AU2016222425A1 - Transgenic photosynthetic microorganisms - Google Patents

Abstract

AfSR. A(T Pr o ided is a iransgente photosynthetic nimeoo~t anin es' counpiiosc an artiicia DNA\ construct nhereim the transgec photos nthetia microrgansm cel accumulates increased le\els O1 disaccharide as compared to a photosynthele micr oorusilm ccli not comprising the DNA construct Als provided is use of h rasgenic pho tosvncue mnieroorgamsmeeci n mproecng a ermentalesugr andi cuilti atmg photosyntheue mcroorgaItsmns

Description

CEOSS--REFF RP.NCB TO RELATED AP'fB.lCATIONS

[pOOX] The present application is-a divisional application derived from Australian Patent Application No, 2.(),14.250606, which in turn is a divisional application derived from Australian Patent Application No. 2009204313 . pp-q/gigpoOri/Ooft] 62: WC) 20()9/089185), .ciaiming priority of US Application Nos. ft ] /0187/)8 and 61./()85797, the entire contents of which ore incorporated by reference herein.

INCORPORATE >NTf V-KEFERENCB OF MATERIAL SUBMITTED IN COMP1 HER READABLE .FORM

[0002] The Sequence listing, which is a part of the present disclosure, includes a computer readable form lodged with the parent application published under WO 2009/089185 and a written sequence listing comprising, nucleotide and/or amino acid sequences of the present invention. The sequence listing information, recorded in computer readable form: is identical to the written sequence listing, 'The subject matter of the Sequence Listing is incorporated herein by reference in. its entirety.. FIELD OF THE INVENTION: 10003 j The present divisional application, as well as the grandparent application, generally relate to transgenic microorganisms and fjieir use, whereas the parent application generally relates to photobioreactorS: for cultivating m ic roo rgani srn s and de v i ces i hcorporal i ng sue h p ho toh i oreactors.

BACR6R0UND

[ 000 4 ] To address the world’s increasing, energy requirements, efficient and eftvirooinentally sound alternatives to fheuse of fossil fuels are sought after, Alternative.fuels, such as ethanol or biodiesel:, can be produced from plant biomass. For example Ah© key ingredient used to produce ethanol from current processes is termed fermentable sugar. Most often, fermen table sugar is in the form of sucrose, glucose, or high-fructose corn syrup. Plants- currently .grown to produce such biomass include com, sugarcane, soybeans, canola, jatropha, and so forth. But much of the plant biomass: used to produce fermentable sugar requires extensive energy-in tensive pre-processing, .Further; use of such plant biomass can lead to soil depletion, erosion, and diversion of the .food Supply. £00 05] it is kaowtx that some cyanobacteria produce sucrose through the action of socrose phosphate synthase sad sucrose phosplmte phosphatase, where it has bee» studied exclusively as an osmoptotectank With respect to salt tolerance, cyanobacteria can be divided into three groups. Strains having tow tolerance (less than.700 ntM) synthesize either sucrose, as is the case with Synechoeoecus eiongatus PCC 7942, or another dissaceharide known as trehalose [BlunwaM et al, Proc Natl Aed Set USA (1983) 80:2599-2602 and Reed et ah, FEMS Microbiol Rev (1986} 39:5 1~56]< Giucosylglyeerol is produced by strains having moderate halotblerance (0.7-1,8 mM), such as Syhechocystis sp. PCC 6803. High salt tolerance (up to 2,5 M) results from the accumulation of either glycine betaine or glutamate betaine. Miao et at. [FEMS Microbiol Lett (2003) 218:71-77) determined that when giucosylgiycerol biosynthesis is blocked by deletion of the agp gene, however, Synechocystis sp. PCC 6803 produces sucrose as Its osmoprotectant. Desiccation tolerant cyanobacteria also produce sucrose and trehalose in response to matric water stress [Hershkovitz et at, Appl Environ Microbiol (1991) 57:645-648].

[00061 Syneckocystis spp. .PCC 6803 (ATCC 27184) and Symchmoccm eiongatus PCC 7942 (Al CC 33912) are relatively w-ell-studied, have genetic tools available and the sequences of their genomes are known (see Koksharova, O. A. and-Wolk, C. P, 2002, Appl Microbiol Biotechnol 58, .123-137; Ikeuehil, M. and Satoshi Tabata, S, 2001, Photosynthesis Research 70, 73-83; Golden, S. S., Brusslaa, J. and Hase&amp;om, R. 1987. Methods in Enzymology 153,215-231; Fricdberg, D, 1988, Methods in Enzymolpgy 167,736-747; Kancko, T. etal 1996. DNA Research 3,109-136). £00073. 1 he commercial cultivation of phoiosynthetic inicroorgamsms such as Spirnlina maximum, SpiMina platensis, Dunalielia salina, Botrycoccus hraunii, CMorella vmlgaris, Chlorolla pyreaoidosa, Serenastrum eapricemutum, Scenedesmus auadrieauda, Porphyridium cruentum, Scenedesmus aeutus, Dunalielia sp,, Scenedesmus obliquus, Aaabaenppsis, Aulosira, Cyiindrospennum, Seeneeoceus sp., Seeneeosystis sp., and Tolypothrix is desirable for numerous applications including the production of fine chemicals, pharmaceuticals, cosmetic pigments, fatty acids, antioxidants, proteins with prophylactic action, growth lactors, antibiotics, vitamins and polysaccharides. The algic biomass can also be useful, in a low dose, to replace or decrease the level of an tibiottes in animal food or be useful m a source of proteins. Furthermore, the algic biomass provided in a wet form, as opposed to a dried form, can he fermented or liquefied by thermal processes to produce fuel Tims, there is great interest in the ability to increase the efficiency of cultivating such, organisms, f 0 0 0§ 3 in genera!, current photosynthctic hioreaetors rely on the cultivation of microorganisms in a liquid phase system to produce biomass. These systems arc usually open-air pond-type reactors or enclosed tank-type reactors. Enclosed bioreactors, however, typically are considered to be an improvement over pond type reactors in many respects. Importantly, enclosed systems provide a barrier against environmental contamination. In addition, these systems allow" for greater control of temperature and gas content of the liquid media, [0009] Still, the nses of enclosed photobi oread o t$ tend to he limited by phofosyntheiic microorganisms5 requirement for light {be., actinic radiation provides the energy required by phetosynthetic microorganisms to fix carbon dioxide in to organic molecules). Thus, sufficient illumination of the photosynthetic microorganisms is an unyielding requirement, Nevertheless,-as the cell density in a liquid phase photobioreactor increases, the ability of light to penetrate into the media decreases, which typically limits the cell density that may be achieved. Additionally, .some type of agitation of fee liquid media is generally required to prevent unwanted sedimentation of fee organisms, a process that requires fee input of energy .

[00X03 Numerous attempts have been made to devise a method of bringing light to the organisms in liquid phase systems, For example, some systems involve circulating the liquid culture media through transparent tubes. Other attempts involve placing a light source within the media or introducing reflecting particles into the culture media to adjust the radiation absorbance of fee culture. Despite these efforts, a significant increase in the ability to culture organisms in liquid phase systems at higher cell densities has not yet been achieved, [00113 In addition to the aforementioned light requirement, the use of liquid phase photobioraactors has been huidened wife providing- the photosynthetie microorganisms' enough carbon dioxide for photosynthesis. Typically, these systems generally incorporate some type of additional, aeration system to. increase fee concentrat ion of carbon dioxide dissolved in the media. Eliminating the need for aeration would greatly simplify the system fens reducing operating costs. 100123 Liquid phase phoioMoreactors also tend not to be well suited for conventional methods of continuous production. In general, the transporiatioa of large volumes of liquid is complex and burdensome. Further, because liquid phase systems usually require mechanisms for circulation, agi tation, aeration, and the like, it is generally simpler and more cost effective to operate only one or a few large cultivation devices rattier than numerous smaller ones,

Therefore, currently practiced methods involve processing relatively large hatches (te.t a hatch of photosynthetic microorganisms is cultivated and the entire resulting biomass is then harvested). idol 3 3 Fhus* there is a great need in the ait for advancement in photosynthetic bioreactor design. Providing a new type of photosynthetic bioreactor capable of efficiently cultivating and harvesting relatively high densities of photosynthetic microorganisms without large volumes of water or other liquid media, without the aforementioned extraordinary measures for supplying adequate light and carbon dioxide, and at a reasonable cost would represent a substantial advance in the art, and benefit industry' and consumers alike.

SUMMARY QP THE INVENTION 100143 Provided herein is a transgenic bac teria engineered to accumulate carbohydrates, for example disaccharides. Also provided is a photobioreacior for cultivating photosynthetic microorganisms comprising a hen-gelatinous,· solid cultivation support suitable for providing nutrients and moisture to photosynthetic microorganisms and a physical barrier covering at least: a portion of the surface of the cultivation .support Devices for the large scale and continuous cultivation of photosynthetic microorganisms incorporating photobioreactors and methods of use are disclosed. Also disclosed arc methods of producing fermentable sugar from photosynihetie microorganisms using a photobioreactor of the invention. 10 015] One aspect provides a photobioreactor for cultivating photosynthetic microorganisms. The photobioreactor comprises a non-gelatinons, solid cultivation 'support suitable for providing nutrients and moisture to photosynthetic microorganisms on at least a portion of a surface thereof, wherein said portion of the surface has a topography that allows photosynthetic microorganisms to adhere thereto when said portion of the surface is oriented non-horizontaliy' and a physical harrier covering at least said portion of the surface of the cultivation support, wherejn the physical barrier is configured so as to allow inoculation of said portion of the surface of the cultivation support, formation and maintenance of an environment suitable- for the cultivation of such photosynthetie microorganisms, and harvesting of such cultivated photosynthetic microorganisms, [0015] In some embodiments, the photobioreactor comprises photosynthetie microorganisms on said portion of the surface of the cultivation support. In some embodiments, the photobioreactor further comprises a cell engineered to accumulate a disachari.de, as described further below, wherein the cell is adhered to the solid cultivation support. In some embodiments, said portion of the surface of the cultivation support is capable of cultivating photosynthetie microorganisms at a density of at least about 50 grams of dry biomass per liter equivalent, 100X73 In some embodiments, the cultivation support is flexible. In some embodiments, the cultivation support comprises one or more rigid materials. In some embodiments, the cultivation support of the photobioreactor comprises at least two layers, a first layer adjacent to a second layer, wherein material of the at least two layers is the same material or different: materials. In some embodiments, the first layer comprises a high surface area growth material and the second layer a permeable type material. In some embodiments, the cultivation support of the photobioreactor comprises flexibly connected rigid portions, wherein the rigid portions are comprised of the one or more rigid materials. In some embodiments, the photobioreactor comprises a single cultivation support. In some embodiments, the photobioreactor comprises a plurality of culti vation supports. £00X81 In some embodiments, the cultivation support comprises a fabric, In some embodiments, the fabric is comprised of fibers that are natural, modified natural, synthetic, or a combination thereof. In some embodiments, the fabric is a woven fabric, a knitted fabric, a felt, a mesh of croxs-Smked fiber polymers, or a combination thereof, to some embodiments, the natural fibers are selected from the group consisting of cotton,wool, hemp, tree fiber, oilier cellnlosie fibers, and combinations thereof. In some embodiments, the modified natural fibers are selected from the group consisting of nitrocellulose, cellulose acetate, cellulose sulfonate, crosslmked starches, and combinations thereof In some embodiments, the synthetic fibers are selected from the group consisting of polyester, polyacrylate, polyamine, polyamide, polysulfone, and combinations thereof. 1001 S I In some embodiments, the cultivation support is coated with a moistare absorbent polymer. In some embodiments, the fabric, the fiber of the fabric, or both, are coated with a moisture absorbent polymer. In some embodiments, the moisture absorbent polymer is selected from the group consisting of agar, polyacrylate, polyamide, poiyamiae, polyethylene glycol, modified starches, and combinations thereof.

[00203 in some embodiments, the physical barrier o f the photebioreactor is at least substantially impermeable to solid particulate and liquid but does not prevent the transport of gas or vapor to and from the space proximate to said portion of the surface of tire cultivation support nor actinic irradiation of said portion of the surface of the cultivation support, in some embodiments, the physical barrier is sufficiently impermeable to water vapor so that the cultivation support upon being moistened will retain enough of the moisture so the photosyndretic .microorganisms remain adequately hydrated during cultivation. In some embodiments, the barrier is configured to enclose the cultivation support and any photosynthetic microorganisms thereon, and to be releasably sealed during at least a portion of the cultivation of the photosynthetic microorganisms, in some embodiments, the physical barrier is flexible. In some embodiments, the physical barrier further comprises a first portion that is at least substantially impermeable to solid particulate, liquid, gas, and vapor, and a second portion that is permeable to gas and vapor but at least substantially impermeable to solid particulate and liquid. In some embodiments, the second portion of the barrier has a gas or vapor exchange rate that is from at least about 5 Gurley seconds to no greater than about 10,000 Gurley seconds. In some embodiments, the second portion of the barrier comprises a selective membrane comprising olefin fiber or polyethylene fiber material, polytetrafiuoroethylene. filtration media, cellulosic filter material, fiberglass filter material, polyester filter material, polyacrylate filter material, poiysulfone membranes, or nylon membranes. In some embodiments, the first portion Is at least substantially transparent to actinic radiation and the second portion is· not at least substantially transparent to actinic radiation, and the configuration of the first and second portions relative to each other and at least said portion of tile surface of the cultivation support is such that there a sufficient amount of actinic radiation and gas exchange to support photosynthesis by photosynihebc microorganisms. £00213 jfl some embodiments, die photobioreactor further comprises a source .of actioie radiation situated between the cultivation support and the physics! harrier. In some embodiments, the physical barrier is between the culttvarion support and a source of actinic radiation and is sufficiently transparent to such actinic radiation and sufficiently gas permeable to allow for photosynthesis by the photosynthetic microorganisms during cultivation, £0022] In some embodiments, the photobioreactor further comprises water, nutrients, or a combination thereof on, within, or on and within, fee cultivation support. In some embodiments, the photobioreactor further comprises one or more attachment points for attaching fee photobioreactor to a structure. In some embodiments, the solid cultivation support further comprises one or more attachment points for attaching the cultivation support. In some embodiments, fee photobioreactor further comprises at least one of a fluid supply system, .a nutrient supply system, a gas supply system, and a miemorgaasim supply system, £00233 Another aspect provides a device for cultivating photosynfeetic microorganisms. Such device comprises at least one photobioreactor as described above, and a structure to which the at least one photobioreactor is attached feat orientates at least one cultivation support of the at least one photobioreactor non-horizontally, In some embodiments, fee at least one photobioreactor is suspended from the structure. In some embodiments, the structure is substantially covered by the physical barrier. In some embodiments, fee structure comprises a conveyor system or a component thereof such that the at least one cultivation support is capable of being conveyed along fee path of fee conveyor system. In some embodiments, the device further comprises one, two, or feme of fee foliowing: an inoculation station such that, each cultivation support as it is conveyed along fee path of fee con veyor system may be inoculated wife photosynfeetic microorganisms; a cultivating station such that fee photosynftetie microorganisms on. each inoculated cultivation support are cultivated as each cultivation support is con veyed along fee path of the con veyor system; and a harvesting station to which fee cultivation support is conveyed so that at least a portion of fee cultivated photosynthetie microorganisms may be harvested from each cultivation support In some embodiments, the inoculation station and fee harvesting station are substantially adjacent to each other or are substantially coextensive. In some embodiments, the device further comprises an inducing station for inducing the synthesis of fermentable sugar by photosynfeetic microorganisms on each- cultiyation support. In some embodiments, the device futher comprises at least one of a fluid supply system, a nutrient supply system, a gas supply system, or a microorgans bn supply system. In some embodiments, the device further comprises a phoiosynthetic microorganisms adhered on the solid cultivation support. In some embodiments, the device further comprises a cell engineered to accumulate a disacharlde, as described further below, wherein the cell is adhered to the solid cultivation support.

[0 0243 Another aspect provides a transgenic photosynthetic microorganism cell engineered to accumulate a disaccharide. The transgenic photosynthetic microorganism cell comprises, as operahly associated components in the 5* to 3' direction of transcription; a promoter funedona! in the photosynthetic microorganism cell; a polynucleotide comprising a nucleotide sequence encoding a polypeptide having a disaccharide biosynthetic activity selected from the group consisting of a. disaccharide phosphate synthase and a disaccharide phosphate phosphatase; and a transcriptional termination sequence; wherein the transgenic photosyuthetic microorganism ceil accumulates increased levels of the disaccharide compared to a photosynthetic microorganism cell not comprising the 0ΝΑ construct 100253 In some embodiments, the transgenic phoiosynthetic microorganism cell comprises a polynucleotide comprising a first nucleotide sequence encoding a polypeptide having disaccharide phosphate synthase activity and a second nucleotide sequence encoding a polypeptide having disaccharide phosphate phosphatase activity. In some embodiments, the comprises a polynucleotide comprising a nucleotide sequence encoding a polypeptide having disaccharide phosphate synthase activity and disaccharide phosphate phosphatase activity. In some embodiments, the comprises a a first nucleotide sequence encoding a polypeptide having disaccharide phosphate synthase activity; a second nucleotide sequence encoding a polypeptide having disaccharide phosphate phosphatase activity; and a third nucleotide sequence encoding a polypeptide having disaccharide phosphate synthase activity and disaccharide phosphate phosphatase activity.

[00261 In some embodiments, the polynucleotide of the transgenic photosymthetic microorganism cell is selected from the group consisting of; (a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide selected firim the group consisting of SEQ10 NO; 2 or a sequence 95% identical thereto having sucrose phosphate synthase and sucrose phosphate phosphatase (ASF) activity; SEQ ID NO; 4 or a sequence 95% identical thereto having sucrose phosphate synthase (SPS) activity; SEQ ID NO; 6 or a sequence 95% identical thereto having a sucrose phosphate phosphatase (SPP) activity; SEQ ID NO ?7 or a sequence 95% identical thereto having trehalose phosphate synthase (TPS) activity; SEQ ID NO: 79 or a sequence 95% identical thereto having trehalose phosphate phosphatase (TPP) activity; SEQ ID NO; 81 or a sequence 95% identical thereto having giucosylgiyceml phosphate synthase. (GPS) acidvity; SEQ ID. NO: 83 or a sequence 95% identical thereto having glucosylglycerol phosphate phosphatase (GPP) activity; SEQ ID NO: 85 or a sequence 95% identical thereto having tnannosylfructose phosphate synthase (MPS) activity; and SEQ ID NO: 87 or a sequence 95% identical thereto having tnannosylfructose phosphate phosphatase (MPP) activity; ..(b) an isolated polynueleptide comprising SEQ ID NO: 1. or asequence 95% identical thereto encoding sucrose phosphate synthase / sucrose phosphate phosphatase (ASF) activity; SEQ ID NO; 3 or a sequence 95% identical thereto encoding sucrose phosphate synthase (SPS) acdvity; SEQ ID NO: 5 or a sequence 95% identical thereto encoding sucrose phosphate phosphatase (SPP) activity ; SEQ ID NO: 76 or a sequence 95% identical thereto encoding trehalose phosphate synthase (TPS) acdvity'; SEQ ID NO; 78 or a sequence 95% Identical thereto encoding trehalose phosphate phosphatase (TPP) activity; SEQ ID NO: 80 or a sequence 95% identical thereto encoding glucosylgiyeerol phosphate synthase (GPS) acidvity; SEQ ID NO: 82 or a sequence 95% identical thereto encoding glucosylgiyeerol phosphate phosphatase (GPP) acdvity; SEQ ID NO: 84 or a sequence 95% identical thereto encoding mannosylfructose phosphate synthase (MPS) activity; and SEQ ID NO: 86 or a sequence 95% identical thereto encoding inannosyilructose phosphate phosphatase (MPP) activity; (e) an Isolated polynucleotide that hybridizes under stringent conditions to a nucleic acid sequence selected from the group consisting of: SEQ ID NO: I, wherein the isolated polynucleotide encodes a polypeptide having ASF acdvity; SEQ ID NO:.3, wherein the isolated polynucleotide encodes a polypeptide having SPS 'activity; SEQ ID NO: 5» wherein the Isolated polynucleotide encodes a polypeptide .having SPP acdvity; SEQ ID NO: 76, wherein the isolated polynucleotide encodes a polypeptide having TPS activity·'; SEQ ID NO: 78, wherein the isolated.polynucleotide encodes a polypeptide having TPP activity, SEQ ID NO: 80, wherein the isolated.polynucleotide encodes a polypeptide having GPS activity; SEQ ID NO; 82, wherein the isolated polynucleotide encodes a polypeptide having OPP activity; SEQ ID NO: 84, wherein the isolated polynucleotide ettcodes a polypeptide havrog MPS activity; SEQ ID NO: 86, wherein the isolated polynucleotide encodes a polypeptide 'having MPP activity; wherein said stringent conditions comprise incubation at 65°G in a solution comprising 6X SS€ (0.9 M sodium chloride and 0.09 M sodium citrate); and (d) an isolated polynucleodde complementary to the polynucleotide sequence of (a), (b), or (c). 100273 In some embodiments, monomers of the accumulated disaccharide are endogenous to the cell. In some embodiment a monomerfs) of the accumulated disaccharide are exogenous to the cell arid expression of such monomers) is engineered into the cell.

[0028] In some embodiments, the cell is a cyanobacterium cell, a photosynthelie bacteria; or a green algae. In some embodiments, the cell is a cyanobacterium cell In some embodiments, the cell is a cyanobacterium selected from the group consisting of Synechocoecus and Syaechoeystis, [0029] In some embodiments, the promoter is an inducible promoter. In some embodiments, the promoter is iducibie by an agent selected from the group consisting of temperature, pH, a metabolite, light, an osmotic agent, a heavy metal, and an antibiotic, in some embodiments, toe promoter is selected from the group consisting of carB, rdrA, pshAIL dnaK, kaiA„ and £0 03 0] In some embodiments, the DN A construct of the cell comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 19 (pLybAL! 1 encoding asf); SEQ ID NO: 20 (pLybALl2 encoding us/); SEQ ID NO: 44 (pLybALl 5 encoding mf); SBQIDNO; 45 (pLybALld encoding os/); SEQ ID HO: 46 (pLybALl? encoding αφ;SEQ ID NO: 47 (pEybALlS encoding us/); SEQ ID NO: 4g (pLybALl9 encoding asf); SEQ ID NO: 49 (pLybAL21 encoding αφ; SEQ ID NO: 50 (pLybAL22 encoding asf); SEQ ID NO: 51 (pLybAL Of encoding mf); SEQ ID NO: 52 (pLyALI 3r encoding os/}; SEQ ID NO: 53 (pLybAl·14.f encoding asf); SEQ ID NO: 54 (pLybALIdr encoding asf); SEQ ID NO: 65 (pLybAL71 encoding αφ; SEQ ID NO: 69 (pLybALSf encoding αφ; SEQ ID NO: 118 (pEybAL23 encoding ips&amp;nd 'tpp); SEQ ID NO: 121 (pLybAE28 encoding tps and tpp); SEQ ID NO; 122 (pLybAL29 encoding tps and tpp); SEQ ID NO: 123 (pLybAL30 encoding tps and tpp); SEQID NO: 124 (pLybAUl encoding tps and tpp); SEQ ID NO: 125 (p.I.ybAI.36 encoding tps mid tpp); SEQID NO; 126 CpEybAE37 encoding tps wad tpp}; SEQ ID NO: 1 30 (pLybAE24 encoding tps and tpp); and SEQ ID NO: 133 {pLyfeAL33 encoding-.'tps md tpp), [00313 In some embtKhments, the cel! accumulates at least about 0.1 micrograms of tkedisaceharide per minute per gram dry biomass. In some embodiments, tile eel! accumulates at least about 0.1 micrograms of the disaeeharide per minute per gram dry biomass up to about 10 tnicrograms of the disaeeharide per minute per gram dry biomass. 10 032 ] In some embodiments, the ceil does not comprise a nucleotide sequence selected from the group consisting of SEQ ID NO; 70, SEQ ID NO; 72, and SEQ ID NO: 74, or a nucleotide variant thereof having at least 95% identity thereto and invertase activity or sucraseferridoxin -activity. In some embodiments, the cell does not express a polypeptide sequence selected from the group consisting of SEQ ID NO; 71, SEQ ID NO; 73, and SEQ ID NO; 75, or a polypeptide variant thereof having at least 95% identity thereto and invertase activity or sucraseferridoxin activity. In some embodiments, the cell expresses a small interfering ENA specific a nucleotide sequence selected from the group consisting of SEQ ID NO; 70, SEQ ID NO: 72, and SEQ ID NO: 74, or a nucleotide variant thereof having at least 95% identity thereto and invertase activity' or sucraseferridoxifl activity. 10033] In some embodiments, the cell further comprises an isolated polynucleotide comprising SEQ ID NQ: 94 or a sequence 95% identical thereto encoding an active porin polypeptide; an isolated polynucleotide encoding a polypeptide Comprising SEQ ID NO : 95 or a sequence 95% identical thereto and having porin activity; or an isolated polynucleotide comprising SEQ ID NO; 91 (pLybAL32 encoding a porin); wherein, the accumulated disaceacfaaride is sucrose, the cell expresses porin, and tlm expressed porin secretes tire aeeumulated sucrose from the cell, 100341 Another aspect provides an artificial DNA construct In some embodiments, the artifi c i al DNA construct comprises at least one sequence selected from the group consisting of SEQ ID NO: 19 (pEybALl i encoding ns/); SEQ ID NO; 20 (pLybAL 12 encoding us/); SEQ ID NO: 44 (pLybALIS encoding np#}; SEQ ID NO: 45 .(pLybAL 16 encoding asf); SEQ ID NO: 46 (pLybAL 17 encoding αφ; SEQ ID NO: 47 (pLybAL 18 encoding as]}; SEQ ID NO: 48 (pLybAL 19 encoding asj}; SEQ ID NQ: 49 (pLybAL21 encoding as/}; SEQ ID NO: 50 (pLyb AL22 encoding mf); SEQ ID NO: 51 &amp;EyhAE13f encoding asfy, SEQ ID NO: 32 (pLyAEDr encoding asf); SEQ ID NO: 53 (pLybALMf encoding mf); SEQ IDNQ: 54 CpLybAE14r encoding as/); SEQ ID NO: 65 (pLyhAL7f encodingup); SEQ ID NO: 69 (pLybAOf encoding mf); SEQ ID NO: 118 (pLybAL23 encoding tps-and tpp); SEQ ID NO: 121 (pLybAL28 encoding tps and tpp); SEQ ID NO: 122 (pLybAL29 encoding ^ and ipp); SEQ ID NO; l23<pLybAL30 encoding tps and ipp); SEQ ID NO; 124 (pLybAOl encoding ps and tpp); SEQ ID NO; 125 (pLybAL36 encoding tps and tpp): SEQ ID NO; 126 (pLybAIJ? encoding ps and tpp); SEQ ID NO-139 (pLybAL24 encoding tps and tpp); SEQ ID NO; 133 (pLybAL33 encoding ipsmidtpp); SEQ ID NO: 91 (pLyhAE32 encoding a porin); SEQ ID NO; 102 (pLybAL3f encoding SS-4JPP); SEQ ID NO: 103 (pLybALSfencoding SE-UPP); SEQ ID NO; 106 (pEybAL4f encoding SE-UPP); SEQ ID NO: 107 (pLybALOf encoding SE-DFP); SEQ ID NO; 109 (pLybALbfb encoding SE-tlPP); SEQ ID NO; 110 (pLybAL IOfb encoding SE-OPP); and SEQ ID NO: 91 (pLybAE32 encoding a ροπή).

