AU2014250606B2 - Photobioreactor for cultivating photosynthetic microorganisms - Google Patents

Abstract

Provided is a photobioreactor for cultivating photosynthetic microorganisms comprising a cultivation support with a solid textured surface allowing photosynthetic microorganisms to adhere thereto and a physical barrier disposed over at least a portion of the textured surface. Also provided are devices for cultivation of photosynthetic microorganisms incorporating the photobioreactor. EIAiO4Z Suspension Culture media upply 1 Grotup y a 2 Proct harvst lineeto Culture meodia suplR as supply I, I-r la r b r -Breatable anen rurProducthaar

Description

CROSS-R£FERENCE IX) RELATED APPLICATIONS

[00013 The present application is a divisional application derived from Australian Patent Application No. 2009204313 (PCT/IIS2{MN/030162: WO 2009/0891S5)¥ claiming priority of US Application Nos. 61/0115798 and 61/085797, the entire contents of which are incorporated by reference-herein.

INCORPORATION-B'V-RFFERENi’F OF MATERIAL SUBMITTED IN COMPUTER READABLE FORM 10002] The Sequence Listing, which is a pari of the present disclosure, includes a computer readab le form lodged with the parent application published under WO 2009/089185 and a written sequence listing comprising nucleotide and/or amino acid sequences of the present invention. The sequence listing information recorded in computer readable form is identical to the written sequence listing. The subject matter of the Sequence Listing is incorporated herein by reference in. its entirety.

FIELD OF THE INVENTION

[.0003] The present divisional application generally relates to photobioreactors -for cultivating' microorganisms and devices -incorporating- such photobioreactors, whilst the parent application generally relates to transgenic microorganisms and methods and devices tor their cultivation.

BACKGROUND

[0004] To address the world's increasing energy requirements, efficient and environmentally sound -alternatives to the use of fossil fuels are .sought after. Alternative fuels, such as ethanol or biodiesel. can be produced foom plant biomass. For example, the key ingredient used to produce ..ethanol from current processes is termed fermentable sugar. Most often, fermentable sugar Is in the form of sucrose, glucose, or high-fructose com syrup. Plants currently grown to produce such biomass include com, sugarcane, soybeans, canola, jatropha, ,and so forth, Bui much of the plant biomass used to produce fermentable sugar requires extensive energy-intensive pre-processing. Further, use of such plant biomass can lead to sod depietron, erosion, and diversion of the food supply. £8005] It is known that some cyanobacteria produce sucrosethrough the action of sucrose phosphate synthase., and sucrose phosphate phosphatase, where it has been: studied exclusively as an osmoproiectaot With respect to salt tolerance, cyanobacteria can he divided into three groups. Strains having low tolerance (less than 700 tnM) synthesize either sucrose, as is the case with Synechocoecus etongatus PCC 7942, or another dissaeeharide known as trehalose [BlurowaM et at., Proc Mat! Aed Sei USA (1983) 80:2599-2602 and Reed et al, FEMS Microbiol Rev (1986) 39:51-56). Glucosylglycorol is produced by strains having moderate hatotoleraacc (0,7-1.8 mM), such as Synechocystis sp, PCC 6803. High salt tolerance (up to 2.5 M) results from, the accumulation of either glycine betaine or glutamate betaine, Miao et al . [FEMS Microbiol Lett (2003) 238:71-77] determined that when giuoosylglycerol biosynthesis is blocked by deletion of the agp gene, however, Synechocystis sp. P€€ 6803 produces sucrose as its osmoprotectant. Desiccation tolerant cyanobacteria also produce sucrose and trehalose in response to matric; water stress [Herslikovitz; et al, App! Environ Microbiol (1991) 57:645-648].

[00061 Synechocystis spp. PCC 6803 (ATCC 2 7184) and ISynechpcaccm ehmgams P€C 7942 (ATCC 33912) are relatively well-studied, have genetic tools available and the sequences of their genomes are known (see eg,, Koksharova, O . A. and· Wolk, C. P. 2002. Appl Microbiol Bioteehnol 58, 123-13?; fkeuchil, M. and Satoshi Tabata, S. 2001. Photosynthesis Research 70, 73-83; Golden, S. S,, Brusslan, J. and Haselkom, R, 1987, Methods in Enzymology 153,215-231; Priedberg; D. 1988. Methods in Enzymology 167,736-747; Kaheko, Ί: -et άί. 1996. DNA Research 3, 109-136).

[00073 The commercial cultivation of photosynthetic microorganisms such as Spirulina maximum, Spirulina pi atensis, Dunaliella salina, Botryeoccus braunii, Chlorella vulgaris, Chlorella pyrenoidosa, Serenastmm capricOmitfuro, Scenedesmus auadricanda, Porphyridium cruenium, Scenedesmus acutus, Dunaliella sp., Scenedesmus oMiquus, Anabaenopsis, Aulosiro, Cylmdrospermum, Scenecoecus sp., Sceaccosysiis sp„ and Tolypothrix: is desirable for numerous applications including the production of fine chemicals, pharmaceirticals, cosmetic pigments, fatty adds, antioxidants, proteins with prophylactic action, growth factors, .antibiotics» vitamins and polysaccharides. The algic biomass can also be useful, in a lo w dose, to replace or decrease the level of an tibiotics in animal food or be useful as a source of proteins , Furthermore, the algic biomass prodded in a wrot torm, as opposed to a dried form, can be fermented or liquefied by thermal processes to produce fuel Thus, there is great interest in the ability to increase the efficiency of cultivating such, organisms.

[00083 In general, current photosynthetic hioreaetors rely on the cultivation, of microorganisms in a liquid phase system to produce biomass. These systems are ..usually open-air pond-type reactors or enclosed rank-type reactors. Enclosed bioreaetors, however, typically are considered to be an improvement over pond type reactors in many respects. Importantly, enclosed systems provide a barrier against environmental contamination. In addition, these vsystems allow for greater control of temperature and gas content of the liquid media.

[00093 Still, the uses of enclosed photobioreactors tend to be limited by photosynthetic imctooigaaisms* requirement for light (/. e., actinic radiation provides the energy required by photosyntbetle microorganisms to fix carbon dioxide Into organic molecules). Thus, sufficient illumination of the photosynthetie microorganisms is an unyielding requirement. Nevertheless, as the cell density in a liquid phase photobioreactor increases, the ability of light to penetrate into the media decreases, which typically limits die cel! density that may be achieved. Additionally , some type of agitation of the liquid media is generally required to prevent unwanted sedimentation of the organisms, a process that requires the input of energy.

[00101 Numerous attempts have been madeto devise a method of bringing light to the organisms in liquid phase systems. For example, some systems Involve circulating 'the liquid culture media through transparent-tubes. Other attempts involve placing a light source within the media or introducing reflecting particles into the culture media to adjust the radiation absorbance of the culture. Despite these efforts, it significant increase in the ability to culture organisms in liquid phase systems at higher cell densities has not yet been achieved.

[0 011J In addition to the aforementioned light requirement, tire use of liquid phase photobioreactors has been burdened with providing the photosynthetie microorganisms enough carbon dioxide For photosynthesis. Typically* these systems generally incorporate some type of additional aeration system to increase the concentration of carbon dioxide dissolved in tire media. Eliminating the need for aeration would greatly simplify the system thus reducing operating costs.

[0012] Liquid phase photobioreactors also tend not to be well suited for conventional methods of continuous production . In general, the transportation of large volumes of liquid is complex and burdensome. Further, because liquid phase systems usually require mechanisms for circulation, agitation, aeration, and the like, It is generally simpler and more cost effective to operate only one or a few large cultivation devices rather titan numerous smaller ones.

Therefore, currently practiced methods involve processing .relatively large batches (Le.t a batch, of photosynthetic, microorganisms is cultivated and the entire resulting biomass is then harvested)* [0013] Thus, there .is; a great need in the art for advancement in photosymihetie hioreaetor design. Providing a new type of photosynthetic· bioreactor capable of efficiently cultivating and harvesting relatively high densities of photosynthetic microorganisms without large volumes of water or other liquid media, without the aforementioned extraordinary measures for supplying adequate light and carbon dioxide, and at a reasonable cost would represent a substantial advance in the art, and benefit industry' and consumers alike.

SUMMARY QF THE, INVENTION

[0014] Provided herein is a transgenic bacteria engineered to accumulate carbohydrates, for example disaecharides. Also provided'»·a phetobioreactor for cultivating photosynthetie microorganisms comprising a non-gelatinous, solid cultivation support suitable for providing nutrients and moisture to photosynthetie microorganisms and a physical barrier covering at least a portion of the surface of tire cultivation support:. Devices for the large scale and continuous cultivation of photosynthetic microorganisms incorporating photobioreadors and methods of use are disclosed. Also disclosed are methods of producing fermentable sugar from, photosynthetie microorganisms using a phofobioreactoF of the invention, [00153 One aspect provides a photobioreactor for cultivating photosynthetie microorganisms. The photobioreactor comprises a non-gelatinous, solid cultivation support suitable for providing nutrients and moisture to .photosynthetie microorganisms on at least a portion of a surface thereof, wherein said portion of the surface has a topography that allows pho tosyn thetie microorganisms to adhere thereto when said portion of the surface is oriented non-horizon tally; and a physical barrier covering at least said portion of the surface of toe cultivation support, wherein the physical barrier is configured so as to allow inoculation of said portion of the surface of fee cultivation support, formation and mainienance ofan envimnment suitable for the education of such photosynthetic microorganisms, and harvesting of such cultivated photosynthetic microofgamsrns, 10016} In some embodiments, the photobioreactor comprises photosynthetic microorganisms on said portion of the surface of fee cultivation support , In some embodiments, fee photobioreactor further comprises a cell engineered to accumulate a disaeharide, as described fiirther below, wherein the cell is adhered to the solid cultivation support. In some embodiments, said portion of the surface of the cultivation support is capable of cultivating photosynthetic mkimuganisms at a density o f at least about 50 grams of dry biomass per liter equivalent, t'0 0171 In some embodiments, fee cultivation support Is flexible. In some embodiments, fee cultivation support comprises one or more rigid materials. In some embodimen ts, the cultivation support of the photobioreactor comprises at least two layers, a first layer adjacent to a second layer, wherein material of the at least two layers is the same material or different materials, In some embodiments, the first layer comprises a high surface area growth material and the second layer a permeable type material. In some embodiments, the cultivation support of the photobioreactor comprises flexibly connected rigid portions, wherein the rigid portions are. comprised of fee one or more rigid materials. In some embodiments, the photobioreactor comprises a single cultivation support, in. some embodiments, the phoiobioreactor comprises a plurality of cultivation supports, £0018 J In some embodiments, the cultivation support comprises a fabric, in some embodiments, the fabric? is comprised of fibers that are natural, modified n atural, synthetic, or a combination .thereof. In some embodiments, the fabric is a woven fabric, a knitted fabric, a felt, a mesh of cross-linked fiber polymers, or a combination thereof. In some embodiments, the natural fibers are selected from the group consisting of cotton, wool, hemp, tree fiber, other ceiluiosie fibers, and combinations thereof. In some embodiments, the modified natural fibers are selected from fee group consisting of nitrocellulose, cellulose acetate, cellulose sulfonate, crosslinked starches, and combinations thereof. In some embodiments, fee synthetic fibers are selected from the group consisting of polyester, polyaorylate, polyamine, polyamide, poiysulfone, and combinations thereof.

[002 91 in some embodiments, the cultivation support is coated with a moisture absorben t polymer. In some embodiments, the fabric, the liber of the fabric, Or both, are coated with a moisture absorbent polymer. In some embodimentSi the moisture absorbent polymer is selected from the group consisting of agar,..polyacrylate, polyamide, polyamine, polyethylene glycol, modified starches, and combinations thereof, 100 203 in some embodiments, the physical barrier of the photobioreaefor is at least substantially impermeable to solid particulate and liquid but does not prevent the transport of gas or vapor to and from thespace 'proximate to said portion of the surface of the cultivation support nor actinic irradiation of said portion of the surface of the cultivation support, in some embodiments, the physical barrier is sufficiently impermeable to water vapor so that the cultivation support upon being moistened will retain enough of the moisture so die photosynthetie microorganisms remain adequately hydrated during cultivation, in some embodiments, the barrier is configured to enclose the cultivation support and any photosynthetie micnootganisnis thereon, and to.be releasabSy sealed during at least a portion of the cultivation of the photosynthetie microorganisms. In some embodiments, the physical barrier is flexible. In some embodiments, the physical barrier further comprises a first portion that is at least substantially impermeable to solid particulate, liquid, gas, and vapor, and a second portion that is permeable to gas and vapor but at least substantially impermeable to solid particulate and liquid, in some embodiments, the second portion of the barrier has a gas or vapor exchange rate that is from at least about 5 Gurley seconds to no greater than about 10,.000 Gurley seconds. In some embodiments, the second portion of the barrier comprises a selective membrane comprising olefin fiber or polyethylene fiber material, polytetrafluofoethytene filtration media, eeliulosic filter material, fiberglass filter material, polyester filter material, poly aery late filter material, polysnlfbne membranes, or nyion membranes, in some embodiments, the first portion is at least substantially transparent to actinic radiation and the second portion is not at least substantially transparent to actinic radiation., and the configuration of the first and second portions relative to each other and at least said portion of the surface of the cultivation support, is such: that there a sufficient amount of actinic radiation and gas exchange to support photosynthesis by photosynthetie microorganisms.

[00211 in some embodiments, the photobioreactor further comprises a source of actinic radiation situated between the cultivation support and the physical barrier. In some embodiments* the physical barrier is between the cul tivation support and a source of actinic radiation and is sufficiently transparent to such actinic radiation and sufficiently gas permeable to allow for photosynthesis by the photosynthetic microorganisms during cultivation, [00221 In some embodiments, the photobi oreactor further comprises water , nutrients, or a combination thereof on, within, or on and within, the cultivation support. In some embodiments, the pbotobioreactor further comprises one or more attachment poin ts for attaching, the photobioreactor to a structure. In some embodiments, the solid cultivation support further .comprises one or more attachment points tor attaching the cultivation support. In some einbodiments, the photobkireactor further comprises at least one of a fluid supply system, a nutrient supply system, a gas supply system, and a microorgansim supply system. CO0231 Another aspect provides a device for cultivating photosynthetic microorganisms. Such device comprises at least one pbotobioreactor as described above, and a structure to which the at least one photohioreaeidr is attached that orientates at least one cult ivation support of the at least one photobioreactor non-horizontally, in some embodiments^ the at least one pbotobioreactor is suspended from fee structure. In some embodiments, the structure is substantially covered by the physical barrier, in some embodiments, the structure comprises a conveyor system or a component thereof such that the at least one cultivation support is capable of being eon veyed along the path of the conveyor system. I n some embodiments, the device further comprises one, two, or three of the following; an inoculation station such that each cultivation support as it is conveyed along the path of'the conveyor system may be inoculated, with photosyuthetic microorganisms; a cultivating station such that the photosynthetic microorganisms on each inoculated cultivation support are cultivated as each cultivation support is conveyed along the path of the conveyor system; and a harvesting station to which the cultivation support is conveyed so that at least a portion of the cultivated photosynthetic microorganisms may be harvested from each cultivation support. In some embodiments, the inoculation station and the harvesting station are substantially adjacent to each other or are substantially coextensive. In some embodiments,the device further comprises an inducing station for inducing the synthesis of fermentable' sugar by pkotosynthetie imcroorgattistjB οώ each cultivation support. In some embodiments, the device futher comprises at least one of a fluid supply system., a nutrient supply system, a gas supply system, or a nrieroorgansitn supply system. In some embodiments, the device further comprises a photosyntStetic microorganisms adhered on the solid cultivation support, In some embodiments, the device further comprises a cell engineered' to accumulate a disacharide, as described 'further below, wherein the ceil is adhered to the solid cultivation support.

