CN114085859B

CN114085859B - Gene editing method and system for new mycobacterium aurum engineering bacteria

Info

Publication number: CN114085859B
Application number: CN202111325156.3A
Authority: CN
Inventors: 柳志强; 王鑫鑫; 柯霞; 郑裕国
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2021-11-10
Filing date: 2021-11-10
Publication date: 2024-02-13
Anticipated expiration: 2041-11-10
Also published as: CN114085859A

Abstract

A gene editing method and system for new Mycobacterium aureum engineering bacteria belong to the technical field of genetic engineering. The editing system disclosed by the invention comprises a pMV261-rAPOBEC/N (d) Cas9/UGI plasmid and a pTarget-sgRNA plasmid, wherein the pMV261-rAPOBEC/N (d) Cas9/UGI plasmid can fusion express Cas9 protein, cytosine deaminase and uracil glycosidase inhibitor which lose cutting activity, and can carry out deamination reaction on cytosine (C) in a sequence N20 fragment to be converted into uracil (U) under the guidance of sgRNA under the targeting of a target gene, and become thymine (T) to form TAG, TGA and TAA stop codons in the subsequent replication process, so that the purpose of silencing or interrupting normal reaction of the target gene is achieved. The system has low toxicity to hosts, can be specifically edited, and is stable in passage, and the highest editing efficiency can reach 50%.

Description

Gene editing method and system for new mycobacterium aurum engineering bacteria

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a method and a system for editing a new mycobacterium aurum engineering bacterium gene.

Background

Steroid drugs are approved to be marketed in 300 or more, and are one of the most important drugs for treating diseases in humans. Its market demand is enormous and the production scale grows year by year, such trend being attributed to its wide range of therapeutic uses. Steroid drugs are largely divided into two classes, sex hormones and adrenocortical hormones. Wherein sex hormone comprises male hormone, estrogen, etc., and can be used for treating male sexual organ dysfunction, gynecological diseases, contraception, etc. The adrenocortical hormone comprises glucocorticoid, mineralocorticoid, etc., and can be used for treating inflammation, rheumatoid arthritis, shock, etc. In addition, steroid drugs are widely used in the treatment of diseases such as anti-tumor, antiviral, antiallergic and endocrine dyscrasia.

Steroid drugs and steroid drug intermediates have larger production and export scale in China, and research on steroid synthesis, extraction and excellent strains is never interrupted, but a plurality of defects still exist compared with advanced countries in the world, so that the steroid drugs and steroid drug intermediates are always in the middle-low end of the market in the field. Therefore, breaking the technological monopoly of the production and research of the steroid medicines outside the country is urgently needed. The steroid medicine mainly originates from various steroid intermediates, and is some molecules containing stane nucleus, mainly 4-androstene-3, 17-dione (AD), 1, 4-androstene-3, 17-dione (ADD), 9-hydroxy-4-androstene-3, 17-dione (9-OH-AD), 22-hydroxy-23, 24-di-cholest-4-en-3-one (4-HBC), 22-hydroxy-23, 24-di-cholest-1, 4-dien-3-one (1, 4-HBC), 9, 22-dihydroxy-23, 24-di-cholest-4-en-3-one (9-OH-4-HBC) and the like (see figure 1).

Microbial conversion is currently a common means of preparing steroidal intermediates. Although chemical synthesis has had absolute dominance in this field, it has been replaced by safe, mild, low-cost, eco-friendly biotechnology in the last decades. More and more techniques for modifying steroids by means of microorganisms are reported, which allow, in general, the introduction or modification of the desired groups at specific positions of the sterol molecules, ensure the specificity of the molecules and integrate multiple reaction steps into one organism, even designing or creating new metabolic pathways according to the requirements. The microorganism capable of synthesizing the steroid intermediate products has quite various types, wherein new golden mycobacterium (Mycobacterium neoaurum, mn) of actinomycetes can convert phytosterol to prepare the steroid intermediates such as ADD, HBC, AD and the like, and is a potential industrial production bacterium due to the natural capability of taking and utilizing cholesterol and good growth characteristics.

The new process of converting Mycobacterium aurum from phytosterol to steroid involves more than ten enzymes, and the path is complex and tedious. Wild-type Mycobacterium neogolden is difficult to accumulate large amounts of steroid intermediates, which requires modification of the strain by genetic techniques, and if accumulation of HBC is desired, 3-sterone is knocked out or blocked-key enzymes for downstream metabolism, Δ1-dehydrogenase (Ksdd), 17β cholesterol dehydrogenase (Hsd) and 3-sterone-9α -hydroxylase (Ksh) (see figure 2). The conventional homologous recombination technology can realize the knockout and integration of the genes, but the recombination efficiency of the new Mycobacterium aurum is low (10) ^-6 ～10 ^-5 ) The use of this technique involves problems such as complicated operation, long period, difficulty in screening, and low efficiency. In recent years, CRISPR/Cas (regularly spaced clustered short palindromic repeats, clustered Regularly Interspaced Short Palindromic Repeats) technology has also been introduced into gene knockouts of new Mycobacterium aurum, which can accurately perform DNA editing, but is limited by the shortcomings of influencing growth due to DNA double strand breaks, low repair efficiency of homology and non-homology, disruption of adjacent gene expression due to large fragment knockouts, and the like.

The CRISPR-n/D Cas9 (nCas 9: cas 9D 10A, dCAS9: cas 9D 10A/H840A) system does not have the function of cutting a DNA chain, but retains the recognition capability of a specific site of the CRISPR-n/D Cas9 (nCas 9: cas 9D 10A/H840A), and avoids the influence on the activity of a host. Cytosine (C) can be deaminated to uracil (U) by coupling with cytosine deaminase, which will be interpreted as thymine (T) and cause a G: C to A: T base pair transition in subsequent DNA replication, and a stop codon can be introduced at a specific position of the coding strand to silence the associated gene. The uracil DNA glycosylase inhibitor (UGI) can inhibit U glycosylation by uracil glycosidase, so that repair of mutation sites by intracellular repair mechanism is avoided, and editing efficiency is improved. This would be an available, simple, efficient genetic tool, more conducive to the engineering and research of new Mycobacterium aurum producing steroids.

Disclosure of Invention

Aiming at the problems existing in the prior art, the invention aims to design and provide a novel gene editing system of golden mycobacterium engineering bacteria and a technical scheme of application thereof, and the invention constructs a rapid, efficient and stable rAPOBEC-n/dCAS9-UGI+sgRNA single base editing system in wild mycobacterium Mycobacteriumneoaurum ATCC 25795 for the first time, carries out fixed-point base editing on two genes kshA1 and kshA2, and obtains the gene engineering strain capable of efficiently accumulating ADD.

The invention is realized by the following technical scheme:

the invention provides a gene editing system of a novel Mycobacterium aureum engineering bacterium, which comprises pMV261-rAPOBEC/n (d) Cas9/UGI plasmid and pTarget-sgRNA plasmid;

the pMV261-rAPOBEC/n (d) Cas9/UGI plasmid is obtained by the following steps:

pMV261 is taken as a framework, and comprises a mycobacterium replicon OriM, a promoter hsp60, an escherichia coli replicon OriE and a terminator rrnB and kana resistance gene kan, rAPOBEC, n (d) Cas9 and UGI gene fragments are inserted between the promoter hsp60 and the terminator rrnB, rAPOBEC and n (d) Cas9 are connected through Linker1, n (d) Cas9 and UGI are connected through Linker2, a complete expressible plasmid is formed in a Gibson assembly mode, and pMV261-rAPOBEC/n (d) Cas9/UGI plasmid is cloned in escherichia coli;

the pTarget-sgRNA plasmid is obtained by the following steps:

pTarget is taken as a framework, high copy replicon OriMe containing OriM different from pMV261, hygromycin resistance gene Hyg and escherichia coli replicon OriE are connected with sgRNA gene fragments, the sgRNA is taken as a targeting sequence, the targeting sequence can be specifically targeted, and pTarget-sgRNA plasmids are obtained by cloning in escherichia coli.

Further, the nucleotide sequence of rAPOBEC is shown as SEQ ID NO. 1, and the nucleotide sequence of UGI gene is shown as SEQ ID NO. 2; the nucleotide sequence of the nCas9 gene is shown as SEQ ID NO. 3; the nucleotide sequence of the dCAS9 gene is shown as SEQ ID NO. 4; the nucleotide sequence of the Linker1 is shown as SEQ ID NO. 5; the nucleotide sequence of the Linker2 is shown as SEQ ID NO. 6.

Further, the nucleotide sequence of pTarget is shown as SEQ ID NO. 7, and the nucleotide sequence of OriMe is shown as SEQ ID NO. 8; the nucleotide sequence of Hyg is shown as SEQ ID NO. 9; the nucleotide sequence of the OriE is shown as SEQ ID NO. 10.