[0 0 3.51 Another aspect provides a method of cultivating a photosynthetie microorganism. Tbc method ot cultivating a photosynthetie microorganism can use any of pbotobiofcacior or device described above. The method comprises inoculating a cultivation support with phofcosyntheitemicroorganisms; cultivating &amp;e photosynthetie microorganisms on the inoculated culti vation support; and haryestmg- at least a portion of the cultivated photosynthetic nueroorgaaisms from the cultivation support. In some embodiments, the method further comprises sealing the physical harrier of the photohxorcaetor after the inoculation of the cultivation support such that ail or a substantial portion of the cultivation of the photosynthetie microorganisms occurs while the physical harrier is sealed, in some embodiments, the physical barrier is releasahly sealed. In some'embodiments, the method further comprises conveying each cultivation support to an inoculation station, a cultivation station, and a harvesting station. In some embodiments, the method further comprises at least one of: supplying fluid to the cultivation support; supplying nutrients to the cultivation support; or supplying gas to the cultivation support. In some embodiments, the photosynthetie microorganisms axe cultivated to a density of at least about 50 grams of dry biomass per liter equivalent. In some embodiments, tire photosynthetie microorganisms comprise a transgenic phoiosyutheiic microorganism engineered to accumulate a disaccharide, as described above.

[ 0 03 63 Ano ther aspect provides a method of producing a fermentable sugar. The method producing; a fermentable sugar can use any of plwtobioreactor of device described above. The method of, producing a fermentable· sugar comprises inoculating a cultivation support with phofosyniheti c microorganisms capable of accumulating a fermentable sugar; cul tivating the photosynthetic microorganisms on the inoculated cultivation support; isolating accumulated fermentable sugar. In some embodiments, the fermentable sugar accumulates within the photosynihetie microorganisms. In some embodiments, isolating the accumulated fermentable sugar comprises: harvesting at least a portion of the cultivated photosynihetie microorganisms from cultivation support; and recovering the fermentable sugars from the-harvest In some embodiments, the accumulated fctmentabie sugar is secreted from the photosynthetic microorganisms and isolated from a cul tivation media. In. some embodiments, isolating the accumulated fermentable sugar comprises isolating the accumulated fermentable sugar from a cultivation media, in some embodiments, the method further comprises relcasably sealing the physical barrier of the photobioroactor after the inoculation of the cul tivation support such that all or a substant ial portion of the cultivation of the photosymthetie microorganisms occurs while the physical barrier is sealed. In some embodiments, the method further comprises at least one of: supplying fluid to the cultivation support; supplying nutrients to tlic cultivation support; or supplying gas to the cultivation support In some embodiments, the method further comprises conveying the cultivation support to at least one of an inoculation station, a- cultivation station, and a harvesting station, [00373 In some embodiments, the method further comprises inducing synthesis of the fermentable sugar by the photosynthetic microorganisms. In some embodiments, inducing synthesis o f the fermentable sugar comprises exposing the photosyntlietic microorganism to an inducing agent selected &amp;om the group consisting of temperature, pH. a metabolite, light, an osmotic agent, a heavy metal, and an antibiotic. In some embodiments, inducing synthesis of the fermentable sugar comprises treating the photosynthetic microorganisms with a salt compound.

In some embodiments, the salt compound is sodium chloride. In some embodiments, the salt compound is added at a concentration of between about 0.01 mjyl and 1.5 M or between about 0.2 and 0.9 M. In some embodiments, the inducing agent is applied to the growth surface by aerosol spray. In some embodiments,.the photosynihetie microorganisms are cultivated to a density of at least about 50 grams of dry biomass per liter equivalent In some embodiments, the fermentable sugar comprises at least one sugar selected from the group consisting of glucose, fructose, sucrose, trehalose, glueosylglyerol, and maonosylfrucfose. la some embodiments, the. iermentable sugar comprises at least one sugar selected from the group consisting of sucrose and trehalose, [0038] In some embodiments, the photosynf hcric microorganisms comprise naturally occurring photosyntfretie microorganisms. In some embodiments, the photosynthetic microorganisms comprise genetically modified phoiosytithelic microorganisms. In some embodiments, the photosynthetic microorganisms comprise cyanobacteria. In some embodiments, the photosynthetic microorganisms comprise cyanobacteria selected from the group consisting of Synschocoecus or Synechocysiis. In some embodiments, the photosynthetic microorganisms comprise a transgenic photosynthetic microorganism engineered to accumulate a .disaccharide, as described above, £ 0038] Other objects and features will be in part apparent and in part pointed out hereinafter.

BRIEF DESCRIPTION OF THE DRAWINGS

[ 0 0401 Those of skill in the art will understand that the drawings, described below, are for illustrative proposes only. The. drawings are not intended to limit the scope of the present teachings in any way, [004X3 FIG. i illustrates a front view of the photobioreactor of die invention including a solid cultivation support, an outer protecti ve transparent barrier layer, a selective panel, reseaiable closures, and support elements for suspending die device.

[0042] FIG. 2. illustrates aside view of the photobloreactor of the invention including a »>*$ cultivation support, an outer protective transparent harrier layer, a selective panel, reseakble closures, and support elements for suspending the device. £00433 FIG. 3 illustrates an arrangement of multiple photobioreaotors or cultivation supports of the Invention along multiple closed loop conveyor systems radiating out from common inoculation and harvesting centers to comprise a photobioreaetor farm.

[0044] FIG. 4 is a cartoon depicting phoiosyniherie production of sucrose in cyanobacteria.

[0045] FIG. 5 is a. polypeptide sequence alignment of the Sytiechocgstis^spp. PCC 6803 <Sxp6803) sucrose phosphate synthase (BPS) and sucrose phosphate phosphatase (SPP) proteins with the Synecktcoecus elongates PCC7942. (Sele?942) active SPS/SPP fusion (ASF). Ssp6803 contains separate genes encoding SPS and SPF activities. The EPS protein from Symchocystis spp, PCX' 6803 beats a presumably inactive SPP domain, as many of the active site residues are not conserved. The canonical GAD hydrolase active site residues are shown above the al ignment with conserved amino adds shown underhned and non-eo&amp;served residues double underlined. An eight amino acid insertion within the inactive SPP domain of Syneeho0stis spp. PCC 6803 SPS is italicized. Further details regarding methodology are provided in Example 4.

[0046] FIG. 6 is schematic depletion of pLybAId 1. pLybAI i l allows coidtruction of libraries of eyanobactenal DMA and selection for promo ter sequences. The promoterless mf gene is behind bidirectional terminators, separated by a multiple cloning site (MGS). ori¥ allows for plasmid replication in most Gram-negative organisms. ohT allows for doiljugal transfer of the plasmid from E.'coli to a chosen cyanobacterium (of other organism) with the assistance of the pRK2Q 13 helper plasmid. The· lactamase gene (hla) is present for selection in E. coH, 'DMA libraries can be constructed in E. mli by cloning cyanobacteria! genomic DMA into the MGS, The plasmid library can then be transferred to cyanobacteria by conjugation or direct transformation. Active promoters can then he isolated by selection for resistance to chloramphenicol through expression of the chloramphenicol acetyltransferase gene (cat). The strength of the promo ters can be assessed by both assay for chloramphenicol acetyltransferase activity and direct examination of sucrose production. Further details regarding methodology are provided in Example 5.

[ 0047] FIG, 7 is schematic depiction of pLybALll, pLyhALl S allows analysis of the capacity of preselected promoters to drive asf expression. The only difference between pLybALl-2 and -pLyhAL.l I is the presence of an active promoter in front of the chloramphenicol acetyitransferase gene (eat). Specific DMA sequences isolated from cyanobacterial chromosomal DMA amplified by PGR caa.be cloned into the MGS, Both chloramphenicol and ampieillin can be used for selection in E.coiL The plasmid library can then be ttamfenred .to cyanobacteria by conjugation or direct transformation. Fksmid bearing cyanobacteria can then be isolated by selection for resistance to chioramphemcoΪ through expression of the chloramphenicol acetyltransferase gene (cat). The strength of the promoters can be assessed by both assay for chloramphenicol acetyltransferase activity' and direct examination of sucrose production. Further details regarding methodology are provided in Example 5, .(0048] FIG, 8 is a cartoon depicting constmetlonof a cyanobacteria! promoter library. Further details regarding methodology are provided in Example 8. (0049] FIG. 9 is a schematic diagram depicting pSMART-LCKan, Further details regarding methodology are provided in Example 8, (00501 FIG, 10 is a sequence feting showing a possible promoter-within Synechococcm elangatm PCC 7942 mf. Shown is the amplified PGR product containing the mj gene from Synechococcus elongatm PCC 7942 that was- cloned upstream of the chloramphenicol resistance marker. The regions of asf encoding the sucrose phosphate synthase and sucrose-phosphate phosphatase polypeptide activities are single underlined and double underlined, respectively. All DMA sequence elements are italicized and labeled above. Start and Stop represent the start and stop codons, respectively. SD represents the Shiae-Delgarao sequence. The -35 and -10 regions of the putative promoter are highlighted in gray. Further details regarding methodology are provided in Example 8., (00511 FIG. .1.1 is a schematic diagram depicting a two-step protocol for markerless deletion of genes in die cyanobacteria! genome. This strategy assumes that the cyanobacteria! strain being used has had its upp gene deleted. The upp gene will have been deleted during the sucrose biosynthetic insertions. The gene of interest that has been targeted for deletion must be identified. The starting strain is resistant to 5-fluorouracii, but sensitive to kanamycin. The gene is either completely or partially deleted by the insertion of a cassette containing a kanamycin resistance marker and an active upp, making the strain resistant to kanamycin, but sensitive to 5-fiuorouraeil. The upp and kanamycin resistance markers can then be removed, making the strain once again resistant to S-fiuorouracii, but sensitive to kanamycin, Further details regarding .methodology are provided in Example 12. E 0 S 52 3 FIG. 12.is a schematic diagram of a photobioreactor embodiment. FIG. 12A provides a front view while FIG. 12B provides a side view. The phoiobioreaeiGr includes suspension element (6); culture media supply (8); gas supply (10); growth surface (2¾ outer barrier layer (7); quick connector; and product harvest line (9). E δ 053 3 FIG. 13 is a schematic diagram of a growth surface in a single material format (FIG. 13A) and a hybrid material format (FIG. I3B).

DETAILED DESCRIPTION OF THE INVENTION i S 054 3 The present application relates to fermentable sugar' accumulating photosyothetic microorganisms, solid-phase photoreactor devices, and methods of using each. £0055J in the fermentable sugar accumulating photosynthetic microorganisms, it may be preferable to produce a dissaccharide sugar not generally utilized by die photosynihctic microorganisms, which therefore can accumulate within the cultivated biomass (e.g., sucrose, trehalose). In some embodiments, photosynthetic microorganisms are genetically engineered to synthesize a dissaccharide sugar normally produced according to osmotic stress pathways (e.g., sucrose or trehalose) such that the sugar is produced in the absence of, or at reduced levels of, osmotic stress. Because oi the greater efficiency and lower environmental impact of growing photosynthetie microorganisms compared to higher plants, the method represents important improvements in sustainability over current biofuel production practices. Advantageously, the foregoing method of synthesizing a dissaccharide sugar has been adapted to occur within fee photobforeactor(s) of the present invention, 100563 The photobioreactor described herein utilizes a solid cultivation support. Advantageously, the difficulty of providing adequate light exposures is alleviated, at least in part. Utilizing the aforementioned solid cultivation support in a photobioreactor can allow for cultivation and -growth of photosynthetie microorganisms at cell densities greater than those of commercial-scale liquid phase bioreactors (e.g., celt densities in excess of200 grams of dry biomass per liter equivalent). In addition, various embodiments of the photobioreactor described herein can be operated using less energy and more simply than conventional commercial-scale liquid phase photobioreaetors. (CO'573 Embodiments of the photobioreactor described herei s provide additional benefits over conventional liquid phase photobioreactors. For example, liquid systems typically require special equipment to deliver adequate coneentrations/amount of carbon dioxide to. the photosynthetie microorganisms to support their growth and photosynthesis, in contrast, by growing the microorganisms on a solid cultivation support, carbon dioxide can be provided in a relatively simple, less costly manner, such as exposure to surrounding air. If additional carbon dioxide is desired, it can easily be delivered by, for example, adding it to the atmosphere (eg,, air) surrounding or in contact with the cultivation support. Another benefit i&amp; ease of transport. Liquid phase photobioreactors can be a pond (completely immobile) or bulky tanks or colteetions of tubing. In contrast, in various embodiments, the photobioreactor is fiat and flexible, which allows for it or a multiplicity of them to be stacked, rolled up, folded, and/or configured in a similar manner for relatively easy transport, in various embodiments, the photobioreactor can be configured in a manner such that it is suspended from a system that allows for easy conveyance of one or more photobioreactors from one location to another. This portability may bo utilised on a commercial scale to allow for efficient methods of handling and processing large numbers of photobioreaciors in a continuous-type manner. £00581 One aspect of the application is directed to a method of fermentable sugar feedstock production: by photosynthetie microorganisms. Preferably,'the fermentable sugar is a fermentable disaccharide sugar, Examples of fermentable· disaccharide sugars include, but are not limited to sucrose and trehalose. The fermentable sugar can be a disaccharide not generally utilized by photosynthetie microorganisms. For example, trehalose is not generally utilized by cyanobacteria and therefore can accumulate within the cultivated biomass without substantial degradation by endogenous metabolic pathways. The fermentable sugar can be a disaccharide that is generally utilized by photosynthetie microorganisms. For a disaccharide not used as a primary energy source, tile disaccharide can often be accumulated to sufficient levels even in the presence of endogenous metabolic pathways. Where endogenous degradation pathways-specific for the target fermentable sugar, the photosynthetie microorganism, can be engineered to reduce or eliminate such activity. For example, a cyanobacterium engineered to accumulate sucrose can be further engineered to reduce or eliminate sucrose invertase activity, in various embodiments, strains of photosynthetie- microorganisms that synthesize fermentable disaccharide sugar In response to osmotic or m&amp;tric water stress can be used. In other embodiments transgenic strains of photosynthetie microorganisms engineered to accumulate fermentable disaceharide sugar in the absence of, or reduced levels of, osmotic stress. Advantageously, the foregoing methods of synthesizing fermentable disaccharide sugar can be adapted to occur within photohioroactors described herein.

[00593 Because of the greater efficiency and lower environmental impact of growing photosynthetie. microorganisms compared to higher plants, compositions, devices, and methods described herein represent important improvements in sustainability over current biofuel production practices.

[0O6 0 3 Photosynthetie Microorganism [0063.1 Provided herein is a photosynthetie microorganism genetically engineered to accumulate a dissaecharide sugar. The photosynthetie microorganism can he, for example, a naturally photosynthetie microorganism, such as a cyanobacterium. Or an engineered photosyntlretic microorganism, such as an artificially photosynthetie bacterium. Examples of the accumulated dissaecharide sugar include, but are not limited to sucrose, trehalose, gluocosylgiycerol, and mannosylfructose. In various embodiments, one or more genes encoding fee protein(s) .responsible for producing the desired dissaecharide from corresponding phosphorylated monomers is engineered in a host photosynthetie microorganism (e.g„ cyanohaetermm) so ns to result in the accumulation of the desired dissaecharide. in some embodiments, an endogenous .pathway of the.host photosynthetie. microorganism.· is engineered so as to accumulate a dissaecharide sugar. For example, the osmotic sucrose pathway In cyanobacteria can be engineered to accumulate sucrose in the absence of osmotic stress, in some embodiments, an exogenous dissaecharide pathway is engineered in cyanobacteria so as to accumulate a dissaecharide sugar. F or example, the osmotic trehalose pathway from E, coli can be engineered to accumulate trehalose in cyanobacteria.

[00621 Synthase and Phosphotase [O0631 A. photosynthetie microorganism can be transformed so as to have a synthase activity and a phosphotase activity for tire desired dissaecharide. For example, a cyanobacterium can be engineered to have sucrose phosphate synthase activity and sucrose phosphate phosphatase activity. As another example, a cyanobacterium can be engineered to have trehalose phosphate synthase activity and trehalose phosphate phosphatase activity. As another example, a cyanobacterium can be engineered to have gluocosyi glycerol phosphate synthase activity and giuocosylglycerol phosphate phosphatase activity. As another example, a cyanobacterium can be engineered to have mannosylfructose phosphate synthase activity and mannosylfructose phosphate phosphatase activity. It is contemplated these activities can likewise be engineered in other photo-synthetic microorganisms . 100641 Synthase activity and phosphotase activity can he engineered into a photosymthetie microorganism by way of the individual genes, one encoding a polypeptide having syn thase activity and die other encoding a polypeptide having phosphatase activity; or by one gene encoding both synthase activity and phosphatase activity. For example, synthase activity and phosphatase activity can be present in a fusion polypeptide, [0065] The monomeric sugars; of the desired dissaccharide can be endogenous or exogenous to tlie photosynthetic microorganism. Where monomeric sugars of the desired dissaccharide are endogenous, the photosynthetfc microorganism can he engineered to produce increased levels of such monomers , Where monomeric sugars of the desired dissaccharide are exogenous, the photosynthetic microorganism can be engineered to produce such exogenous monomers.

[005 6 3 The photosynthetic microorganism can be engineered to synthesize and accumulate the desired d issaccharide continuously , after some developmental state, or upon being induced to do so. Induction of dissaccharide synthesis can be according to the actions of an inducible promoter associated with the encoded synthase or phosphotase and an inducing agent, as discussed in further detail herein, [0067} In some embodiments, transformed cyanobacteria, as described herein, can accumulate at least about 0.1 micrograms of a dissaccharide (e,g., sucrose, trehalose, glucesylgiycerol, or mannosylfructose) per minute per gram dry biomass. In some embodiments, transformed cyanobacteria can accumulate at least about 0.1 up to about 10 micrograms of a dissaccharide (e.g., sucrose, trehalose, glucosylglycerol, or mannosylfructose) per minute per gram dry biomass. For example, .transformed cyanobacteria can accunmiaie at least about 0.2, at least about 0 J, at least about 0,4, at least about 0.5, at least about 0,6, atleast about 0.7, at least about 0.8, or at least about 0.9 nucrograms of a dissaecharide (e.g.* sucrose, trehalose, glucosylglyeerol, or mannosylfruetose) per minute per gram dry biomass. Ια other embodiments, various transformed photosynthetic microorganisms accumulate similar amounts of a dissaccharide. to 0683 It is contemplated that that various embodiments will accumulate a disaecharide (e.g., sucrose, trehalose, glucosylglyeerol, or mannosylfructose) at defined ranges of the values above. For example, some transformed cyanobacteria can accumulate at least about 0.1 up to about 0.9 micrograms of a disaecharide (e,g„ sucrose, trehalose, gtucosylglycerol, or mannosylfruetose) per minute per grant dry biomass; at least about 0.1 up to about 0. 8 mierograms of a disaecharide (e.g., sucrose, trehalose, glucosylglyeerol, or mannosylfruetose) per minute per gram dry biomass; at least about 0.1 up to about 0,7 micrograms of a disaecharide (e.g, , sucrose, trehalose, glueosyiglyesFoi, or marmosylfructose) per minute per gram dry biomass; etc. Similarly, some transformed cyanobacteria can accumulate at least about 0.2 up to about 1.0 mierograms of a disaecharide (e.g,, sucrose, trehalose, glucosylglyeerol, or marmosylfructose) per minute per gram dry biomass; at least about 0,3 up to about 1.0 micrograms of a disaecharide (e.g., sucrose, trehalose, glucnsytglyeerol, or mannosylfruetose) per minute per gram dry biom ass ; at least about 0.4 up to about 1,0 microgram.S of a dmaccharide (e.g., sucrose, trehalose, glucosylglyeerol, or mannosylfruetose) per minute per gram dry biomass; at least about 0.5 up to about 1.0 mierograms of a disaecharide (e.g,, sucrose, trehalose, glucosylglyeerol, or mannosylfruetose) per minute per gram dry biomass; at least about 0.6 up to about 1,0 micrograms of a disaecharide (e.g,, sucrose, trehalose, glucosylglyeerol, or mamiosylfructose) per minute per gram dry biomass; at least about 0.7 up to about J 0 mierograms of a disaecharide (e,g„ sucrose, trehalose, glucosylglyeerol, or marmosylfructose) per minute per gram dry biomass; at least about 0,8 up to about 1.0 mierograms of a disaecharide (e.g,, sucrose, trehalose, glucosylglyeerol, or mannosylfruetose) per minute per gram dry biomass; or at least about 0.9 up to about 1.0 mierograms of a disaecharide (e.g., sucrose, trehalose, giucasylglyeerol, or mannosylfmctose) per minute per gram dry biomass. Methods for assaying sugar accumulation is host cells are weil-imown to those of skill in the art (see e.g., Example 10), [00693 Host C0 07 01 The host genetically engineered to accumulate a dissaocharide sugar can be any photosynthetic microorganism. The photosynthetic microorganism can be, for example, a naturally photosynthetic microorganism, such as a cyanobacterium, or an engineered photosynthetic microorganism, such as an artificially photosynthetic bacterium. Exemplary' microorgansims that are either naturally photosynthetic or can be engineered to be photosynthetic include, but are not limited to, bacteria- fungi; arehaea; protista; microscopic plants, such as a green algae; and animals such-as plankton, planarian, and amoeba. Examples of naturally occurring photosynthetic microorganisms .include, but are not limited to, Spirulina maximum, Spirulina platensis, -Dunaliella salina, Botrycoeeus bmunii, Chlorella vulgaris»· Chlorella pyrenOtdosa, Serenastrum eapricomutum, Scenedesrnus auadrieauda, Porphyridium craentum, Scenedesmus acutus, Dunaliella sp., Scenedesmus obltquus, Anabaenopsis, Aulosira, Cyiindrospermum, Syuechoccus sp,, Synechocystis sp., and/or Tolypothrix, [00713 Preferably, the host photosynthetic microorganism is a cyanobacterium. Cyanobacteria, also know as blue-green algae, are a broad range of oxygengenic photoautotophs. The host cyanobacterium, can be any photosynthetic microorganism from the phylum Cyaoephyta, The host ‘cyanobacterium can have a unicellular or colonial (e.g., filaments, sheets, or balls) morphology. Preferably, the host cyanobacterium is a unicellular cyanobacierium. Examples of cyanobacteria that can be engineered to accumulate a disaccharide sugar iocS ude, hut are not limited to, the genus Synechocystis, Synechococeus, Thermosymechococcus, Nostoe, Prochlorocoecu, Microcystis, Anabaena, Spirulina, and Qioeobaeter, Preferably the host cyanobacterium is a Synechocystis spp. or Synechococeus spp. More preferably, the host cyanobacterium is Synechococeus. eimgatm PCC 7942 (ATCC 33912) and/or Synechocystis spp. PCC 6893 (ATCC 27184).

[00723 Sucrose [00733 Biosynthesis of sucrose in a photosynthetic microorganism, such as cyanobacteria, can be accomplished through tire catalytic action of two enzyme activities, sucrose-phosphate synthase (sp.<) and sucrose phosphate phosphatase (spp), fimetioning in sequence (see e.g, FIG, 4). Such activities are present in some cyanobacteria for acclimation to osmotic and matric water stress (see- e.g, Luna, J. £. 2002, Plant Physiol 128, 1490-1500).

Either or both, of these activities can be engineered in a cyanobacterium so as to result in accumulation of sucrose, [00743 A gene of particular interest for engineering a photosyniheiic microorganism to accumulate sucrose is the dctimspsispp fusion (ύχή gene from Symchoeocem eiongatm PCC 7942, Asfhas both sps and spp biosynthetic functions (see e.g., Example 4), In some embodiments, an ASP-encoding nucleotide sequence is cloned from its native source (e.g,, Synechococew-etongaius PCC 7942} and inserted into a host cymrobacterium (see e.g., Examples 4-9). In some embodiments, a transformed host photosyiUhetie microorganism comprises an as/polynucleotide of SEQ ID NO; L In some embodiments, a photosymfhetic microorganism is tramdormed wi th a nucleo tide sequence encoding A SF polypeptide of S EQ ID NO; 2, In further embodiments, a transformed host phoiosynthetie microorgamsm comprises a nucleotide sequence having at least about 80% sequence identity to SEQ ID NO: 1 or a nucleotide sequence encoding a polypeptide having sps and spp activity' and at least about 80% sequence identity to SEQ ID NO; 2. As an example, a transformed host photosyniheiic microorganism, such as a cyanobacterium, can comprise a nucleotide sequence having at least about 8S%, at least about 90%, at least about 95?4, or at least about 99% sequence identity to SEQ ID NQ: 1, wherein the tansiormed host exhibits ASF, SPS, and/or SPP activity and/or accumulation of sucrose . As an. example, a transformed host, photosymthetic microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO; 2, wherein the transformed host exhibits ASF, SPS, and/or SPP activity and/or accumulation of sucrose. As another example,·a transformed host photosynthetic microorganism can comprise a nucleotide sequence that hybridizes under stringent conditions to SEQ ID NO: 1 over the entire length of SEQ ID NO: 1., and which encodes an active SPS/SFP fusion (ASF) polypeptide. As a further example, a transformed host photosynthetic microorganism can comprise the complement to any of the above sequences, [00753 In some embodiments, a sucrose phosphate synthase (sps) (see e.g,, SEQ ID NO: 3 encoding sps gene and SEQ ID NO: 4 encoding SPS polypeptide), or homologue thereof, is engineered to be expressed or overexpressed in a transformed .photosynthetio microorganism,·

For example, a photosynthetic microorganism can be transformed with a nucleotide having a sequence of SEQ ID NO: 3 so as to express sucrose phosphate.synthase. As another example, a photosynthetic aieroorganism can be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO: 3 encoding a polypeptide having sucrose phosphate synthase. As another example, a transformed host photosynthetic microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO: 4, wherein the transformed host exhibits.SPS activity and/or accumul aiion of sucrose. £0 9761 In some embodiments, sucrose phosphate phosphatase (spp) (see e.g,, SEQ ID NO: ..5-encoding spp gene and SEQ ID NO: 6 encoding SPP polypeptide), or homologue thereof; is engineered to be expressed or overexpressed in a transformed photosynthetie micsxtorganism. Pot example, a photosynthetic· microorganism, such as a cyanobacterium, catt be transformed with a nucleotide having a sequence of SEQ ID NO; 5 so as to express sucrose phosphate phosphatase. As another example, a photosynthetic· microorganism can be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 993ί> percent identity to SEQ ID NO: 5 encoding a polypeptide having suemse phosphate phosphatase activity. As another example, a transformed host photosynthetic microorgattism can comprise a nucleotide sequence encoding a polypeptide bavutg at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO: 6, wherein the transformed host exhibits SPP acti vity and/or accumulation of sucrose.

