AU2020321673A1 - Anti-CD3 aptamers for use in cell targeting and labeling - Google Patents

Abstract

High affinity aptamer sequences recognizing CD3 protein complex on cell surfaces are provided. The aptamers can be used as targeting moieties for delivery vehicles or as molecular components for immunotherapy, immunodiagnostics, or for isolating, purifying, or characterizing CD3+ T cells in a subject.

Description

TITLE

Anti-CD3 Aptamers for Use in Cell Targeting and Labeling

CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Application No. 62/879,401, filed 26 July 2019; and to U.S. Provisional Application No. 62/879,413, filed 26 July 2019; and to PCT Application No. PCT/IB2019/000890, filed 26 July 2019. Each of the aforementioned applications is hereby incorporated by reference in its entirety.

BACKGROUND

Cluster of differentiation 3 (CD3) is a protein complex containing one g subunit, one d subunit, and two e subunits, which form CD3ye and CD35s heterodimers that associate with the T cell receptor (TCR) and transmit an intracellular signal when the TCR binds to a peptide - MHC complex. The CD3 subunits are highly homologous, and each has a small cytoplasmic domain and a transmembrane domain containing negatively charged residues, through which it associates with positively charged residues in the transmembrane region of the TCR. The TCR contains a, b, z, and h subunits and exists as ab heterodimers associated with zz homodimers or zh heterodimers. The TCR in turn is associated with CD3ys and CD35s heterodimers.

Aptamers are short, single-stranded oligonucleotides with unique three-dimensional configurations. Like antibodies, aptamers bind to targets with high specificity and can often modulate the biological activity of a target. Aptamers offer many advantages relative to antibodies, including lack of immunogenicity, well controlled and inexpensive chemical synthesis, high stability, and good tissue penetration. Aptamers also can be attached to nanoparticles, drugs, imaging agents, and other nucleic acids for use as targeting moieties.

SUMMARY

The present technology provides DNA and RNA aptamers that bind to CD3 and can be used to target, label or sort T cells. Accordingly, in one aspect, the technology provides an aptamer that binds to CD3 e/g or CD3 e/d protein complexes. The aptamer comprises a polynucleotide having any of several nucleic acid sequences described herein.

Another aspect of the invention is a method of labeling, purifying, or sorting cells expressing CD3. The cells are incubated with an anti-CD3 aptamer which carries a label, such as a fluorescent label or radioisotope.

Another aspect of the technology is a delivery vehicle for in vitro or in vivo targeting T cells comprising the above anti-CD3 aptamer.

Yet another aspect of the technology is a method of targeting the delivery vehicle to T cells in a subject. The method comprises administering the delivery vehicle to the subject.

Further, the technology provides a pharmaceutical composition comprising the above - described drug delivery vehicle.

The present technology can be further summarized in the following list of features.

1. An aptamer comprising the sequence GX₁X₂TX₃GX₄X₅X₆X₇X₈X₉GGX₁₀CTGG, wherein Xi is G or A; X₂ and Cb are A, T, or G; X₃ is T, or G; X₄ and X₉ are G or C; X₅ is C or T; X₇ is T, G, or C; and Xs and X₁₀ are C, T, or A (SEQ ID NO: 109) or a variant thereof; and wherein the aptamer binds to CD3 e/g or CD3 e/d.

2. An aptamer comprising the sequence GGGX₁TTGGCX₂X₃X₄GGGX₅CTGGC, wherein Xi and X₂ are A, T, or G; X₃ is T, C, or G; X₄ and X₅ are A, T, or C (SEQ ID NO: 1 10) or a variant thereof, and wherein the aptamer binds to CD3 e/g or CD3 e/d.

3. An aptamer comprising the sequence GX₁TTX₂GX₃X₄X₅X₆CX₇GGX₈CTGGX₉G, wherein Xi is A or G; X₂ is T or G; X₃ and X₇, X₉ are G or C; X₄ is T or C; X₅ is A or T; Xe is T, C, or G; Xs is A or C (SEQ ID NO: 1 1 1) or a variant thereof, and wherein the aptamer binds to CD3 e/g or CD3 e/d.

4. An aptamer comprising the sequence GGGTTTGGCAXiCGGGCCTGGC, wherein Xi is G, C, or T (SEQ ID NO: 1 12) or a variant thereof, and wherein the aptamer binds to CD3 e/g or CD3 e/d.

5. An aptamer comprising the sequence GCAGCGAUUCUXiGUUU, wherein Xi is U or no base (SEQ ID NO: 1 13) or a variant thereof, and wherein the aptamer binds to CD3 e/g or CD3 e/d.

6. The aptamer of any of features 1 -5, wherein the aptamer binds to human CD3 e/g and/or CD3 e/d with a dissociation constant of about 0.2 pM to about 250 nM.

7. The aptamer of any of features 1 -5, wherein the aptamer binds to a non-human form of CD3 e/g and/or CD3 e/d with a dissociation constant of about 20 nM to about 800 nM. 8. The aptamer of any of features 1 -7 comprising a sequence selected from SEQ ID NOS: 1 to 108.

9. The aptamer of any of features 1 -8 comprising a variant of said sequence, wherein one or more of said bases are substituted with a non-naturally occurring base or wherein one or more of said bases is omitted or the corresponding nucleotide is replaced with a linker.

10. The aptamer of feature 9, wherein the one or more non-naturally occurring bases are selected from the group consisting of methylinosine, dihydrouridine, methyl guanosine, and thiouridine.

11. The aptamer of any of features 1 -10 that binds to but does not activate CD3+ T cells.

12. A vehicle for delivering an agent, a dye, a functional group for covalent coupling or a biologically active agent to T cells, wherein the vehicle comprises the aptamer of any of features 1 -11.

13. The vehicle of feature 11 or feature 12 that comprises a polymeric nanoparticle.

14. The vehicle of feature 13, wherein the polymeric nanoparticle comprises a poly(beta amino ester) (PBAE).

15. The vehicle of feature 13 or feature 14, wherein the aptamer is covalently linked to the polymer.

16. The vehicle of any of features 13-15, wherein the agent is a T cell modulator or an imaging agent.

17. The vehicle of feature 16, wherein the T cell modulator is a viral vector carrying a transgene; wherein the viral vector is coated with the polymer; and wherein the aptamer is covalently linked to the polymer.

18. The vehicle of feature 17, wherein the viral vector is a lentiviral vector.

19. The vehicle of feature 17 or feature 18, wherein the transgene encodes a chimeric antigen receptor.

20. The vehicle of feature 16, wherein the T cell modulator is selected from the group consisting of dasatinib, an MEK1/2 inhibitor, a PI3K inhibitor, an HD AC inhibitor, a kinase inhibitor, a metabolic inhibitor, a GSK3 beta inhibitor, an MAO-B inhibitor, and a Cdk5 inhibitor.

21. A method of delivering an agent to T cells in a subject, the method comprising administering the vehicle of any of features 16-20 to the subject.

22. A pharmaceutical composition comprising the vehicle of any of features 16-20 and one or more excipients. 23. A method of isolating T cells from a subject, the method comprising using the vehicle of any of features 1 -12 to isolate T cells from the subject.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the first 45 nucleic acid sequences (SEQ ID NOS: 1-45, from top to bottom) of anti-CD3 DNA aptamers (clusters) obtained by performing SELEX on a mixture of recombinant human CD3 e/g and human CD3 e/d proteins. Each complex was prepared as a C - terminal Fc fusion. hlgGl Fc was used as a counter target. The clusters are arranged from top to bottom in the order of decreasing frequency of occurrence in a given round of SELEX.

Figures 2A-2E are bar graphs showing results of binding of aptamers Cluster_l (SEQ ID NO: 1), Cluster ls (SEQ ID NO:46, equivalent to Cluster l in which the 5’ and 3’ flanking regions have been removed), Cluster_2 (SEQ ID NO:2), Cluster_3 (SEQ ID NO:3), and Cluster_21 (SEQ ID NO:21) obtained by the SELEX procedure (Fig. 1) to Jurkat cells (human CD3 positive cells). For comparison, binding of the aptamers to Ramos cells (human CD3 negative cells; control) is also shown. The binding was tested at three concentrations of the aptamers: 3 nM, 10 nM, and 30 nM.

Figures 3A-3E are bar graphs showing results of binding of aptamers CELTIC l (SEQ ID NO: l), CELTIC ls (SEQ ID NO:46), CELTIC 2 (SEQ ID NO:2), CELTIC 3 (SEQ ID NO:3), and CELTIC 21 (SEQ ID NO:21) obtained by the SELEX procedure (Fig. 1) to Jurkat cells (CD3 positive cells). For comparison, binding of the aptamers to Ramos cells (CD3 negative cells; control) is also shown. The binding was tested at the following aptamer concentrations: 1 nM, 2.5 nM, 5 nM, 7.5 nM, and 10 nM.

Figures 4A-4C are sensorgrams showing results of binding of each of biotinlylated aptamers CELTIC l (SEQ ID NOT), CELTIC 3 (SEQ ID NO:3), and CELTIC 21 (SEQ ID NO:21) immobilized on a Series Sensor SA Chip to CD3 e/g (left column), CD3 e/d (middle column), and control hlgGl Fc (right column). Binding was measured by surface plasm on resonance using a single cycle kinetic protocol. Serial injections of aptamer at concentrations 3 nM, 10 nM, 30 nM, 50 nM, and 100 nM were performed.

Figures 5A-5F are bar graphs showing results of binding of each of aptamers CELTIC 2 (SEQ ID NO:2), CELTIC 3 (SEQ ID NO:3), and CELTIC 21 (SEQ ID NO:21), and their shorter versions lacking flanking region nucleotides CELTIC_2s (SEQ ID NO:47), CELTIC_3s (SEQ ID NO:48), and CELTIC_21s (SEQ ID NO:49), to Jurkat cells (CD3 positive cells). Binding was measured at aptamer concentrations 3 nM, 10 nM, and 30 nM. Figures 5A and 5D show binding of CELTIC 2 and CELTIC_2s, respectively, to the cells. Figures 5B and 5E show binding of CELTIC 3 and CELTIC_3s, respectively, to the cells. Figures 5C and 5F show binding of CELTIC 21 and CELTIC_21s to the cells. Binding of the aptamers to Ramos cells (CD3 negative cells; control) is shown for comparison.

Figure 6 shows the alignment of the sequences of clusters 1, 2, 3, and 21 (SEQ ID NOS: l, 2, 3, and 21, respectively), and that of clusters 1, 2, and 3 to show the core region of homology. Multiple sequence alignment was performed with ClustalW algorithm. Nucleotides found conserved in each cluster are marked with an *.

Figures 7A and 7B show DNA sequences of several additional clusters (SEQ ID NOS: 11, 7, 5, 9, 22, 2, 17, 14, 15, 20, 18, 12, 1, 8, 13, 3, 4, 6, 19, 10, and 16 from top to bottom of Fig. 7A, SEQ ID NOS: 1 -22 from top to bottom of Fig. 7B) obtained by the SELEX procedure (Fig. 1) and an alignment of the sequences excluding and including the sequence of cluster 21 (Fig. 7A and Fig. 7B, respectively). Multiple sequence alignments were performed with ClustalW algorithm. Nucleotides found conserved in each cluster are marked with an *. Figure 7C shows the core sequence (SEQ ID NO:57) and base distribution identified by MEME (Multiple Em for Motif Elicitation) among the first 45 clusters obtained by the SELEX procedure (Fig. 1).

Figures 8A-8G are bar graphs showing results of binding of aptamers (without the 5’ and 3’ flanking regions) CELTIC_4s (SEQ ID NO:50), CELTIC_5s (SEQ ID NO:51), CELTIC_6s (SEQ ID NO:52), CELTIC_9s (SEQ ID NO:53), CELTIC l ls (SEQ ID NO:54), CELTIC_19s (SEQ ID NO:55), and CELTIC_22s (SEQ ID NO:56), obtained by the SELEX procedure (Fig. 1) to Jurkat cells (CD3 positive cells) to estimate binding saturation and KD. The binding was tested at three concentrations of the aptamers: 3 nM, 10 nM, and 30 nM. For comparison, binding of the aptamers to the Ramos cells (CD3 negative cells; control) is also shown.

Figures 9A and 9B are bar graphs showing comparisons of the results of binding of several selected aptamers to Jurkat cells (CD3 positive cells) and Ramos cells (CD3 negative cells; control) at concentrations of 3 nM (Fig.9A) and 10 nM (Fig. 9B). Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as positive control.

Figures 10A-10D show the stability of aptamers CELTIC ls (Fig 10A), CELTIC_4s (Fig 10B), CELTIC l Is (Fig IOC) and CELTIC_19s (Fig 10D) in presence of serum. Integrity of aptamers was determined by agarose gel electrophoresis after incubating the aptamers in serum, in SELEX buffer containing 5 % serum or in RPMI medium containing 10 % serum for different periods of time (24 h, 4 h, 2 h, 1 h, 30 min, 10 min, or 0 h) at 37 °C. Figures 1 1A and 11B are bar graph showing the stability of aptamers CELTIC ls, CELTIC_4s, CELTIC_9s, CELTIC l ls, CELTIC_19s and CELTIC_22s in presence of serum. Stability was determined by incubating the aptamers in serum or in SELEX buffer containing 5 % serum for different periods of time (24 h, 4 h, 2 h, 1 h, 0.5 h, 10 min, or 0 h) at 37 °C, followed by measuring binding of the aptamers to Jurkat cells (CD3 positive cells) by flow cytometry. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as positive control.

Figure 12 is a bar graph showing results of binding of aptamers CELTIC ls, CELTIC_4s, CELTIC_9s and CELTIC_19s obtained by the SELEX (Fig. 1) to peripheral blood mononuclear cells isolated from healthy donors. The binding was tested at the following aptamer concentrations: 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as positive control.

Figures 13A-13D are bar graphs showing results of binding of aptamers CELTIC ls, CELTIC_4s, CELTIC_9s and CELTIC_19s obtained by the SELEX procedure (Fig. 1) to mouse CD3 -positive EL4 cells to estimate binding saturation and KD . The binding was tested at three concentrations of the aptamers: 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM. For comparison, binding of the aptamers at a concentration of 300 nM and of the anti-CD3 145- 2C11 monoclonal antibody (32 nM) to human Jurkat cells is also shown (grey bars).

