AU2020103196A4 - Reagent, primer, and kit for detecting intramascular fat content of beef cattle, and use - Google Patents
Reagent, primer, and kit for detecting intramascular fat content of beef cattle, and use Download PDFInfo
- Publication number
- AU2020103196A4 AU2020103196A4 AU2020103196A AU2020103196A AU2020103196A4 AU 2020103196 A4 AU2020103196 A4 AU 2020103196A4 AU 2020103196 A AU2020103196 A AU 2020103196A AU 2020103196 A AU2020103196 A AU 2020103196A AU 2020103196 A4 AU2020103196 A4 AU 2020103196A4
- Authority
- AU
- Australia
- Prior art keywords
- fat content
- detecting
- haplotype
- intramuscular fat
- disclosure
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000283690 Bos taurus Species 0.000 title claims abstract description 65
- 235000015278 beef Nutrition 0.000 title claims abstract description 53
- 239000003153 chemical reaction reagent Substances 0.000 title claims abstract description 21
- 101150104779 HTR2A gene Proteins 0.000 claims abstract description 71
- 102000054766 genetic haplotypes Human genes 0.000 claims abstract description 66
- 238000007918 intramuscular administration Methods 0.000 claims abstract description 59
- 230000035772 mutation Effects 0.000 claims description 23
- 210000000349 chromosome Anatomy 0.000 claims description 10
- 239000002773 nucleotide Substances 0.000 claims description 10
- 125000003729 nucleotide group Chemical group 0.000 claims description 10
- 238000000034 method Methods 0.000 claims description 8
- 238000011144 upstream manufacturing Methods 0.000 claims description 6
- LGZXYFMMLRYXLK-UHFFFAOYSA-N mercury(2+);sulfide Chemical compound [S-2].[Hg+2] LGZXYFMMLRYXLK-UHFFFAOYSA-N 0.000 abstract description 20
- 235000013372 meat Nutrition 0.000 abstract description 16
- 108090000623 proteins and genes Proteins 0.000 abstract description 7
- 238000009395 breeding Methods 0.000 abstract description 6
- 230000001488 breeding effect Effects 0.000 abstract description 6
- 230000002068 genetic effect Effects 0.000 abstract description 6
- 239000003550 marker Substances 0.000 abstract description 6
- 238000004519 manufacturing process Methods 0.000 abstract description 5
- 238000012216 screening Methods 0.000 abstract description 4
- 238000003752 polymerase chain reaction Methods 0.000 description 17
- 238000012163 sequencing technique Methods 0.000 description 14
- 238000004458 analytical method Methods 0.000 description 9
- 108020004414 DNA Proteins 0.000 description 8
- 238000001514 detection method Methods 0.000 description 8
- 238000006243 chemical reaction Methods 0.000 description 6
- 238000012408 PCR amplification Methods 0.000 description 5
- 238000000246 agarose gel electrophoresis Methods 0.000 description 5
- 230000003321 amplification Effects 0.000 description 5
- 238000003199 nucleic acid amplification method Methods 0.000 description 5
- 238000007480 sanger sequencing Methods 0.000 description 5
- 108700028369 Alleles Proteins 0.000 description 4
- 108091026890 Coding region Proteins 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 238000007400 DNA extraction Methods 0.000 description 3
- 238000001543 one-way ANOVA Methods 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 108700024394 Exon Proteins 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000000605 extraction Methods 0.000 description 2
- 239000000499 gel Substances 0.000 description 2
- 238000003205 genotyping method Methods 0.000 description 2
- 239000004579 marble Substances 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 102220027179 rs63750216 Human genes 0.000 description 2
- 238000003307 slaughter Methods 0.000 description 2
- 102100036321 5-hydroxytryptamine receptor 2A Human genes 0.000 description 1
- 101000783617 Homo sapiens 5-hydroxytryptamine receptor 2A Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 238000010171 animal model Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 230000000875 corresponding effect Effects 0.000 description 1
- 238000004925 denaturation Methods 0.000 description 1
- 230000036425 denaturation Effects 0.000 description 1
- 238000005516 engineering process Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 239000012634 fragment Substances 0.000 description 1
- 238000001727 in vivo Methods 0.000 description 1
- 239000007788 liquid Substances 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 235000013336 milk Nutrition 0.000 description 1
- 239000008267 milk Substances 0.000 description 1
- 210000004080 milk Anatomy 0.000 description 1
- 238000009304 pastoral farming Methods 0.000 description 1
- 102000054765 polymorphisms of proteins Human genes 0.000 description 1
- 238000012257 pre-denaturation Methods 0.000 description 1
- 230000001105 regulatory effect Effects 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 1
- 239000003643 water by type Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The disclosure belongs to the technical field of molecular breeding of Chinese Red Steppe
cattle, and relates to a reagent, a primer, and a kit for detecting intramuscular fat content of beef
cattle, and use. The disclosure provides use of a reagent for detecting a haplotype in HTR2A gene
5 in detecting intramuscular fat content of beef cattle. The use of the disclosure can provide a
reference for improving meat quality of Chinese Red Steppe cattle and screening effective
genetic marker genes. In addition, the disclosure provides a basis for fundamental improvement
of beef quality and fat content, and production of high-grade beef.
