AU2020100740A4 - Base editor, preparation method and use thereof - Google Patents
Base editor, preparation method and use thereof Download PDFInfo
- Publication number
- AU2020100740A4 AU2020100740A4 AU2020100740A AU2020100740A AU2020100740A4 AU 2020100740 A4 AU2020100740 A4 AU 2020100740A4 AU 2020100740 A AU2020100740 A AU 2020100740A AU 2020100740 A AU2020100740 A AU 2020100740A AU 2020100740 A4 AU2020100740 A4 AU 2020100740A4
- Authority
- AU
- Australia
- Prior art keywords
- ebe
- sgrna
- recombinant plasmid
- dcpfl
- pcmv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2810/00—Vectors comprising a targeting moiety
- C12N2810/10—Vectors comprising a non-peptidic targeting moiety
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Mycology (AREA)
- Crystallography & Structural Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a base editor, a preparation method and use thereof, and belongs to the technical field of gene editing. The base editor includes a pCMV-dCpfl-RR-eBE recombinant plasmid and a pLbCpfl-sgRNA recombinant plasmid. The use includes the following steps: determining a target sequence and designing a single-stranded oligonucleotide pair; annealing to obtain a double-stranded DNA fragment; ligating to the pLbCpfl-sgRNA recombinant plasmid to obtain a targeting sgRNA expression vector; and culturing after cotransfection of cells with the targeting sgRNA expression vector and the pCMV-dCpfl-RR-eBE recombinant plasmid. The base editor of the present invention specifically mutates cytosine (C) to thymine (T) at a target site, but has no effect on bases at a non-target site. Gene editing efficiency ranges between 20% and 30%.
Description
BASE EDITOR, PREPARATION METHOD AND USE THEREOF
2020100740 11 May 2020
TECHNICAL FIELD
The present invention relates to the technical field of gene editing, and in particular to a base editor, a preparation method and use thereof.
BACKGROUND
Conventional CRISPR/Cas9 gene editing technology features high gene knockout efficiency, but the efficiency thereof is usually very low during the implementation of base substitution (for example, correction of point mutations causing genetic disease). This further restricts the use of CRISPR/Cas9 gene editing. In recent years, using a new base editor (BE) developed by integrating CRISPR/Cas9 with APOBEC (a cytosine deaminase), efficient targeted genome editing and manipulation can be achieved at a single base level (e.g., cytosine to thymine). In theory, such a new base editing system may correct genomic point mutations causing hundreds of human diseases. Therefore, the base editing system has a tremendous clinical application potential. All base editors reported so far use Cas9 proteins (mainly Streptococcus pyogenes Cas9, SpCas9, Staphylococcus aureus Cas9, and SaCas9) to execute targeted binding to genomes; however, the targeted binding depends on a protospacer adjacent motif (PAM) sequence next to a target. Most of PAM sequences recognized by SpCas9 and SaCas9 protein are G/C-rich. Therefore, efficient gene editing cannot be conducted in an A/T-rich domain using the base editors reported.
Recently, scientific researchers from ShanghaiTech University and Chinese Academy of Sciences constructed a range of novel CRISPR/Cas9-based base editors (Cpfl-BE) (see: Base editing with a Cpfl-cytidine deaminase fusion, Xiaosa Li, Ying Wang, Yajing Liu, Bei Yang, Xiao Wang, Jia Wei, Zongyang Lu, Yuxi Zhang, Jing Wu, Xingxu Huang, Li Yang & Jia Chen. Nature Biotechnology volume 36, pages 324-327 (2018)). Because Cpfl protein can recognize an A/T-rich PAM sequence, such a novel Cpfl-based BE achieves base editing in an A/T-rich domain. While expanding an editing domain, the novel Cpfl-based BE produces a low level of editing by-products, thereby having higher editing accuracy. The novel Cpfl-based BE can achieve effective complementation of base editing with Cpfl-based BEs in the prior art, providing a method and an idea for comprehensive and further application of BEs in basic research and future clinical setting. However, the BE merely recognizes a PAM sequence of 5’-TTTV; such a target is rare in genomes, resulting in narrow application range thereof. CRISPR/Cpfl-RR variant (see: Engineered Cpfl variants with altered PAM specificities. Linyi Gao, David Β T Cox, Winston X Yan, John C Manteiga, Martin W Schneider, Takashi Yamano, Hiroshi Nishimasu, Osamu Nureki, Nicola
2020100740 11 May 2020
Crosetto & Feng Zhang. Nature Biotechnology volume 35, pages 789-792 (2017)) expands the recognition scope to 5’-TYCV. Such a target is relatively common in genomes. Modification of the CRISPR/Cpfl-RR variant into a novel BE will expand the target scope of the BE significantly.
SUMMARY
In view of this, an objective of the present invention is to provide a base editor specifically mutating cytosine (C) to thymine (T) at a target site, a preparation method and use thereof.
In order to achieve the foregoing invention objective, the present invention provides the following technical solutions:
A base editor is provided, including a pCMV-dCpfl-RR-eBE recombinant plasmid and a pLbCpfl-sgRNA recombinant plasmid; where the pCMV-dCpfl-RR-eBE recombinant plasmid includes a pCMV-dCpfl-eBE vector backbone and a DNA fragment of dCpfl-RR-eBE expression cassette;
the pLbCpfl-sgRNA recombinant plasmid includes a pUC57 vector backbone and a DNA fragment of universal sgRNA expression cassette.
Preferably, a nucleotide sequence of the DNA fragment of dCpfl-RR-eBE expression cassette is shown in SEQ ID NO. 1.
Preferably, a nucleotide sequence of the DNA fragment of universal sgRNA expression cassette is shown in SEQ ID NO. 2.
Preferably, a nucleotide sequence of the pLbCpfl-sgRNA recombinant plasmid is shown in SEQ ID NO. 3.
The present invention provides a preparation method of the base editor, including the following steps:
inserting the DNA fragment of dCpfl-RR-eBE expression cassette into the pCMV-dCpfl-eBE vector backbone to construct and obtain the pCMV-dCpfl-RR-eBE recombinant plasmid; and inserting the DNA fragment of universal sgRNA expression cassette into the pUC57 vector backbone to obtain the pLbCpfl -sgRNA recombinant plasmid.
Preferably, an insertion site of the DNA fragment of dCpfl-RR-eBE expression cassette is located between PstI and Apal restriction enzyme sites of the pCMV-dCpfl-eBE vector backbone; an insertion site of the DNA fragment of universal sgRNA expression cassette is an EcoRV restriction enzyme site of the pUC57 vector backbone.
The present invention provides use of the base editor in gene editing, including the following steps:
1) determining a target site of a gene to be tested, and designing a single-stranded oligonucleotide pair of the target site according to the target site;
2020100740 11 May 2020
2) annealing the single-stranded oligonucleotide pair to obtain a double-stranded DNA fragment;
3) ligating the double-stranded DNA fragment to the pLbCpfl -sgRNA recombinant plasmid to obtain a targeting sgRNA expression vector; and
4) cotransfecting cells with the targeting sgRNA expression vector and the pCMV-dCpfl-RR-eBE recombinant plasmid and then culturing for 36 to 60 h.
Preferably, a ratio of total mass of the targeting sgRNA expression vector and the pCMV-dCpf 1-RR-eBE recombinant plasmid in step 4) to the number of transfection cells is 0.5 pg:(0.5-5) x 106 cells.
Preferably, a ratio of the targeting sgRNA expression vector to the pCMV-dCpf 1-RR-eBE recombinant plasmid is (1-5):(1-5).
Preferably, in step 3), the double-stranded DNA fragment is ligated to the pLbCpfl-sgRNA recombinant plasmid after enzyme digestion; an enzyme for the enzyme digestion is Bbsl.
Beneficial effects of the present invention are as follow: The base editor provided by the present invention includes a pCMV-dCpfl-RR-eBE recombinant plasmid and a pLbCpfl-sgRNA recombinant plasmid; the pCMV-dCpfl-RR-eBE recombinant plasmid includes a pCMV-dCpf 1-eBE vector backbone and a DNA fragment of dCpfl-RR-eBE expression cassette; the pLbCpfl-sgRNA recombinant plasmid includes a pUC57 vector backbone and a DNA fragment of universal sgRNA expression cassette. The base editor of the present invention specifically mutates cytosine (C) to thymine (T) at a target site, but has no effect on bases at a non-target site. Gene editing efficiency ranges between 20% and 30%. The base editor can modify mammalian genomic DNA sequences effectively and is an efficient genetic base editor.
DETAILED DESCRIPTION
The present invention provides a base editor, including a pCMV-dCpfl-RR-eBE recombinant plasmid and a pLbCpfl-sgRNA recombinant plasmid; the pCMV-dCpfl-RR-eBE recombinant plasmid includes a pCMV-dCpf 1-eBE vector backbone and a DNA fragment of dCpfl-RR-eBE expression cassette; the pLbCpfl-sgRNA recombinant plasmid includes a pUC57 vector backbone and a DNA fragment of universal sgRNA expression cassette.
In the present invention, the pCMV-dCpfl-RR-eBE recombinant plasmid includes a pCMV-dCpf 1-eBE vector backbone and a DNA fragment of dCpfl-RR-eBE expression cassette; sources of the pCMV-dCpf 1-eBE vector backbone are not particularly limited in the present invention, as long as commercially available products may be used preferably; in the specific implementation of the present invention, the pCMV-dCpf 1-eBE vector backbone is purchased from addgene (Cat No. 107688). In the present invention, a nucleotide sequence of the DNA fragment of
2020100740 11 May 2020 dCpfl-RR-eBE expression cassette is preferably shown in SEQ ID NO. 1. In the present invention, an insertion site of the DNA fragment of dCpfl-RR-eBE expression cassette is preferably located between PstI and Apal restriction enzyme sites of the pCMV-dCpfl-eBE vector backbone, i.e., a 2,365-5,178 bp fragment of the pCMV-dCpfl-eBE vector backbone.