[00241 Another aspect provides a transgenic photosyftthetic microorganism cell engineered to accumulate a disaecharide. The transgenic photosynthetic micnoorgaoism cell comprises, as operably associated components in the 5* to 3’ direction of transcription: a promoter functional in the photosynthetic microorganism cell: a polynucleotide comprising a nucleotide sequence encoding a polypeptide having a disaecharide biosynthetic activity selected from the group consisting of a disaecharide phosphate synthase and a disaecharide phosphate phosphatase; and a transcriptional termination sequence; wherein the transgenic photosynthetic microorganism cell accumulates increased levels of the disaecharide compared to a photosynthetic microorganism cell not comprising the DNA construct [00251 In some embodiments, the transgenic phoiosynthetic microorganism cell comprises a polynucleotide comprising a first, nucleotide sequence encoding a polypeptide having disaecharide phosphate synthase acti vity and a second nucleotide sequence encoding a polypeptide having disaecharide phosphate phosphatase acti vity. In some embodiments, the comprises a polynucleotide comprising a nucleotide sequence encoding a polypeptide having disaecharide phosphate synthase activity and disaecharide phosphate phosphatase activity. In some embodiments, the comprises a a first nucleotide sequence encoding a polypeptide having: disaecharide phosphate synthase activity; a second nucleotide sequence encoding a polypeptide having disaecharide phosphate phosphatase activity; and a third nucleotide sequence encoding a polypeptide having disaecharide phosphate synthase activity and disaecharide phosphate phosphatase activity. C 00261 In some embodiments, the polynucleotide of the transgenic photosynthetic microorganism ceil is selec ted from the group consisting of; (a) a polynucleotide comprising a nucleotide sequence encoding a polypeptide selected from the group consisting of: SEQ ID NO: 2 or a sequence 95% identical thereto hawing sucrose phosphate synthase and sucrose phosphate phosphatase (ASE) activity; SBQ ID NO: 4 or a sequence 95% identical thereto having sucrose phosphate synthase (SPS) activity; SBQ ID NO: 6 or a sequence 95%identical thereto having a 'sucrose phosphate phosphatase (SPP): activity; SEQ ID NO: 77 or a sequence 95% identical thereto having trehalose phosphate synthase (TPS) activity; SEQ ID NO: 79 or a sequence 95% identical thereto having trehalose phosphate phosphatase (TPP) activity; SEQ ID NO: 81 or a sequence.95% identical thereto having giueosylglycerol phosphate synthase (OPS) acitivity;· SEQ ID NO: 83 or a sequence 953( identical thereto having.glucosylgiycerol. phosphate phosphatase (GPP) activity; SEQ ID NO: 85 or a sequence 953·« identical thereto having maonosy I fructose phosphate synthase (MPS) activity; and SEQ ID NO: 87 or a sequence 95% identical 'thereto having jnatmosylfruciose phosphate phosphatase (MPP) activity; (h) an isolated polynucleotide comprising SEQ ID NO: 1 or a sequence 95% identical thereto encoding sucrose phosphate synthase j sucrose phosphate phosphatase (ASP.) activity; SEQID NO; 3 or a sequence 95% identical thereto encoding sucrose phosphate synthase (SPS) activity; SEQ ID NO: 5 or a sequence 95% identical thereto encoding sucrose phosphate phosphatase (SPP) activity; SEQ ID NO; 76 or a sequence 9584 identical thereto encoding trehalose phosphate synthase (TPS) activity; SEQ ID NO: 78 or a sequence 95% identical thereto encoding trehalose phosphate phosphatase (TPP) activity; SEQ ID NO: 80 or a sequence 95% identical thereto encoding giueosytglycerol phosphate synthase (GPS)-acitivity; SEQ ID NO: '82 or a sequence 9584 identical thereto encoding glucosylgiycerol phosphate phosphatase (GPP) activity; SEQ ID NO: 84 or a sequence 95% identical thereto encoding man nosy I fructose phosphate synthase (MPS.) activity; and SEQ ID NO: 86 or a sequence 95'% identical thereto encoding mannosyltmctose phosphate phosphatase (MPP} activity; {c) an isolated polynucleotide that hybridizes under stringent conditions to a nucleic acid sequence selected from the group consisting of: SEQ ID NO: 1, wherein the-isolated polynucleotide encodes a polypeptide having ASF activity; SEQ ID NO: 3, wherein the isolated polynucleotide encodes a polypeptide having BPS activity · SEQ ID NO: 5, wherein the isolated polynucleotide encodes a polypeptide having SPP activity; SEQ ID NO: 76, wherein the isolated polynucleotide encodes a polypeptide having TPS activity; SEQ ID NO; 78y wherein the isolated polynucleotide encodes a polypeptide having TPP activity; SEQ ID NO: 80, wherein the isolated. polynucleotide encodes a polypeptide having GPS activity; SEQ ID NO: 82, wherein the isolated polynucleotide; encodes a polypeptide having GPP activity; SEQ ID NO: 84, where» the isolated polynucleotide encodes a polypeptide having MPS activity; SEQ ID NO: 86, wherein. the isolated polynucleotide encodes a polypeptide having MPP activity; wherein, said stringent conditions comprise incubation at 65¾ in a solution comprising 6X SSC (1).9 M sodium chloride and 0.09 M sodium citrate); and (d) an isolated polynucleotide complementary to the polyaueleotide sequence of (a), (b), or (c). £0 027 3 In some embodiments, monomers of the accumulated, disaccharide are endogenous to the cell, in some embodiments, a monomerf s) of the accumulated disaccharide are exogenous, to the cell and expression of such monomers) is engineered into the cell.

[00283 In some embodiments, the cell is a cyanobacterium cell, a photosynthetic bacteria; or a green algae, in some embodiments, the cell is a cyanobacterium cell In some embodiments* the ceil is a cyanobacterium selected from the group consisting of Synechococctis and Synechocystis.

[0029] In some embodiments, the promoter is an Inducible promoter. In some embodiments, the promoter is idoeible by an agent selected from the group consisting of temperature, pH, a metabolite, light, an osmotic agent, a heavy metal, and an antibiotic, in some •embodiments, the promoter is selected from the group consisting of carB, nirA, psbAIl, 4naKf kai4f and [00303 in some embodiments, the DMA construct of the cell comprises a nucleotide sequence selected .from the group consisting of SEQ ID NO: 19 (pLybAL 11 encoding asf); SEQ ID NO: 20 (pLybALl 2 encoding αφ; SEQ ID NO: 44 (pLybAL 15 encoding asj); SEQ ID NO: 45 (pLybALl 6 encoding αφ; SEQ ID NO: 46 (pLybALl? encoding βφ; SEQ ID NO; 47 (pLybAL 1.8 encoding αφ; SEQ ID NO; 48 (pLybALl 9 encoding asfi; SEQ ID NO: 49 (pLybAL21 encoding αφ; SEQ ID NO: 50 (pLybAL22 encodkg αφ; SEQ ID NO: 51 (pLybAL i 3'f encoding as/); SEQ ID NO: 52 (pLyAL 13r encoding αφ; SEQ ID NO: 53 (pLybAL14f encoding as/}; SEQ ID NO: 54 (pLybAL 14r encoding αφ; SEQ ID NO: 65 (pLybAL7f encodkg αφ; SEQ ID NO: 69 (pLybALSf encoding «9); SEQ ID NO; 118 {pI:.ybAE23 encoding tps and ψρ}; SEQ ID NO: 121 (pEybAL28 enbpdmg tps and tpp); SEQ ID NO: 122 (pLybAL29 encoding tps and tpp); SEQ ID NO: 123 (pLybAL3Q encoding tps. and tpp); SEQ ID NO: 124 (pLybAL3.f encoding tps and tpp); SEQ ID NO: 125 (pEybAL-36 encoding Sps and tpp); SEQ ID NO: Γ26 (pLybAiJ? encoding t?>s.stid.ipp); SEQ ID NO: 130 {pLybAL24 encoding tps and ψρ); and SEQID NO; 133 (pLybAL33 encoding tps and 'tpp), (0031} In some embodiments, the cel! accumulates at least about 0.1 mierograms of the disaccharide per minute per grain dry biomass, in some emlxtdiments, the cell accumulates at least about 0.1 micrograms of the disaccharide per minute per gram dry biomass up to about 10 micrograms of the disaceharide per minute per gram dry biomass.

[00321 In some embodiments, the ceil does not comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 70, SEQ ID NO: 72, and SEQ ID NO: 74, or a nucleotide variant thereof having at least 95% identity thereto and iovertase activity or sucraseferridoxin activity. In some embodiments, the ceil does not express a polypeptide Sequence selected from the group consistingof SEQ ID NO: 71, SEQ ID NO: 73, and SEQ· ID NO; 75, or a polypeptide variant thereof having at least 95% identity thereto and invertase activity or .sucraseferridoxin activity. In some embodiments, the cell expresses a small interfering RNA specific a nucleotide sequence selected from, the group consisting of SEQ ID NO: 70, SEQ ID NO: 72, and SEQ ID NO: 74, or a-nucleotide variant thereof having at least 95% identity' thereto and invertase activity or soeraxeferridoxin activity.

[00333 In some embodiments, the cell further comprises an isolated polynucleotide comprising SEQ ID NO: 94 or a sequence 95% identical thereto encoding an active porin polypeptide; an isolated polynucleotide encoding a polypeptide comprising SEQ ID NO: 95 or a sequence 95% identical thereto and having porin activity; or an isolated polynucleotide comprising SEQ ID NO: 91 (pLybAL32 encoding a porin); wherein the accumulated disaccachande is sucrose, the cell expresses porin, and the expressed porin secretes the accumulated sucrose from the cell [0034] Another aspect provides an artificial DNA construct. In some embodiments, the artificial DNA construct comprises at least one sequence selected from the group consisting of SEQ ID NO: 19 (pLybALl I encoding tis/}; SEQ ID NO: 20 (pLybALl 2 encoding as/}; SEQ ID NO: 44 (pLybALl 5 encoding a#; SEQ ID NO: 45 (pi ybALlb encoding asf); SEQ ID NO: 46 (pLybALl? encoding αφ; SEQ ID NO; 47 (pLyfeAT. S h encoding ®/}; SEQ ID NO: 48 (pLybAL 19 encoding as/); SEQ ID NO: 49 (pLyhAL21 encoding άφ; SEQ ID NO: 50 (pLybAI>22 encoding as/); SEQ1D NO: 51 (pLybAL13f encoding asj); SEQ ID NO: 52 (pLyAL13r encoding mj}; SEQ ID NO: 53 (pLybAL14f encoding asf); SEQ ID NO: 54 (pLybAEMr encoding mj); SEQ ID NO: 65 (pLybAL7f encoding asf); SEQ ID NO; 69 (pLybALSf encoding asf); SEQ ID NO: 118 (pLybAL23 encoding tps and tpp); SEQ ID NO: 121 {pLybAL28 encoding tps and tpp); SEQ ID NO: 122 (pLybAL29 encoding tps and tpp); SEQ ID NO: 123 (pLybALSQ encoding tps and tpp); SEQ ID NO: 124 {pLybALS I encoding tps m\&tpp); SEQ ID NO: 125 (pLybAL36 encoding tps and tpp); SEQ ID NO: 126 (pLybAL37 encoding tps mdtpp); SEQ ID NO: 130 (pLybAL24 encoding tps and tpp): SEQ ID NO: 133 (pLybAL33. encoding tps and tpp); SEQ ID NO: 91 (pLybAL32 encoding a porin); SEQ ID NO: 102 (pLybAUf encoding SS-L'PP); SEQ ID NO: 103 (pLybALSf encoding SE-UPP); SEQ ID NO; 106 CpLybALAFencoding SE~L.;PP); SEQ ID NO; 107 (pLybALPf enedding SE-IJPE); SEQ ID NO: 109 (pLybAL6fb encoding SE-IJPP); SEQ ID NO: 110 (pLybAEtQfb encoding SE-DPP); and SEQ ID NO; 91 (pLybAE32 encoding a porin). CO0351 Another aspect provides a method of c ul tivating a photosynthstie microorganism. The method of cultivating a photosyniheiic microorganism can use any of phdtobiOreaetor or device described above. The method comprises inoculating a cultivation support with photosynthetie microorganisms; cultivating the photosynthetie microorganisms on the inoculated cultivation support; and harvesting at least a portion of the cultivated phoiosyndietic microorganisms from, the cultivation support, in some embodiments, the method further comprises sealing the physical barrier of the photobsoreactor after the inoculation of the cultivation support such that all or a substantial portion of the cultivation of the photosynthetic microorganisms occurs while the physical barrier is sealed. In some embodiments, the physical barrier is releasabiy sealed. In some embodiments, the method further comprises conveying each cultivation support to an inoculation, station, a cultivation station, and a harvesting station, in some embodiments, the method further comprises at least one of: supplying fluid to the cultivation support; supplying nutrients to the cultivation, support; or supplying gas to the cultivation support. In some embodiments, the photosynthetie microorganisms are cultivated to a density of at least about 50 grams of dry biomass per liter equivalent. In some embodiments, the photosynthetie microorganisms comprise a transgenic photosynthetie microorganism engineered to accumulate a disaccharide, as described above.

[00361 Another aspect provides a method of producing, a fermentable sugar. The method producing a fermentable sugar can use .any of photobioreactor or device described above. The method of producing a fermentable sugar comprises inoculating a cultivation, support with photosynthetic microorganisms capable of accumulating a fermentable sugar; cultivating the photosynthetic microorganisms on the inoculated cultivation support; isolating accumulated fermentable sugar. In some embodiments, the fermentable sugar accumulates within tire photosynthetic microorganisms. In some embodiments, isolating the accumulated fermentable sugar comprises: '.harvesting at least a portion of the cultivated photosynthetic microorganisms from cultivation support; and recovering the fermentable sugars from the harvest, in some embodiments, the accumulated fermentable sugar is secreted from the photosynthetic nucroorgaamns and isolated from a cultivation media, In some embodiments, isolating the accumulated fermentable sugar comprises isolating the accumulated fermentable sugar from a cultivation media, in some embodiments, the method further composes releasably seating the physical harrier of the photobioreaqior after tire inoculation of the cultivation support such that all of a substantial portion of tire cultivation of the photosyrithetio microorganisms occurs while the physical barrier is sealed. In some, embodiments, ihe method further comprises at least one of; supplying fluid, to the cultivation support; supplying nutrients to the cultivation support; or |a»pplyi»g:ga6' to the cultivation support. 1ft some embodiments, the method further comprises conveying the cultivation support fo at least one of an inoculation station, a eultivation station, and a harvesting, station, [00373 In some embodiment;;. the method further comprises mducing synthesis of the fermentable sugar by the photosy mhetic microorganisms, in some embodiments, mducing synthesis of the fermentable sugar comprises exposing the photosynthetic· microorganism to an tadueing agent selected from the group consisting of temperature, pH, a metabolite, tight, an osmotic agent, a heavy metal, and. art antibiotic* In some embodiments, inducing synthesis of the fermentable sugar comprises treating the photosynthetic microorganisms with a salt compound.

In some embodiments, the salt compound is sodium chloride, in some embodiments, the salt compound is added at a concentration of between about 0*01 mM and 1.5 M or between about 0,2 and. 0.9 M. in some embodiments., the inducing agent is applied to the growth surface by aerosol spray. In some embodiments, the photosynthetic .microorganisms are cultivated to a density of at least about 50 grams of dry biomass per liter equivalent. la some embodiments, the fermentable sugar comprises at least oite sugar selected from the gmup consisting· of glucose, fructose, sucrose, trehalose, glitcosylgiyerol, and mannosyifructose. In some embodiments, the fermentable sugar comprises at least one sugar selected from the group consisting of sucrose and trehalose.

[0038] In some embodiments, the photosynthetic microorganisms comprise naturally occurring photosynthetic microorganisms. In some embodiments, the photosynthetic microorganisms comprise genetically modified photosynthetic microorganisms In some embodiments, tire photosynthetic microorganisms comprise cyanobacteria, to some emoodiments» the photosynthetic microorganisms comprise cyanobacteria selected from the group consisting of Synechococcus or Syneehocystis. In some embodiments, the photosynthetic microorganisms·comprise a-transgenic photosynthetic microorganism engineered to accumulate a disaceharide, as described above.

[00393 Other objects and features will be in part apparent and in part pointed out hereinafter.

BRIEF DESCRIPTION OF THE DRAWINGS

[00403 Those of skill in the art will understand that the drawings, described below, arc lot illustrative purposes Only. The drawings are not intended to limit the scope of the present teachings in any way.

[00413 FIG. 1 illustrates a front view of the photohioreacior of the invention including a solid cultivation support, an outer protective transparent barrier layer, a selective panel, resealable closures, and support elements tor suspending the device.

[0O423 FIG. 2 illustrates a side view of the photobioreaetor of the invention including a solid cultivation support, an outer protective transparent barrier layer, a selective panel, resealable closures, and support elements for suspending the device.

[ 0043 3 FIG. 3 illustrates an arrangement of multiple photobioreactors or culti vation supports ot the invention along multiple closed ..loop conveyor systems radiating out from common inoculation and harvesting. centers to comprise a photobioreaetor farm.

[0044] FIG.4 is & cartoon depicting photosynthetic production of sucrose in cyanobacteria.

[0045] FIG. 5 is a polypeptide sequence alignment of the Synechocystis spp, PCC 6803 (Ssp6803). sucrose phosphate synthase (SPS)and sucrose phosphate phosphatase (SPP) proteins with the Syneckococcits ekmgaim PCG 7942 (Selo7942) active SPS/SPP fusion (ASF). Ssp6803 contains separate genes encoding SPS and SPP activities. The SPS protein from SynechoeysMs spp, PCC 6803 hears a presumably inactive SPP domain, as many of the active site .residues are not conserved. The canonical HAD hydrolase active site residues are shown above the alignment with, conserved amino acids shown underlined and non-conscrved residues double underlined An eight amino acid insertion within the inactive SPP domain of Symekacyst&'fipp* PCC 6803 SPS is italicized. Further details regarding methodology are provided In Example 4. CO04S1 FIG. 6 is schematic depiction of pLybALI I, pLybALII allows construction of libraries of cyanobacteria! DMA and selection for promoter sequences. The promoteriess asf gene is behind bidirectional terininators, separated by a multiple cloning site {MGS). onV allows-for plasmid replication in most Gram-negative organisms. driT allows tor conjugal transfer of the plasmid from E. mb' to a chosen cyanobacterium (or other organism) with the assistance of the pRK2013 helper plasmid. Tire ]T lactamase gene (hla) is present for selection m £ mil DMA· libraries can be constructed in £. mb' by cloning cyanobacteria! genomic DMA into the MGS. The plasmid library can then be transferred to cyanobacteria by conjugation or direct transf ormation. Active promoters can then be isolated by selection for resistance to chloramphenicol through expression of the chloramphenicol acetyitrans (erase gene (cat). The strength of the promoters· can be assessed by both assay for chlorainphenicol acetyltraasierase. activity and direct examination of sucrose production. Further details regarding methodology arc provided in Example 5.