12
DRAWINGS
Marker 1 i3 4
1000
750
500 469bp
200
150
FIG. 1
NC037339.1
2-1 /
2-2
2-3
2
2:-S
Genotype CC Genotype GC Genotype CG
A
NC037339.1
2
2-2
2-3
2-- J J
Genotype GG Genotype AA Genotype GA
B
FIG. 2
Description
Marker 1 i3 4
1000 750 500 469bp 200
150
FIG. 1
NC037339.1
2-1 /
2-2 2-3 2 2:-S Genotype CC Genotype GC Genotype CG
NC037339.1
2 2-2 2-3 2-- J J Genotype GG Genotype AA Genotype GA
B FIG. 2
This application claims priority from Chinese patent application 202011053207.7, filed 29 September 2020, the entire content of which is incorporated by reference.
The disclosure relates to the technical field of molecular breeding of Chinese Red Steppe cattle, in particular to a reagent, a primer, and a kit for detecting intramuscular fat content of beef cattle, and use.
The Chinese Red Steppe cattle is bred in China for meat and milk production. It has many advantages such as strong adaptability, suitability for grazing, tolerance to rough feeding, and excellent meat quality.
The intramuscular fat content is an important factor affecting the meat quality of the Chinese Red Steppe cattle as well as an important indicator for determining high-quality beef. Individuals with a high intramuscular fat content have more obvious marble patterns in meat or form marbled beef which is delicious and juicy with an excellent taste. If the intramuscular fat content is excessively low, the meat will be hard and dry without a desired taste.
At present, the intramuscular fat content of beef is mainly measured and analyzed by a fat analyzer after slaughter, and can hardly be predicted during growth. Ultrasonic detection can be used to detect in vivo intramuscular fat content of beef cattle, while it applies to only months-old cattle. In addition, ultrasonic detection has a low accuracy. At present, there is no detection means that uses a molecular genetic method to determine intramuscular fat level in cattle through genetic linkage.
An objective of the disclosure is to provide a reagent, a primer, and a kit for detecting intramuscular fat content of beef cattle, and use, and/or to at least provide the public with a useful choice. The use of the disclosure is implemented to determine production of beef with a high intramuscular fat content by detecting combinations as haplotypes when cattle is born, avoiding improper fattening and reducing feeding costs. The disclosure can provide a reference for improving beef quality of Chinese Red Steppe cattle and screening effective genetic marker genes. In addition, the disclosure provides a basis for fundamental improvement of beef quality and fat content, and production of high-grade beef.
The disclosure describes use of a reagent for detecting a haplotype in HTR2A gene in detecting intramuscular fat content of beef cattle.
Preferably, the detecting a haplotype in HTR2A gene is carried out at a site located on exon 3 of the HTR2A gene.
Preferably, the detecting a haplotype in HTR2A gene is carried out at a site located at 86 bp and 164 bp of exon 3 of the HTR2A gene.