Figures 14A-14L are graphs showing activation of human lymphocytes by anti-CD3 DNA aptamers at 1 pm concentration, as measured by secretion of cytokines. Levels of secreted cytokines were determined by ELISA after incubating the aptamers in presence of costimulatory anti-CD28 antibody in RPMI medium containing 10 % serum for different periods of time (0 h, 3 h, 19 h, 27 h or 48 h) at 37 °C. Figures 14A, 14B, and 14C show secretion of IFN-g, IL-2, and TNF-a, respectively, by the aptamer CELTIC ls. Figures 14D, 14E, and 14F show secretion of IFN-g, IL-2, and TNF-a, respectively, by the aptamer CELTIC_4s. Figures 14G, 14H, and 141 show secretion of IFN-g, IL-2, and TNF-a, respectively, by the aptamer CELTIC l ls. Figures 14J, 14K, and 14L show secretion of IFN-g, IL-2, and TNF-a, respectively, by the aptamer CELTIC l 9s. For comparison, activation of anti -CD3 monoclonal antibody with or without costimulatory anti-CD28 antibody is also shown.

Figures 15A-15C are bar graphs showing activation of human lymphocytes by anti- CD3 DNA aptamers at 1 pm concentration, as measured by expression of CD25 and CD69 activation markers. Levels of CD25 and CD69 surface markers on CD4- and CD8-positive T lymphocytes were determined by flow cytometry after incubating the aptamers with or without costimulatory anti-CD28 antibody in RPMI medium containing 10 % serum for 48 h at 37 °C. Figure 15A shows expression results obtained with cells treated with CELTIC ls, CELTIC_4s, CELTIC l ls or CELTIC_19s alone. Figure 15B shows expression results obtained with cells treated with the same aptamers mixed with costimulatory anti-CD28 antibody. Figure 15C shows expression results obtained with cells treated with fresh aptamer solutions mixed with anti-CD28 antibody added to culture medium after 3 h, 19 h and 27 h incubation in order to keep the concentration of reagents constant.

Figures 16A-16C are bar graphs showing activation of human lymphocytes by anti- CD3 DNA aptamers at 1 pm concentration, as measured by secretion of cytokines. Levels of secreted cytokines were determined with Human Thl/Th2 Cytometric Bead Array after incubating the aptamers in presence of costimulatory anti-CD28 antibody in RPMI medium containing 10 % serum for 48 h at 37 °C. Figure 16A shows secretion of IFN_^y, IL-2, IL-4, IL- 5, IL-10 and TNF-a for cells treated with CELTIC ls, CELTIC_4s, CELTIC l ls or CELTIC_19s alone. Figure 16B shows cytokine secretion profile of cells treated with the same aptamers mixed with costimulatory anti-CD28 antibody. Figure 16C shows cytokine secretion profile of cells treated with fresh aptamer solutions mixed with anti-CD28 antibody added to culture medium after 3h, 19 h and 27 h incubation in order to keep the concentration of reagents constant.

Figures 17.1A-17.3B are bar graphs showing results of binding of aptamers CELTIC ls, CELTIC_4s, CELTIC l Is and CELTIC_19s obtained by the SELEX procedure (Fig. 1) and antibodies specific for CD3 epitopes to Jurkat cells (CD3 positive cells) in order to map regions of CD3 recognized by aptamers. The binding was performed in presence of saturating concentrations of competitors. In Figures 17.1A, 17.2A and 17.3A binding of PE- labeled monoclonal OKT3, UCHT1 and HIT3a antibodies specific for CD3 was tested at one concentration (0.1 nM for OKT3 and HIT3a or 1 nM for UCHT1) and in absence or in presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a or 10 nM for UCHT1) or biotinylated aptamers (300 nM). In Figures 17. IB, 17.2B and 17.3B binding of biotinylated aptamers was tested at a concentration of 300 nM in absence or in presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a or 10 nM for UCHT1) and in presence of PE labeled streptavidin.

Figure 17.4 is a bar graph showing results of binding of aptamer CELTIC core corresponding to the computed conserved motif found among top 45 sequence families isolated during SELEX (Fig. 7C) to Jurkat cells (CD3 positive cells). For comparison, binding of the aptamer to Ramos cells (CD3 negative cells; control) is also shown. The binding was tested at the following aptamer concentrations: 3 nM, 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM 75 nM and 100 nM. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as positive control.

Figure 17.5 lists the sequences of the different variants (1 to 13) (SEQ ID NOS:58-71, respectively) of aptamer CELTIC core (top sequence, SEQ ID NO:57) corresponding to the computed conserved motif found among top 45 sequence families isolated during SELEX (Fig. 7C). Underscore refers to positions in the sequence where the base has been replaced by a C3 spacer therefore creating an abasic site. Mutations introduced in the original core sequence are highlighted in bold.

Figures 176A-17.6N are bar graphs showing results of binding of aptamers CELTIC corel, CELTIC_core2, CELTIC_core3, CELTIC_core4, CELTIC_core5, CELTIC_core6, CELTIC_core7, CELTIC_core8, CELTIC_core9, CELTIC corelO, CELTIC core 11 , CELTIC_corel2, CELTIC_corel3 and CELTIC coreT carrying modifications compared to CELTIC core (Fig. 17.5) to Jurkat cells (CD3 positive cells). The binding was tested at the two aptamer concentrations (50 nM and 100 nM) and compared to cell staining obtained with CELTIC core (50 and 100 nM) and full length CD3_CELTIC_ls (10 and 50 nM). For comparison, binding of the aptamers to Ramos cells (CD3 negative cells; control) is also shown. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as positive control.

Figure 18 lists the sequences of the different variants (1 to 44, SEQ ID NOS:58-102, including the 13 mutants already described in Figure 17.5 and evaluated in Figures 17.6A to 17.6N) of aptamer CELTIC core (“0”, SEQ ID NO:57) corresponding to the computed conserved motif found among top 45 sequence families obtained during SELEX (Fig. 7C). Underscore refers to positions in the sequence where the base has been replaced by a C3 spacer therefore creating an abasic site. Mutations introduced in the original core sequence are highlighted in bold.

Figures 19A-19D are bar graphs showing results of binding of aptamers CELTIC_corel4 to CELTIC_core44 carrying modifications compared to CELTIC core (Fig. 17.5) to Jurkat cells (CD3 positive cells). The binding was tested at the two aptamer concentrations: 50 nM (Figures 19. A for mutants 14 to 37 and 19.C for mutants 38 to 44) and 100 nM (Figures 19.B for mutants 14 to 37 and 19.D for mutants 38 to 44) and compared to cell staining obtained with CELTIC core (50 and 100 nM) and full length CD3_CELTIC_ls and CD3_CELTIC_19s (10 and 50 nM). For comparison, binding of the aptamers to Ramos cells (CD3 negative cells; control) is also shown. Anti-CD3 OKT3 and anti-CD 19 monoclonal antibodies (32 nM each) were included as positive controls. Figure 20 summarizes the results of binding of aptamers CELTIC corel to CELTIC_core44 (SEQ ID NOS:58-102) carrying above-described modifications compared to CELTIC core (SEQ ID NO:57) (Fig. 17.5) to Jurkat cells (CD3 positive cells).

Figures 21A-21F are bar graphs showing results of binding of aptamers CELTIC_corel2, CELTIC_core40HEGt, CELTIC_core42HEGt to Jurkat cells (CD3 positive cells) and antibodies specific for CD3 epitopes in presence of saturating concentrations of competitors in order to map regions of CD3 recognized by aptamers. In Figures 21 A, 21C and 2 IE. a binding of PE-labeled monoclonal OKT3, UCHT1 and HIT3a antibodies specific for CD3 was tested at one concentration (0.1 nM for OKT3 and HIT3a or 1 nM for UCHT1) and in absence or in presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a or 10 nM for UCHT1) or biotinylated aptamers (300 nM). In Figures 21.B21.D and21.Fbinding of biotinylated aptamers was tested at a concentration of 300 nM in absence or in presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a or 10 nM for UCHT1) and in presence of PE labeled streptavidin. The results are compared with cell staining obtained with full length CD3_CELTIC_ls.

Figures 22A-22F show the stability of aptamers CELTIC_coreHEG (Fig 22A), CELTIC_corel2 (Fig 22B), CELTIC_core24HEG (Fig 22C), CELTIC_core29HEG (Fig 22D), CELTIC_core40HEG (Fig 22E) and CELTIC_core42HEG (Fig 22F) in presence of serum. Integrity of aptamers was determined by agarose gel electrophoresis after incubating the aptamers in serum, in SELEX buffer containing 5 % serum or in RPMI medium containing 10 % serum for different periods of time (24 h, 4 h, 2 h, 1 h, 30 min, 10 min, or 0 h) at 37 °C.

Figures 23A-C are bar graph showing the stability of aptamers CELTIC coreHEG, CELTIC_corel2 (Fig 23A), CELTIC_core24HEG, CELTIC_core29HEG (Fig 23B), CELTIC_core40HEG and CELTIC_core42HEG (Fig 23C) in presence of serum. Stability was determined by incubating the aptamers in serum or in SELEX buffer containing 5 % serum for different periods of time (24 h, 4 h, 2 h, 1 h, 0.5 h, 10 min, or 0 h) at 37 °C, followed by measuring binding of the aptamers to Jurkat cells (CD3 positive cells) by flow cytometry. Anti- CD3 OKT3 monoclonal antibody (32 nM) was included as positive control.

Figures 24A-D show the stability of aptamers CELTIC_core40HEG (Fig 24A), CELTIC_core4 OHEGt (Fig 24B), CELTIC_core42HEG (Fig 24C) and CELTIC_core42HEGt (Fig 24D) in presence of serum. Integrity of aptamers was determined by agarose gel electrophoresis after incubating the aptamers in serum, in SELEX buffer containing 5 % serum or in RPMI medium containing 10 % serum for different periods of time (24 h, 4 h, 2 h, 1 h, 30 min, 10 min, or 0 h) at 37 °C. Figures 25A-25B are bar graphs showing the stability of aptamers CELTIC_core4 OHEG, CELTIC_core40HEGt (Fig 25A), CELTIC_core42HEG and CELTIC_core42HEGt (Fig 25B) in presence of serum. Stability was determined by incubating the aptamers in serum or in SELEX buffer containing 5 % serum for different periods of time (24 h, 4 h, 2 h, 1 h, 0.5 h, 10 min, or 0 h) at 37 °C, followed by measuring binding of the aptamers to Jurkat cells (CD3 positive cells) by flow cytometry. Anti-CD3 OKT3 monoclonal antibody (32 nM) was included as positive control.

Figure 26 is a bar graph showing results of binding of aptamer CELTIC_core42HEG carrying chemical modifications on extremities: tetrazin group at the 5’ end and biotin at the 3’ end to Jurkat cells (CD3 positive cells). The binding was tested at the aptamer concentrations: 15 nM, 25 nM, 35 nM, 50 nM and 75 nM and compared to cell staining obtained with aptamer CELTIC_core42HEG modified with biotin at the 3’ or 5’ end. For comparison, binding of the aptamers to Ramos cells (CD3 negative cells; control) is also shown. Anti-CD3 OKT3 and anti -CD 19 monoclonal antibodies (32 nM each) were included as positive controls.

Figure 27 shows the alignment of nucleic acid sequences (SEQ ID NOS: 103-107, top to bottom) of the five most frequent nucleic acid sequences of anti -CD 3 RNA aptamers (clusters) obtained by SELEX performed on a mixture of recombinant CD 3 e/g and CD3 e/d proteins, each prepared as a C-terminal Fc fusion. hlgGl Fc was used as the counter target. The last three rounds of this SELEX were performed on Jurkat (CD3 positive) cells as target and Ramos (CD3 negative) cells as counter target. Multiple sequence alignment was performed with ClustalW algorithm. Nucleotides found conserved in each cluster is marked with an *.

Figure 28 shows the core sequence (SEQ ID NO: 108) and base distribution identified by MEME (Multiple Em for Motif Elicitation) among the first 5 clusters obtained by the SELEX procedure (Fig. 27).

Figures 29A-29B shows sequence and Mfold predicted secondary structure of ARACD3-0010209 (SEQ ID NOT03), ARACD3 -0270039 (SEQ ID NO: 105), ARACD3- 2980001 (SEQ ID NOT04), ARACD3 -3130001 (SEQ ID NO: 106) and ARACD3-3700006 (SEQ ID NO: 107). Numbering indicates base numbers of aptamers lacking the flanking region nucleotides. Secondary structure of the core sequence found in the 5 clusters obtained by the SELEX is also depicted. The secondary structure and free energy for each aptamer was computed by Quikfold 3.0 (Zuker et al. 2003) at 37°C, 1 M Na⁺.

Figures 30A-30E are bar graphs showing results of binding of aptamers ARACD3- 0010209, ARACD3 -0270039, ARACD3 -2980001, ARACD3 -3130001 and ARACD3- 3700006 obtained by the SELEX (Fig. 27) to Jurkat cells (CD3 positive cells). For comparison, binding of the aptamers to Ramos cells (CD3 negative cells; control) is also shown. The binding was tested at three concentrations of the aptamers: 30 nM, 100 nM, and 300 nM.

Figures 31A-31C are sensorgrams showing results of binding of biotinylated aptamers ARACD3-3700006, ARACD3 -0010209, and ARACD3 -3130001 immobilized on a Series Sensor SA Chip to CD3 e/g (left column), CD3 e/d (middle column), and control hlgGl Fc (right column). Binding was measured by surface plasmon resonance using a single cycle kinetic protocol. Serial injections of aptamer at concentrations of 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM were performed.

Figures 32A-32C show the stability and integrity of the anti-CD3 RNA aptamers ARACD3-3700006 and ARACD3 -0010209 in the presence of serum. In Figure 32A (graph bars) stability was determined by incubating the aptamers in serum or in DPBS containing 5 % serum for different periods of time (24 h, 4 h, 2 h, 1 h, 30 min, 10 min, or 0 h) at 37 °C, followed by measuring binding of aptamers to Jurkat cells (CD3 positive cells) by flow cytometry. Figures 32 B-C show the integrity of aptamers determined by agarose gel electrophoresis after incubating the aptamers in serum, in DPBS buffer containing 5 % serum or in RPMI medium containing 10 % serum for different periods of time (24 h, 4 h, 2 h, 1 h, 30 min, 10 min, or 0 h) at 37 °C.