[00771 In some embodiments, a photosynthetic microorganism is engineered to express one or more of ASF, SPS, and/or SPP. For example, a photosynthetic microorganism, such as a cyanobacterium, can be engineered to express ASF and SPS; ASF and SPP; SPS and SPP; or ASF, SPS, and SPP.

[00781 Trehalose E 0 07 9 3 Biosyn thesis of trehalose can be accomplished through the catalytic action of two enzyme activities, trehalose phosphate synthase (tps) and trehalose phosphate phosphatase (tpp), functioning in sequence. Either or both of these activities can be engineered in a photosymthetic microorganism so as to result in accumulation of trehalose. Biosynthesis of trehalose does not naturally occur in some photosynthetic tnicsoo^anisms, such as cyanobacteria. I 0 0 8 0 ] In some embodiments, a trehalose phosphate synthase (tps) (see e.g., SEQ IP NO; 76 encoding tps gene and SEQ ID NO: 77 encoding TPS polypeptide), or horoologue thereof, is engineered to he expressed or overexpressed in a transformed photosynthetic microorganism. For example, a photosynthetic microorganism, such as cyanobacterium, can he transformed with a nucleotide having a sequence of SEQ ID HO: 76 so as to express trehalose phosphate synthase. As another example, a photosynthetic microorganism can be transformed : with, a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about ; 95%, or at least about 99% percent identity to SEQ ID HQ; 76 encoding a polypeptide basing trehalose phosphate synthase. As another example, a transformed host photosynthetic microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO; 77, wherein the Pansformed host exhibits TPS acti vity and/or accumulation of trehalose.

[00811 In some embodiments, trehalose phosphate phosphatase (φρ) (see e.g., SEQ ID NO: 78 encoding φρ gene and. SEQ ID NO: 79 encoding TPP polypeptide), or homologue thereof, is engineered to be expressed or overexpressed in a transformed photosynthetic microorganism. For example, a photosynthetic microorganism, such as a cyanobacterium, can. be tmmformed with a nucleotide having a sequence of SEQ ID NO; 78 so as to express trehalose phosphate phosphatase. As another example, a photosynthetic microorganism can. be transformed with a nucleotide having at least about 80%, at Least about 85%, at least about 90%, at least about 95%, or at least about 99% percent identity to SEQ I'D NO: 78 encoding a polypeptide having trehalose phosphate phosphatase activity . As another example, a transformed host photosynthetic microorganism can comprise &amp; nucleotide sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO: 79, wherein the transformed host exhibits TPP activity and/or accuoHiiatioo of trehalose. £00823 Giucosylglycerol £0083] ίο some embodimcn ts, a glucosylgiyccrolphosphate synthase (gp,v) (see e.g., SEQ ID NO: 80 encoding gps- geo® and SEQ ID NO: 81 encoding GPS'polypeptide), or faomologue thereof, is engineered to be expressed or overexpressed in a transformed phoiosyntheiie microorganism. For example, a photosynthetic microorganism, sneli as a cyanobacterinm, can. be transformed with a nucleotide .having a sequence of SEQ ID NO: 80 so as to express gincosylgiycerolphospliaie -synthase. As another example, a photosynthetic microorganism can be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO: 80 encoding a polypeptide having glucosylglycerolptospbate synthase. As another example, a transformed host phoiosynthetie microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at feast about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO; 81, wherein the transformed host exhibits GPS activity and/or accumulation of glucosylgycerol, £00843 In some embodiments, glucosylglycerolpbosphate phosphatase (gp/>) (see e.g., SEQ ID NO; 82 encoding gpp gene and SEQ ID NO; S3 encoding GPP polypeptide), or homologuc thereof* is engineered to be expressed or overexprossed in a transformed photosynthetic microorganism. For example, a phoiosynthetie microorganism, such as a cyanobacterium, can be transformed with a nucleotide having a sequence of SEQ ID NO : 82 so as to express ghieosylglyeerolphosphate phosphatase. As another example, a photosynthetic miemorganism can be transformed with a nucleotide having at least about 80%, at least about 8554, at least about 90%, at least about 95%, or at f east about 99% percent Id entity to SEQ ID NO: 82 encoding a polypeptide basing glucosylglycerolphospbate phosphatase activity. As another example, a. transformed host photosynthetic microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 855 0, at least about 90%, at least about 95%, or at least about 99% sequence identify to SEQ ID NO: 85, wherein the transformed host exhibits GPP activity and/or accumulation of glueosylgyeerol. £00853 Mannosylfruetose £00861 In some embodiments, a mannosylfruetose phosphate synthase {mps) (see e g., SEQ ID NO: 84 encoding mps gene and SEQ ID NO; 85 encoding MPS polypeptide), or homologue thereof, is engineered to be expressed or overexpressed In a transformed photosynihetic microorganism. For example, a photosynthetic microorganism, such as a cyanobacterium, can be transformed with a nucleotide having,» sequence of SEQ ID NO; 84 so as to express mannosylfrnetose phosphate synthase. As another example, a phoiosynihetic microorganmm can be transformed with a nucleotide having at least about 80%, at least about 85%, at. least about 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO; 84 encoding a polypeptide having mannosylfruetose phosphate synthase. As. another example, a transformed host photosynthetic microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO; 85, wherein the transformed host exhibits MPS activity anchor accumulation of mannosylfruetose. 10087] la some embodiments, mannosyi Iruetese phosphate phosphatase (mpp) (sec e.g.» SEQ ID NO; 86 encoding -mpp gene and SEQ ID NO* 87 encoding MPP polypeptide), or homotogue thereof, is engineered to be expressed or overexpressed In a transformed photosynthetic microorganism. For example, a phqtosymihetic microorganism, such as a cyanobacterium, can be iransformed with a nucleotide having a sequence of SEQ ID NO: 86 so as to express nmnoosyliAtctosc phosphate phosphatase. As another example, a photosynthetic microorganism can be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO: 86 encoding a polypeptide having mannosylfruetose phosphate phosphatase activity. As another example, a transformed host photosynthetic microorganism can comprise a nucleotide·· sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity' to SEQ ID NO: 87, wherein the transformed host exhibits MPP activity and/or accumulation of mannosylfruetose.

[00881 Molecular Engineering £.0 0893 Design, generation, and testing of the varian t nucleotides,. and their encoded polypeptides, having the above required percent identities to an mf sequence and mtaining a required activity of the expressed protein and/or sugar accumulation phenotype is within the skill of the art . For example, directed evolution and rapid isolation of mutants can be according to methods described in references including, but not limited to, Link et al (2007) Nature Review's 5(9), 680-688; Sanger et al. (1991) Gene 97(1), 119-123; Ghadessy et at, (2001) Proc Natl Acad

Set USA 98(8) 4552-4557. Thus, one skilled in the art could generate a large number of nucleotide (e.g-„ mfc sps, spp, $as, tppt gps, gpp, mps, or mpp) and/or polypespiide (e,g., ASF, SPS, SPP, TPS, TPP, GPS, GPP, MPS, or MPP) variants having, for example, at least 95-99% identity to the reference sequence described herein and screen such for phenotypes including dlsaccharide accumulation according to methods routine in the art. Generally, conservative substitutions can be made at any position so long as the required activity is retained.

[0090 J Nucleotide and/or amino acid sequence identity percent (%) is understood as the percentage of nucleotide or amino acid residues that are identical wi th nucleotide or amino acid residues in a candidate sequence in comparison to a reference sequence when the: two sequences are aligned. To determine percent identity, sequences are aligned and if necessary, gaps are Introduced to achieve the maximum percent sequence identity. Sequence alignment procedures to determine percent identity are well kno wn to those of skill in the art. O ften pubiicly available computer software such as BLAST, BLAST2, ALIGNS or Megatign (DNASTAR) software is used to align sequences. Those skilled in the art can determine appropriate parameters for measuring alignment, Including any algorithms needed to achieve maximal alignment o ver the full-length of the sequences being compared . When sequences are aligned, die percent sequence identity of a given sequence A to, with, or against a given sequence 8 (which can alternatively be phrased as a given sequence A dial has or comprises a certain percent sequence identity to, with, or against a given sequence B) can be calculated as: percent sequence identity =- XfY 100,-where X is the number of residues scored as identical matches by die sequence alignment program's or algorithm’s alignment of A and B and Y is the total number of residues in B, if the length of sequence A is not equal to the length of sequence B, the percent sequence identity of A to B will not equal the percent sequence identity of B to A, [0091] “Highly stringent hybridization conditions” are defined as hybridization at 65 aC in a 6 X SSC butler (/.<?., 0.9 M sodium chloride and 0.09 Msodium .citrate). Given these conditions, a determination can be made as to whether a given set of sequences will hybridize by calculating the melting temperature (Tm) of a DNA duplex between the two sequences. If a particular duplex has a melting temperature low er than 65*C in the salt conditions of a 6 X SSC, then the two sequences will not hybridize. On the other hand, if the melting temperature is above 65 °C in the same salt conditions, then the sequences will hybridize. In general, the melting· temperature for any hybridized DN A:DN A sequence can be determined using the following formula: Tm «81.5 °C + 16,6<Iogit>|lSTa^l) 4- 0.41 (fraction G/C content) - 0.63(% formamide) - (600/1), furthermore, the Tw of a DMA'DNA hybrid is decreased by 1-1,5°C for every 1% decrease in nucleotide identity (see e.g., Sambrook and Russel, 2006), £00923 Host cells· can be transformed using a variety of standard techniques, .known to the art (see, e.g., Sambrook and Russel (2006) Condensed Protocols .from Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, ISBN-10:08796977.17; Ausubel et al. (2002) Short Protocols in Molecular Biology, 5th ed„ Current Protocols, ISBH-10:0471250929; Sambrook and Russel (2001) Molecular Cloning: A laboratory Manual, 3d ed, Cold Spring Harbor Laboratory Press, ISBN-10; 0879695773; Eihai, 1 and Wblk, C, P, 1988. Methods m Enzymology 107,747-754). Such techniques include, but are not limited to, viralinfection, calcium phosphate transfection, ligofome-mediated transfection, mietoptqjeetlle-mediated delivery, receptor-mediated uptake, ceil fusion, oiectroporation, and the like. The transfected cells can. be selected and propagated to provide recombinant host cells that comprise the expression vector stably integrated in the host cell genome. £00933 Promoter £0 0943 One or more of the nucleotide sequences discussed abo ve (e,g„ -m£ sp>% spp, tps, ipp,mps, mpp, gp$>,gpp) can: be operabiy linked to a promoter that can function in the host photosyrithetic microorganism. Where the host is cyanobacteria, preferably, the promoter can function efficiently in both cyanobacteria and a bacteria, such as E, coli. Promoter selection can allow expression of a desired gene product under a variety of conditions. £00953 Promoters can be selected for optimal function in. a photosynthetic microorganism host cell, such as a cyanobacterium, into which the vector construct will be inserted. Promoters can also be selected on the basis of their regulatory features. Examples of such features include enhancement of transcriptional activity and inducibiiity. £0096] 1 he promoter can be an inducible promoter. For example, the promoter can he induced according to temperature, pH, a hormone, a metabolite (e.g., lactose, mannitol, an amino add), light (e.g., wavelength specific), osmotic potential (e.g., salt induced), a:heavy metal, or an antibiotic. Numerous standard inducible promoters will be known to one of skill ίο the art, £'00973 Idsome embodiments, the promoter is a temperature inducible promoter. For example, the Lambda promoter is a temperature mducible promoter that can fonetion In cyanobacteria. Surprisingly, the Lambda promoter functions at a temperature different than when utilized In E. coll. In E, coli, the lambda promoter is most active at 42°€, a temperature above the normal viability range for cyanobacteria. Generally, in E. coll, the Lambda promoter has about a 5% to 10% increased expression from about 30°C to 3SX and at about 3?°€ has about a 20% increased, expression; but from about 3?eC to 42°C provides about 100% increased expression. In cyanobacteria, the Lambda promoter is most active at around 30*0 to 35X, an ideal growth temperature range.for cyanobacteria and a range much lower than optimal expression of the Lambda promoter in. E, coli. So, the Lambda promoter provides for effective expression of disaccharide biotsynthetic acti vity in cyanabcieria, [00981 Examples of promoters that can be inserted into the plasmid include, but are not limited to, carB, mrA, psbAIl dmK, kaiA, and Xm (see eg, Example 6). In some embodiments, the promoter can function efficiently In both cyanobacteria and &amp; coil In some embodiments, the asf coding region comprises a promoter with said coding region (see e.g.. Example 8). For example, the «.v/coding region can comprise a promoter in front of the SPP domain of asf (see eg., FIG, 10), Such an internal promoter can occur with or without a promoter at the start of the asf coding region, [08993 The term "chimeric" is understood to refer to the product of the fusion of portions of two or more different polynucleotide molecules. "Chimeric promoter" is understood to refer to a promoter produced through the manipulation of known p romoters or other polynucleotide molecules. Such chimeric promoters can combine enhancer domains that can confer or modulate gene expression from, one or more promoters or regulatory dements, tor example, by fusing a heterologous enhancer domain from a first promoter to a second promoter with its own partial or complete mgnktory elements. Thus, the design, construction, and use of chimeric promoters according to the methods disclosed herein for modulating the expression of operably linked polynucleotide sequences are encompassed by the present invention.

[0100] Move! .chimeric promoters can fee designed or engineered fey a number of methods. For example, a chimeric promoter may be produced by fusing an enhancer domain from a first promoter to a second promoter. The resultant chimeric promoter may have novel expression properties relative to the first or second promoters. Novel chimeric promoters can he constructed such that the-enhancer domain from a first promoter is &amp;sed at the S' end, at tire 3’ end, or at any position internal to the second promoter.

[0101] Constructs [01023 Any of the transcfibable polynucleotide molecule sequences described above can be provided in a construct. Constructs of the present mvenrion gcneraliy include a promoter functional ta the host photosynihefie microorganism, such as cyanobacteria, operably linked to a transcribable polynucleotide molecule for disaechari de biosynthesis ;(e,g., asft -sps, spp> tys, tpp, mpsi:mpjp,.gps, gpp\ such as provided in SEQ ID NO: 1,3, 5,76, 78» 80,82, 84, and 86, and variants thereof as discussed above.

[01031 Exemplary promoters are discussed above. One or more additional promoters may also fee. provided in the recombinant construct. These promoters can fee operably linked to any of the transcribable polynucleotide molecule sequences described above, [ 01041 The term "construct" is understood to refer to any recombinant polynucleotide molecule such as a plasmid, co&amp;mid, virus» autonomously replicating polynucleotide molecule, phage, or linear or circular single-stmnded or double-stranded DNA or RNA polynucleotide molecule, derived from any source, capable of genomic integration or autonomous replication, comprising a polynucleotide molecule where one or more polynucleotide molecule has been finked in a functionally operative manlier, Le. operably linked. The term ’’vector” or "vector construct" is understood to refer to any recombinant polynucleotide construct that may be used for the purpose of transformation, in., the introduction of heterologous DNA into a host photosyntheiie microorganism, such as a cyanobacterium, [01053 In addition, constructs may include, but are not limited to, additional polynucleotide molecules from an untranslated region of the gene of interest These additional polynucleotide molecules can be derived from a source that is native or heterologous with respect to the other elements present in the construct [0106] Plasmid [0107] 1b some embodiments, a host photosynthetic mieroorgansini, such as a cyanobacterium, is transformed with a plasmid-based expression system (see e.g,, Example 5). Preforably the plasmid encoding the gene of interest comprises a promoter, such as one or more of those discussed above. For plasmid based transformation, preferred is a broad host range plasmid that enables function in both A, mti md cyanobacteria, which provides the advantage of working in a convenient fast growing well understood system (E coti) that can be efficiently transferred to the final host (cyanobacteria). In some embodiments, plasmid based transformation and chromosomal integration are used in conjunction, where the plasmid protocol Is used for design and testing of gene variants followed by chromosomal integratloa of identified variants* [ 01081 Host strains developed according to foe approaches described herein can be evaluated by a number of means known in the art (see eg., Studier (2005) Protein Expr PuriF. 41(1), 2G7---234; Getiksen, ed. ¢2005) Production of Recombinant Proteins; Novel Microbial and Eukaryotic Expression Systems, Wiley-VCH, ISBN-10; 35273ΙΘ363; Baneyx (2004) Protein Expression Technologies, Taylor &amp; Francis, ISBN-10:0954523253), [0109 ] Provided herein are nucleotide sequences for plasmid constructs encoding sps, ΨΡ, and/or asf, Examples of plasmid constructs encoding sps, spp, and/or us/'meiude, but are not limited to, pLybALll (SEQ ID NO: 19) (see v.g., PIG, 6) and pLybAL12 (SEQ ID NO: 20) (sec e.g„ FIG. 7). Also provided herein are nucleotide, sequences for plasmid constructs encoding tps and tpp. Examples of plasmid constructs encoding tps and tpp include, but are not limited to, pLybAL23 (SEQ ID NO; 118)* A skilled artisan will understand that similar contracts can be generated for biosynthe tic genes necessary for accumulation of other dixaccharides, such as glucosylglyeetol and mannosyliractose.

[ 01101 in some embodiments, foe transformed host photosynthetic microorganism comprises pLybALl 1 (SEQ ID NO: 19) or pLybAL12 (SEQ ID NO: 20). In some embodiments, foe transformed host photosynthetic mlemorganism comprises pI,yhAL23 (SEQ ID NO; 118). For example, a transformed cyanobacterium cart comprise pLybALl 1 (SEQ ID NO: 19), pLybALl2 (SEQ ID NO; 20), or pLyhAL23 (SEQ ID NO; 1 IE).

[ 01113 A plasmid coasfruct comprising a disaecharide.biosynthetic gene(s) can also include a promoter. Examples of plasmid constructs comprising $ps, spp} and/or asf and a promoter include, but am mot limited to, pLyl>AL7f(SEQ ID NO: 65); pI.ybAL.8f, including kanamydft resistance (SEQ ID NO; 69); pLybALl 3f (SEQ ID NO: 51), pLvALBr (SEQ ID NO: 52), pLyb ALI 4f (SEQ ID NO: 53), pLybALl 4r(SEQ ID NO: 54), pLybALlS (SEQ ID NO: 44% pLybALl 6 (SEQ ID NO: 45), pLybALl? (SEQ ID NO: 46), pLybALlS (SEQ ID NO: 47), pLybAEI9 (SEQ ID NO: 48), pLybAL21 (SEQ ID NO: 49), and pLybAL22 (SEQ ID NO: 50), Examples of plasmid constructs comprising ¢75 m&amp;fyp and a promoter include, but are not limited to, pLybAL23 (SEQ ID NO; 118), pLybAL28 (SEQ ID NO; 121), pLybAL29 (SEQ ID NO: 122), and pLyb ALSO (SEQ ID NO: 123). A skilled artisan will understand that similar promoter containing contracts can be generated for biosynthetic genes necessary for accumnlation of other disaccbarides,, such as giueosylglycerol and manndsyltructose.

[01123 In some embodiments, the translbimed host cyanobacterium comprises pLybAL7f (SEQ ID NO: 65); pLybALSf (SEQ ID NO: 69); pLybALl 3f (SEQ ID NO: 51), pLyALl 3r (SEQ ID NO: 52), pLybALl4f (SEQ ID NO: 53), pLybAL14r (SEQ ID NO; 54), pLybALl 5 (SEQID NO: 44), pLybALl 6 (SEQ ID NO; 45), pLybALl? (SEQ ID NO: 46), pLybALl8 (SEQ ID NO: 47), pLybALl9 (SEQ ID NO: 48), pLybAL2i (SEQ ID NO: 49), and pLyb.AL22 (SEQ ID NO: SO). In some embodiments, the ixansformed host eyanobacterium comprises pLybAL28 (SEQ ID NO; 121), pLybAL29 (SEQ ID NO: 122), pLybALSO (SEQ ID NO: 123), and pLybAL23 (SEQ ID NO: 11S >.

[01133 Sugar' Secretion [01143 In various embodiments, a transformed disaccharide-aecumtdating photosynthetie microorganism can secrete the accumulated disaccharide from within die cell into its gro wth environment. Secretion of the disaccharide can be. an inherent effect of transforming the photosynthetie microorganism to accumulate a disaecharide or the photosynthetie microorganism can be further engineered to secrete the disaecharide. For example, some cyanobacteria transformed to accumulate .trehalose inherently secrete trehalose from the cell (see e.g., Examples 19-20), As another example, a eyanobacterium transformed to accumulate sucrose can be further engineered to secrete sucrose from the cell (see e.g„ Example 16). £01151 A'host phoiosynthette microorganism, such m a cyanobacterium, can be further engineered to secrete a dtsaccharide. In somo embodiment, a transformed host ptofesynlfeetic microorganism is engineered to express a porin specific for the accumulated, disaccharide·. For example, a cyanobacteriumengineered to accumulate sucrose can be farther engineered to express a sucrose porin (see e.g.s Example 16). In one embodiment, tire transformed disaceharide-accurmdating cyanobacterium comprises an scrTnucleic acid, such as SEQ ID NO; 94, in one embodiment, the transformed disaccharide-aeeumulatmg cyanobacierium comprises a nucleic acid encoding a scrY polypeptide, such as SEQ ID NO: 95. In one embodiment, the tansfooned disaccharide-aceumulating cyanobacterium comprises a plasmid containing serf, such as pbybAL32 (SEQ ID NO: 91). It is contemplated that a similar approach can be applied to other photosynthetic microorganisms or other target dmeeharides, [01161 Modulation of Sugar Degradation.

[01171 In some embodiments, a host photosynthetic microorganism, such as a cyanobacterium, is further engineered to improve disaccharide production by modulation of degradation activity (see e.g„ Example 14),- In some embodiments, an invertase homologue can be down.~regulated or eliminated in a transformed pfaotosynfhetic mictoorgansim. For example an invertase homologue from Syneehoeysiis spp. PGC 6803 (nucleotide sequence SEQ ID NO; 70; polypeptide sequence SEQ ID NO; 71) can be down-regulated or eliminated, in a transformed cyanobacterium. As another example, an inveriase homologue from Synechoweem elmgaius PGG 7942 (nucleotide sequence SEQ IB NO; 72; polypeptide sequence SEQ ID NO: 73) can be down-regulated or eliminated in a transformed cyanobacterium, in some embodiments, a sucmseferredoxin-liite protein Is down-regulated or eliminated in a transformed cyandbacteriuma. For example, a sucraseferredoxin~iike protein from Syneehacysiis spp, PCC 6803 (hucleotide sequence SEQ ID NO: 74; polypeptide sequence SEQ ID NO; 75) (Machray G.C. eiat 1994, FEB$ Lett 354, 123-127) can be down-regulated or eliminated jjti a transformed cyanobacterium. These genes cart.be deleted using the markerless deletion protocol described in, for example, FIG. 11 (see e.g.. Examples 12-13) A similar approach can be taken for other disaceharides engineered to be accumulated in a cyanobacterium.

[0118J Other methods of down-regulation or silencing the- above genes are known in the art. For example, disaccharide degradative activity can be down-regulated or eliminated using anUsense,oligonucleotides, protein aptamers, mrcclotide aptamers, and RNA interference (RNAij (eig.,-small interfering RNAs (siRNA), short hairpin ENA (shRNA), and micro RNAs (miRNA) (sec e.g., Fanning arid Symonds (2006)' Handb Exp Pharmacol 173,289-303G, describing hammerhead ribozyraps- and small hairpin RNA; Helene, C, et al (1992) Ann. N.Y, Acad. Set. 660,27-36; Maher (1992) Bioassays 14(12): 807-15» describing targeting deoxyribomicieotide sequences; Lee et al (2006) Cufr Opin Chem Biol. 10* I-S, describing aptamers; Reynolds et ah (2004) Mature Biotechnology·· 22(3), 326 - 330, describing RNAi; Pusbparaj and Melendez (2006) Clinical,and Experimental Pharmacology and Physiology 33(5-6), 504-510, describing RKAi; Dillon et ai. (2005) Annual Review of Physiology 67,147-173, describing RNAi; Dykxhoom and Eiebefman (2005) Annual Review of Medicine 56* 401-423, describing RNAi). RNAi molecules are commercially available from a variety of sources (e,g,., Ambton, TX; Sigma Aldrich, MO; Mviirogen), Several siRNA molecule design programs using a variety of algorithms are known to the art (see e.g., Cenix algorithm, Ambton; BEOCK-iT™ RMAi Designer, Invitrogen; siRMA Whitehead Institute Design Tools, Bioinofimatics &amp; Research Computing). Trails influential in defining optimal siRNA sequences include G/C content at the temuniof fee siRNAs, Tm of specific internal domains of the siRNA, siRNA length, position of the target sequence within the CDS (coding region), and nucleotide content of the 3' overhangs. 101193 In some embodiments, a host photosviuhetic microorganism can be further engineered to promote disaccharide secretion from the cells. For example, a cyanobacterium can be further engineered to promote sucrose secretion from the ceils (seee.g,. Example 15-16), When in a low osmotic environment, fee sucrose can be automatically expunged from the cells, as done with osomoprotectaats by some organisms when transitioning from high to-low salt environments (Schleyer, M„ Schmidt, R, and Bakker, E. P. 1993, Arch Microbiol 160,424-43; Koo, S. P,, Higgins, C, F. and Booth, l R, 199.1. J Gen Microbiol 137,2617-2625; Larnark, T., Styrvold, Ο. B. and Strgim, A. R, 1992. FEMS Microbiol Lett. 96,149-154). Sucrose porins can be engineered to be expressed in a transformed cyanobacterium (see mg., Example 16). These genes can be cloned and transformed into cyanobacteria according to techniques described above. Such approaches can he adapted to other photosynthetic mieroorganisms.

[ 012 δ J in some cmbodimeuts,test photosynthetic. microorganism is transformed by stable integration into a chromosome of the host. For example, a host cyanobacterium caa.be transformed by stable integration into a chromosome of the test (seeeg,, Examples Π>13). Chromosomal integration can insure that the target gene(s) is installed into the organism without risk of expulsion as sometimes occurs with plasmid-based gene expression. Chromosomal integration can also reduce or eliminate the need for antibiotics to maintain target genes, £01213 Preferably, the strategy for chromosomal integration targets gene insertion into what· is termed the upp locus on the chromosome (see e.g.. Example 11-13). This she codes for the enzyme uracil phospboribosyItransfcrase (UPRTaso) which is a scavenger enzyme in pyrimidine biosynthesis. Using this strategy allows candidate selection by 5-tIuorouracil (5-FU), which can eliminate non-integrated organisms. Segregation methods are generally used in cyanohacterial systems because these organisms contain multiple copies of their chromosomes (eg., up to 12 for 'Synechocystis spp. PCG 6803 and Ml for Synechowccus elongatus PCC 7942). This strategy is particularly attractive for cyanobacteria, because this approach can avoid the use of traditional segregation techniques that rely on selective pressure and statistical integration for successful segregation. Using 5-FU as a screening-agent can be more efficient because it can prevent growth for any organism, that contains even a single active upp gene. In this manner, folly integrated; candidates can fee selected rapidly over fewer generation cycles compared to foe processes required of traditional techniques.