Further, the pTarget-sgRNA plasmids also include pTarget-sgRNA_ (kshA 1-1), pTarget-sgRNA_ (kshA 1-2), pTarget-sgRNA_ (kshA 1-1), pTarget-sgRNA_ (kshA 1-2), and pTarget-sgRNA_ (kshA 2), specifically, pTarget-sgRNA is used as a template for PCR amplification of mutations using targeting primers related to kshA1 and kshA2 genes, respectively.

Further, the nucleotide sequence of kshA1 is shown as SEQ ID NO. 12, and the nucleotide sequence of kshA2 is shown as SEQ ID NO. 13.

The invention also provides an application of the gene editing system in single base editing of new Mycobacterium aureofaciens engineering bacteria genes.

Further, the application method comprises the following steps:

the pMV261-rAPOBEC/n (d) Cas9/UGI plasmid is introduced into the new Mycobacterium aurum, after rAPOBEC/n (d) Cas9/UGI gene is stably expressed in the new Mycobacterium aurget-sgRNA_ (kshA 1-1), pTarget-sgRNA_ (kshA 1-2) and pTarget-sgRNA_ (kshA 2) plasmids are introduced into the new Mycobacterium aurum, so that the pTarget-sgRNA plasmids are transcribed into sgRNA sequences, and the sgRNA sequences are combined with a three-enzyme fusion protein to form a complex, the complex can target genes to be edited in the new Mycobacterium aurum, cytosine deaminase can convert cytosine C into U to be further T, and UGI can inhibit uracil glycosidase, and the influence of intracellular repair mechanism is reduced.

The invention has the beneficial effects that:

(1) The invention provides a single base editing system based on double plasmids pMV261-rAPOBec/n (d) Cas 9/UGI-pTar get-sgRNA, which can achieve the aim of gene silencing of new Mycobacterium aurum. The pMV261-rAPOBEC/n (d) Cas9/UGI plasmid expresses cytosine deaminase, cas9 kinase and uracil glycosidase inhibitor in series, and the pTarget-sgRNA plasmid can guide Cas9 kinase to combine with a specific site of a gene, and the cytosine deaminase converts C into U, so that a stop codon is formed in the subsequent replication process of the gene, and the normal expression of the related gene is silenced.

(2) The plasmid used by the single-base gene editing system can exist and be expressed in new mycobacterium aurum stably, and as Cas9 protein is mutated into nCas9, the double-strand cutting function is lost, and the toxicity of the plasmid to a host is reduced.

(3) The single base editing system of the invention is used for carrying out gene editing on new golden mycobacterium, the mutation rate of the gene is high, the total mutation rate can reach 50%, and the efficiency of forming codons is 35%.

Drawings

FIG. 1 is a plant sterol and steroid intermediate;

FIG. 2 is a schematic diagram of a plant sterol metabolic pathway;

FIG. 3 is a pMV261-rAPOBEC/nCas9/UGI plasmid map;

FIG. 4 is a pTarget-sgRNA plasmid map;

FIG. 5 is a nucleic acid gel electrophoresis;

FIG. 6 is a liquid phase detection pattern.

Detailed Description

The scheme of the present invention will be explained below with reference to examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the present invention and should not be construed as limiting the scope of the invention. The examples are not to be construed as limiting the specific techniques or conditions described in the literature in this field or as per the specifications of the product. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention. (1) The media and reagent solutions involved in the following examples were as follows:

LB liquid medium: glucose 10g/L, yeast powder 5g/L, naCl g/L;

m3 liquid medium: KH (KH) ₂ PO ₄ 0.5g/L、K ₂ HPO ₄ 0.5g/L、(NH ₄ ) ₂ HPO ₄ 1.5g/L、FeSO ₄ ·7H ₂ O0.005g/L、ZnSO ₄ ·7H ₂ O 0.002g/L、MgSO ₄ ·7H ₂ O0.2 g/L, yeast powder 5g/L, glycerol 5g/L pH 7.2;

hygromycin B: mother liquor 100mg/mL and working concentration 200mg/L;

kanamycin: 50mg/mL of mother solution and 50mg/L of working concentration;

solid medium: adding 2% agar powder into the liquid culture medium;

phytosterol solution: 100g/L phytosterol and 370g/L hydroxypropyl cyclodextrin.

(2) The PCR reactions involved in the examples below were as follows:

PCR fragment amplification System: 2. Mu.L of each of the upstream and downstream primers, 50-100ng of the template, 1. Mu.L of dNTP, 2 XBuffer 25. Mu.L of DNA polymerase, 1. Mu.L of ddH ₂ O is added to 50 mu L;

PCR fragment amplification procedure: 95-5 min, 95-15 s, (Tm-5 ℃) 15s, 72-30 s/kb, 72-10 min,30 cycles.

(3) The reaction involving Gibson assembly ligation in the examples below is as follows:

linearizing the carrier: (0.02 vector size) ng, insert: (0.04 fragment size) ng,2xClonExpress Mix 10. Mu.L, ddH ₂ O is added to 20 mu L for 50-20 min and transformed into DH5 alpha competence of the escherichia coli.

(4) The following examples relate to the preparation and electrotransformation of novel Mycobacterium aureofaciens competent cells as follows:

taking a loop bacterial liquid from a glycerol pipe, and culturing for 36 hours at 30 ℃ by three dividing lines on an LB solid culture medium; monoclone is selected and cultured in 5mL LB liquid at 30 ℃ for 36h in an oscillating way; transferring 2% into 50mL LB, shake culturing at 30deg.C for 6h, and standing for OD ₆₀₀ 1.5-2; standing the culture solution on ice for 30min, centrifuging for 10min at 4 ℃ with 4000g, and removing the supernatant; re-suspending with pre-cooled 10% glycerol aqueous solution, 30mL, standing on ice for 10min, centrifuging for 10min at 4deg.C, removing supernatant, and repeating for 3 times; then, the mixture was resuspended in 2mL of a 10% glycerol aqueous solution, and the mixture was dispensed into EP tubes, each of which was 100. Mu.L, and stored at-80 ℃.

100-300ng of plasmid is added into Mycobacterium competence (dissolved on ice) and kept stand for 20min at 4 ℃; setting voltage of Gene Pulser Xcell type electroporation apparatus to 2.5kV, selecting aperture of electric shock cup to 2mm, and electric shock for 2 times; confirm that the shock frequency is (4-5 ms) ^-1 Standing for 3min at 4 ℃ after electric shock; 600. Mu.L of fresh LB medium was added and transferred to a sterile centrifuge tube; resuscitates at 37℃for 3-4h with shaking at low speed, centrifugates for 3min with 5000g, resuspension of 100. Mu.L supernatant, spreading on resistance plates, and culturing at 37℃for 5-7d.

(5) The following examples relate to methods for calculating gene editing efficiency:

total efficiency of gene editing= (number of colonies subjected to base editing/total number of picked transformants by sequencing verification) ×100%;

successful efficiency of gene editing= (number of colonies whose stop codon has been formed/total number of transformants picked by sequencing verification) ×100%.

(6) The following examples relate to the methods for converting phytosterols from Mycobacterium neogolden as follows:

monoclone is selected and cultured in 5mL LB liquid at 30 ℃ for 36h in an oscillating way; 2% was transferred to 100mL of LB, cultured at 30℃for 12 hours with shaking, and sterilized phytosterol substrate solution (working concentration 5 g/L) was added thereto, followed by culturing at 30℃with shaking.

(7) The detection method involved in the following examples is as follows:

sample treatment mode: ethyl acetate extraction is 2:1, nitrogen is blown to volatilize, and methanol is redissolved.

The liquid phase detection method comprises the following steps: product detection, C18 column (5 μm,4.6×250 mm), 75% methanol, 254nm,1mL/min,35 ℃; substrate detection, C18 column (5 μm, 4.6X 250 mm), 100% methanol, 210nm,1mL/min,35 ℃.

Example 1: construction of Single base editing plasmid pMV261-rAPOBec/n (d) Cas9/UGI (pBE)

(1) Plasmid linearization and acquisition of inserts

Linearization of plasmid pMV261, in pMV-F1:5'-CCATTGCGAAGTGATTCCTCCGG-3', pMV-R1:5'-GTTAACTAGCGTACGATCGACTGCC-3' is primer, PCR amplification and gel electrophoresis verification (see figure 5), 0.5 mu LDpnI 37-2 h digestion template is added, and the product is purified and recovered.

The rAPOBEC (nucleotide sequence shown as SEQ ID NO: 1), UGI (nucleotide sequence shown as SEQ ID NO: 2) and n (d) Cas9 (nucleotide sequence shown as SEQ ID NO:3, SEQ ID NO: 4) are obtained through gene synthesis, inserted into the multicloning site of pET28a plasmid and stored in E.coli DH5 alpha.