Figure 33 shows results of binding of aptamers ARACD3 -3700006 and ARACD3- 0010209 obtained by the SEFEX procedure (Fig. 27) to peripheral blood mononuclear cells isolated from healthy donors. The binding was tested at the following aptamer concentrations: 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM.

Figures 34A-34B are bar graphs showing results of binding of aptamers ARACD3- 3700006 and ARACD3 -0010209 obtained by the SEFEX (Fig. 27) to mouse CD3 -positive EF4 cells to estimate binding saturation and KD. The binding was tested at the following aptamer concentrations: 3 nM, 10 nM, 30 nM, 100 nM, and 300 nM. For comparison, binding of the aptamers at a concentration of 300 nM to human Jurkat cells is also shown.

Figures 35A-35F are graphs showing activation of lymphocytes by anti-CD3 RNA aptamers at 1 pm concentration, as measured by secretion of cytokines. Fevels of secreted cytokines was determined by EFISA after incubating the aptamers in the presence of costimulatory anti-CD28 antibody in RPMI medium containing 10 % serum for different periods of time (0 h, 16 h, 24 h or 48 h) at 37 °C. Figures 35A, 35B, and 35C show secretion of IFN-g, IL-2, and TNF-a, respectively, by the aptamer ARACD3 -3700006. Figures 35D, 35E, and 35F show secretion of IENg, IL-2, and TNF-a, respectively, by the aptamer ARACD3-0010209. For comparison, activation of anti-CD3 monoclonal antibody with or without costimulatory anti-CD28 antibody is also shown.

Figures 36A-36C are bar graphs showing activation of human lymphocytes by anti- CD3 RNA aptamers at 1 pm concentration, as measured by expression of CD25 and CD69 activation markers. Levels of CD25 and CD69 surface markers on CD4- and CD8-positive T lymphocytes were determined by flow cytometry after incubating the aptamers with or without costimulatory anti-CD28 antibody in RPMI medium containing 10 % serum for 48 h at 37 °C. Figure 36A shows expression results obtained with cells treated with ARACD3 -3700006 or ARACD3-0010209 alone. Figure 36B shows expression results obtained with cellstreated with the same aptamers mixed with costimulatory anti-CD28 antibody. Figure 36C shows expression results obtained with cells treated with fresh aptamer solutions mixed with anti- CD28 antibody added to culture medium after 3 h, 19 h and 27 h incubation in order to keep the concentration of reagents constant.

Figures 37A-37C are bar graphs showing activation of human lymphocytes by anti- CD3 RNA aptamers at 1 pm concentration, as measured by secretion of cytokines. Levels of secreted cytokines were determined with Human Thl/Th2 Cytometric Bead Array after incubating the aptamers in presence of costimulatory anti-CD28 antibody in RPMI medium containing 10 % serum for 48 h at 37 °C. Figure 37 A shows secretion of IFN^y, IL-2, IL-4, IL- 5, IL-10 and TNF-a for cells treated with ARACD3 -3700006 or ARACD3-0010209 alone. Figure 37B shows cytokine secretion profile of cells treated with the same aptamers mixed with costimulatory anti-CD28 antibody. Figure 37C shows cytokine secretion profile of cells treated with fresh aptamer solutions mixed with anti-CD28 antibody added to culture medium after 3h, 19 h and 27 h incubation in order to keep the concentration of reagents constant.

Figures 38A-38F are bar graphs showing results of binding of aptamers ARACD3- 3700006 and ARACD3 -0010209 obtained by the SELEX procedure (Fig. 27) to Jurkat cells (CD3 positive cells) and antibodies specific for CD3 epitopes in presence of saturating concentrations of competitors in order to map regions of CD3 recognized by aptamers. In Figures 38 A, 38C and 38E binding of PE -labeled monoclonal OKT3, UCHT1 and HIT3a antibodies specific for CD3 was tested at one concentration (0.1 nM for OKT3 and HIT3a or 1 nM for UCHT1) and in absence or in presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a or 10 nM for UCHT1) or biotinylated aptamers (300 nM). In Figures 38B, 38D and 38F binding of biotinylated aptamers was tested at a concentration of 300 nM in absence or in presence of saturating concentrations of unlabeled antibodies (32 nM for OKT3 and HIT3a or 10 nM for UCHT1) and in presence of PE labeled streptavidin.

DETAILED DESCRIPTION

The present technology relates to anti-CD3 aptamers. Methods for isolating CD3- specific aptamers are disclosed, as well as various uses of the anti-CD3 aptamers including as targeting moieties for delivery vehicles for therapeutic agents directed to T cells and as components of pharmaceutical compositions.

Embodiments of the anti-CD3 aptamers of the present technology can be described using several consensus sequences. DNA aptamers can include the following consensus sequences or variants thereof:

1. GX₁X₂TX₃GX₄X₅X₆X₇X₈X₉GGX₁₀CTGG, wherein Xi is G or A; X₂ and X₆ are A,

T, or G; X3 is T, or G; X4 and X9 are G or C; X5 is C or T; X7 IS T, G, or C; and

Xs and X10 are C, T, or A (SEQ ID NO: 109).

2. GGGX₁TTGGCX₂X₃X₄GGGX₅CTGGC, wherein Xi and X₂ are A, T, or G; X is T,

C, or G; X₄ and X₅ are A, T, or C (SEQ ID NO : 1 10).

3. GX₁TTX₂GX₃X₄X₅X₆CX₇GGX₈CTGGX₉G, wherein Xi is A or G; X₂ is T or G; X and X7, X9 are G or C; X4 is T or C; X5 is A or T; Xe is T, C, or G; Xs is A or C

(SEQ ID NO: l l l).

4. GGGTTTGGCAXiCGGGCCTGGCG, wherein Xi is G, C, or T (SEQ ID NO: 112).

5. GCAGCGAUUCUXiGUUU, wherein Xi is U or no base (SEQ ID NOT 13).

Aptamers are DNA and RNA oligonucleotides having secondary and tertiary structures that impart high affinity and specific binding to a target molecule. Generation of aptamers using molecule capture technologies is known (see A. D. Ellington and J. W. Szostak. Nature 346: 818-822, 1990; and C. Tuerk and L. Gold. Science 249: 505-510, 1990). Aptamers can be used as targeting devices for delivery of molecular agents to specific target sites. Certain tumors are associated with specific antigens based on which tumor-binding aptamers may be designed to aid tumor targeting for diagnostic or therapeutic purposes.

Generally, aptamers are identified and isolated from pools of nucleic acid sequences using known methods. A pool of nucleic acid sequences is incubated with a target molecule, bound oligonucleotides are selected and, in the next step, amplified, e.g., by polymerase chain reaction (PCR). The product is further purified using affinity column composed of target molecules. The aptamer can comprise DNA, RNA or PNA, and the bases can be natural as well as non-natural. Natural bases are adenine (A), guanine (G), cytosine (C), thymine (T), inosine (I), and uracil (U). Non-naturally occurring bases include, for example, methylinosine, dihydrouridine, methylguanosine, thiouridine, 2’ -O-Methyl purines, 2’-fluoro pyrimidines and many others well known to those of ordinary skill in the art. PNA bases can include natural or non-natural bases attached to an amide (peptide-like backbone). The backbone of nucleic acid sequence can be an amide such as PNA, or a phosphodiester such as in DNA or RNA, a thiophosphodiester, a phosphorothioate, a methylene phosphorothioate, or a modification of these chemical structures.

The nucleic acid sequence of the aptamer can comprise only the target-binding sequences which can include both a constant and a variable region or only a variable region. Constant region sequences can be used to facilitate binding, amplification, replication or cleavage of the sequence.

Aptamers can be coupled to agents that are delivered to the target or target site for various purposes, e.g., detection, imaging, diagnostic, therapeutic, or prophylactic. The agents include cells, nanoparticles, hormones, vaccines, haptens, toxins, enzymes, immune system modulators, anti -oxidants, vitamins, functional agents of the hematopoietic system, proteins, such as streptavidin or avidin or mutations thereof, metals and other inorganic substances, virus particles, antigens such as amino acids, peptides, saccharides and polysaccharides, receptors, paramagnetic and fluorescent labels, pharmaceutical compounds, radioisotopes and radionuclides such as is 93P, 95mTc, 99Tm, 186Re, 188Re, 189Re, l l lln, 14C, 32P, 3H, 60C, 1251, 35S, 65Zn, 1241 and 226 Ra, and stable isotopes such as 3He, 6Li, 10B, 113Cd, 135Xe, 149Sm, 15 lEu, 155Gd, 174Hf, 199Hg, 235U, 241Pu, and 242Am.

Pharmaceutical compounds that can be coupled to aptamers include, for example, conventional chemotherapeutic agents, antibiotics, corticosteroids, mutagens (e.g., nitroureas), antimetabolites, and hormonal antagonists.

Macromolecules that can be coupled to an aptamer include mitogens, cytokines, and growth factors. Potentially useful cytokines include tumor necrosis factor (TNF), the interleukins (IL-1, IL-2, IL-3, etc.), the interferon proteins, IFN IFN-a, INF-b, and IFN-M, hormones including glucocorticoid hormones, cytosine arabinoside, and anti-virals such as acyclovir and gancyclovir.

An aptamer can be coupled to an agent using well-known methods, including chemical and biological techniques. Both covalent and non-covalent bonds can be created (C.-P. D. Tu et ah, Gene 10: 177-83, 1980; A. S. Boutorine et ah, Anal. Biochem. Bioconj. Chem. 1:350-56, 1990; S. L. Commerford Biochem, 10: 1993-99, 1971; D. J. Hnatowich et ah, J. Nucl. Med. 36:2306-14, 1995). Covalent bonds can be formed using, for example, chemical conjugation reactions, chelators, or bonds formed from phosphodiester linkages. Non-covalent bonds include molecular interactions such as those between streptavidin and biotin, hydrogen bonding, and other forms of ionic interaction. Exemplary chelators include DTPA, SEINE! and multidentate chelators such as N2S2 and N3S (A. R. Fritzberg et al., J. Nucl. Med. 23:592-98, 1982). Aptamers may also be bound to the cell surface or to a nanoparticle to guide the cell or the nanoparticle to a specific location in vitro or in vivo.

Aptamers are selected using an approach called the selective evolution of ligands by exponential enrichment (SELEX) process (Ellington et al, 1990; Tuerk et al., 1990). SELEX is a method for screening very large combinatorial libraries of oligonucleotides by a repetitive process of in vitro selection and amplification. The method involves selection from a mixture of candidates and stepwise iterations of structural improvement, using the same general selection theme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning (i.e., separating) unbound nucleic acids from those nucleic acids which have bound to target molecules, dissociating the nucleic acid-target pairs, amplifying the nucleic acids dissociated from the nucleic acid-target pairs to yield a ligand- enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired.

SELEX is based on the insight that within a nucleic acid mixture containing a large number of possible sequences and structures there is a wide range of binding affinities for a given target. A nucleic acid mixture comprising, for example a 20 -nucleotide randomized segment can have 420 candidate possibilities. Those which have the higher affinity constants for the target are most likely to bind. After partitioning, dissociation and amplification, a second nucleic acid mixture is generated, enriched for the higher binding affinity candidates. Additional rounds of selection progressively favor the best ligands until the resulting nucleic acid mixture is predominantly composed of only one or a few sequences. These can then be cloned, sequenced and individually tested for binding affinity as pure ligands.

Cycles of selection and amplification are repeated until a desired goal is achieved. In the most general case, selection/amplification is continued until no significant improvement in binding strength is achieved on repetition of the cycle. The iterative selection/amplification method is sensitive enough to allow isolation of a single sequence variant in a mixture containing at least 65,000 sequence variants. The method is even capable of isolating a small number of high affinity sequences in a mixture containing 10¹⁴ sequences. The method could, in principle, be used to sample as many as about 10¹⁸ different nucleic acid species. The nucleic acids of the test mixture preferably include a randomized sequence portion as well as conserved sequences necessary for efficient amplification. Nucleic acid sequence variants can be produced in a number of ways including synthesis of randomized nucleic acid sequences and size selection from randomly cleaved cellular nucleic acids. The variable sequence portion may contain fully or partially random sequence; it may also contain sub portions of conserved sequence incorporated with randomized sequence. Sequence variation in test nucleic acids can be introduced or increased by mutagenesis before or during the selection/amplification iterations.

In many cases, it is not necessarily desirable to perform the iterative steps of SELEX until a single nucleic acid ligand is identified. The target-specific nucleic acid ligand solution may include a family of nucleic acid structures or motifs that have a number of conserved sequences and a number of sequences which can be substituted or added without significantly affecting the affinity of the nucleic acid ligands to the target. By terminating the SELEX process prior to completion, it is possible to determine the sequence of a number of members of the nucleic acid ligand solution family, which will allow the determination of a comprehensive description of the nucleic acid ligand solution.

After a description of the nucleic acid ligand family has been resolved by SELEX, in certain cases it may be desirable to perform a further series of SELEX that is tailored by the information received during the SELEX experiment. For example, in a second series of SELEX, conserved regions of the nucleic acid ligand family may be fixed while all other positions in the ligand structure are randomized. In an alternate embodiment, the sequence of the most representative member of the nucleic acid ligand family may be used as the basis of a SELEX process wherein the original pool of nucleic acid sequences is not completely randomized but contains biases towards the best -known ligand. By these methods it is possible to optimize the SELEX process to arrive at the most preferred nucleic acid ligands.

The aptamers of invention can have any desired length. The aptamers may include at least about 15 oligonucleotides. Preferably, the aptamers may include up to about 80 nucleotides.

Modern techniques allow the identification or generation of aptamers with any desired equilibrium constant (KD). In some embodiments, the aptamer includes equilibrium constant (KD) of about 1 pM up to about 10.0 mM; about 1 pM up to about 1.0 mM; about 1 pM up to about 100 nM; about 100 pM up to about 10.0 mM; about 100 pM up to about 1.0 mM; about 100 pM up to about 100 nM; or about 1.0 nM up to about 10.0 mM; about 1.0 nM up to about 1.0 mM; about 1 nM up to about 200 nM; about 1.0 nM up to about 100 nM; about 500 nM up to about 10.0 mM; or about 500 nM up to about 1.0 mM.

