TCTCAAGACGCTCTGGAATC-3’(SEQ ID NO: 4) gE-R: 5’-AGCGAGTACTTCTCTGCGTC-3’(SEQ ID NO: 3) PCR amplification system included: 22 pL of ddH:O, 25 pL of PrimeSTAR® Max DNA Polymerase, 1 pL of the upstream primer gE-F, 1 uL of the downstream primer gE-R, and 1 uL of the resuspension solution of each of the single colonies obtained in step (6) as the template.

PCR amplification conditions included: pre-denaturation at 98°C for 2 min, 30 cycles denaturation at 98°C for 10s, annealing at S5°C for 15s, and extension at 72°C for Ss, and final extension at 72°C for 10 min and storage at 16°C.

5. Amplification of I Scel-Kana-gl target fragment (1) An Escherichia coli strain with pEPkan-S plasmid was resuscitated in LB solid medium containing kanamycin and cultured overnight at 37°C. Then, single colonies were inoculated in LB liquid medium containing kanamycin and cultured overnight at 37°C. The pEPkan-S plasmid was extracted by the Mini Plasmid Kit.

(2) The I_Scel-Kana-gl target fragment was amplified with the pEPkan-S plasmid as a template and GS1783-BAC-AgI-F and GS1783-BAC-Agl-R as primers, and the amplified fragments were recovered with the general agarose gel DNA recovery kit.

GS1783-BAC-Agl-F: 5°- GTGCGCCATATAGACGATATATTGAGTTTCAAAAATAGAAtagggataacagggtaa tegattt-3’ (SEQ ID NO: 5)

-15- GS1783-BAC-Agl-R: 5’-

TCATAACAAAAACATTTACTTTTAGTCATACTGATGTGAATTCTATTTTTGA AACTCAATATATCGTCTATATGGCGCACgccagtgttacaaccaat-3’ (SEQ ID NO: 6) PCR amplification system included: 22 pL of ddH2O0, 25 uL of PrimeSTAR® Max DNA Polymerase, 1 uL of the upstream primer GS1783-BAC-AgI-F, 1 uL of the downstream primer GS1783-BAC-AgI-R, and 1 pL of the template pEPkan-S plasmid.

6. Preparation of GS1783-pBAC-DPV-AgE electrotransformation competent cells for target fragment (1) The frozen GS1783-pBAC-DPV-AgE strain was resuscitated in LB solid medium containing chloramphenicol and incubated at 30°C overnight.

(2) A single colony of the GS1783-pBAC-DPV-AgE strain was selected and inoculated in 5 mL of LB liquid medium containing chloramphenicol, and incubated at 30°C overnight to obtain seed liquid.

(3) 5 mL of the seed liquid was added to 100 mL of LB liquid medium containing chloramphenicol, and placed at 30°C and shaken to an OD value of 0.5-0.7.

(4) The bacterial solution obtained in step (3) was incubated at 42°C for 15 min and then immediately put in an ice-water mixture to cool for 20 min.

(7) The bacteria obtained in step 6) were added with ultra-pure water to reach a constant volume of 500 pL of the bacterial solution. Then, the bacterial solution was sub-packed into precooled EP tubes with 100 pL in each tube to obtain the GS1783- pBAC-DPV-AgE electrotransformation competent cells.

(8) 200 ng of the I Scel-Kana-gl target fragments were added to 100 pL of the electrotransformation competent cells and mixed uniformly, and then was added to the

-16- bottom of a precooled 2 mm electroporation cuvette, and was electroporated at 15kV/em.

(9) The electroporated bacteria was suspended with 100 uL of LB liquid medium, shaken at 30°C for 1 h, and centrifuged at 4500 = g for 2 min. Then, the supernatant was discarded. 200 uL of LB liquid medium was used for suspending the precipitation, and then coated on LB solid medium containing kanamycin and chloramphenicol and cultured at 30°C for 48 h.

(10) Single colonies obtained in step (9) were subjected to a PCR identification to obtain a positive colony GS178-pBAC-DPV-AgE-gl-Kana, including: using the resuspension solution of each of the single colonies obtained in step (9) as templates, GS1783-BAC-Agl-F for amplifying I Scel-Kana-gl target fragment as an upstream primer, and the gI-R for identifying gl gene as a downstream primer to identify positive colonies.