[0047] FIG. 7 is schematic depiction of pLybAl .12. pLybAL12 allows analysis of the capacity of preselected promoters to drive ^/'expression. The only difference between pLybAL 12 and pLybAL 11 is the presence of an acti ve promoter in front of the chloramphenicol acetyitransferase gene (cm). Specific DMA sequences isolated from cyanobacteria! chromosomal DMA amplified by PCR. can be cloned into the MCS. Both chloramphenicol and ampteiMrt. can be used for selection in E, colL The plasmid, library can then be transferred to cyanobacteria by conjugation or direct transformation. Plasmid bearing cyanobacteria can then be isolated by selection for resistance to chloramphenicol through expression of the chloramphenicol aectyltransierase gene (cat). The strength of the promoters can be assessed by both assay for chloramphenicol acetyl tmnsferase activity and direct examination of sucrose production. Further details, regarding methodology are pros ided in Example 5,.

[08481 FIG. 8 is a cartoon depicting construction of a cyanobacteria! promoter library. Further details regarding methodology are provided in Example 8, [00491 FIG, 9 is a schematic diagram depleting pSMART-LCRaii. Further details regarding methodology are provided in Example 8, [00503 FIG. 10 is a sequence· listing showing a possible promoter within Synechoeoccus elongates PCG 7941 asf, Shown is the amplified PGR product containing the asf gene from Symchocoecm elongates PGG 7942 that was cloned upstream of the ehloraoiphcmeol resistance marker. The regions of asf encoding the sucrose phosphate synthase and sucrose phosphate phosphatase polypeptide activities are single underlined and double Underlined, respectively. All DNA sequence elements are italicized and labeled above. Start and Stop represent the start and stop codons, respectively. SD represents the Shine-Delgamo sequence. The -35 and -10 regions of the putative promoters are highlighted in gray* Further details regarding methodology are provided in Example 8. {00511 FIG. H is a schematic diagram depicting a two-step protocol for markerless del etion of genes in the cyanobacteria I genome. This strategy assum es that the cyanobaeterial strain, being used has had its upp gene deleted. The upp gene wall, have been deleted during the sucrose biosynthetic insertions. The gene o f interest that has been targeted for deletion must be identified. The starting strainis resistant to 5-fluorouracil, hut sensitive to kanamycin,. The gene is either completely or partially deleted by the insertion of a cassette containing a kanamycin resistance marker and an active upp, making the strain resistant to kanamycin, but sensitive to 5~ fluorouracil. The upp and kanamycin resistance markers can then he removed, making the strain once again resistant to S-tiuoroumeil, but sensitive to kanamycin. Further details regarding methodology axe provided in Example 12. I Ο 0523 FIG, 12 is a schematic diagram of a photobioreaeior embodiment, FIG, 12A provides a front view while FIG, 128 provides a side view. The phoiobioreactor includes suspension element (6); culture media supply (S); gas supply i 10); growth surface (2); outer harrier layer (7); quick connector; and product harvest line (9), [ 0 0 53 3 PIG. 13 is a schematic diagram of a growth surface in a single material format (PIG. 13A) and a hybrid material format (FIG. 13B),

DETAILED DESCRIPTION OF THE INVENTION 10054] The present application relates to fermentable sugar accumulating photosynthetic microorganisms, solid-phase photoreactor devices, and methods of using each, 100553 In the fermentable sugar' accumulating phoiosynthetie microorganisms, it may he preferable to produce a dissaccharide sugar not generally utilized by the photosyntheti c microorganisms, which therefore can accumulate within the cultivated biomass (e,g., sucrose, trehalose). In some embodiments, photosynthetic microorganisms are genetically engineered to synthesize a dissacclmride sugar normally produced according to osmotic stress pathways (e.g., sucrose or trehalose) such that the sugar is produced in the absence of, or at reduced levels of, osmotic stress. Because of the greater efficiency and lower environmental impact of growing photosynthetk microorganisms compared to higher plants, the method represents important improvements in sustainability over .current biofuel production practices. Ad vantageously , the foregoing method of synthesizing a dissaccharide sugar has been adapted to occur within the photahioreaetorfs) of the present invention, £ S 0563 The photobioreactor described herein utilizes a solid cultivation support. Advantageously, the difficulty of providing adequate light exposures is alleviated, at least in part. Utilizing the aforementioned solid..cultivation support in a photobioreactor can allow for cultivation and growth of photosynthetie microorganisms at cell densities greater than those of •commercial-scale liquid phase biereaetors (e.g., cell densities in excess of 200 grams of dry biomass per liter equivalent). In addition, various embodiments of the photo bioreaetor desc ri bed herein can be operatedusing less energy and more simply than 'conventional commercial-scale liquid phase photobioreaetors.

[00571 Embodiments of the phofohioreacfor described hereia provide additional benefits over conveationai liquid phase photobioreaetors, For example, liquid systems typically require special equipment to deliver adequate eoacetitrations/amonnt of carbon dioxide to the photosyntlietie microorganisms to support their growth and photosynthesis. In contrast, by grooving the microorganisms on a solid cultivation support, carbon dioxide can be provided in a relatively simpl e, less costly manner, such as exposure to surrounding air. if additional carbon dioxide is desired, it can easily be delivered by, for example, adding it to the atmosphere (e.g., air) surrounding· or in contact with the cultivation support. Another benefit is ease of transport. Liquid phase photobioreactors can be a pond (completely immobile) or bulky tanks or collections of tubing. In contrast, in various embodiments, the photobioreactor is'flat and flexible, which allows for it or a multiplicity of them to be stacked, rolled up, folded, and/or configured in a similar manner for relatively easy transport, in various embodiments, the photobioreactor can be configured in a manner such that it is suspended from, a system that allows for easy conveyance of one or more photobioreaetors from one location to another. This portability may be utilized on a commercial scale to allow for efficient methods of handling and processing large numbers of photobioreaetors in a continuous-type manner.

[ Q 0581 One aspect of the application is directed to a method of fermentable sugar feedstock production by photosynthetic microorganisms. Preferably, the fermentable sugar is a fermentable disaecharide sugar. Examples of fermentable disaecharide sugars include, but are not limited to sucrose and trehalose. The fermentable sugar can be a disaecharide not generally utilized by photosynthetic microorganisms. For example, trehalose is not generally utilized by cyanobacteria and therefore can accumulate within the cultivated biomass without substantial degradation by endogenous metabolic pathways. The fermentable sugar can be a disaecharide that is generally utilized by photosynthetic microorganisms. For a disaceharide not used as a primary energy source, the disaceharide can often be accumulated to sufficient levels even in the presence of endogenous metabolic pathways. Where endogenous degradation path ways specific For the target fermentable sugar, the photosynthetic microorganism can be engineered to reduce or eliminate such activity. For example, a cyanobacterium engineered to accumulate sucrose cun be further engineered to reduce or eliminate sucrose inveriase activity. In various embodiments, strains of photosynthetic microorganisms that synthesize fennentable dTsaecharids sugar in response to osmotic or tnatriq water stress can be used, In other embodiments transgenic strains of photosynthetic microorganisms engineered to accumulate fermentable disaccharide sugar in the absence of, or reduced levels of, osmotic stress. .Advantageously, the foregoing methods of synthesizing: fermentable disaccharide sugar can be adapted io occur within photohioreaetors described herein, 100593 Becauseof the greater efficiency and lower enviionmental impact of growing photosynthetic microorganisms compared to higher plants, compositions, devices, and methods described herein represent important Improvements in .sustainability over current biofuel production practices.

[00601 Photosynthetic Microorganism [00613 Provided herein is a photosymthetiemieroo^anism genetically engineered, to accumulate a dissaccharide sugar. The photosynthetic microorganism can he, for example, a naturally photosynthetic microorganism, such as a cyanobacterium, or an engineered photosynthetic microorganism, such as an ariificialiy photosynthetic bacterium. Examples of the accumulated dissaccharide sugar include, but are not limited to sucrose, trehalose, gSuocosyiglyeerol, and mannosylirueiosc, in various embodiments, one or more genes encoding the ptoiein(s) responsible for producing the desired dissaccharide from corresponding phosphoiylated monomers is engineered in a host photosynthetic microorganism (e.g,, cyanobacterium) so as to result In the accumulation of the desired dissaccharide. In. some embodiments, an. endogenous pathway of the host photosynthetic microorganism is engineered so as to accumulate a dissaccharide sugar. For example, the osmotic sucrose pathway in cyanobacteria can be engineered to accumulate sucrose in the absence of osmotic stress. In some •embodiment^ an exogenous dissaccharide pathway is engineered in cyanobacteria so as to accumulate a dissaccharide· sugar. For example, the osmotic trehalose pathway from £< coli can be engineered to accumulate trehalose in cyanobacteria.

[0 0623 Synthase and Phosphatase [00633 A photosynthetic microorganism can be transformed so as to have a synthase, activity and a pbosphotase activity for the desired dissaccharide. For example, a cyanobacterium can be engineered to have sucrose phosphate synthase activity and sucrose phosphate phosphatase activity. As soother example, a eyariobaeterimii eao be engineered to have trehalose phosphate ..synthase activity and trehalose phosphate phosphatase activity. As another example, a cyanobacterium can be engineered to have gluocosylgiycera! phosphate synthase activity and giuocosylglycerol phosphate phosphatase activity. As another example, a cyanobacterium .qan.be engineered to have mannbsyTfhtciose phosphate synthase activity and maooosylfmctose phosphate phosphatase activity . It is contemplated,those activities can likewise be engineered in other phoiosynihetic microorganisms, [ 0 0 641 Synthase activity and phosphotase activity can be engineered into a photosynthetic microorganism by way of the individual genes, one encoding a polypeptide haying synthase activity and the other encoding a polypeptide having phosphatase acti vity; or by one gene encoding both synthase activity and phosphatase activity. For example, synthase activity and p hosphatase activity can be present in a fusion polypeptide.

[00651 The monomeric sugars of the desired dissaccharide can he endogenous or exogenous to the photosynthetie microorganism, Where monomeric sugars of the desired dissaechari.de are endogenous, the photosynthetie mieroorganism can be engineered to produce increased levels of such monomers. Where monomeric sugars of the desired dissaccharide are exogenous, the photosynthetic microorganism, can be engineered to produce such exogenous monomers.

[00661 The photosynthetie microorganism can be engineered to synthesize and acemmd&amp;te the desired dissaceharide continuously, alter some developmental state, or upon being induced to do so. Induction of dissaceharide synthesis can he according to the actions of an '.inducible promoter associated with the encoded synthase or phosphotase and an inducing agent, as discussed in further detail herein.

[00671 In some embodiments, transformed cyanobacteria, as described herein, can accumulate at least about 0,1. micrograms of a dissaccharide (e.g„ sucrose, trehalose, glucosyiglycerol, or mamtosyl fructose) per minute per gram .dry biomass, in some embodiments, transiformed cyanobacteria can accumulate at least about 0.1 up to about 10 m icrograms of a dissaccharide (e.g., sucrose, trehalose, glucosylglycero!, or mammsy I fructose) per minute per gram dry biomass. For example, transformed cyanobacteria can accumulate at least about 0.2, at least about 0,3, at least about 0,4, at least about 0,5, at least about 0.6, at least about 0.7, at least about 0.8, or at least about 0.9 micrograms of a dissaccharide (e.g,, sucrose, trehalose, glucosylglycerol, or manuosylfructose) per minute per gram dry biomass. In other embodiments, various ^transformed photosynthetic microorganisms accumulate similar amounts of a dissaccharide, [00681 It is contemplated that that various embodiments will accumulate a disaccharide (e.g,, .sucrose, trehalose, glucosylglycerol, or mannosylffuctose) at defined ranges of the values above. For example, some transformed cyanobacteria can: accumulate at least about 0.1 up to about 0.9 micrograms of a disaceharide (e.g., sucrose, trehalose, glucosylglycerol., or mannosyl fructose) per minute per gram dry' biomass; at least about 0..1 up to about 0.8 micrograms of a disaccharide (e.g., -sucrose, trehalose, glucosylglycerol, or mannosy I fructose) per minute per gram dry biomass; at least about 0.1 up to about 0.7 micrograms of a disaccharide (e.g,, sucrose, trehalose, glucosylglycerol, or manuosylfructose) per minute per gram dry Biomass; etc. Similarly, some transformed cyanobacteria can .accumulate at least about 0.2 up to about 1.0 mierograms of a disaccharide (e.g., sucrose, trehalose, glucosylglycerol, or mannosylifuctose) per minute per gram dry biomass; at least about 0,3 up to about 1,0 micrograms of a disaccharide (e.g., sucrose, trehalose, glucosylglycerol, or mannosylfructose) per minute per gram dry biomass; at least about 0.4 up to about .1.0 mierograms of a disaccharide (e.g,, sucrose, trehalose, glucosylglycerol, or mannosylifuctose) per minute per gram dry biomass; at least about 0.5 Up to about 1.0 mierograms of a disaccharide (e.g,, sucrose, trehalose, glucosylglycerol, or - mannosylfructose) per minute per gram dry biomass; at least about 0.6 up to about 1.0 mierograms. of a disaccharide (e.g., sucrose, trehalose, glucosylglycerol, or manBQsylfructose) per minute per gram dry biomass; at least about 0.7 up to about 1.0 mierograms of a disaceharide (e.g., sucrose, trehalose, glucosylglycerol; or maanosylfruetose) per minute per gram dry biomass; at least about 0,8 up to about 1,0 mierograms of a disaceharide (e.g., sucrose, trehalose, glucosylglycerol, or mamtosylfructose) per minute per gram dry biomass; or at least about 0.9 up to about 1.0 mierograms of a disaceharide (e.g., sucrose, trehalose, glucosylglycerol, or mamrosylffuetose) per minute per gram: dry biomass. Methods for assaying sugar accumulation is host cells are well-kuov-'h to those of skill in the art (see eg.. Example 10). irnssi Host £00703 The host genetically engineered to accumulate a dissaecharide sugar can be any phofosyuthehcmktootgfiuiism. The photosynthetic microorganism can be, for example, a naturally photosynthetic mieroorganisni, such as a cyanobacterium, or an engineered photo-synthetic microorganism, such as an .ariificiaUy-photosynthetic bacterium. Exemplary mlcroorgansims that are either naturally photosynthetic or can be engineered to be photosynthetie include, bin are not limited to,, bacteria; fungi; archaea; protists; microscopic plants, such as a green algae; and animals such as plankton, planarian, and amoeba. Examples of naturally occurring photosynthetic microorganisms include, but are not limited to* Spirdina maximum, Spirulina platensis, Dunaliella Safina,Botryeoceus breunii, Chlorella vulgaris, Chlorella pyrenoidosa, Serenastram captieomutum, Scenedesmus auadrieauda, Porphyridium omentum, Scenedesmus acutus, Dunaliella sp„ Scenedesmus obliqnus, Anabaenopsis, Aulosira, Cylmdrospermum, Syneehoecus sp., Synechocystis sp., and/or. Tolypdthrix. 1Ό.0713 Preferably, the host photosynthetie microorganism is a cyanohaeteriura. Cyanobacteria, also known as blue-green algae, are a bread range of oxygengenie photoaitiotophs. The host cyanobacterium can be any photosynthetie microorganism from the phylum Cyanophyta, The host cyanobacterium can have a unicellular or colonial (e,g.·., filaments, sheets, or balls) morphology. Preferably, the host cyanobacterium is a unicellular cyanobacterium. Examples of cyanobacteria that can be.engineered to 'accumulate a disaccharide sugar-include, but are not limited to, the genus.Syncchocystis, Synechococcus, Theirnosynechococcus, Nostoc, ProchlorococcUj Microcystis, Anabaena, Spirulina, and Gloeobacter, Preferably the host cyanobacterium is a Syneehocysris spp. or SyuechocOccus spp. More preferably, the host cyanobacterium is Smechococcm ekmgatm PCC 7942 (ATCC 33912) and/or Syneehocysris spp. PCC 6803 (ATCC 27.184), [00721 Sucrose £00733 Biosynthesis of sucrose in a photosynthetic imcroorganism, such as cyanobacteria, .can be accomplished through the catalytic action of two enzyme acti vities, sucrose phosphate synthase (sps) and sucrose phosphate phosphatase-fspp), functioning in sequence (sen e.g,, FIG. 4). Such activities are present in some cyanobacteria for acclimation to osmotic sad raatrie water stress (see?7g,t Luna, 1E, 2002, Plant Physiol 128, 1490-1500). Eitheror both of these activities can be engineered in a cyanobacterium so as to remit in accumulation .of sucrose. f 0 07 4 J A gene of particular interest for engineering a photosyntheric microorganism to accumulate sucrose is the active ψχ/.φρ fusion (as/)·gene from Syneehomcem ekwgaws FCC 7942, Asfhas both spsmdspp biosynthetic functions1 (me e,g., Example 4). In some embodiments, an ASF-encodmg nucleotide sequence is cloned from its native source (e g,, Symchacmxm elongate® PCC 7942) and inserted into a host cyanobacterium·(see e.g,y Examples 4-9), In some embodiments, a transformed host photosynthetic microorganism comprises an <*sf polynucleotide of S EQ ID MO: I, In some embodiments,, a pbotosynthetie microorganism: is transformed with a nucleotide sequence encoding ASF polypeptide of S EQ ID MO: 2. In further·embodiments, a transformed host photosymthetlc mierdorganism comprises a dncleotide sequence having at least about 80% sequence identity to SEQ ID MO: 1 or a nucleotide sequence encoding a polypeptide having sps and spp activity and at least about 80% sequence Identity to SEQ ID MO: 2, As an example, a transformed host photosynthetic microorganism, such as a cyanobacterium, can comprise a nucleotide sequence having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID MO: 1, wherein the transformed host exhibits ASF, SPS, and/or SPP activity' 3114% accumulation of sucrose. As an exappb, a transformed host photosynihetie microorganism: can comprise a nucleotide sequence encoding a polypeptide haying at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID MO; 2, wherein the transformed host exhibits ASF, SPS, and/or SPP activity and/or accumulation'of sucrose. As another example, a transformed host photosyntheric microorganism can comprise a nucleotide sequence that hybridizes under stringent conditions to SEQ ID NO; 1 over the entire length of SEQ ID MO; l, and which encodes an active SPS/SPP fusion t ASP) polypeptide. As a further example, a transformed host photosynihetie microorganism can comprise the complement to any of the above sequences, 100751 In some embodiments, a sucrose phosphate synthase (sps) (see e.g„ SEQ ID NO: 3 encoding sps gene and SEQ ID NO: 4 encoding SPS polypeptide}, or homologue thereof, is engineered to be expressed or overexpressed in a transformed photosynihetie microorganism.