The target molecule may include a small molecule, a protein, or a nucleic acid. For the aptamers described herein, target molecule is CD3 e/g and/or CD3 e/d proteins.

The aptamers of invention can be used in a pharmaceutical composition.

Definitions

Nucleic acid means DNA, RNA, XNA single -stranded or double -stranded and any chemical modifications thereof.

Aptamer (or ligand) means a nucleic acid that binds another molecule (target). In a population of candidate nucleic acids, an aptamer is one which binds with greater affinity than that of the bulk population. Among a plurality of candidate aptamer sequences there can exist more than one aptamer for a given target. The aptamers can differ from one another in their binding affinities for the target molecule.

A variant of a nucleic acid sequence, such as an aptamer sequence, can include sequences having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity as determined by a sequence identity algorithm, such as a BLAST algorithm. A variant can also include substitution of one or more bases by non- naturally occurring bases, or elimination of one or more bases, optionally with replacement of the nucleotide by a linker or a bond. A variant also can include a modified nucleic acid backbone, such as that found in peptide nucleic acids (PNA).

A plurality of candidate aptamer sequences is a plurality of nucleic acids of differing sequence, from which to select a desired aptamer. The source of candidate sequences can be from naturally-occurring nucleic acids or fragments thereof, chemically synthesized nucleic acids, enzymatically synthesized nucleic acids or nucleic acids made by a combination of the foregoing techniques.

Target molecule means any compound of interest for which a ligand is desired. A target molecule can be a protein, peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc., without limitation. A target can also be a cell expressing a desired protein to which the aptamers sought specifically bind. Aptamer selection using cells can be referred to as cell-SELEX (Chen C et ah, npj Precision Oncology (2017) 1- 37). Cell-SELEX uses living cell as target. Aptamers bind with living cell membrane proteins. The procedure of cell-SELEX includes positive selection and negative selection. For positive selection, single strand DNA or RNA library is incubated with target cells and the bound sequences are collected. The bound sequences are incubated with negative cell, and the unbound sequences are collected to be used for amplification, sequencing, and cloning. Aptamers are obtained after several alternate cycles. The present disclosure includes selection of anti-CD3 aptamers by incorporating use of live cells as target. CD3 positive Jurkat cells and CD3 negative Ramos cells were used for positive and negative selection, respectively.

Separation (or partitioning) means any process whereby ligands bound to target molecules, termed aptamer-target pairs or sequence -target complexes herein, can be separated from nucleic acids not bound to target molecules. Separation can be accomplished by various methods known in the art. Nucleic acid-protein pairs can be bound to nitrocellulose filters while unbound nucleic acids are not. Columns which specifically retain sequence -target complexes (or specifically retain bound aptamer complexed to an attached target) can be used for partitioning. Liquid-liquid partition can also be used as well as filtration gel retardation, and density gradient centrifugation. The choice of separation method will depend on properties of the target and of the sequence -target complexes and can be made according to principles and properties known to those of ordinary skill in the art.

Amplifying means any process or combination of process steps that increases the amount or number of copies of a molecule or class of molecules. Amplifying RNA molecules in the disclosed examples was carried out by a sequence of three reactions: making cDNA copies of selected RNAs, using polymerase chain reaction to increase the copy number of each cDNA, and transcribing the cDNA copies to obtain RNA molecules having the same sequences as the selected RNAs. Any reaction or combination of reactions known in the art can be used as appropriate, including direct DNA replication, direct RNA amplification and the like, as will be recognized by those skilled in the art. The amplification method should result in the proportions of the amplified mixture being essentially representative of the proportions of different sequences in the initial mixture.

Randomized is a term used to describe a segment of a nucleic acid having, in principle any possible sequence over a given length. Randomized sequences will be of various lengths, as desired, ranging from about eight to more than 100 nucleotides. The chemical or enzymatic reactions by which random sequence segments are made may not yield mathematically random sequences due unknown biases or nucleotide preferences that may exist. The term "randomized" is used instead of "random" to reflect the possibility of such deviations from non-ideality. In the techniques presently known, for example sequential chemical synthesis, large deviations are not known to occur. For short segments of 20 nucleotides or less, any minor bias that might exist would have negligible consequences. The longer the sequences of a single synthesis, the greater the effect of any bias.

A bias may be deliberately introduced into randomized sequence, for example, by altering the molar ratios of precursor nucleoside (or deoxynucleoside) triphosphates of the synthesis reaction. A deliberate bias may be desired, for example, to approximate the proportions of individual bases in a given organism, to affect secondary structure, or to influence melting pH or pH sensitivity. The sequences may be biased to contain a higher percentage of AT than CG base pairs, thus decreasing their melting pH.

EXAMPLES

Example 1 : Anti-CD3 DNA aptamers

Library and primers

Single -stranded DNA (ssDNA) library designed for the DNA aptamer selection was purchased from TriLink Biotechnologies. The library consisted of a 40 -nucleotide random region (N40) flanked with two constant regions: 5’-TAGGGAAGAGAAGGACATATGAT- (N40)-TTGACTAGTACATGACCACTTGA-3’ (SEQ ID NO: 114), which was used as a template for PCR amplification. The primers sequences for PCR reaction were: 5’- T AGGG A AG AG A AGG AC AT AT GAT -3’ (SEQ ID NO: l 15) (forward primer) and 5’biotin- TCAAGTGGTCATGTACTAGTCAA-3’ (SEQ ID NOT 16) (reverse primer). During selection, the library was amplified in Eppendorf Mastercycler Nexus using AmpliTaq Gold 360 polymerase kit (Applied Biosystems) according to manufacturer’s protocol. The following conditions were used: polymerase activation and initial denaturation at 95 °C for 10 min, denaturation at 95 °C for 30 s, annealing at 45 °C for 30 s (with increment of 0.2 °C for each PCR cycle), extension at 72 °C for 1.5 min and final extension at 72 °C for 7 min. The modification of reverse primer with biotin at the 5’ end allowed generation of a ssDNA library for each successive round of the selection from amplified double -stranded DNA (dsDNA) using streptavidin-coupled magnetic beads. Both primers were HPLC grade purified and purchased from Eurogentec.

DNA Aptamers selection

SELEX process consisted of six selection rounds and was performed on recombinant e chain of CD3 protein consisting in CD3 epsilon/gamma (CD3 e/g) and CD3 epsilon/delta (CD3 e/d) dimers purchased as C-terminal fusions with constant Fc domain of human Immunoglobulin Gl . Consequently, the Fc fragment of human Immunoglobulin G1 (IgGl Fc) was used for negative selection. All proteins were purchased from AcroBiosystems. Each round of selection included the following steps: counter selection, incubation of the ssDNA library with the target, PCR amplification of sequences that recognized the target and separation of dsDNA on streptavidin-modified magnetic beads. Prior to each cycle, ssDNA library (2.5 nmol for the initial cycle) was denatured at 95 °C for 5 min and then immediately cooled at 4 °C for 5 min in the selection (SELEX) buffer (20 mM HEPES, 150 mM NaCl, 5 mM KC1, 1 mM MgCh, and 1.5 mM CaCh, pH 7.2, DNase and RNase free purchased from Sigma -Aldrich) . To eliminate Fc domain specific sequences, ssDNA library was incubated with IgGl -Fc protein (0.5 nmol, 1 mM) at 37 °C for 90 min in a thermocycler (Eppendorf Mastercycler Nexus). The reaction mixture was then filtered through a nitrocellulose acetate membrane (0.45 pm HAWP membrane, 25 mm diameter, Millipore) which was inserted in a 25 mm diameter support filter holder from Millipore and washed with selection buffer. Prior to filtration, HAWP membranes were soaked in selection buffer for at least 30 min. After filtration, the membranes with attached IgGl -Fc/ssDNA complex and non-specific ssDNA sequences bound to the filter, was discarded. The filtrate containing unbound sequences was concentrated using 10 kDa AMICON Ultra-15 MWCO filters followed by incubation with the positive target. In the first cycle, aptamers were selected against the recombinant CD3 e/g (0.15 nmol, 0.3 mM) and CD3 e/d (0.15 nmol, 0.3 mM) domains in a volume of 500 pL at 37 °C for 120 min in a thermocycler. From the second round, CD3 e/g and CD3 e/d were used alternately in each cycle. The reaction mixture was then filtered through nitrocellulose acetate membrane. The filter was washed with 8 mL of selection buffer to remove all low-affinity and low- specificity sequences attached to the proteins. The ssDNA that bound to the proteins retained on the filter was eluted by incubating the membrane in 1 mL of 7 M urea at 75 °C for 5 min, twice. The recovered ssDNA solution was diluted two times in DNase and RNase free water (Invitrogen) and concentrated using 10 kDa AMICON Ultra -4 MWCO filters. The sequences were re-diluted in water and re -concentrated. The solution obtained was purified on Micro Bio- Spin P-6 columns (in SSC buffer, Bio-Rad) and precipitated in ethanol (HPLC grade, Fisher) and 3 M of sodium acetate pH 5.2 (Thermo Scientific, Waltham, MA, USA) in the presence of 5 pL of linear polyacrylamide (Invitrogen). After incubation at -25 °C for around 1 h, eluted ssDNA was centrifuged at 21000 g at 4 °C for 20 min. The supernatant was discarded, the pellet with ssDNA was diluted in 200 pL of DNase and RNase free water and left in air for 20 min to evaporate the ethanol. The selected ssDNA sequences were amplified in a PCR reaction (AmpliTaq Gold 360, Applied Biosystems) in the presence of un -modified forward primers and biotinylated reverse primers. The optimal number of PCR cycles was chosen individually for each round of the selection. For this purpose, the progress of the amplification was followed by migration of dsDNA samples obtained after various number of PCR cycles on an agarose gel (3 % with SYBRSafe in TBE buffer, Invitrogen). PCR reaction was stopped when the band corresponding to dsDNA appeared on the agarose gel. The PCR mixture with amplified dsDNA was then collected, diluted in water to obtain a final volume of 15 mL and concentrated using 10 kDa AMICON Ultra-15 MWCO membranes. An aliquot of the concentrated sample was stored at -20°C for sequencing analysis. In order to purify and generate ssDNA chains for the next cycle of the selection, the remaining sample was bound to the streptavidin coated magnetic beads (MyOne Streptavidin Dynabeads) through biotin present on the amplified dsDNA. Incubation was performed at room temperature for 18 min in binding buffer (1 M NaCl, 5 mM Tris, 0.5 mM EDTA pH 8.0, DNase and RNase free purchased from Sigma -Aldrich), according to manufacturer’s protocol. 3 mg of magnetic beads were used for 20 pg of dsDNA. Afterwards, magnetic beads with dsDNA were separated from solution and washed five times with binding buffer (double volume used for incubation) to eliminate any remaining non- specifically bound library species and PCR reaction residues. Separation of the DNA chains occurred by denaturation under basic conditions and was carried -out by incubation of modified beads in a solution of 50 mM NaOH (BioUltra from Sigma -Aldrich) for 3 min. As a result, biotinylated DNA chain remained attached to the magnetic beads and un -modified chain of interest was released to the solution and recovered. The obtained ssDNA was then diluted in water to a final volume of 4 mL and concentrated using a 10 kDa AMICON Ultra -4 MWCO to remove NaOH. The exchange to selection buffer was performed using Micro Bio-Spin columns (P-6; BioRad). The quality of recovered ssDNA library was analysed by migration on agarose gel (3% in TBE buffer) and the concentration was calculated using NanoDrop One (ThermoScientific, Waltham, MA, USA) by measuring the absorbance at 260 nm.

During successive rounds of the SELEX process, the stringency of the selection was gradually increased (see Table 1). For example, the concentration of the target and ssDNA library was decreased, incubation time with protein was reduced, volume of buffer for membranes washing after the selection was increased and for the last selection round non specific competitor (yeast total RNA, Sigma-Aldrich) was added. Table 1 : SELEX conditions used for each selection round of DNA aptamers

Round Counter selection Target Target ssDNA Membranes Incubation Competitor quantity quantity washing time (min) (tRNA)

_ (pmol) _ (pmol) _ (mL) _

1 l pM IgGI Fc CD3 e/g 150 + 150 200 8 120

+ CD3

e/d

2 0.5 mM IgGl Fc CD3 e/g 150 400 10 45

3 0.5 mM IgGl Fc CD3 e/d 125 400 10 30

4 0.5 mM IgGl Fc CD3 e/g 75 230 12 30

5 0.5 mM IgGl Fc CD3 e/d 50 230 13 25

6 0.5 mM IgGl Fc CD3 e/g 50 _ 180 _ 15 _ 20 _ 20 gg/mL

PCR aliquots obtained after each SELEX cycle as well as initial ssDNA library were analyzed by next generation sequencing using Illumina NextSeq MidOutput (150 cycle) system. This analysis was performed at the Genome Technology Center, New Y ork University. Data from high throughput sequencing was analyzed using Galaxy project web site. Based on the sequencing results, aptamer candidates were chosen for affinity and specificity test.

The nucleic acid sequences of these aptamers are shown in Figs. 1, 6 and 7A-7B. DNA aptamers with or without the flanking regions used in PCR amplification were obtained from Eurogentec Kaneka (Liege Belgium) as HPLC-RP purified single stranded oligos synthetized via standard solid phase phosphoramidite chemistry. Biotin was added to the 5’-end of aptamers as a Biotin-TEG that introduces a 16-atom mixed polarity spacer between the aptamer sequence and the biotin flag. For all aptamers, molecular weight, purity and integrity were verified by HPLC-MS by the manufacturer.

The same synthetic approach was followed in order to introduce mutations in the core sequence CELTIC_core and shown in Fig.17.5 and Fig.18. Abasic sites were created at various positions along the core sequence by incorporating C3 spacer arms during the solid phase synthesis. When required, further hexaethylene glycol (HEG) linkers were inserted between the 5’-end modifying functional groups and the first nucleotide the aptamers in 5’ position in order to minimize steric hindrance. Further modifications of the core sequence variants involved the addition of 3’-3’ deoxy -thymidine as a strategy to enhance resistance to nuclease degradation.