GS1783-BAC-Agl-F: 5°- GTGCGCCATATAGACGATATATTGAGTTTCAAAAATAGAAtagggataacagggtaa tcgattt-3° (SEQ ID NO: 5) gl-R: 5’-GACCGGTAGTTCCAATCACT-3 ’(SEQ ID NO: 7) PCR amplification system included: 22 pL of ddH2O, 25 pL of PrimeSTAR® Max DNA Polymerase, 1 uL of the upstream primer GS1783-BAC-AgI-F, 1 uL of the downstream primer gl-R, and 1 pL of the template.

PCR amplification conditions included: pre-denaturation at 98°C for 2 min, 30 cycles denaturation at 98°C for 10s, annealing at 55°C for 15s, and extension at 72°C for Ss, and final extension at 72°C for 10 min and storage at 16°C.

7. Removal of I Scel-Kana fragment (1) A single colony of the positive clone GS1783-pBAC-DPV-AgE-gl-Kana was selected and inoculated in 2mL of LB liquid medium containing chloramphenicol, and cultured at 30°C overnight to obtain seed liquid; (2) 10 uL of the seed solution obtained in step (1) was inoculated in 2 mL of LB liquid medium containing chloramphenicol, and cultured at 30°C for 2 hours until the bacterial solution had cloudy appearance.

-17- (3) 1 mL of LB liquid medium containing chloramphenicol and 5M of L-arabinose with a final concentration of 2% by weight were added to the bacterial solution obtained in step (2), and incubated at 30°C for 1 h.

(5) The bacterial solution obtained in step (4) was cultured at 30°C for 2 h. Subsequently, 1uL of the bacterial solution was added into 200 pL of LB liquid medium and mixed uniformly, and then coated on LB solid medium containing chloramphenicol and incubated at 30°C for 24 h-48 h; (6) Single colonies obtained in step (5) were subjected to a parallel screening on both the LB solid medium containing chloramphenicol and kanamycin and the LB solid medium containing chloramphenicol. The colonies growing on the LB solid medium containing chloramphenicol but not the LB solid medium containing chloramphenicol and kanamycin were identified by PCR with the gl gene upstream identification primer gI-F and the gE gene downstream identification primer gE-R. After that, a positive clone GS1783-pBAC-DPV-AgE + Agl was obtained.

gI-F: 5’-TGTGGGTGGGTCATCTACAT-3(SEQ ID NO: 14) gE-R: 5°- AGCGAGTACTTCTCTGCGTC-3’(SEQ ID NO: 3) PCR amplification system included: 22 pL of ddH2O0, 25 pL of PrimeSTAR® Max DNA Polymerase, 1 pL of the upstream primer gI-F, 1 uL of the downstream primer gE-R, and 1 pL of the resuspension solution of each of the single colonies obtained in step (6) as the template.

8. Amplification of I Scel-Kana-MiniF fragment (1) An Escherichia coli strain with pEPkan-S plasmid was resuscitated in LB solid medium containing kanamycin and cultured overnight at 37°C. Then, single colonies were inoculated in LB liquid medium containing kanamycin and cultured overnight at 37°C. The pEPkan-S plasmid was extracted by the Mini Plasmid Kit.

-18- (2) The I_Scel-Kana-MiniF target fragment was amplified with the pEPkan-S plasmid as a template and GS1783-MiniF-F and GS1783-MiniF-R as primers, and the amplified fragments were recovered with the general agarose gel DNA recovery kit.

GS1783-MiniF-F: 5°-

TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCAT GATGCCTGCAAGCGGTAACGAAAACGATgttacaaccaattaacc-3’ (SEQ ID NO: 8) GS1783-MiniF-R: 5'- ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTATtag ggataacagggtaatcgat -3° (SEQ ID NO: 9) PCR amplification system included: 22 pL of ddH2O0, 25 pL of PrimeSTAR® Max DNA Polymerase, 1 pL of the upstream primer GS1783-MiniF-F, 1 uL of the downstream primer GS1783-MiniF-R, and 1 uL of the template pEPkan-S plasmid.