For example, a photosynthetie microorganism. can be transformed with·* nucleotide.'having, a sequence ol SEQ ID NO: 3 so as to express sucrose phosphate synthase. As another example, a. photosynthetie microorganism can. be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO: 3 encoding a polypeptide having sucrose phosphate synthase. As another example, a transformed host photosynthetie miemorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO: 4, wherein the transformed host exhibits SPS activity and/or accumulation, of sucrose.

[00763 In some embodiments, sucrose phosphate phosphatase (.ψρ) (see e.g,, SEQ ID MO: 5 encoding ψρ gene and SEQ ID NO; 6 encoding SPP polypeptide),, or homologue thereof, is engineered to be expressed or overexpressed in a transformed photosynthetic microorganism. For example, a phofosyathetic microorganism, such as a cyanobacterium, can be transformed with a nucleotide having a sequence of SEQ ID NO: 5 so as to express sucrose phosphate phosphatase. As another example, a photosynthetic microorganism can be transformed with a nucleotide-having at least about 80%, at least about 85%, at least about. 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO: 5 encoding a polypeptide having sucrose phosphate phosphatase activity. As another example, a transformed host photosynthetie-microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO : 6, wherein the transformed host .exhibits- SPP activity and/or accumulation of sucrose. 100773 in some embodiments, a photosynthetic microorganism is engineered to express one or more of ASF, SPS, and/or SPP. For example, a photosynthetic microorganism, such as a cyanobacteriura, can he engineered to express ASF and SPS; ASF and SPP; SPS and SPP; or ASF, SPS, and SPP, 100783 Trehalose [00793 Biosynthesis of trehalose can be accomplished through the catalytic action, of two enzyme activities, trehalose phosphate synthase (tps) and trehalose phosphate phosphatase (φρ), fonettoning in sequence. Either or both of these activities can be engineered in a photosynthetic microorganism so as to result in accumulation of trehalose, Biosynthesis of trehalose does not naturally occur in some photosynthetic microorganisms, such m cyanobacteria, tG080] In some embodiments, a trehalose phosphate .synthase (tps)(sce.e.g* SEQ ID NO: 76 encoding ips gene and SEQ ID NO: 77 encoding TPS polypeptide}, or homologue thereof, is engineered to he expressed or overexpressed in a transformed photosynthetic microorganism. For example, a photosynthetic miemorganism, such as cyanobacterium, can be transformed with a nucleotide .having a sequence of SEQ ID NO: 76 so as to express trehalose phosphate synthase. As another example, a photosynthetic microorganism can he transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO: 76 encoding a polypeptide having trehalose phosphate synthase. As another example, a transformed host photosynthetic microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identify to SEQ ID NO: 77, wherein the transformed host exhibits TPS acti vity andiar accumulation of trehalose.

[00811 In some embodiments, trehalose phosphate phosphatase t tpp) (see e.g„ SEQ ID NO: 78 encoding tpp gene and SEQ ID NO: 79 encoding TPP polypeptide), or homologue thereof, is engineered to be expressed, or overexpressed in a txarmibmted photosymthetic microorganism. For example, a photosynthetic microorganism, such as a cyanobacterium, can bedransfomted with a nucleotide having a sequence of SEQ ID NO: 78 so as to express trehalose phosphate phosphatase. As another example, a photosynthetic microorganism can be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least abou t 99% percent identity to SEQ ID NO: 78 encoding a polypeptide having trehalose phosphate phosphatase activity. As another example, a transformed host photosynthetic microorganism can comprise a nucleotide sequence; encoding a polypeptide having at least about 85%, at least about 90%. at least about 95%, or at least about 99% sequence identity to SEQ ID NO: 79, wherein the •transformed host exhibits TPP activity hh'd/or accumulation of trehalose.

[ δ 0 821 Ci iueosy tglycerol 100833 in some embodiments, a gJueosylglycerolphosphate synthase .'(gas) (see e.g.s SEQ ID NO: 80 encoding gp gene and SEQ ID NO: 81 encoding GPS polypeptide), or iiotnoiogue thereof, is engineered to be expressed or overexpressed in a transformed phoiosynthetie microorganism. For example, a photosynthetic microorganism , such, as a cyanobacterium, can he transformed with a nucleotide having a sequence of SEQ ID NO: 80 so as to express glueosylgiyeerolphosphate synthase. As another example, a photosynthetic microorganism can be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO: 80 encoding a polypeptide having ghieosylglycemiphosphaie synthase. As another example, a transformed host piiotosynthetie miemorgsoisni can comprise a nucleotide sequence encoding a polypeptide having at least about.85%, at least about 90%, at least about 95%, or at least about 99% sequence identify to SEQ ID NO: 81, wherein the transformed host exhibits GPS activity and/or accumulation of glucosylgycerol, [00843 In some embodiments, glueosylgiyeerolphosphate phosphatase (gpp) (see e,g,, SEQ ID NO: 82 encodinggpp gene and SEQ ID NO: 83 encoding GPP polypeptide), or homologue thereof, is engineered to be expressed or overexpressed in a transformed photosyntheiic microorganism. For example, a photmynthetic microorganism, such as a cyanobacterium, can be tmnsfbmied with a nucleotide having a sequence of SEQ ID NO: 82 so as to express glueosylgfycereiphosphate phosphatase. As another example, a phoiosynthetie microorganism can be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 909¾ at least about 95%, or at least about 99% percent identity to $BQ ID NO; 82 encoding a polypeptide having glucosyi g! yceroIphosphate phosphatase activity. As another example, a transformed host piiotosynthetie microorganism can comprise a nucleotide Sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identify to SEQ ID NO; 83, wherein the transformed host exhibits GPP activity and/or accumulation of. glucosylgycerol.

[00853 Matmosylfractose [00863 In some embodiments, a matmosylfructose phosphate synthase (mps) (see e,g,, SEQ ID NO: 84 encoding mps gene and SEQ ID NO: 85 encoding MPS polypeptide), or homologue thereof, is engineered to be expressed or overexpressed in a transformed photosynthetic microorganism. For example, aphotosynthetie microorganism, such as a cyanobacterium, can be transformed with a.nucleotide having a sequence of SEQ ID NO: 84 so as to express mannosylfruetose phosphate synthase. As another example, a photosyniheiie microorganism can be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO: 84 encoding a polypeptide having mannosytfructose phosphate synthase. As another example, a transformed host photosynthetie microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at least about 90%, at least about 95%, or at least about 99% sequence identity to SEQ ID NO: 85, wherein the transformed host, exhibits MPS activity and/or accumulation of mannosylfructpse, [00873 In some embodiments, mannosylfructose phosphate phosphatase (mpp) (see e.g., SEQ ID NO: 86 encoding mpp gene and SEQ ID NO: 87 encoding MPP polypeptide), or homoiogue thereof, is engineered to be expressed or overexpressed in a transformed photosynthetic microorganism. For example, a photosynthetle microorganism, such as a cyanobacterium, can he transformed with a nucleotide having» sequence of SEQ ID NO: 86 so as to express mannosylfruciose phosphate phosphatase. As another example, a photosyitthetlc microorganism can be transformed with a nucleotide having at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% percent identity to SEQ ID NO: 86 encoding a polypeptide having mannosylfructose phosphate phosphatase activity. As another example, a transformed host photosynthetle microorganism can comprise a nucleotide sequence encoding a polypeptide having at least about 85%, at least about '99%, at least about 95%. or at least about 99% sequence identity to SEQ ID NO: 87, wherein the transformed host exhibits MPP activity and/or accumulation of mannosylfructose.

[00881 Molecular Engineering [00891 Design, generation, and testing of the variant; nucleotides, and their encoded polypeptides, having the above required percent identities to an asfsequence and retaining a required activity of the expressed protein and/or sugar accumulation phenotype is. within the skill of the art. For example, directed evolution and rapid isolation of mutants can be according to methods described in references including, but not limited to. Link el ah (2007) Nature Reviews 5(9), 680-688; Sanger et ai. (1991) Gene 97(1), 119-123; Ghadessy et.al. (2001) Proc Natl Acad

Sci USA 98(8) 4552-4557. Thus, one skilled in. the art could generate alarge number of nucleotide (e.g;, mf, spst spps tps, tpp, gps> gpp, mpst or mpp) and/or polypeptide (e.g„ ASF, SPS, SPP, TPS, TPP, GPS, GPP, MPS, or MPP) variants having, for example, ai least 95-99% identity to the reference sequence described herein and screen such for phenotypes including disaccharide accumulation according to methods routine in the art. Generally, conservative substitutions can be made at any position so long as the required'Activity is retained, [00901 Nucleotide and/or amino acid sequence identity percent (%) is understood as the percentage of nucleotide or amino acid residues that are identical wi th nucleotide or amino acid residues in a candidate sequence in comparison to a reference sequence when the two sequences are aligned. To determine percent identity, .sequences are aligned and if necessary, gaps are introduced to achieve the maximum percent sequence identity. Sequence alignment procedures to determine percent identity are well known to those of skill in the art Often publicly available computer software such as BLAST, BLASTS, ALIGN2 or Megaiign (DNASTAR) software is used to align sequences. Those skilled in the art can determine •appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared. When sequences are aligned, the percent sequence identity of a given sequence A to, with, or against a given sequence 8 (which can alternatively be phrased as a given sequence A that has or comprises a certain percent sequence identity to, with, or against a given sequence 8) can be calculated as: percent sequence identity = X/YIG0, where X is the number of residues scored as identical matches by the sequence alignment program’s or algorithm’s alignment of A and B and Y is the total number of residues in B. If the length of sequence A is not equal to the l ength of sequence B, the percent sequence identi ty of A to B will not equal tire percent sequence identity of B to A, [00911 ‘‘Highly stringent .hybridization conditions” are defined as hybridization at 65 WG in a 6 X SSC buffer {/..&amp;, 0.9 M sodium chloride and 0.09 M sodium citrate). Given these conditions, a deteonination cab he made as towhetber a given set of sequences will hybridize by calculating the melting temperature (¾ of a DN A duplex between the two sequences . If a particular duplex has a melting temperature lower than 6S°C in the salt conditions of a 6 X SSC, then the two sequences will not hybridize. On the other hand, if the melting temperature is above 65 °C in the same salt conditions, then the sequences will hybridize. In general, the melting temperature for toy hybridized DNA:DNA sequence eah be determmed usiag the following formula: Tw· - 81.5 °C' + 16.6(log«i[Na, j) -f 0,4 Infraction G/C content) - 0:63(¾ Fanraarai.de) - (600/1), Furthermore, the Tw of a DNAtDNA hybrid' is decreased by l~l,5°C for every 1% decrease in nucleotide identity (see e.g., S.^^k'and'li«ssei, 2006). £00921 Host ceils can be transformed using a variety of standard techniques known to the ad (see, eg., Stettbrook and Russel (:2006) Condensed Pmtocob fk>m Molecular Cloning: A Laboratoi-y Manual, Cold Spring Harbor Laboratory Press, ISBN-10: 0879697717; Aasubel ct al. (2002) Shod Protocols in Molecular Biology, 5th e&amp;,:Current Protocols, ISBN-10; 0471250929; Sambtook and Russel (2001) Molecular Cloning; A Laboratory Manual, 3d ed., Cold Spring Harbor Laboratory Press, ISBN-10:0879695773; Elhai, J. and. Wolk, C, P. 1988, Methods in Brazymology 167, 747-754). Such techniques include, but are not limited to, viral infection, calcium phosphate transfection, liposome-mediated transfection, microprojectile-mediated 'delivery, receptor-mediated uptake, cell fusion, electroporation, amt the. like. The transfected ceils can be selected and propagated to provide recombinant host cells that comprise the expression vector stably integrated in the host cell genome. £00931 Promoter £0094] One or more of the nucleotide sequences discussed above (e.g., asp sps, spp, q?s, φρ% mp.\, mpp. gpx, gpp) cmi he operably linked to a promoter that can function in the host phestosyn thetic microorganism. Where the host is cyanobacteria, preferably, the promoter can function efficiently in both cyanobacteria and a bacteria, such as E. coli. Promoter selection can al low·· expression of a desired gene product under a variety of condi tions. £00951 .Promoters can be selected for optimal function in a photosynthetie microorganism host cell, such as a cyanobacterium, into which the vector construct will be inserted . Promoters can also be selected on the basis of their regulator features. Examples of such features include enhancement, of traiiseriptionai activity and mducftnlity. £ 0 O 9 61 The promoter can be an inducible promoter. For example, the promoter can be induced according to temperature, pH, a hormone, a metabolite (e.g., lactose, mannitol, an amino, acid), light (eg., wavelength specific), osmotic potential (e.g., salt induced), a heavy metal, or an anti biotic. Numerous standard inducibl e promoters yttt! be known to one of skill in the art. 100973 In some embodiments, the promoter is a temperature inducible promoter. For example, the Lambda promoter is a temperature inducible promoter that can function M cyanobacteria. Surprisingly, the Lambda promoter functions at a temperature different than when utilized in ,E, coll. In E. coil, the Lambda promoter is most acti ve at 42°C, a temperature above the normal viability range for cyanobacteria. Generally, in E. coil, the Lambda promoter has about a 5% to 10% increased expression from about30°€ to 350€ and at about :37CC has about a 20% increased expression; but from about 370€ to 42°C provides about 100% increased expression. In cyanobacteria, the Lambda promoter is most active at around 30°C to 35°€, an ideal, growth temperature range tor cyanobacteria and a range much lower than optimal expression of the Lambda promoter in B, coll. So, the Lambda promoter provides for-effective: expression of disaeeharide biotsynthetie actiyi ty in cyanabcieria. C00983 Examples of promoters that can be inserted into the plasmid include, but are not limited to, carB, nmd, pshMi, dnaK,JeatA, and .¾¾ (see e.jp, Example 6). in some embodiments, the promoter can function efficiently In both cyanobacteria and '&amp; c&amp;H. la some embodiments, the as/coding region comprises a promoter with said coding region..(see e,g.y Example 8). For example, the asf coding region can Comprise a promoter In fron t of the SEP domain of asf (see e.g,, FIG, 10). Such an internal promoter cab occur with of without a promoter at the start of the aif coding region.

[00991 The term "ciumerie" is understood to refer to the product of the fusion of portions-of two or. more different polynucleotide molecules. “Chimeric promoter" is understood to refer to a promoter produced through the manipulation of known promoters or other polynucleotide molecules. Such chimeric promoters can combine enhancer domains that can confer or modulate gene expression from one or more promoters or regulator)’ elements, for example, by fusing a heterologous enhancer domain from’ a first promoter to a second promoter with its own partial or complete regulatory elements. Thus, the design, construction, and use of chimeric promoters according to the· methods disclosed herein lor modulating the expression of operabiy linked polynucleotide sequences arc encompassed by the present invention.