Extracting pET28a-rAPOBEC, pET28a-UGI, pET28a-nCas9 and pET28a-dCAS9 plasmids as templates, and using a primer APO-F: GGAGGAATCACTTCGCAATGGATGTCGTCGGAGACCGGCCCC and APO-R: ggactccggggtggcggactccgaggtgcccggggtctcggagccggaCTTCAGGCCGGTGGCCCACAGGATG (Linker 1 in small case, nucleotide sequence shown as SEQ ID NO: 5), and PCR amplification to obtain rAPOBEC gene fragment; with primer Cas9-F: AGTCCGCCACCCCGGAGTCCGATAAGAAATACTCAATAGGCTTAGCGATCGGCAC and Cas-R: GTCACCTCCTAGCTGACTCAAATCAATGCG, PCR amplification gives an n (d) Cas9 gene fragment; primer UGI-F: TTGAGTCAGCTAGGAGGTGACtcgggcggctcgACCAACCTGTCGG (Linker 2 in lowercase, nucleotide sequence shown in SEQ ID NO: 6) and UGI-R: TCGATCGTACGCTAGTTAACTCACAGCATCTTGATCTTGTTCTCGCCGTTGCTGT, PCR UGI gene fragments were amplified.

(2) Multi-fragment ligation and cloning

Adding rAPOBEC, UGI, n (d) Cas9 gene fragment (shown in figure 5) and pMV261 linear plasmid into PCR tube according to proportion, adding ClonExpress Mix and double distilled water, connecting, transferring into Escherichia coli DH5 alpha, and coating on kan ^r The plate was incubated for 16h at 37℃with inverted incubation, transformants were picked for PCR (see FIG. 5) and sequencing, the PCR and sequencing primers were pMV-F2: ATAGGCGAGTGCTAAGAATAACG and pMV-R2: ATGGCTCATAACACCCCTTG. Positive transformants with correct sequencing were transferred to LB liquid medium (containing Kan ^r ) Shaking culture is carried out for 16h at 37-180 rpm, and pMV261-rAPOBEC/nCas9/UGI (pBE) and pMV261-rAPOBEC/dCAs9/UGI (pBEd) plasmids are obtained. The plasmid map of pMV261-rAPOBEC/nCas9/UGI is shown in FIG. 3.

Example 2: construction of Single base editing plasmid pTarget-sgRNA, pTarget-sgRNA_ (kshA 1-1), pTarget-sgRNA_ (kshA 1-2), pTarget-sgRNA_ (kshA 2)

(1) Plasmid linearization and acquisition of inserts

The pTarget plasmid backbone (nucleotide sequence shown as SEQ ID NO: 7) is obtained by gene synthesis and comprises an OriMe replicon capable of independent replication in mycobacteria (nucleotide sequence shown as SEQ ID NO: 8), a hygromycin resistance gene Hyg (nucleotide sequence shown as SEQ ID NO: 9) and an E.coli replicon OriE (nucleotide sequence shown as SEQ ID NO: 10), which are stored in E.coli DH5 alpha, cultured and extracted in LB to obtain the plasmid pTarget. In pT-F: AGACTCGAGTCTAGAGTTTAAACAGTATTAAACGC and pT-R: AAATAAAACGAAAGGCTCAGTCGAAAGACT is primer, PCR amplification and gel electrophoresis verification (see figure 5), 0.5 mu LDpnI 37-2 h digestion template is added, and the product is purified and recovered to obtain linearization plasmid.

The sgRNA sequence (the nucleotide sequence is shown as SEQ ID NO: 11) is obtained through gene synthesis, and C9SG-F is used as the nucleotide sequence: TAAACTCTAGACTCGAGTCTGATTTAGGTGACACTATAGATTTCACACATAGTGG and C9SG-R: CTGAGCCTTTCGTTTTATTTTCGACGGATCCTATGTATGCACCGA is primer, PCR amplification and gel electrophoresis verification (see figure 5), and the product is purified and recovered to obtain the gene fragment with 20bp homologous sequence.

(2) Multi-fragment ligation and cloning

Adding the sgRNA gene fragment and pTarget linear plasmid into a PCR tube according to a proportion, adding ClonExpress Mix and double distilled water, connecting, transferring into Escherichia coli DH5 alpha, and coating on kan ^r The plate was incubated for 16h at 37℃in an inverted position, and transformants were picked for PCR and sequencing verification (see FIG. 5), with primers sg-F: GGGAAACGCCTGGTATCTTTATAGT and sg-R: AAGCTTAAGAGTTTGTAGAAACGCA. Positive transformants with correct sequencing were transferred to LB liquid medium (containing Hyg) ^r ) Shaking culture is carried out for 16h at 37-180 rpm, and pTarget-sgRNA (pTs) plasmid is obtained by extraction.

(3) N20 mutation

pTs as template, primers KA1-sg-F1 were used: ATTTCACACAAGCCAGTACCTGCACAACGTGTTTTAGAGCTAGAA and KA1-sg-R1:ACGTTGTGCAGGTACTGGCTTGTGTGAAATCTATA、KA1-sg-F2：ATTTCACACATCCTGCAGGATGTCGAGATCGTTTTAGAGCTAGAA and KA1-sg-R2:GATCTCGACATCCTGCAGGATGTGTGAAATCTATA、KA2-sg-F：ATTTCACACAGGCGCCAGGATTCACCGTGGGTTTTAGAGCTAGAA and KA2-sg-R:CCA CGGTGAATCCTGGCGCCTGTGTGAAATCTATA (the underlined part is the N20 sequence of the PAM site), electrophoresis and sequencing verification, and purifying the PCR product to obtain pTarget-sgRNA_ (kshA 1-1), pTarget-sgRNA_ (kshA 1-2), pTarget-sgRNA_ (kshA 2) plasmids, and the method can be used for editing the genes of kshA1 (the nucleotide sequence is shown as SEQ ID NO: 12) and kshA2 (the nucleotide sequence is shown as SEQ ID NO: 13) of new Mycobacterium aurum. The plasmid map of pTarget-sgRNA is shown in FIG. 4.

Example 3: application of single base editing system

Respectively electrotransforming the constructed pBE and pBEd plasmids into new Mycobacterium aurumIn Kan ^r Positive transformants were screened on plates, colony PCR and sequencing primers were pMV-F2 and pMV-R2, and correct transformants were verified to be transferred to 5mL of liquid LB (Kan ^r ) In the culture, 30-180 rpm shaking culture is carried out for 3d, and then 2% of the culture is transferred to 50mL of LB (Kan) ^r ) The medium is subjected to shaking culture at 30-180 rpm for preparing electrotransformation competence, so that Mn-pBE and Mn-pBEd competence are obtained.

Example 4: gene editing of kshA1 and kshA2 in novel Mycobacterium aurum

Extracting pTs _ (kshA 1-1), pTs _ (kshA 1-2), pTs _ (kshA 2) plasmid, respectively adding 200ng into Mn-pBE competent cells for electrotransformation, recovering, and coating on Kan ^r And Hyg ^r Culturing on a double-antibody plate, and sequencing and analyzing the base editing condition of the PAM-N20 region of the target gene by picking 20 transformants when the transformants are generated.

Extracting pTs _ (kshA 1-1) plasmid, adding 200ng into Mn-pBEd competent cells for electrotransformation, recovering, and coating on Kan ^r And Hyg ^r Culturing on a double-antibody plate, and sequencing and analyzing the base editing condition of the PAM-N20 region of the target gene by picking 20 transformants when the transformants are generated.

Table 1: gene editing efficiency of kshA1-1 Gene

Table 2: gene editing efficiency of kshA1-2 Gene

Table 3: gene editing efficiency of kshA2 Gene

Table 4: gene efficiency of editing of kshA1 Gene (pBEd)

Example 5: pTarget plasmid elimination and iterative silencing gene

Mn-pBE-pTs _ (kshA 1-1) strain in which a stop codon was formed in the N20 region was introduced into Kan ^r Repeatedly passaging 5 times in the resistant liquid LB, and eliminating pTs _ (kshA 1-1) plasmid to obtain Mn-ksh1 (BE) strain. And further preparing new golden mycobacterium electrotransformation competence, transferring into pTs _ (kshA 2) plasmid, carrying out double-gene editing of Ksh enzyme, and finally, carrying out passaging again to eliminate pTs _ (kshA 2) plasmid to obtain Mn-Ksh12 (BE) strain.

Example 6: phenotypic validation experiments

Fermenting and transforming plant sterol by two strains of Mn-ksh1 (BE) and Mn-ksh12 (BE), and selecting monoclonal in 5mL LB (Kan ^r ) In the liquid, shake culture is carried out at 30 ℃ for 36h.2% switch to 100mL LB (Kan) ^r ) In the method, the sterilized plant sterol substrate solution (working concentration is 5 g/L) is added for 12h in a shaking culture manner at 30 ℃, the shaking culture is continued for 100h and 150h for sampling at 30 ℃, the ADD product is accumulated in 100h in the liquid phase detection product ADD, mn-ksh1 (BE) (see figure 6), but the product is reduced more in 150h, the ADD yield in 150h of Mn-ksh12 (BE) is higher than 120h, and the molar conversion rate is 67.9% and 53.6%, respectively.