[012 2 3 Solid Phase Photosynthetic Bioreactor £ 012 31 Provided herein is a phofobioreactor for etthuring pbotosynfoetic microorganisms comprising a solid phase cultivation support for foe growth of photosynthetic microorganisms, A solid phase cultivation support, or solid cultivation support, or solid support, or fee like, is generally understood to mean a cultivation support that is neither a liquid nor a gas. Although the support itself is a solid, foe support structure may be selected so that it absorbs a liquid (e.g,, growth media), a gas, or both, lo certain preferred embodiments, as described more fully below, the solid support can absorb moisture for use by the microorganisms during cultivation. £0124] V arious embodiments of the photobioreacforfs) described herein can support the growth a photosynthetie microorganism. The photosyntheiic microorganism grown in the photobiorcactor can he, for example, a naturally photosynthetic microorganism, such as a cyanobacterium, or an engineered photosynthetie microorganism, such as an artificially photosynthetie bacterium. Exemplary microorganisms that are either naturally photosynthetic or can be engineered to be photosynthetie include, but are not limited to, bacteria; fungi; arohaea; protons; microscopic plants, such as a green algae; and animals such as plankton, pknarkn, and amoeba, Examples of naturally occurring photosynthetic microorganisms include, but are not limited to, Spiruhna maximum, Spiruhaa platensis, Dunaliella salina, Botrycoccus braunii, Chlorella vulgaris, Chlorella pyrenoidosa, Serenastrum capricomutum, Scenedesmus auadrlcauda, Porphyridium craentum, Scenedesmus acutus, Dunaliella sp„ Sccnedesmus obliquus, Anabaenopsis, Aulosira, Cylmdrospermnm, Synechoccus sp.s Synechocysfis sp., and/or Tolypoihrix, £ 0125] Preferably, the bioreactor is configured to support «inoculation, growth, and/or harvesting of cyanobacteria transformed to accumulate a disaccharide, as described above. £0126] The photobioreaetorcanbe an open or aelosed system, as described more fully below. In various embodiments, foe photobidreactor includes a solid phase euhivation support, a protective harrier layer, and a suspension, element. Some embodiments of foe photobiomactor can contain a system for delivery and/or removal of gas, fluids, nutrients, and/or photosynthetie miermirganisms. Delivery systems can be, for example, standard plumbing fixtures. Any of the various l ines can include quick-connect plumbing fixtures. The photebioreactor can have a gas delivery line, which can deliver, for example, delivering carbon dioxide or normal atmospheric air. The photobioreactor can have a fluid delivery line. Preferably, foe fluid deli very' line connects to a trickle or drip system which conveys a fluid (e.g,, water) to the solid phase cultivation support. The phofehioreaetor can have a nutrient delivery Ike, Formulation of a n utrient composition for foe growth and maintenance of a photosynthetie microorganism is within the ordinary skill, of the art. In some embodiments, foe nutrient and fluid delivery lines can be combined, for example to supply a fluid-based nutrient mixture. In some embodiments* the fluid delivery line or the nutrient deli very line can be a spray device for distributing a liquid medium over 'the growth surface, lit such spray de vices, the photobioreactor is large enough to accommodate, for example, a spray device .between, an outer layer, such as a hamer layer, and the solid phase cultivation support. Usually, nutrients are supplied in a water-based composition. It can be advantageous to provide for different water delivery 1ioe(s) and nutrient delivery line(s) so -as to provide for independent control of moisture and nutrient levels. The photobioreactor can have a product harvest line so as to provide for collection of photosynthetic microorganisms and/or liquid suspended/soluhie products. The photobioreactor can have an inoculation line so as to pro vide for inoculation o f photosynthetic microorganisms.

In some embodiments, the fluid, nutrient, and/or inoculation lines can be combined. £01273 Ode embodiment of a solid-phase photobidreactor is depicted in FIG 1 (front view) and FIG 2 (side view). In du^se embodiments, a solid phase cultivation support 2 is enclosed by protective barrier 7. FIG 2 shows that the solid cultivation support is between protective barrier layers 3 that comprise the protective barrier 7, The solid cultivation support 2 provides the surface upon which photosynthetic microorganisms are cultivated- The protecti ve barrier layers 3 that make op the protective barrier 7 are transparent to allow actinic radiation to reach the surface of the solid cultivation support 2 to support the . growth of photosynthetic microorganisms. Resealable closures 4 allow for a protective barrier 7 that is releasably sealed. Exchange of gases and vapor occurs through a selective panel 5 of material that «incorporated into the pndeetive barrier 7. The photobioreactor! can be suspended by support elements 6 to allow for a vertical or non-horizontal orientation.

[01281 Another embodiment of a solid-phase photobioreactor is depicted In FIG, 12 A (front view) and FIG. 12B (ride view). The reactor 1 can be designed in a segmented format, which can aid in. servicing· and minimizes potential contamination of the surface and/or plumbing. Each segment can be connected to the reactor through plumbing (e.g,, quick connect type plumbing) of the various supply and product harvest lines. The reactor can be supported by a suspension element 6 from, for example, rails, which allows the reactor 1 to hang in space and aid in rapid servicing of each segment. The outer protective barrier 7 can be a transparent material that enables light penetration facilitating photosynthesis on the growth surface 2, while preventing environmental contamination and moisture loss from evaporation. The growth surface 2 can be composed of a material that retains moisture, supplies nutrients, removes products* and/or enables high densi ty growth of photosynthetio microorganisms. The growth surface 2 can be serviced by plumbing that provides continuous fccdiug/produot harvest from the surface by liquid culture media. The media tubing 8can be a porous hose that seeps liquid to the surface 2* which can percolate through the growth· surface 2 by gravity. The liquid can be harvested at tire bottom of the reactor by a .harvesting' tube 9, which collects products and excess liquid media for transport, from the reactor L Gases, such as carbon dioxide and air, can be supplied to the reactor by a gas dispersion tube 10. The gas supply tube 10 can provide a positive pressure environment and is expected to supply gases accessary for growth in a controlled, efficient manner. The gas supply line 10 can also assist in minimizing moisture loss by huuudifyiag incoming gas streams. Excess gas from the reactor can be vented hy a breathable panel 5 (on the reverse side* not shown) that is a porous material that allows for gas passage but minimizes or eliminates environmental contamination. Contamination is expected to be minimized by the positive pressure configuration of the reactor 1 through filtration of the incoming gas delivered by the supply line .10, Positive pressure can also prevent contamination, from the environment by providing an inside out pathway for gas Sow. CO 12$ 3 In the embodiment depicted in FIG, I2B, features of the reactor 1 are depicted in an. orientation relative to the growth surface. The breathable panel 5 allowing for excess gas to escape the reactor 1 can be located toward the bottom of thedevice to provide apath for gas to migrate across the growth surface 2. Location of the breathable panel 5 on the bottom: of the barrier surface 7 also minimizes or prevents the possibility of carbon dioxide segregation and build up resul tmg from its higher density relative to air. The 'dimensions of the .'breathable panel 5 can be determined based on gas flow rate requirements for Optimal growth on the cultivation surface 2, [01303 Solid Phase Cultivation Support [0X311 The solid phase cultivation support of a photobioreactor as described herein provides a surface on and/or in which a photosynthetic microorganism can grow. Preferably, the solid phase cultivation support comprises a material that provides or facilitates the provision and/or retention of moisture and/or nutrients to the organisms, so as to promote and sustain growth. Embodiments of the invention are not limited to the type or strain of photosynthetie microorganisms that can be cultivated , One of ordinary skill in the art will recognize that the amount of moisture and the amount and composition of nutrien ts desirable for cell growth will vary with the type or strain of photosynihefie microorganism and the application for which it is to be grown. Materials (or the substances contained within or on. those materials) that may have a deleterious effect on the growth of phoiosynthetic microorganisms are generally avoided, [01321 A single photobioreaetor can be used to cultivate a single type or multiple types or strains of photosynthetic microorganisms. Further, the solid cultivation support can comprise material(s) such that it is suitable for a single cultivation cycle or multiple cycles of cultivation, with or without sterilization between cultivation cycles. Still further, a photobioreaetor can be configured to cultivate a single type or strain of microorganism or multiple types or strains of microorganisms on a single or multiple solid supports. In some embodiments, instead of an axenic culture, a community of different phctosynthetic microorganisms, or a community of photosynthetic and non-photosynthetie microorganisms, can be grown together simultaneously on one cultivation support. A single photobioreaetor can also comprise multiple cultivation supports. Thus in another embodiment, multiple cultivation supports within a single protective barrier can cultivate one or more types or strains of photosyntbetic microorganisms simultaneously, [01331 The solid cultivation support preferably comprises a relatively porous material A relatively porous material generally has increased surface area and can retain and/or absorb more moisture than a relatively non-porous material. Also preferred is a solid cultivation support that has a textured or topographical surface(s), A textured or topographical surface can enhance cell density compared to a relatively oon-textured or smooth, surface. Although the choice of support material and surface topography are typically selected to enhance the adhesion of microorganisms to the support, it generally is desirable that the organisms not so tightly adhere so as to impede their removal or .harvest. In some embodiments, the solid eultivation support comprises a. material suitable for adhesion and growth of microorganisms. In some embodiments, the .solid eultivation support comprises a material that reduces or eliminates Mofilm formation. C O 13 41 The solid-phase supports of the photobioreaetofs described herein are believed to be different front solid supports that have been utilized in the art (e-g·, the most commonly used solid phase support for the growth of miemorganisms is aear). Agar is generally east into rigid forms, such as a petti dish, and used while therein to maintain its physical integrity because agar tends to break or tear when subjected to minimal ..levels of stress, strain, or both. In contrast, various embodiments of the culti vation support is sutimiently strong and durable that it can be used in a photobioreactor while maintaining its physical integrity' without the need of a stronger, more durable "frame” Or stated another way, the prior art involved a sufficient portion of the weak agar support in contact with a substantially stronger, more durable material (e.g., a petri dish) such that a composite is formed. Thus, the solid-phase supports of various embodiments of the photobioreaetor are suitable in themselves for the cultivation of microorganisms and are sufficiently strong and durable. 101353 Other desirable physical characteristics and/or operation parameters of the solid-phase support are described below. For example, the support can be relatively flat, and rigid (like a plate) or it may consist of a multiplicity of fiat and rigid Sections flexibly connec ted by, c.g., hinges, springs; wires, threads, etc. Suitable rigid materials include, but are trot limited to, various metals, polymers, ceramics, and^ composites ffietmfi The rigid materials preferably have surface topographies that enhance the adherence of the photosynthetic microorganisms ...thereto, .Further, the rigid materials may be formed whit a desired level of porosity to enhance the ability1 to deliver moisture and/or nutrients to the photosynthetie microorganisms. Still further, the rigid materials may be coated with absorbent or super absorbent polymer formulations (see below). Alternatively, the support may consist essentially of flexible material, such as a fabric. Fabrics for use in a solid-phase support include, hut are mot limited to, cotton, polyester, and/or cotton polyester blends, optionally coated with absorbent or super absorbent polymer formulations. Flexibility of the cultivation support can be greatly advantageous because it allows for the culti vation support to be folded, twisted, draped, or rolled tor storage, transport, or handling. 10136] In addition, die solid-phase cultivation support is preferably structurally stable at elevated temperatures (c.g,, about 120°C and above), such-as -would be typically encountered during autoclave sterilization, and will not melt like agar. Thus, in one embodiment, the cultivation support may be sterilized by autoclaving and then placed within the protective barrier of the invention. In another embodiment, the cultivation support cau be placed within the protective barrier, and the entire photobioreaetor may then be autoclaved. Although autoclaving is one «letted for sterdization, one of skill m the art will recognize that any other appropriate method of sterilization may be utilized, [01371 The -solid cultivation support of the present invention can comprise or be made of any material appropriate for supporting the growth of photosyn thetic microorganisms. For example, the support may be composed of natural materials, modified natural materials, synthetic materials, or any combination thereof. Natural materials can include, but are not limited to cotton, wool, processed woven plant fibers, and natural polysaccharides (e.g„ agar, starches, ceLlulosics). Modified natural materials can include, hut are not limited to, chemically modified plant fibers such as nitrocelluiose or cellulose esters, in addition to natural fibers, co~ woven or Wended with polyester or polyamide fibers. Synthetic materials can include, but are not limited to, fibers composed of nylon, fiberglass, polysiioxanes, polyester, polyolefins, polyamide, copolyester polyethylene, polyaerylaies, or potysnlfonaies. Further examples of solid cultivation support materials include wire mesh, polyurethane foams, polyethylene foams, vitreous carbon foams, polyester/polyethyieue foams, polyimide foams, polyisoeyanaie foams, polystyrene foams, and polyether foams, or combinations thereof. ' [01381 In various embodiments, the solid cultivation support is a fabric. The fabric can be formed by methods such as, but not limited to, weaving, knitting, felting, and tbe bonding or cross-linking of fibers or polymers together. The construction of file fabric can be loose or open. Alternatively, the fabric can he tightly constructed. That said, fabrics that have a significant texture, surface area, topographical variability, and/or roughness may provide more mechanical bonding or adherence of the photosynthetic microotyjanisms to the cultivation support and thus may be preferable, especially-fit embodiments wherein the photobioreaetor is handled, transported, or otherwise moved during the process for inoculating the support: with, and/or growing and/or harvesting the organisms. Preferably, in most applications the adherence of fiie organisms to the substrate should not be so great as to unduly hinder their removal during a harvesting operation. Still further, the ability of a fabric-to retainmoisture and/or nutrients for use by the organisms can lx? controlled by selecting fibers that are genially hydrophobic, hydrophilic, or a mixture of such fibers.- These properties allow for moisture and/or nutrients' dissolved therein to be retained and/or transported by the solid support so that they are available to the mieroorganisms growing on fire surface.

[01383 The properties of the cultivation support, especially moisture and/or nutrient retention, can be enhanced by coating tire support with a materia! selected to enhance photosynthetic microorganism growth. For example, the cultivation support can be coated with agar or a super absorbent polymer such as modified cellulose ester, acrylate or acrylate/polyamine copolymer blends. These coating materials are typically able to absorb and retain, greater than 3 0 to 100 times their dry weight in water. In some embodiments, these materials are formulated such that they would retain their superabsorbent properties in the presence of ionic culture media components. The coating material can coat the surface of the cultivation support, or the fibers of a fabric if used, or both, la one embodiment, a swatch of terrycioth serving as the cultivation support is coated in agar. When a solid cultivation support is coated as such, the “surface” of the cultivation support incl udes the surface of the coating if photosynthetic microorganisms attach to such. To keep the cnltivatton support thin, pliable, and light, the coating is preferably thin, for example, no greater than about i 00 microns. However, thicker coatings can also be used depending on the application desired, or on the eombmationof solid cultivation support and coating material selected.

[01403 The solid-phase cultivation support can be a composite, layered structure.

The solid-phase cultivation support can comprise at least two layers arranged so as to be adj acent. Multiple layers of the solid-phase cultivation support can be coupled, such as by bonding, stitching, adhesive, compression, or any other suitable means. The various layers can each independently be selected from among the several materials discussed above. For example, the solid-phase cultivation support c an comprise a first material layer of fabric bonded to a second material layer of synthetic foam. An another example, the solid-phase cultivation support can comprise a first material layer of synthetic foam bonded to a, second materiailayer of synthetic foam of the same or different density. Preferably, the solid-phase cultivation support is a composite, layered structure comprising at least a first layer, which is composed of a high surface area growth material, and a second layer, which Is composed of a permeable type material. .10141] In addition to supplying moisture, nutrients, and a surface for attachment, the cultivation support can provide a surface for capturing actinic radiation. Thus, in some embodiments, the dimensions of the solid cultivation support are sheet-like. That is* the depth of t&amp;e support is small relative to the length and width of the support. In one embodiment, the cultivation support is a sheet-like layer between film-like layers of a protecti ve barrier. Such a Oat bioreactor can be suspended like a. flat panel, in another embodiment,just tire cultivation support is suspended like a curtain enclosed by the outer barrier of the photobioreactor. A thin sheet oi a traditional solid phase support such as agar would easily rip apart, and would likely not be able to be suspended as such , Therefore, it is preferable that the solid cultivation support-alone he able fe maintain its integrity when suspended, even when saturated with liquid. E 014 23 As shown herein, a fabric with a terryclodutype weave can provide a suitable solid support (see e.g., Example i). One of skill in the art will understand that other natural, modified-natural, and synthetic materials may also be acceptable. Terryeioth provides many of tire attributes believed to he desirable in a solid support of the presen t Invention. For example, it is flexible, and not prone to tearing, ripping, breaking, or cracking when handledin accordance wdtli non-destructive techniques (e,g^ bending, folding, twisting, or foiling) under conventional conditions (e.,g., temperature). Likewise, ienyeloth is typically not prone to tearing, ripping, or breaking when modestly stretched (even when saturated with liquid). Additionally, terryeioth tends to he highly textured because it is composed of the many loops of fibers. This provides a large amount of surface area for tire attachm ent of m icroorganisms thereby increasing the amount of microorganisms that can be grown on a support of any gi ven size. Further, a cotton terryeioth typically absorbs at least about three times its own· weight, which allows for moisture and any nutrients dissolved therein to be retained by the fabric support so that they are available to the microorganisms growing on the surface Of the support. Thus, various embodiments provide for a solid cultivation support that is thin or sheet-like in dimension, able to support its own wet weight while suspended, flexible, pliable, absorbent, highly textured, or any combination thereof.

[01433 The above-described supports carl be, and In many applications preferably are, used repeatedly and more preferably for so long as they are structurally sound and provide a surface adequate to support the growth of the microorganisms disposed of after a single use thereby reducing operational costs and waste. That said, there can be certain applications in which single-use supports would be desirable, such as cultivation of recombinant photosynthetle microorganisms useful in producing pharmaceutical products such as small organic molecules or therapeutic proteins and peptides. To reduce the costs of such single-use supports and in view of the tact that that they will not he reused, such .supports' need not he as durable and therefore can be made or constructed using methods and/or materials that are less cosily arid less durable. For example, supports comprised of paper fibers similar to that of paper towels may be appropriate, [01443 Several embodiments of a solid phase cultivation support are depicted la FIG. 13, The solid phase cultivation support materia! depicted in FIG. 13A is a single material that can provide sustainable surface for organism growth, access to moisture and nutrients, point of organism attachment, and/or removal of cultivation products, lire material can allow for liquid percolation and equilibrium diffusion to exchange nutrients, moisture, and products between the surface and organisms. The rendering of the structure configuration Is air example of a high surface area material, which can be optimized for dimension and shape. The solid phase cultivation support material depicted in FIG. 13B is a hybrid material that is composed of multiple layers of materials, each having specific functions for the growth surface, lire base layer can be a porous material that efficiently allows for supply of nutrients and moisture as wet! as removal of products that are percolated through the material. The base material can also provide physical support for the growth surface. The outer layerfs) is expected to be attached to the base layer and can be optimised to provide point of attachment for the organisms. The surface layer can achieve more control of the surface growth environmen t in terms of surface area and compatibility with the cultivated organism.

[01453 Protective Barrier [01461 A photobioreactor as described herein can comprise a barrier that protects the solid cultivation support and growth surface from contamination and/or moisture toss. At.the same time, the phoiobioreactor provides for actinic radiation, either sunlight or artificial light, and earbon dioxide reaching the photosynthetic microorganisms. In various embodiments, the photobioreac tor comprises at least one solid support: and a protective barrier for the cultivation of photosy nthetie m icroorganisms, 10 M? 3 Protection from Physical Handling andtor Contamination [01481 To prevent contamination, a protective physical barrier can at least partially cover the solid cultivation support. In certain embodiments, the physical barrier can enclose the cultivation support The .protective barrier can also control at least in part, the loss of the moisture from the support and/or the atmosphere within the photobioroactor to the atmosphere outside the photobioreactor. One of skill in the art wilt recognize that the protective harrier can he constructed from any of numerous .types· of materials depending on the embodiment of the invention desired, [01493 The -protective battier can completely enclose the cultivation support. If the protective barrier is permanently sealed, the barrier must be breached, cut, tom, or the like to access the cultivation support within. Thus, in some embodiments, accessis provided through the protective barrier to the cultivation support and the surface on which the microorganisms are grown, [01503 In preferred embodiments, the protective harrier is releasabiy sealed. The releasable seal can be any of a number of closure types including, but not limited to zipper-type closures such as found in Ziploc® storage hags (SC Johnson Company), hook-and-loop type fasteners (e.g., Velcro USA, Inc,), twist ties, zipties, snaps, clips, pressure sensitive adhesive hacked surfaces, and all art recognized equivalents thereto. A complete seal, however, is not necessarily required- and it may be more efficient not to completely seal the outer barrier to allow for easier access to the cultivation support.

[ 01513 The photobioreactor can comprise a single culti vation support or multiple cultivation supports within a protective harrier. In some embodiments, a single cultivation support is enclosed within a single protective barrier, for example, a plastic bag may form a protective barrier within which a single solid cultivation support is enclosed (sec e.g,, FI0.1). In other embodiments, a single protective harrier may enclose multiple solid cultivation supports;. For example, a greenhouse-type structure may form a protective harrier within which multiple solid cultivation supports are enclosed.

[01523 Transmission of Actinic Radiation [01533 The photoMorcactor can .provide, for transmission of actinic radiation, either sunlight or artificial light, to the photosynthetic microorganisms. But the protective barrier of the invention need not necessarily be transparent to light. Some embodiments can comprise a cultivation support enclosed within a non-transparent protective harrier if a sufficient light source for the growth of photosynfoetic microorganisms is provided within. It may he desirable, simpler, more economical, and the like to provide a tmnsparenf harrier to utilize sunlight, for instance, as a light source. £0X543 Preferred embodiments provide for a transparent barrier comprising a material such as, but not limited, glass or any type of transparent or generally visible l ight transmitting polymer such m polyethylene, acrylic polymers, polyethylene terephthalate, polystyrene, polyiertafluoroethylene, or co-polymers thereof, or corobinations thereof. The transparent harrier can be selected from materials that are durable and not prone to ripping, tearing, cracking, fraying, shredding, or other such physical damage. The transparent barrier material can ho selected for its ability to withstand autoclave sterilization or other exposure to temperature extremes. Further, the transparent barrier materials can be selected to withstand prolonged exposure to sunlight or other radiation without discoloring or deteriorating. One of skill in the art will recognize that certain coatings or formulations that resist photooxidation can be particularly useful In addition, infrared reflecting or absorbing coatings can be selected to feduce· and/or- otherwise regulate the buildup of temperature within the photobioreactof of the Invention. 10X553 One of skill in the art will recognize .that; the thickness of the transparent barrier ntaforial will vary depending on mechanieal ptoperties of scale. For example, the transparent barrier material may he of an industrial/marine type plastic about 10 mil thick or it may be of the type used in a household plastic bag, around 2 mil thick. In one embodimen t, the transparent barrier material is thin and flexible. For example, foe transparent Wrier· material can be less than about 10 mil. C015SI In some embodiments, the barrier forms a protective layer or Aim covering the two sides of a thin, flexible, solid cultivationsupport. The: assembled photobioreactor of this embodiment would be flexible, and could Wbent,. rolled, folded, twisted, or the like for storage, transport, conveying, or handling. In another embodiment, the transparent barrier material is rigid. For example, the barrier can be a glass greenhouse . Most likely, the thickness of the greenhouse glass would preferably he consistent with building practices but it is possible that it could be altered. The photobioreactor of such an embodiment would be for practical purposes

Immovable, but multiple solid supports could be handled, transported, conveyed and the like wi thin the confines of one protective, transparent barrier.

[ 01571 Although a protective barrier can be selected to provide sufficient light for the growth of photosyntheitc mfotoorgamsms,'if is not necessary that the entire harder be transparent. Thus, m sonte embodiments, portions of tire barrier, such as one or more edges, are made from a non-transparent material. The non-transparent materia! can be composed of materials including, but not limited to polyethylene fiber material (TyveM% polytetrafluoroethyiene filnation media, celMoste filter material, fiberglass filter material, polyester filter material and polyacryktc filter material, and combinations thereof. The nontransparent material can. be selected for durability. In such an embodiment, a transparent portion of the barrier would be further protected from tearing, ripping, fraying, shredding, and the like by a durable, non-transparent portion. In one embodiment, a non-transparent portion provides or comprises an attachment structure and/or reinforcement for suspending fee phoiohioreactor by further comprising mounting or attachment points (c.g. , holes, loops, hooks, grommets, or other art equivalent device, opening or, recess) and/or or a mechanism for securing the photobioreactor to a structure. Although it is not required that any such motmting points, etc., be located in or on the non-transparent portion, they can be contained within or on a non-transparent portion of fee harrier, within or on a transparent portion of fee barrier, or within or on a non-transparent and a transparen t portion o f the barrier. The attaching structure may also be contained within or on, or pass through, fee solid cultivation support.

[01581 In some embodiments., fee device has a diseemable front side and back side. The front side of this device is meant to face a light source, and feus the portion of the barrier on fee front side is preferably transparent, while the portion of fee protective barrier on the side facing away from the light fouree is not necessarily transparent, 10159 3 Provision of Gas Exchange £01601 During photosynthesis,photosynthetic microorganisms consume carbon dioxide and release oxygen. A photobioreactor as described herein can provide carbon dioxide sufficient for a desired amount of photosynthesis to occur. One way to supply carbon dioxide to fee rnside of the photobioreactor is to allow direct gas exchange between the air inside and fee air surromrding the photoWoi^aeiex. For example, holes, vents, windows, or other such openings can he provided in the protective barrier so that the system is open to the surrounding atmosphere.

[01613 But such an open configuration may not he desirable when contamination of the photosynthetie^ microorganisms is a concern. To address this concern, the protective barrier can completely seal off the solid support or supports enclosed .'within from the outside air. la such an embodiment, foe desired edneentration of earbon dioxide can be maintained by introducing it into the enclosure. For example, one of skill iu the art would recognize th at plumbing or tubing from a tank of compressed carbon dioxide would allow for carbon dioxide to be mixed into the air enclosed within the photobioreactor, In addition, it is known that the entlssions &amp;btn factories, industrial plants, power plants, or the like can be harnessed as a source of carbon, dioxide for photosynthetie microorganisms, -thus reducing carbon emissions. la one embodiment, a gas supply line can provide carbon dioxide to the growth surface local area, 101623 It may be desirable, simpler, more economical, and the like to provide a selective barrier that is gas permeable to utilize atmospheric carbon dioxide. Thus, some photobioreactor embodiments provide for a selective, barrier that allows gas and vapor exchange between foe environment enclosed within tile protective barrier and foe surrounding air, while still providing a sealed physical harrier against contamination. Such harrier can be at least partially gas/vapor permeable (e.g.,.much less permeable than conventional textile fabrics, higher than that of plastic Films, and/or similar to that of coated papers), thus allowing foe exchange of gases such as carbon dioxide and oxygen but is additionally at least partially and preferably considered to be impermeable to solids and liquids. In some embodiments, foe photobioreactor can contain a semi-permeable barrier layer and a gas supply line to maintain, an elevated carbon dioxide concentration in the area around or near the growth surface, [016 3 3 In some embodiments, a selective barrier can have an average pore size or diameter of no greater than about 10 micrometers and a gas exchange rate that is at least about 5 and no greater than about 10,000 Gurley seconds (a Gurley second or Gurley is a unit describing the number of seconds required for 100 cubic centimeters of gas to pass through 1.0 square i nch of a gi von materia! at a given pressure differential). Therefore, in addition to altowdng gas exchange, the selective barrier can prevent loss of moisture from the enclosed system. C0164] The selective barrier portion of the protective harder can be composed of aay appropriate polymer-based material, such as spunbonded olefin barriers. Spunbonded olefin barriers (very fine polyethylene· fibers) with various properties are readily available from DuPont under the brand name Tyvek®. Such materials are part icularly advantageous because of their combination· of physical properties, *>., they tend to resist the transmission of liquids such as water yet they have a sufficiently high degree of gas/vappr permeability; they are relatively strong, absorb little or no moisture, are rip-resistant, have a signific ant degree of elasticity, and are highly flexible. Spunbonded olefin can exceed 20,000 cycles when tested on an MIT Hex tester (TAPP! method T-423), in addition, they are inert to most acids, bases and salts although a prolonged exposure to oxidizing substances, such as concentrated nitric add or sodium persulfate, will cause some loss of strength. Spunbonded olefin barriers have good dimensional stability in that sheet dimensions tend to change less than 0.0 f% between 0 and 100% relative humidity at cons tant temperature. Certain products meet the requirements of Titl e 21 of the United States Code of Federal Regulations (21CFR 177.1520) for direct food contact applications. They also have excellent mold and mildew resistance; and are of a neutral pH. Unfortunately, however, their ITV resistance is not exceptional That said, at least one to three months of useful outdoor life can usually· be expected. Additionally, their UV resistance cm be improved with opaque coatings or by including UV inhibitors in the polymer fibers.