[010 0 3 Novel chimeric promoters can be designed or engineered by a number of methods. For example, a chimeric promoter may be produced by fusing an enhancer domain from a first promoter to a second promoter* The resultant chimeric promoter may have novel expression properties relative to the first or second promoters, Novel chimeric promoters can be constructed such that the enhancer domain from a first promoter is feed at the 5' end, at the 3’ end, or at any position interna! to the second promoter.

[01011 Constructs £0102} Any of the transmbabie polynucleotide molecule sequences described above can be provided in a construct. Constructs of the present invention generally include a promoter fenctional In the host photosynthetic microorganism, -such as cyanobacteria, operably linked to a transeribable polynucleotide molecule for disaceharide biosynthesis (e.g„ mjl sps, spp, tps, tpp, mps, mpp, gps, gpp), such as provided in SEQ ID NO: 1,3,5,76,78, 80,82, 84, and 86, and variants thereof as discussed above. £ 01031 Exemplary promoters are discussed above. One or more additional promoters may also be provided in the recombinant construct. These promoters can. be operably linked to any of the transeribable .polynucleotide molecule sequences described above.

[ 01041 The term “construct* is understood to refer to any recombinant polynucleotide molecule such as a plasmid, eosmid, virus, autonomously replicating polynucleotide molecule, phage, or linear or circular single-stranded or double-stranded DMA or RNA polynucleotide molecule, derived from any source, capable of genomic integration or autonomous replication, comprising a polynucleotide molecule where one or more polynucleotide molecule has been linked in a functionally operative manner, be. operably linked. The term "vector" or '’vector construct" is understood to refer to any recombinant polynucleotide construct that may be used for the purpose of transformation, te., the in troduction of heterologous 0ΝΑ into a host photosynthetlc microorganism, such as a cyanobacterium.

[01053 In addition, constructs may include, but are not limited to, additioual polynucleotide molecules from an untranslated region of the geneof interest. These additional polynucleotide molecules can he derived from a source that is native or heterologous with respect to the other elements present in the construct.

[OIOS] Plasmid E0107 ] in some-embodiments, a -host photosynthetie microorganisms, such as a cyanobacterium, is transformed with a |>lasmid-based expression system (see e.g„ Example 5), Preferably the plasmid encoding tire gene ;of interest comprises a promoter, such as one or more of those discussed above. For piasmid based transformation, preferred is a broad host range plasmid that enables function in both £ ep/i .and cyanobacteria, which provides the advantage of working in a convenient fast growing well understood system (E. coU) that can be efficiently transferred to the final host (cyanobacteria), in some embodiments, plasmid based transformation and-.chromosomal integration are used in oohjunctkm,.where the plasmid protocol is usedfor design and testing of gene variants followed by clnomosomal integration of identified variants, [ 010 8 J Host strains developed according to the japptpach.es described herein can be evaluated by a number of means known in the art (see %gh Studier (2005) Protein Expr Purif. 41(1), 207-234* Gellissen, ed. (2005) Production of Recombinant Pmtems: Novel Microbial and Eukaryotic Expression Systems, Wiley-VGH, ISBN-1'0-: 3527310363; Bancyx- (2004) Protein Expression Technologies,: Taylor &amp; Francis, ISBN-10:0954523253), 101093 Provided herein are nucleotide sequences forptesrriid eonstniets encoding spp, and/οr asf. Examples of plasmid constructs encoding sps, spp, and/or as/'iiiciudc, but are not limited to, pLybALl 1 (SEQ ID NO: .19) (see e.g., FIG. 6) and pLybALl 2 (SEQ ID NO: 20) (tee e.g.t FIG. 7). Also provided herein are nucleotide sequences for plasmid constructs encoding tps and tpp. Examples of plasmid constructs encoding tps and tpp include, but are not limited to, pLybAL23 (SEQ ID NO: 118). A skilled artisan will understand that similar contxucts can be generated for biosynth etic genes necessary for accumulation of other disaccharides, such as glucosy I glycerol and rnanrsosy lfrisctose.

[01101 In some embodiments, the transformed host photosynthetie microorganism comprises pL-ybAL 11 (SEQ ID NO: 19} or pLybALl 2 (SEQ ID.NO: 20). In some embodiments, the transformed host photosynthetic mteroorganism comprises pLybAL23 (SEQ ID NO: 118). For example, a transformed cyanobacterium can comprise pLybALl 1 (SEQ ID NO: 19), pLybALI2 (SEQ ID NO: 20), orpLybAL23 (SEQ ID NO: 118). 1011X3 A plasmid construct comprising a disacchari.de biosynthetic gene(s) can also include a promoter. Examples of plasmid constructs comprising sps, spp, and/or as/'and a promoter include, but are not limited to, pLybAL7f iSEQ ID NO: 65); pLyhALSfj including kanamycia resistance (SEQ ID NO: 69); pl.ybAL13f (SEQ ID NO; 51), pLyAL13r (SEQ ID NO: 52), pLybALMf (SEQ ID NO: 53), pLyhAL J 4r (SEQ ID NO: 54), pLybAL 15 (SEQ ID NO: 44), pLybAL.16 (SEQ ID NO: 45), pLybALl 7 (SEQ ID NO: 46), pLybAL 18 (SEQ ID NO·: 47). p.LybAL'I9 (SEQ ID NO; 48), pLybAL21 (SEQ ID NO; 49), andpLybAL22 (SEQ ID NO: 50). Examples of plasmid constructs comprising tps and tpp and a promoter include, but are not limited to, pLybAI.,23 (SEQ ID NO: 118), pLybAL28 (SEQ ID NO; 121), pLybAL29 (SEQ ID NO: 122), and pLybAL30 (SEQ ID NO: 123). A skilled artisan will understand that similar promoter containing contructs can be generated for biosynthetic genes necessary lor accumulation of other disaccharides, such as gl ueosylgtycerol and roarmosy Ifructose.

[0112 3 In some embodiments, die transformed host cyanobacterium comprises pLybAI,7f (SEQ ID NO: 65); pLybALSf (SEQ ID NO: 69); pLybAL 5 3f (SEQ ID NO: 51), pLyAU3r (SEQ ID NO; 52), pLybAL 14f (SEQ ID NO. 53), pLybALMr (SEQ.lD NfO: 54), pLybAL 15 (SEQ ID NO: 44), pLybALl 6 (SEQ ID NO; 45), pLybAL 17 (SEQ ID NO: 46), pLybALll (SEQ ID NO: 47), pLybAL 19 (SEQ ID NO; 48), ptybAL2I (SEQ ID NO: 49), and pLybAL22 (SEQ ID NO; 50), In some embodiments, the transformed host cyanobacterium comprises pLybAL28 (SEQ ID NO: 121), pLybAL29 (SEQ ID NO: 122), pl.ybAL30 (SEQ ID NO; 123), and pLybAL23 (SEQ ID NO; 118). E 01131 S ugar Secretion [01143 In various embodiments, a transibrnieddisaccharide-accumulating photosynthetic microorganism can secrete die accumulated dNaeehatide from within the cell into its growth environment. Secretion of the disaecharide can be an inherent effect of transforming the photosynthetic microorganism to accumulate a disaecharide or the photosynthetic microorganism can be further engineered to secrete the disaccharide. For example, some cyanobacteria transformed to accumulate trehalose inherently secrete trehalose from the cell (see e.g·, Examples 19-20). As another example, a cyanobacterium transformed to accumulate sucrose can be further engineered to secrete sucrose from the cell (see e.g., Example 16).

[01153 A host photosynthetie microorganism:, such.as a cyanobacterium, can be farther engineered to secrete a dtsaediaride. In some embodiment, a transformed host photosynthetie microorganism is engineered to express a pork specific for the accumulated disaecharide, For example, a cyanobacterium engineered to accumulate sucrose can be farther engineered to express a sucrose pork (see e.g., Example 16). in one embodiment, the transformed disacchmide-aceumulatmg cyanobacterium comprises aiixcr.F nueIeic acid, such as SEQ ID NO: 94, In one embodiment, the transformed disaceharide~aceum.ulatkg cyanobacterium comprises a nucleic acid encoding a serf polypeptide, such as SBQ ID NO: 95. In one embodiment, the transformed disacchsride-accumulatkg cyanobacteriumcomprises a plasmid containing serf, such as pEybAL32 (SBQ ID NO; ..91), It is contemplated that a similar approach can be applied to other pbotosynthetic microorganisms or other target disaecharides .

[01161 Modulation of Sugar Degradation [ 01173 In some embodiments, a host photosynthetie microorganism, such as a cyanobacterium, is further engineered to improve disaccharide production by modulation of degradation activity (see e,g., Example 14). In some embodiments, m kvertase homologue can be dowmreplated or eliminated k a tmnsiormed piiotosykhetic mieroorgansim. For example an inveriase homolope from %neeko(ysti$ i^p. POC 6803 (nucleotide sequence SBQ ID NO; 70: polypeptide sequence SEQ ID NO: 71) can be down-regulated or eliminated k a transformed cyanobacterium. As another· example, an kvertase homologue from Synechococcm eimgatm FCC 7942 (nucleotide sequence SEQ ID NO; 72; polypeptide sequence SEQ ID NO: 73) can be down > opiated or eiimkated k a transformed cyanobacterium. In some embodiments, a sucrasefei i edoxin-like protein is down-regulated or eliminated k a transformed cyanobacteriuma. For example, a sueraseferredoxin-like protein teamSyn@cho(&amp;$ti$ spp. PCC 6803 (nucleotide sequence SEQ ID NO: 74; polypeptide sequence SEQ ID NO: 75) (Maehray G.C. ei ai. 1994, FEBS Lett 354, 123-127) can be down-regulated or eliminated in a transformed cyanobacterium. These genes can be deleted using the marfcerless deletion protocol described in, for example, FIG. 11 (see e.g., Examples 12-13) A similar approach can be taken for other disaecharides engineered to be accumulated in a cyanobacterium.

[01183 Other methods of down-regulation or silencing the above genes are known in the art. For example, disaecharide degradative activity can be down-regulated or eliminated using antisense ollgomicleotides, protein aptainers, nueelodde aptatnem, and RNA interference-(RNAi) (e.g,, small interfering RNAs (siRNA}, short hairpin. RMA (shRNA), and micro RNAs (mlRNA) (see e.g., Fanning arid Symonds (2006) Handb Exp Pharmacol. .173,289-3030, describing hammerhead ribozymes and small hairpin RNA; Helene, €,, elal. (1992) Ann., Ν.Ϋ, Acad. Set 060,27-36; Maher (1992) Bioassays 14(12): 807-15, describing targeting deoxyribonucleotide sequences; Lee et al, (2006) Ctirr Opin. Chem BtoL-10,1-8, describing apmmers; Reynolds et al. (2004) Nature Biotechnology 22(3), 326 - 330, describing RNAi; Pushpara) and Melendez (2006) Clinical and Experimental Pharmacology and Physiology 33(5-6), 504-510, describing RNAi; Dillon et al. (2005) Annual Review of Physiology 67,147-173, describing RNAi; Dykxhoora and Lieberman (2005) Annual Review of Medicine 56,401-423, describing RNAi). RNAi molecules are-commercially available from a variety of sources (e.g., Arahion, TX; Sigma· Aldrich, MO; Invitrogen), Several siRNA molecule design programs -using a variety of algorithms are known to the art (.see e.g., Cenix algorithm, Ambion; BLOCK-iT™ RNAi Designer, Invitrogen: siRNA Whitehead Institute Design Tools, Bioinoiromfics &amp; Research Computing). Traits -influential, in defining optimal siRNA sequences include G/C content at the termini of the stRNAs, Tm of specific internal domains of the siRNA, siRNA length, position of the target sequence within the CDS (coding region), and nucleotide content of ttte 3* overhangs, [01193 In some embodiments, a host photosynthetic microorganism con be further engineered to promote disaccharide secretion from the cells. For example, a cyanobacterium can be further engineered to promote sucrose secretion from the cells (.see e.g., Example 15-16). When in a low osmotic environment, the sucrose can be automatically expunged from the cells, as done with osomoprotectants by some organisms when transitioning from high to-, low salt environments (Sehleyer, M,, Schmidt, R, and Bafcker, E. P, 1993, Arch Microbiol .160,424-43; Koo, S, P,, Higgins, C. F, and Booth, 1. R. 1991. J Gen Microbiol 137, 2617-2625; Lamark, T., Styrvoid, Ο. B. and Strgim, A, R. 1992. FBMS Microbiol, Lett 96, 149-154). Sucrose porins can be engineered to be expressed in a transttrmed cyanobacterium (see e.g,, Example 16). These genes can be cloned and transformed into cyanobacteria according to techniques described above. Such approaches can be adapted to other photosynthetie microorganisms. 101203 hi some embodiments, a tost photosynihetic mieroorgamsm is trmsformed by stable integration into a chromosome of the host. For example, a. host cyanobacterium can be transformed by stable integration into a chromosome of the host fee e.g,, Examples 11-13). Chromosomal integration can insore that the target genets) is installed into the organism without risk of expulsion as. sometimes occurs with plasmid-based gene expression . Chromosomal integration can also reduce or eliminate the need for antibiotics to maintain target genes. 1 01213 Preferably, the strategy for chromosomal integration targets gene insertion into what is termed the ιψρ locus on the chromosome (see e.g., Example 11-13). This site codes for the enzyme uracil phosphoribosyhransferase (UPRTase) which is a scavenger enzyme in pydmidine biosynthesis. Using this strategy allows candidate selection by 5-fluomuracil (5-FU), which can eliminate non-integrated organisms. Segregation methods are generally used in cyanobacierial systems because these organisms contain multiple copies of their chromosomes (eg., up to 12 for SynecMcystisspp, PCC 6803 and 16 for SymcMxxKcm ekmgatus PCC 7942). This strategy is particularly attractive for cyanobacteria, because this approach can avoid the use of traditional segregation techniques that rely on selective pressure and statistical integration, for successful segregation. Using 5-FU m a screening agent can be more efficient because it can prevent growth for any organism that contains even a single active upp gene. In this manner, fully integrated candidates can be selected rapidly over fewer generation cycles compared to the processes required of traditional: techniques. 101223 Solid Phase Photosyuthetic Bioreactor [01231 Provided herein is a photobioreactor for culturing photosyuthetic 'microorganisms, comprising a. solid phase cultivation support for the growth of photosynthetic microorgamsras. A solid phase cultivation support, or solid cultivation support, or solid support, or the like, is generally understood to mean a cultivation support that is neither a liquid nor a gas. Although the support itsel f is a sol id, the support structure may be selected so that it absorbs a liquid fe.g,, growth media), a gas, or both. In certain preferred embodiments, as described more folly below, the solid support can absorb moisture for use by the microorganisms during cultivation. £ 01243 Varions embodiments of the photobio reaotor(s) described hernia can support the growth a photosynthetic microorganism. The pimtosynthetic microorganism grows .is the phoiobioreactor can be* for example, a naturally photosynthetie microorganisms saeh- as a cyanobacterium, or an engineered photosynthetie mferoorgauism, such as an artificially photosynthetie bacterium. Exemplary microorganisms that are either nate'ally photOsyntbetic or can be engineered to-bephotosynthetie include, but are not limited to, bacteria; fungi; arehaea; protists; microscopic plants, such as a green algae; and animals such as plankton, pknarian, and amoeba. Examples of naturally occurring photosynthetic microorganisms include, but are not limited to, Spirulma maximum, Spirulma platensis, Dunaliella salina, Botryeoeeus braunii, Chioreila vulgaris, Chioreila pyrenoidosa, Serenastrum capricosautes, Seenedesmus auadricauda, Porphyridium cruentum, Sceuedesmus aeutus, Dssalrdla sp., Scenedesmus obliquus, Anabaeiiopsis, AuSbsita, Cylindrospentmin, Synechoecussp>, Syneehocystis sp,f and/or Tolypothrix.

[012 53 Preferably, the bioreactor is configured to support i η n ocul at ton, growth, and/or harvesting of cyanobacteria transformed to accumulate a disaccharide, as described above.

[012 6 ] The photohioreactor can be -an open or a closed system, as described more fully below. In various embodiments, the photobioreactor includes a solid phase cultivation support, a protective barrier layer, and a suspension element. Some embodiments of the photobioreaetor can contain a system for delivery and/or removal of gas, fluids, nutrients, and/or photosynthetie microorganisms. Delivery systems can he, for example, standard plumbing fixtures. Any of the various lines can include quick-connect plumbing fixtures. The photobioreactor can have a gas delivery line, which can deli ver, for example, delivering carbon dioxide or normal atmospheric air. The photohioreactor can have a fluid delivery line. Preferably, the fluid 'delivery line connects to a trickle or drip system which conveys a fluid (e,g,, water) to the solid phase cultivation support The photohioreactor 'em have a nutrient delivery line. Form ulation of a nutrient composition for the growth and maintenance of a photosynthetie microorganism, is within the ordinary skill of the art. In some embodiments, the n utrient and fluid delivery lines can be combined, for example to supply a fluid-based nutrient mixture. In some embodiments, the fluid delivery line or the nutrient delivery line can be a spray device for distributing a liquid medium over 'the -growth surface. to such spray devices, the photobioreactor is large enough to accommodate, for example, a spray device between an outer layer, such as a barrier layer, and the solid phase cultivation support. Usually,-nutrients are supplied in a. water-based composition, it can be advantageous to provide for different water delivery linefs) and nutri ent delivery l me(s) so as to provide for independent control of moisture and n utrient levels. The photobioreactor can have a product harvest- line so as to provide for collection of photosyntheiic mienoorganisms and/or liquid snspended/soiuble products. The photobioreactor can have an inoculation line so as to provide for inoculation of photosynthetic microorganisms. In-some embodiments* the fluid, nutrient, and/or inoculation, lines can be combined.