In the description of the present specification, a description referring to terms "one embodiment," "some embodiments," "examples," "specific examples," or "some examples," etc., means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present invention. In this specification, schematic representations of the above terms are not necessarily directed to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, the different embodiments or examples described in this specification and the features of the different embodiments or examples may be combined and combined by those skilled in the art without contradiction.

While embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and not to be construed as limiting the invention, and that variations, modifications, alternatives and variations may be made to the above embodiments by one of ordinary skill in the art within the scope of the invention.

Sequence listing

<110> Zhejiang university of industry

<120> Gene editing method and system for novel Mycobacterium aureofaciens engineering bacteria

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 687

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgtcgtcgg agaccggccc cgtcgccgtc gacccgaccc tgcgccgccg catcgagccg 60

cacgagttcg aggtcttctt cgacccgcgc gagctgcgca aggagacctg cctgctgtac 120

gagatcaact ggggcggccg ccactcgatc tggcgccaca ccagccagaa caccaacaag 180

cacgtcgagg tgaacttcat cgagaagttc accaccgagc gctacttctg ccccaacacc 240

cgctgctcga tcacctggtt cctgtcgtgg agcccgtgcg gcgagtgctc gcgcgccatc 300

accgagttcc tgtcgcggta cccgcacgtc accctgttca tctacatcgc ccgcctgtac 360

caccacgccg acccgcgcaa ccgccagggc ctgcgcgacc tgatctcgag cggcgtcacc 420

atccagatca tgaccgagca ggagtcgggc tactgctggc gcaacttcgt caactactcg 480

ccctcgaacg aggcccactg gccgcgctac ccccacctgt gggtccgcct gtacgtcctg 540

gagctgtact gcatcatcct gggcctgccg ccgtgcctga acatcctgcg ccgcaagcag 600

ccccagctga ccttcttcac catcgccctg cagtcgtgtc actaccagcg cctgcccccg 660

cacatcctgt gggccaccgg cctgaag 687

<210> 2

<211> 252

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

accaacctgt cggacatcat cgagaaggag accggcaagc agctggtcat ccaggagtcg 60

atcctgatgc tgccggagga ggtcgaggag gtcatcggca acaagccgga gtcggacatc 120

ctggtccaca ccgcctacga cgagtcgacc gacgagaacg tcatgctgct gaccagcgac 180

gccccggagt acaagccgtg ggcgctggtc atccaggaca gcaacggcga gaacaagatc 240

aagatgctgt ga 252

<210> 3

<211> 4101

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

gataagaaat actcaatagg cttagcgatc ggcacaaata gcgtcggatg ggcggtgatc 60

actgatgaat ataaggttcc gtctaaaaag ttcaaggttc tgggaaatac agaccgccac 120

agtatcaaaa aaaatcttat aggggctctt ttatttgaca gtggagagac agcggaagcg 180

actcgtctca aacggacagc tcgtagaagg tatacacgtc ggaagaatcg tatttgttat 240

ctacaggaga ttttttcaaa tgagatggcg aaagtagatg atagtttctt tcatcgactt 300

gaagagtctt ttttggtgga agaagacaag aagcatgaac gtcatcctat ttttggaaat 360

atagtagatg aagttgctta tcatgagaaa tatccaacta tctatcatct gcgaaaaaaa 420

ttggtagatt ctactgataa agcggatttg cgcttaatct atttggcctt agcgcatatg 480

attaagtttc gtggtcattt tttgattgag ggagatttaa atcctgataa tagtgatgtg 540

gacaaactat ttatccagtt ggtacaaacc tacaatcaat tatttgaaga aaaccctatt 600

aacgcaagtg gagtagatgc taaagcgatt ctttctgcac gattgagtaa atcaagacga 660

ttagaaaatc tcattgctca gctccccggt gagaagaaaa atggcttatt tgggaatctc 720

attgctttgt cattgggttt gacccctaat tttaaatcaa attttgattt ggcagaagat 780

gctaaattac agctttcaaa agatacttac gatgatgatt tagataattt attggcgcaa 840

attggagatc aatatgctga tttgtttttg gcagctaaga atttatcaga tgctatttta 900

ctttcagata tcctaagagt aaatactgaa ataactaagg ctcccctatc agcttcaatg 960

attaaacgct acgatgaaca tcatcaagac ttgactcttt taaaagcttt agttcgacaa 1020

caacttccag aaaagtataa agaaatcttt tttgatcaat caaaaaacgg atatgcaggt 1080

tatattgatg ggggagctag ccaagaagaa ttttataaat ttatcaaacc aattttagaa 1140

aaaatggatg gtactgagga attattggtg aaactaaatc gtgaagattt gctgcgcaag 1200

caacggacct ttgacaacgg ctctattccc catcaaattc acttgggtga gctgcatgct 1260

attttgagaa gacaagaaga cttttatcca tttttaaaag acaatcgtga gaagattgaa 1320

aaaatcttga cttttcgaat tccttattat gttggtccat tggcgcgtgg caatagtcgt 1380

tttgcatgga tgactcggaa gtctgaagaa acaattaccc catggaattt tgaagaagtt 1440

gtcgataaag gtgcttcagc tcaatcattt attgaacgca tgacaaactt tgataaaaat 1500

cttccaaatg aaaaagtact accaaaacat agtttgcttt atgagtattt tacggtttat 1560

aacgaattga caaaggtcaa atatgttact gaaggaatgc gaaaaccagc atttctttca 1620

ggtgaacaga agaaagccat tgttgattta ctcttcaaaa caaatcgaaa agtaaccgtt 1680

aagcaattaa aagaagatta tttcaaaaaa atagaatgtt ttgatagtgt tgaaatttca 1740

ggagttgaag atagatttaa tgcttcatta ggtacctacc atgatttgct aaaaattatt 1800

aaagataaag attttttgga taatgaagaa aatgaagata tcttagagga tattgtttta 1860

acattgacct tatttgaaga tagggagatg attgaggaaa gacttaaaac atatgctcac 1920

ctctttgatg ataaggtgat gaaacagctt aaacgtcgcc gttatactgg ttggggacgt 1980

ttgtctcgaa aattgattaa tggtattagg gataagcaat ctggcaaaac aatattagat 2040

tttttgaaat cagatggttt tgccaatcgc aattttatgc agctgatcca tgatgatagt 2100

ttgacattta aagaagacat tcaaaaagca caagtgtctg gacaaggcga tagtttacat 2160

gaacatattg caaatttagc tggtagccct gctattaaaa aaggtatttt acagactgta 2220

aaagttgttg atgaattggt caaagtaatg gggcggcata agccagaaaa tatcgttatt 2280

gaaatggcac gtgaaaatca gacaactcaa aagggccaga aaaattcgcg agagcgtatg 2340

aaacgaatcg aagaaggtat caaagaatta ggaagtcaga ttcttaaaga gcatcctgtt 2400

gaaaatactc aattgcaaaa tgaaaagctc tatctctatt atctccaaaa tggaagagac 2460

atgtatgtgg accaagaatt agatattaat cgtttaagtg attatgatgt cgatcacatt 2520

gttccacaaa gtttccttaa agacgattca atagacaata aggtcttaac gcgttctgat 2580

aaaaatcgtg gtaaatcgga taacgttcca agtgaagaag tagtcaaaaa gatgaaaaac 2640

tattggagac aacttctaaa cgccaagtta atcactcaac gtaagtttga taatttaacg 2700

aaagctgaac gtggaggttt gagtgaactt gataaagctg gttttatcaa acgccaattg 2760

gttgaaactc gccaaatcac taagcatgtg gcacaaattt tggatagtcg catgaatact 2820

aaatacgatg aaaatgataa acttattcga gaggttaaag tgattacctt aaaatctaaa 2880

ttagtttctg acttccgaaa agatttccaa ttctataaag tacgtgagat taacaattac 2940

catcatgccc atgatgcgta tctaaatgcc gtcgttggaa ctgctttgat taagaaatat 3000

ccaaaacttg aatcggagtt tgtctatggt gattataaag tttatgatgt tcgtaaaatg 3060

attgctaagt ctgagcaaga aataggcaaa gcaaccgcaa aatatttctt ttactctaat 3120

atcatgaact tcttcaaaac agaaattaca cttgcaaatg gagagattcg caaacgccct 3180

ctaatcgaaa ctaatgggga aactggagaa attgtctggg ataaagggcg agattttgcc 3240

acagtgcgca aagtattgtc catgccccaa gtcaatattg tcaagaaaac agaagtacag 3300

acaggcggat tctccaagga gtcaatttta ccaaaaagaa attcggacaa gcttattgct 3360

cgtaaaaaag actgggatcc aaaaaaatat ggtggttttg atagtccaac ggtagcttat 3420

tcagtcctag tggttgctaa ggtggaaaaa gggaaatcga agaagttaaa atccgttaaa 3480

gagttactag ggatcacaat tatggaaaga agttcctttg aaaaaaatcc gattgacttt 3540

ttagaagcta aaggatataa ggaagttaaa aaagacttaa tcattaaact acctaaatat 3600

agtctttttg agttagaaaa cggtcgtaaa cggatgctgg ctagtgccgg agaattacaa 3660

aaaggaaatg agctggctct gccaagcaaa tatgtgaatt ttttatattt agctagtcat 3720

tatgaaaagt tgaagggtag tccagaagat aacgaacaaa aacaattgtt tgtggagcag 3780

cataagcatt atttagatga gattattgag caaatcagtg aattttctaa gcgtgttatt 3840

ttagcagatg ccaatttaga taaagttctt agtgcatata acaaacatag agacaaacca 3900

atacgtgaac aagcagaaaa tattattcat ttatttacgt tgacgaatct tggagctccc 3960

gctgctttta aatattttga tacaacaatt gatcgtaaac gatatacgtc tacaaaagaa 4020

gttttagatg ccactcttat ccatcaatcc atcactggtc tttatgaaac acgcattgat 4080

ttgagtcagc taggaggtga c 4101

<210> 4

<211> 4101

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gataagaaat actcaatagg cttagcgatc ggcacaaata gcgtcggatg ggcggtgatc 60