Additionally, because the spunbonded oelefins produced to date are opaque, t he portion of the protective barrier that would comprise such material is preferably not situated and/or so extensive as to compromise the cultivation of the photosynthetie microorganisms. (0X653 In particular, spunbonded olefin can be produced in “hard” and “soft” structure types. Type 10, a “hard,” area-bonded product, is a smooth, stiff non-directional paperlike form. Types 1.4 and 16 are “soft,5’ point-bonded products with an embossed pattern, providing a fabric-like flexible substrate. Type 14 styles (or tiro equivalent thereof) can be used, for example, where barrier, durability, and breathability are required. Type 16 styles are pin perforated with 5-20 mil (0.13-0,51 mm) holes, giving them much higher air and moisture permeability, additional softness, and greater flexibility and drape than Type 5 4 styles, but at the expense of lower tear strength and barrier properties. Thus, the particular properties of the selective barrier can be customized by selecting one or more types of spunhonded olefin products, [0166] Other examples of selective polymer barriers include, but are not limited to nykrn, jadysulfone, polyietrafiimroethyleae, ceilulbsic, fiberglass, polyester and polyacrylate membranes and filter material, and combinations thereof.

[ 0167 ] The entirety of the protective barrier need not be gas permeable to provide for a barrier that is sufficiently selective for the growth of pbotosyntheiic microorganisms. Only a portion of the protective barrier sufficient to allow for adequate gas exchange need be gas permeable. In one embodiment, the selective portion is a panel, of the protective barrier (see FIG 1). The size and placement of the sel ective panel in relation to the area of the support surface can be altered to achieve a desired amount of gas exchange for a particular application without unduly hindering tie-cultivation of the microorganisms. One of skill in the art-will recognize that the percentage of the area of the outer barrier composed of the gas permeable selective material will depend on the gas permeability rate of the material. In fact, because the gas permeable portion will still allow the transport of water vapor across it, in various embodiments, the size of the gas permeable; portion of the protective barrier is selected so as to allow for sufficient transport of oxygen and carbon dioxide while minimizing the loss of moisture, [ 016 8 3 Suspension and Conveyance System [ 016 91 Photobioreactors described herein can he configured for large scale production and/or haivesting tluough, for example, integration into a handling and conveyance sy stem. FIG 3 shows an above view of an exemplary design of a photObtomaetor farm for -handling large numbers of photobioreactors in a continuous process. The photobioreaeiors or cultivation panels (not individually shown) ate attached to conveyor systems 8. The conveyor systems 8 mtsve the cultivation panels along their paths,. Mul tiple conveyor systems 'converge at centrally located inoculation and harvesting centers 9. Thus, the cultivation panels arc moved into the modulation and harvesting centers 9 where they can be processed (eg., harvested and/or inoculated) and then the panels are moved away from the centers foliowing inoculation and during the period of cultivation of the biomass. The panels are then moved back towards the centers during the latter period of cultivation prior to harvesting, eventually arriving back at the centers with mature biomass for harvest The cycle is then repeated. Harvested biomass can be transported through a pipeline 10 for further processing. The capacity of the photobiorcaetor farm can he increased by adding additional conveyor systems or additional inoculation and harvest centers to form large arrays dedicated to biomass production.

[0170] Suspension of PhotoBioreactor £.017X3 To supply light to photosynihetic nderoorganisms, a favored embodiment of the phoiobioreactot is one in which the cultivation support Is thin and shectriike. When oriented horizontally, the efficient utilization of floor space tends to decrease, therefore in certain embodiments of the invention the cultivation support is oriented non-horizontally, preferably substantially vertically, or more preferably vertically. Nevertheless, the cultivation support maybe oriented in essentially-any manner so tong as a sufficient amount of actinic radiation can reach the microorganisms. Thus, when the photobioreactor is of the type where the protective barrier forms a closely associated film or layer around the solid support, a preferred orientation of the entire photobioreactor is vertical, but any orientation is acceptable. To be clear, the aforementioned orientations {e,g., vertical, horizontal, substantially vertical, non-horizontal, cm.) are relati ve to tire floor or ground beneath the cultivation support, assuming that the floor or ground is horizontal.

[01723 Various structures, scaffolding, stands, racks, etc, may be used to hold or suspend a cultivation support or an entire photobioreactor in a desired orientation. In particular, the cultivation support and/or the protective barrier can be suspended from, or attached to. a rope, line, hook, cable, track, fail, chain, shelf, pole, tube, scaffold, stand, beamorany other such structure capable of suspending the solid cultivation support and/or photobioreactor. Multiple cultivation supports and-'or photobtoreactors may be suspended from a common structure, like sheets hanging from a clothes line. The cultivation supportfs) and/or pk>tohtoreaetor(s) may be suspended statically, or in a manner that allows for their movement. The position of the holes, loops, hooks, or the like will preferably distribute die weight of the cultivation support and/or photobioreactor substantially evenly.

[01733 Suspension of t he photobioreaetor or cultivation support, especially in.a; vertical orientation, is space efficient and may provide advantages in handling. However, the bioreaetor or cultivation support of the invention need not be suspended. For example, in certain embodiments of the present invention, the cultivation support is sufficiently rigid that if oriented non-borizonialty, vertically, Or substantially·vertically (e.g., by securing or placing its base to'on a surface, in an embodiment in which die support is l ike a rigid plate, panel, grid, etc.) it can support its own weight and will, remain so oriented, in another embodiment, the protective barrier is free standing, such as a greenhouse, and multiple cultivation supports are suspended and/or free-standing within, [01741 Suspension of the photobioreaetor and/or cultivation support, especially in a vertical orientation, is space efficient and may provide advantages in handling. However, the bioreaetor or cultivation support of the invention need not be suspended. For example, in certain embodiments of the present .invention, the cultivation-support» sufficiently rigid that if oriented non-horizooiaOy, vertically, or substantially vertically (e,g., by securing or placing its base to/on a surface, in an embodiment in which the support is like a rigid plate, panel, grid, etc.) it can support its own weight and will remain so oriented. 3n another embodiment, the protective barrier is free standing, such as a greenhouse, and multiple cultivation supports are suspended and/or firee-standlng within.

[01753 'Conveyance CO-17'61 Also described herein is a system for conveying photobioreactors, cultivation supports within the. protecti ve barrier of a pho tobioreaetor, or some combination thereof from one locution to another. The ability to transport a photobioreaetor .and/or cultivation support can be advantageous for a variety-of reasons. For example, it may allow for optimizing their position(s) for receiving light, and for maintaining a desired temperature or gas content. 'The ttansportabiltty can be particularly advantageous when multiple photobioreactors or cultivation supports are to be subject to discrete steps, such as; inoculating, cultivating, inducing, and/or harvesting, because it is likely to be more efficient to move the photobioreactors or cultivation supports to several assigned locations in a continuous-type process instead of transporting the necessary materials and equipment to stationary photobioreactors or cultivation supports. E917?I Thus, die growing surface, whether the cultivation support alone, or the cultivation support enclosed in a protective barrier, can be conveyed even after inoculation. One of shill in the art will he familiar with numerous types of conveyor systems frequently used in industrial applications. The conveyance system is not limited to any particular type so long as it is capable of moving one or more photobioreactors or cultivation supports. One shilled in the art will recognize that the type of attachment between the photobiomactor or cultivation support and the conveyor system will vary with the type of conveyance system employed and .will he selected to work cooperatively with any mounting points that are part of the cultivation support and/or the protective barrier. Although it Ls envisioned that the cultivation supports) or photobioreactor(s) will he conveyed in a mechanized maimer powered by one or more motors (e.g., through the action of a chain and gears), it is also possible for them to be conveyed with human effort (e.g., by simply pushing suspended hioreactors that are attached to a rail by a bearing mechanism .that slides along the mil), £017 S3 A conveyor system that suspends photohioreaciotfs) and/θί cultivation supports}, especially in a vertical orientation, is space efficient and may provide ad vantages in handling. But the conveyor system need not rely on suspending phoiobioreactor(s) or cnhivation supportfs) . For example, a photobioreactor may move along on top of .the conveyor system, such as by sliding over a roller conveyor. In one embodiment, the conveyor system may move photobioreactors comprising a .cultivation· support enclosed m a protective barrier, Alternatively, the protective barrier of a pimtoiHoreactprm^ be alarge enclosure pfotpeting o ........................................ conveyor systems moving multiple cultivation supports. £ 017 9 3 Photobioreactor Farm [01001 For large scale applications, it may he impractical to construct a single cultivation support of sufficient size. Thus is provided· use of two or several or tens or hundreds or thousands or more cultivation supports to cultivate plmtosyihhetic microorgairisms in a photobioreactor “farm.” These cultivation supports can all reside within a single protective barrier, thus comprising a single photobioreactor, or multiple cultivation supports may be part of multiple photohioreactors. In either case, it can be beneficial to organize the multiple photobioreaciors or cultivation supports within a photobioreactor farm for ease and efficiency of handling and processing. It can also be beneficial to organize their arrangement to maximize the amount of energy captured from a li ght so urce such 6s the sun. Such organization can consist of arranging numerous photobiomaeiors or cultivation supports » an orderly fashion such as, but not limited to, rows, columns, concentric circles, in grids, radiating outward froma central point, and so forth. 101813 in various embodiments, the farm comprises Multiple photobioreactors or cultivation supports suspended from a common structure such as a track, rail, chain, line, or the like. In further embodiments, the structure is part of a conveyor system and the photohioreactors or cultivation supports move along the path, of the conveyor system from one location to another, £01821 A photobioreactor farm can comprise one or an arrangement of multiple conveyor systems handling numerous photobioreactors or cultivation supports. Such an arrangenient could be scaled up to comprise two or several or tens or hundreds or thousands or more conveyor systems together handling two or several or tens or hundreds or thousands or more photobioreactors or cultivation supports, in addition to the conveyor system(s), a photobioreactor farm can include defined areas, stations, or centers for performing steps such as inoculating, cultivating, inducing, and/or harvesting photosynthetic microorganisms. Such centers can be the location of specialized equipment for performing certain steps. The paths of the conveyor systems can bring the photohioreactors or cultivation supports to such centers where a particular step is performed. The photobioreactor or cultivation support can then be moved along to the next area or center in the sequence. Different photobioreactom or cultivation supports along the conveyor system can reside at different centers along the path and thus be subject to different steps simultaneously. In one embodiment, the path of the conveyor system is a loop. Once a. photobioreactor or cultivation support completes one round of steps in the cultivation process, it cun repeat the process. Allowing for some units to be damaged or otherwise eventually needing replacement, essentially the same set of photobioreactors or solid cultivation supports can be used repeatedly, 10183] In a further embodiment, cultivation and harvest can occur at the same or nearly tire same location. This location is termed an inoculation and harvest center (see eg., FU3 3). Inoculation of the photobioreactors andtor solid cultivation supports occurs at the inoculation and harvest center. The conveyor system forms a loop that, tlren transports the photobioreactors or cultivation supports away from tireinoculation and harvest center. The photobioreactors or cultivation supports file»' travel along the path of the conveyor system lor an amount, of lime sufficient for the desired amount of cell growth. The conveyor system then returns the photobioreactors or cultivation supports back to the inoculation and harvest center for harvest. Multiple conveyor systems can share a common inoculation and harvest center from which they radiate out from. If even more capacity is needed, a .photobioreactor farm can comprise multiple inoculation and harvest centers handling the photobioreactors or cultivation supports from multiple conveyor systems. Although increased efficiencies may be realized, it is not necessary that the location of inoculation and of harvest be the same or nearly the same location. £01843 Methods of Using a Photobioreactor 101853 Cultivation of Photosynthetie Microorganisms [01801 A solid phase photobioreactor, as described herein, can be used for cultivating photosynthetic microorganisms. Photosynthetic microorganisms that can be grown in tire solid phase photobioreactor include, hut are not limited to, a naturally photosynthetic microorganism, such as a cyanobacterium, or an engineered photosynthetie microorganism, such as an artificially photosynthetic bacterium, Exemplary mictoorgansitns that are cither naturally photosynthetic or can be engineered to be photosynthetic include, but are not limited to, bacteria; fungi; archaea; protista; microscopic plants, such as a green algae; and animals such as plankton, planarian, and amoeba. Examples of naturally occurring photosynthetic microorganisms that can be grown in the bioreaetor include, but are not limited to, Spirulina maximum, Spirulina platensts, Dunalielta salina, Botrycoccus braunti, ChloreJla vulgaris, Chlorella pyrenoldosa, Serenastmm eapricomnium, Scenedesmus auadrieauda, Po^hyridium cmentum, Scenedesmus aeutus, Dunalieila sp,5 Scenedesmus obliquus, Anabaenopsis, Aulosira, Cylindrospermum, Syaechoccus sp., Synechoeystis sp,, and/or Tolypothrix.

[01873 Preferably, the photosynthetie microorganisms grown in the solid phase photobioreactor comprise cyanobacteria. The cyanobacterium grown in the bioreaetor can be any photosynthetie microorganism from the phylum Cyanophyta. The cyanobacterium grown m the bioreaetor can have a unicellular or colonial {«.g.,: filaments, sheets, or balls) morphology . Preferably, the cyanobacterium grown in the bioreaetor is a unicellular cyanobacterium. Examples of cyanobacteria that can be grown in the bioreaetor include, bn! are not limited to, the geaus Synechocystis, Synschacoceus, ThermosynechoaKums, Nbstoe, froehlorQeoecu, Microcystis, Anabaena, Sptrulina,and Gloeohaeter, Preferably the cyanobacterium grown in. the bioreaetor is a Syneehocystisspp, or Synechoeoceus spp. {e,g,s Smechocoam eiongatm PCC 794:2 (ATCC 33912) and/or Symchacystis spp. PGG. 6803 (ATCC 27184)), More preferably, the. phoiosymihetic microorganism grow in the bioreaetor is a trari^geaic photosya&amp;eiic nvicroorgairism engineered to accumulate* disaccharide, as disclosed herein, [01881 A solid cultivation' support of a photobioreactor can be inoculated with a photosynthetic imcroorganism, along with addition of moisture and other components including, hut not limited to, nutrients, salts, buffers, metals, nitrogen, phosphate, sulfur, etc. The pbotobioreactor can then be rcleasably sealed with the culti vation support within the protecti ve barrier, The sealed photobioreactor can be placed, for example by suspending it, in a location and manner to allow for control of illumination and temperature. The placement can be static, or the photobioreactor can be moved, such as to ensure maximum exposure to the sun’s radiation over the course of a day, The photosynthetic microorganisms can be cultivated for a desired amount of time. One of skill M the art will recognize that the length of time -will vary' according to the type of microorganism and the density of cell growth desired . For example, for certain strains of cyanobacteria, a cultivation period that, is-'within the range of about four to about seven days can provide a yield of cells that is within the range of about 50 to about 250 grams of dry biomass per liter equivalent. Following a period for cultivation, the releasable seal can be opened and tire photosynthetic microorganisms can be harvested. EGX893 As used herein, “grams of dry biomass per liter equivalent” is a unit determined by calculating the average depth of the biomass layer (e.g., about. 150 microns) growing on the cultivation surface and multiplying that value by the length and the width of tire cultivation surface. This calculation provides a volume. The weight of the collected biomass from the cultivation surface can then be correlated to the volume and expressed as “grams of dry biomass per liter equivalent.” [01901 Method of Conrinnous Cultivation £61911 Greater efficiencies can be realized if the process of cultivating photosynthetic microorganisms were to be made continuous, for example, like an assembly line, instead of requiring the equipment and capacity to handle a targe amoam of biomass alt at once that then site idle in between batches, a continuous system would, require less total capacity', but would utilize that capacity more efficiently through continuous operation. By dividing cultivation into Smaller but more numerous components, the components can be organized in a spatially continuous arrangement, Different discrete steps of tlte overall production process cm then occur simul taneously. After a culti vation component is subjected to a process step, the component moves forward in the process while another component replaces it in that step.

Therefore, production of the end product would not be limited to the maturation of a l arge hatch, but can occur regularly as individual components complete the assernMy line-like process. •Further, following tire completion of one round of the process, the components can immediately start tire process over and do so repeatedly, [0132] More specifically, continuous cultivation relates to methods of using : conveyable photobioreactors or cultivation supports for cultivating photosynthetic microorganisms in a continuous manner. Continuous or continuous process is understood as the Spatial' relationship that can allow' the photohioreactors or 'solid cultivation supports to progress from one step of tire cultivation process to another. Alternatively, it is possible for a single large structural support to be utilized in a continuous process. Specifically, the support can be a loop of material (e,g., terry cloth fabric) that is made to travel along a circuit (eg., Ike a conveyor belt that is arranged preferably vertically). The end result is that, biomass production can be achieved, regularly as multiple photobioreactors or solid cultivation supports finish the process sequentially and repeatedly. This type of process presents opportunities in large scale applications for increased effieiencies over producing biomass la large, but infrequent batches, [0193 ] in a preferred embodiment, tire continuous spatial relationship is along the path of a conveyor system. The manner of operation is analogous to an assembly line. Such a conveyor system can operate in a number of ways. For example, the conveyor system can operate without interruption while moving the photobioreactors or cultivation supports from one location to another, in such an embodiment, inoculation,, harvesting, and the like occur while the photobioreactors or cultivation supports are in motion,. Alternatively, the conveyor system can stop to allow for steps to be performed, and then resume to move tire photobbreactors or cultivation supports to the location of the next step. Further, the conveyor system can operate without interruption, and the photobioreactors or cultivation supports can be detached from the movement of the,conveyor system for processing, and to reattached to re-enter into the steam of conveyance. One skilled in the art wtii realise that oth«- permutations of this general theme are also possible.

[0194] In one embodiment of a method of continuous cultivation, multiple photobioreactors are inoculated at one location along the conveyor system. The conveyor system then moves the photobioreactors to an area where culti vation of the photosynthetic rnknoorganisms occurs. During this portion of conveyance, the photobioreactors can be positioned to allow for optimal illumination to promote growth and photosynthesis. Next, the photobioreactors would arrive at a location where the photosynthetic microorganisms can.be. harvested. The photobioreactors can then return along the path of the conveyor system to the point of inoculation to begin tire process again. To improve efficiency, the time between when the photobioreactors leave tbe location of inoculation and arrive at the location of harvest can be made to coincide with tire time it takes for the desired amoun t of growth o f the photosynthetic microorganisms to occur. The steps of the process are not limited to inoculation, cultivation, and .harvest; additional steps can include inducement of tbe celtsto synthesize a desired product or sterilijation. Although: the above embodiment describes a system of eouveyable photobioreactors, it will be appreciated that the same type of continuous cultivation can be practiced within a single protective barrier to convey and process multiple solid cultivation supports, [ 01953 Method of Producing Fermentable Sugar's [01961 One technology that can benefit from the ability to mote efficiently grow photosynthetic .microorganisms .is the production of biomass for alternative fuels such as ethanol or biodiesel. Relative to plants currently grown to produce biomass such as com, sugarcane, soybeans, canola, jatropha, and so forth, photosynthetic microorganisms, such as cyanobacteria, produce biomass at a much faster rate, which may lead to much greater productivity. In addition, direct production of disaceharides by microorganisms avoids much of the extensive energyintensive pre-processing of using plant biomass to produce fermentable sugar. Further, the use of phototrophic microorganisms instead of plants can lead to higher yields of fermentable sugars without soil depletion, erosion, and di version of the food supply. Relative to other microorganisms, preference is given to phntotrophie mierwarganisms because their sources of carbon (GO$. and energy (light) can be supplied from the environment, making them far less expensive to cultivate. In. addition, phototrophie microorganisms can be utilized to consume carbon emissions from Industrial processes, thus providing further benefits to the environment, [02,973 One obstacle to producing high quantities of fermentable sugars from photosynthetic microorganisms is that they generally consume produced carbohydrates rather than accumulating them. While some sugars, such as sucrose or trehalose, are not utilized as a primary' carbon source by photosynthetic· microorganisms, there are mechanisms for slow assimilation. In spite of reprocessing mechanisms, such material, can accumulate without being metabolized. If the organism Is engineered appropriately, the assimilation mechanism can be inactivated, which enables high yields of sugars to be produced.

[ Q19 8 3 Provided herein is a method for producing fermentable sugars, especially disaccharide sugar's, by photosynthetic microorganisms. Examples of fermentable sugars include, but are not limited to, sucrose, trehalose, glucosyigycerol and mannosySfruetose. Preferably, the fermentable sugar is sucrose or trehalose. The method can be adapted to occur in a continuous manner to Improve the cost effectiveness of produc tion.

[ 01991 Various embodiments of this method can be practiced using a photosynthetic microorganism capable of synthesizing fermentable sugars. Some embodiments harness and con trol the natural phenomena of osmo- and manic water protection for the generation of fermentation feedstocks, in one embodiment, synthesis of fermentable sugars Is inducible. In another embodiment, synthesis oi fermentable sugars can be modified by genetic manipulation to he produced eomtitutively.

[02001 Fermentable sugar-producing photosynthetic microorganisms are preferably cyanobacteria. In some embodiments, a cyanobacterium accumulates a disaecharide according to inducible endogenous pathways. In some embodiments, a transgenic cyanobacterium accumulates a disaecharide according to engineered exogenous pathways. Both endogenous and exogenous pathways are discussed in further detail above.

[0.20X3 Preferably, the transgenic photosynthetic microorganisms are one or more of those discussed above.

[02023 Two nondkoUing examples of strains of cyanobacteria capable of accumulating a .disaccharide are Synechococcos etongatus PCC 7942 and Syncchdcystis sp. PCC 6803 . Naturally occurring Synechococcus elongates PCC 7942 synthesizes sucrose upon exposure to salt concentrations of up to about 700 tnM*..its tolerance.limit When glucosyiglyeeml biosynthesis is blocked by deletion of &amp;e agp gene, Synechocystis sp. PCC 6803 produces sucrose as its osmoproieciani upon exposure to salt concentrations up to its tolerance limit which may approach 900 mM. In some embodiments, salt induction can be accomplished by introducing aerosoltoed saline solution applied directly to the cultivation surface. One advantage of this process is. application can be cotorollahly introduced along the growing surface depending on growth time of the cults war thereby balancing accumulation of biomass and production of a disaccharide such as sucrose.

[02033 For producing fennentahle sugars, the photosynthetie microorgaiusms can be cultured and grown on a solid medium or in a liquid or gel medium. Culture and growth of photosynthetie nhcroorgauisms are well known ί» the art. Except as otherwise noted herein, tbereidre, culture and growth: of photosynthetie microorganisms can be carried out in accordance with such known processes. For example, a framsgsnic cyanobacteria engineered to accumulate· a disaccharide can be cultured and grown in a liquid medium. The accumulated sugar can be isolated from such liquid medium if 'excreted from the ceil. The accumulated sugar can be isolated horn photosynthetie microorganisms harvested from, the liquid medium. In one embodiment, a .transgenic cyanobacteria engineered to accumulate trehalose, as discussed above, is cultured and grown in a liquid medium. Trehalose secreted from the transgenic cyanobacteria can be Isolated directly .from the liquid medium, to one embodiment, a transgenic cyanobacteria engineered to accumulate sucrose, as discussed above, Is cultured and grown in a liquid medium. Sucrose can be isolated directly from engineered eyanobactria harvested from the liquid medium. In one embodiment, a transgenic cyanobacteria engineered to accumulate and secrete sucrose, as discussed above, is cultured and grown in a liquid medium. Sucrose secreted from the transgenic cyanobacteria can be isolated directly from the liquid medium, [ 0 2 δ 4 ] Preferably, photosynthetie microorganisms are cultivated to a relatively high cell density of at least about 50 grams of dry biomass per liter equivalent prior to induction.

Such relatively high cell densi ties can be achieved using a solid phase photobioroaetoiyas described herein. Disaceharide (e.g„ sucrose) production can then be imikied/indueed by treating the accumulated biomass with defined concentrations of-suitable salt compounds effective at altering the activity of water in fee culture media as measured by solution conductivity. In a further preferred embodiment, sodium chloride is fee salt used. Following an appropriate response time period {e,g,, at least about 1 hour to no greater than about 48 hours), fee Sucrose laden cells can be. harvested and processed to isolate and recover the sucrose produced. Typically, an appropriate response period is within the. range of at least about 5 hours to no greater than about 24 hours. More typically, the appropriate response period is within the range of at least about 10 hours to no greater than about 20 hours.

[02051 In one embodiment, the majority of disaccharide (e ,g., sucrose, trehalose, giucosylglycerol, mannosylfeoctose) synthesized accumulates within fee cells. In another embodiment, the disaecharide is secreted by fee cells which can then be recovered from the photobibreactor. Regardless of whether fee disaoefaari de is within the cells or secreted, fee disaccharide can be obtained using any appropriate harvesting process including, but not limited to, an aqueous spray wash applied to fee cultivation Surface, The wash comprising cells author disaecharide can be collected and processed to isolate and recover fee disaecharide. £02063 Having described the invention In detail, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing fee scope of the invention defined in fee appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples.

EXAMPLES

[020?I The following non-limiting examples are provided to further illustrate the present invention, it should be apprec iated by those of skill in fee art that the techniques disclosed in fee examples that follo w represent approaches fee inventors have found function well in the practice of fee invention, and thus can be considered to constitute examples of modes for its practice. However, those of skill in fee art should, in light of the present disclosure, appreciate feat many changes can be made in the specific embodiments feat arc disclosed and still obtain a like or similar result without departing from fee spiri t and scope of the invention.