[01273 One embodiment of a solid-phase photobioreactor is depicted in FIG 1 (front view) and FIG 2 (side view), in these embodiments, a solid phase cultivation support 2 is enclosed by protective barrier 7, FIG 2 shows that the solid cultivation support is between protective harrier layers 3 that comprise the protective barrier 7, The solid cultivation support 2 provides the surface upon which-photosynthetic n«croorganism.s are cultivated. The protective barrier layers 3 that make up the protective barrier 7 are transparent to allow actinic radiation, to reach the surface of the solid cultivation support 2 to support: tlte growth of photosynthetic, microorganisms. Resealable closures 4 allow for a protective harrier 7 that is releasably sealed. Exchange of gases and vapor occurs through a selective panel 5 of material that is- incorporated into the protective barrier 7, The -photobioreactor Ϊ can be suspended by support elements -6 to allow for a vertical or non-horizontal orientation, [0X281 Another embodiment of a solid-phase photobioreactor is depicted in FIG. I2A (front view) and FIG, 12B (side view). The reactor 1 can be designed in a segmented format, which can aid in servicing and minimizes potential contamination of the surface-aud/or plumbing. Each segment can be connected to the reactor through, plumbing (e,g., quick connect type plumbing) of the various supply and product harvest lines. The reactor can be supported by a suspension element 6 from, for example, mils, which allows the reactor 1 to hang in space and aid in rapid servicing of each segment The outer protective'barrier? can be a transparent material that enables light penetration facilitating photosynthesis on the growth surface 2, while preventing environmental contamination and moisture loss from evaporation. The growth surface 2 can he composed of a material that retains moisture, supplies nutrients, removes products, and/or enables high density growth of photosjtidietie mieroorgnnisms. The growth surface 2 can be serviced by plumbing that provides continuous teeding/pioduct harvest from the surface by liquid culture media. The media tubing 8 can be a porous hose that seeps liquid to the surface 2, which can percolate through the growth surface 2 by gravity. The liquid can be harvested at the bottom of the reactor by a harv’csting tube 9, which collects products' and excess liquid media for transport from the reactor 1, Gases, such as carbon dioxide and air, can be supplied to the reac tor by a gas dispersion tube 10 . The gas supply tube 10 can /provide a positive pressure environment and is expected to supply gases necessary for growth in a controlled, efficient manner. The gas supply line 10 can also assist in minimizing moisture, loss by humidifying incoming gas streams. Excess gas from the reactor can be vented by a breathable panel 5 (on the reverse side, not shown) that is a porous material, drat allows for gas passage but minimizes or eliminates environmental contamination. Contamination Is expected to be Minimized by the positive pressure configuration of the reactor 1 through filtration of the incoming gas delivered by the supply line 10. Positive pressure can also prevent contamination front the environment by providing an inside out pathway for gas flow. £01231 In. the embodiment depicted in FIG. 12B, features of the reactor 1 are depicted in an orientation relative to the growth surface. The breathable panel 5 allowing for excess'.gas· to escape the reactor 1 can be located toward the bottom of the device to provide a path for gas to migrate across the growth surface 2, Location of the breathable panel 5 on the bottom of the barrier surface 7 also minimizes or prevents the possibility of carbon dioxide segregation and build up resulting from its higher density relative to air. The dimensions of the breathable panel 5 can be determined based on gas flow rate requirements for optimal growth on the cultivation surface 2. £0130] Solid Phase Cultivation Support £0131] The solid phase cultivation support of a photobioreactor as described herein provides a surface on and/or in which a photosynthetic microorganism can grow. Preferably,, the solid phase cultivation support comprises a material that provides or facilitates the provision, and/or reten tion of moisture and/or nutrients to the organisms, so as to promote and sustain growth . Embodiments of the invention are not limited to the type or strain of photosyniheric microorganisms that can be cultivated. One of ordinary skill in the art will recognize that the amount of -moisture and the amount and .composition of nutrients desirable for cell growth will vary with the type: Or strain.of photosynthetic microorganism and the application for which it is to be grown. Materials (or the substances contained within or on those materials) that may have a deleterious effect· on the growth of phoiosynthetic microorganisms are generally avoided. £0X32·] A single photobioreactor can be used-to cultivate a single type or multiple types or strains of phoiosynthetic microorganisms. Further, the solid cultivation support can comprise material(s) such that it is suitable for a single cultivation cycle or multiple cycles of cultivation, with or without sterilization between cultivation cycles. Still farther,.* photobioreactor can bo configured to cultivate a single type or strain of microorganism or multiple types or strains of microorganisms on a single or multiple solid supports. In some embodiments, instead of an axenic culture, a community of different .phoiosynthetic microorganisms, or a community of phoiosynthetic and non-photosynthetic microorganisms, can be grown together simultaneously on one culti vation support. A single photobioreactor can also comprise multiple cultivation supports. Thus in another embodiment multiple cultivation supports within a single protective barrier can cultivate one or more types or strains of phoiosynthetic microorganisms simultaneously, 10X331 The solid cultivation support preferably comprises a -relatively porous material A relatively porous material generally has increased surface area and can retain and/or absorb more moisture than a relatively non-porous material. Also preferred is a solid cultivation support that has a textured or topographical surface(s). A textured or topographical surface can enhance cel! density compared to a relatively non-textured or smooth surface. Although the choice of support material and surface topography are typically selected to enhance the adhesion of microorganisms to the support, it generally is desirable that the organisms not so tightly adhere so as to impede their removal or harvest in some embodiments, the solid cultivation support comprises a material suitable ibr adhesion and growth of tmeroorganisms, in some embodiments, the solid cultivation support comprises a material that reduces or eliminates biofilm formation. £ 013 41 The solid-phase supports of the photebioreactors described herein are believed to be 'different .from solid supports that have been utilized in the art fe.g., the most commonly used solid phase support for the growth of microorganisms is agar). Agar is generally cast in to rigid forms, such as a petri dish, and used while, therein to maintain its physical integrity because agar fends to break .or fear when subjected to minimal levels of stress, strata, or both. In contrast, various embodiments of the cultivation support is sufficiently strong and durable that it can he used in a photoMoreaetor while maintaining its physical integrity .without the need of a stronger, more durable ’‘frame”. Or stated another way, the prior art involved a sufficient portion of the weak agar support in contact with a substantially stronger, more durable material ie.g., a petri dish) such that a composite is formed. Thus, fee solid-phase supports of various embodiments of the photobioreactor are suitable in themselves for the cultivation of microorganisms and are sufficiently strong and durable. 10135] Other desirable physical characteristics aud/or'operation parameters of the solid-phase support are described below. For example, the support can be relatively fiat and rigid (like a plate) or it may consist of a multiplicity of flat and rigid sections flexibly connected by, e.g,, hinges, springs, wires, threads, etc. Suitable rigid materials include, but are not limited to, various metals, polymers, ceramics, and composites thereof The rigid materials preferably have surface topographies that enhance the adherence of the .photosynthetic· microorganisms thereto . Further, fee rigid materials may be formed with, a desired level of porosity to enhance the ability to deliver moisture and/or nutrients to fee photosynthetic microorganisms. Still further, the rigid materials may be coated with absorbent or super absorbent polymer formulations (see below). Alternatively, the support may consist essentially of flexible material, such as a fabric. Fabrics for use in a solid-phase support include, but are not limited to, cotton, polyester, and/or cotton polyester blends, optionally coated wife absorbent or super absorbent polymer formulations. Flexibility of the cultivation support can be greatly advantageous because it allows for the cultivation support to be folded, twisted, draped, or rolled for storage, transport, or handling.

[013-6} in addition, the solid-phase cultivation support is preferably structurally stable at elevated temperatures (e.g., about 1.20*0. and above), such as would be typically encountered during autoclave sterilisation, and will-not melt like agar. Thus, in one embodiment, the cultivation support may be sterilized by autoclaving and then placed within the protective barrier of the invention. In another embodiment, the cultivation support can be placed within the protective harrier, and the entire photobioreactor may then be autoclaved. Although autoclaving is one method for sterilization, one o f skill in the art will recognize that any o ther appropriate method of sterilization may he utilized .

[01373 The solid eulrivation support of the present invention can comprise or he made of any materia! appropriate for supporting the growth of photosyaihetic microorganisms. For example, the support may be composed of natural materials, modifi ed natural materials, synthetic materials, or any combination thereof, Natural materials can include, but are not limited to cotton, wool, processed woven plant fibers, and natural polysaccharides (e.g,, agar, starches, cell ulosics), Modified natural materials can include, hut are not limited to, chenhcaiiy modified plant fibers such as. nitrocellulose or cellulose esters, ih addition to natural fibers cowoven or blended with polyester or polyamide fibers. Synthetic materials can include, but are not limited to, fibers composed of ny lon, fiberglass, polysiloxanes, polyester, polyolefins, polyamide., eopoiyester polyethylene, poiyacrylates, or polysulfonates. Further examples of solid cultivation, support materials include wire mesh, polyurethane foams, polyethylene foams, vitreous carbon foams, polyester/polyetbylene foams, polylmide foams, polyisocyauate foams, polystyrene foams, and polyether foams, or combinations thereof.

[ 013 83 la various embodiments, tire solid cultivation support is a fabric. The fabric can he formed by methods such as, hut not limited to, weaving, knitting, felting, and the bonding or cross-linking of fibers or polymers together, The construction of the fabric cart be loose or open. Alternatively, the fabric can be tightly constructed. That said, fabrics that have a significant texture, surface area, topographical variability, and/or roughness may provide more mechanical bonding or adherence of the photosynthetic microorganisms to the cultivation support and thus may be preferable, especially in embodiments wherein· the phoiohioreaetor is handled, transported, or otherwise moved during the process for inoculating the support .with, and/or growing and'or harvesting. ihe organisms. Preferably, in most applications the adherence of the organisms to the substrate should not he so great as to unduly hinder their· removal during a harvesting operation. Still further, the ability of a fabric to retain moisture and/or nutrients for use by the organisms can be controlled by selecting fibers Pun are generally hydrophobic, hydrophilic, or a mixture of such fibers. These properties allow for moisture and/or nutrients dissol ved therein to be retained and/or transported by the solid support so that they are available to the microorganisms growing on the surface. 10X3.9} The properties of the cultivation· support, especially moisture and/or nutrient retention, can. be enhanced by coating the support with a material selected to enhance photosynthetie microorganism growth. For example, die euMvafion support can he coated with agar or a super absorbent polymer such as modified cellulose ester, acrylate or acrylate/polyamine copolymer blends. These coating materials are typically able to absorb and retain greater than 1.0 to 100 times their dry weight in water. In some embodiments, tliese materials are formidated such that they would retain their superabsorbent properties in the presence of ionic culture media components, The coating material can coal the surface of the cultivation support, or the fibers of a fabric if used, or both. In one embodiment, a swatch of terrycloth serving as the cultivation support is coated In agar, Whena solid cults vation support is coated as such, the “surface” of the cultivation- support includes the surface of the coating if photosynthetic microorganisms attach to sueh. To keep the cultivation support thin, pliable, and light, the coating is preferably thin, for example, no greater than about 100 microns. However, thicker coatings can also be used depending on the application desired, or on the combination of solid cultivation support and coating material selected, [01403 The solid-phase cultivation support can be a composite, layered structure.

The solid-phase cultivation support can comprise at least (wo layers arranged so as to be adjacent. Multiple layers of the solid-phase cultivation support can be coupled, such as by bonding, stitching, adhesive, compression, or any other suitable means. The various layers can each independently be selected from among the several materials discussed above, for example, the solid-phase cultivation support can comprise a first material layer of fabric bonded to a-second material layer of synthetic foam. An another example, the sol id-phase cultivation support can comprise a first material layer of synthetic foam bonded to a second material layer of synthetic foam of the same or different'density. Preferably , the solid-phase cultivation support is a composite, layered structure comprising at least· a .first layer,' which is composed: of a high surface area growth material, and a second layer, which is composed of a permeable type material.

[0X413 In addi lion to supplying moisture, nutrients, and a. surface for attachment, the cultivation support can prow de a surface for capturing actinic radiation. Thus, in some embodiments, the dimensions of the solid cultivation support am sheet-like. That is, the depth of the support is ..small ..relative to the length and width of the support, in one embodiment, the cultivation support is a sheet-like layer between film-like layers of a protective barrier. Such a flat bioreactar can be suspended like a flat panel. in another embodiment, just the cultivation s upport is suspended like a c urtain enclosed hy the outer barrier of the -phqtobioreactor. A thin sheet of a traditional solid phase support such as agar would easily rip apart, and would likely not be able to he suspended as such. Therefore, it is preferable that the solid cultivation support alone be able to maintain its integrity when suspended, even when saturated with liquid, to 14 21 As shown herein, a fabric with a terrycloth-type weave-can provide a suitable solid support (see e.g, . Example 1). One of skill in the art will understand that other natural, modlfied-natural, and synthetic materials may also be acceptable. 'Terrycioth provides many of the attributes believed to be desirable in a solid support of the present invention. For example, it is flexible, and not prone to tearing, ripping, breaking, or cracking when handled in accordance with nondestructive techniques (e.g., bending, folding, twisting, or tolling) under conventional conditions (c.g,, temperature). Likewise, terrycioth is-typically not prone to tearing, ripping, or breaking when modestly stretched (even when saturated with liquid). Additionally, terrycioth tends to be highly textured because it is composed of the many loops of fibers. This provides a large amount of surface area for the attachment of microorganisms thereby increasing the amount of microorganisms that can be grown on a support of any given size. Further, a cotton terrycioth typically absorbs at least about three times its own weight, which allows for moisture and any nutrients dissolved therein to be retained by the fabric support so that they are available to the microorganisms growing on the surface of the support. Thus, various, embodiments provide for a solid cultivation support that is thin or sheet-like in dimension, able to support its own wet weight while suspended, flexible, pliable, absorbent, highly textured, or any combination thereof.

[:01431 The above-described supports can be, and in many applications preferably are, used repeatedly and more preferably for so long as they are structurally sound and provide a surface adequate to support the gro wth of the microorganisms disposed of after a single use thereby reducing operational costs and waste. That said, there can be certain applications in which single-use supports Would he desirable, such as cultivation of recombinant photosynthetic microorganisms useful in producing pharmaceutical products such as small organic molecules or therapeutic proteins and peptides. To reduce tire costs of such single-use supports and in view of the feci that that they will not be reused, such supports need not fee as durable and ttiere&amp;re can be made or constructed using methods -and/or materials that are less -costly and less durable. For example, supports comprised of paper fibers similar to that of paper towels may be appropriate, [01443 Several embodiments of a solid phase cultivation support are depicted in FIG, 13. The solid phase cultivation support material depicted in FIG. 13A is a single material that can provide sustainable surface for organism growth, access to moisture and nutrients, point of organism attachment, and/or removal of cultivation products. The material can allow for liquid percolation, and equilibrium diffusion to exchange nutrients, moisture, and products between the surface and organisms . The rendering of the structure: configuration is-an. example o f a h igh surface area material, which can be optimized for dimension and shape. The solid phase cultivation support material depicted in FIG, 13B is a hybrid-material that is .'Composed of multiple layers of materials, each having specific functions for the growth surface. The base layer can be a porous material that efficiently allows for supply of nutrients and moisture as well as removal of products that are percolated through the material. The base material can also provide physical support for the growth surface. The outer layers) is expected to be attached to tlie base layer and can be optimized to provide point of attachment for the organisms. The surface layer can achieve more control of the surface growth environment in terms of surface area and compatibility with the cultivated organism.

[01453 Protective Barrier tO 1463 A. photobioreactor'as described herein can comprise a barrier that protects the solid cultivation support and growth-surface· from contamination and/or moisture loss. At the same time, the photobioreactor provides for actinic radiation, either sunlight or artificial light, and carbon dioxide reaching the photosyntheiic microorganisms. 1« various embodiments, the photobioreactor comprises at least one solid support and a protecti ve barrier for the cultivation of photosymthetic microorganisms. CO 147 3 Protection from Physical Handling and/or Contamination [01483 To prevent contamination, a protective physical barrier can at I east parti ally cover fee solid cultivation support. In certain embodiments, fee physical barrier can enclose the cultivation support. Tie protective bamer can also control, at least in part, tie loss of tie moistoxe lorn the support andforthe atmosphere within the photobioreactor to the atmosphere outside the phoiobioreactor. Oue of skill in the art will recognize that the protective harrier can. be cmstrueted from any of numerous types of materi als depending· ott the embodiment of the invention desired.