Finally, the 5’-ends of the aptamers were functionalized with primary amines via a C6 amino modifier added to terminal phosphates. Tetrazine functional groups were added as Tetrazine-PEG5-NHS esters via standard NHS/EDC chemistry, introducing a 16-atom mixed polarity spacer between the aptamer sequence and the tetrazine flag. Example 2: Anti-CD3 RNA aptamers

Library and primers

The initial RNA library template and primers were synthesized by IDT (Coralville, IA, USA) as ssDNA: 5’ -C CTCT CTAT GGGC AGTCGGT GAT -(N 20)-

TTTCTGCAGCGATTCTTGTTT -(N 10)-GGAGAATGAGGAACCCAGTGCAG-3’ , (SEQ ID NO: l 17), 5’-TAATACGACTCACTATAGGGCCTCTCTATGGGCAGTCGGTGAT-3’, (SEQ ID NO: 118) (forward primer), 5’-CTGCACTGGGTTCCTCATTCTCC-3’ (reverse primer) (SEQ ID NO: 119). Two short “blocking” sequences (purchased from IDT) complementary to the 5’- and 3’-constant primer regions were synthetized to minimize the effect of primers on secondary structure: 5’ -ATC AC CGACTGCCC AT AGAGAGG-3’ , (SEQ ID NO: 120) (forward blocking sequence), 5’-CTGCACTGGGTTCCTCATTCTCC-3\ (SEQ ID NO: 121) (reverse blocking sequence). An additional biotinylated“capture” sequence, complimentary to the constant center region of the library was also synthesized by IDT: 5’- Biotin-GTC-PEG-6 Spacer-CAAGAATCGCTGCAG-3’ (SEQ ID NO: 122). All materials were ordered at a 250 nmole scale and underwent desalting purification.

The RNA library for RNA aptamer selection was modified with 2’Fluoro- (2Έ-) pyrimidines for greater stability in the final application. T7 primer was combined with library template sequences for primer extension with Titanium Taq DNA polymerase (Clontech; Mountain View, CA, USA). Primer-extended material was then transcribed using the Durascribe® T7 Transcription Kit (Epicentre; Madison, WI, USA), purified on denaturing polyacrylamide with 8 M urea (Sequel NE Reagent, Part A and Part B), which was purchased from American Bioanalytical (Natick, MA, USA). During selection, the library was reverse transcribed using Superscript IV Reverse Transcriptase (Invitrogen; Carlsbad, CA, USA) according to manufacturer’ s protocol and amplified using T itanium T aq DNA polymerase from Clontech. During selection, the library was amplified using a following PCR protocol (10 seconds at 95°C, 30 seconds at 60°C, with initial HotStart activation of 60 seconds at 95°C). RNA library was then transcribed using the Durascribe® T7 Transcription Kit and purified on polyacrylamide gel (PAGE). Gel elution buffer for 4 °C overnight post -purification library recovery was prepared to 0.5 M NEUOAc, 1 mM EDTA (both purchased from Teknova), 0.2% SDS (purchased from Amresco), pH 7.4.

RNA aptamer selection RNA library screening was conducted with nine rounds ofthe selection using a Melting - Off approach. Rounds 1 -6 of the selection were performed on the recombinant e chain of CD3 protein as a target and with IgGl Fc fragment as a counter-target, by using the same material as for DNA aptamer selection. From seventh round, the screening was carried out on the Jurkat cells (Acute T Cell Leukemia Human Cell Line - ATCC TIB-152) that express CD3 protein and with Ramos cells (Burkitt’s Lymphoma Human Cell Line - ATCC CRL-1596) for the negative selection step (cell-SELEX). Cell lines were obtained from American Type Cell Collection and cultured in RPMI-1640 medium (Gibco Invitrogen), supplemented with 10 % FBS (Gibco Invitrogen) and 1 % Penicillin/Steptomycin (Gibco Invitrogen). All selections were performed in IX RPMI medium supplemented with 10 % serum matrix and each ofthe SELEX rounds included the following steps: immobilization of the RNA library on the streptavidin-coated magnetic beads, counter selection, incubation with the target, reverse transcription of sequences that recognized the target, PCR amplification, and transcription to RNA. Prior to each round, an aliquot of streptavidin-coated magnetic beads (MyOne Streptavidin T1 Dynabeads™, typically 1 pmole of biotinylated material is used with every 20 pg of Dynabead™, amount varied depending on the required stringency) was pre-washed three times with 200 pL PBS-T (final concentration of 0.01% Tween 20, pH 7.4) wash buffer. RNA library was refolded in IX RPMI medium without serum (1 -minute denaturing at 90°C, 5- minute annealing at 60°C, then 5 minutes at 23 °C) with twice the library molar amount of both primer-blocking sequences and the capture sequence. This was done to minimize the effects of the constant primer regions on the secondary structure of aptamers, to allow the library to be captured by the magnetic beads through a streptavi din-biotin binding interaction and to protect the ends of the aptamers from exonucleases. After refolding was completed, the library was captured on magnetic beads by incubation for 15 minutes at room temperature. Magnetic beads were then separated from solution and washed three times with 200 pL of the selection buffer at 37°C to eliminate any remaining PBS-T and non-specifically bound library species. Magnetic beads with immobilized RNA library underwent then a counter selection incubation in 200 pL of the counter-target preparation at 37 °C for 30 minutes which resulted in releasing the non-specific sequences from the magnetic beads. Non-specific library members were then discarded and the magnetic beads were washed six times for 7 min with 200 pL ofthe selection buffer. Positive selection consisted of the incubation of the magnetic beads RNA library with 200 pL of the positive preparation at 37 °C for 30 minutes. In the first cycle, aptamers were selected against the recombinant CD3 e/g and CD3 e/d domains (0.1 pM each) and from the second round, CD3 e/g and CD3 e/d were used alternately. In the sixth round, prior to selection against the cells, the library was split into two positive conditions (against CD3 e/g or CD3 e/d respectively) to ensure that a response could be observed against both recombinant proteins. The sixth-round positive libraries were then pooled together during recovery and followed by cell selections. For cell-SELEX rounds, target and counter-target cells were thawed, pelleted by centrifugation at 5,000 x g, and washed twice with the selection buffer, before being suspended in 200 pL of the selection buffer. The number of cells used for incubation was 15xl0⁶ for counter selection and lxl 0⁶ - 15xl0⁶ for positive selection. Once the positive selection was completed, the supernatant containing the sequences that recognized the target was separated from magnetic beads and recovered. The supernatant then underwent a second magnetic separation in order to ensure that the magnetic beads had been completely removed. For cell-SELEX rounds, the targeted Jurkat cells were pelleted by centrifugation at 5,000 x g after the second magnetic separation. The pelleted cells were washed once with 200 pL of the selection buffer to remove low-affinity and low-specificity aptamer species. Library was recovered from the cells by heat denaturation at 70 °C. Recovered library in all rounds underwent protein precipitation with MPC reagent (Lucigen Corp, Middleton, WI, USA), ethanol precipitation, and concentration of the sample, and were purified by 10 % denaturing PAGE with 8 M urea. The library was then reverse -transcribed using Superscript IV Reverse Transcriptase according to the manufacturer’s instructions, amplified using Titanium® Taq DNA polymerase, and transcribed using the Durascribe® T7 Transcription Kit according to the manufacturer’s instructions. Transcription products were then purified by 10 % denaturing polyacrylamide gel electrophoresis (PAGE) with 8 M urea. Gel slices were excised, eluted overnight at 4 °C in gel elution buffer, and the concentration of RNA library was calculated by measuring the absorbance at 260 nm on NanoDrop-1000.

During successive rounds of the SELEX process, the concentration of the RNA library was gradually decreased. Additional parallel assessments and“cross over fitness test” were performed to facilitate identification of good aptamer candidates during post-selection bioinformatic analysis.

Aptamer candidates were chosen by next generation sequencing using MiniSeq Mid Output (150 cycle) system (Illumina). Several aptamers were selected for further testing. For this purpose, 2’-Deoxy-2’-fluoro-thymidine-modified RNA aptamers were purchased from Integrated DNA Technologies (IDT, Coralville, USA). Biotin was added to the 5’-end of aptamers as a Biotin-TEG that introduces a 16-atom mixed polarity spacer between the aptamer sequence and the biotin flag. Molecular weight, purity and integrity were verified by HPLC- MS. The nucleic acid sequences of these aptamers are shown in Fig. 27. Example 3: Determination of the affinity and specificity of anti-CD3 DNA aptamers to CD3 protein expressed on the cells

The affinity and specificity of DNA aptamer candidates to CD3 protein expressed on the cells were evaluated by flow cytometry. These studies were performed on CD3 positive Jurkat (Acute T Cell Leukemia Human Cell Line - ATCC TIB-152), EL4 (Lymphoma Mouse Cell Line - ATCC CRL-2638) and CD3 negative Ramos (Burkitt’s Lymphoma Human Cell Line - ATCC CRL-1596) cells by incubation with biotinylated candidate aptamers in selection (SELEX) buffer, supplemented with 5 % of LBS. Cells were cultured in RPMI-1640 medium (Gibco Invitrogen), supplemented with 10% LBS (Gibco Invitrogen) and 1% Penicillin/ Steptomycin (Gibco Invitrogen) prior to use. Prior to experiment, Jurkat, EL4 and Ramos cells (2.5 ^c 10⁵ cells/well) were seeded in 96-well plates and centrifuged at 2500 rpm for 2 min. The supernatant was discarded, and the pelleted cells were washed twice with 200 pL of SELEX-5 % PBS buffer preheated at 37 °C. Each washing step was followed by centrifugation at 2500 rpm for 2 min. Candidate aptamers were denatured at 95 °C for 5 min and immediately placed on ice block of 4 °C for 5 min. Test samples were subsequently diluted at two different concentration ranges: 3, 10, 30 nM and 1, 2.5, 5, 7.5, 10 nM followed by addition of 100 nM phycoerythrin-labelled streptavidin (streptavidin-PE, eBioscience) to each solution. Lor incubation with EL4 cells, aptamers were additionally diluted to 100 and 300 nM. Jurkat, EL4 and Ramos cells were resuspended in the DNA dilutions (100 pL/well) and incubated at 37°C for 30 min in a 5 % CO2 humidified atmosphere. As controls, cells were incubated with CD3 monoclonal antibodies (PE-labelled, OKT3 human anti-CD3, Invitrogen), PE-streptavidin or the respective buffers without additional reagents. After incubation, cells were centrifuged at 2500 rpm for 2 min and the supernatant with unbound sequences was discarded.The pelleted cells were washed with SELEX-5 % FBS buffer (200 pL/well) and centrifuged twice in order to remove all weakly and non -specifically attached sequences. The cells were then washed with 1 mg/mL salmon sperm DNA solution (100 pL/well) at 37°C in a 5 % CO2 humidified atmosphere. After 30 min, the salmon sperm solution was removed by centrifugation at 2500 rpm for 2 min and the cells were additionally washed twice with SELEX- 5 % buffer (200 pL/well) followed by centrifugation. Jurkat, EL4 and Ramos cells with attached DNA sequences were then fixed (BD CellFIX solution #340181) and the fluorescence-positive cells were counted by flow cytometry (AttuneNXT; Invitrogen, Inc.) on the YL-1 channel.

The results of the binding studies are shown in Figures 2A-2E. Five aptamers, CELTIC l, CELTIC ls, CELTIC 2, CELTIC 3, and CELTIC 21 were analyzed. CELTIC ls differs from CELTIC l in that it lacks certain flanking region nucleotides. For comparison, binding of the aptamers to CD3 negative Ramos cells (Burkitt’s Lymphoma Human Cell Line - ATCC CRL-1596) was also measured. All aptamers show preferential binding to CD3 positive cells. CELTIC 3 showed saturation binding at 10 nM. It showed significant binding at 3 nM with much greater specificity. Based on these results, the apparent K_D of the binding of CELTIC 3 to Jurkat cells is between 3 nM and 10 nM. These aptamers were tested also at lower concentrations for binding to Jurkat cells, which confirmed preferential binding to Jurkat cells. See Figures 3 A-3E. In another cell binding assay, binding to cells of aptamers CELTIC 2, CELTIC 3, and CELTIC 21 was compared to the binding of their shorter versions CELTIC_2s, CELTIC_3s, and CELTIC_21s to cells. The improvement of the aptamers’ specificity was observed when flanking regions were removed. See Figs. 5A- 5F. In yet another cell binding assay, binding of aptamers CELTIC_4s, CELTIC_5s, CELTIC_6s, CELTIC_9s, CELTIC ls, CELTIC_19s, and CELTIC_21s to cells was measured, showing higher specificity to Jurkat then Ramos cells. The binding was tested at aptamer concentrations 3 nM, 10 nM, and 30 nM. See Figs. 8A to 8G. A comparison of the results of binding of all the aptamers to Jurkat and Ramos cells at concentrations 3 nM and 10 nM is shown in Figs. 9A and 9B, respectively. In a further cell binding assay, binding of aptamers CELTIC ls, CELTIC_4s, CELTIC_9s, and CELTIC_19s to mouse EL4 cells was evaluated. The results of the binding studies are shown in Figures 13A-13D. The dose- dependent staining of cells obtained in this assay suggests that these aptamers are cross-specific and recognize both human and murine CD3 protein.

The same experimental set-up was used to evaluate the binding affinity and specificity of aptamer CELTIC core corresponding to the computed conserved motif found among top 45 sequence families isolated during SELEX (Fig. 7C). As shown in Figure 17.4, the shortening of aptamers down to the strictly conserved 21 nucleotides resulted in a highly improved recognition specificity for CD3 receptor. For each tested concentration, signal on CD3 -positive Jurkat cells was measured when it was negligible on CD3 -negative Ramos cells. This gain in specificity was achieved at the expense of affinity as apparent K_D observed in this experiment was above 50 nM when parental sequences such as CELTIC ls, CELTIC_4s, CELTIC_9s, and CELTIC_19s reached saturation of the signal above 10 nM.