Example 1; Sou»Phase Fhotomobeactor [0208] A static prototype device was constructed composed of a 2 mil polyethylene harrier layer with a Zipfoc® resealable closure. A 60 sq. cm breathable panel was incorporated into one surface, and a 225 sq. cm woven cotton fabric culti vation support surface was placed inside. The device was sterilized by treatment with 70% volume aqueous ethanol followed by drying of the device at SCriC with a stream of sterile filtered air. 30 ml of sterile BG-ll culture media was absorbed onto the cultivation support followed by inoculation of the growing surface with a pre-culture of Syneehococcus elongates PCG 7942. using an aerosol applicator. The preculture· was grown in BG~11 media at 26°0 for 2 days prior to inoculation. The photobioreactor wus placed in an .incubation chamber maintained at 33°C and illuminated at 300 mieroeinsteins with cool white fluorescent lamps. After 2 days, the reactor displayed active growth of organisms and was allowed to continue growth for an additional 2 days whereupon the reactor was removed front the incubator and the growth .surface washed· with· deionized water. The water was removed by" evaporation, to afford 254 mg dry weight biomass.

Example 2: PmBmmoNOFSm:sosEB¥PmmsmTHEncMf€R00RGA^jSMS 102093 The following is a prophetic example to illustrate a method for production of sucrose by phoiosynihetic microorganism in combination with a pho tobioreactor. At least one photobioreactor, for example a phoiobioreaeior of the current invention such as described in Example 1 or Example 3, may be run'· for approximately 4-7 days with either Synechoeysris sp, PCC6803. or engineered Synechocystis sp. at a temperature range o'f between about 15 and 40°C, under illumination of between about 60 and 300 mieroeinstems, and carbon dioxide concentration of between about 0.2 and 15 volume%. Following the initial cultivation period the growth surface may be treated with an aqueous salt solution in the concentration range of between about 0,01 and 1.5 M, more preferably between about 0,2 and 0.9 M, using an aerosol spray. The cultivation may be allowed to continue for approximately an additional one to two days to allow sucrose production. The growth surface may then be harvested by washing the surface with deionized water. In a-further embodiment the wash water is sterile fresh cultivation media and the washing stringency is such that between about 70 and 90% of the cell mass is collected. The biomass remaining on the cultivation support may then be allowed to continue growth as a subsequen t cycle, It is anticipated that the yield for these cultivations should be between about 200 and 600 mg dry biomass depending on the growth surface material and organism employ ed,

Exampm 3: Solid Cuim'ATMN Support Coated with ax Absorbent Polymer £0210] The growth surface of a static pfaotobioteactor of the type described in Example I was pre pared by di p coating the sterile dry surface of the materia! with a heated solution of sterile 3,5 weight percent agar dispersed in BG- ί 1 culture media. The coated gro wth surface was allowed to cool and harden upon which the surface was inserted into a sterilized protective barrier to form a photobioreactor device and inoculated with Syncchococcus sp, growai in preculturc as described in Example |. Cultivation and harvesting were performed essentially as described in Example 1.

Examples ASFgexetarget £02113 Biosynthesis of sucrose in cyanobacteria was explored through modulation of sucrose phosphate synthase (sps) and sucrose phosphate phosphatase (spp) activities. Such activities ate already present in many cyanobacteria for acclimation to osmotic ami matric water stress (seu e.g.lLunm J, E, 2002, Plant Physiol 128, 1490-1500), 102123 Lurm* J. E, (2002, Plant Physiol 128,1490-1500) analyzed tire genomic organization of the sps mtispp genes of several organisms, including Syttechocystis spp. PCC 6803 and Symchocoecus elongates KG' 7942, Lunn proposed that the sucrose phosphate synthase (SPS) of Syneckocystis spp, PCC 6803 (SEQ ID NO: 3) has an inactive sucrose phosphate phosphatase (SPP4ifce) domain and a distinct SPP activity. The SPP-like domain has a high level of identity with the spp, but is missing many of the conserved active site residues of the haloacid dehalogenase (MAD) superfamily, While no work has yet been done on Syneehococctis elongates PCC 7942, Lunn proposed that both activities are contained within a single enzyme. An alignment of these enzymes is shown in FIG, 5, £02133 Searches of the- Synechocpccus elongates- PCC 7942 genome did not reveal a distinct sps gene elsewhere on the chromosome. The.Synechociiceus elongates PCC 7942 enzyme (SEQ ID NO: 2) was utilized so as to avoid the necessity of muStiple gene expression. the gene from PCC 7942 has been teemed -sps, because it is a single enzyme fusion bearing both SPS and SPP activities, it was termed as/for active SPS/SPP fusion (SEQ ID NO: 1) (see below for further information on the possible expression of a distinct SPP enzyme.) C0214J There are two approaches to expressing ih&amp; Symehoeecem 'elongams PCC 7942 asfgme product (SEQ ID NO: 2). 10 2IS 3 The first approach is a plasmid-based expression system built open the broad host range vector pMMB67BH (Fnrste, l P., Pansegmu, W,s Frank, R„ Blocker, H.s Scfeolz, P., Bagdasaiian, M. and Lanka, E. 1986, Gene 48,119-131). PlasmidpMMB6?EH is a derivative of RSF1Q1Q, which replicates in most Gram-negative and even some Gram-positive organisms, thus allowing tor plasmid-based analysis of sucrose production in E. coii, Synecfi&amp;cyMis s$p. PCC 6803, Symckococcm eiongaius PCC 7942 and a variety of other cyanobacteria (Kreps, S., ferine, F.s Mosrin, G>, -Gents, J., Mergeay, M, and Thuriaux, P. 1990. Mol Gen Genet 221, 129133; Marraccini, P.5 Bulteau, $., Cassier-Chauvat, C., Mermet-Bouvier, P, and Chauvat, F. 1993. Plant Molecular Biology 23,905-909; Gormley, F, P. and Davies, 3,1991. J Bacteriology 173, 6705-8).

[02163 The second approach is stable integration into the chromosome of SyneehoirssiL·' spp. PCC 6803 and Synechecoecus ebngatus-PCC 7942 at.the upp (uracil phosphonbosyitransferase) locus. The upp locus was chosen for reasons described below.

Example S: Pi^smm-bmm&amp;Expsession 102173 Two plasmids were designed for plasmid-based expression of the as/gene product, pLybALl 1 fee e.g., FIG, 6; SEQ ID NO; 19) and pLybAL12 Qee c.g., FIG. 7; SEQ I'D NO; 2()), Plasmid pLybALI 2 was constructed for expression from predetermined promoters and pLybAFl 1 was constructed for expression from promoters selected at random., [02183 Both plasmids were constructed as follows. The u.yfgene from SjmeBhomccus elongates PCC 7942 was amplified by PCRwith the oligonucleotides 5 '-AGACTAGMTTSqGSCGTTTTCTGTGAO-?' (the ipi restriction endonuclease site is nucleotide positions 7-12) (S EQ ID NO; 7) and 5 - CTTACGTGCCGATCAACGTCTCATTCTGAAAAGGTTAAGCGATCGCCTC~3' (SEQ ID NO: 8) using whole cells as the template, yielding the product of SEQ ID NO: 1. £02191 The gene encoding for chloramphenicol aeeiytransferase (cat), both with and without the upstream-promoter, was amplified from pBeioBACI 1 (GenBank Accession U51113). £02203 The eat gene lacking the promoter was amplified from pBeioBACI 1 by PCR With the oligonucleotides 5'- TTATCX7CGATCG1XG\GGAGCTAAGGAAGCTAAAATGGAG~3' (SEQ ID NO: 9) and 5'-CGACCAATTCACGTGTTTGACAGd'TATC-3' (SEQ ID NO: 10} (the Pwtl and PmiI restriction endonuclease sites are at nucleotide positions 4-9 and 10-15, respectively) to yield the product of SEQ ID HQ : I I.

[02213 The cat gene hearing the promoter was amplified from pBeioBACI I by PGR with the oligonucleotides 5 ' -1GTTTGGCGATCGTGRGACGTTGATCGGCACGTAAG-3' (SEQ ID NO: 12) and 5 '-CGACCRATTCACGTGTTTGAGAGCTTATC-3' (SEQ ID NO: 13) (the Ρνύϊ and Pmll restriction endonuclease sites are at nucleotide positions 7-12 and 10-15, respectively) to yield the product of SEQ ID NO: 14.

[022 23 The PCR products hearing the cut genewere digested with.PvUl and the ends blunted with T4 DNA polymerase. They were then individually ligated to the asfPCli product The resultant psOducts were purified by agarose gel electrophoresis, digested with Iceland.Pmft and then ligated with T4 DNA ligase to the 6.6- Rhp product of pMMB67 EH digested with EcoRl and Hpah The ligation products were transformed into chemically competent NBBSn (New England Biolabs; Ipswich, MA) and. selected for at 37°C on LB agar supplemented with !00pg/rai ampicillin. Selected candidates were grow at 37s€ in LB supplemented with 1 OOpg/ml ampicillin for miniprep, analyzed by resirictioo endonuclease digest and then verified by sequence analysis with tee oligonucleotides 5'-GCTTCrGCGTTCTGATTTAATCTGTATCAG-3' (SEQ ID HO: 15), 5'-TATCACTTATTCAGGCGTAGCAAGCAG-3'{SBQ ID NO: 16), 5'-GTCGTTAGTGACATCGACAACACACTG--3' (SEQ ID NO: 17). and 5'- GATCGCGATACTGATCGAGATAGGTC-3' (SEQ ID NO: IE). Candidate number 5 of pLybALI 1 (pLybALl 1-5) (SEQ ID NO: 19) and Candidate number j of pLybA.L12 (pLybAL 12-1) (SEQ ID NO: 20) were chosen for further study.

[02233 Based upon plasmid yield dating minipreps, it appears that the copy number of these plasmids is greatly reduced when propagated in the £. coli strain NEB Turbo (New England Biolabs; Ipswich, M A), suggesting the importance in choice of host strain for those plasmids.

Example 6: Promote# Insertion £ 02243 Six promoters were chosen for insertion into pLybAL 12-5, The presumed promoter for Synechoeystis spp. PCC 6803 carB encoding carbamoyl phosphate synthase,* which is likely to he immediately upstream of the gene pyrk where they would be ^-transcribed as an operon, was chosen because it is likely to be strong due to its role in both pyrimidine and arginine biosynthesis. The nitrate reductase (nirA) promoters from bo^^ynechocystis spp. PCC 6803 (Aichi, M, Takatani, N, and Qmata, T, 2001, J Bacteriol. 183,5840-584?) and Synechococcus elongates PCC 7942 (Maeda, S~I. et al, 1998, J Bacteriol ISO, 4080-4088) were chosen for their ability to be regulated by the source of nitrogen. The strong light-phase promoter for the photosystem IID1 protein (pshAlf) from Synecko&amp;occw elongates PCC 7942 (Golden, S. S., Brusslan, J, and Haselfcom, R. 19S6,BMB0 Journal 5,2789-2798) and two dark-phase promoters from Synechoeystis spp. PCC 6803 {4naK (AoM, S„ Rondo, T. and Ishiura M. 1995. J Bacteriol 177,5606-1 i) and kaiA (Kueho, K-l et al. 2005. J Bacteriol 187,2190-2199)1 were also selected as regulated cyanobacteria! derived promoters. Lastly, the temperature-regulated promoter, which has been shown to be active in cyanobacteria, was chosen (Eerino, F, and Chauvat, F, 1989, Gene 84,257-66; Mermet-Bouvier, P, and Chauvat, F. 1994, Current Microbiology 28, 145-148). 10 22 5 3 The following oligonucleotides were used to amplify the promoters by PCR using whole cells as foe template, yielding foe products shown. The restriction endonuclease sites incorporated for closing am provided in the sequence.

[02263 Syneehoeystis spp, PCC 6803 pyrR (SpHlMpriS) (SBQ ID NO: 23) was amplified from whole cells by PCR with the oligonucleotides 5 CGGTGTGCAlTlCCGTTATfGATGGAATG-3 · (SEQ ID MG: 21) and 5'- TCACTAG0TMi^AAAll'ACCTGC.KiAAGCCAG-3 ' (SEQ ID NO; 22), having restriction: ehdomieleak; sites at micleotide positions 7-12 for both. £0227] Synechocystia spp' PCC 6E03 nirA (SpM/Rpal) (SEQ ID NO; .26).was amplified from whole cells by PCR with the oligonucleotides 5 -CCCAAGGCATGCA0Ct^AAACAAGGTCAGAATGCTG4 ' (SEQ ID NO; 24) and 5'* having restriction endonuclease sites at nucleotide positions 7-:12 for both.

[02283 Synechocacem elongates-PCC. 7942pshAU(Sphl/£pnl)(SEQ ID NO: 29) was amplified from whole cells by PGR with the oligonucleotides 5'-ATGTTTGCGTTCCGTGAGGGCTACTG-3" (SEQ ID NO; 27).and 5'-GGAGATGGTACQGGTCAGCAGAGTG-3' (having restriction endonuclease sites at nucleotide positions 7-12) (SEQ ID NO ; 28). £0229 ] Symchococcus elongates PCC 7942 nirA (SpHi/Κρηί) (SEQ ID NO; 32) was amplified from whole cells by PCR with the oligonucleotides 5'-CAGCCAGCAIGCATAAATTTCTGTTlTGACCAAACCATCC-3 ' (SEQ ID NO: 30) and..5 GTGGCTGGTACXATGGATTCATCTGCCTACAAAG-3'(SEQ ID NO. 31h having restriction endonuclease sites at nucleotide positions 7-12 for both.

[02303 Xi^(XbaVlQml) (SEQ ID NO: 35) was amplified fiom. whole ceils by PCR wdth foe oligonucleotides 5'-GTGGAITCTAGATCjGCT'ACGAGGGCAGACAGTAAG-3r (SEQ ID NO; 33) and 5'- TTCTGTGGXACCATATGfjATCCTCCTTCTrAAGATGC AACC1ATFATCACC-3' (SEQ ID NO; 34), having restriction endonuclease sites at nucleotide positiotis 7-12 for both.

[0231] Symckocystis spp. PCG 6803 dmK (SphUKpnl) (SEQ ID NO: 3$) was amplified from whole cells by PCR with the oligonucleotides 5 G €C CC AGC ATGC A CCA GTA A AC A T AA ATCTC-3' (SEQ ID NO: 36) and5'-ATrGGTGGTAC^GAGG'rCAi‘lTCCX'AACAAC-3' (SEQ ID NO; 37), having restriction endonuclease sites at nucleotide positions 7-12 for 'both.

[0232] Sjmechoc^iis ipp. ID N0:41) was amplified fitsm whole cells by PCR with the oligonucleotides 5'- GCCAGAGCAl^AAA.GC:TCACTAACl'CiG-3 ' (SEQ SB NO: 39) and 5 GGAAAAGG, IACCTGAGTC1 ATQGQCAACGTG-3' (SEQ ID MO: 40), having restriction endonuclease sites at nucleotide positions 7-12 for both. E02 3 3 J After amplification, the PGR products were digested with the restriction endonucleases shown above, gel purified, and ligated into similarly digested pLybALl 2-1 to yield plasmids pLybAL 15 (SEQ ID NO: 44), pLybALlfi (SEQ ID NO: 45), pLybAL! ? (SEQ ID NO: 46% pLybAL! 8 (SEQ ID NO: 47), pLybALl 9 (SEQ ID NO: 48), pLybAL21 (SEQ ID NO: 49), and pLybAL2I (SEQ ID NO: 50), respectively. The ligation products were transformed into eleefioeompetent NEB5«; (New England Biolabs; Ipswich, MA) and selected for at 30QC on LB agar supplemented with 100pg/nd ampiciflin, 34 pghnt chloramphenicol, and 5% sucrose. Seleetcd candidates were grown at 30eC in LB supplemented with lOQpg/ml ampieiilim 34 p.g/ml chloramphenicol and 5% sucrose for mintprep, analyzed by restriction endonuclease digest, and then verified by sequence analysts with the oligonucleotides GCTTCTGCGTTCTGATTTAArCTGTATCAG-J' (SEQ ID NO; 42) and 5'-AT©3GTCTGAATGTGG&amp;GAATGTAGftG-3' (SEQ ID NO; 43). Candidates 6 and 7 (pLybALl 5-6 and pLybALiS-7), 2 (pLybAI,16-2), 4 and 5 (pLybAL 17-4 and pLybAL 17-5), 1 and 2 (pEybAL:18-1 and pLybALl 8-2), 1 and 2 (pLybAL 19-1 and pLybAL19-2), 3 and 5 (pLybAL21-3 and pLyb AL2I-S) and 4 and 8 {pLybAL22-4 and pLybAL22~8) w?ere chosen for plasmids pLyhALIS (SEQ ID NO: 44), pLybAL 16 (SEQ ID NO; 45), pLybALl? (SEQ ID NO: 46), pLybALl 8 (SEQ ID NO; 47), pLybAL 19 (SEQ ID NO: 48), pLybAL21 (SEQ ID NO: 49), and pLybAL21 (SEQ ID NO: 50), respectively.

[02343 Selection and growth of these plasmids on LB supplemented with sucrose and •both antibiotics-was essential to obtaining clones. Selection was originally conducted on LB supplemented with ampiciilin alone, but plasmids containing a promoter could not be isolated. Isolates were either re-ligation of the vector alone or of varying size and lacking die ability to be propagated in the presence ehloramphexdcol, It is thought that internal sucrose was being produced, creating an osmotic shock for the cells that leads to deletions preventing sucrose production. Subsequent experiments indicated that, once isolated, the plasmids may he stable in the absence of sucrose, possibly through the eventual induction of osmotic stress machinery and/or sucrose consumption enzymes. T8Aj^FmmnmoFSrNEcmc¥STis4NBSyNEcm>c&amp;ccm £02353 Thepromoter-containing plasmids, pLybALl5 (SEQ ID NO; 44% pfybAL16 (SEQ ID NO; 45), pLybALl? (SEQ ID NO: 46), pLybALl 8 (SEQ ID NO: 47), pLybAL19 (SEQ ID NO: 48), pLybALzl (SEQ ID NO: 49), and pLyhAL21 (SEQ ID NO: 50), as well as til® pitJiaoterless pLybAL 12-1 vector (SEQ ID NO: 20) (see Examples. 5-6), were placed into both Syneehmystis spp, PCC 6803 and S^mckiCoccusei&amp;n^atm fCC: 7942' by trlparehtal conjugation, performed consistent with Eihag l and Wolk, CP. 1988, Methods in Insymology 167,747-754, unless indicated oiherewise. £02 3S3 Overnight cultures of the cargo strains (NEB5a bearing the plasmids to be transferred), as well as an overnight culture of HBI01 bearing the helper plasmid pKK20B (ATGC 37159) grown at 30°C were pelleted by centrifugation, washed twice with LB and then resuspended in LB in one-tenth the original Volume, Each cyanobacterium was grown at 30°C in BG11-A, which, is the same as BG11 except the trace elements have been replaced with Nitsch’s trace elements (Nitsch, J. P. and Nitsch, €. 1956. American Journal of Botany 43, 839-851) under constant illumination to an OD?® of approximately 0.5, The cells were pelleted by" centrifugation, washed twice with BG11 -A, and resuspended in BG.11-A with a 7.5-fold increase in concentration. A series of 10-fold dilutions of die cyanobacteria in BG11-A were prepared down to ICT’. At each dilution, 100 μί of the cyanobacterium was' combined with 50 p.1 each of the cargo and helper strains of E, coll 150 μΐ of each mixture was then plated onto BG11- A: agar (1.5¾) plates supplemented with 5% LB, The plates were incubated at 26-28“€ under constant illumination for 16 to 24 hours. The agar (app. 30 oil) on each plate was lifted and 300 μί of a Ϊ00Χ chloramphenicol solution was added. The final concentration of chloramphenicol was 25 pg/ffii for Syneehmystis spp. ICC 6803 and 7.5 p.g/ml for Synechmoccm elongates PCC 7942. Incubation continued for 8-12 days. Individual colonies of transcoUjngants were purified, away from contaminating A. call by restreafcing onto BG11-A supplemented with the appropriate amount of chloramphenkot to, again, obtain isolated colonies. EXAMPLES: PitOMm£RlmRAMYMPlmAliI~5 £0237 3 The following example describes consouetion of a library of cyanobacteria! DMA for promoter selection using pLybALl 1-5 (SEQ ID NO: 10) (see Example 5), A modified, scaled up wrsion of foe etamosomai DNA isol ation protocol of Wilson, R. (1997 . Preparati on of Genomic DNAfrorn Bacteria, In Current Protocols in Molecular Biology, Joint Wiley and Sons VoL I, pp, 2,4.1-2,4.5) was employed, where foe primary differences were much longer incubation times and the replacement of SOS with SarkosyL The DMA isolated was of sufficient quality for partial Sau3M digest for insertion: into foe site of pLybALl 1 -5. As shown in. FIG. 8, some of the fragments 'would, have promoters and others would not £0238 3 During foe process of library construction, a jxxssible promoter within the off gene was discovered. To fonction as a promoter cloning vector, plasmid pLybALl 1-5 (SEQ ID NO: 19) is supposed to only be resistant to eWoramphenicoI when a promoter has been inserted in frontof foe osfgene, as the marker lacks its normal promoter and the promoter upstream of asf was not included. Once constructed, however, foe chloramphenicol resistance conferred by this plasmid was examined in E. eoli. When KEBSa bearing pLybAL 11-5 was cultured on LB agar (1,5%) supplemented, with 34 Jig/ml chloramphenicol at 3?°C, growth was observed. When cultured in liquid LB medium supplemented with 34 jxg/ml chloramphenicol, however, little-to-no growth was observed. NEB$a bearing pLybAL12~l (SEQ ID NO: 20) grows in the presence of chloramphenicol on both solid and in liquid LB medium. 10239 3 To verify there was- no missed promoter upstream of the asf gene but downstream of foe transcriptionlemjhmtors, the insert placed into pMMB67EH to make pLybAl. 1 > was cloned into Lucigen Corp.Y(Middleton, Wl) pSMART-LCKan blunt-end cloning vector using Lncigen’s CloneSmart kit with foe Lucigen strain of ,£ colt (£, eloni I0G) competent cells (see e,g., FIG, 9), Because it was blunt-ended cloning, the inserts could ligate to foe plasmid in either direction to create pLybALl 3f (SEQ ID NO: 51) and pLyAL13r (SEQ ID NO: 52), This vector is specifically designed to eliminate transcription read through from foe vector by surrounding the cloning site with terminators. As a control, the insert used to construct pLybAL12 was also placed into this vector, creating pLybALldf (SEQ ID NO: 53) and pLybALl4r (SEQ ID NO: 54). The plasmids looked to be the appropriate size on an agarose gel but inserts wore, not verified by DNA sequencing to confirm the integrity of the clones. Similar results, however, were seen for Ae&amp;mlOG bearing pLyhAJLD and pLybAU4 (with the cloned DNA ligated in either .direction f or r) as were seen forNEBSa hearing pLybALl 1 (SEQ ID NO·: .19) and pl,yhALi2 (SEQ ID NO: 20}, respectively; This indicates that the activity of this promoter is weak in £ caii. E0240J Many E. cob promoters do not function in cyanobacteria, and vice versa, it is possible that this promoter acti vity would not be observed in Symckocystis spp. PCC 6803 or Synechoeoccm elongates PCC 7942. To check this, pLybALl 1 -5 (SEQ ID NO: 19} was inserted into both organisms by conjugation, as described above. On BG11-A agar (! .5%> supplemented with chloramphenicol (25 pg/ml and 7,5 μ^ί for Synechoeystis spp. PCC 6803 sndSyneehocoaw elongates PCC 7942, respectively), growth,was observed. E0241J Growth ofthese organisms bearing pLyhALl 1-5 (SEQ ID NO: 19} on liquid BG1 l-A supplemented with chloramphenicol was examined. Jt is possible that this activity is very weak and is only observable when present on a multipte-eopy plasmid. This may be the case with. E. coli, out is not likely with the cyanobacteria, RSFIOJO is &amp; relatively low-copy, plasmid, having only 12 copies .in E. cob' (Frey, J.s Bagdasarian, Μ. M. and Bagdasarian, M. 1992), ¢¢^113,101-106). £ coll undergoing: rapid division has at most 2 copies-of its chromosome, thus at least a 6-fold increase in copy number, A comparable copy number in cyanobacteria for this plasmid is likely. The chromosomal copy numbers of fynechocystts 'spp. PCC 6803 and Synechococeus eiong&amp;tus PCC 7942 ot .10-12 and 16, respectively, are similar tXnhame, 3., Chauvai, F. andThuriaux, P. 1989. J Bacteriol 171,3449-57), The results above suggest the presence of a promoter within the as/gene of cyanobacteria, [02421 FIG. 10 shows a possible location of a promoter (or promoters) within the mf gene. Transcription initiation elements have been described by Curtis, S. E, [1994. The transcription apparatus and the regulation of transcription initiation. /« The Molecular Biology of Cyanobacteria. Bryant, D, A. (ed). Kluwer Academic Publishers pp. 613499], Translation initiation elements have been defined by Smsuka, T, and Ohara, O. (1996, DNA Research 3,225232), [02433 Based upon alignment to known SFS enzymes and the presence of a stop codon only two' codons upstream, the translation initiation of the as/gene is predicted to start at a OTG start codon. While ATG start codons are the most common, GTG and TTG are less common, hot not rare. A typical K coli-like Shine-Delgamo sequence (GGAG or GAGG) complementary the 3 -end of the 16S rRNA for which the adenine nucleotide is optimally 9-12 bp away from fee first nucleo tide of the start codon is also present, except wife somewhat longer spacing. This sequence is found in about half the genes studied by Sazuka and Ohara. Less optimal spacing is not uncommon, but often leads to reduced levels of expression. There is too little sequence upstream of the Shiuc-Detgarno sequence but downstream of the Mfei s ite to incorporate a promoter. It is possible feat a partial promoter may: be incorporated, but fee rest of fee .promoter would have to produced by the vector sequence of all feree plasmids (pLybALl 1-5 (SEQ ID NO: 19); pLybALBf (SEQ ID NO: 51); and pLyfeALI 3r (SEQ ID NO; 52», which is improbable. £.92443 Thus it likely that fee promoter activity is located within the urt'gene. If fee promoter is within the arfgene, one potential position is in front of the SPP domain of otyi This would give fee sucrose biosynthetic enzymes of Syneckocmms elongatm PCC 7942 a similar quaternary structure to those from Symchm^Ms spp, PCC 6803. Each organism would have two proteins, an SPS domain wife a transktionally fused SPP or SFP-Iike domain and a distinct SPP that, may (or may not) interact with each other. £ 924 5 3 First, it was determined whether the SPP domain of fer/'could even be translated separately . As can be seen in FIG. 10 and Table 1, there is a TI G start codon immediately upstream of fee SPP domain that is preceded by a Shine-Delgatno sequence.

Table 1: Nucleotides immediately surrounding the proposed spp start codon. The nucleotides immediately surrounding the proposed spp start codon are compared to the consensus of 72 cyanobacteria! genes. Nucleotides matching fee consensus are italicized, whereas nucleotides that do not match the consensus are underlined. Nucleotide numbers are relative to the first nucleotide of the start codon. «Tt -10 -9 -8 -? -6 -5 -3 -3 -2 -1 123 4 58

Consensus A/G A/G. A/T A/T A/T A/T A/T A/T C/T T/C AfQ. A/Q C G/T

SelQ7 942 asf T G A C T A Q £ G C GTG G C A

Sel.o? 94 2 spp T 0 G C A A A C G C TTG A T T t Ο 2.4 63 The region surrounding the start codon matches the consensus determined by Sazaka and Ohara for 72 cyanobacteria! genes almost as well as the native start codon. While determining cyanobacteria! promoters based, upon rules established for £. coti promoters, the typical -35 and -10 elements were searched for since the promoter does appear to he active in A. coli. Two possible promoters were identified, as seen in FIG. 10, There remains the possibility of an additional promoters) elsewhere in asf.