The disclosure also provides a reagent for detecting a haplotype in HTR2A gene to detect intramuscular fat content in beef cattle, where the reagent detects mutation sites at 86 bp and 164 bp of exon 3 of the HTR2A gene.
The disclosure also provides a primer for detecting a haplotype in HTR2A gene to detect intramuscular fat content in beef cattle, where the primer includes an upstream primer (F) with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer (R) with a nucleotide sequence as shown in SEQ ID NO.2.
The disclosure also provides a kit for detecting a haplotype in HTR2A gene to detect intramuscular fat content in beef cattle, where the kit includes a reagent for detecting mutation sites at 86 bp and 164 bp of exon 3 of the HTR2A gene.
The disclosure also provides a method for detecting intramuscular fat content of beef cattle, including the following steps: detecting mutation sites at 86 bp and 164 bp of exon 3 of HTR2A gene, and analyzing haplotypes, where H2H3 as a haplotype positively correlates with intramuscular fat content of beef cattle, in which H2 refers to G at 86 bp and A at 164 bp of exon 3 of the HTR2A gene on one chromosome, and H3 refers to G at 86 bp and G at 164 bp of exon 3 of the HTR2A gene on another chromosome.
The disclosure also describes a method for breeding beef cattle with a high intramuscular fat content based on the primer described in the above technical solution, including the following steps:
performing polymerase chain reaction (PCR) amplification on a sample to be tested with the primer of the above technical solution to obtain a PCR product; directly subjecting the PCR product to Sanger sequencing, and summarizing haplotypes, where H2H3 as a haplotype indicates a higher intramuscular fat content of beef cattle, in which H2 refers to G at 86 bp and A at 164 bp of exon 3 of the HTR2A gene on one chromosome, and H3 refers to G at 86 bp and G at 164 bp of exon 3 of the HTR2A gene on another chromosome.
Preferably, the amplification is carried out with each 20 pL of reaction system including 10 pL of 2xMaster Mix, 0.5 pL of each primer, 1 L of the sample to be tested, and ddH 20 as balance.
Preferably, the amplification is carried out at 95°C for 2 min; 95°C for 30 s, 50°C for 30 s and 72°C for 30 s for 35 cycles; 72°C for 5 min; and finally with a temperature dropped to 4°C.
The disclosure describes use of a reagent for detecting a haplotype in HTR2A gene in detecting intramuscular fat content of beef cattle. The disclosure uses Chinese Red Steppe cattle DNA as a template to detect polymorphism and haplotype composition of HTR2A gene through PCR sequencing technology. Then, correlation between the haplotype and a meat quality trait is analyzed through one-way analysis of variance. Finally, use of a reagent for detecting a haplotype in HTR2A gene in detecting intramuscular fat content of beef cattle is studied. The disclosure confirms that the haplotype H2H3 of HTR2A gene of Chinese Red Steppe cattle has significant and positive correlation with the intramuscular fat content as the meat quality trait. The disclosure describes a haplotype of HTR2A gene of cattle associated with high intramuscular fat content. The method of the disclosure can be used to obtain level of intramuscular fat content of beef cattle by determining the haplotype of the HTR2A gene of the cattle, thereby providing guidance for fattening of the beef cattle, and ensuring breeding and cultivating of beef cattle individuals having the H2H3 haplotype with a high intramuscular fat content. The disclosure provides a reference for improving meat quality of the Chinese Red Steppe cattle and screening of effective genetic marker genes. In addition, the disclosure provides a basis for fundamental improvement of beef quality and fat content, and production of high-grade beef. Test results of detection of the disclosure show that, the third exon of 5 exons of the HTR2A gene has two single nucleotide polymorphisms (SNPs) in a strong linkage, and the two can form different haplotypes. Linkage analysis with meat quality performance shows that, the haplotype H2H3 has a significant and positive correlation with the intramuscular fat content, and is a key haplotype for regulating the intramuscular fat content of the Chinese Red Steppe cattle. The disclosure obtains a haplotype in HTR2A gene of cattle that is related to the intramuscular fat content of the Chinese Red Steppe cattle, that is, the haplotype in HTR2A gene H2H3 which can be used as a reference for high intramuscular fat content. The intramuscular fat content is 2.79%±1.13% with the haplotype
H1H2, 2.87%±1.20% with haplotype H1H3, 4.75%±0.12% with haplotype H2H3 and 1.52%±0.15% with the haplotype H3H3. Results show that, there is a significant difference in intramuscular fat content as a trait with the haplotype in HTR2A gene H2H3 (P<0.05).