9. Amplification of UL23-MiniF fragment (1) Duck embryo fibroblasts (DEF) were prepared and inoculated in a T25 cell culture flask at 37°C and 5% CO: for 24 h, and then were incubated with 5 MOI (multiplicity of infection) of DPV CHy at 37°C and 5% CO: for 48 to obtain virus. The virus was frozen and thawed repeatedly. After the second time, the DPV CHv genome was extracted according to the instructions of TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0.

(2) The UL23-MiniF target fragment was amplified with the DPV CHv genome as a template and CHv-UL23-F and CHv-UL23-R as primers. The amplified fragments were recovered with the general agarose gel DNA recovery kit.

CHv-UL23-F: S°-GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg- 3’(SEQ ID NO: 10) CHv-UL23-R: 5°-

CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGG CATATTCAACGGACATATTAAAAATTGA-3’(SEQ ID NO: 11)

-19- PCR amplification system included: 22 pL of ddH2O0, 25 pL of PrimeSTAR® Max DNA Polymerase, 1 pL of the upstream primer CHv-UL23-F, 1 pL of the downstream primer CHv-UL23-R, and 1 pL of the template DPV CHv genome.

10. Fusion of I Scel-Kana-MiniF fragment and UL23-MiniF fragment to obtain I _Scel-Kana-MiniF-UL23 target fragment (1) Using I Scel-Kana-MiniF fragment and UL23-MiniF fragment as templates, fuse The I Scel-Kana-MiniF fragment and the UL23-MiniF fragment were fused with the I Scel-Kana-MiniF fragment and the UL23-MiniF fragment as templates.

The fusion system: 8 uL of ddH:O, 10 pL of PrimeSTAR® Max DNA Polymeras, 1 uL of each of the templates including the I Scel-Kana-MiniF fragment and the UL23-MiniF fragment; The fusion conditions: pre-denaturation at 95°C for Smin, and 5 cycles of denaturation at 95°C for 15 s, annealing at 55°C for 5 s, and extension at 72°C for Imin.

(2) The primers GS1783-MiniF-F and CHv-UL23-R were added to the fused template obtained in step (1) to amplify the I Scel-Kana-MiniF-UL23 target fragment.

The amplified fragments were recovered with the general agarose gel DNA recovery kit.

GS1783-MiniF-F: 5°-

TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCAT GATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3’(SEQ ID NO: 8) CHv-UL23-R: 5’-

CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAAGG CATATTCAACGGACATATTAAAAATTGA-3’(SEQ ID NO: 11) PCR amplification system included: 20 pL of the fused template, 0.5 pL of the upstream primer GS1783-MiniF-F, and 0.5 pL of the downstream primer CHv-UL23-

R

-20- PCR amplification conditions included: pre-denaturation at 98°C for 2 min, 30 cycles denaturation at 98°C for 10s, annealing at 55°C for 15s, and extension at 72°C for 5s, and final extension at 72°C for 10 min and storage at 16°C.

FIG. 3 shows an operation flowchart of deleting a MiniF element by a Red-based modification technique and an intracellular spontaneous homologous recombination technique. The specific process includes the following steps 11-13

11. Preparation of GS1783-pBAC-DPV-AgE+Agl electrotransformation competent cells for target fragment (1) The frozen GS1783-pBAC-DPV-AgE+Agl strain was resuscitated in LB solid medium containing chloramphenicol and incubated at 30°C overnight.

(2) A single colony of the GS1783-pBAC-DPV-AgE+AgI strain was selected and inoculated in 5 mL of LB liquid medium containing chloramphenicol, and incubated at 30°C overnight to obtain seed liquid.

(3) 5 mL of the seed liquid was added to 100 mL of LB liquid medium containing chloramphenicol, and placed at 30°C and shaken to an ODso value of 0.5-0.7.

(7) The bacteria obtained in step 6) were added with ultra-pure water to reach a constant volume of 500 uL of the bacterial solution. Then, the bacterial solution was sub-packed into precooled EP tubes with 100 pL in each tube to obtain the GS1783- pBAC-DPV-AgE+Agl electrotransformation competent cells.