Because this conserved motif exhibits GGG/C repeats that define a so-called“G- quadruplex” organization, we designed a set of mutants to eventually confirm the importance of the G residues in the predicted conformation, to identify the key positions involved in binding specificity and affinity, and to introduce mutations that may improve aptamer properties. Several sequence variants CELTIC core l to CELTIC_core_13 (Fig. 17.5) were synthetized and tested on Jurkat and Ramos cells at concentrations of 50 and 100 nM as previously described. As comparison, unmodified core sequence CELTIC_core (50 and 100 nM) and full length CD3_CELTIC_ls (10 and 50 nM) were included in these analyses. Results disclosed in Fig. 17.6.A to 17.6.N indicate that each modification had a significant and unpredictable impact on the biological activity of the aptamers: adding GC or G at the 3’end of the conserved motif (CELTIC core l or CELTIC_core_4) resulted in loss of specificity. Some mutations disrupted the interaction with CD3 receptor (CELTIC_core_2, CELTIC_core_5, CELTIC_core_6 and CELTIC_core_13). Loss of binding also occurred when G/C nucleotides at some positions were replaced by abasic sites (CELTIC_core_7 to CELTIC core l 1) while the creation of an abasic site at position 16 yielded an aptamer with a better affinity but reduced specificity.

The addition of a TTT triplet at the 5’-end (CELTIC core T) had no impact on the binding properties of the core sequence indicating that it was possible to introduce some space between the biotine label and the aptamer without any steric hindrance. This observation prompted us to evaluate further sequence variants all carrying HEG linkers at the 5’-end that introduce a longer Cl 8 spacer. Sequence variants CELTIC_core_14 to CELTIC_core_44 were synthetized (Fig.18) and tested on Jurkat and Ramos cells at concentrations of 50 and 100 nM as previously described (Fig.19A-D). As comparison, unmodified core sequence CELTIC core (50 and 100 nM) and full length CD3 CELTIC Is and CD3_CELTIC_19s (10 and 50 nM) were included in these analyses. For most of positions an abasic site or base substitution disrupted the binding to CD3 receptor expressed the surface of Jurkat cells. Removal of nucleosides at positions 10 and 12 reduced the affinity (CELTIC_core_23 and CELTIC_core_25) whereas the same modification at positions 11 (CELTIC_core_24) or 16 (CELTIC_core_29) that are not part of the GGG/C triplets that define the“G-quadruplex" architecture yielded aptamers with equal or improved affinities and specificities respectively. Unexpectedly, substitution of the original C at position 16 by a G reduced the affinity of the aptamer (CELTIC_core_39) when an A had no impact (CELTIC_core_38) and a T translated into an improved affinity and specificity (CELTIC_core_40). Simultaneous modifications of positions 11 and 16 caused a gain in affinity and specificity (CELTIC_core_42) or an affinity loss (CELTIC_core_44). All together these results from conformation-function studies and summarized in Figure 20 suggest that improved versions of the core sequence can be empirically engineered by substituting and introducing abasic sites at positions located outside of the GGG/C triplets that form the“G-quadruplex" structure. Example 4: Determination of the affinity and specificity of anti-CD3 RNA aptamers to CD3 protein expressed on the cells

Anti-CD3 RNA aptamers were evaluated for binding to Jurkat and EL4 cells to determine their apparent K_D of binding. The binding was carried out generally as described in Example 3 except that instead of the SELEX buffer DPBS was used. The aptamers were used at three concentrations, 30 nM, 100 nM, and 300 nM. For incubations with EL4 cells aptamers were also diluted to 3 nM and 10 nM. The results of the binding studies are shown in Figures 30A-E. Five aptamers, ARACD3-3700006, ARACD3-0010209, ARACD3 -3130001, ARACD3-2980001, and ARACD3-0270039 were analyzed. Binding of the aptamers to CD3 negative Ramos cells (control) was also measured for evaluating specificity of the aptamers. In yet another cell binding assay, binding of aptamers ARACD3 -3700006 and ARACD3- 0010209 to mouse EL4 cells was evaluated. The results of the binding studies are shown in Figures 34A-B. The dose-dependent staining of cells obtained in this assay suggests that these aptamers are cross-specific and recognize both human and murine CD3 protein.

Example 5: Binding of anti-CD3 DNA aptamers as measured by surface plasmon resonance

Binding affinity measurements were performed using a BIAcore T200 instrument (GE Healthcare). To analyze interactions between aptamers and CD3 proteins, 1000 Resonance Units of biotinylated aptamers were immobilized on Series S Sensor chips SA (GE Healthcare) according to manufacturer’s instructions (GE Healthcare). SELEX buffer was used as the running buffer. The interactions were measured in the“Single Kinetics Cycle” mode at a flow rate of 30 mΐ/min and by injecting different concentrations of human CD3 e/g, CD3 e/d, IgGl Fc and mouse CD3 e/d (Sino Biological). The highest protein concentration used was 100 nM. Other concentrations were obtained by 3 -fold dilution. All kinetic data of the interaction were evaluated using the BIAcore T200 evaluation software. Examples of binding profiles obtained from these measurements are shown in Figs. 4A-4C. Table 3 below provides a summary of K_D values obtained from surface plasmon resonance measurements.

Table 3: K_D values determined by surface plasmon resonance for the first 5 anti-CD3 DNA aptamers

_ Aptamer _ Human (R3e/g Human (R3e/d _ Human Fc IgG _ Murine

CELTIC_CD3_1 . . . .

CELTIC_CD3_1 s 5 nM 3.7 nM 56.3 mM 297.6 nM

CELTIC_CD3_2 . . . .

CELTIC_CD3_3 65.4 nM 86.5 nM 57.2 nM 237 nM

CELTIC CD3 21 _ 43 6 nM _ 62 2 nM _ 58 9 nM _ 136 5 nM Comparison of KD values for binding to human and murine CD3 e/d shows that the aptamers bind also to murine CD3 e/d but with lesser affinity. Further, it was observed that compared to the aptamer CELTIC l (CD3-1 in Table 1), CELTIC ls (CD3-ls) bound to the CD3 proteins more strongly. Table 4 below provides a summary of KD values obtained from another set of surface plasmon resonance measurements. It includes KD values of the first five aptamers with and without flanking regions .

Table 4: KD values determined by surface plasmon resonance for the first 5 anti-CD3 DNA aptamers with or without (“s”) flanking regions. From the recorded sensorgrams, data were computed with the steady-state analysis mode.

Aptamer Human (R3e/g Human CD3E/5 Human Fc IgG Murine CD3e/5

CELTIC_CD3_1 NA NA NA NA

CELTIC_CD3_ls 53 nM 125 nM NA 142 nM

CELTIC_CD3_2 NA NA NA NA

CELTTC_CD3_2s 627 nM 260 nM NA 237 nM

CELTTC_CD3_3 65.4 nM 86.5 nM NA 237 nM

CELTIC_CD3_3s 156 nM 409 nM NA 109 nM

CELTIC_CD3_21 56.4 nM 49.8 nM NA 313 nM

CELTIC CD3 21s 155 nM 405 nM NA 104 nM

Tables 5 and 6 below provide a summary of K_D values of a few more aptamers. While the K_D values listed in Tables 4 and 5 were obtained by performing measurements in a steady state analysis mode, those in Tables 3 and 6 were obtained by measurements performed in a kinetic analysis mode.

Table 5: K_D values determined by surface plasmon resonance for the different anti-CD3 DNA aptamers without flanking regions. From the recorded sensorgrams, data were computed with the steady-state analysis mode.

Aptamer Human (Ό3e/g Human (Ό3e/d Human Fc IgG Murine CD3e/6

CELTTC_CD3_ls 53 nM 125 nM NA 142 nM

CELTIC_CD3_21 56.4 nM 49.8 nM NA 313 nM

CELTTC_CD3_2s 627 nM 260 nM NA 237 nM

CELTTC_CD3_3s 156 nM 409 nM NA 109 nM

CELTTC_CD3_4s 117 nM 144 nM NA 189 nM

CELTIC_CD3_5s 182 nM 120 nM NA 151 nM

CELTIC_CD3_6s 287 nM 168 nM NA 630 nM

CELTIC_CD3_9s 47.3 nM 60.5 nM NA 216 nM

CELTIC_CD3_1 Is 94 nM 138 nM NA 122 nM

CELTIC_CD3_19s 104 nM 150 nM NA 107 nM

CELTIC CD3 2 Is 155 nM 405 nM NA 104 nM

CELTIC CD3 22 162 nM 164 nM NA 153 nM Table 6: KD values determined by surface plasmon resonance for the different anti-CD3 DNA aptamers without flanking regions. From the recorded sensorgrams, data were computed with the kinetic analysis mode.

Aptamer Human (R3e/g Human CD3e/5 Human Fc IgG Murine (R3e/d

CELTIC_CD3_ls 5.2 nM 9.9 nM NA 3.2 pM*

CELTIC_CD3_21 2.8 nM 3.4 nM NA 0.01 nM* CELTIC_CD3_2s 65.2 nM 3.2 mM NA 6.3 nM

CELTIC_CD3_3s 0.01 nM* 41.1 nM NA 0.01 nM* CELTIC_CD3_4s 4.1 nM 3.4 nM NA 0.01 nM* CELTIC_CD3_5s 3.2 pM* 3.2 pM* NA 0.2 nM*

CELTIC_CD3_6s 0.02 nM* 29.3 pM* NA 0.01 nM* CELTIC_CD3_9s 3.8 nM 3.7 nM NA 0.01 nM* CELTIC_CD3_1 Is 3.9 nM 3.2 nM NA 0.2 nM*

CELTIC_CD3_19s 9.5 pM 8.2 nM NA 11.9 nM

CELTIC_CD3_2 Is 2.1 pM* 23.3 nM NA 42.3 pM*

CELTIC CD3 22 2.3 nM 2.7 nM NA 3.4 nM

Example 6: Binding of anti-CD3 RNA aptamers as measured by surface plasmon resonance

Binding of anti-CD3 RNA aptamers to each of purified recombinant human CD3 e/g and CD3 e/d proteins was measured using surface plasmon resonance. Binding studies were performed generally as described in Example 5 except that SELEX buffer was replaced by DPBS. The highest protein concentration used was 300 nM. Other concentrations were obtained by 3 -fold dilution. Binding to hlgGl Fc was used as control. Binding to murine CD3 e/d (mCD3 e/d) was also measured. The results of these studies are shown in Table 7 below. Table 7: K_D values determined by surface plasmon resonance for the different anti-CD3 RNA aptamers. From the recorded sensorgrams, data were computed with the kinetic analysis mode.

Aptamer Human CD3s/y Human CD3e/8 Human Fc IgG Murine CD3s/6

ARACD3-370006 21 nM 75 nM NA 24.2 nM

ARACD3-0010209 20.6 nM 22 nM NA ND

ARACD3-3130001 332 nM NA NA ND

ARACD3-2980001 231 nM 239 nM NA 26.5 nM

ARACD3-0270039 150 nM 189 nM NA 17.7 nM

ND not determined.

The binding profiles of aptamers ARACD3 -3700006, ARACD3 -0010209, and ARACD3 -3130001 are shown in Figs. 31A-32C. Example 7: T cell activation by anti-CD3 DNA aptamers

For measuring T cell activation by anti-CD3 DNA aptamers, the aptamers were used at 1 mM concentration together with CD28 co -stimulation of T cells. Cytokines secreted by the cells in response to the activation were measured by ELISA and Human Thl/Th2 Cytometric Bead Array (CBA). Expression of CD25 and CD69 activation markers at the surface of T cells was measured by flow cytometry. The results obtained are shown in Figs. 14A-14L, 15A-15C and 16A-16C respectively.

T cell activation assays were carried out on peripheral blood mononuclear cells (PBMCs). Freshly prepared PBMCs were isolated from buffy coats obtained from healthy donors (Etablissement Francais du Sang, Division Rhones-Alpes). After diluting the blood with DPBS, the PBMCs were separated over a FICOLL density gradient (FICOLL-PAQUE PREMIUM 1.084 GE Healthcare), washed twice with DPBS, resuspended to obtain the desired cell density and cultured in RP MI-1640 medium (Gibco Invitrogen), supplemented with 10 % FBS (Gibco Invitrogen) and 1 % Penicillin/ Steptomycin (Gibco Invitrogen) at 37 °C, 5 % CO2.

Before evaluating the T cell activation properties, the binding of anti-CD3 DNA aptamers to human PBMCs was first verified by flow cytometry as described in Example 3 except that SELEX buffer was replaced by RPMI-1640 medium supplemented with 10 % FBS and 1 % Penicillin/Steptomycin. Four aptamers, CELTIC ls, CELTIC_4s, CELTIC_9s, and CELTIC_19s were used at concentration of 3 nM, 10 nM, 30 nM, 100 nM and 300 nM. The results of the binding studies are shown in Figure 12.

PBMCs activation assays were carried out on four aptamers, CELTIC ls, CELTIC_4s, CELTIC l ls, and CELTIC_19s with or without anti-CD28 monoclonal antibodies (Invitrogen) as co -stimulatory agent. A third condition with addition of fresh aptamer solution in presence of anti-CD28 mAb after 3 h, 19 h and 27 h was included to keep the concentration of reagents constant. Prior to experiment, PBMCs were seeded in 24-well plates at a density of 2.5 x 10⁵ cells per well in 400 pL of RPMI medium containing 10 % FBS and 1 % penicillin/streptomycin and incubated for 4 h at 37 °C, 5 % CO2. Candidate aptamers were denatured at 95 °C for 5 min and immediately placed on ice block of 4 °C for 5 min. After sampling 100 pL of supernatant (cytokine basal level condition), 100 pL of the stimulation solutions containing 1 pM DNA aptamers and 0.5 pg/mL CD28 mAb diluted in RPMI was added to the wells. Cells were incubated at 37 °C, 5 % CO2 for 16, 24 or 48 h. Alternatively, PBMCs were incubated with 100 pL of a mix containing 2 pg/mL CD3 mAb and 5 pg/mL CD28 mAb (Invitrogen), a solution containing 2 pg/mL CD3 mAb or RPMI medium without reagents (negative control). The samples were then centrifuged at 320 g for 5 min and the supernatant was recovered. PBMC activation was assessed by measuring the levels of secreted Interleukin 2 (IL-2), Tumor Necrosis Factor alpha (TNF-a), and Interferon gamma (IFN-g) in culture supernatants collected at different intervals. Sandwich ELISAs (DUO SET ELISA R&D Systems) were used for the measurements. 100 pL of undiluted samples or cytokine standards were added to each well previously coated overnight with a capture antibody. IL-2, TNF-a, or IFN-g cytokine binding was detected with biotinylated detection antibodies revealed with a streptavidin-HRP conjugate and TMB substrate. Following the addition of stop solution, the ELISA plates were read at 450 nm on a VARIOSCAN LUX plate reader and the levels of cytokines determined against a reference standard curve. The results obtained are shown in Figs. 14A-14L. Levels of secreted Interleukin 2 (IL-2), Interleukin 4 (IL-4), Interleukin 5 (IL- 5), Interleukin 10 (IL-10), Tumor Necrosis Factor alpha (TNF-a) and Interferon gamma (IFN- g) in culture supernatants collected after 48 h were measured with Human Thl/Th2 Cytometric Bead Array (CBA) (Becton Dickinson Biosciences) according to manufacturer’s instructions. The results obtained are shown in Figs. 16A-16C.