Example 9: Transfer of plasmids fkom E, coli to cyanobacteria [02473 Conjugation was used for transfer of the p.MMB67EH-hased plasmids into cyanobacteria» Protocols exist for the tansfoxmation of these organisms (Zang, X., Lin, B„ Liu, $., Arueakuruara, hL K. 1, U. and Zhang, X, '2007. Journal of Microbiology 45,241-245; Golden, S . S, and Sherman, L. A. 1984. Journal of Bacteriology 158,36-42), but such approaches were unsuccessful for placing these plasmids Into Symchocystis spp. PCC 6803 and Symckococcm eUm$atus-PCC 7942 using natural transformation. 102483 The presence of the plasmids in the cyanobacteria was verified Transconjugants were analyzed for the presence of plasmid by PCR of tire asfeat gene armbination with the oligonucleotides 5 '~AGACT AC.AATTGGGGCGTTTTCTGTG AG-3f (SEQ ID NO; 7) and 5-GGTGGTTGTGTTTGaCAGCTTATC-3' (SEQ ID NO; 55), yielding a 3.1 kb product, in addition, plasmids were isolated and analyzed. CMinres of cells grown in BG11 -A supplemented with chloramphenicol (at the concentrations described above) are pelleted by centrifugation, resuspended in TE, heat-treated and minlprepped by the Promega Wizard SV Plus miniprep kit But with poor, yield, direct plasmid analysis is difficult, As such, the isolated DNA is transformed into Ε» coii Ν1Β5α, re-isolated using the Promega Wizard SV Plus miniprep kit, and then subjected to restrieiion endonuclease analysis.

Example m SummEpmotfcrioN assay and analysis 102493 Synechoeoccus transformed with pLybALl9 or pLybALl? (see Example 7) was assayed for sucrose aecumnlation. Sucrose is measured with BioVision, Inc.’s (Mountain

View, CA) sucrose assay kit.; Assays were run following a 4 Hour induction period '{increased. %bi to 180 microeinsteins from 50 raiemeinsteins for pLybALl?. (SEQ-ID NO; 46) and increased temperature from 26 to 39°C for pLybALl 9 (SEQ ID NO; 48)), Data was corrected for background glucose present in the cells, 10250] Results showed Synechococcus transformed withpLybALI9 (SEQ ID NO; 48) accumulated 0,78 nanomoles of sucrose per mg of dry biomass. Results also showed'that Synecfeoeoccus transformed.with pLybALl? (SEQ ID NO; 46) accumulated 0.95 nanomoles of sucrose per mg of dry biomass, IP 2 51] Further analysis for plasmid-based sucrose production in E: eoli, Symchocysfis spp, PCC 6803, and Synechococcus elongates PCC 7942 was performed. Because bacteria can consume sucrose, detection may be difficult. As such, cells are grown under suppressing conditions and then assayed shortly after induction, The pyrR promoter may he suppressed by growth with uracil and induced by transfer medium lacking uracil, Hie mrA promoters can be suppressed by growth with ammonium ions as the nitrogen source and induced by transfer to medium with nitrate as the nitrogen source. TUepsbAII promoter can be shifted from low light to high light. The dark phase promoters can be shifted from light to dark. And, the km promoter can be shifted from low (25°C) to high (39°C) temperature.

Example lit Expression through Stable Chromosomal-Integration E0252] insertion of sucrose biosynthetic genes can cause a negative impact on cell growth, leading to difficulties in obtaining complete segregation of the 10-16 chromosomes.

With normal selection for an antibiotic resistance marker, having additional copies of the marker does not dramatically impact the cells ability to survive in the presence of antibiotic. Therefore, complete chromosomal segregation can he difficult to achieve using antibiotic selection when faced with:a.negative phenotype.

[0253 ] Deletion of the upp gene (encoding for uracil phosphoribosyltransferase) in most organisms leads to resistance to the otherwise toxic S-fiuorouraciL To obtain complete resistance, all copies of the upp gene must be deleted. Thus integrating into the upp locus of Synechocystis spp. PCC 6803 (SEQ ID MO; 56} and Synechococcm elongates PCC 7942 (SEQ ID NO; 5¾)-will lead to S-fiuorouracil resistance and allow for positive selection of complete segregation, eves in the presence of a negative phenotype.

Example 12: Tm< VTP/KdNxmmv resistance-cassette [02543 A general strategy for genomic manipulation using a upp/km&amp;axjcm resistance cassette is outlined in FIG. 11 . .Deletion of a gene is depicted, but the strategy can easily be modified at the ‘placement” step for insertions and mutations, [02553 An up-p/kanamycin resistance cassette was constructed. The cassette was constructed in Epicentre Biotechnologies CopyControl cloning kit with blunt-end cloning vector pCC l and £ coh* strain EPI30O according to manufacturer protocols. The upp gene Horn Bacillus subtilis 168 was amplified from whole cells using the oligonucleotides S'~ AAGAAGCrtAGACAGCGTGTAGCTGCTCTGACTG-3'(SEQ ID NO; 60} and 5'-TCCCG'GG?vTTTGGTRCCTTATTTTGTTCCAARCATGCGGTCACCCGCATC-3' (having restriction endonuclease sites at.nucleotide positions 2-7 and 32-17) (SEQ R> NO: 61), yielding the product of SEQ ID NO; 62, [0255] The PCRproduct was cloned into pCCl and those bearing the insert were selected for on LB supplemented with chloramphenicol as described In Epicentre Biotechnologies’ protocol. The forward orientation, relative to imZf was screened for by restriction endonuclease digest, yielding pLyhAL7f (SEQ ID NO: 65). The exact sequence of the insert was verified by DN A sequencing with the oligonucleotides 5'-<3TA&amp;TACGACTCACTATAGGGC-3.' (SEQ ID NO: 63) and 5'~ CACACAGGAAACAGCTATGACCAT-3'(SEQ ID NO: 64) tor candidates 3 and 8 (pLybAL7-3 and pLyhAL?~8).

[0257] The fcanamycin resistance marker from the Lybradyn vector pLybAAl [originally derived from pACYCl?? (Rose, R. E, 1988. Nucleic Acids Res. 16, 356] was amplified with the oligonucleotides 5'-GTCAGIXICACI'GCTCTGCCAGTG'ITACAACC-3" (having Τ/λϊΕΙ restriction endonuclease sites at nucleotide positions 5-10) (SEQ ID NO: 66) and 5'A7rCACT^CG€CAAAACTCACGTTAAGGGATTrrGGTC-3' (SEQ ID NO: 67) (baying w /

Narl restriction endanuctease sites at nucleotide positions 7-12), yielding the product of SEQ ID MO: 68.

[02S83 The PCR product was digested with,dpoli and iYsrland ligated into similarly digested pLyhAL?T creating pLybAIJf (S£Q ID NO: 49). The proper plasmid was selected for on TB supplemented with'50 pgfrni neomycin and examined by restriction endonuclease digestion,

Example IS: IfPPmwnm 10255] One strategy to force segregation of chromosomal inserts for the expression of sugars, including sucrose, trehalose, giucosylglyeeroi, and manoosyifmctose, atihzes deletion of ιφρ from the chromosome leadi ng to resistance, to- 5-fiuorouraeiL While this hits been established in many organisms (such as £ mli and B< suMUs), it has not previously been established for cyanobacteria, such as Syneekocystis spp. PCC 6803 and Symchococcm eimgatm PCC 7942.

[02603 Testing showed that growth of each of these organisms was completely inhibited by 3.p'g/ml, S-fiuorouraciL Growth of spp. PCC 6803 is completely inhihhed by 0.5 μ grid, 5-tluoronracil and is sensitive to as little as little as 0.1 pg/ml, 5-fluorouracil, t0'2 613 The upp gens and stuxonnding sequences of both Symchocjmis spp . PCC 6803 was amplified with. the oligonucleotides Sspopp-F (SEQ ID MG: 96) and Sspupp-R (SEQ ID MO: 97). The upp gene and surroundingsequences of Synechmxtccus elongates PCC 7942 was- amplified with the oligonucleotides Seloupp-F (SEQ ID MO: 538) and Scloupp-R (SEQ ID NO: 99). The PCR products (upp of Symohocysth spp. PCC 6803, SEQ ID NO: 100; upp of Synechoeoccus elongates- PCC 7942, SEQ ID NO: 101) were then cloned into the Epicentre Biotechnologies* (Madison, WI) blunt cloning vector pCC'I, as per the manufacturer’s instructions..

[02623 While the PCR product (SEQ ID NO; 100 or SEQ ID MO: 101) can ligate into pC(, 1 m either direction, the forward orientation relative to'the /00 promoter was chosen, generating pLybAL3f (SEQ ID NO: 102) (containing upp of Synechocystis spp. .PCC 6803) and pLybALSf(SEQ ID MO; 103) (containing upp of: Synechococcm eiong&amp;tus FCG 7942), respectively. The inserts were sequenced using oligonucleotides T7loag (SEQ ID NO: 104) and Ml Brev (SEQ ID NO; 105), Thenucleotide sequence of upp of Symckwystis $p$. POC 6803 is represented by SEQ ID NO: 111 and the polypeptide sequence by SEQ ID NO: 112. The nucleotide sequence of upp of Symch^occm ehngaitis KC 7942 is represented by SEQ ID NO: 113 and the polypeptide sequence by SEQ ID NO: 114. C0'26.33 Plasmid pLybALdf (SEQ ID NO: 106) was created from pfrybALlf (SEQ ID NO: 102) by removal of the Blpl andOpuLi fragment, blunt ending .with T4 DNA polymerase and then recircularizing with T4 DNA ligase. Part of the Syneckwystis spp. POC 6803 upp gene was then deleted by digesting pEybAL4f with Ayrft and Sgfls blunt ending withT4 DNA polymeraseand then recircularimngwith ·Τ4 DNA ligase, creating pLybALOf (SEQ ID NO; 107). The Sscl'Sphl fragment (SEQ ID NO: 108) bearing the cyanobacteria! DNA was excised from pLybAL9f (SEQ ID NO: 107) and ligated into similarly digested pARO 180 (sequence not completely known; Parke, D. 1990. Construction of mobilizabte vectors derived from plasmids RE4, pUCiS and pUCI.9. Gene 93:135-137; ATCC 77123), creating pLybAL25. Plasmid pLybALfrfb (SEQ ID NO: 109) was created from pLybAESf by removal of the Supl m&amp;Ajx&amp;l fragment, blunt ending with T4 DNA polymerase and tlten recirculariring with T4 DNA ligase. Part of the Syneckoc&amp;ccus eiongatm PCC 7942 upp gene was then deleted by digesting pLybAL6ft with BssHII and ifed, blunt ending with T4 DNA -polymerase and then recircidarizmg with T4 DNA ligase, creating pLybALlOfb (SEQ ID NO: 1 1Θ). The Sacl/Sphl fragment (SEQ ID NO: 138) bearing the cyanobacteria! DNA was excised from pLybAL 10ft and ligated into similarly digested pAROlSO, cmetiag pLyhAL26. C 02 6 41 Plasmids pLybAL25 and pLybAL26 were placed in £. colt S17-1 (ATCC 47055). Plasmids pLybAE25 and pLybAL26 are to be transferred to Syttechocystis spp. PCC 6803 and Syneeh&amp;coccm elmgams PCC 7942 by biparental conjugation, Since these plasmids do not replicate in cyanobacteria, they should function as suicide vectors and cross over into the chromosome, deleting upp on one of the copies of the chromosome. An optimized protocol will enable speeding of segregation without killing the cells by premature exposure to too much 5~ fluorouracil

BKAMHM14: MOMFICATtm Of'SVCMOSE mOMM TiON ENZYMES

[ 0 2 6 5 3 Cyanobacteria transformed wife as/are farther engineered to improve sucrose production by modulation of sucrose degradation activity . 102661 The inventors have identified genes encoding mvcriase homoiogues in both Symehocystis spp. PCC 6803 (nucleotide sequence SEQ ID NO: 70; polypeptide sequence SEQ ID NO: 71) and Synschococcuselongatus PCC 7942 (nudeotide sequence SEQ ID NO; 72; polypeptide sequence SEQ ID NO: 73), Synechocysirs spp. PCC 6SQ3 also encodes a snwmseferjredoxin-like protein (nudeotide sequence SEQ ID NO: 74; polypeptide sequence SEQ ID NO: 75) (Machray G.C. etal 1994. FEBS Lett 354,123-127).

[0 2671 These genes are deleted using the marker less deletion protocol described in FIG. 11.

Bxamfim IS:: M<mncATtoNOF$vcKWEDBGiuMnwEmnm [02683 Cyanobacteria transformed with as/ are further engineered to promote sucrose secretion, from the cells, [02693 When in a low osmotic environment, the sucrose may be automatically expunged from the cells, as done with osomoprotectants by some organisms when tensitioaing from high to low salt environments (Schleyer, M., Schmidt, R. and Bakfcer, E. P. 1993. Arch Microbiol 360,424-43; Roo, S. P„ Higgins, C. F, and Booth, I. R. 1991. J-Gen-Microbiol 137, 2617-2625: LamarRT., StyrvoM, Ο. B. and Strgim, A. R. 1992. PEMS Microbiol. Lett 96,. 149154), Engineering of cyanobacteria can promote such a process.

[0 27 01 Cyanobacteria transformed with mf are further engineered to express sucrose permease, such a* those used by E. coti and Salmonella m in the transport of sucrose to ni trogen-rixmg cys ts of certain cyanobacteria (Jahreis K, et at 2002, J Bacterid 184,5307--5316;

Cnmino, A. C. 2007. Plant Physiol 143,3 385-97). These genes are cloned and traasfdmied into cyanobacteria according to techniques described above.

Example 16: svcxose Secretion m Cyanobacteria TBanspommed wimPomf [0271] Sucrose secretion from Syn eckocystis spp. PCC 6803 and Synechococcw eJongatus PCC 7942 can be facilitated by'transformation with sucrose -porin.

[0272] The gene encoding sucrose porin (serf)'from Enterobaetersa&amp;izakiiAl'CC BAA-894 was cloned for expression in Sypechocysds spp. PCC 6803 and Syneehocoecm eiongaws PCC 7942, The function of this gene has been inferred from i ts sequence and those of its neighbors. Bnterobacier sakmaM ser f was amplified from chromosomal DNA.by PCR wi th the oligonucleotides EsserYBandii-F (SBQ 33> NO: 88) and EsscrYSaci-R (SEQ ID NO: 89). The PCR product (SEQ ID NO: 90) was digested wife Bamlil and &amp;ml and iigaied into simiiarly digested pLybAL19 and cloned into NEBSe* creating pLyb AES 2 (SEQ ID NO: 91). The ser-Y gene (nucleic acid SEQ ID NO; 94; polypeptide sequence, SEQ ID NO: 95) was then sequenced with the oligonucleotides EsserYmidseq~P (SEQ ID HO: 92) and EsscrYthidseq-R (SEQ ID HO: 93), When infrodticed into the host, this construct allows for fee co-expression of the genes scrY and asf under the control of the temperatnre-inducible promoter. This plasmid was transferred hy tri-parental'conjugation·(as described above) into-Syitechoisysiis-spjJ. PCC 6803. The transformed Symchocystis spp, PCC 6803 is tested for efficacy in the secretion of sucrose. Similar transformation and testing of Syneehococcus ekmgaius PGC 7942 follows.

Example 17; QmEmn&amp;Nor TmmwsE Accumuiajt!ng CfAmBACTBMM

[0273] The trehalose biosynthetic genes encoding trehalose phosphate synthase and trehalose phosphate phosphatase (ptsA and vtsB, respectively) from E. coli arc found in a two gene operon. ntsBA (SEQ ID HQ: 115). The operon was cloned by PCR amplification of E. coli Κ.Ϊ2. genomic DMA with the oligonucleotides EcotsBA-F (SEQ ID NO: .116) and EeotsBA-R: (SEQ ID HO: 117). The PCR product was digested with. AMI and Nhei and was cloned Into pLybAEl 9 (SEQ ID NO: 48), replacing most of the u|fgene. The new plasmid, pLybAL23 (SEQ ID NO; 118), places the trehalose biosynthetic genes under the control of the temperaiure-indneibie Xpr promoter. The genes were sequenced to verify their integrity with' the oligonucleotides EcotsBAmidseq-F (SEQ ID NO: 119) and BeoteBAmidscq-R (SEQ ID NO:

120). Expression of the oisBA operon was then placed under control of ihtpyrR. pshAIC dnaK and kiad. promoters (as described above) by ligating the Afi&amp; (blunt -ended with T4 DHA polymerase)/A«el fragment of. pLybAL23 bearing fhe oisBA operou, iaio pLybALlS, pLvbALI 7, pLybAL2I and pLybAL22 digested with ridel (bJuat-ended with T4 DMA polymerase)'and AM, creating pLybAL2 8 (SEQ ID NO: 121},pLybAL29(SEQ ID.NO:· 122), pLybALBO (SEQ ID NO: 123), andpLybAL3l (SEQ ID NO: 124), respective^.

[02743 Each of plasmids pLyhAL28 (SEQ ID NO: 121), pLyfeAL29 (SEQ ID NO: 122), pLybAL30 (SEQ' ID NO: 123), and pLybA131 (SEQ ID NO: 124) were moved into Symchocystis spp. PCC 6803 by bi-parentai conjugation (as described above), [02751 Expression of the otsBA operou from piyh AL23 was placed under the control of the Symckocystis spp, PGC 6803 and Synechococcus eiongatus PCC 7942 nirA promoters (as described above) in pLybALlb and pLybALlS ia the same way as just described for the other promoters, creating pLybAL36 (SEQ ID MO: 125) andpLybAL37 (SEQ ID NO: 126), respectively.

Examwuz 18: Trimalose Assat E 0 27 6 3 Biomass was separated from the culture·, broth as necessary' by centrifugation and residual biomass was removed from the clarified culture broth by filtration through 0.2 micron filter. The culture broth was: concentrated to a residue by evaporation under reduced pressure. The concentrated culture broth was dissolved in 1 ml of de-ionized water and then 10 roicrolhers of solution was sampled in a trehalose assay. The biomass collected by centrifugation was transferred to a weigh dish and heated to 100 °C to remove residual moisture. The dry bioinass was weighed and then a 100 mg sample was dissolved in 1 ml of de-tonized water. The mixture was then ground and the solids were removed by centrifugation. A 10 microliter sample of the clarified supernatant was diluted 100 fold with dc-ionized water and 10 microliters of the diluted sample were tested for trehalose.

[02773 The assay for trehalose used a modified procedure of a commercially supplied sucrose assay kit available through Biovision, Inc, The modification to fee standard protocol was the substitution of trehaiase for the kit supplied ihvertase enzyme solution. The kit involves the hydrolysis'of trehalose with trehaiase to release glucose. The glucose is oxidized by glucose oxidase to produce hydrogen peroxide which is detected by fee action of peroxidase in the presence of a colored indicator, 1 he colored indicator is quantitatively measured by its characteristic, absorbance at 570nm to afford the concentration of glucose originally .present is the sample. £0278] Trehalase (treA nucleic acid SEQ ID NO: 134 encoding trehalase polypeptide SEQ ID NO; 135) was prepared from the recombinant B. coli treA gene which has been engineered into a plasmid and transformed into an E, coli host by a similar method as described by'Gutierrez C, Ardonrel M, Bremer E, Middendorf A, Boos W, Ehmann U.Mol Gen Genet 1989 )tm;217(2-3):347-54. Periplasmic trehalase was cloned from £. eoti 02, encoded by treA.. The treA PCR product (SEQ ID NO: 127) was digested witiiri/MSM and then ligated into similarly digested pLybCBb,a proprietary plasmid with a consthutiw version of the strong E, c&amp;U trp promoter, creating pEybAL24 (SEQ ID NO: 130). The mtegrity ofthe insert was analyzed by sequencing with tire oligonucleotides EefreAmidseq-F and EctreAmrdseq-R:. 10279] A C-terminai Hi%-tagged ve rsion of the trehalase was- constructed. The gene was amplified by PCR wiili the oligonucleotides EerieA-F2 (SEQ ID NO: 131) and EcrieA-R2 (SEQ ID NO: 132). The PGR. product (SEQ ID NO: 13t>) was rhea digested with AfiWXbal and then ligated into similarly digested pLybAL24, creating pLyhAL33 (SEQ ID NO: 133). £02803 Strong; constitutive expression o f the periplasmtc trehalase is detrimental to the cells, causing a strong growth defect at 37 SC. This can be significantly alleviated by growing the cells at 30T'.

[02813 The protein was expressed in E, coli BW25113 on a plasmid pL YBAL24 (SEQ ID NO: 130) which was/grown in 2xYT media containing kansraycin, The protein, was produced constitutively using the Trp promoter and contains a signal peptide which allows the protein to be transported to the periplasm. Following fermentation and harvesting of the biomass, tire enzyme was purified by selective periplasmic release by treatment of the .washed, and resuspended cel! pellet with 2 % v/v diehloromethane in 50 oiM Tris buffer pH 8. The lysate was separated from cell debris by centrifugation and further processed by concentration using an Amieott ultra filter fitted with a 10,000 Dalton membrane. The concentrated lysate may be used in assays directly or the enzyme can be further purified by metal ion affinity chromatography using the engineered 6X poly histidine tag on the C-terminus of the enzyme (SEQJDNO: 137). :

Example 19: Soim Phase Tsehaiose PMomcrmN £0282] A solid composite fabric covered hydrophilic foam composed of a substrate foam used as a media/moisture reservoir (Poamex Aquazone) was bound to a .fabric layer (DuPont Soatam) used as a growth surface measuring 15 cm by 15 cm. The composi te material was sterilized by soaking in 70% ethanol in water and then hung in a vertical bioreactor plumbed to deliver solutions to the top of die composite material. The solutions were allowed to percolate through the growing composite surface by gravity. Residual ethanol was removed from the sterilized growing surface by passage of 1 liter of sterile de-ionized water Sowing at 0,2 ml/min. The growing surface wfas equiEbrated with culture media by flowing 0.5 liters of BG11A growth medium Containing 10 mierograms/mi cMoramphenicof through tire composite material at Q.2mi/min. £0283] ITte equilibrated, sterile growth surface was inoculated by flooding the surface with 10 ml of a 4 day pre-culture of Synechocystts spp. PCC 6803 transfOmrcd by plasmid pLYBA.L23, Following 30 minute incubation the reactor was turned to a vertical position and the fermentation was begun. The reactor was illuminated with 80 nucroeisteins of light from a white LED array. Temperature was maintained at 28 CC, by a resistive heating device attached to the bioreactor. The reactor was continuously purged with 0.2 micron filtered air at 0.2 LinEi and fresh culture media was supplied by pump and gravity percolation through the foam layer of the growth composite at a rate of 0.2 nd/mln for 30 minutes every 6 hours. The reactor was run continuously for 4-7 days during 'which the growth surface of the composite was. overspread with a dense lawn of cyanobacteria, Foliowing the initial cultivation period the temperature of the bidre&amp;ctar was increased to 40°C and maintained at. this temperature for an additional 24 hours. During the elevated temperature period spent culture broth mas collected and processed for trehalose determination. At the completion of fee fermentation run the biomass was collected by rinsing the -growth surface with de-ionized water which can he processed for trehalose assay. (.0284] The amemni o f trehalose produced,mid' retained in the,biomass grown, on the solid surface' was up to 2,5 wt % of the total dry weight biomass recovered from the hioreactor .following: temperature induction, 0,8 \vt% of the dry biomass equivalent weight of trehalose was recovered from the culture medium: Mi owing temperature induction, F.xampte 20: Trehalose Production Liquid Phase [02S? ] 1 liter of sterile Bid 11A media was prepared in a Biofiow reactor to which Chloramphenicol was added to a concentration of Ί 0 micrograms/ml The-reactor was then inoculated with a 5% by volume. 4 da> pre-culture of Syneehocystis spp. PCC 6803 transformed with plasmid ρί,.ΥΒΛ 1.23. The reactor was run at 28 °C. 300 RPM, 0,2 L/min 0.2 micron filtered air purge and illuminated at 80 microeinsteins of light using a fluorescent bulb array. The cultivation was maintained for 4-7 days following which a 200ml samp le 'was removed for processing and trehalose assay. The temperature of the fermentation was then elevated to 40 °C for 24 hours, A 200ml sample was then removed from the bioreactor for processing and trehalose assay, (0286] Following temperature induction the dried biomass produced up to 3 wt% trehalose while the spent culture broth contained 0,3 wt% trehalose equivalent relative to biomass, (.02-87} In a first aspect, the present invention provides a transgenic photosynthetic microorganism, cell comprising an artificial DNA construct comprising, as operahly associated components in the 5' to 3’ direction of transcription: (a) a promoter functional in the photosvnthetie microorganism ceil; (hi (i t a polynucleotide comprising a nucleotide sequence encoding a polypeptide having a disacehari.de phosphate synthase and a disaccharide phosphate phosphatase; or (ii) a polynucleotide comprising a nucleotide-sequence.encoding a first polypeptide having a disao-haride phosphate synthase activity and a disaceharide phosphate phosphatase activity: or t»ii a first polynucleotide comprising a nucleotide sequence encoding a first polypeptide havtng a disaccharide phosphate synthase activity and a second pelynucleetide: comprislug a nucleotide sequence encoding a second polypeptide having a disaccharide phosphate phosphatase activity; and (c) a transcriptional temnnation sequence; wherein the transgenic photosynthetie- microorganism cell accumulates increased levels of the disaecharicleicompareci to a photosynthetic rnieroorganism cell not comprising the DNA construct.

[0288] in a second aspect, the present invention pro vides a method of producing a fermentable sugar using a transgenic phorosynihetie microorganism cell, the method comprising: inoculating a cultivation support with the transgenie photosymlietic microorganism cell of the--'first .aspect of the invention; cultivating the phoiosynihetie microorganisms on the inoculated cultivation support; isolating accumulated fermentable sugar· and optionally, one or more of the following features: (a) the fermentable sugar accumulates within the photosyntheiic microorganisms; (b) isolating the accumulated fermentable sugar comprises (1) harvesting at least a portion of the cultivated photosvmihedic microorganisms from the cultivation support; and (2) recovering the fermentable, sugars from the harvest; (c) the··accumulated fermentable sugar is secreted from the phOfosynthetic microorganisms and isolated from a cultivation media: (d) isolating the accumulated: fermentable sugar comprises isolating: the accumulated fermentable sugar from a cultivation media* .'(e) releasably sealing a physical harrier around the cultivation support after the inoculation such, that: all or a substantia! portion of the cultivation of the phoiosyntheiic microorganisms occurs while the physical barrier is sealed; (f) at least one of (I) supplying fluid to-the cultivation support; (2) supplying nutrients to the cultivation support; or (3) supplying gas to the cultivation SUppOl t. (g) conveying the cultivation support to at k\ot one of an inoculation station, a cultivation station, and a harvesting station; .(h) inducing synthesis of the fermentable sugar by the phoiosynihetie microorganisms; (i) inducing synthesis of the fermentable sugar comprises exposing the .phoiosynihetie microorganism to an inducing agent selected from the .group consisting of temperature, pH, a metabolite, iigiU. an osmotic agent, a hea\ \ metal, and an antibiotic.