(8) 200 ng of the I Scel-Kana-MiniF-UL23 target fragments were added to 100 uL of the electrotransformation competent cells and mixed uniformly, and then was added to the bottom of a precooled 2 mm electroporation cuvette, and was electroporated at 15kV/cm.

-21- (9) The electroporated bacteria was suspended with 100 uL of LB liquid medium, shaken at 30°C for 1 h, and centrifuged at 4500 x g for 2 min. Then, the supernatant was discarded. 200 uL of LB liquid medium was used for suspending the precipitation, and then coated on LB solid medium containing kanamycin and chloramphenicol and cultured at 30°C for 48 h.

(10) Single colonies obtained in step (9) were subjected to a PCR identification to obtain a positive colony GS1783-pBAC-DPV-AgE+Agl-UL23-Kana, including: using the resuspension solution of each of the single colonies obtained in step (9) as templates, and the MiniF-F and MiniF-R as identification primers to identify positive colonies.

MiniF-F: 5°-GTTATCCACTGAGAAGCGAACG-3’(SEQ ID NO: 12) MiniF-R: 5°-GGCTGTAAAAGGACAGACCACA-3’(SEQ ID NO: 13) PCR amplification system included: 22 pL of ddH2O, 25 pL of PrimeSTAR® Max DNA Polymerase, 1 uL of the upstream primer MiniF-F, 1 uL of the downstream primer MiniF-R, and 1 pL of the resuspension solution of each of the single colonies obtained in step (9) as the template.

12. Removal of I Scel-Kana fragment (1) A single colony of the positive clone GS1783-pBAC-DPV-AgE+Agl-UL23- Kana was selected and inoculated in 2mL of LB liquid medium containing chloramphenicol, and cultured at 30°C overnight to obtain seed liquid.

(2) 10 uL of the seed solution obtained in step (1) was inoculated in 2 mL of LB liquid medium containing chloramphenicol, and cultured at 30°C for 2 hours until the bacterial solution had cloudy appearance.

-22- (4) The bacterial solution obtained in step (3) was immediately put into a 42°C water bath and incubated for 30 min.

(5) The bacterial solution obtained in step (4) was cultured at 30°C for 2 h. Subsequently, luL of the bacterial solution was added into 200 uL of LB liquid medium and mixed uniformly, and then coated on LB solid medium containing chloramphenicol and incubated at 30°C for 24 h-48 h.

(6) Single colonies obtained in step (5) were subjected to a parallel screening on both the LB solid medium containing chloramphenicol and kanamycin and the LB solid medium containing chloramphenicol. The colonies growing on the LB solid medium containing chloramphenicol but not the LB solid medium containing chloramphenicol and kanamycin were identified by PCR with the MiniF gene identification primers. A positive clone GS1783-pBAC-DPV-AgE+AgI-UL23 was obtained.

MiniF-F: 5’-GTTATCCACTGAGAAGCGAACG-3’(SEQ ID NO: 12) MiniF-R: 5°-GGCTGTAAAAGGACAGACCACA-3’(SEQ ID NO: 13) PCR amplification system included: 22 pL of ddH:O, 25 uL of PrimeSTAR® Max DNA Polymerase, 1 pL of the upstream primer MiniF-F, 1 pL of the downstream primer MiniF-R, and 1 uL of the resuspension solution of each of the single colonies obtained in step (6) as the template.

13. Rescue of DPV CHv-AgE+AgI virus (1) The frozen GS1783-pBAC-DPV-AgE+AgI-UL23 strain was resuscitated in LB solid medium containing chloramphenicol and incubated at 30°C overnight.

(2) pBAC-DPV-AgE + Agl-UL23 plasmid was extracted according to the operating instruction of QIAGEN Plasmid Midi Kit.

(3) Duck embryo fibroblasts (DEF) were prepared and inoculated in a 12-well plate. After culturing at 37°C and 5% CO: for 24 hours, the duck embryo fibroblasts were transfected the pBAC-DPV-AgE+AgI-UL23 plasmid according to the

-23- instructions of Lipofectamine 3000. After 96 h, fluorescent spots were observed, and the virus was collected. After freezing and thawing twice, the virus was inoculated into 6-well plates overgrown with the DEF.