FIG. 1 shows results of detection with agarose gel electrophoresis of the disclosure; and
FIG. 2 shows comparison of sequencing results for mutations in exon 3 of HTR2A gene provided by the disclosure, where A shows comparison of sequencing results for g.C86G mutation in exon 3 of the HTR2A gene, and B shows comparison of sequencing results for g.G164A mutation in exon 3 of the HTR2A gene.
The disclosure describes use of a reagent for detecting a haplotype in HTR2A gene in detecting intramuscular fat content of beef cattle. The disclosure determines the intramuscular fat content of beef cattle based on polymorphism. In a preliminary experiment, the disclosure measured meat quality traits of a Chinese Red Steppe cattle population, such as intramuscular fat content, designed primers for the HTR2A (NCBI accession number: NC_037339.1) gene, performed PCR amplification, had a recovered gel containing products of the PCR amplification sequenced on a Sanger sequencing platform of Jinweizhi Biological Co., Ltd. and screened SNPs by NCBI-Blast. As a result, a C-G mutation and a G-A mutation were found at 86 bp and 164 bp of exon 3 of the HTR2A gene. In the disclosure, the detecting a haplotype in HTR2A gene is carried out at a site located on exon 3 of the HTR2A gene. In the disclosure, the HTR2A gene has an original nucleotide sequence as shown by SEQ ID No.3: acaacagcctgagttcacaacacaccagcatgattctagctataagttttcaaatcttgcattcaaccagagcagtcttactctacttcagtacag ttgacatcaggctcctctgaagtactgaaagtatcttgtgttgccctttgctgttaactgtgccttttcccaggatgaaaactatccaagcagggta aatttcatacgccagagaagctccaggtcattcactaatgctaaccttctgcatcccagggtaccggtggcctctgcccagcaagctctgcgct gtttggatttacctggatgtgctcttctccacggcctccatcatgcatctctgtgctatctccctggaccgctatgttgccattcagaaccccatcc atcacagccggttcaactccagaactaaggcgtttctgaaaataattgctgtttggacgatatcagtgggtaagtggaacagtat. In case of mutation, the C at 86 bp of exon 3 of the HTR2A gene is mutated into G, and the G at 164 bp is mutated into A. The disclosure detects two SNP sites, S and S2, in the exon 3. The Si site has a C>G mutation at 86 bp in a coding region of the exon 3 of the HTR2A gene, forming three genotypes: CC, GG and CG with two alleles: C and G. The S2 site has a G>A mutation at 164 bp in a coding region of the exon 3 of the HTR2A gene, forming three genotypes: GG, AA and GA with two alleles: A and G. A HaploView software is used for haplotype analysis and results show
D' = 0.794 and r2 = 0.350 between the Si and S2 sites, indicating a strong linkage. The two sites (Si, S2) form a total of 4 haplotypes H (CG), H2 (GA), H3 (GG) and H4 (CA) with haplotype frequencies of 0.570, 0.234, 0.163, and 0.033, respectively.
In the disclosure, the detecting a haplotype in HTR2A gene is carried out at a site located at 86 bp and 164 bp of exon 3 of the HTR2A gene. In the disclosure, it is preferable to design genotyping primers (F and R) with upstream and downstream sequences of the above two SNP sites as templates, carry out genotyping by PCR sequencing, and analyze haplotypes with the HaploView software. An SPSS 22.0 statistical software is used to test significance of difference in intramuscular fat content corresponding to different genotypes.
The disclosure also provides a reagent for detecting a haplotype in HTR2A gene to detect intramuscular fat content in beef cattle, where the reagent detects mutation sites at 86 bp and 164 bp of exon 3 of the HTR2A gene.