[01431 The protective harrier cap completely enclose the cultivation support. If the protective harrier is permanently sealed, the barrier must be breached, cut, torn, or the like to access the cultivation support within. Thus, in some embodiments, access is provided through the protective barrier to the cultivation support and the surface on which the microorganisms am grown.

[01503 In preferred embodiments, the protective barrier is releasably sealed. The releasable seal can be any of a number of closure types including, but not limited to zipper-type closures such as found in Ziploe® storage bags (SC Johnson Company), hook-and-loop type fasteners (eg,. Velcro USA, lnc.)s twist ties, zipttes, snaps, clips, pressure sensitive adhesive backed surfaces, and all art recognized equivalents thereto, A complete seal, 'however, is not necessarily required; and it may be more efficient not to completely-seat the outer hairier to allow' for easier access to the cultivation support.

[01513 The photobioreacior can. comprise a single cultivation support or multiple cultivation supports within a protective bamer. In some embodiments, a single cultivation support is enclosed within a single protective barrier. For· example, a plastic bag may form a protective barrier within which a single solid cultivation support is enclosed (see e.g., FIG. .1), In other embodiments, a single protective barrier may enclose multiple solid cultivation supports. For ex ample, a greenhouse-type structure may form a p rotective barrier w ithin which multi pie solid cultivation supports are enclosed.

[0152] Transmission of Actinic Radiation [0153 3 The photobioreactor can provide for transmission of actinic radiation, either sunlight or artificial light, to the pbotosyntlietie microorgan isms. But the protective barrier of the invention need not necessarily be transparent to light. Some embodiments can comprise a. cu ltivation support enclosed within a non-transparent protective barrier if a sufficient light source for the growth of photosynthetic microorganisms is provided within, it may he desirable, simpler, more economical, and tire like to provide a transparent barrier to utilize sunlight, for instance, as a light source, £ 015 4 3 Preferred embodiments provide for a transparent barrier comprising a material such as, but not limited, glass or any type of transparent or generally visib le light transmitting polymer such as polyethylene, acrylic polymers, polyethylene terephthalate, polystyrene, polyteiratlooroethylene, or co-polymers thereof, or combinations thereof. The transparent harrier can be selected from materials that are durable and not prone to ripping, tearing, cracking, fraying, shredding, or other such physical damage. The transparent barrier material can he selected for its ability to withstand autoclave sterilization or other exposure to temperature extremes. Further, the transparent barrier materials can. be selected to withstand prolonged exposure to sunlight or other radiation wlfoout discoloring or deierioratmg. One of skill in the art will recognize that certain coatings or formulations that resist photoaxidaiion can be particularly useful, hr addition, infrared reflecting or absorbing costings can be selected to reduce and/or otherwise regulate the buildup of temperature within the photobiofeactor of the invention, 101551 Ode of skill in the art will recognize foal the thickness of foe transparent harrier material will vary depending on mechanical properties of scale. For example, the transpare nt barrier material may he of an industriabmarine type plastic about 10 mil thick or i t may he of the type used in a household plastie bag, Le., around 2 mil thick. In one embodiment, the transparent barrier material is thin and flexible. For example, the transparent barrier material can be less than about 10 mil. £01561 In some embodiments, the barrier forms a protective layer or film covering the two sides of a thin, flexible, solid cultivation support. The assembled photobioreactor of this embodiment would be flexible, and could be bent, rolled, folded, twisted, or foe like for storage, transport, conveying, or handling. In another embodiment, the transparent barrier material is rigid. For example, the barrier can be a glass.greenhouse. Most likely, the thickness of the greenhouse glass would preferably be consistent with building-practises;but it is possible that it could be altered. The photobioreactor of such an embodiment would be for practical purposes immovable, but multiple solid supports could be handled, transported, conveyed and the like wit hin the confines of one protective, transparent barrier. CO 157.1 Although: a protective barrier can be selected to .provide sufficient light for the growth of photosynthetic microorganisms, it is not necessary that the entire barrier be transparent. Thus, in some embodiments, portions of the barrier, such as one or more edges, are made from a non-transparent material The non-transparent material cad be composed of materials including, but not limited to polyethylene fiber material (Tyvefc®), polytctrafiuoroethylene filtration media, ceifuiosic filter material, fiberglass filter material, polyester filter material and polyaerylate filter material, and combinations ..thereof. The nontransparent material can be selected for durability. In such an embodiment, a transparent portion of the harrier would be further protected from tearing, ripping, fraying, shredding, and theiifce by a durable, non-transparent portion. In one embodiment, a non-transparent portion provides or comprises an attachment structure and/or reinforcement for suspending the photobioreaetor :by fisrther comprising mounting or attaclunent points (e.g., holes, loops, hooks, grommets, or other art equivalent device, opening or, recess) and/or or a mechanism for securing the photobioreaetor to a structure. Although it is not required that any such .mounting points, etc., be located in or on the non-transparent portion, they can be contained within or on a noh-transpar ent portion of the harrier, within or on a transparent portion of the barrier, or within or on a non-transparent and a transparent portion of the harrier. The attaching structure may also be eontained within or on, or pass thtriugh,:the solid cultivation support.

[01581 In some embodiments, the device has a dtscemable front side and back side. The front side of this device is meant to face a light source, and-thus the portion of the harrier on the front side is preferably .transparent, while the portion of the protective barrier on the side facing away from the fight source is not necessarily .transparent 10159] Provision of Gas Exchange [0160] During photosynthesis, photosynthetie microorganisms consume carbon dioxide and release oxygen. A photobioreaetor as described herein can. provide carbon dioxide sufficient for a desired amount of photosynthesis to occur. One way to supply carbon dioxide to the inside of the photobioreaetor is to allow direct gas exchange between the air inside and the air surrounding the phoiobioreaetor. For example, holes, vents, windows, or other such openings ean be provided in the protective barrier so that the system is open to the surrounding: atmosphere. £01611 But such an open configuration may not be desirable when contamination of the pj^to^th^c.microoiS^isms.is a concern. To address this concern, the protective barrier cun completely seal off die solid support or supports enclosed within from the outside air. In such an embodiment, the desired concentration of carbon dioxide can be maintained by introducing it into die enclosure, For example, one of skill in the art would recognize that plumbing or tubing from a tank of compressed carbon dioxide would allow for carbon dioxide to be mixed into the air enclosed within the photobioreaetor, In addition, it is known that the emissions from factories, industrial plants, power plants, or the like can be harnessed as a source of carbon dioxide for photosyntlietic microorganisms, thus reducing carton emissions. In one embodiment, a gas supply line can provide carbon dioxide to the growth surface local area. 10162] It may be desirable, simpler, more economical, and the like to provide a selective barrier that is gas permeable to utilize atmospheric carbon dioxide. Thus, some photobioreaetor embodiments provide for a selective barrier that allows gas and vapor exchange between the'environment enclosed within the protective barrier and the surrounding air, while still providing a sealed physical barrier-against contamination. Such barrier can be at least partially gas/vapor permeable much loss permeable than conventional textile fabrics, higher than that of plastic films, and/or similar to that of coated papers), thus allo wing tire exchange of gases such as carbon dioxide and oxygen but is additionally at .leastpartially and preferably considered to be impermeable to solids and liquids. In some embodiments, the photobioreaetor can contain a semi-permeabie hairier layer and a gas supply line to maintain an elevated carbon dioxide concentration in toe area around or near the growth, surface.

[0163] In some embodiments, a selective barrier can have an average pore size or diameter of no greater than about 10 micrometers and a gas exchange rats that is at least about 3 and no greater than about 10,000 Gurley seconds (a Gurley second or Gurley is a unit describing toe n umber of seconds required for 100 cubic centimeters of gas to pass through 1.0 square inch of a given material at a given pressure differential). Therefore, in addition to allowing gas exchange, the selective harrier can prevent loss of moisture from the enclosed system.

[01643 The selective barrier portion of the protective barrier can. he composed of any appropriate polymer-based material, such as spunbonded olefin barriers. Spunbonded olefin barriers (very fine polyethylene fibers) with various properties are readily available from DuPont under the brand name Tyveki). Such materials are particularly·advantageous because of their combination of physical properties, i,e,f they tend to resist die transmission of liquids such-as water yet they have a sufficiently high degree of gas/vapor permeability; they ape relatively strong, absorb little or no moisture, are rip-resistant, have a significant degree of elasticity, and are highly flexible. Spunbonded olefin can exceed 20,000 cycles when tested on an MIT flex tester (TAPP! method T-423). In addition, they are inert to most adds, bases and salts although a prolonged exposure to oxidizing.substances, such·as concentrated nitric acid or sodium persulfate, will cause some loss of strength. Spunbonded olefin barriers have good dimensional stability in that sheet dimensions tend to change less than 0,01% between 0 and 100% relative humidity at constant temperature . Certain products meet the requirements of Title 21 of the United States Code of Federal Regulations (21 CPR 3 77.1520) for direct food contact applications. They also have excellent mold and mildew resistance; and are of a neutral pH. Unfortunately, however, their UV resistance is not exceptional. That said, at least One to three months of useful outdoor life cau usually be expected. Additionally, their UV resistance can he improved with opaque coatings or by including UV inhibitors in the polymer fibers.

Additionally, because the spunbonded oelefins produced to date are opaque , the portion of the protective barrier that would comprise such material is preferably not situated and/or so extensive as to compromise the cuidvaiion of the photosyntiietlc microorganisms.

[01653 In particular, spunbonded olefin can be produced in ‘‘hard” and “soft” structure types. Type 1.0, a “hard,” area-bonded product, is a smooth, stiff nou-directionaf paper-iike form. Types 14 and 16 arc “soft,” point-bonded products with an embossed pattern, providing a fabric-like flexible substrate, Type. 14 styles (or the equivalent thereof) can he used, for example, where harrier, durability, and breathahility are required. Type 16 styles are pin. perforated with 5-20 mil (0,13-0.51 mm) holes, giving them much higher air and moisture permeability, additional softness, and greater flexibility and drape than Type44 styles, but at the expense of lower tear strength and harrier properties. Thus, the particular properties of the selective barrier cm be customized by selecting' one or more types of spunbonded olefin products, [ 01663 Other examples of selective polymer barriers include, but are not limited to nylon, polysulfone, polytetrailuoroetbylene, celiulosic, fiberglass, polyester and polyacrylate membranes and filter material, and combinations--thereof, [0167 3 The entirety of the protective barrier need not be gas permeable to provide for a barrier that is- sufficiently selective for the growth of photosynthetic microorganisms. Only a portion of the protective barrier sufficient to allow for adequate gas exchange need he gas permeable. In one embodiment, the selective portion is a panel of the protective barrier {see e,g., FIG 1.). The size and placement of the selective panel in relation to the area of the support surface can be altered to achieve a desired amount of gas exchange for a particular application without unduly hindering tiro cultivation of the microorganisms. One of skill in die art .will recognize that the percentage of the area of the. outer barrier composed of the gas permeable selective material will depend on the gas permeability- rate of the material . In fact, because the gas permeable portion will still allow the transport of water vapor across it, in various embodiments, the size of the gas permeable' portion of the protective barrier is selected so as to allow for sufficient transport of oxygen and carbon dioxide while minimizing the loss of moisture, E 0 i 6 S 3 Suspension and Conveyance System [01661 Photobioreactors described herein can be configured for large scale production and/br harvesting through, for example, integration into a handling and conveyance system, FIG 3 show's an above view of an exemplary design of a pbotobioreaefor farm for handling large numbers of photobioreactors in a continuous process. The .photobioreactors or cultivation panels {not iMividually shown) are attached to conveyor systems 8,- The conveyor systems 8 move the cultivation panels along 'their paths. Multiple conveyor sy stems converge at centrally located inoculation and harvesting centers 9. Thus, the cultivation panels are moved into foe inoculation and harvesting centers 9 where they can be processed {e.g., harvested- and/or inoculated} and then the panels are moved away from the centers following inoculation and during the period of cultivation of the biomass . The panels are then Proved back towards the centers during the latter period ofadrivatkm prior to harvesting, eventually arriving back at the centers with mature biomass for harvest The cycle is then repeated- Harvested biomass can be transported through a pipeline 10 for further processing. The capacity of fee photobioreaetor farm can be increased by adding additional conveyor systems or additional inoculation and harvest centers to form large arrays dedicated to biomass production.

[01701 Suspension of FhotoBioreactor [01713 TO supply light tophotosymtheric mictxtorganisnts, a favored embodiment of the photobioreactor is one in which the cultivation support is thin and sheet-like, When oriented horizontally, the efficient utilization of floor space tends to decrease, therefore in certain embodiments of the invention the cultivation support is oriented non-horizontally, preferably Substantially vertically, or more preferably vertically . Nevertheless, the cultivation: support may be oriented in essentially any manner so long as a sufficient amount of actinic radiation can reach the microorganisms; Thus, when the photobloreacior is of the typd wh ere the protective barrier forms a closely associated film or layer around the solid support, a preferred orientation of the entire photobioreactor is vertical, but any orientation is acceptable. To be clear, the aforementioned orientations {e,g,, vertical, horizontal, substantially vertical, non-horizontal, etc.) are relative to the floor or ground beneath the cultivation support, assuming that the floor dr ground is horizontal [Q1723 Various structures, scaffolding, stands, racks, e/e, may be nsed to hold or suspend a cultivation support or an entire photobioreactor in a desired orientation. In particular, the culti vation suppbrtand/or the protective-barrier can be suspended from, or attached to.-a rope, hue, hook, cable, track, rail, chain, shelf, pole, tube, scaffold, stand, beam or any other such structure capable of suspending the solid cultivation support and/or photobioreactor. Multiple cultivation supports and/or photobloreactors may be .suspended from a common structure, like sheets hanging from a clothes line. The culti vation supporf(s) and/or pbotobloreacioris} may be suspended statically, or in a manner that allows for their movement. The position of the holes, loops, hooks, or the like will preferably distribute the weight of the c ultivation support and/or photobiorcactor substantially evenly. £ 01733 Suspension of the phoiobtoreacior or cultivation support* especially in a vertical orientation, is space eridcient and may provide advantages in: handling. However, the bioreactor or cultivation support of the invention need not be suspended. For example, in. certain embodimen ts of the present invention* the cultivation support is sufficiently rigid that if oriented non-hdrizottially, vertically, or substantially vertically (eg,, by securing or placing its base to/on a surface, in an embodiment in which, the support is like a rigid plate, panel, grid, etc,} it can support its own weight and will remain so oriented. In another embodiment, the protective barrier is free standing, such as a greenhouse, and multiple cultivation supports are suspended and/or free-standing within.

[01743 Suspension of the photobioreaetor 'and/or cultivation support, especially in a vertical orientation, is space efficient and may provide advantages in handling. However, the hioreactor or .cultivationsupport of the invention need not be suspended. For example, in certain embodiments of the present invention, the cultivation support is sufficiently rigid that if oriented non-horizontally, vertically, or substantially vertically (e.g., by securing or placing its base to/on a surface, in an embodiment in which the support is like a rigid plate, panel, grid, eta) it can support its own weight and will remain so oriented. In another embodiment, the protective barrier is free standing, such as a greenhouse, and multiple cultivation supports are suspended and/or free-standing, within, [01751 Conveyance £01763 Also described herein is a system for conveying photobioreactors, cultivation supports within the protec tive harrier of a photobioreactor, or some combination thereof from one location to another. The ability to transport a photobioreactor author'Cultivation support can be advantageous for a variety of reasons. For example, ii may allow for optimizing their posMon(s) for receiving light, and for maintaining a desired temperature or gas content The transportability can be particularly advan.tageous.when multiple photobioreactors or cultivation supports are to be subject to discrete steps, such as inoculating, culti vating, inducing, and/or harvesting,, because it. is likely to be more efficient to move the photobioreactors or cultivation supports to several assigned, locations in a continuOus-type process instead of transporting the necessary materials and equipment to stationary photobioteactors or cultivation supports. £017? 3 Thus, the growing surface, whether the ooltivatfon support alone, or the cultivation support enclosed in a ^protective harrier, can he conveyed, even after inoculation. One o f skill in the art will he familiar with, numerous types of conveyor systems frequently used in industrial applications. The conveyance system is not limited Co any particular .type· so long as it is capable of moving one or more photobioreaetors or cultivation supports. One skilled in Che art will recognize that the type of attachment between the photobioreactor or cultivation support and the conveyor system will vary with the type of conveyance system employed and will be selected to work cooperatively with any mounting points that are part of die cultivation support .and/or the protective barrier. Although it is envisioned that the cultivation supports) or photobioreaetoris) will be conveyed in a mechanized manner powered by one or more motors {e,g.f through the action of a chain and gears), it is atso possible for them to be conveyed with human effort (e<g., by simply pushing suspended bioreactors that are attached to a rail by a bearing mechanism that slides along the rail).

[01781 A conveyor system that suspends photobioreactorfs) and/or cultivation support^), especially in a vertical orientation, as space efficient and may provide advantages in handling. But the conveyor system need not rely on suspending photoblareactorfs) or cults vation supports). For example, a photobioreactor may move along on top of the conveyor system, such as by sliding over a roller conveyor. In one embodiment, the conveyor system may move photobioreaetors comprising a cultivation support enclosed in a proiective -barrier. Alternatively, the protective barrier of a photobioreactor may be a large enclosure protecting one or more................................. conveyor systems moving multiple cultivation supports.