(4) Step (3) was repeated three times (5) The virus obtained in step (4) was repeatedly frozen and thawed twice, diluted times, and inoculated into a 6-well plate overgrown with the DEF. After incubation at 37°C and 5% CO: for 2 h, the incubation solution was discarded and 1% methylcellulose was added to fix the cells. After incubation at 37°C and 5% CO: for 120 h, non-fluorescent diseased cells were selected and re-inoculated into the DEF 10 after being repeatedly frozen and thawed twice to obtain a virus DPV CHv-AgE+Agl- Q.

(6) The DPV CHv-AgE+Agl-Q virus genome was extracted according to the instructions of TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0, MiniF identification primers including MiniF-F and MiniF-R were used to identify the missing MiniF element. Finally, a positive markerless deletion virus strain DPV CHv- AgE+Agl without MiniF element residues and base residues at deleted gene positions was obtained, see FIG. 4.

MiniF-F: 5’-GTTATCCACTGAGAAGCGAACG-3’(SEQ ID NO: 12) MiniF-R: 5-GGCTGTAAAAGGACAGACCACA-3’(SEQ ID NO: 13) PCR amplification system included: 22 pL of ddH2O, 25 pL of PrimeSTAR® Max DNA Polymerase, 1 uL of the upstream primer MiniF-F, 1 uL of the downstream primer MiniF-R, and 1 pL of the template DPV CHv-AgE+Agl-Q virus genome extracted in step (6).

Embodiment 2. Detection of virus number after inoculation of 7-day-old ducks with markerless deletion strain DPV CHv-AgE+Agl

-24-

0.01 MOI of the gE-gl gene- and MiniF element-markerless deletion strain DPV CHv-AgE+Agl, were inoculated into DEF cells. The cells were collected 120 h after inoculation with the virus, and were frozen and thawed twice. After TCID: determination, the muscle with 2 MOI of the DPV CHv-AgE+ gl deletion virus was inoculated into 7-day-old ducks. Blood, liver and spleen were collected at 24 h, 48 h, 72 h and 96 h, respectively. DNA was extracted from each tissue according to the instructions of TaKaRa MiniBEST Viral RNA/DNA Extraction Kit Ver.5.0. PCR were carried out to detect whether duck liver virus was a double deletion virus of gE gene and gl gene 48 hours after virus inoculation (see FIG. 5). The amount of virus in blood, liver and spleen at different time points were detected by Quantitative Real-time PCR (qPCR) with UL30 identification primers and Taq probes of qPCR (see FIG. 6). The results showed that the DPV CHv-AgE+Agl was detected in blood, liver and spleen after inoculation, the number of DPV CHv-AgE+Agl virions in blood and liver increased at first and then decreased; the number of DPV CHv-AgE+Agl virions in spleen decreased gradually; the number of DPV CHv-AgE+Agl virions in blood was lower than that in liver and spleen; and the number of DPV CHv-AgE+Agl virions in liver tissue reached the maximum at 48 h and that in spleen tissue reached the maximum at 24 h.

In addition, the present disclosure further carried out genetic stability experiments, safety experiments and immunogenicity experiments on the duck plague virus gE-gl gene markerless deletion strain DPV CHv-AgE+Agl.

Genetic stability: the duck plague virus gE-gl gene markerless deletion strain DPV CHv-AgE+Agl passaged on DEF cells for 20 generations without lesion plaques, indicating that the obtained duck plague virus gE-gl gene markerless deletion strain DPV CHv-AgE+Agl was stably inherited in DEF cells.

Safety: fifteen 4-week-old ducks with negative DPV antibody and negative PCR test were randomly divided into 3 groups with 5 ducks in each group. The first group received intramuscular injection of DPV CHv-AgE+ A gl, the second group received intramuscular injection of parent virus DPV CHv, and each duck of the above two groups was injected at the same viral titer. The third group received equal dose of MEM as the control group. Each group was fed separately, and the morbidity and death were observed and recorded every day. The results showed that all the ducks

-25- injected with the parental virus died, but the ducks injected with the DPV CHv- AgE+Agl and the control group did not die, indicating that the DPV CHv-AgE+ Agl was safe.