In the present invention, the pLbCpfl-sgRNA recombinant plasmid includes a pUC57 vector backbone and a DNA fragment of universal sgRNA expression cassette. In the present invention, the pUC57 vector backbone preferably comes from commercially available products; the DNA fragment of universal sgRNA expression cassette includes a U6 promoter sequence, a transcriptional initiation signal, an upstream sequence of sgRNA, spacer cloning sites, a U6 terminator coding sequence, and a bGH polyA sequence, which are sequentially ligated. The DNA fragment of universal sgRNA expression cassette is preferably regulated by integration of the foregoing sequences; a nucleotide sequence of the DNA fragment of universal sgRNA expression cassette is preferably shown in SEQ ID NO. 2. In the present invention, the DNA fragment of universal sgRNA expression cassette is preferably inserted into an EcoRV restriction enzyme site of the pUC57 vector backbone. In the present invention, a nucleotide sequence of the pLbCpfl-sgRNA recombinant plasmid is preferably shown in SEQ ID NO. 3.
The present invention provides a preparation method of the base editor, including the following steps: inserting the DNA fragment of dCpfl-RR-eBE expression cassette into the pCMV-dCpfl-eBE vector backbone to construct and obtain the pCMV-dCpfl-RR-eBE recombinant plasmid; and inserting the DNA fragment of universal sgRNA expression cassette into the pUC57 vector backbone to obtain the pLbCpfl-sgRNA recombinant plasmid.
In the present invention, an insertion site of the DNA fragment of dCpfl-RR-eBE expression cassette is located between PstI and Apal restriction enzyme sites of the pCMV-dCpfl-eBE vector backbone; i.e., a 2,365-5,178 bp fragment of the pCMV-dCpfl-eBE vector backbone. In the present invention, the insertion is preferably individual double digestion of the DNA fragment of dCpfl-RR-eBE expression cassette and the pCMV-dCpfl-eBE, followed by ligation; enzymes for the double digestion are PstI and Apal. In the present invention, a system of the double digestion is 50 pL, preferably including 1 pL of PstI, 1 pL of Apal, 1 pg of DNA fragment of dCpfl-RR-eBE expression cassette, 5 pL of Buffer H, and the rest of the volume of double distilled water. In the present invention, reagents in the system of the double digestion are preferably purchased from Takara Biotechnology (Dalian) Co. Ltd. In the present invention, digested products are ligated after the digestion. In the present invention, a system of the ligation is 10 pL, preferably including 1 pL of T4 DNA ligase, 1 pL of T4 DNA ligase buffer, 4 pL of digested product of the DNA fragment of dCpfl-RR-eBE expression cassette, and 4 pL of digested product of the pCMV-dCpfl-eBE vector backbone. Reagents used in the ligation process are preferably purchased from NEB (Cat No. M0202S); a temperature of the ligation is preferably 4°C; the ligation time is preferably 10 to 14 h.
2020100740 11 May 2020
In the present invention, after the pCMV-dCpfl-RR-eBE recombinant plasmid is obtained, the plasmid is preferably introduced into competent Escherichia coli cells for cloning; specific operation of the cloning is not particularly limited in the present invention, as long as the operation is conventional in the art.
In the present invention, the DNA fragment of universal sgRNA expression cassette is inserted into the pUC57 vector backbone to obtain the pLbCpfl-sgRNA recombinant plasmid. In the present invention, the insertion site of the DNA fragment of universal sgRNA expression cassette is preferably the EcoRV restriction enzyme site of the pUC57 vector backbone; methods for inserting the DNA fragment of universal sgRNA expression cassette into the pUC57 vector backbone are not particularly limited in the present invention, as long as enzyme digestion-ligation method conventional in the art may be used for insertion and self-preparation or synthesis may be entrusted to a biotechnology company. In an example of the present invention, preparation of the pLbCpfl-sgRNA recombinant plasmid is entrusted to Sangon Biotech (Shanghai) Co., Ltd.
The present invention provides use of the base editor in gene editing, including the following steps: 1) determining a target site of a gene to be tested, and designing a single-stranded oligonucleotide pair of the target site according to the target site; 2) annealing the single-stranded oligonucleotide pair to obtain a double-stranded DNA fragment; 3) ligating the double-stranded DNA fragment to the pLbCpfl-sgRNA recombinant plasmid to obtain a targeting sgRNA expression vector; and 4) cotransfecting cells with the targeting sgRNA expression vector and the pCMV-dCpfl-RR-eBE recombinant plasmid and then culturing for 36 to 60 h.
In the present invention, the target site of the gene to be tested is determined first; the gene to be tested is not particularly limited in the present invention, as long as any genes in mammalian cells may be used as genes to be edited; in the present invention, a length of the target site is preferably 5 to 10 bp, and more preferably 6 to 7 bp. After the target site is determined in the present invention, the single-stranded oligonucleotide pair of the target site is designed according to the target site; in the present invention, the single-stranded oligonucleotide pair is designed according to the following rule: in a genomic sequence, extending a sequence of the target site upstream and downstream, making a 5’-terminal of the sequence next to a TYCV sequence (i.e., PAM sequence), with a full length of 20 to 30 bp, i.e., a target sequence (a section recognizing and binding to a DNA sequence since encoding of sgRNA). A forward oligonucleotide sequence is a sequence adding AGAT at the 5’-terminal of the target sequence, while a reverse oligonucleotide sequence is a sequence adding AAGC at the 5’-terminal of a reverse complementary sequence of the target sequence.
In the present invention, after the single-stranded oligonucleotide pair is obtained, the single-stranded oligonucleotide pair is annealed to obtain a double-stranded DNA fragment. In the present invention, the single-stranded oligonucleotide pair is preferably entrusted to a biotech
2020100740 11 May 2020 company for synthesis. In the present invention, a procedure of the annealing is preferably as follows: 95°C for 5 min, 72°C for 10 min, maintenance at 0°C. In the implementation of the present invention, the “maintenance at 0°C” is preferably achieved by placing an annealing system on ice.
In the present invention, the double-stranded DNA fragment is ligated to the pLbCpfl -sgRNA recombinant plasmid to obtain the targeting sgRNA expression vector. In the present invention, the double-stranded DNA fragment is ligated to the pLbCpfl-sgRNA recombinant plasmid after enzyme digestion; an enzyme for the enzyme digestion is Bbsl. Detailed methods and parameters of the enzyme digestion and ligation are not particularly limited in the present invention, as long as methods and parameters of the enzyme digestion and ligation may be conventionally used in the art. In the present invention, after the ligation, the ligated product is assayed preferably. The assay preferably includes the following steps: transfecting the ligated product into competent Escherichia coli cells to culture, followed by colony PCR and sequencing successively; the correctly tested targeting sgRNA expression vector is used in subsequent experiments. Methods for the transfection, colony PCR and sequencing are not particularly limited in the present invention, as long as the methods may be conventionally used in the art.
In the present invention, after the targeting sgRNA expression vector is obtained, preferably, a process of specificity test for the targeting sgRNA expression vector is further included to determine if the targeting sgRNA expression vector can specifically recognize and bind to a specific target site. In the present invention, preferably, the targeting sgRNA expression vector, a PY010 plasmid, and a dual-luciferase reporter vector SSA-DKK2 (which has a nucleotide sequence as shown in SEQ ID NO. 4) are cotransfected at a mass ratio of 1:1:1, and activity of dual-luciferase report gene is tested by a kit after 48 h to determine if the targeting sgRNA expression vector can specifically recognize and bind to a specific target site.
In the present invention, after the targeting sgRNA expression vector is obtained, cells are cotransfected with the targeting sgRNA expression vector and the pCMV-dCpfl-RR-eBE recombinant plasmid and cultured for 36 to 60 h. In the present invention, a mass ratio of the targeting sgRNA expression vector to the pCMV-dCpfl-RR-eBE recombinant plasmid is preferably (1-5):(1-5); in the present invention, a ratio of total mass of the targeting sgRNA expression vector and the pCMV-dCpfl-RR-eBE recombinant plasmid in step 4) to the number of transfection cells is preferably 0.5 pg:(0.5-5) χ 106 cells, and more preferably 0.5 pg: 1 χ 106 cells. In the present invention, the transfection reagent is preferably DNA Feet Transfection Reagent (CWBIO, Cat No. CW0860). Operations of the transfection are not particularly limited in the present invention, as long as operations are conducted according to the operating instructions of the transfection reagent. In the present invention, the culture time is preferably 40 to 56 h, and more preferably 48 h. In the present invention, the cells are preferably mammalian cells. In a preferred example of the present invention, the cells are Diqing sheep skin fibroblasts DQSHS1, purchased from Kuming Cell Bank,
2020100740 11 May 2020
Chinese Academy of Sciences, Deposit No. KCB 94026.
The technical solutions provided by the present invention are described in detail below with reference to the examples, but the technical solutions cannot be understood as limiting the protection scope of the present invention.
Example 1
Construction of base editor
1. Construction of pCMV-dCpfl-RR-eBE recombinant plasmid
A 2,814 bp DNA fragment of dCpfl-RR-eBE expression cassette (which has a nucleotide sequence as shown in SEQ ID NO. 1) was synthesized and inserted into a pCMV-dCpfl-eBE vector through double digestion with PstI and Apal, to obtain a pCMV-dCpfl-RR-eBE vector.
The pCMV-dCpfl-RR-eBE vector was purchased from addgene, Cat No. 107688.
PstI was purchased from Takara Biotechnology (Dalian) Co. Ltd., Cat No. 1624; Apal was purchased from Takara Biotechnology (Dalian) Co. Ltd., Cat No. 1604.
Digestion system: 50 pL; reagents were purchased from Takara Biotechnology (Dalian) Co. Ltd.: including 1 pL of PstI, 1 pL of Apal, 1 pg of DNA fragment of dCpfl-RR-eBE expression cassette or pCMV-dCpfl-eBE vector backbone, 5 pL of Buffer H, and double distilled water (diluted to 50 pL). Restriction enzyme digestion was conducted for 3 h at a temperature of 37°C.
Steps and parameters of ligation:
Ligation system (10 pL, ligation reagents purchased from NEB, Cat No. M0202S): including 1 pL of T4 DNA ligase, 1 pL of T4 DNA ligase buffer, 4 pL of digested fragment of the DNA fragment of dCpfl-RR-eBE expression cassette, and 4 pL of digested fragment of the pCMV-dCpfl-eBE vector backbone.
Ligation conditions: overnight at 4°C.
Steps and parameters of transformation:
Live microliters of ligation product was charged into 50 pL of competent cells (purchased from Takara Biotechnology (Dalian) Co. Ltd., Cat No. 9057), flicked, mixed well, allowed to stand for 30 min, heat-shocked for 90 s at 42°C, supplemented with 500 pL of LB medium, and recovered in a rotary shaker at 37°C at 200 rpm for 1 h; 100 pL of recovered cell suspension was applied evenly on a solid LB medium supplemented with 60 mg/ml ampicillin, and allowed to stand and culture at 37°C for 14 h.