The disclosure also provides a primer for detecting a haplotype in HTR2A gene to detect intramuscular fat content in beef cattle, where the primer includes an upstream primer (F) with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer (R) with a nucleotide sequence as shown in SEQ ID NO.2. The primer of the disclosure can be used to detect two mutation sites constituting a haplotype at one time. The upstream primer has a nucleotide sequence of: 5'-ACAACAGCCTGAGTTCACA-3' (SEQ ID NO.1); and the downstream primer has a nucleotide sequence of: 5'-ATACTGTTCCACTTACCCACT-3'(SEQ ID NO.2).
The disclosure further provides a kit for detecting a haplotype in HTR2A gene to detect intramuscular fat content in beef cattle, where the kit includes a reagent for detecting mutation sites at 86 bp and 164 bp of exon 3 of the HTR2A gene.
The disclosure further provides a method for detecting intramuscular fat content of beef cattle, including the following steps: detecting mutation sites at 86 bp and 164 bp of exon 3 of HTR2A gene, and analyzing haplotypes, where H2H3 as a haplotype positively correlates with the intramuscular fat content of beef cattle, in which H2 refers to G at 86 bp and A at 164 bp of exon 3 of the HTR2A gene on one chromosome, and H3 refers to G at 86 bp and G at 164 bp of exon 3 of the HTR2A gene on another chromosome. The disclosure finds that, the H2H3 haplotype of the HTR2A gene of the Chinese Red Steppe cattle has significant and positive correlation with the intramuscular fat content as a meat quality trait. Results of the disclosure can serve as a reference for improving beef quality of the Chinese Red Steppe cattle and screening of effective genetic marker genes.
The disclosure further describes a method for breeding beef cattle with a high intramuscular fat content based on the primer of the above technical solution, including the following steps:
performing PCR amplification on a sample to be tested with the primer of the above technical solution to obtain a PCR product;
directly subjecting the PCR product to Sanger sequencing, and summarizing haplotypes where H2H3 as a haplotype indicates a higher intramuscular fat content of beef cattle, in which H2 refers to G at 86 bp and A at 164 bp of exon 3 of the HTR2A gene on one chromosome, and H3 refers to G at 86 bp and G at 164 bp of exon 3 of the HTR2A gene on another chromosome. The disclosure detects a genotype at 86 bp and 164 bp of exon 3 of the HTR2A gene of Chinese Red Steppe cattle with the specific primer of the above technical solution, and selects Chinese Red Steppe cattle individuals with the H2H3 gene haplotype relating with high intramuscular fat content for cultivation.
In the disclosure, the PCR product is 469 bp, and preferably the PCR product is subjected to Sanger sequencing by a sequencing company. After a PCR amplification reaction is completed, the disclosure preferably detects a PCR amplified product with 1% agarose gel electrophoresis in about 30 min. After detection, the disclosure preferably recovers a cut gel. After sequencing, the disclosure preferably uses a DNAMAN software to analyze sequencing results to find SNP sites, and use the HaploView software to analyze haplotypes.
In the disclosure, the amplification is carried out with each 20 pL of reaction system including 10 pL of 2xMaster Mix, 0.5 pL of each primer, 1 L of the sample to be tested, and ddH20 as balance.
In the disclosure, the amplification is carried out at 95°C for 2 min; 95°C for 30 s, 50°C for 30 s and 72°C for 30 s for 35 cycles; 72°C for 5 min; and finally with a temperature dropped to 4 0 C.
In the disclosure, the sample to be tested is preferably genomic DNA of the beef cattle. In the disclosure, the genomic DNA of a beef cattle sample is preferably extracted and stored at -20C.
The following text further describes in detail the reagent, the primer, the kit and the use for detecting intramuscular fat content of beef cattle of the disclosure with reference to specific examples. The technical solutions of the disclosure include, but are not limited to, the following examples.
Example 1
1. Materials and methods
1) Experimental Animal
58 Chinese Red Steppe cattle of 30 months old were randomly selected and slaughtered to determine a meat quality trait. Longissimus dorsi tissues were collected and stored at -80°C for later use in DNA extraction with a kit.