actgatgaat ataaggttcc gtctaaaaag ttcaaggttc tgggaaatac agaccgccac 120

agtatcaaaa aaaatcttat aggggctctt ttatttgaca gtggagagac agcggaagcg 180

actcgtctca aacggacagc tcgtagaagg tatacacgtc ggaagaatcg tatttgttat 240

ctacaggaga ttttttcaaa tgagatggcg aaagtagatg atagtttctt tcatcgactt 300

gaagagtctt ttttggtgga agaagacaag aagcatgaac gtcatcctat ttttggaaat 360

atagtagatg aagttgctta tcatgagaaa tatccaacta tctatcatct gcgaaaaaaa 420

ttggtagatt ctactgataa agcggatttg cgcttaatct atttggcctt agcgcatatg 480

attaagtttc gtggtcattt tttgattgag ggagatttaa atcctgataa tagtgatgtg 540

gacaaactat ttatccagtt ggtacaaacc tacaatcaat tatttgaaga aaaccctatt 600

aacgcaagtg gagtagatgc taaagcgatt ctttctgcac gattgagtaa atcaagacga 660

ttagaaaatc tcattgctca gctccccggt gagaagaaaa atggcttatt tgggaatctc 720

attgctttgt cattgggttt gacccctaat tttaaatcaa attttgattt ggcagaagat 780

gctaaattac agctttcaaa agatacttac gatgatgatt tagataattt attggcgcaa 840

attggagatc aatatgctga tttgtttttg gcagctaaga atttatcaga tgctatttta 900

ctttcagata tcctaagagt aaatactgaa ataactaagg ctcccctatc agcttcaatg 960

attaaacgct acgatgaaca tcatcaagac ttgactcttt taaaagcttt agttcgacaa 1020

caacttccag aaaagtataa agaaatcttt tttgatcaat caaaaaacgg atatgcaggt 1080

tatattgatg ggggagctag ccaagaagaa ttttataaat ttatcaaacc aattttagaa 1140

aaaatggatg gtactgagga attattggtg aaactaaatc gtgaagattt gctgcgcaag 1200

caacggacct ttgacaacgg ctctattccc catcaaattc acttgggtga gctgcatgct 1260

attttgagaa gacaagaaga cttttatcca tttttaaaag acaatcgtga gaagattgaa 1320

aaaatcttga cttttcgaat tccttattat gttggtccat tggcgcgtgg caatagtcgt 1380

tttgcatgga tgactcggaa gtctgaagaa acaattaccc catggaattt tgaagaagtt 1440

gtcgataaag gtgcttcagc tcaatcattt attgaacgca tgacaaactt tgataaaaat 1500

cttccaaatg aaaaagtact accaaaacat agtttgcttt atgagtattt tacggtttat 1560

aacgaattga caaaggtcaa atatgttact gaaggaatgc gaaaaccagc atttctttca 1620

ggtgaacaga agaaagccat tgttgattta ctcttcaaaa caaatcgaaa agtaaccgtt 1680

aagcaattaa aagaagatta tttcaaaaaa atagaatgtt ttgatagtgt tgaaatttca 1740

ggagttgaag atagatttaa tgcttcatta ggtacctacc atgatttgct aaaaattatt 1800

aaagataaag attttttgga taatgaagaa aatgaagata tcttagagga tattgtttta 1860

acattgacct tatttgaaga tagggagatg attgaggaaa gacttaaaac atatgctcac 1920

ctctttgatg ataaggtgat gaaacagctt aaacgtcgcc gttatactgg ttggggacgt 1980

ttgtctcgaa aattgattaa tggtattagg gataagcaat ctggcaaaac aatattagat 2040

tttttgaaat cagatggttt tgccaatcgc aattttatgc agctgatcca tgatgatagt 2100

ttgacattta aagaagacat tcaaaaagca caagtgtctg gacaaggcga tagtttacat 2160

gaacatattg caaatttagc tggtagccct gctattaaaa aaggtatttt acagactgta 2220

aaagttgttg atgaattggt caaagtaatg gggcggcata agccagaaaa tatcgttatt 2280

gaaatggcac gtgaaaatca gacaactcaa aagggccaga aaaattcgcg agagcgtatg 2340

aaacgaatcg aagaaggtat caaagaatta ggaagtcaga ttcttaaaga gcatcctgtt 2400

gaaaatactc aattgcaaaa tgaaaagctc tatctctatt atctccaaaa tggaagagac 2460

atgtatgtgg accaagaatt agatattaat cgtttaagtg attatgatgt cgatgctatt 2520

gttccacaaa gtttccttaa agacgattca atagacaata aggtcttaac gcgttctgat 2580

aaaaatcgtg gtaaatcgga taacgttcca agtgaagaag tagtcaaaaa gatgaaaaac 2640

tattggagac aacttctaaa cgccaagtta atcactcaac gtaagtttga taatttaacg 2700

aaagctgaac gtggaggttt gagtgaactt gataaagctg gttttatcaa acgccaattg 2760

gttgaaactc gccaaatcac taagcatgtg gcacaaattt tggatagtcg catgaatact 2820

aaatacgatg aaaatgataa acttattcga gaggttaaag tgattacctt aaaatctaaa 2880

ttagtttctg acttccgaaa agatttccaa ttctataaag tacgtgagat taacaattac 2940

catcatgccc atgatgcgta tctaaatgcc gtcgttggaa ctgctttgat taagaaatat 3000

ccaaaacttg aatcggagtt tgtctatggt gattataaag tttatgatgt tcgtaaaatg 3060

attgctaagt ctgagcaaga aataggcaaa gcaaccgcaa aatatttctt ttactctaat 3120

atcatgaact tcttcaaaac agaaattaca cttgcaaatg gagagattcg caaacgccct 3180

ctaatcgaaa ctaatgggga aactggagaa attgtctggg ataaagggcg agattttgcc 3240

acagtgcgca aagtattgtc catgccccaa gtcaatattg tcaagaaaac agaagtacag 3300

acaggcggat tctccaagga gtcaatttta ccaaaaagaa attcggacaa gcttattgct 3360

cgtaaaaaag actgggatcc aaaaaaatat ggtggttttg atagtccaac ggtagcttat 3420

tcagtcctag tggttgctaa ggtggaaaaa gggaaatcga agaagttaaa atccgttaaa 3480

gagttactag ggatcacaat tatggaaaga agttcctttg aaaaaaatcc gattgacttt 3540

ttagaagcta aaggatataa ggaagttaaa aaagacttaa tcattaaact acctaaatat 3600

agtctttttg agttagaaaa cggtcgtaaa cggatgctgg ctagtgccgg agaattacaa 3660

aaaggaaatg agctggctct gccaagcaaa tatgtgaatt ttttatattt agctagtcat 3720

tatgaaaagt tgaagggtag tccagaagat aacgaacaaa aacaattgtt tgtggagcag 3780

cataagcatt atttagatga gattattgag caaatcagtg aattttctaa gcgtgttatt 3840

ttagcagatg ccaatttaga taaagttctt agtgcatata acaaacatag agacaaacca 3900

atacgtgaac aagcagaaaa tattattcat ttatttacgt tgacgaatct tggagctccc 3960

gctgctttta aatattttga tacaacaatt gatcgtaaac gatatacgtc tacaaaagaa 4020

gttttagatg ccactcttat ccatcaatcc atcactggtc tttatgaaac acgcattgat 4080

ttgagtcagc taggaggtga c 4101

<210> 5

<211> 48

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

tccggctccg agaccccggg cacctcggag tccgccaccc cggagtcc 48

<210> 6

<211> 12

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

tcgggcggct cg 12

<210> 7

<211> 5475

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

cgcgcgcggc cgtgcgggct cggtggggcg gctctgtcgc ccttgccagc gtgagtagcg 60

cgtacctcac ctcgcccaac aggtcgcaca cagccgattc gtacgccata aagccaaggc 120

gggcaacacg acatctcaat agttggcacg gagctcctaa acgacgacag ccccgctaat 180