Colony picking: Live to ten single colonies were picked from the solid LB medium plate in the previous step, placed in 1 mL of LB liquid medium supplemented with 60 mg/ml ampicillin, and cultured in the rotary shaker at 37°C at 200 rpm for 2 to 3 h for sequencing use.
2. Construction of pLbCpfl-sgRNA recombinant plasmid
Construction of universal sgRNA expression vector pLbCpfl-sgRNA sequence:
2020100740 11 May 2020 sgRNA expression vector (U6 promoter): For sequence synthesis, see 1-249 in pX335 sequence (U6 promoter) + G (transcriptional initiation signal) + upstream sequence of sgRNA + spacer cloning site (two reverse Bbsl sites, between which a random sequence is inserted) + U6 terminator 344.349 + bGH polyA5457-5688
U6 promoter:
gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga cgaaacacc (SEQ ID NO. 5)
Transcriptional initiation signal: G
Upstream sequence of sgRNA: taatttctactaagtgtagat (SEQ ID NO. 6)
Spacer cloning site: gggtcttcg (SEQ ID NO. 7)
Random sequence:
Ggcgagctgcacgctgccgtcctcgatgttgtggcggatcttgaagttcaccttgatgccgttcttctgcttgtcggccatgatatagacgtt gtggctgttgtagttgtactccagcttgtgccccaggatgttgccgtcctccttgaagtcgatgcccttcagctcgatgcggttcaccagggtgtcg ccctcgaacttcacctcggcgcgggtcttgtagttgccgtcgtccttgaagaagatggtgcgctcctggacgtagccttcgggcatggcggactt gaagaagtcgtgctgcttcatgtggtcggggtagcggctgaagca (SEQ ID NO, 8)
Spacer cloning site: agaagacctgc (SEQ ID NO. 9)
U6 terminator: ttttttJSEQ ID NO. 10)
5457-5688 (bGH polyA):
ctagagctcgctga tcagcctcga ctgtgccttc tagttgccag ccatctgttg tttgcccctcccccgtgcct tccttgaccc tggaaggtgc cactcccact gtcctttcct aataaaatgaggaaattgca tcgcattgtc tgagtaggtg tcattctatt ctggggggtg gggtggggcaggacagcaag ggggaggatt gggaagagaa tagcaggcat gctgggga_(SEQ ID NO. 11)
An 859 bp universal sgRNA expression cassette was properly adjusted and obtained on this basis, and a sequence thereof is shown in SEQ ID NO. 2.
The 859 bp sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd. and cloned to a pUC57 vector (clone location was an EcoRV restriction enzyme site, between 432 and 433 bp), to obtain a pLbCpfl -sgRNA recombinant plasmid.
The sequence of pLbCpfl-sgRNA vector had a full length of 3,569 bp, and a nucleotide sequence thereof is shown in SEQ ID NO. 3.
Example 2
Use of the base editor in gene editing of mammalian cell lines
Diqing sheep skin fibroblasts DQSHS1, purchased from Kuming Cell Bank, Chinese Academy of Sciences, Deposit No. KCB 94026.
2020100740 11 May 2020
1. sgRNA target design
Sheep DKK2 gene extracted from a sequence of sheep chromosome 6 (NCBI GI: 417531944) includes a sequence of exon 1 (DKK2-440, as shown below). A Cpfl sgRNA target was designed.
Agactgagttcacacggtgctgggcccccaaagccaagtggggttgggggaacagagtctgcgagtcccggcgccccgagtgcag ggccccgtgttggggtcctccttcccatttgtatccgtatccttgcgggctttgcgcctccccgggggacccctcgccgggagatggccgcact gatgcggggcaaggactcctcccgctgcctgctcctactggccgcggtgctgatggtggagagctcacagttcggcagctcgcgggccaaac tcaactccatcaagtcctctctgggcggggagacgcctgcccaggccgccaatcgatctgcgggcacttaccaaggactggctttcggcggca gtaagaagggcaaaaacctggggcaggtaggaaaatacccccaatacactcttcaaccagaagaggtagggacccg (SEQ ID NO. 12)
Target site TF3: atccgt (SEQ ID NO. 13)
2. Construction of sgRNA expression plasmid
First, a sequence of the target site as designed was sent to a company to synthesize single-stranded oligonucleotides, as shown below:
RRF3F:agat catttgtatccgtatccttgcggg(l 11-134) (SEQ ID NO. 14)
RRF3R:aagc cccgcaaggatacggatacaaatg (SEQ ID NO. 15)
RRF3F and RRF3R were annealed (at 95°C for 5 min, at 72°C for 10 min, on ice) to obtain a short double-stranded DNA fragment with sticky end; after digestion with BbsI, the fragment was ligated to a pLbCpfl-sgRNA vector (meanwhile, pLbCpfl-sgRNA was digested with BbsI, and the recovered restriction fragments was ligated to the short double-stranded DNA fragment) to obtain a TF3 target sequence sgRNA expression vector pLbCpfl-TF3.
Forward single-stranded RRF3F of an oligonucleotide was paired with reverse primer X2sgRNA-R; the corresponding vector was tested; if a 120 bp PCR product was obtained, the vector would be positive and be used for subsequent sequencing; sequencing results were aligned with an RRF3F sequence, respectively; in case of a positive rate of 100%, a correct plasmid would be determined.
Reverse primer: X2sgRNA-R: 5' cagtgggagtggcacctt 3' (further used as a sequencing primer) (SEQ ID NO. 16) pLbCpfl-TF3 and pCMV-dCpfl-RR-eBE vector were tranfected into Diqing sheep skin fibroblasts DQSHS1 in a mass ratio of 1:1, as experimental groups. Each group was treated in triplicate; for each treatment, total mass of transfected plasmids was 0.5 pg, the number of transfected cells was 1 x IO6 cells, transfection reagent was DNA Feet Transfection Reagent (CWBIO, Cat No. CW0860); addition of the transfection reagent in each treatment was 6 pL; operations were performed according to the instructions. Control group was cotransfected with pLbCpfl-sgRNA empty plasmid and pCMV-dCpfl-RR-eBE recombinant plasmid (the control group had the same ratio and total mass of transfection as the experimental group).
After culture for 48 h, cell genomic DNAs were extracted, DKK2-F and DKK2-R were
2020100740 11 May 2020 subjected to PCR amplification using primers, and a 440 bp PCR product obtained was cloned and sequenced.
DKK2-F: agactgagttcacacggtgc (SEQ ID NO. 17)
DKK2-R: cgggtccctacctcttctgg (SEQ ID NO. 18)
A total of 10 monoclonal colony sequences were selected. Sequencing results of 3 of monoclonal sequences showed C-T mutations at the target site compared with the original sequence (i.e., DKK2-440 sequence). For mutated sequence, see DKK2-TF3. Moreover, there was no mutation at non-target sites; base editing efficiency was 30%. It was indicated that the base editor constructed in the present invention can modify mammalian genomic DNA sequences effectively and is an efficient chromosomal base editor.
The DKK2-TF3 sequence is as follows:
agactgagttcacacggtgctgggcccccaaagccaagtggggttgggggaacagagtctgcgagtcccggcgccccgagtgcagggccc cgtgttggggtcctccttcccatttgtatttgtatccttgcgggctttgcgcctccccgggggacccctcgccgggagatggccgcactgatgcg gggcaaggactcctcccgctgcctgctcctactggccgcggtgctgatggtggagagctcacagttcggcagctcgcgggccaaactcaactc catcaagtcctctctgggcggggagacgcctgcccaggccgccaatcgatctgcgggcacttaccaaggactggctttcggcggcagtaaga agggcaaaaacctggggcaggtaggaaaatacccccaatacactcttcaaccagaagaggtagggacccg(SEQ ID NO. 19)
Example 3
Use of the base editor in gene editing of mammalian cell lines
1. sgRNA target design
Sheep DKK2 gene extracted from a sequence of sheep chromosome 6 (NCBI GI: 417531944) includes a sequence of exon 1 (DKK2-440, as shown below). A Cpfl sgRNA target was designed.
Agactgagttcacacggtgctgggcccccaaagccaagtggggttgggggaacagagtctgcgagtcccggcgccccgagtgcag ggccccgtgttggggtcctccttcccatttgtatccgtatccttgcgggctttgcgcctccccgggggacccctcgccgggagatggccgcact gatgcggggcaaggactcctcccgctgcctgctcctactggccgcggtgctgatggtggagagctcacagttcggcagctcgcgggccaaac tcaactccatcaagtcctctctgggcggggagacgcctgcccaggccgccaatcgatctgcgggcacttaccaaggactggctttcggcggca gtaagaagggcaaaaacctggggcaggtaggaaaatacccccaatacactcttcaaccagaagaggtagggacccg (SEQ ID NO. 12)
Target site TF7: gcgggc (SEQ ID NO. 20)
2. Construction of sgRNA expression plasmid
First, a sequence of the target site as designed was sent to a company to synthesize single-stranded oligonucleotides, as shown below:
RRF7F:agat gcagctcgcgggccaaactcaact (254-277) SEQ ID NO. 21)
RRF7R: aagc agttgagtttggcccgcgagctgc (SEQ ID NO. 22)
RRF7F and RRF7R were annealed (at 95°C for 5 min, at 72°C for 10 min, on ice) to obtain a short double-stranded DNA fragment with sticky end; after digestion with BbsI, the fragment was
2020100740 11 May 2020 ligated to a pLbCpfl-sgRNA vector (meanwhile, pLbCpfl-sgRNA was digested with BbsI, and the recovered restriction fragments was ligated to the short double-stranded DNA fragment) to obtain a TF7 target sequence sgRNA expression vector pLbCpfl-TF7.
Forward single-stranded RRF7F of an oligonucleotide was paired with reverse primer X2sgRNA-R; the corresponding vector was tested; if a 120 bp PCR product was obtained, the vector would be positive and be used for subsequent sequencing; sequencing results were aligned with an RRF7F sequence, respectively; in case of a positive rate of 100%, a correct plasmid would be determined.