2) Main instruments and reagents
Ultra-micro spectrophotometer (Quawell-Q500), gas chromatograph (GC-14CPTF), high performance liquid chromatograph (WATERS 600), PCR instrument (100), colorimeter (X RiteSP62), genomic DNA extraction kit and the like were purchased from Dalian Bao Biological Engineering Co., Ltd.
3) Determination of meat quality traits
According to the interim standards of beef cattle slaughter test in China, meat quality traits were measured, mainly including cooked meat percentage, tenderness, water loss rate, drip loss, intramuscular fat content, and marble pattern.
4) Extraction of genomic DNA
Extraction was carried out with a genomic DNA extraction kit, and the ultra-micro spectrophotometer was used to determine DNA purity and concentration. 5 l of extracted DNA solution was taken for agarose gel electrophoresis while ensuring its integrity.
5) Primer design and synthesis
Based on the DNA sequence of the HTR2A gene of beef cattle published by GenBank (access number: NC_037339.1), gene exons were found through Ensembl. Primers were designed by Primer 5.0 with information of the primers shown in Table 1. The primers were all synthesized by Suzhou Jinweizhi Biotechnology Co., Ltd.
Table 1 Sequences of gene primers
Nameof Sequence of primer (5'-3') Fragment Annealing primer size temperature
HTR2A- F: ACAACAGCCTGAGTTCACA(SEQ ID NO.1) 469 bp 50 0 C exon3 R: ATACTGTTCCACTTACCCACT(SEQ ID NO.2)
6) PCR reaction system and conditions
PCR reaction system (20 pl): 10 pl of 2xTaq Master Mix, 8 pl of ddH20, 1 l of DNA, and 0.5 pl of each of upstream and downstream primers.
PCR reaction conditions: pre-denaturation at 95°C for 2 min; a total of 35 cycles of denaturation at 95°C for 30 s, annealing at a temperature(see Table 1) for 30 s, extension at 72°C for 30s; final extension at 72°C for 5 min, with products stored at 4°C.
7) Detection of HTR2A gene polymorphism of Chinese Red Steppe cattle and haplotype analysis
PCR amplification was performed on DNA samples of 58 Chinese Red Steppe cattle. 5 pl of PCR product in each sample was taken for 1.0% agarose gel electrophoresis (FIG. 1, detection results of the agarose gel electrophoresis). The products after identification were sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for Sanger sequencing. A DNAMAN software was used to analyze the sequencing results to find SNP sites. A Chromas software was used to analyze peak patterns of the sequencing. The HaploView software was used for haplotype analysis.
8) Statistical analysis of data
The SPSS 22.0 software was used to analyze correlation between different haplotypes and beef traits of Chinese Red Steppe cattle and determine significance of difference by one-way analysis of variance. The results were expressed as mean standard deviation, with P<0.05 indicating a significant difference.
2. Results
1) PCR sequencing results
Two SNP sites, Si and S2, were detected on exon 3. FIG. 2 showed sequence comparison for mutations in exon 3 of the HTR2A gene. Comparing the sequencing results with a reference sequence (Genbank: NC_037339.1), it was found that the S site had a C>G mutation at 86 bp in a coding region of the exon 3 of the HTR2A gene (in FIG. 2, A showed comparison of sequencing results for g.C86G mutation in exon 3 of the HTR2A gene), forming 3 genotypes: CC, GG and CG with 2 alleles: C and G. The S2 site had a G>A mutation at 164 bp in a coding region of the exon 3 of the HTR2A gene (in FIG. 2, B showed comparison of sequencing results for g.G164A mutation in exon 3 of the HTR2A gene), forming three genotypes: GG, AA and GA with two alleles: A and G.
2) Haplotype analysis
Linkage disequilibrium analysis was performed on the two detected SNP sites. The analysis showed D' = 0.794 and r2 = 0.350 between the Si and S2 sites, which indicated a strong linkage. The two sites (Si, S2) formed a total of 4 haplotypes Hi (CG), H2 (GA), H3 (GG) and H4 (CA) with haplotype frequencies of 0.570, 0.234, 0.163, and 0.033, respectively.