gcggggccgc aacgtcgatt tggctctact tcgtctctgg agtttcgtct ctggagtttc 240

aggtccgagc ggctaactcg gtcctaggcg tctcccgtgc cgcgcccccg aagggacagt 300

cttgctggac tggtctcacg gtagcgcata cccgaatcag attcgtggtg acgcgcaaaa 360

ccgtgatctc acatttacag attcccgtgc atccgtgtgc acggattcac gcccatctgg 420

gcattcacgt ggccgttttg gtgcctccgt ctgggctctc gtcgctcccg gcggcgcgtc 480

gtggtgacaa ccgcgttcga cgcggcagag attgccgccg cggtcccgga atctggctca 540

ccgtgcagcg gtacagcgtc agctcgactg cgcagaatcc gcgccaagga agcccgcagg 600

gcgtcgatcg aacgctgtgg ggcggtgccg gccgcggtgc cgatgtggtc gtcgcgggag 660

ttgtggactg ccgatctgcg ggtgcttttg tcgggtccgg agttcagcac gcgccgggtg 720

atttcggcgg cgacggtgct cgctgtcgcg gtggcgatgg ccgagttcgc cgaccatgcc 780

acgggccgca atgtggcggt gacaaacgag gttctggccg agcgcgcgag gtgttctaag 840

cgttcggtga ccgcggcgcg cggggtgttg aaagcgttgg gtgtcgcggt ggaagcggta 900

cgtgggcatg gctctgcgac cacacacacg gtcggtaatc gaccgagcat ttggcacctg 960

gtaagccgac gccagcccac catcgacaac ccgcccacgg ccccgcagaa cggccgcggc 1020

gagcctgccg atacggtgcc cgatcgcggc cagagcgcgc ccgtggctgt ggagacttgc 1080

gacctaccac catcccgtag ggataggtgg gtaactcctg ttgagaatta ctcaccaagc 1140

acgcgcgagc gcgcgagcgc ggaaaattct tccccaaaac aaacacaacc ggcgcggtcg 1200

cggcggcgct accgcgccac gccgcgcccc ctggacgttc agcgactcgc cgccggcctg 1260

gtcacgccgg cagtcggcca cggcccagac aacgacgggc ggcgaaccgc gctgatcgcc 1320

ggcctggagc agggccatat cggggccatc tgcgacgcga tcacgacggc cggcatcgac 1380

gcgaccgcct ggactccgaa gacgctcacg gcggcactga acgccgacgc gcgggtgacc 1440

ggctggtcgt ggccggatcg catcgaacgt cctggcgcgt tcctggcgtc gcggctgcgc 1500

cgcctgcccg cacggcccga caccagtggc ccggttgaca acggcctgga tcaggcccgt 1560

aggacacccg ttgagccgtc agcggcccgt gtagcgccgg tacagacggc cgctggccgc 1620

gcgtacgccc gtgcgttgtt cgccgagcag cgacggcacc gggtgaccgc cgccaatgcc 1680

cagtcagccg cggtgccggt gcgccaaagt gcgccagaaa ccgcggtgtg cgcaacgtgc 1740

ggatgctcgg acgcaccacg gcggcggttc ctgccaacgc ggcgggctca catttgcgat 1800

gcctgtttcc aaggatgtgg tggtgggcag gcgcgtactg gtcgcgtcgg aacggtcggc 1860

agcagttccg cggtgccaca gtgccagtag tcgggcaggg cttgcacggg gatgcggacc 1920

catccgccgg ccgcggccgg cgatgggtcc agtgtcgcgt tagggccgtc gtccagccgc 1980

gccagctcgc ggtcggatgc gatcagcttg gcaccgtaga tgtcgtcgtg gcggcggtcc 2040

cacgtgttgg tgatgcggtc gcggtaccag cctgtccagt cttcgccggt gccgccggcg 2100

gtgagcccgg cccggtacca cgcttcgagg cgatcacggc cccgtgcgtg gttgatggtc 2160

tgggccgcag cccagtccgc gtcacggagg gctctgtcgg cttcgtccat gaacccgcgc 2220

cgggtcatgt cgatgatggc tggcgacggg gcgtcgtagg ggcctggcat gggcggaggc 2280

agtcggaact gttgcggttt gcttgcgttc agttcctcgt cctgctggtg ggtgcggtcg 2340

tgcagggcaa ggctgtcgcg gtaccaggcg tcgagcgcgg tgcgccagtc cccgccagtg 2400

gcgtagggct cccacggttg cggtggcagg gtggtgaact cgtgcaggac caggccgtcg 2460

atgtcgtcgc gcagttcttc accggcgatg gcggcgatgc gggcgcagta gccgggcaga 2520

tggctacgcc agtcggcggg cagttcgccg ctgcgcgccc accgcagcac atcggcccac 2580

aacccgcggc cgccactctc gttgcacggt tcgttgtgcc gttacaggcc ccgttgacag 2640

ctcaccgaac gtagttaaaa catgctggtc aaactaggtt taccaacgat acgagtcagc 2700

tcatctaggg ccagttctag gcgttgttcg ttgcgcggtt cgttgcgcat gtttcgtgtg 2760

gttgctagat ggctccgcaa ccacacgctt cgaggttgag tgcttccagc acgggcgcga 2820

tccagaagaa cttcgtcgtg cgactgtcct cgttgatcct tgccgagctg ggatggaagc 2880

ccggccgacc caccctggag gagatgatcg aggatgccag ggcctttcac gcccgccgct 2940

gctgagcgtc cgccgccggg cggcccgggg cgtcaggcgc cgggggcggt gtccggcggc 3000

ccccagagga actgcgccag ttcctccgga tcggtgaagc cggagagatc cagcggggtc 3060

tcctcgaaca cctcgaagtc gtgcaggaag gtgaaggcga gcagttcgcg ggcgaagtcc 3120

tcggtccgct tccactgcgc cccgtcgagc agcgcggcca ggatctcgcg gtcgccccgg 3180

aaggcgttga gatgcagttg caccaggctg tagcgggagt ctcccgcata gacgtcggtg 3240

aagtcgacga tcccggtgac ctcggtcgcg gccaggtcca cgaagatgtt ggtcccgtgc 3300

aggtcgccgt ggacgaaccg gggttcgcgg ccggccagca gcgtgtccac gtccggcagc 3360

cagtcctcca ggcggtccag cagccggggc gagaggtagc cccacccgcg gtggtcctcg 3420

acggtcgccg cgcggcgttc ccgcagcagt tccgggaaga cctcggaatg gggggtgagc 3480

acggtgttcc cggtcagcgg caccctgtgc agccggccga gcacccggcc gagttcgcgg 3540

gccagggcga gcagcgcgtt ccggtcggtc gtgccgtcca tcgcggaccg ccaggtggtg 3600

ccggtcatcc ggctcatcac caggtagggc cacggccagg ctccggtgcc gggccgcagc 3660

tcgccgcggc cgaggaggcg gggcaccggc accggggcgt ccgccaggac cgcgtacgcc 3720

tccgactccg acgcgaggct ctccggaccg caccagtgct cgccgaacag cttgatcacc 3780

gggccgggct cgccgaccag tacggggttg gtgctctcgc cgggcacccg cagcaccggc 3840

ggcaccggca gcccgagctc ctccagggct cggcgggcca gcggctccca gaattcctgg 3900

tcgttccgca ggctcgcgta ggaatcatcc gaatcaatac ggtcgagaag taacagggat 3960

tcttgtgtca cagcggacct ctattcacag ggtacgggcc ggcttaattc cgcacggccg 4020

gtcgcgacac ggcctgtccg caccgcggat caggcgttga cgatgacggg ctggtcggcc 4080

acgtcgggga gtcaggcaac tatggatgaa cgaaatagac agatcgctga gataggtgcc 4140

tcactgatta agcattggta actgtcagac caagtttact catatatact ttagattgat 4200

ttaaaacttc atttttaatt taaaaggatc taggtgaaga tcctttttga taatctcatg 4260

accaaaatcc cttaacgtga gttttcgttc cactgagcgt cagaccccgt agaaaagatc 4320

aaaggatctt cttgagatcc tttttttctg cgcgtaatct gctgcttgca aacaaaaaaa 4380

ccaccgctac cagcggtggt ttgtttgccg gatcaagagc taccaactct ttttccgaag 4440

gtaactggct tcagcagagc gcagatacca aatactgttc ttctagtgta gccgtagtta 4500

ggccaccact tcaagaactc tgtagcaccg cctacatacc tcgctctgct aatcctgtta 4560

ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg ggttggactc aagacgatag 4620