Reverse primer: X2sgRNA-R: 5' CAGTGGGAGTGGCACCTT 3' (further used as a sequencing primer) (SEQ ID NO. 16) pLbCpfl-TF7 and pCMV-dCpfl-RR-eBE vector were tranfected into Diqing sheep skin fibroblasts DQSHS1 in a mass ratio of 1:1, as an experimental group. Each group was treated in triplicate; for each treatment, total mass of transfected plasmids was 0.5 pg, the number of transfected cells was 1 x IO6 cells, transfection reagent was DNA Feet Transfection Reagent (CWBIO, Cat No. CW0860); addition of the transfection reagent in each treatment was 6 pL; operations were performed according to the instructions. Control group was cotransfected with pLbCpfl-sgRNA empty plasmid and pCMV-dCpfl-RR-eBE recombinant plasmid (the control group had the same ratio and total mass of transfection as the experimental group).
After culture for 48 h, cell genomic DNAs were extracted, DKK2-F and DKK2-R were subjected to PCR amplification using primers, and a 440 bp PCR product obtained was cloned and sequenced.
DKK2-F: agactgagttcacacggtgc (SEQ ID NO. 17)
DKK2-R: cgggtccctacctcttctgg (SEQ ID NO. 18)
A total of 10 monoclonal colony sequences were selected. Sequencing results of 3 of monoclonal sequences showed C-T mutations at the target site compared with the original sequence (i.e., DKK2-440 sequence). For mutated sequence, see DKK2-TF7. Moreover, there was no mutation at non-target sites; base editing efficiency was 30%. It was indicated that the base editor constructed in the present invention can modify mammalian genomic DNA sequences effectively and is an efficient chromosomal base editor.
The DKK2-TF7 sequence is as follows:
agactgagttcacacggtgctgggcccccaaagccaagtggggttgggggaacagagtctgcgagtcccggcgccccgagtgcagggccc cgtgttggggtcctccttcccatttgtatccgtatccttgcgggctttgcgcctccccgggggacccctcgccgggagatggccgcactgatgcg gggcaaggactcctcccgctgcctgctcctactggccgcggtgctgatggtggagagctcacagttcggcagctcgtgggtcaaactcaactc catcaagtcctctctgggcggggagacgcctgcccaggccgccaatcgatctgcgggcacttaccaaggactggctttcggcggcagtaaga agggcaaaaacctggggcaggtaggaaaatacccccaatacactcttcaaccagaagaggtagggacccg (SEQ ID NO. 23)
2020100740 11 May 2020
Example 4
Use of the base editor in gene editing of mammalian cell lines
1. sgRNA target design
Sheep DKK2 gene extracted from a sequence of sheep chromosome 6 (NCBI GI: 417531944) includes a sequence of exon 1 (DKK2-440, as shown below). A Cpfl sgRNA target was designed.
Agactgagttcacacggtgctgggcccccaaagccaagtggggttgggggaacagagtctgcgagtcccggcgccccgagtgcag ggccccgtgttggggtcctccttcccatttgtatccgtatccttgcgggctttgcgcctccccgggggacccctcgccgggagatggccgcact gatgcggggcaaggactcctcccgctgcctgctcctactggccgcggtgctgatggtggagagctcacagttcggcagctcgcgggccaaac tcaactccatcaagtcctctctgggcggggagacgcctgcccaggccgccaatcgatctgcgggcacttaccaaggactggctttcggcggca gtaagaagggcaaaaacctggggcaggtaggaaaatacccccaatacactcttcaaccagaagaggtagggacccg (SEQ ID NO. 12)
Target site TRI: caagtg (SEQ ID NO. 24) (the target was reverse)
2. Construction of sgRNA expression plasmid
First, a sequence of the target site as designed was sent to a company to synthesize single-stranded oligonucleotides, as shown below:
RRRlF:agat ccaaccccacttggctttgggggc (SEQ ID NO.25)
RRRlR:aagc gcccccaaagccaagtggggttgg(24-47) (SEQ ID NO. 26)
RRR1F and RRR1R were annealed (at 95°C for 5 min, at 72°C for 10 min, on ice) to obtain a short double-stranded DNA fragment with sticky end; after digestion with BbsI, the fragment was ligated to a pLbCpfl-sgRNA vector (meanwhile, pLbCpfl-sgRNA was digested with BbsI, and the recovered restriction fragments was ligated to the short double-stranded DNA fragment) to obtain a TF7 target sequence sgRNA expression vector pLbCpfl-TRl.
Forward single-stranded RRR1F of an oligonucleotide was paired with reverse primer X2sgRNA-R; the corresponding vector was tested; if a 120 bp PCR product was obtained, the vector would be positive and be used for subsequent sequencing; sequencing results were aligned with an RRF7F sequence, respectively; in case of a positive rate of 100%, a correct plasmid would be determined.
Reverse primer: X2sgRNA-R: 5' CAGTGGGAGTGGCACCTT 3' (further used as a sequencing primer) (SEQ ID NO. 16) pLbCpfl-TRl and pCMV-dCpfl-RR-eBE vector were tranfected into Diqing sheep skin fibroblasts DQSHS1 in a mass ratio of (1-5):(1-5), as an experimental group. Each group was treated in triplicate; for each treatment, total mass of transfected plasmids was 0.5 pg, the number of transfected cells was 1 χ 106 cells, transfection reagent was DNA Feet Transfection Reagent (CWBIO, Cat No. CW0860); addition of the transfection reagent in each treatment was 6 pL; operations were performed according to the instructions. Control group was cotransfected with pLbCpfl-sgRNA empty plasmid and pCMV-dCpfl-RR-eBE recombinant plasmid (the control
2020100740 11 May 2020 group had the same ratio and total mass of transfection as the experimental group).
After culture for 48 h, cell genomic DNAs were extracted, DKK2-F and DKK2-R were subjected to PCR amplification using primers, and a 440 bp PCR product obtained was cloned and sequenced.
DKK2-F: agactgagttcacacggtgc (SEQ ID NO. 17)
DKK2-R: cgggtccctacctcttctgg (SEQ ID NO. 18)
A total of 10 monoclonal colony sequences were selected. Sequencing results of 2 of monoclonal sequences showed C-T mutations at the target site compared with the original sequence (i.e., DKK2-440 sequence). For mutated sequence, see DKK2-TR1. Moreover, there was no mutation at non-target sites; base editing efficiency was 20%. It was indicated that the base editor constructed in the present invention can modify mammalian genomic DNA sequences effectively and is an efficient chromosomal base editor.
The DKK2-TR1 sequence is as follows: agactgagttcacacggtgctgggcccccaaagccaaatagggttgggggaacagagtctgcgagtcccggcgccccgagtgcagggccc cgtgttggggtcctccttcccatttgtatccgtatccttgcgggctttgcgcctccccgggggacccctcgccgggagatggccgcactgatgcg gggcaaggactcctcccgctgcctgctcctactggccgcggtgctgatggtggagagctcacagttcggcagctcgcgggccaaactcaactc catcaagtcctctctgggcggggagacgcctgcccaggccgccaatcgatctgcgggcacttaccaaggactggctttcggcggcagtaaga agggcaaaaacctggggcaggtaggaaaatacccccaatacactcttcaaccagaagaggtagggacccg (SEQ ID NO. 27)
Example 5
Three Cpfl sgRNA targets, ΤΙ, T2, and T3, were designed based on sheep DKK2 exon 1.
A 440 bp equence of the sheep DKK2 exon 1 :(italic indicates the start site and termination sites of an exon 1 coding region; underlying parts present three target sequences; relative to the present sequence, the third target sequence is reverse) agactgagttcacacggtgctgggcccccaaagccaagtggggttgggggaacagagtctgcgagtcccggcgccccgagtgcagg gcccc gtgttggggtcctccttcccatttgtatccgtatccttgcgggctttgcgcctccccggg ggacccctcgccgggaga/ggccgcactgatgcggggcaaggactcctcccgctgcctgctcctactggccgcggtgctgatggtggagag ctcacagttcggcagctcgcgggccaaactcaactccatcaagtcctctctgggcggggagacgcctgcccaggccgccaatcgatctgcgg gcacttaccaaggactggctttcggcggcagtaagaagggcaaaaacctggggcagg taggaaaatacccccaatacactcttcaaccagaagaggtagggacccg (SEQ ID NO. 12)
Six oligonucleotides synthesized are as follows:
T1F: agattatccgtatccttgcgggctttg (117-139) (SEQ ID NO. 28)
T1R: aagccaaagcccgcaaggatacggata (SEQ ID NO. 29)
T2F: agatggcggcagtaagaagggcaaaaa (358-380) (SEQ ID NO. 30)
T2R: aagctttttgcccttcttactgccgcc (SEQ ID NO. 31)
T3F: agatgcccgcgagctgccgaactgtga (SEQ ID NO. 32)
2020100740 11 May 2020
T3R: aagctcacagttcggcagctcgcgggc (244-266) (SEQ ID NO.33)
Tl-F and Tl-R, T2-F and T2-R, T3-F and T3-R were annealed pairwise (at 95°C for 5 min, at 72°C for 10 min, on ice) to obtain three double-stranded DNA oligonucleotides (ΤΙ, T2, and T3); meanwhile, pLbCpfl-sgRNA vector was digested with endonuclease BbsI and purified; ΤΙ, T2, and T3 were ligated to the digested pLbCpfl-sgRNA vector and transformed to obtain pLbCpfl-ΤΙ, pLbCpfl-T2, and pLbCpfl-T3 vectors, respectively.
Steps of ligation:
Ligation system (10 pL; ligation reagents purchased from NEB, Cat No. M0202S): including 1 pL of T4 DNA ligase, 1 pL of T4 DNA ligase buffer, 4 pL of double-stranded DNA oligonucleotide (ΤΙ, T2, or T3), and 4 pL of linearized pLbCpfl-sgRNA vector.
Ligation condition: overnight at 4°C.
Steps of transformation:
Five microliters of ligation product was charged into 50 pL of competent cells (purchased from Takara Biotechnology (Dalian) Co. Ltd., Cat No. 9057), flicked, mixed well, allowed to stand on ice for 30 min, heat-shocked for 90 s at 42°C, allowed to stand on ice for 2 min, supplemented with 500 pL of LB medium, and recovered in a rotary shaker at 37°C at 200 rpm for 1 h; 100 pL of recovered cell suspension was applied evenly on a solid LB medium supplemented with 60 mg/ml ampicillin, and allowed to stand and culture at 31 °C for 14 h.
After the ligation and transformation, PCR amplification and sequencing were conducted.
Steps and parameters of PCR:
Colony picking: Five to ten single colonies were picked from the solid LB medium plate in the previous step, placed in 1 mL of LB liquid medium supplemented with 60 mg/ml ampicillin, and cultured in the rotary shaker at 37°C at 200 rpm for 2 h for subsequent PCR.