Immunogenicity: ten 4-week-old ducks with negative DPV antibody and negative PCR test were randomly divided into two groups with 5 ducks in each group.

The first group was injected intramuscularly with the DPV CHv-AgE+Agl, and the second group was injected with the same dose of MEM as the control group, and each group was fed separately.

Fourteen days after the immunization, the leg muscles were injected with DPV CHv virulent virus, and the morbidity and death were observed and recorded.

The results showed that after injection with the virulent virus, 100% death occured in the control group and 100% protection occured in the immunization group, indicating that the DPV CHv-AgE+Agl had good immunogenicity.

GBCDO50-NL_seq list _ST25_20200511-1521.txt-110-998-88.txt

SEQUENCE LISTING <110> Sichuan Agricultural University <120> Duck Plague Virus gE-gI Double Gene Markerless Deletion Strain DPV CHv- | HgE+HgI and Construction Method Thereof <130> GBCD950-NL <160> 14 <170> PatentIn version 3.5 <2105 1 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 1 atactgccgg ccagactacg gaacctcaac aattggtacg tagggataac agggtaatcg 60 attt 64 <2105 2 <211> 98 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 2 taactatttc actagtgagt cattagttca acatccatga cgtaccaatt gttgaggttc 60 cgtagtctgg ccggcagtat gccagtgtta caaccaat 98 <2105 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 3 agcgagtact tctctgcgtc 20 <2105 4 Pagina 1

GBCDO50-NL_seq list _ST25_20200511-1521.txt-110-998-88.txt <211> 20 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 4 tctcaagacg ctctggaatc 20 <216> 5 <211> 64 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 5 gtgcgccata tagacgatat attgagtttc aaaaatagaa tagggataac agggtaatcg 60 attt 64 <210> 6 <211> 98 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 6 tcataacaaa aacatttact tttagtcata ctgatgtgaa ttctattttt gaaactcaat 60 atatcgtcta tatggcgcac gccagtgtta caaccaat 98 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 7 gaccggtagt tccaatcact 20 <2105 8 <211> 98 <212> DNA

Pagina 2

GBCDO50-NL_seq list _ST25_20200511-1521.txt-110-998-88.txt <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 8 ttattaatct caggagcctg tgtagcgttt ataggaagta gtgttctgtc atgatgcctg 60 caagcggtaa cgaaaacgat tgttacaacc aattaacc 98 <210> 9 <211> 72 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 9 atcgttttcg ttaccgcttg caggcatcat gacagaacac tacttcctat tagggataac 60 agggtaatcg at 72 <210> 10 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 10 gcctgcaagc ggtaacgaaa acgattcaat taattgtcat ctcgg 45 <210> 11 <211> 79 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 11 ccgctccact tcaacgtaac accgcacgaa gatttctatt gttcctgaag gcatattcaa 60 cggacatatt aaaaattga 79 <210> 12 <211> 22 <212> DNA

Pagina 3

GBCDO50-NL_seq list _ST25_20200511-1521.txt-110-998-88.txt <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 12 gttatccact gagaagcgaa cg 22 <21e> 13 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 13 ggctgtaaaa ggacagacca ca 22 <210> 14 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> The sequence is a synthetized nucleotide sequence. <400> 14 tgtgggtggg tcatctacat 20 Pagina 4

Claims

-26- Conclusions

1. Markerless gE-gl double gene deletion strain of duck sickness virus, wherein the markerless gE-gl double gene deletion strain of duck sickness virus, conserved at the China Center for Type Culture Collection on July 4, 2018, has a retention number of CCTCC NO: V201841 .