ttaccggata aggcgcagcg gtcgggctga acggggggtt cgtgcacaca gcccagcttg 4680

gagcgaacga cctacaccga actgagatac ctacagcgtg agctatgaga aagcgccacg 4740

cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg gcagggtcgg aacaggagag 4800

cgcacgaggg agcttccagg gggaaacgcc tggtatcttt atagtcctgt cgggtttcgc 4860

cacctctgac ttgagcgtcg atttttgtga tgctcgtcag gggggcggag cctatggaaa 4920

aacgccagca acgcggcctt tttacggttc ctggcctttt gctggccttt tgctcacatg 4980

ttctttcctg cgttatcccc tgattctgtg gataaccgta ttaccgcctt tgagtgagct 5040

gataccgctc gccgcagccg aacgaccgag cgcagcgagt cagtgagcga ggaagcggaa 5100

gagcgcccaa tacgcaaacc gcctctcccc gcgcgttggc cgattcatta atgcagctag 5160

aactagttga ttagctaagc agaaggccat cctgacggat ggcctttttg cgtttaatac 5220

tgtttaaact ctagactcga gtctgaaata aaacgaaagg ctcagtcgaa agactgggcc 5280

tttcgtttta tctgttgttt gtcggtgaac gctctcctga gtaggacaaa tccgccggga 5340

gcggatttga acgttgcgaa gcaacggccc ggagggtggc gggcaggacg cccgccataa 5400

actgccaggc atcaaattaa gcagaaggcc atcctgacgg atggcctttt tgcgtttcta 5460

caaactctta agctt 5475

<210> 8

<211> 2469

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

aggcgggcaa cacgacatct caatagttgg cacggagctc ctaaacgacg acagccccgc 60

taatgcgggg ccgcaacgtc gatttggctc tacttcgtct ctggagtttc gtctctggag 120

tttcaggtcc gagcggctaa ctcggtccta ggcgtctccc gtgccgcgcc cccgaaggga 180

cagtcttgct ggactggtct cacggtagcg catacccgaa tcagattcgt ggtgacgcgc 240

aaaaccgtga tctcacattt acagattccc gtgcatccgt gtgcacggat tcacgcccat 300

ctgggcattc acgtggccgt tttggtgcct ccgtctgggc tctcgtcgct cccggcggcg 360

cgtcgtggtg acaaccgcgt tcgacgcggc agagattgcc gccgcggtcc cggaatctgg 420

ctcaccgtgc agcggtacag cgtcagctcg actgcgcaga atccgcgcca aggaagcccg 480

cagggcgtcg atcgaacgct gtggggcggt gccggccgcg gtgccgatgt ggtcgtcgcg 540

ggagttgtgg actgccgatc tgcgggtgct tttgtcgggt ccggagttca gcacgcgccg 600

ggtgatttcg gcggcgacgg tgctcgctgt cgcggtggcg atggccgagt tcgccgacca 660

tgccacgggc cgcaatgtgg cggtgacaaa cgaggttctg gccgagcgcg cgaggtgttc 720

taagcgttcg gtgaccgcgg cgcgcggggt gttgaaagcg ttgggtgtcg cggtggaagc 780

ggtacgtggg catggctctg cgaccacaca cacggtcggt aatcgaccga gcatttggca 840

cctggtaagc cgacgccagc ccaccatcga caacccgccc acggccccgc agaacggccg 900

cggcgagcct gccgatacgg tgcccgatcg cggccagagc gcgcccgtgg ctgtggagac 960

ttgcgaccta ccaccatccc gtagggatag gtgggtaact cctgttgaga attactcacc 1020

aagcacgcgc gagcgcgcga gcgcggaaaa ttcttcccca aaacaaacac aaccggcgcg 1080

gtcgcggcgg cgctaccgcg ccacgccgcg ccccctggac gttcagcgac tcgccgccgg 1140

cctggtcacg ccggcagtcg gccacggccc agacaacgac gggcggcgaa ccgcgctgat 1200

cgccggcctg gagcagggcc atatcggggc catctgcgac gcgatcacga cggccggcat 1260

cgacgcgacc gcctggactc cgaagacgct cacggcggca ctgaacgccg acgcgcgggt 1320

gaccggctgg tcgtggccgg atcgcatcga acgtcctggc gcgttcctgg cgtcgcggct 1380

gcgccgcctg cccgcacggc ccgacaccag tggcccggtt gacaacggcc tggatcaggc 1440

ccgtaggaca cccgttgagc cgtcagcggc ccgtgtagcg ccggtacaga cggccgctgg 1500

ccgcgcgtac gcccgtgcgt tgttcgccga gcagcgacgg caccgggtga ccgccgccaa 1560

tgcccagtca gccgcggtgc cggtgcgcca aagtgcgcca gaaaccgcgg tgtgcgcaac 1620

gtgcggatgc tcggacgcac cacggcggcg gttcctgcca acgcggcggg ctcacatttg 1680

cgatgcctgt ttccaaggat gtggtggtgg gcaggcgcgt actggtcgcg tcggaacggt 1740

cggcagcagt tccgcggtgc cacagtgcca gtagtcgggc agggcttgca cggggatgcg 1800

gacccatccg ccggccgcgg ccggcgatgg gtccagtgtc gcgttagggc cgtcgtccag 1860

ccgcgccagc tcgcggtcgg atgcgatcag cttggcaccg tagatgtcgt cgtggcggcg 1920

gtcccacgtg ttggtgatgc ggtcgcggta ccagcctgtc cagtcttcgc cggtgccgcc 1980

ggcggtgagc ccggcccggt accacgcttc gaggcgatca cggccccgtg cgtggttgat 2040

ggtctgggcc gcagcccagt ccgcgtcacg gagggctctg tcggcttcgt ccatgaaccc 2100

gcgccgggtc atgtcgatga tggctggcga cggggcgtcg taggggcctg gcatgggcgg 2160

aggcagtcgg aactgttgcg gtttgcttgc gttcagttcc tcgtcctgct ggtgggtgcg 2220

gtcgtgcagg gcaaggctgt cgcggtacca ggcgtcgagc gcggtgcgcc agtccccgcc 2280

agtggcgtag ggctcccacg gttgcggtgg cagggtggtg aactcgtgca ggaccaggcc 2340

gtcgatgtcg tcgcgcagtt cttcaccggc gatggcggcg atgcgggcgc agtagccggg 2400

cagatggcta cgccagtcgg cgggcagttc gccgctgcgc gcccaccgca gcacatcggc 2460

ccacaaccc 2469

<210> 9

<211> 1120

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 9

tcaggcgccg ggggcggtgt ccggcggccc ccagaggaac tgcgccagtt cctccggatc 60

ggtgaagccg gagagatcca gcggggtctc ctcgaacacc tcgaagtcgt gcaggaaggt 120

gaaggcgagc agttcgcggg cgaagtcctc ggtccgcttc cactgcgccc cgtcgagcag 180

cgcggccagg atctcgcggt cgccccggaa ggcgttgaga tgcagttgca ccaggctgta 240

gcgggagtct cccgcataga cgtcggtgaa gtcgacgatc ccggtgacct cggtcgcggc 300

caggtccacg aagatgttgg tcccgtgcag gtcgccgtgg acgaaccggg gttcgcggcc 360

ggccagcagc gtgtccacgt ccggcagcca gtcctccagg cggtccagca gccggggcga 420

gaggtagccc cacccgcggt ggtcctcgac ggtcgccgcg cggcgttccc gcagcagttc 480

cgggaagacc tcggaatggg gggtgagcac ggtgttcccg gtcagcggca ccctgtgcag 540

ccggccgagc acccggccga gttcgcgggc cagggcgagc agcgcgttcc ggtcggtcgt 600

gccgtccatc gcggaccgcc aggtggtgcc ggtcatccgg ctcatcacca ggtagggcca 660

cggccaggct ccggtgccgg gccgcagctc gccgcggccg aggaggcggg gcaccggcac 720

cggggcgtcc gccaggaccg cgtacgcctc cgactccgac gcgaggctct ccggaccgca 780

ccagtgctcg ccgaacagct tgatcaccgg gccgggctcg ccgaccagta cggggttggt 840

gctctcgccg ggcacccgca gcaccggcgg caccggcagc ccgagctcct ccagggctcg 900

gcgggccagc ggctcccaga attcctggtc gttccgcagg ctcgcgtagg aatcatccga 960

atcaatacgg tcgagaagta acagggattc ttgtgtcaca gcggacctct attcacaggg 1020

tacgggccgg cttaattccg cacggccggt cgcgacacgg cctgtccgca ccgcggatca 1080

ggcgttgacg atgacgggct ggtcggccac gtcggggagt 1120

<210> 10

<211> 589

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 10

ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc 60

agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt 120

cagcagagcg cagataccaa atactgttct tctagtgtag ccgtagttag gccaccactt 180

caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc 240

tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa 300

ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac 360

ctacaccgaa ctgagatacc tacagcgtga gctatgagaa agcgccacgc ttcccgaagg 420

gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga 480

gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact 540

tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaa 589

<210> 11

<211> 228

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 11

atttaggtga cactatagat ttcacacacc cgttccacga ctggcgctgt tttagagcta 60

gaaatagcaa gttaaaataa ggctagtccg ttatcaactt gaaaaagtgg caccgagtcg 120

gtgcatacat aggatccgtc gaaaataaaa cgaaaggctc agtcgaaaga ctgggccttt 180

cgttttatct gttgtttgtc ggtgaacgct ctcctgagta ggacaaat 228

<210> 12

<211> 1188

<212> DNA

<213> New golden Mycobacterium (Mycobacterium neoaurum)