PCR spiking system (25 pL): including 22 pL of PCR MIX, 1 pL of cell suspension (obtained in the previous step), 1 pL of forward primer (T1F, T2F, or T3F), and 1 pL of reverse primer X2sgRNA-R.
PCR amplification program: 95°C for 3 min, followed by 30 cycles (95°C for 30 s, 60°C for 30 s, and 72°C for 30 s), and final extension at 72°C for 5 min.
Determination of PCR results: If a 120 bp PCR product is obtained, positivity will be determined, for subsequent sequencing.
Determination of sequencing conditions and results: Reverse primer X2sgRNA-R was used as a sequencing primer. Sequencing results were aligned with the forward oligonucleotide T1F, T2F, or T3F of the corresponding target; in case of 100% homology, a correct plasmid will be determined.
Activity assay of dual-luciferase report gene pLbCpfl-ΤΙ, pLbCpfl-T2, and pLbCpfl-T3 vectors were cotransfected with a pYOlO plasmid (purchased from Addgene, Cat No. 69982) and a dual-luciferase reporter vector SSA-DKK2 in a
2020100740 11 May 2020 ratio of 1:1:1, respectively; after 48 h, activity of dual-luciferase report gene was assayed by a kit (results are shown in Table 1). Results indicated that sgRNAs expressed by pLbCpfl-Tl, pLbCpfl-T2, and pLbCpfl-T3 vectors actually had activity of recognizing and binding to specific DNA targets, i.e., results demonstrated that universal pLbCpfl-sgRNA expression vectors were effective.
Table 1 Activity assay of dual-luciferase report gene
| Combination of transfected plasmids | Firefly luciferase activity | Ranilla luciferase activity | Ratio | |
| Control-1 | SSA-DKK2+pLbCpfl -sgRNA+pYO 10 | 1252301 | 53896 | 23.2355 |
| Control -2 | 1003521 | 36854 | 27.2296 | |
| Control -3 | 965348 | 43897 | 21.9912 | |
| Experimental 1-1 | SS A-DKK2+pLbCpf 1 -T1 +p Y010 | 254687 | 186942 | 1.3624 |
| Experimental 1-2 | 3587950 | 2159742 | 1.6613 | |
| Experimental 1-3 | 4359620 | 3569871 | 1.2212 | |
| Experimental 2-1 | SS A-DKK2+pLbCpf 1 -T2+p Y010 | 1755641 | 2645123 | 0.6637 |
| Experimental 2-2 | 12695873 | 25468911 | 0.4985 | |
| Experimental 2-3 | 1678954 | 2986412 | 0.5622 | |
| Experimental 3-1 | SSA-DKK2+pLbCpfl -T3+pY010 | 2532165 | 4548971 | 0.5566 |
| Experimental 3-2 | 1585417 | 3876540 | 0.4090 | |
| Experimental 3-3 | 3689456 | 5897641 | 0.6256 |
From above examples, the base editor of the present invention specifically mutates cytosine (C) to thymine (T) at a target site, but has no effect on bases at a non-target site. Gene editing efficiency ranges between 20% and 30%. The base editor can modify mammalian genomic DNA sequences effectively and is an efficient genetic base editor.
The above descriptions are merely preferred implementations of the present invention. It should be noted that a person of ordinary skill in the art may further make several improvements and modifications without departing from the principle of the present invention, but such improvements and modifications shall also be deemed as falling within the protection scope of the present invention.
Sequence Listing
2020100740 11 May 2020 < 110> Qingdao Agricultural University <120> BASE EDITOR, PREPARATION METHOD AND USE THEREOF <160> 33 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2814 <212> DNA <213> Artificial Sequence <400> 1 ctgcaggagt acgccgacgc tgacctgtca gtcgtggaga aactcaagga gatcataatc 60 cagaaggtgg atgaaatcta caaagtgtat ggaagctctg agaaactctt cgatgcagac 120 tttgttctgg agaagagtct gaagaagaac gacgcagtgg ttgctatcat gaaggacctg 180 ctggattctg ttaagtcttt cgagaattac attaaggcat tctttggtga agggaaggag 240 acaaataggg acgagagctt ctatggcgac tttgttctgg cctacgacat cctcctcaag 300 gttgaccaca tctatgacgc tatacggaat tacgttaccc agaagcccta tagcaaagac 360 aagttcaagc tgtatttcca gaatccacag tttatgcgcg ggtgggataa agacaaagaa 420 acagattaca gggccactat cctgcggtac ggcagcaaat actatctggc tatcatggat 480 aagaagtacg ccaaatgcct ccagaagatc gacaaggacg acgtgaacgg taactacgag 540 aagatcaatt acaagctcct gccaggacct aacaagatgc tgccccgggt gttcttctcc 600 aagaaatgga tggcctacta taacccaagc gaggacattc agaagatata caagaatggg 660 acattcaaga agggcgatat gttcaacctc aacgactgcc acaagctgat tgatttcttc 720 aaggatagca tttctcgcta tcccaagtgg tctaatgcat acgatttcaa cttcagcgag 780
2020100740 11 May 2020 actgagaagt acaaagacat cgctggcttc taccgggagg tggaagagca aggctataag 840 gtgtcattcg aatccgcttc taagaaggaa gtggataagc tcgtggaaga gggtaagctg 900 tacatgttcc agatatacaa caaagacttc agcgataaga gccacggcac tccaaacctc 960 catactatgt atttcaagct gctgtttgac gagaacaacc acggacagat taggctgtca 1020 ggaggcgcag aactcttcat gcgcagagct tcactgaaga aggaggaact cgttgtccac 1080 ccagccaata gccctatagc caataagaat ccagacaatc ctaagaaaac cactactctg 1140 tcttacgatg tgtataagga taagagattc tctgaagatc agtacgaact gcacataccc 1200 attgccatta acaagtgccc taagaacatc ttcaagatta acacagaggt tagagtgctc 1260 ctgaaacacg acgataaccc ttatgttata ggcattgctc gcggagagag aaacctgctg 1320 tacatcgtcg tggtggacgg caaaggcaac atcgtggaac agtacagtct caatgaaatc 1380 attaacaatt tcaacggaat ccgcattaag accgactacc attctctcct cgacaagaag 1440 gagaaagaaa ggttcgaagc aagacagaat tggacaagta tagagaatat caaagaactg 1500 aaggctgggt acatctctca ggttgtgcac aagatatgtg agctggtgga gaagtacgac 1560 gctgttatcg ccctcgcgga cctgaatagc ggcttcaaga actccagggt gaaggtggag 1620 aagcaggtgt atcagaagtt cgagaagatg ctgatcgaca agctcaacta tatggtggac 1680 aagaaatcca atccttgcgc tactggtgga gccctgaagg gctatcaaat caccaataag 1740 ttcgaatctt tcaagtctat gagcacccag aatggcttca tcttctacat acccgcatgg 1800 ctgacatcca agattgatcc ctctaccgga tttgttaatc tgctcaagac taagtacacc 1860 tctattgctg actcaaagaa gttcatatca tcatttgacc gcatcatgta cgtgccagaa 1920 gaggacctgt tcgagtttgc cctggattac aagaatttct ctcggactga cgccgactac 1980 atcaagaagt ggaagctcta ctcttatggt aatcggattc gcatattccg caatcccaag 2040 aagaataacg tgttcgattg ggaggaagtt tgcctcacca gcgcttacaa ggagctgttc 2100 aataagtatg ggattaacta ccagcagggc gacataagag ccctgctgtg cgaacaatct 2160 gataaggcat tctattcctc tttcatggca ctgatgtcac tgatgctgca aatgcgcaat 2220 tccatcaccg gaagaacaga cgtggccttt ctgatctctc ctgtcaagaa ctcagatggc 2280 atcttctacg attcccgcaa ctatgaagca caggagaatg ctatcctgcc taagaatgcc 2340 gatgcaaatg gagcctataa catcgccaga aaggtcctct gggccatagg acaattcaag 2400 aaagctgaag atgagaagct ggacaaggtg aagatcgcca tttcaaacaa agagtggctc 2460 gaatatgctc agacctcagt gaagcatgga tcacccaaga agaaacggaa agtgtctggt 2520 ggttctacta atctgtcaga tattattgaa aaggagaccg gtaagcaact ggttatccag 2580
2020100740 11 May 2020 gaatccatcc tcatgctccc agaggaggtg gaagaagtca ttgggaacaa gccggaaagc 2640 gatatactcg tgcacaccgc ctacgacgag agcaccgacg agaatgtcat gcttctgact 2700 agcgacgccc ctgaatacaa gccttgggct ctggtcatac aggatagcaa cggtgagaac 2760 aagattaaga tgctctctgg tggttctccc aagaagaaga ggaaagtcgg gccc 2814 <210> 2 <211> 859 <212> DNA <213> Artificial Sequence <400> 2 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 cgaaacaccg taatttctac taagtgtaga tgggtcttcg ggcgagctgc acgctgccgt 300 cctcgatgtt gtggcggatc ttgaagttca ccttgatgcc gttcttctgc ttgtcggcca 360 tgatatagac gttgtggctg ttgtagttgt actccagctt gtgccccagg atgttgccgt 420 cctccttgaa gtcgatgccc ttcagctcga tgcggttcac cagggtgtcg ccctcgaact 480 tcacctcggc gcgggtcttg tagttgccgt cgtccttgaa gaagatggtg cgctcctgga 540 cgtagccttc gggcatggcg gacttgaaga agtcgtgctg cttcatgtgg tcggggtagc 600 ggctgaagca agaagacctg cttttttcta gagctcgctg atcagcctcg actgtgcctt 660 ctagttgcca gccatctgtt gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg 720 ccactcccac tgtcctttcc taataaaatg aggaaattgc atcgcattgt ctgagtaggt 780 gtcattctat tctggggggt ggggtggggc aggacagcaa gggggaggat tgggaagaga 840 atagcaggca tgctgggga 859 <210> 3 <211> 3569 <212> DNA <213> Artificial Sequence
2020100740 11 May 2020 <400> 3 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360 tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acctcgcgaa 420 tgcatctaga tgagggccta tttcccatga ttccttcata tttgcatata cgatacaagg 480 ctgttagaga gataattgga attaatttga ctgtaaacac aaagatatta gtacaaaata 540 cgtgacgtag aaagtaataa tttcttgggt agtttgcagt tttaaaatta tgttttaaaa 600 tggactatca tatgcttacc gtaacttgaa agtatttcga tttcttggct ttatatatct 660 tgtggaaagg acgaaacacc gtaatttcta ctaagtgtag atgggtcttc gggcgagctg 720 cacgctgccg tcctcgatgt tgtggcggat cttgaagttc accttgatgc cgttcttctg 780 cttgtcggcc atgatataga cgttgtggct gttgtagttg tactccagct tgtgccccag 840 gatgttgccg tcctccttga agtcgatgcc cttcagctcg atgcggttca ccagggtgtc 900 gccctcgaac ttcacctcgg cgcgggtctt gtagttgccg tcgtccttga agaagatggt 960 gcgctcctgg acgtagcctt cgggcatggc ggacttgaag aagtcgtgct gcttcatgtg 1020 gtcggggtag cggctgaagc aagaagacct gcttttttct agagctcgct gatcagcctc 1080 gactgtgcct tctagttgcc agccatctgt tgtttgcccc tcccccgtgc cttccttgac 1140 cctggaaggt gccactccca ctgtcctttc ctaataaaat gaggaaattg catcgcattg 1200 tctgagtagg tgtcattcta ttctgggggg tggggtgggg caggacagca agggggagga 1260 ttgggaagag aatagcaggc atgctgggga atcggatccc gggcccgtcg actgcagagg 1320 cctgcatgca agcttggcgt aatcatggtc atagctgttt cctgtgtgaa attgttatcc 1380 gctcacaatt ccacacaaca tacgagccgg aagcataaag tgtaaagcct ggggtgccta 1440 atgagtgagc taactcacat taattgcgtt gcgctcactg cccgctttcc agtcgggaaa 1500 cctgtcgtgc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat 1560 tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg 1620 agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc 1680 aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgttl740