A method of constructing the markerless gE-g1 double gene deletion strain of duck plague virus DPV CHv-AgE + AgI according to claim 1, comprising the steps of: (1) transforming a pBAC-DPV plasmid into competent cells of Escherichia coli strain GS1783 to obtain a GS1783 pBAC-DPV strain, and then prepare competent cells from the GS1783 pBAC-DPV strain; (2) amplifying an I Scel-Kana gE target fragment containing a base fragment with an I Scel restriction site and a Kana element and both upstream and downstream homologous sequences of 40 bp gE gene by polymerase chain reaction (PCR) with pEPkan -S as a template and GS1783-BAC-AgE-F and GS1783-BAC-AgE-R as primers, and performing a gel extraction to obtain the I Scel-Kana-gE fragment; (3) transforming the I Scel-Kana gE fragment into the competent cells of the GS1783-pBAC-DPV strain, and screening to obtain a positive clone GS1783-pBAC-DPV-gE-Kana; (4) removing the I Scel-Kana fragment in the positive clone GS1783-pBAC-DPV-gE-Kana to obtain a GS1783-pBAC-DPV-AgE strain, and preparing competent cells of the GS1783- pBAC-DPV-AgE strain; (5) amplifying an I Scel-Kana-gl target fragment containing a base fragment with an I Scel restriction site and a Kana element and both upstream and downstream homologous sequences of 40 bp gl gene by the PCR with pEPkan-S as a template and GS1783 -BAC-AgI-F and GS1783-BAC-AgI-R as primers, and performing a gel extraction to obtain the I Scel-Kanagi fragment; (6) transforming the I Scel-Kana-g1 fragment into the competent cells of the GS1783-pBAC-DPV-AgE, followed by antibiotic screening and a PCR

-27-

identification to obtain positive clone GS1783-pBAC-DPV-AgE-g1-Kana;

(7) deletion of the I Scel-Kana fragment in the positive clone GS1783-

pBAC-DPV-AgE-g1-Kana to obtain a GS1783-pBAC-DPV-AgE + AglI strain, and prepare competent cells of the GS1783-pBAC-DPV

AgE + Agi strain;

(8) amplifying an I Scel-Kana-MiniF fragment containing: a base fragment with an I Scel restriction site and a Kana element, a downstream homologous sequence of MiniF element-ori2 gene of 240 bp and a downstream homologue sequence of 290 bp MiniF element ori2 gene by the PCR with pEPkan-S as a template and GS1783-MiniF-F and GS1783-MiniF-R as primers, and performing a gel extraction to obtain the I Scel-Kana- Obtain MiniF fragment;

(9) amplifying a UL23-MiniF fragment containing: a UL23 gene, a downstream homologous sequence of I Scel-Kana-MiniF of 25 bp and a downstream homologous sequence of the ori2 gene of MiniF element of 180 bp by PCR with CHv genome as a template and CHv-UL23-F and CHv-UL23-R as primers, and performing a gel extraction to obtain the UL23-MiniF fragment;

(10) performing a fusion PCR with the I Scel-Kana-MiniF fragment and the UL23-MiniF fragment as templates to obtain a fused fragment, and then performing a PCR amplification with GS1783-MiniF- F and CHv-UL23-R as primers to obtain an I Scel-Kana-MiniF-UL23 target fragment; (11) transforming the I Scel-Kana-MiniF-UL23 target fragment into the competent cells of the GS1783-pBAC-DPV-AgE + Ag1 strain, followed by antibiotic screening and PCR identification to obtain a positive clone GS1783- obtain pBAC-DPV-AgE + AgI-UL23-Kana;

(12) removing the I Scel-Kana fragment in the positive clone GS1783-pBAC-DPV-AgE + AgI-UL23-Kana to generate a positive clone GS1783-pBAC-DPV-

AgE + AglI-UL23; and (13) extracting pBAC-DPV-AgE + AgII-UL23 plasmids from the positive clone GS1783-pBAC-DPV-AgE + AgII-UL23 and transfecting the pBAC-

28 - DPV-AgE + AgI-UL23 plasmids in DEF cells, followed by clone screening to obtain the markerless gE-g1 double gene deletion strain DPV CHv-AgE + AgII.

The method of constructing the markerless gE-g1 double gene deletion strain of duck plague virus DPV CHv-AgE + Ag1 according to claim 2, wherein PCR amplification systems in step (2), step (5), step (8), and step (9) each comprising: 22 µL ddH → 0.25 µL PrimeSTAR® Max DNA Polymerase, 1 µL upstream primer, 1 µL downstream primer, and 1 µL template; PCR amplification conditions included: pre-denaturation at 98 ° C for 2 minutes, 30 cycles of denaturation at 98 ° C for 10 s, annealing at 55 ° C for 15 s and extension at 72 ° C for 5 s, and finally perform an extension at 72 ° C for 10 minutes.