3) Analysis of correlation between different haplotypes of HTR2A gene and intramuscular fat content
The SPSS Statistics one-way ANOVA was used to explore the correlation between different haplotypes of HTR2A gene and intramuscular fat content. Results showed that, the H2H3 haplotype of the HTR2A gene positively correlated with the intramuscular fat content, with a significant difference (P<0.05). The H2H3 haplotype of the HTR2A gene indicated a high intramuscular fat content. Therefore, if beef cattle with a high intramuscular fat content were desired, individuals with the H2H3 genotype can be selected for breeding.
Table 2 Analysis of correlation between different haplotypes of HTR2A gene and intramuscular fat content as a trait
Haplotype HIH2 HIH3 H2H3 H3H3
Intramuscular fat 2.79b±1.13 2.87b±1.20 4.75Aar0.12 1.52Bb0.15 content %
Note: Different lowercase letters indicated a significant difference (p<0.05), and different uppercase letters indicated an extremely significant difference (p<0.01); other haplotypes had a low chance of occurrence and failed to meet statistical requirements, so they were not summarized.
The above descriptions are merely preferred implementations of the disclosure. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the disclosure, but such improvements and modifications should be deemed as falling within the protection scope of the disclosure.
The term "comprising" as used in this specification and claims means "consisting at least in part of'. When interpreting statements in this specification and claims which include the term "comprising", other features besides the features prefaced by this term in each statement can also be present. Related terms such as "comprises" are to be interpreted in similar manner.
In this specification where reference has been made to other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents or other sources of information is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art.
Claims (4)
1. A reagent for detecting a haplotype in HTR2A gene to detect intramuscular fat content in beef cattle, wherein the reagent detects mutation sites at 86 bp and 164 bp of exon 3 of the HTR2A gene.
2. A primer for detecting a haplotype in HTR2A gene to detect intramuscular fat content in beef cattle, wherein the primer comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2.
3. A kit for detecting a haplotype in HTR2A gene to detect intramuscular fat content in beef cattle, wherein the kit comprises a reagent for detecting mutation sites at 86 bp and 164 bp of exon 3 of HTR2A gene.
4. A method for detecting intramuscular fat content of beef cattle, comprising the following steps: detecting mutation sites at 86 bp and 164 bp of exon 3 of HTR2A gene, and analyzing haplotypes, wherein H2H3 as a haplotype positively correlates with the intramuscular fat content of beef cattle, in which H2 refers to G at 86 bp and A at 164 bp of exon 3 of the HTR2A gene on one chromosome, and H3 refers to G at 86 bp and G at 164 bp of exon 3 of the HTR2A gene on another chromosome.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011053207.7A CN112176072B (en) | 2020-09-29 | 2020-09-29 | Reagent, primer, kit and application for detecting intramuscular fat content of beef cattle |
| CN202011053207.7 | 2020-09-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2020103196A4 true AU2020103196A4 (en) | 2021-01-14 |
Family
ID=73946652
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2020103196A Active AU2020103196A4 (en) | 2020-09-29 | 2020-11-03 | Reagent, primer, and kit for detecting intramascular fat content of beef cattle, and use |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN112176072B (en) |
| AU (1) | AU2020103196A4 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113897445A (en) * | 2021-11-29 | 2022-01-07 | 华南农业大学 | Molecular marker related to porcine intramuscular fat and application thereof |
| CN114058712A (en) * | 2021-09-06 | 2022-02-18 | 广东海洋大学 | Molecular marker of UCP1 gene related to yak meat quality |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1417338A4 (en) * | 2001-07-16 | 2005-06-29 | Price Foundation Ltd | Genes and snps associated with eating disorders |
| KR101496022B1 (en) * | 2013-08-09 | 2015-02-26 | 영남대학교 산학협력단 | Single nucleotide polymorphism marker in LPL gene for diagnosis of meat quality in Hanwoo and method for diagnosis of meat quality in Hanwoo using same marker |