Finally, activation of PBMCs was evaluated by analysing the expression of CD25 and CD69 activation markers at the surface ofCD4- and CD8 -positive T cells. After 48 h incubation in presence of the different test conditions and collection of culture supernatants for ELISA and CBA analysis, PBMCs were transferred into 96-well plates and centrifuged at 2500 rpm for 2 min. The supernatant was discarded, and the pelleted cells were washed twice with 200 pL of DPBS-0.2 % BSA. Each washing step was followed by centrifugation at 2500 rpm for 2 min. Cells were then incubated with anti-CD4, anti-CD8, anti-CD25 and anti-CD69 monoclonal antibodies (Miltenyi) diluted in DPBS-0.2 % BSA (1 pl/test). After 10 min incubation at 4 °C, cells were centrifuged at 2500 rpm for 2 min and washed twice with DPBS- 0.2 % BSA (200 pL/well). Cells were fixed with CellFix solution (BD Biosciences) and the fluorescence-positive cells were counted by flow cytometry (AttuneNXT; Invitrogen, Inc.) on BL3 (anti-CD4-PerCP-Vio700), YL1 (CD69-PE), YL2 (CD8-PE-Vio-615) and YL4 (CD25- PE-Vio770) channels. The results obtained are shown in Figs. 15A-15C.

Cells treated with anti-CD3 monoclonal antibodies combined with or without anti- CD28 monoclonal antibodies exhibited an increased secretion all measured cytokines except IL-5 and upregulation of surface expression of CD25 and CD69 activation markers. None of the tested aptamers was able to activate cytokine secretion of surface marker expression even when combined with costimulatory anti-CD28 antibody. Keeping aptamers concentrations constant by adding fresh solutions in a repeated manner to compensate for degradation in serum did not result in a more sustained activation profile. Example 8: T cell activation by anti-CD3 RNA aptamers

T cell activation by anti-CD3 RNA aptamers was measured by incubating cells with aptamer at 1 mM concentration together with CD28 co -stimulation using the procedures described in Example 7. Cytokines secreted by the cells in response to the activation was measured by ELISA and Human Thl/Th2 Cytometric Bead Array. Expression of CD25 and CD69 activation markers at the surface of T cells was measured by flow cytometry. The results obtained are shown in Figs. 35A-F, 37A-C and 36A-C respectively.

As already observed in Example 7, cells treated with anti-CD3 monoclonal antibodies combined with or without anti-CD28 monoclonal antibodies exhibited an increased secretion all measured cytokines except IL-5 and upregulation of surface expression of CD25 and CD69 activation markers. None of the tested aptamers was able to activate cytokine secretion of surface marker expression even when combined with costimulatory anti-CD28 antibody. Keeping aptamers concentrations constant by adding fresh solutions in a repeated manner to compensate for degradation in serum did not result in a more sustained activation profde.

Example 9: Functional stability of anti-CD3 DNA aptamers

Stability of anti-CD3 DNA aptamers (CELTIC_ls, CELTIC_4s, CELTIC_9s, CELTIC l ls, CELTIC_19s and CELTIC_22s) was measured in SELEX buffer containing 5 % FBS or the FBS alone. Biotinylated aptamers were denatured at 95 °C for 5 min and then immediately cooled on ice block to 4 °C for 5 min. The sequences were then diluted to a final concentration of 2 mM in SELEX buffer supplemented with 5 % of FBS or in pure FBS. Samples were incubated at 37° C for 10 min, 30 min, 1 h, 2 h, 4 h or 24 h; the control samples contained the freshly prepared aptamers without incubation at 37 °C. 100 nM streptavidin-PE was then added to each solution and aptamers were incubated with positives CD3 Jurkat cells as previously described. The half-life of aptamers in SELEX buffer containing 5 % FBS or in pure FBS was then determined using flow cytometry on the YL-1 channel, based on the variation of the fluorescence-positives cells number as a function of the incubation time at 37 °C. The results of the measurements are shown in Figs. 11A and 11B. All the aptamers incubated in SELEX buffer containing 5% serum were stable, even when incubated for 24 h. Dilution of DNA aptamers in pure FBS shows gradual degradation of the sequences from 2 h of incubation at 37°C. Example 10: Functional stability ofanti-CD3 RNA aptamers

Stability of aptamers ARACD3 -3700006 and ARACD3 -0010209 was measured in Dulbecco's phosphate-buffered saline (DPBS) containing 5 % FBS or the FBS alone. The procedure described in Example 9 was used except that denaturation was carried out at 85 °C. The results of the measurements are shown in Fig. 32-A. Both aptamers incubated in DPBS containing 5 % serum were stable, even when incubated for 24 h. When incubated in pure serum half of the binding activity was lost after 30 min.

Example 11 : Serum stability of anti-CD3 DNA aptamers using gel electrophoresis

Stability of anti-CD3 DNA aptamers (CEFTIC_ls, CEFTIC_4s, CEFTIC_l ls, CEFTIC_19s) was studied in selection (SEFEX) buffer containing 5 % fetal bovine serum (FBS), RPMI medium containing 10 % FBS or pure FBS. Aptamers were denatured at 95°C for 5 min and then immediately cooled on ice block to 4 °C for 5 min. The sequences were then diluted to a final concentration of 2 mM in SEFEX buffer supplemented with 5 % of FBS, RPMI medium supplemented with 10 % FBS or in pure FBS serum. Samples were incubated at 37 °C for 10 min, 30 min, 1 h, 2 h, 4 h or 24 h; the control samples contained the freshly prepared aptamers without incubation at 37°C. Half-life of aptamers in their respective buffers was then determined by migration on agarose gel using electrophoresis method as follows: aptamer sample from different incubation times were mixed with loading buffer (ThermoScientific, Waltham, MA, USA) and 15 pF of each sample was placed on freshly prepared 3 % agarose gel containing SYBRsafe (Invitrogen) as a DNA stain marker. The migration of DNA aptamers on agarose gel was performed in IX TBE buffer (Invitrogen) by applying 100 V during 20 min. The gels were visualized using Bio-Rad imaging system and the results are shown in Figs. 10A-10D. All tested aptamers were stable in SEFEX-5% FBS buffer for at least 24 h. Incubation in RPMI medium containing 10 % FBS caused degradation of CEFTIC_4s and CEFTIC l ls after 24 h at 37°C. However, dilution of DNA aptamers in pure serum resulted in a decrease of the intensity after 1 h of incubation. These results are in perfect agreement with stabilities reported with flow cytometry in Example 9.

Example 12: Serum stability of anti-CD3 RNA aptamers using gel electrophoresis

Stability ofanti-CD3 RNA aptamers (ARACD3 -3700006 and ARACD3 -0010209) was studied in DPBS buffer containing 5 % FBS, RPMI medium containing 10 % FBS or pure FBS. Aptamers were denatured at 85 °C for 5 min and then immediately cooled on ice block to 4 °C for 5 min. The sequences were then diluted to a final concentration of 2 pM in DPBS buffer supplemented with 5 % of FBS, RPMI medium supplemented with 10 % FBS or in pure FBS serum. Samples were incubated at 37 °C for 10 min, 30 min, 1 h, 2 h, 4 h or 24 h; the control samples contained the freshly prepared aptamers without incubation at 37°C. Half-life of aptamers in their respective buffers was then determined by migration on agarose gel using denaturing electrophoresis method as follows: aptamer sample from different incubation times were mixed with formamide -containing loading buffer (ThermoScientific, Waltham, MA, USA) and after denaturation at 85°C for 5 min, 15 pL of each sample was placed on freshly prepared 3 % agarose gel containing SYBRsafe (Invitrogen) as a RNA stain marker. The migration of RNA aptamers on agarose gel was performed in IX TBE buffer (Invitrogen) by applying 100 V during 20 min. The gels were visualized using Bio-Rad imaging system and the results are shown in Figs. 32B-C. Both aptamers were stable in DPBS-5% FBS and RPMI- 10% FBS for at least 4 h. Incubation of RNA aptamers in pure serum resulted in a decrease of the intensity after 30 min. These results are in perfect agreement with stabilities reported with flow cytometry in Example 10.

Example 13: Epitope mapping of anti-CD3 DNA aptamers by competition binding assay with anti-CD3 monoclonal antibodies

In order to gather more information on the region recognized by CELTIC ls, CELTIC_4s, CELTIC l Is, CELTIC_19s aptamers, competition binding assays with reference monoclonal antibodies were performed on CD3 -positive Jurkat cells essentially as already described in Example 3 but with the following changes.

Jurkat cells were incubated with PE -labelled monoclonal antibody (OKT3-PE - 0.1 nM; UCHT1-PE - 1 nM or HIT3a-PE - 0.1 nM - all purchased from ThermoScientific, Waltham, MA, USA) for 30 min at 37 °C in presence of an excess of various competitors (unlabeled OKT3 - 32 nM; unlabeled UCHT1 - 10 nM; unlabeled HIT3a - 32 nM - all purchased from ThermoScientific, Waltham, MA, USA and aptamers -300 nM). Binding of the labelled anti- CD3 monoclonal antibodies on cells was then evaluated by flow cytometry.

In a reverse experimental setting, Jurkat cells were incubated with CELTIC ls, CELTIC_4s, CELTIC l Is, CELTIC_19s DNA aptamers (fixed concentration of 300 nM) with or without a saturating concentration of unlabeled monoclonal antibodies (OKT3 - 32 nM; UCHT1 - 10 nM; unlabeled HIT3a - 32 nM). Binding ofthe biotinylated aptamers on cells was then evaluated by flow cytometry after detection with Streptavidin-PE.

Binding results of PE-labelled anti-CD3 monoclonal antibodies with or without saturating concentrations of competitors are shown in Figures 17.1. A, 17.2.A and 17.3. A. For each of tested antibodies, using an excess of its unlabeled form inhibited or completely abolished the binding of its PE-labeled version which validated the experimental conditions. Maximal signal was measured when aptamers were used as competitors suggesting that tested candidates failed to interfere with the binding of the three reference antibodies.

Binding results of anti-CD3 aptamers with or without saturating concentrations of monoclonal antibodies are shown in Figures 17.1.B, 17.2. B and 17.3.B. Similar signals were measured when aptamers were incubated with and without competitors suggesting that antibodies failed to interfere with the binding of tested sequences.

The lack of competition seen between anti-CD3 aptamers and the tested reference monoclonal antibodies suggests that the regions of human CD3 receptor targeted by aptamers differ from OKT3, HIT3a and UCHT1 epitopes. OKT3 and UCHT1 antibodies have been reported to activate T lymphocytes upon binding. The recognition of alternative CD3 epitopes by CELTIC ls, CELTIC_4s, CELTIC l ls, CELTIC_19s is in line with the absence of activating properties observed on human PBMCs in Example 7.

Example 14: Epitope mapping ofanti-CD3 RNA aptamers by competition binding assay with anti-CD3 monoclonal antibodies

In order to gather more information on the region recognized by ARACD3-3700006 and ARACD3 -0010209 aptamers, competition binding assays with reference monoclonal antibodies were performed on CD3 -positive Jurkat cells essentially as already described in Example 13 except that DPBS-5 % FCS was used instead of SELEX buffer -5 % FCS.

Binding results of PE-labelled anti-CD3 monoclonal antibodies with or without saturating concentrations of competitors are shown in Figures 38 -A, 38-C and 38-E

For each of tested antibodies, using an excess of its unlabeled form inhibited or completely abolished the binding of its PE -labeled version which validated the experimental conditions. Maximal signal was measured when aptamers were used as competitors suggesting that tested candidates failed to interfere with the binding of the three reference antibodies.

Binding results of anti-CD3 aptamers with or without saturating concentrations of monoclonal antibodies are shown in Figures 38.B, 38-D and 38-F. Similar signals were measured when aptamers were incubated with and without competitors suggesting that antibodies failed to interfere with the binding of tested sequences.

The lack of competition seen between anti-CD3 aptamers and the tested reference monoclonal antibodies suggests that the regions of human CD3 receptor targeted by aptamers differ from OKT3, HIT3a and UCHT1 epitopes. OKT3 and UCHT1 antibodies have been reported to activate T lymphocytes upon binding. The recognition of alternative CD3 epitopes by ARACD3 -3700006 and ARACD3 -0010209 is in line with the absence of activating properties observed on human PBMCs in Example 8.

Example 15 : Engineering of stability -improved anti-CD3 DNA aptamers derived from the core sequence

Based on the results obtained in binding studies performed on CD3 -positive and CD3- negative cells and described in Example 3, a short list of sequence-optimized anti-CD3 aptamers derived from the core sequence and with improved apparent affinity and target specificity was selected in order to further investigate their stability in serum. These analyses were carried out with aptamers CELTIC core, CELTIC_core_12 and 5’-end HEG modified CELTIC_core_24, CELTIC_core_29, CELTIC_core_40 and CELTIC_core_42 incubated in selection (SELEX) buffer containing 5 % fetal bovine serum (FBS), RPMI medium containing 10 % FBS or pure FBS. After various incubation times, fraction of undegraded aptamers was quantified by flow cytometry and agarose gel electrophoresis as previously described in Examples 11 and 13 respectively.