Cl').-inducing. 'et φρ fermentable sugar comprises treating the plidtosynthttie microprgitms'n^s w uh a salt compound; (k) inducing synthesis ot flic termerstaiiie sugar comprises treating the pliotosyntSletic microorganisms with sodium chloride; 0) inducing- synthesis o f the fermentabio sugar comprises:' treating the photo synthetic microorganisms with a salt compound, wherein the salt compound is added at a concentration of between about ftOl mM and IJ M or between about 0,2 M and 0,9 M; (m) inducing synthesis of the fermentable sugar comprises exposing the photosynthetic microorganism to an inducing agent applied to the grow ih surlace by aerosol spray; (n) the photosynthetic microorganisms are cultivated to a density of at. least about 50 grams of dry biomass per liter equivalent; (o) the fermentable--sugar..comprises.at least'one sugar selected from the group consisting., of glucose, fructose, sucrose, trehalose, glucosylglye.ro!, and mannosyl fructose; (p| the fermentable sugar comprises at least one sugar selected from the group consisting of sucrose and trehalose; (q) the photosyntheticmicroorganisms comprise -naturally occurring photosynihetic microorganisms; or (r) the photosynthetic microorganisms comprise naturally occurrioa cy anobacteri u.m. (0289] In a third aspect, the present invention provides a method O-f cultivating' photo-synthetic .microorganisms, the method comprising: inoculating a cultivation support with p.liofosynthetic iiiieroorgamsms of the first aspect of the invention. cultivating the photosynthetic microorganisms on the inoculated cultivation support; harvesting .u least a portion ol the: cultivated .'photosynthetic niieroorganisivvs from the eultivatioii support; and optionally, one or more of the following features.; (a) sealing a .physical barrier of a photobiorcaetor comprising the cultivation support after the inoculation of the cultivation support such that all or a substantial portion of the cultivation of the photosynthctic microorganisms occurs while the physical barrier is sealed; (b) re leasable sealing fhe physical barrier of the photobiorcaetor ubcr the inoculation of the cultivation support such that all or a substantial portion of the cultivation of the photosynthetic microorganisms occurs while the physical barrier is sealed; (c) conveying each cultivation support to an inoculation station, a cultivation station, and a harvesting station; (d) at least one of {1} supplying fluid to the cultivation support; {2? supplying nutrients to the cultivation support: or (3) supplying gas to the cultivation support; (e) the photosynthetie microorganisms are cultivated to a density of at least about 50 grams of dry bioinass per liter equivalent; or {f) the photosynthetie microorganisms comprise a cel 1 according to the first aspect of the invention.

[0290] in preferred embodiments of the first aspect of the invention, tiie cell is: characterized in that: [0290.. 1 ] The1 photosynthetie microorganism comprises; (a) (i) a nucleotide sequence encoding SEQ ID: NO;. I of ^ sequence 95% 'identical thereto having sucrose phosphate synthase and sucrose phosphate phosphatase C AS I") activity; (if)· a first nucleotide encoding SEQ ID NO: 4 or a sequence 95% identical thereto having sucrose phosphate synthase (SPS) activity and a second nucleotide encoding SEQ ID NO: 6 or a sequence 95% identical thereto having a sucrose phosphate phosphatase (SEP) activity; (hi) a first nucleotide sequence encoding SEQ ID NO: 77 or a sequence 95% identical thereto having trehalose phosphate synthase (TPS) activity and a second nucleotide sequence encoding SEQ ID NO: 79 or a sequence 95% identical thereto having trehalose phosphate phosphatase (TPPj activity; ^ first >)vK ]ι^υίκίθ Si vjjU-( CO CHO^'iPl·1 St( ^ ^ f Qjf 0 SCC]liOilCc 9S% identical (hereto having glueosylgfycero). phosphate synthase (GPS) activity and a second, nucleotide sequence encoding SEQ IP NO: S3: or a sequence-9.5% identical thereto having gSueosylgiyceral. phosphate phosphatase (GPP) activity; or. f v j o fits! nucleotide sccjucncc encoding 1Γ) NO; S5 or <i sequence 95¾ identical· thereto havtp^mai«.Htsy|fiuetose;phos'p.hate symhase.{MPSyactiv:!tv and a second nucleotide sequence encoding SEQ ID NQ: S7 or a sequence 95% identical thereto having mannosylfructose phosphate phosphatase(MPP) activity; or (!>) (i) a nucleic acid sequence of S EQ ID NO; I or a sequence 95% identical thereto encoding sucrose phosphate synthase / sucrose phosphate phosphatase (ASF) ^activity; (ri) a first nuc leic acid sequence Pi SEQ ID NO* 3 Or a sequence 95% identical thereto encoding sucrose phosphate synthase (SFS) activity and a second nucleic acid sequence of SEQ: ID)NO: 5 or a sequence 95% identical thereto encoding sucrose phosphate phosphatase (SEP) activity; tin! a first nucleic, acid sequence of SEQ ID NO; 76 or a. sequence 95% identical thereto encoding trehalose phosphate synthase (TPS) activity and a second nucleic acid sequence ed SEQ ID NO; 78 or a sequence 95% identical thereto encoding trehalose phosphate phosphatase (TPP) activity;

Civ.) a first nucleic· acid sequence of SEQ [Q NO; 80 or a sequence 95% identical thereto encoding glucosylglyeerpl phosphate synthase (GPS) activity and a second nudeic acid sequence: of SEQ ID NO: 82 or a sequence 95% identical thereto encoding, ghicosyIgiyeerol phosphate phosphatase (GPP) acti vity; or |v) a first nucleic acid sequence of SEQ 11) NO: 84 or a sequence 95% identical thereto encoding mannosyjfinctose phosphate synthase (MPS) activity and a seeondvnucleic acid sequence of SEQ ID NO: 86 or a sequence 95% 'identical thereto encodmg raannosvlihiciose phosphate phosphatase (MPP) actiyity; (c) (i) a nucleic acid sequence that hybridizes tinder stringent conditions tp SEQ ID NO: 1, wherein the nucleic acid sequence encodes a polypeptide having ASF activity; {it.} a first, nucleic acid sequence that hybridizes under stfingeht-conditions to" SEQ ID NG; 3, wherein the first, nucleotide sequence encodes a polypeptide havimt SPS :activity and a second nucleic acid sequence that hybridizes under stringent conditions to SR.) ID NO; 5, vyhefeindhe .second nucleic acid sequence encodes-a pqlypepfide'having-SiJ!' aets\ !i v; (di t a first nucleic acid sequence that hybridizes under stringent conditions to SBQ ID NO; 76, wherein the first nucleotide sequence encodes a polypeptide having i PS activity and a second nucleic acid sequence that hybridizes under stringent conditions, to: -Sfc-Q 1.0 NO; 78, wherein the second nucleic acid sequence encodes: a polypeptide having TfiP activity; (iv) a "first nucleic acid sequence that hybridizes: under siringen.t conditions to SEQ ID NO; 80, wherein the first nucleotide sequence encodes a polypeptide having GPS activity and a second nucleic acid sequence that hybridizes under stringent conditions to $fr.Q ID NO; 82,.:wherein the second nucleic acid sequence encodes a polypeptide having UPP activity; (v) a first nucleic acid sequence that hybridizes under stringent conditions to SEQ ID: NO: 84, wherein die first nucleotide: sequence encodes a polypeptide having MPS acti vity and a second nucleic acid sequence that hybridizes under stringent conditions to SEQ I D NO: 86, wherpin the second nucleic acid .sequence encodes a polypeptide having MPP activity; wherein, said stringent conditions comprise incubation at 65*0 in a solution comprising 6X SSC-(0:9. M sodium chloride and 0.09 Msodimn citrate); or (d) an isolated polynuelcotide complementary to the polynucleotide sequence of (a), (b). or (e), [0290.2] Monomers of the aecnrmilated disaeeharide are endogenous to the cell, (0290.3 ] The cell is a qyanqbscferium/peih.a'phMosiyrithetic bacteria; .or a green algae. 19290.4] 1, he cell is a cyanobacterium selected ifom the group consisting of Synechoeoecus and Synechocysiis, [0290.5] The promoter is an ..inducible promoter or a promoter selected ifom carB, mrA,μφΑΚ-ΦίβΚ, foM-Cor/.^. \ 0290.6] The DMA construe:; comprises a nucleotide sequence selected door SEQ. ID NO: 19 {pLybALI I. encoding iq/);.SEQ ID NO: 20 (p[,ybALI2 encoding os/); SEQ: ID NO: 44 fptyhAL.SS encoding ox/);..SEQ ID NO: 45 (pLyhAI.,16 encoding mfi: SEQ ID : NO; 46 (pLyhALI 7 encoding asf); SEC} ID"NO: .47 (pLybALl 8 encoding asf): SEQ .1.1) NO: 48 (pLybA.Ll 6 encoding mf): SEQ ID NO: 49 (pLybAL21 encoding asf): SEC} ID NO; 50 (pLybAL22 encoding, asf)· SI.:Q ID NO: 51 (pLybALlof encoding ct.?/); SEQ ID NO: $2 CpEyALt3r encoding ax/); SEQiD NQ: S3 (pLyhAL14l>ncoding.ny/); SEQ ID NO: 54 (pLybALMr encoding ns/}: SEQ ID NO: 65 (pLybAL?! encoding:«y/}; SEQ ID NO: 69 (pEybALSf encoding Psf); SEQ ID NO; 118 (pLybAJL23 encoding tps.mid tpp): SEQ ID ;NO:. 121 (pLvbAL28 encoding r/ry and #yj); SEQ ID NO; 122 (pLybAL29 encoding tps and ipp); SEQ ID NO; 123 CpLybAL3'0 encoding tps·and //?;?); SEQ ID NO; 124 (pLybAL31 encoding tps<and tppp SEQ ID NO: 125 (pEybAOb «bedding tps and: tpp)’, SEQ ID NO; 126 (pLybAL37 encoding tps and ipp); SEQ ID NO; '1.30 (pI,yb AL>24 encoding tps and tpp); or SEQ IDNO: 133 (pLybAL53 encoding tps and. tpp).

[0290.7] "Hie cel I accumulates at. least about 0.1 micrograms of the disaeeharide pet minute per gram dry biomass: or at least about .0,1 microgrants· of the disaeeharide: per minute per gram dry biomass up to about 10 micrograms ofthe disaeeharide per minute per grant dry bi am ass, [0290.8] At least one ofthe following are: satisfied:: (a) die eel I does not comprise: a nucleotide sequence selected from the group consisting of SEQ ID NO: 70; SET} ID NO; 72,,and SEQ ID NO: 74, or a nucleotide variant thereof having at least 9535 identity thereto and invertase activity or sucrasefenidoxin activity; m the cell does not express a polypeptide sequence; selected from the group consisting of SEQ ID NO: 71, SEQ I D NO: 73» and SEQ ID NO: 75, or a polypeptide variant thereof having at least 95% identity thereto and invertase activity or sucraseierridoxm activity; or ;(c) die cell expresses a small interfering RNA specific to a nuelcOdde sequence selected from the group consisting of SEQ ID NO:. 70,.SEQ ID NQ: 72, and SEQ ID NO: 74, or a nucleotide variant thereof having at least 957-¾ identity thereto and kvertase activity or sucrose fcrridoxiπ activiiy: (d) the cell comprises aii isolated polynucleotide comprising SEQID N0: 94 or a setgience 95% identical thereto encoding an active porkpoiypeptide,: wherein the accumulated disaccacharide is sucrose, the cell expresses porih, and the expressed .porin secretes the accumulated sucrase irarn the cell;. te) the cell comprises an isolated polyrmdeotide encoding a polypeptide comprising SEQ ID HO: 95 or a sequence 957¾ identical thereto and.hdviggpofm activity, wherein the accumulated drsaccachande is sucrose, lire cell expresses port», and the expressed park secretes the accumulated sucrose from the cell; or (!) the cell comprises an isolated polynucleotide comprising SEQ. ID NO: 91 (pLybAL32 encoding a poring wherein the aecunmlafeddisaccacharide is sucrose, the cell expresses porin, and the expressed pork secretes the accumulated sucrose from the ceil.

[0291] With reference to the use of the wordfs) '‘comprise’’' or “comprises” or '‘'‘comprising’'' in the foregoing description and/or in the foil owing claims, unless the context requires otherwise, those words are used cm the basis and clear understanding that they are to be interpreted inclusively, rather than exclusively, and that each of those words is to be so interpreted in construing the foregoing description and/or the: following claims.

References [9292] All publications.' patents, patent applications, and other references cited in' this application are incorporated heroin -by reference in their .entirety for all purposes to the same extent as if each individual .publication, patent, patent appheafi on or other reference was specifically and individually- indicated to he incorporated by reference in its entirely for all purposes. Citation of a reference herein shall hot be construed a$ an admission that such is prior art to the present invention.

Claims (10)

1. T he claims defining the invention are as follows; Claim 1, A. transgenic pliotosyathefic microorganism ceil comprising an artificial'DNA construct comprising, as operably associated components in trie 5’ to 1' direction of transcription: (a) a promoter functional· in the: photosynthetic microorganism cell; (b) (i) a poiyrmcleoiide comprising a nucleotide .sequence .encoding·' a polypeptide having a disaceharsde phosphate synthase and a disaecharide phosphate phosphatase; or (si) a polynucleotide comprising a nucicoudc sequence encoding a first polypeptide-having a disaecharide phosphate synthase activity and a disaecharide phosphate phosphatase activity; Or (in) a first polynucleotide comprising a nucleotide sequence encoding a first polypeptide having a disaecharide phosphate synthase activity and a second polynucleotide comprising a nucleotide sequence encoding a second polypeptide having a -disaecharide phosphate phosphatase activity, and tc) a transen.ption.ai termination sequence; wherein the transgenic photosynthetic microorganism-cell accumulates-increased levels of the disaecharide compared to a photosyhthetic microorganism cell not comprising the DMA construct.
2. Claim 2. The cell .of claim 1. wherein the photosyntiietic inicroorganisni comprises: (a) (i) a nucleotide sequence encoding SEQ ID NO: 2 or a sequence hate- identical thereto having.sucrose phosphate synthase and sucrose phosphate phosphatase (ASF) activity; fm a first nucleotide encoding SEQ ID NO: 4 or a sequence 95% identical thereto having sucrose phosphate synthase (SPS.) activity and a second nucleotide encoding SEQ ID NO: 6 or a sequence 95% identical thereto having a sucrose phosphate phosphatase (SPP) activity; (h i) a first nucleotide sequence encoding SEQ ID NO: 77 or a sequence 95% identical thereto having trehalose phosphate sv mhase (TPS:) activity and a second nucleotide sequence encoding SEQ ID-NO.: 79 or a sequence 95% identical thereto having trehalose phosphate phosphatase'(I PP) activity: Gy) a first nueledH.de sequence encoding SEQ ID NO: SI or a sequence 95% identieai'xhereto having g hie osy f glycerol phosphate: synthase. (GPS) activity and a second nucleotide sequence encoding SEQ .ID NO: 83 or ascquenee 95% identical thereto having glucose GKceroI phosphate phosphatase (GPP)activity; or (v) a first nucleotide sequence encoding SKQ ID NO: 85 or a sequence 95% identical thereto having manjtps^lfmjptose/plirxsplTaile synthase (MBS) activity and a second nucleotide sequence encoding SEQj ID NO: 87 or a sequence 95% identical thereto having, mannosyliructose phosphate phosphatase (MPP) ado uy; or (h) (i) a nucleic acid sequence of SEQ ii) NO: I or a sequence 95% identical thereto encoding sucrose phosphate synthase / sucrose: phosphate phosphatase (ASF) activity; (ii) a first nucleic acid sequence of SEC) ID NO: 3 or a sequence 95% identical thereto encoding sucrose phosphate synthase (SPS) activity and a second nucleic acid sequenee of SEQ ID NO: 5 or a sequenee 95% identical thereto encoding sucrose phosphate phosphatase (SPP) activity; (hi) a first nucleic acid sequence pf SEQ ID NO: 76 or a sequenee 95% identical thereto encoding trehalose phosphate synthase (TPS) activity and a second nucleic acid sequence of SEQ ID NO; 78 ora sequence 95% identical thereto encoding trehalose phosphate phosphatase (TPP) activity; (iv) a first nucleic acid sequence of SEQ ID NO: 80 or a sequence 95% .identical thereto encoding gtueosylglycero! phosphate synthase (GPS) activity and a second nucleic acid sequence of SEQ ID NO: 82 or a sequence 95% identical thereto encoding giucosylgiyceroS phosphate phosphatase (GPP) activity; or (v) a first nucleic acid sequence of SEQ ID NO: 84 or a sequence 95% identical thereto encoding maunosylfi'uctose phosphate synthase (MPS) activity and a second nuc leic acid sequence of SEQ ID NO: 86 or a sequence 95% identical thereto encoding rriannosylffuctose phosphate phosphatase (MPP) activity; (c) (!) a nucleic acid sequence that hybridizes under stringent conditions to SBQ ID NO: l, wherein the nucleic acid sequence encodes a polypeptide having ASF activity; Gi) a first nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 3> wherein the first nucleotide sequence encodes a polypeptide having SPS activity and a second nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO; 5, wherein the second nucleic acid sequence encodes a polypeptide Imving SPP activity; (hi) a less nucleic acid sequence that hybridises under siringeni conditions to SEQ ID NO; 76, wherein: the. Erst nucleotide sequence encodes a polypeptide having TPS activity and a second nucleic add sequence that hybridizes imder stringent conditions to SEQ ID NO; 73, wherein·the second nucleic acid sequence encodes a polypeptide having TPP activity; (iv) a first nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO; 80, wherein the first nucleotide' sequence encodes a polypeptide having OPS activity and a second nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 87. wherein the second nucleic acid sequence encodes a polypeptide having GPP activity; :(v) a first nucleic acid sequence that hybridizes under stringent conditions to SEQ ID NO: 84, wherein the first nucleotide sequence encodes a polypeptide having MPS activ ity and a second nude», aud «cquence that hybridizes under stringent conditions to SF.Q ID NO' 86, wherein the second nucleic acid sequence eneod.es a polypeptide hav mg MPP activity; wherein said stringent conditions comprise men bat son at 65N7 in a solution comprising 6X SSC (0.9 M sodtnm chloride and 0.()9 M sodium citrate}; or (d) an isolated polynucleotide complementary to the polynucleotide sequence of (a), (b), or (c).
3. Claim 3. The cell of any one of claims 1-2 wherein monomers of the accumulated disaccharide are endogenous to the cell.
4. Claim 4. The cell of any one of claims 1-3 wherein the cell is a cyanobacterium cell, a photosynthetic bacteria; or a green algae.
5. Claim .5- The cell of any one of claims 1-4 wherein the cel l is a cyanobacterium selected from the group consisting of Syneehoeoceus and Syneehocystis.
6. Claim 6. The cell, of any one of claims 1-5 wherein the prompter is an inducible promoter or a promoter -selected from mrlL nirA, psbAIL dnaK, kaiA, or λ»*, (‘lawn
7. 7. The cell of any one <d claims 1--6 wherein hie ON A construct comprises a nucleotide sequence selected from: SEQ ID NO: 16 (pLybAL i I encoding usf): SEQ 11) NO: 20 (pl.ybAl ,12 encoding αφ; SEQ ID NO: 44 (pLybAL 15 encoding as/): SEQ ID NO: 45 (pLybAL, 16 encoding ey/); SEQ ID NO: 46 (pLybAL 17 encoding ns;/); SEQ ID NO: 47 (pLybAL. 18 encoding os/): SEQ ID NO: 48 (pLybAL19 encoding u.v/}; SEQ ID NO: 49 {pLyhALB 1 encoding αφ: SEQ ID NO' 50 (pLybAI..22 encoding asf): SEQ ID NO: 51 {pLybAL 13f encoding u.y); SEQ ID NO: 52 (pLyAL!3r encoding as ft: SEQ ID NO; 53-(pLybALI4f encoding asf); $EQ ID NO: 54 (pLyhALHr encoding ns/): SEQ ID NO: 65 (p,LybAL7f encodingox/); SEQ ID NO. 69 (pLybALSf encoding ns/); SEQ ID NO: 118 (pL,ybAL23 encoding tps and ipp'K SEQ ID NO* 121 (pLybAL2S: encoding tps and tpp): SEQ ID NOr 122 (pLyb.AL29 encoding tps anil tpp): SEQ ID NO: 123 (pLybALBO encoding- tps and- tpp); SEQ I'D NO; 124 (pLybALS I encoding 'tps and tpp); SEQ..1.1.) NO: 125 (pLybAL36 encoding tpsrapd φρ): SEQ ID NO: 126 (pLybAL37 encoding tps and tpp): SEQ ID NO: 130 (pL.ybAL.24 encoding tps and ipp% or SEQ ID NO: 133 (ptybAi.33 encoding tps and tpp).
8. Claim -8.- The-cell of any of claims 1-7 wherein the cell accumulates at least about :0.1 miefogrants of the disaecharide per minute per grarn dry biomass; or at least about (/.1 mi urograms of the disaecharide per minute :per gram dry biomass up to about 1.0 micrograms of die disaecharide per minute per gram dry biomass.
9. Claim 9. Tire cell of any of claims 1-8, wherein at least one of the following are satisfied: (a.).the cell does not comprise a nucleotide sequence selected from the group consisting, of SEQ - l'I> NO: 70, SEQ ID NO: 72, and Sid.) ID NO: 74, or a.-.nucleotide variant 'thereofhaving at. least. 95% identity thereto and invertase activity or sitcraselerridoam activity; (b) the cell does not express a polypeptide sequence selected from the group consisting of SEQ ID NO: 71, SEQ ID NO: 73, and SEQ ID NO: 75, or a polypeptide variant thereof having at least 95% identity thereto aod ijivertase activity or siicraseferidoxra activity; or (c) the cell expresses a small interfering RNA specific to a nucleotide sequence i selected from the group consisting of.SEQ ID NO: 70, SEQ ID NO: 72.. and SEQ ID HO: 74, or a nucleotide variant thereof having at least 95% identity thereto and invertase activity or sucraseienidoxirt activity: (d) the ceil comprises an isolated polynucleotide comprising SEQ ID NO: 94 or a sequence 95% identical thereto encoding an active ponn polypeptide, wherein the accumulated disaccachande is sucrose, the cell expresses pork, and the expressed porin secretes the accumulated sucrose from the cell; (e) the cell comprises an isolated polynucleotide encoding a polypeptide comprising SEQ ID NO: 95 .or a sequence .95%' identical thereto and having: porin activity, wherein, the accumulated disaecacharide is·. sucrose, the cell expresses porin, and the expressed porin secretes the aceurnuSated sucrose from the cell; or (f) the cell comprises:an isolated polynucleotide eomprisi.ng SEQ ID NO: 91 (pLybALo? encoding a porin), wherein the accumulated disaceaeharide is sucrose, the cell expresses porin, and the expressed porin secretes the accumulated sucrose from the cell, Chaim
10. 10. A method of producing a feoqentahle sugar using a transgenic photosynthetic microorganism celt, the method comprising: inoculating a cultivation support with the transgenic phOtosynthetic microorganism ceil of any one of claims 1-9; cultivating: the photosynthetic microorganisms: on the inoculated 'cultivation support; isolating accumulated- fermentable sugar; and optionally, one or more of the following' features: (a) the fermentable sugar accumulates within the pbotosynthetic microorganisms; (b) isolating the accumulated fermentable- sugar comprises .(1) harvesting at least a portion of the cultivated pbotosynthetic microorganismsirom the cultivation support; and (2) recovering the fermentable sugars from the harvest; (c) the accumulated fermentable sugar is secreted from the photosynthetic microorganisms and isolated front a-cultivation media; (d) isolating the accumulated fermentable sugar comprises isolating.' the accumulated lamentable sugar front a cultivation media; (¾} julyasably sealing. a physical barrier around the cult Nation support after the inoculation such that all or a substantia! portion pf the cultivation of the photosynthetic microorganisms occurs while the physical barrier is sealed; f I) at feast one of (I) supplying fluid to the cultivation support; i 2) supplying nutrients io the cultivation support; or (3) supplying gas to the cultivation support; (g) con veying the cultivation support to at least one of an inoculation ; slat ion. a cultivation station, and a harvesting station; i (h.) inducing synthesis of the fermentable, sugar by the photosyntbetie j microorganisms; (j) inducing synthesis of the fermentable sugar comprises exposing the photosyntlietic microorganism to. an. inducing agent selected from the group consisting of temperature,.·pH, a metabolite, light, an osmotic agent, a hea vy metal, and an antibiotic; j < i! inducing synthesis of the fermentable sugar comprises treating the i 'photosynthetic microorganisms with a salt compound; (k) inducing synthesis of the fermentable sugar comprises treating the photosyntlietic microorganisms with sodium chloride; (l) inducing synthesis of the ferment able sugar comprises treating the phofosynthefic microorganisms with a salt compound, wherein the salt compound is added at a concentration ofhetween about O.Oi mfvl and 1.5 M or between about 0,2 M and 0,0 Vi; in;} inducing synthesis of the iennemabk: sugar comprises exposing the 'photosynthetic microorganism to an inducing agent applied to the growth surface by aerosol spray: (η) the photosynthetic microorganisms are cultivated to a density of at least about 50 grams of dry biomass per liter equivalent; to) the fermentable sugar comprises· at least one sugar selected from the group·consisting ofgiucose, fructose, sucrose, trehalose; gkicosyfglyerol, and. rnannosyifruetose; (pi dm fermentable sugar comprises at feast one sugar selected, from the group consisting of sucrose and trehalose; (q) the photesynihetic microorganisms comprise naturally occurring photosynthetk microorganisms; or (r) the photosynthetic microorganisms comprise naturally occurring •cyanohacferipin. Claim 1; 1. A. method of cultivating photosyfithetic microorganisms, the .method comprising: inoculating a cultivation support with phoiosynthctre microorganisms of any one of claims 1-9; cultivating the photosynthetic· microorganisms on the inoculated cultivation support; harvesting at least a portion of the cultivated photosynthetic microorganisms front the cultivation support; and optionally, one or more o f the following features: (a) sealing a physical barrier of a photobioreactor comprising the cultivation support after the inoculation of the cultivation support such that all or a substantial portion of the cultivation of the phoiosynthetic n.ricroorganisms 00001¾ while the physical barrier is sealed; .(b) releasahly sealing the physical barrier of the photphioreactor after the inoculation of the cultivation support such that all or a substantial portion of the cultivation of the photosynthetic microorganisms occurs while the physical barrier is sealed; (e) conveying each cultivation support to .an inoculation station* a cultivation station, and a harvesting station; 0) at least one of (1) supplying fluid to the cultivation support; (2) •supplying'nutrients to the cultivation support; or (3) supplymg gas· to the cultivation support; (e) the photosynthetie microorganisms are'cultivated to a density of at least, about 50 grains of dry biomass per liter equivalent; or (I) the photosynthetic nricroorganlshis comprise a: cell according to any one of claims 1 -9. A Λ : · 1 '>* '