The method of constructing the markerless gE-g1 double gene deletion strain of duck plague virus DPV CHv-AgE + Ag1 according to claim 2 or 3, wherein sequences of the primers in step (2) comprise: GS1783-BAC-AgE-F: 5'-ATACTGCCGGCCAGACTACGGAACCTCAACAATTGGTACGtagggataacagg gtaatcgattt-3 '; and GS1783-BAC-AgE-R: 5'-

TAACTATTTCACTAGTGAGTCATTAGTTCAACATCCATGACGTACCAATT GTTGAGGTTCCGTAGTCTGGCCGGCAGTATgccagtgttacaaccaat-3 ".

The method of constructing the markerless gE-gl double gene deletion strain of duck plague virus DPV CHv-AgE + Ag1 according to claim 2 or 3, wherein sequences of the primers in step (5) comprise: GS1783-BAC-AglI-F: 5'-GTGCGCCATATAGACGATATATTGAGTTTCAAAAATAGAAtagggataacaggg taatcgattt-3 '; and GS1783-BAC-Agl-R: 5'-

TCATAACAAAAACATTTACTTTTAGTCATACTGATGTGAATTCTATTTTT GAAACTCAATATATCGTCTATATGGCGCACgccagtgttacaaccaat-3 ".

-29-

The method of constructing the markerless gE-g1 double gene deletion strain of duck plague virus DPV CHv-AgE + Ag1 according to claim 2 or 3, wherein sequences of the primers in step (8) comprise: GS1783-MiniF-F: 5 ' -

TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3 "; and GS1783-MiniF-R: 5'-

ATCGTTTTCGTTACCGCTTGCAGGCATCATGACAGAACACTACTTCCTAT tagggataacagggtaatcgat-3 ".

The method of constructing the markerless gE-gl double gene deletion strain of duck plague virus DPV CHv-AgE + Ag1 according to claim 2 or 3, wherein sequences of the primers in step (9) comprise: CHv-UL23-F: S ° -GCCTGCAAGCGGTAACGAAAACGATtcaattaattgtcatctcgg- 3; and CHv-UL23-R: 5'-

CCGCTCCACTTCAACGTAACACCGCACGAAGATTTCTATTGTTCCTGAA GGCATATTCAACGGACATATTAAAAATTGA-3 ".

The method of constructing the markerless gE-gl double gene deletion strain of duck plague virus DPV CHv-AgE + Ag1 according to claim 2, wherein sequences of the primers in step (10) comprise: GS1783-MiniF-F: 5 "

TTATTAATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTC ATGATGCCTGCAAGCGGTAACGAAAACGATtgttacaaccaattaacc-3 "; and CHv-UL23-R: 5'-

The method of constructing the markerless gE-g1 double gene deletion strain of duck plague virus DPV CHv-AgE + Ag1 according to claim 2 or 8, wherein a PCR fusion system in step (10) comprises: 8 µL ddH: 0.10 µL PrimeSTAR® Max DNA polymerase and 1 µL of the I Scel-Kana-MiniF fragment

-30- and 1 µL of the UL23 MiniF fragment as templates; PCR fusion conditions included: performing a pre-denaturation at 95 ° C for 5 minutes then performing 5 cycles of denaturation at 95 ° C for 15 s, annealing at 55 ° C for 15 s and extension at 72 ° for 1 minute.

The method of constructing the markerless gE-g1 double gene deletion strain of duck plague virus DPV CHv-AgE + Ag1 according to claim 2 or 8, wherein a PCR amplification system in step (10) comprises: 20 µL fusion template, 0.5 µL of the upstream primer GS1783-MiniF-F and 0.5 µL of the downstream primer CHv-UL23-R; and PCR amplification conditions include: performing a pre-denaturation at 98 ° C for 2 minutes, running 30 cycles of denaturation at 98 ° C for 10 s, annealing at 55 ° C for 15 s and extension at 72 ° C for 5 s, and finally perform an extension at 72 ° C for 10 minutes.