2020100740 11 May 2020 gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag 1800 tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc 1860 cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc 1920 ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt 1980 cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt 2040 atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc 2100 agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa 2160 gtggtggcct aactacggct acactagaag aacagtattt ggtatctgcg ctctgctgaa 2220 gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg 2280 tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga 2340 agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg 2400 gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg 2460 aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt 2520 aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact 2580 ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat 2640 gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg 2700 aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg 2760 ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat 2820 tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc 2880 ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt 2940 cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc 3000 agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga 3060 gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc 3120 gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa 3180 acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta 3240 acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg 3300 agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg3360 aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat 3420 gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt 3480 tccccgaaaa gtgccacctg acgtctaaga aaccattatt atcatgacat taacctataa 3540 aaataggcgt atcacgaggc cctttcgtc 3569
2020100740 11 May 2020 <210> 4 <211> 7123 <212> DNA <213> Artificial Sequence <400> 4 agatctgcgc agcaccatgg cctgaaataa cctctgaaag aggaacttgg ttaggtacct 60 tctgaggcgg aaagaaccag ctgtggaatg tgtgtcagtt agggtgtgga aagtccccag 120 gctccccagc aggcagaagt atgcaaagca tgcatctcaa ttagtcagca accaggtgtg 180 gaaagtcccc aggctcccca gcaggcagaa gtatgcaaag catgcatctc aattagtcag 240 caaccatagt cccgccccta actccgccca tcccgcccct aactccgccc agttccgccc 300 attctccgcc ccatggctga ctaatttttt ttatttatgc agaggccgag gccgcctcgg 360 cctctgagct attccagaag tagtgaggag gcttttttgg aggcctaggc ttttgcaaaa 420 agcttgattc ttctgacaca acagtctcga acttaagctg cagaagttgg tcgtgaggca 480 ctgggcaggt aagtatcaag gttacaagac aggtttaagg agaccaatag aaactgggct 540 tgtcgagaca gagaagactc ttgcgtttct gataggcacc tattggtctt actgacatcc 600 actttgcctt tctctccaca ggtgtccact cccagttcaa ttacagctct taaggctaga 660 gtacttaata cgactcacta taggctagcc accatggctt ccaaggtgta cgaccccgag 720 caacgcaaac gcatgatcac tgggcctcag tggtgggctc gctgcaagca aatgaacgtg 780 ctggactcct tcatcaacta ctatgattcc gagaagcacg ccgagaacgc cgtgattttt 840 ctgcatggta acgctgcctc cagctacctg tggaggcacg tcgtgcctca catcgagccc 900 gtggctagat gcatcatccc tgatctgatc ggaatgggta agtccggcaa gagcgggaat 960 ggctcatatc gcctcctgga tcactacaag tacctcaccg cttggttcga gctgctgaac 1020 cttccaaaga aaatcatctt tgtgggccac gactgggggg cttgtctggc ctttcactac 1080 tcctacgagc accaagacaa gatcaaggcc atcgtccatg ctgagagtgt cgtggacgtg 1140 atcgagtcct gggacgagtg gcctgacatc gaggaggata tcgccctgat caagagcgaa 1200 gagggcgaga aaatggtgct tgagaataac ttcttcgtcg agaccatgct cccaagcaag 1260 atcatgcgga aactggagcc tgaggagttc gctgcctacc tggagccatt caaggagaag 1320 ggcgaggtta gacggcctac cctctcctgg cctcgcgaga tccctctcgt taagggaggc 1380 aagcccgacg tcaccggtaa aggcgcgcca gactgagttc acacggtgct gggcccccaa 1440
2020100740 11 May 2020 agccaagtgg ggttggggga acagagtctg cgagtcccgg cgccccgagt gcagggccccl500 gtgttggggt cctccttccc atttgtatcc gtatccttgc gggctttgcg cctccccggg 1560 ggacccctcg ccgggagatg gccgcactga tgcggggcaa ggactcctcc cgctgcctgc 1620 tcctactggc cgcggtgctg atggtggaga gctcacagtt cggcagctcg cgggccaaac 1680 tcaactccat caagtcctct ctgggcgggg agacgcctgc ccaggccgcc aatcgatctg 1740 cgggcactta ccaaggactg gctttcggcg gcagtaagaa gggcaaaaac ctggggcagg 1800 taggaaaata cccccaatac actcttcaac cagaagaggt agggacccgg tcgacaaacc 1860 tgcaggaaaa ctagtcctca ccgcttggtt cgagctgctg aaccttccaa agaaaatcat 1920 ctttgtgggc cacgactggg gggcttgtct ggcctttcac tactcctacg agcaccaaga 1980 caagatcaag gccatcgtcc atgctgagag tgtcgtggac gtgatcgagt cctgggacga 2040 gtggcctgac atcgaggagg atatcgccct gatcaagagc gaagagggcg agaaaatggt 2100 gcttgagaat aacttcttcg tcgagaccat gctcccaagc aagatcatgc ggaaactgga 2160 gcctgaggag ttcgctgcct acctggagcc attcaaggag aagggcgagg ttagacggcc 2220 taccctctcc tggcctcgcg agatccctct cgttaaggga ggcaagcccg acgtcgtcca 2280 gattgtccgc aactacaacg cctaccttcg ggccagcgac gatctgccta agatgttcat 2340 cgagtccgac cctgggttct tttccaacgc tattgtcgag ggagctaaga agttccctaa 2400 caccgagttc gtgaaggtga agggcctcca cttcagccag gaggacgctc cagatgaaat 2460 gggtaagtac atcaagagct tcgtggagcg cgtgctgaag aacgagcagt aattctaggc 2520 gatcgctcga gcccgggaat tcgtttaaac ctagagcggc cgctggccgc aataaaatat 2580 ctttattttc attacatctg tgtgttggtt ttttgtgtga ggatctaaat gagtcttcgg 2640 acctcgcggg ggccgcttaa gcggtggtta gggtttgtct gacgcggggg gagggggaag 2700 gaacgaaaca ctctcattcg gaggcggctc ggggtttggt cttggtggcc acgggcacgc 2760 agaagagcgc cgcgatcctc ttaagcaccc ccccgccctc cgtggaggcg ggggtttggt 2820 cggcgggtgg taactggcgg gccgctgact cgggcgggtc gcgcgcccca gagtgtgacc2880 ttttcggtct gctcgcagac ccccgggcgg cgccgccgcg gcggcgacgg gctcgctggg 2940 tcctaggctc catggggacc gtatacgtgg acaggctctg gagcatccgc acgactgcgg 3000 tgatattacc ggagaccttc tgcgggacga gccgggtcac gcggctgacg cggagcgtcc 3060 gttgggcgac aaacaccagg acggggcaca ggtacactat cttgtcaccc ggaggcgcga 3120 gggactgcag gagcttcagg gagtggcgca gctgcttcat ccccgtggcc cgttgctcgc 3180 gtttgctggc ggtgtccccg gaagaaatat atttgcatgt ctttagttct atgatgacac 3240 aaaccccgcc cagcgtcttg tcattggcga attcgaacac gcagatgcag tcggggcggc 3300
2020100740 11 May 2020 gcggtcccag gtccacttcg catattaagg tgacgcgtgt ggcctcgaac accgagcgac 3360 cctgcagcga cccgcttaaa agcttggcat tccggtactg ttggtaaagc caccatggcc 3420 gatgctaaga acattaagaa gggccctgct cccttctacc ctctggagga tggcaccgct 3480 ggcgagcagc tgcacaaggc catgaagagg tatgccctgg tgcctggcac cattgccttc 3540 accgatgccc acattgaggt ggacatcacc tatgccgagt acttcgagat gtctgtgcgc 3600 ctggccgagg ccatgaagag gtacggcctg aacaccaacc accgcatcgt ggtgtgctct 3660 gagaactctc tgcagttctt catgccagtg ctgggcgccc tgttcatcgg agtggccgtg 3720 gcccctgcta acgacattta caacgagcgc gagctgctga acagcatggg catttctcag 3780 cctaccgtgg tgttcgtgtc taagaagggc ctgcagaaga tcctgaacgt gcagaagaag 3840 ctgcctatca tccagaagat catcatcatg gactctaaga ccgactacca gggcttccag 3900 agcatgtaca cattcgtgac atctcatctg cctcctggct tcaacgagta cgacttcgtg 3960 ccagagtctt tcgacaggga caaaaccatt gccctgatca tgaacagctc tgggtctacc 4020 ggcctgccta agggcgtggc cctgcctcat cgcaccgcct gtgtgcgctt ctctcacgcc 4080 cgcgacccta ttttcggcaa ccagatcatc cccgacaccg ctattctgag cgtggtgcca 4140 ttccaccacg gcttcggcat gttcaccacc ctgggctacc tgatttgcgg ctttcgggtg 4200 gtgctgatgt accgcttcga ggaggagctg ttcctgcgca gcctgcaaga ctacaaaatt 4260 cagtctgccc tgctggtgcc aaccctgttc agcttcttcg ctaagagcac cctgatcgac 4320 aagtacgacc tgtctaacct gcacgagatt gcctctggcg gcgccccact gtctaaggag 4380 gtgggcgaag ccgtggccaa gcgctttcat ctgccaggca tccgccaggg ctacggcctg 4440 accgagacaa ccagcgccat tctgattacc ccagagggcg acgacaagcc tggcgccgtg 4500 ggcaaggtgg tgccattctt cgaggccaag gtggtggacc tggacaccgg caagaccctg 4560 ggagtgaacc agcgcggcga gctgtgtgtg cgcggcccta tgattatgtc cggctacgtg 4620 aataaccctg aggccacaaa cgccctgatc gacaaggacg gctggctgca ctctggcgac 4680 attgcctact gggacgagga cgagcacttc ttcatcgtgg accgcctgaa gtctctgatc 4740 aagtacaagg gctaccaggt ggccccagcc gagctggagt ctatcctgct gcagcaccct 4800 aacattttcg acgccggagt ggccggcctg cccgacgacg atgccggcga gctgcctgcc 4860 gccgtcgtcg tgctggaaca cggcaagacc atgaccgaga aggagatcgt ggactatgtg 4920 gccagccagg tgacaaccgc caagaagctg cgcggcggag tggtgttcgt ggacgaggtg 4980 cccaagggcc tgaccggcaa gctggacgcc cgcaagatcc gcgagatcct gatcaaggct 5040 aagaaaggcg gcaagatcgc cgtgtaataa ttctagagtc ggggcggccg gccgcttcga 5100 gcagacatga taagatacat tgatgagttt ggacaaacca caactagaat gcagtgaaaa 5160