As shown in Figures 22 A-F and 23 A-C aptamers CELTIC core, CELTIC_core_24 and CELTIC_core_29 appeared very unstable in each of the tested serum condition with no integral/functional aptamer left after 4 h incubation in SELEX-5 % FBS or 30 min in pure serum. As already observed in Examples 11 and 13, there was a perfect consistency in results obtained by both methods. As a comparison, parental full-length CELTIC ls and CELTIC_19s sequences were stable 24 h in SELEX-5 % FBS and at least 1 h in pure serum. On the other hand, CELTIC_core_12, CELTIC_core_40 and CELTIC_core_42 performed much better in both stability read-outs. CELTIC_core_12 was by far the most stable aptamer being totally undegraded after 24 h incubation in SELEX-5% FBS and RPMI medium containing 10 % FBS. In pure serum, its degradation started to occur only after 4 h. CELTIC_core_40 and CELTIC_core_42 were intermediate cases being more stable that the unmodified CELTIC core sequence but totally degraded in pure serum after 4 h incubation. It is noteworthy that although CELTIC_core_12, CELTIC_core_29 and CELTIC_core_42 only differ by one nucleotide at position 11 they exhibit totally different stability properties. Moreover, the introduction a second abasic site in CELTIC_core_29 at position 16 that resulted in CELTIC_core_42 appeared to be a strategy to stabilize the sequence.

As another attempt to improve the stability of HEG-modified CELTIC_core_40 and CELTIC_core_42, the benefit of adding a 3’-3’ deoxy -thymidine was investigated. This type of modification at the 3’-end has been reported to enhance the resistance of nucleotidic sequences to nuclease degradation. As shown in Figures 32.1 A-D and 32.2 A-B and compared to CELTIC_core_40 and CELTIC_core_42, the aptamers with a 3’-3’ deoxy -thymidine at the 3’-end had significantly improved stabilities. Although not outperforming CELTIC core, these variants were stable 24 h in SELEX-5 % FBS and at least 2 h in pure serum. It is worth mentioning that despite the presence of two abasic sites that are commonly believed to be nuclease-sensitive sites, CELTIC_core_42 was more stable than CELTIC_core_40.

Example 16: Most stable and sequence-optimized anti-CD3 core DNA sequence derivatives remain cross-specific

Binding affinity measurements with the most interesting anti-CD3 aptamers derived from the core sequence were performed using a BIAcore T200 instrument (GE Healthcare) as already described in Example 4. To analyze interactions between aptamers and CD3 proteins, biotinylated aptamers were immobilized at a lower density than in Example 4 (100-500 RU) on Series S Sensor chips SA (GE Healthcare) according to manufacturer’s instructions (GE Healthcare). Mouse and Cynomolgus CD3 e/d were purchased from AcroBiosystems. For human proteins, the highest concentration used was 100 nM and 1 mM for mouse and cynomolgus antigens. Other concentrations were obtained by 3-fold dilutions.

Table 8 below provides a summary of K_D values obtained from surface plasmon resonance measurements. These results confirm the affinity drop observed in cell binding assays with the core sequence compared to parental sequences CELTIC_CD3_ls and CELTIC_CD3_19s. Variants of the core sequence identified in cell binding assays (CELTIC_core_ 12 , CELTIC_core_24, CELTIC_core_29, CELTIC_core_40 and CELTIC_core_42) were all confirmed to have better affinities than the unmodified aptamer with human CD3 e/g. As already observed in Example 4, the affinities were in general slightly lower with CD3 e/d which is a consequence of the SELEX strategy that included more rounds on the CD3 e/g isoform. None of these sequences did bind to the Fc region of human IgGl . The addition of 3’-3’ deoxy -thymidine at the 3’-end of CELTIC_core_24, CELTIC_core_40 and CELTIC_core_42 did not significantly change K_D values.

Table 8: K_D values determined by surface plasmon resonance for the sequence-optimized anti- CD3 core DNA sequence derivatives. From the recorded sensorgrams, data were computed with the kinetic analysis mode. Aptamer Human Human Human

CD3e/g CD3e/d Fc IgG

CELTIC_CD3_ls 119 pM 217 pM NA

CELTIC_CD3_19s 304 pM 900 pM NA

Core 845 pM 1000 pM NA

Corel2 1.15 pM 1500 pM NA

Core24 67 pM 41 pM NA

Core24t 238 pM 6 pM NA

Core29 5.4 pM 14 pM NA

Core40 0.2 pM 5.2 pM NA

Core40t 104 pM 10 pM NA

Core42 277 pM 772 pM NA

Core42t 43 pM 275 pM NA

Table 9 below provides a summary of K_D values obtained from surface plasmon resonance measurements performed with human CD3 e/g and mouse and cynomolgus CD3 e/d. In this new experimental set-up, CELTIC core showed again a lower affinity for human CD3 e/g compared to parental sequences CELTIC core ls and CELTIC_core_19s when sequence variants CELTIC_core_12, CELTIC_core_24, CELTIC_core_29, CELTIC_core_40 and CELTIC_core_42 showed improved affinities. In these conditions, 3’-3’ deoxy-thymidine- modified versions of the latest four aptamers performed equally well. All these sequenced - optimized aptamers were able to bind the murine and cynomolgus CD3 e/d isoforms confirming the cross-specificity of the CD3 aptamers already observed in Examples 3 and 5. In contrast to CELTIC core, CELTIC ls or CELTIC_19s, K_D values reported for interactions with mouse and cynomolgus CD3 e/d isoforms were in the same range as the human CD3 protein, suggesting that the interactions measured were real. Based on these results, anti-CD3 sequence-optimized aptamers remain cross-specific and bind to mouse, cynomolgus although these were selected against the human receptor.

Table 9: K_D values determined by surface plasmon resonance for the sequence-optimized anti- CD3 core DNA sequence derivatives. From the recorded sensorgrams, data were computed with the steady-state analysis mode.

Aptamer Human Mouse CD3s/6 Cynomolgus

0⁾3e/g (Ό3e/d

CELTIC_CD3_ls 156 nM 937 nM 2220 nM

CELTIC_CD3_19s 99 nM 437 nM 889 nM

Core 427 nM 590686 nM 1210 nM

Corel2 98 nM 455 nM 717 nM

Core24 218 nM 589 nM 752 nM

Core24t 233 nM 601 nM 883 nM

Core29 205 nM 509 nM 940 nM

Core40 129 nM 552 nM 1080 nM

Core40t 156 nM 498 nM 1080 nM

Core42 194 nM 412 nM 692 nM

Core 42t 176 nM 341 nM 572 nM Example 17: Most stable and sequence-optimized anti-CD3 core DNA sequence derivatives still recognize epitopes that are different from reference antibodies

In order to gather more information on the region recognized by CELTIC_core_12, CELTIC_core_40t and CELTIC_42t aptamers, competition binding assays with reference monoclonal antibodies were performed on CD3 -positive Jurkat cells essentially as already described in Example 13. As comparison, full length CD3_CELTIC_ls was included in these analyses.

Binding results of PE-labelled anti-CD3 OKT3, UCHT1 and HIT3a monoclonal antibodies with or without saturating concentrations of competitors are shown in Figures 21- .A, 21 -C and 21 -E. For each oftested antibodies, using an excess of its unlabeled form inhibited or completely abolished the binding of its PE -labeled version which validated the experimental conditions. Maximal signal was measured when aptamers were used as competitors suggesting that tested candidates failed to interfere with the binding of the three reference antibodies.

Binding results of anti-CD3 aptamers with or without saturating concentrations of monoclonal antibodies are shown in Figures 21-B, 21-D and 21-E. Similar signals were measured when aptamers were incubated with and without competitors suggesting that antibodies failed to interfere with the binding of tested sequences.

The lack of competition seen between anti-CD3 aptamers and the tested reference monoclonal antibodies suggests that the regions of human CD3 receptor targeted by aptamers differ from OKT3, HIT3a and UCHT1 epitopes. Taken together these results suggest that sequence-optimized CELTIC_core_12, CELTIC_core_40t and CELTIC_42t aptamers do not differ from parental sequences in terms of epitope specificity despite variations in nucleotide composition and chemical modifications of 5’- and 3’-ends. The binding to CD3 regions alternative to OKT3 and UCHT1 epitopes that are known to activate T lymphocytes upon binding suggests that CELTIC_core_12, CELTIC_core_40t and CELTIC_42t aptamers may not exhibit activating properties.

Example 18: Functionalization of sequence-optimized anti-CD3 core DNA sequence derivatives for subsequent grafting by covalent chemistry does not modify biological properties We finally set out to evaluate the impact of modifications at 3’ and 5’-termini on the biological properties of a given anti-CD3 aptamer. This issue is of particular relevance when considering covalent coupling of functionalized aptamers to a carrier, polymer or surface. To do so, we chose HEG-modified CELTIC_core_42 that we coupled with TEG-biotin via a at the 5’- or 3’-end or introduced at the 5’-end of CELTIC_core_42 a Tetrazine-PEG5 group by solid phase synthesis as already described in Example 1. Such functional groups respectively allow the coupling of aptamers to biotin via affinity interaction (the strongest interaction reported to date with K_D in 10¹⁵ M) or covalent coupling to norbomene/alkene/alkyne-modified partners by click chemistry (Inverse Electron Demand Diels-Alder).

The interaction of these three versions of the same aptamer with CD3 receptor expressed on Jurkat cells was investigated as already described in Example 3. CD3 -negative Ramos cells were included as negative control to monitor unspecific interactions mediated by the introduced chemical modifications. Results summarized in Fig.33 show that both ends of a given aptamer can be modified with a biotin without any impact on the apparent affinity (KD<50 nM) and specificity. The introduction of a tetrazine function at the 5’-end resulted in a slightly improved affinity (apparent KD<25 nM) without any loss of specificity for the CD3 target.

Taken together these results suggest that functionalization of anti-CD3 aptamers for subsequent coupling can be carried out without significantly disturbing their biological properties.

Table 10. Summary of Sequences

For clusters 1 to 45, flanking regions present at the 5’- and 3’-ends (TAGGGAAGAGAAGGACATATGAT and TTGACTAGTACATGACCACTTGA respectively) and described in SEQ ID NO 114 are present but not shown.

As used herein, "consisting essentially of allows the inclusion of materials or steps that do not materially affect the basic and novel characteristics of the claim. Any recitation herein of the term "comprising", particularly in a description of components of a composition or in a description of elements of a device, can be exchanged with "consisting essentially of' or "consisting of'.

While the present invention has been described in conjunction with certain preferred embodiments, one of ordinary skill, after reading the foregoing specification, will be able to effect various changes, substitutions of equivalents, and other alterations to the compositions and methods set forth herein.

Claims (23)

CLAIMS What is claimed is:

1. An aptamer comprising the sequence GX₁X₂TX₃GX₄X₅X₆X₇X₈X₉GGX₁₀CTGG, wherein Xi is G or A; X₂ and Cb are A, T, or G; X₃ is T, or G; X₄ and X₉ are G or C; X₅ is C or T; X₇ is T, G, or C; and Xs and X₁₀ are C, T, or A (SEQ ID NO: 109) or a variant thereof; and wherein the aptamer binds to CD3 e/g or CD3 e/d.

2. An aptamer comprising the sequence GGGX1TTGGCX2X3X4GGGX5CTGGC, wherein Xi and X2 are A, T, or G; X3 is T, C, or G; X4 and X5 are A, T, or C (SEQ ID NO: 110) or a variant thereof, and wherein the aptamer binds to CD3 e/g or CD3 e/d.

3. An aptamer comprising the sequence GX1TTX2GX3X4X5X6CX7GGX8CTGGX9G, wherein Xi is A or G; X2 is T or G; X3 and X7, X9 are G or C; X4 is T or C; X5 is A or T; Cb is T, C, or G; Xs is A or C (SEQ ID NO: 111) or a variant thereof, and wherein the aptamer binds to CD3 e/g or CD3 e/d.

4. An aptamer comprising the sequence GGGTTTGGCAXiCGGGCCTGGC, wherein Xi is G, C, or T (SEQ ID NO: 112) or a variant thereof, and wherein the aptamer binds to CD3 e/g or CD3 e/d.

5. An aptamer comprising the sequence GCAGCGAUUCUXiGUUU, wherein Xi is U or no base (SEQ ID NO: 113) or a variant thereof, and wherein the aptamer binds to CD3 e/g or CD3 e/d.

6. The aptamer of any of claims 1 -5, wherein the aptamer binds to human CD3 e/g and/or CD3 e/d with a dissociation constant of about 0.2 pM to about 250 nM.

7. The aptamer of any of claims 1 -5, wherein the aptamer binds to a non-human form of CD3 e/g and/or CD3 e/d with a dissociation constant of about 20 nM to about 800 nM.

8. The aptamer of any of claims 1 -7 comprising a sequence selected from SEQ ID NOS: 1 to 108.

9. The aptamer of any of claims 1 -8 comprising a variant of said sequence, wherein one or more of said bases are substituted with a non-naturally occurring base or wherein one or more of said bases is omitted or the corresponding nucleotide is replaced with a linker.

10. The aptamer of claim 9, wherein the one or more non-naturally occurring bases are selected from the group consisting of methylinosine, dihydrouridine, methyl guanosine, and thiouridine.

11. The aptamer of any of claims 1 -10 that binds to but does not activate CD3+ T cells.

12. A vehicle for delivering an agent, a dye, a functional group for covalent coupling or a biologically active agent to T cells, wherein the vehicle comprises the aptamer of any of claims 1 1 1

13. The vehicle of claim 11 or claim 12 that comprises a polymeric nanoparticle.

14. The vehicle of claim 13, wherein the polymeric nanoparticle comprises a poly(beta amino ester) (PBAE).

15. The vehicle of claim 13 or claim 14, wherein the aptamer is covalently linked to the polymer.

16. The vehicle of any of claims 13-15, wherein the agent is a T cell modulator or an imaging agent.

17. The vehicle of claim 16, wherein the T cell modulator is a viral vector carrying a transgene; wherein the viral vector is coated with the polymer; and wherein the aptamer is covalently linked to the polymer.

18. The vehicle of claim 17, wherein the viral vector is a lentiviral vector.

19. The vehicle of claim 17 or claim 18, wherein the transgene encodes a chimeric antigen receptor.

20. The vehicle of claim 16, wherein the T cell modulator is selected from the group consisting of dasatinib, an MEK1/2 inhibitor, a PI3K inhibitor, an HD AC inhibitor, a kinase inhibitor, a metabolic inhibitor, a GSK3 beta inhibitor, an MAO-B inhibitor, and a Cdk5 inhibitor.

21. A method of delivering an agent to T cells in a subject, the method comprising administering the vehicle of any of claims 16-20 to the subject.

22. A pharmaceutical composition comprising the vehicle of any of claims 16-20 and one or more excipients.

23. A method of isolating T cells from a subject, the method comprising using the vehicle of any of claims 1-12 to isolate T cells from the subject.