| CN103966209B (en) * | 2014-05-02 | 2016-04-06 | 华中农业大学 | The SNP marker relevant to pig intramuscular fat content proterties and application |
| CN108315433B (en) * | 2018-03-06 | 2018-12-21 | 华南农业大学 | It is a kind of influence Duroc boar intramuscular fat content molecular labeling and application |
| CN108823299A (en) * | 2018-06-11 | 2018-11-16 | 苏州艾达康医疗科技有限公司 | A kind of detection method and kit of depression medication related gene |
| CN111041110A (en) * | 2020-01-16 | 2020-04-21 | 广西扬翔股份有限公司 | Molecular marker related to intramuscular fat content traits of pigs and application thereof |
-
2020
- 2020-09-29 CN CN202011053207.7A patent/CN112176072B/en active Active
- 2020-11-03 AU AU2020103196A patent/AU2020103196A4/en active Active
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114058712A (en) * | 2021-09-06 | 2022-02-18 | 广东海洋大学 | Molecular marker of UCP1 gene related to yak meat quality |
| CN113897445A (en) * | 2021-11-29 | 2022-01-07 | 华南农业大学 | Molecular marker related to porcine intramuscular fat and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112176072A (en) | 2021-01-05 |
| CN112176072B (en) | 2022-07-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108504749B (en) | 29 micro haplotype sites, screening method, composite amplification system and application | |
| Uemoto et al. | Effects of porcine leptin receptor gene polymorphisms on backfat thickness, fat area ratios by image analysis, and serum leptin concentrations in a Duroc purebred population | |
| CN109825598B (en) | SNP (Single nucleotide polymorphism) marker remarkably related to Australian white sheep hair thickness, molecular marker and application | |
| AU2020103196A4 (en) | Reagent, primer, and kit for detecting intramascular fat content of beef cattle, and use | |
| Anttila et al. | Consistently replicating locus linked to migraine on 10q22-q23 | |
| CN106906303B (en) | SNP marker influencing pork quality traits and application thereof | |
| KR101929391B1 (en) | Novel SNP marker for discriminating increasedthe number of nipples of pigs and use thereof | |
| Shi et al. | Association analysis of CAPN1 gene variants with carcass and meat quality traits in Chinese native cattle | |
| KR101312480B1 (en) | Novel snp marker for discriminating number of rib of pig and use thereof | |
| CN115820879B (en) | Molecular marker related to intramuscular fat traits of pigs in pig AOPEP gene and application thereof | |
| US8003328B2 (en) | Bovine polymorphisms and methods of predicting bovine traits | |
| CN107267611B (en) | Primer group for detecting p.Pro189Ala locus genotype and detection kit and application thereof | |
| CN113186301B (en) | BBS2 molecular marker associated with beef cattle meat quality traits and detection kit thereof | |
| CN106947826B (en) | Method for detecting single nucleotide polymorphism of cattle SERPINA3 gene and application thereof | |
| López-Rojas et al. | Genotyping of SNPs associated with meat tenderness: comparison of two PCR-based methods | |
| Perdana et al. | Restriction Mapping of MC4R Gene on Bali Cattle (Bos sondaicus) as Genetic Marker for Breeding Program in Compared to Bos taurus and Bos indicus. | |
| US20090260095A1 (en) | Gene Marker for Evaluating Genetic Ability for Carcass Weight in Bovine and Method for Evaluating Genetic Ability for Carcass Weight Using the Same | |
| JP6683642B2 (en) | Method for determining inosin acid content in meat after slaughter in bovine individuals | |
| EP1660675B1 (en) | Polymorphism of the igf2 gene and improving production characteristics of cattle | |
| CN112111579B (en) | Identification method of Tan sheep derived components | |
| CN114134238B (en) | RALGAPA1 gene SNP molecular marker related to egg laying traits of Muscovy ducks and application thereof | |
| WO2010037020A2 (en) | Compositions and methods for determining likelihood of twinning | |
| CN115807110A (en) | Primer for detecting FBXO32 gene mutation and yak meat quality identification method | |
| CN114107467A (en) | Kit for specifically detecting sarcopenia through rs112892337 | |
| CN114107466A (en) | Kit for specifically detecting sarcopenia through rs28929474 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) |