2020100740 11 May 2020 aaatgcttta tttgtgaaat ttgtgatgct attgctttat ttgtaaccat tataagctgc 5220 aataaacaag ttaacaacaa caattgcatt cattttatgt ttcaggttca gggggaggtg 5280 tgggaggttt tttaaagcaa gtaaaacctc tacaaatgtg gtaaaatcga taaggatcca 5340 ggtggcactt ttcggggaaa tgtgcgcgga acccctattt gtttattttt ctaaatacat 5400 tcaaatatgt atccgctcat gagacaataa ccctgataaa tgcttcaata atattgaaaa 5460 aggaagagta tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt 5520 tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag 5580 ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt 5640 tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg 5700 gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag 5760 aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta 5820 agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttacttctg 5880 acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta 5940 actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac 6000 accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt 6060 actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca 6120 cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agccggtgag 6180 cgtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta 6240 gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag 6300 ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt 6360 tagattgatt taaaacttca tttttaattt aaaaggatct aggtgaagat cctttttgat 6420 aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta 6480 gaaaagatca aaggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa 6540 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt 6600 tttccgaagg taactggctt cagcagagcg cagataccaa atactgttct tctagtgtag 6660 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta 6720 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 6780 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag 6840 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 6900 agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga6960 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc 7020
2020100740 11 May 2020 gggtttcgcc acctctgact tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc 7080 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tgg 7123 <210> 5 <211> 249 <212> DNA <213> Artificial Sequence <400> 5 gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60 ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120 aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180 atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240 cgaaacacc 249 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <400> 6 taatttctac taagtgtaga t 21 <210> 7 <211> 9 <212> DNA <213> Artificial Sequence <400> 7 gggtcttcg 9
2020100740 11 May 2020 <210> 8 <211> 330 <212> DNA <213> Artificial Sequence <400> 8 ggcgagctgc acgctgccgt cctcgatgtt gtggcggatc ttgaagttca ccttgatgcc 60 gttcttctgc ttgtcggcca tgatatagac gttgtggctg ttgtagttgt actccagctt 120 gtgccccagg atgttgccgt cctccttgaa gtcgatgccc ttcagctcga tgcggttcac 180 cagggtgtcg ccctcgaact tcacctcggc gcgggtcttg tagttgccgt cgtccttgaa 240 gaagatggtg cgctcctgga cgtagccttc gggcatggcg gacttgaaga agtcgtgctg 300 cttcatgtgg tcggggtagc ggctgaagca 330 <210> 9 <211> 11 <212> DNA <213> Artificial Sequence <400> 9 agaagacctg c 11 <210> 10 <211> 6 <212> DNA <213> Artificial Sequence <400> 10 tttttt 6 <210> 11 <211> 232
2020100740 11 May 2020 <212> DNA <213> Artificial Sequence <400> 11 ctagagctcg ctgatcagcc tcgactgtgc cttctagttg ccagccatct gttgtttgcc 60 cctcccccgt gccttccttg accctggaag gtgccactcc cactgtcctt tcctaataaa 120 atgaggaaat tgcatcgcat tgtctgagta ggtgtcattc tattctgggg ggtggggtgg 180 ggcaggacag caagggggag gattgggaag agaatagcag gcatgctggg ga 232 <210> 12 <211> 440 <212> DNA <213> Artificial Sequence <400> 12 agactgagtt cacacggtgc tgggccccca aagccaagtg gggttggggg aacagagtct 60 gcgagtcccg gcgccccgag tgcagggccc cgtgttgggg tcctccttcc catttgtatc 120 cgtatccttg cgggctttgc gcctccccgg gggacccctc gccgggagat ggccgcactg 180 atgcggggca aggactcctc ccgctgcctg ctcctactgg ccgcggtgct gatggtggag 240 agctcacagt tcggcagctc gcgggccaaa ctcaactcca tcaagtcctc tctgggcggg 300 gagacgcctg cccaggccgc caatcgatct gcgggcactt accaaggact ggctttcggc 360 ggcagtaaga agggcaaaaa cctggggcag gtaggaaaat acccccaata cactcttcaa 420 ccagaagagg tagggacccg 440 <210> 13 <211> 6 <212> DNA <213> Artificial Sequence atccgt <400> 13
2020100740 11 May 2020 <210> 14 <211> 28 <212> DNA <213> Artificial Sequence <400> 14 agatcatttg tatccgtatc cttgcggg <210> 15 <211> 28 <212> DNA <213> Artificial Sequence <400> 15 aagccccgca aggatacgga tacaaatg 28 <210> 16 <211> 18 <212> DNA <213> Artificial Sequence <400> 16 cagtgggagt ggcacctt 18 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <400> 17 agactgagtt cacacggtgc
2020100740 11 May 2020 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <400> 18 cgggtcccta cctcttctgg 20 <210> 19 <211> 440 <212> DNA <213> Artificial Sequence <400> 19 agactgagtt cacacggtgc tgggccccca aagccaagtg gggttggggg aacagagtct 60 gcgagtcccg gcgccccgag tgcagggccc cgtgttgggg tcctccttcc catttgtatt 120 tgtatccttg cgggctttgc gcctccccgg gggacccctc gccgggagat ggccgcactg 180 atgcggggca aggactcctc ccgctgcctg ctcctactgg ccgcggtgct gatggtggag 240 agctcacagt tcggcagctc gcgggccaaa ctcaactcca tcaagtcctc tctgggcggg 300 gagacgcctg cccaggccgc caatcgatct gcgggcactt accaaggact ggctttcggc 360 ggcagtaaga agggcaaaaa cctggggcag gtaggaaaat acccccaata cactcttcaa 420 ccagaagagg tagggacccg 440 <210> 20 <211> 6 <212> DNA <213> Artificial Sequence <400> 20 gcgggc
2020100740 11 May 2020 <210> 21 <211> 28 <212> DNA <213> Artificial Sequence <400> 21 agatgcagct cgcgggccaa actcaact 28 <210> 22 <211> 28 <212> DNA <213> Artificial Sequence <400> 22 aagcagttga gtttggcccg cgagctgc 28 <210> 23 <211> 440 <212> DNA <213> Artificial Sequence <400> 23 agactgagtt cacacggtgc tgggccccca aagccaagtg gggttggggg aacagagtct 60 gcgagtcccg gcgccccgag tgcagggccc cgtgttgggg tcctccttcc catttgtatc 120 cgtatccttg cgggctttgc gcctccccgg gggacccctc gccgggagat ggccgcactg 180 atgcggggca aggactcctc ccgctgcctg ctcctactgg ccgcggtgct gatggtggag 240 agctcacagt tcggcagctc gtgggtcaaa ctcaactcca tcaagtcctc tctgggcggg 300 gagacgcctg cccaggccgc caatcgatct gcgggcactt accaaggact ggctttcggc 360 ggcagtaaga agggcaaaaa cctggggcag gtaggaaaat acccccaata cactcttcaa 420 ccagaagagg tagggacccg
440
2020100740 11 May 2020 <210> 24 <211> 6 <212> DNA <213> Artificial Sequence <400> 24 caagtg 6 <210> 25 <211> 28 <212> DNA <213> Artificial Sequence <400> 25 agatccaacc ccacttggct ttgggggc 28 <210> 26 <211> 28 <212> DNA <213> Artificial Sequence <400> 26 aagcgccccc aaagccaagt ggggttgg 28 <210> 27 <211> 440 <212> DNA <213> Artificial Sequence
2020100740 11 May 2020 <400> 27 agactgagtt cacacggtgc tgggccccca aagccaaata gggttggggg aacagagtct 60 gcgagtcccg gcgccccgag tgcagggccc cgtgttgggg tcctccttcc catttgtatc 120 cgtatccttg cgggctttgc gcctccccgg gggacccctc gccgggagat ggccgcactg 180 atgcggggca aggactcctc ccgctgcctg ctcctactgg ccgcggtgct gatggtggag 240 agctcacagt tcggcagctc gcgggccaaa ctcaactcca tcaagtcctc tctgggcggg 300 gagacgcctg cccaggccgc caatcgatct gcgggcactt accaaggact ggctttcggc 360 ggcagtaaga agggcaaaaa cctggggcag gtaggaaaat acccccaata cactcttcaa 420 ccagaagagg tagggacccg 440 <210> 28 <211> 27 <212> DNA <213> Artificial Sequence <400> 28 agattatccg tatccttgcg ggctttg 27 <210> 29 <211> 27 <212> DNA <213> Artificial Sequence <400> 29 aagccaaagc ccgcaaggat acggata 27
| <210> | 30 |
| <211> | 27 |
| <212> | DNA |
| <213> | Artificial Sequence |
<400> 30
2020100740 11 May 2020 agatggcggc agtaagaagg gcaaaaa <210> 31 <211> 27 <212> DNA <213> Artificial Sequence <400> 31 aagctttttg cccttcttac tgccgcc 27 <210> 32 <211> 27 <212> DNA <213> Artificial Sequence <400> 32 agatgcccgc gagctgccga actgtga 27 <210> 33 <211> 27 <212> DNA <213> Artificial Sequence <400> 33 aagctcacag ttcggcagct cgcgggc 27
Claims (5)
1) determining a target site of a gene to be tested, and designing a single-stranded oligonucleotide pair of the target site according to the target site;
1. A base editor, comprising a pCMV-dCpfl-RR-eBE recombinant plasmid and a pLbCpfl -sgRNA recombinant plasmid; wherein the pCMV-dCpf 1-RR-eBE recombinant plasmid comprises a pCMV-dCpfl-eBE vector backbone and a DNA fragment of dCpfl -RR-eBE expression cassette;
the pLbCpfl-sgRNA recombinant plasmid comprises a pUC57 vector backbone and a DNA fragment of universal sgRNA expression cassette.