<400> 12

atgactaccg agacagccgg cattcgcgag atcgacaccg gcgacctgcc agaccgctat 60

gcgcgcggtt ggcactgcct gggaccggtg aaggactacc tcgacggcaa gccgcacggg 120

gtggagatct tcgggaccat gctcgtcgtc ttcgccgatt cggaaggcga actcaaagtt 180

ctcgatggct attgccggca tatgggcggc aacctcgccc agggctcgat caagggcgac 240

accgtggcct gcccgttcca cgactggcgc tggggcggcg acggcaagtg caagctcgtc 300

ccctacgcca agcgcacacc gcgcctggcc cgcacccggg cctggcacac cgatgtgcgc 360

ggcgggctgc tgttcgtctg gcatgaccac gagggcaacc caccgcagcc cgaggtgcgg 420

atcccggaga tccccgagtt cgccagcgac gactggaccg attggcggtg gaacacgatg 480

ctcatcgagg gctccaactg ccgcgagatc atcgacaacg tcacagacat ggcgcacttc 540

ttctacatcc actacgggtt gccgacgtac ttcaagaatg tcttcgaggg ccacatcgcc 600

agccagtacc tgcacaacgt cggccgtccg gatgtcaacg acctcggcac cacctacggt 660

gaggcgcacc tggattccga ggcgtcctac ttcggtccgt cgttcatgat caactggctg 720

cacaacaact acggcgggtt caaggccgag tccatcctga tcaactgcca ttacccggtc 780

agccagaact ccttcgtgct gcagtggggc gtcatcgtcg aaaagcccaa ggggctcgac 840

gagaagacca ccgacaagct cgcccgcgtc ttcaccgagg gtgtttccaa ggggttcctg 900

caggatgtcg agatctggaa gcacaagacc cggatcgaca acccgctgct ggtcgaggag 960

gacggcgccg tctatcagat gcgccgctgg tatcagcagt tctacgtcga cgtcgccgac 1020

gtgacccccg atatgaccga ccgcttcgag atggaggtcg acaccaccat cgccaacgag 1080

aagtggcatg tcgaggtcga ggaaaacctg aagctgcagc aggacgccgc cgagcgcgat 1140

gccgccgaac agggtgagcc gcaaaaagaa ccggctcagc cgagctga 1188

<210> 13

<211> 1143

<212> DNA

<213> New golden Mycobacterium (Mycobacterium neoaurum)

<400> 13

atgaccgata tccgcgagat cgacgccggc gccgcgatga cgaggttcgc ccgtggctgg 60

cactgcctcg ggctggccga gaccttccgc gacgggcgac cgcacggtat cgaggcgttc 120

ggttccaagc tggtggtctt cgctgatgcc gccggggccc tgcacgtgct cgacgcgtac 180

tgcaggcata tgggcggtga cctctcccgc ggctcgatca aggacgacac gctggcctgt 240

ccgttccacg actggcgctg gcgtgccgac ggtagatgcg cgctggtgcc ctacgccaag 300

cggaccccgc ggctggcgcg cacccgcgcc tgggagaccc gcgaggtcaa cgggcagctg 360

ctgatctggc acgatcccga gggctcgacg ccgcccgcgg agctgctgcc gccgaccatc 420

gagggctatc ccgaggggca atggtcgccg tggcagtgga actcggtagt gatcgagggt 480

tcgcactgtc gcgaaatcgt ggacaacaac gtcgacatgg cgcatttctt ctacatccac 540

cacgcctatc cgacgtactt caagaacgtc atcgaggggc acaccgcaag tcagttcatg 600

gagtccaaac cccgaccgga ttacatcgcc gaccccgaaa agatctggga aggaacgtat 660

ctgcgatcgg aggccaccta cttcggtcct gcgtacatga tcaactggtt gcacaacgac 720

ctggcgccag gattcaccgt ggaggtggcg ctgatcaact gccactaccc ggtgtcccat 780

gattcgttcg tcctgcagtg gggtgtggcg gtgcaacaga tgcccggcct gtccgccgac 840

aaggccgcca agctggccgg cgcgatgagc cggtccttcg gcgaggggtt catggaggat 900

gtcgagatct ggcggcacaa gaccaggatc gagaacccgc tgctcaccga ggaggacggt 960

gcggtctatc aacaccgccg ctggtacgag cagttctacg tcgactccgc cgatgtcacc 1020

accgatatga ccgaccggtt cgagctggag atcgacacca cccacgccta tgggatctgg 1080

gccgaggagg tggccgagaa tctggccggg ctggcgcagg ccggtcgcgg ttcgactgcg 1140

taa 1143

Claims

1. A gene editing system of a novel Mycobacterium aureum engineering bacterium is characterized by comprising a pMV261-rAPOBEC/n (d) Cas9/UGI plasmid and a pTarget-sgRNA plasmid;

the pMV261-rAPOBEC/n (d) Cas9/UGI plasmid is obtained by the following steps:

the nucleotide sequence of rAPOBEC is shown as SEQ ID NO. 1, theUGIThe nucleotide sequence of the gene is shown as SEQ ID NO. 2; said nCasThe nucleotide sequence of the 9 gene is shown as SEQ ID NO. 3; said dCasThe nucleotide sequence of the 9 gene is shown as SEQ ID NO. 4; the nucleotide sequence of the Linker1 is shown as SEQ ID NO. 5; the nucleotide sequence of the Linker2 is shown as SEQ ID NO. 6;

the pTarget-sgRNA plasmid is obtained by the following steps:

taking pTarget as a framework, connecting a sgRNA gene fragment containing high copy replicon OriMe of OriM which is different from pMV261, hygromycin resistance gene Hyg and escherichia coli replicon OriE, wherein the sgRNA is a targeting sequence, can specifically target the targeting sequence, and is cloned in escherichia coli to obtain pTarget-sgRNA plasmid;

the nucleotide sequence of pTarget is shown as SEQ ID NO. 7, and the nucleotide sequence of OriMe is shown as SEQ ID NO. 8; the nucleotide sequence of Hyg is shown as SEQ ID NO. 9; the nucleotide sequence of the OriE is shown as SEQ ID NO. 10;

the pTarget-sgRNA plasmids also comprise pTarget-sgRNA_kshA1-1, pTarget-sgRNA_kshA1-2 and pTarget-sgRNA_kshA2 plasmids, wherein the pTarget-sgRNA_kshA1-1, pTarget-sgRNA_kshA1-2 and pTarget-sgRNA_kshA2 plasmids specifically use pTarget-sgRNA as templates and use targeting primers related to kshA1 and kshA2 genes for PCR amplification mutation;

the nucleotide sequence of kshA1 is shown as SEQ ID NO. 12, and the nucleotide sequence of kshA2 is shown as SEQ ID NO. 13;

the n (d) Cas9 is nCas9 and dCas9.

2. The use of the gene editing system according to claim 1 for single base editing of a new Mycobacterium aureofaciens engineering bacterium gene.

3. The use according to claim 2, characterized by the steps of:

the pMV261-rAPOBEC/n (d) Cas9/UGI plasmid is introduced into the new Mycobacterium aurum, after rAPOBEC/n (d) Cas9/UGI genes are stably expressed in the new Mycobacterium aurget-sgRNA_kshA 1-1, pTarget-sgRNA_kshA1-2 and pTarget-sgRNA_kshA2 plasmids are introduced into the new Mycobacterium aurum, so that the pTarget-sgRNA plasmids are transcribed into sgRNA sequences and combined with a three-enzyme fusion protein to form a complex, the complex targets genes to be edited in the new Mycobacterium aurum, cytosine deaminase converts cytosine C into U to be further T, and UGI can inhibit uracil glycosidase and reduce the influence of intracellular repair mechanism.