2) annealing the single-stranded oligonucleotide pair to obtain a double-stranded DNA fragment;
2. The base editor according to claim 1, wherein a nucleotide sequence of the DNA fragment of dCpfl-RR-eBE expression cassette is shown in SEQ ID NO. 1, preferably, wherein a nucleotide sequence of the DNA fragment of universal sgRNA expression cassette is shown in SEQ ID NO. 2;
wherein a nucleotide sequence of the pLbCpfl -sgRNA recombinant plasmid is shown in SEQ ID NO. 3.
3) ligating the double-stranded DNA fragment to the pLbCpfl-sgRNA recombinant plasmid to obtain a targeting sgRNA expression vector; and
3. A preparation method of the base editor according to any one of claims 1 to 2, comprising the following steps:
inserting the DNA fragment of dCpfl -RR-eBE expression cassette into the pCMV-dCpfl -eBE vector backbone to construct and obtain the pCMV-dCpf 1 -RR-eBE recombinant plasmid; and inserting the DNA fragment of universal sgRNA expression cassette into the pUC57 vector backbone to obtain the pLbCpfl -sgRNA recombinant plasmid;
preferably, wherein an insertion site of the DNA fragment of dCpfl-RR-eBE expression cassette is located between PstI and Apal restriction enzyme sites of the pCMV-dCpf 1 -eBE vector backbone; an insertion site of the DNA fragment of universal sgRNA expression cassette is an EcoRV restriction enzyme site of the pUC57 vector backbone.
4) cotransfecting cells with the targeting sgRNA expression vector and the pCMV-dCpf 1-RR-eBE recombinant plasmid and then culturing for 36 to 60 h .
4. Use of the base editor according to any one of claims 1 to 2 in gene editing, comprising the following steps:
5. The use according to claim 4, wherein a ratio of total mass of the targeting sgRNA expression vector and the pCMV-dCpf 1-RR-eBE recombinant plasmid in step 4) to the number of transfection cells is 0.5 pg:(0.5-5) x 106 cells; wherein a ratio of the targeting sgRNA expression
2020100740 11 May 2020 vector to the pCMV-dCpfl-RR-eBE recombinant plasmid is (l-5):(l-5); wherein, in step 3), the double-stranded DNA fragment is ligated to the pLbCpfl-sgRNA recombinant plasmid after enzyme digestion; an enzyme for the enzyme digestion is Bbsl.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910441516.2A CN110117621B (en) | 2019-05-24 | 2019-05-24 | Base editor and preparation method and application thereof |
| CN201910441516.2 | 2019-05-24 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| AU2020100740A4 true AU2020100740A4 (en) | 2020-06-18 |
Family
ID=67523199
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2020100740A Ceased AU2020100740A4 (en) | 2019-05-24 | 2020-05-11 | Base editor, preparation method and use thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN110117621B (en) |
| AU (1) | AU2020100740A4 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114250242A (en) * | 2021-12-29 | 2022-03-29 | 上海英基生物科技有限公司 | One-step BbsI enzyme digestion connection fragment assembly method, assembly kit and application |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4063500A4 (en) * | 2019-11-18 | 2023-12-27 | Suzhou Qi Biodesign biotechnology Company Limited | Gene editing system derived from flavobacteria |
| CN112575014B (en) * | 2020-12-11 | 2022-04-01 | 安徽省农业科学院水稻研究所 | Base editor SpCas9-LjCDAL1 and construction and application thereof |
| CN114085859B (en) * | 2021-11-10 | 2024-02-13 | 浙江工业大学 | Gene editing method and system for new mycobacterium aurum engineering bacteria |
| CN114410752B (en) * | 2022-01-24 | 2024-06-25 | 华南师范大学 | Light-control-based CRISPR-Cas nucleic acid detection kit and detection method |
Family Cites Families (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7294504B1 (en) * | 2001-12-27 | 2007-11-13 | Allele Biotechnology & Pharmaceuticals, Inc. | Methods and compositions for DNA mediated gene silencing |
| WO2016094872A1 (en) * | 2014-12-12 | 2016-06-16 | The Broad Institute Inc. | Dead guides for crispr transcription factors |
| IL256387B2 (en) * | 2015-07-14 | 2023-03-01 | Tarnsalgae Israel Ltd | Transgenic microalgae and use thereof as a feed for delivery of interfering rna molecules |
| KR101922989B1 (en) * | 2016-05-13 | 2018-11-28 | 연세대학교 산학협력단 | Generation and tracking of substitution mutations in the genome using a CRISPR/Retron system |
| CN109136248B (en) * | 2017-08-31 | 2022-02-01 | 苏州金唯智生物科技有限公司 | Multi-target editing vector and construction method and application thereof |
| WO2019041296A1 (en) * | 2017-09-01 | 2019-03-07 | 上海科技大学 | Base editing system and method |
| US10253365B1 (en) * | 2017-11-22 | 2019-04-09 | The Regents Of The University Of California | Type V CRISPR/Cas effector proteins for cleaving ssDNAs and detecting target DNAs |
| CN108486146B (en) * | 2018-03-16 | 2021-02-19 | 中国农业科学院作物科学研究所 | Application of LbCpf1-RR mutant in CRISPR/Cpf1 system in plant gene editing |
| CN108949693A (en) * | 2018-07-30 | 2018-12-07 | 苏州茂行生物科技有限公司 | A kind of pair of T cell immune detection point access carries out the method and application of gene knockout |
| CN110079530A (en) * | 2019-05-24 | 2019-08-02 | 青岛农业大学 | A kind of gene editing tool and its preparation method and application from lactobacillus buchneri |
| CN110257427B (en) * | 2019-07-22 | 2021-01-22 | 青岛农业大学 | CRISPR/Cas9 system without PAM restriction and application thereof |
-
2019
- 2019-05-24 CN CN201910441516.2A patent/CN110117621B/en active Active
-
2020
- 2020-05-11 AU AU2020100740A patent/AU2020100740A4/en not_active Ceased
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114250242A (en) * | 2021-12-29 | 2022-03-29 | 上海英基生物科技有限公司 | One-step BbsI enzyme digestion connection fragment assembly method, assembly kit and application |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110117621A (en) | 2019-08-13 |
| CN110117621B (en) | 2021-07-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2020100740A4 (en) | Base editor, preparation method and use thereof | |
| CN110055224B (en) | Genetically modified immune cell and preparation method and application thereof | |
| CN106459957B (en) | Method for modifying genome sequence for specifically converting nucleic acid base of target DNA sequence, and molecular complex used therefor | |
| US5952171A (en) | Method for identifying genes encoding secreted or membrane-associated proteins | |
| US6491924B1 (en) | Chlamydia pneumoniae antigenic polypeptide | |
| WO1995007351A1 (en) | Intron-mediated recombinant techniques and reagents | |
| CN113831394B (en) | Recombinant virus combination of African swine fever virus ASFV gene and vaccine prepared from recombinant virus combination | |
| CN110079551B (en) | Circular RNA expression vector and construction method and application thereof | |
| CN109735498B (en) | Construction method and application of CD137 gene modified humanized animal model | |
| US20220372533A1 (en) | Transgenic microorganisms and synthesis of piperazic acid, piperazic acid containing products, and derivatives thereof | |
| CN109825465B (en) | Recombinant bacillus subtilis for synthesizing lactyl-N-neotetraose based on balanced UDP-sugar supply and construction method and application thereof | |
| KR20210010484A (en) | SEC modified strains for improved secretion of recombinant proteins | |
| AU2014249388A1 (en) | Bacterial xylose isomerases active in yeast cells | |
| CN109810958B (en) | Saffron-derived CCD2 mutant, coding sequence and application thereof, and recombinant yeast strain for producing crocetin | |
| CN108138162A (en) | Recombinant cell, the manufacturing method of recombinant cell and the production method of organic compound | |
| CN111394384B (en) | Biosensor for detecting S-adenosylmethionine and preparation method thereof | |
| CN113880957A (en) | Streptolysin O fusion protein | |
| CN110079530A (en) | A kind of gene editing tool and its preparation method and application from lactobacillus buchneri | |
| CN113354718A (en) | Piranin precursor, expression cassette and preparation method thereof | |
| CN111965367A (en) | Application of HIP-55 as GPCR biased drug target | |
| CN116144517B (en) | 7-Aminocephalosporanic acid producing strain and preparation method and application thereof | |
| CN114574479B (en) | Method for high-flux assembly of chimeric antigen receptor and application thereof | |
| CN116536353A (en) | Replication type efficient guide editing system | |
| CN116536352A (en) | Efficient and accurate polygene editing system mediated by replication type guiding editor | |
| CN116804179A (en) | Engineering bacterium for producing terramycin and construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FGI | Letters patent sealed or granted (innovation patent) | ||
| DA3 | Amendments made section 104 |
Free format text: THE NATURE OF THE AMENDMENT IS: AMEND THE NAME OF THE INVENTOR TO READ LI, HEGANG; ZHANG, NING; ZHAO, JINSHAN; QIN, HUAIYUAN; XIN, JINGJING AND HAO, XIAOJING |
|
| MK22 | Patent ceased section 143a(d), or expired - non payment of renewal fee or expiry |