[01793 Photobioreaetor Farm [01803 For large scale applications, it may be impractical to construct a single cultivation support of.sufficient size. Thus is provided use of two or several or tens or hundreds Or thousands or more cultivation supports to cultivate phqtosynthetic microorganisms in a photobioreaetor “farm” These cultivation: supports can all reside within a single protective barrier, thus comprising a single photobioreaetor, or multiple cultivation supports may be part of multiple photobioreaetors: In either case, it can be beneficial to organize the multiple photobioreaetors or cultivation supports within a photobioreaetor farm tor ease and efficiency of handling and processing. It can also be beneficial to organize their arrangement to maximize the amount of energy captured from a light source such as the sun. Such organization can consist'of arranging numerous photobioreactors or cultivation supports in an orderly fashion such as, but not limited to, rows, columns, concentric circles, in grids, radiating outward front a central point, and so forth. 10181} In various embodiments, the farm comprises multiple photobioreactors or cultivation supports suspended, from a common structure such as a track, rail, chain, line, or the like. In further embodiments. the structure is part of a conveyor system and the photobioreactors or cultivation supports move along the path of the conveyor system from one location to another, 10182} A photobioreactor farm can comprise one or an arrangement of multiple conveyor systems handling numerous photobioreactors or cultivation supports. Such an arrangement could be sealed up to comprise two or several or tens or hundreds Or thousands or more conveyor systems together handling two or several or tens or hundreds or thousands or more photobioreactors or cultivation supports. In addition to toe conveyor system(s), a photobioreactor farm can include defined areas, stations, or centers for performing steps such m inoculating, cultivating, inducing, and/or harvesting photosyntoetic microorganisms. Such centers can be toe location of specialized equipment for performing certain steps. The paths of the conveyor systems can: bring the photobioreactors or cultivation supports to such centers where a particular step is performed. The photobioreactor or cultivation support can then be moved along to the next area or center in toe sequence. Different photobioreactors or cultivation supports along the conveyor system can reside at different centers along toe path and thus be subject to different steps simultaneously. In one embodiment, the path of the conveyor system is a loop. Once a photobioreactor or cultivation support completes one round of steps in the cultivation process, it can repeat the process. Allowing for some units to be damaged or otherwise eventually needing replacement, essentially the. same, set of photobioreactors or solid cultivation supports can be used repeatedly, 10183} In a further embodiment, cultivation and harvest can occur at the same or nearly the same location. This location is termed an inoculation and harvest center (she e.g., FIG 3), Inoculation of the photobioreactors and/or solid culti vation supports occ urs at toe inoculation and harvest center. The convey or system forms a loop that than transports the photobioreac tors or cultivation supports away from the .inoculation'and 'harvest center. The photobioreactors or cultivation:, supports then, travel along the path of the conveyor system for an amount of time sufficient for the desired amount of cell growth. The conveyor system then returns the photob foreactors or cultivation supports back to the .inoculation and harvest center for harvest. Multiple conveyor systems can share a common inoculation and harvest center from which they radiate out from. If even more 'capacity is needed, a photobioreactor farm can comprise multiple inoculation and harvest centers handling the photobioreactors or cultivation supports from multiple conveyor systems. Although increased efficiencies may be realized, it is not necessary' that the location of inoculation and of harvest be the same or nearly the same location, [ 018 41 Methods of Using a Photohioreaetor l018 51 Cultivation of Photosynihelie Microorganisms 10186] A solid phase photobioreaetor, as described herein, can be used for cultivating photosynthetie microorganisms, Phofosymthetic microorganisms that can be grown in the solid phase photohioreaetor 'include, but are not limited to, a napirally photosyntbe&amp; ntieroorganism, such as a cyanobacterium, or an engineered photosynthetic microorganism, such as an artificially photosynthetic bacterium. Exemplary microorgansims that are ei ther naturally photosynthetic or can he engineered to-be photosynthetic include, but are not limited to, bacteria; fungi; arebaea; protista; microscopic plants, such as a green algae; and animals such as plankton, planarian, and amoeba. Examples of naturally occurring photosynthetic microorganisms that can he grown in the bforeactor include, but are not limited to, Spirulina maximum, Spimlina piatsnsis, Dunaiiella salina, Botrycoccus braunii, Chlorelia vulgaris, Chlorelia pyrenoidosa, Serenastrum. eapricomutom, Sccaedesmus auadrieauda, Potphyridium.cruentum, Sceaedesmus- acutus, 'Dunaiiella sp„ Sccnedesmus obliquus, Anabaenopsis, Aulosira, Cylindiospcrmum, Synechoecns sp„ Synechocystis sp., and/or Tolypothrix, 1018? J Preferably, the photosynthetic mfotoorganisms grown in the solid phase photohioreaetor comprise cyanobacteria. The cyanobacterium grown in foe bioreactor can.be any photosynthetic microorgamsm from the phylum Cyanophyta·. Tire cyanobacterium grown in the bioreactor can have a unicellular or colonial {eg., filaments, sheets, or bulls} morphofogy. Preferably, the cyanobacterium grown in the bioreactor is a unicellular cyanobacterium. Examples of cyanobacteria that can be grown in the bioreactor include, but are not limited to, the genus Synechoeystia, Synechococcus, Th.enno^y»echococcus, Nostoc, PiOchlorococcu,

Microcystis, Anabaena, Spkulina, and Gloeobacter, Preferably the cyanobacterium, grown in the bioreactor is a Synecbocystis spp, or Synechococcus spp. (e,g., Syneckamccm ekmgatm PCG 7942 (ATCC 33912) and/or Synechocystis spp. PCG 6803 (ATCC 27184)), More preferably, the photosynthetie .microorganism pnwt in the bloroactar Is a transgenic photosynthetic microorganism engineered to accumulate a-disaccharide, as disclosed herein. £0188? A solid cultivation support of a photobioreactor can be inoculated with a photosynthetic microorganism, along with addition of moisture and other components including, hut not limited to, nutrients, salts, buffers, metals, nitrogen, phosphate, 'sulfur, etc. The photobioreactor can then be releasably sealed with the cultivation support within the protective barrier. The sealed photobioreactor can be placed, for example by suspending it, in a location and manner to allow for control of iliummatidn and temperature. The placement can be static, or the photobioreactor can be moved, such as to ensure maximum exposure to the suit5s radiation over the course of a day. The photosynthetic microorganisms can be cultivated for a desired amount of time, One of skill in the art will recognize that the length of time will vary' according to the type of microorganism and the density of cell growth desired. For example, for certain strains of cyanobacteria, a cultivation, period that is within the range of about four to about seven days can provide a yield of cells that is within the range of about 50 to about 250 grams of dry biomass per liter equivalent. Following a period for cultivation, the releasable seal can be opened and the phouxsynthetic microorganisms can. be harvested. £01893 As used herein, “grams of dry biomass per liter eqtnvaieat” is a unit determined by calculating the average depth of the biomass layer (e.g.f about 150 microns) growing on the cultivation surface and multiplying that value by the length and the width of the cultivation surface. This calculation provides a volume. The weight of die collected biomass from the cultivation surface can then be correlated to the volume and expressed as “grams of dry biomass per liter equivalent.” [0190J Method of Continuous Cultivation [ 01913 Greater efficiencies can be realized if the process of cultivating photosynthetie microorganisms were to he made continuous, for example, like an assembly line. Instead of ^uirkg^.equiptjami'^dc^city to handle a large amount of biomass all at once that then, sits idle m between batches, a continuous system would require less total capacity, but would utilize that capacity more efficiently through continuous operation. By dividing cultivation into smaller hut more numerous components, the components can he organized in a spatially continuous arrangement. Different discrete steps of the overall production process can then occur simultaneously. After a cultivation eomponent is subjected to a process stop, the component moves forward in the process while another component replaces it in dial step. Therefore, production of the end product would not be limited to tile maturation of a large hatch, but can occur regularly as individual components complete the assembly line-like process. Further, following the completion of one round of the process, the components can immediately start the process over and do so repeatedly.

[ 019 21 More specifically, continuous cultivation relates to methods of using cosveyable photobioreactors or cultivation supports for culiwaiing photosynthetic :oucroorganistm. in a continuous manner, Continuous or continuous process is undemtood as the spatial relationship that cam allow the photobioreactors or solid cultivation supports to progress from one step of the cultivation, process to another. Alternatively, it is .'possible for a single large structural support to lie utilized in a continuous process, Specifically, the support can he a loop of material {e.g,t terry cloth fabric) that is made to travel along a circuit (&amp;g., like a conveyor belt that is arranged preferably vertically). The end result is that biomass production can be achieved regularly as multiple photobioreactors or solid cultivation supports finish the process sequentially and repeatedly. This type of process presents opportunities in large scale applications for increased efficiencies over producing biomass in large, but infrequent batches. 10193] In a preferred embodiment, the continuous spatial .relationship is along the path of a conveyor system. The manner of operation is analogous to an assembly line. Such a conveyor system can operate in a number of ways. For example, the conveyor system can operate without mtemiption while moving the photobioreactors or cultivation supports from one location to another. In such an embodiment, inoculation, harvesting, and the. like occur while the photobioreactors or cultivation supports are in motion. A!temativelyy the conveyor system can stop to allow for steps to be performed, and then resume to move the photobioreactors or cultivation supports to the location of foe next step. Further, the conveyor system can operate without ^interruption, and the photobioreactors or cultivation supports can be detached from the movenamt of the conveyor system for processing, and then reattached to re-enter into the stream of conveyance. One skilled in the art will realize that other permutations of this general theme are also possible.

[0194] in one embodiment of a method of continuous cultivation, multiple photobioreactors are inoculated at one location along the conveyor system. The conveyor system then moves the photobioreactors to an.area where cultivation of the pbotosynfhetic microorganisms occurs. During this portion of conveyance, the photoMoreaetors can foe positioned to allow for optimal illumination.·· to promote growth and photosynthesis. Next, the photobioreactors would arrive at a Location where tire pthoiosymhetie microorganisms can be 'harvested. The photobioreactors can then return along the path of the conveyor system to the point of inoculation to begin the process again. To improve efficiency, the time .'between when the photobioreactors leave tire location of inocuiation and arrive at the location of harvest can he made to coincide with the time it takes for the desired amount of growth of the photosynthetic microorganisms to occur. The steps of the process are not limited to inoculation, cultivation, and harvest; additional steps can include inducement of the cells to symthesizc a desired product or sterilization. Although the above embodiment describes a system ofeonveyable photobioreactors, it will he appreciated that the same type of continuous cultivation can be practiced vvithin a single protective barrier to convey and process multiple solid cultivation supports.

[01951 Method of Producing Fermentable S ugars 1019 δ] One technology that can benefit from the ahll by to tftore efficiently· grow photosynthetic microorganisms is the production of biomass for al ternati ve fuels Such as: ethanol or biodiesel. Relative to plants currently grown to produce biomass such as com, sugarcane, soybeans, canola, jatropha, and so forth, photosynthetic microorganisms, such as .cyanobacteria, produce biomass at a much faster rate, which may lead to much greater productivity, in. addition, direct production of disaeeharides fey microorganisms avoids much of the extensive energyintensive pre-processing of using plant biomass to produce fermentable sugar. Further, the use of phototrophic microorganisms instead of plants can lead to higher yields of fermentable sugars without soil depletion, erosion, and diversion of the food supply. Relative toother microorganisms, preference is given to pfootefropltic microorganisms because their sources of carbon (C02) and energy flight) can foe supplied from (he environment, making.them far less expensiveto cultivate. In addition, phototrophic microorganisms can be utilized to consume carbon emissions from industrial processes, thus providing further benefits to the environment.

[ 01971 One obstacle to producing high quantities of fermentable sugars from photosynthetic microorganisms is that they generally consume produced carbohydrates rather than accumulating them. While some sugars, such as sucrose or trehalose, are not utilized as a primary carbon source by photosynthetie microorganisms, there are mechanisms for slow assimilation. In. spite of reprocessing mechanisms, such material can accumulate- without being metabolized. If the organism is engineered appropriately, the assimilation mechanism can foe inactivated, which enables high yields of sugars to be produced, [01981 Provided herein is a method for producing fermentable sugars, especially disaecharide sugars, by photosynthetie microorganisms. Examples of fermentable sugars include, but are not limited to, sucrose, trehalose, glucosytgyeerol, and nrannosylfructese. Preferably, the fermerttahie sugar is sucrose or trehalose. The method can be adapted to occur in a continuous manner to improve the cost effecti veness of production.

[01993 Various embodiments of tins method can be practiced using aphotosynthetie microorganism capable of symthesizing fermentable sugars. Some embodiments harness and. control the natural phenomena of osrho- and matric winter protection for the generation of fermentation feedstocks. In one embodiment, synthesis of fermentable sugars is inducible. In another embodiment, synthesis of fennentable sugars can be modified by genetic manipulation to be produced constitutively.

[02001 Fermentable sugar-producing photosynthetie mi croorganisms are preferably cyanobacteria. In some embodiments, a cyanobacterium accumulates a disaecfo&amp;ride according to inducible endogenous pathways. In some embodiments, a transgenic cyanobacterium accumulates a disaccharide according to engineered exogenous pathways. Both endogenous and exogenous pathways are discussed in further detail above.

[02013 Preferably, the transgenic pholosynthetic. mictoorganisms are one or more of those discussed above. £02023 Two non-limiting examples of strains of cyanobacteria capable of accumulating a disaccharide are Synechococcus elongates PCC 7942 and Symeehoeysiis sp. PCC 6803, Naturally occurring Synechocoecus elongatus PCC 7942 synthesizes sucrose upon exposure to salt concentrations of up to about 700 mM, its tolerance limit, Wit®» glucosylglyceroi biosynthesis is blocked by deletion of the agp gene, Synechoeystis sp, PCC 6803 produces sucrose as its osntoprotectant upon exposure to salt: concentrations up to its tolerance limit which may approach 900 mM. in some embodiments, salt induction can be accomplished by introducing aerosolized saline solution applied directly to the cultivation, surface. One advantage of this process is application can fee controllably introduced along the gro wing surface depending on growth time of the cultivar thereby-balancing accumulation of biomass and production of a disace haride such as sucrose.

[02033 For producing fermentable sugars, the phatosyothdic microorganisms can be cultured and grown on a solid medium or in a liquid or gel medium. Culture and growth of photosyuthetie .microorganisms are well known- in the art Except -as otherwise noted herein, therefore, culture and growth of photosynthetre microorganisms can be'carried out in accordance, with such known processes. For example, a transgenic cyanobacteria engineered toaccumulate a disaccharide can be cultured and -grown in a liquid medium. The accumulated sugar can be isolated from such liquid medium if excreted from the cell. The accumulated sugar can be isolated from photosynthetic microorganisms'harvested from the liquid medium. In one embodiment, a transgenic cyanobacteria engmeered to accumulate trehalose, as discussed above, is cultured and grown in a liquid medium. Trehalose secreted from tire transgenic cyanobacteria can be isolated directly from foe liquid medium. In one embodiment, a transgenic cyanobacteria engineered to accumulate sucrose, as discussed above, is cultured and-grow» i« a liquid medium. Sucrose can be isolated directly From engineered eyanobactria harvested from foe liquid'medium, in one embodiment* a transgenic cyanobacteria engmeered to accumulate and secrete sucrose, as discussed -above, is cultured and grown in a liquid medium. Sucrose,secreted from the transgenic cyanobacteria can be isolated directly from the liquid medium.

[02043 Freferably, photosyuthetie microorganisms are cultivated to a relatively high cell density- of at least about 50 grams of dry biomass per liter equivalent prior to induction.

Such relatively high cell densities can be achieved using a solid phase photohioreaetor, as described herein. Disaecharide (e.g.5 sucrose) production can ten be initiateddnduced by treating'the accumulated biomass with defined concentrations of suitable salt compounds effective at altering die activity of water in tire culture media as measured by solution conductivity, in a further preferred embodiment, sodium chloride is the salt used. Following an appropriate response time period (e.g., at least about 1 hour to no greater ten about 48 hours), tlte sucrose laden ceils can be harvested and .processed to isolate and recover the sucrose produced. Typically, an appropriate response period is within the range of at least about 5 hours to no greater than about 24 hours. More typically, the appropriate response period is within the range of at least about 10 hours ίο no greater ten about 20 hours.

[0205] In one embodiment, the majority of disaccharide (e.g., sucrose, trehalose, giucosylglyeerol, mannosylfruciose) synthesized accumulates-within the cells. In another embodiment, the disaecharide is secreted by the ceils which can then Be recovered item the photobioreactor. Regardless of w hether the disaccharide is within the cells or secreted, the disaecharide can bo Obtained using any appropriate harvesting process including, but not limited to, an aqueous spray wash applied to the cultivation surface. The wash comprising cells and/or disaccharide can be collected and processed to Isolate and recover te disaccharide.

[02 OS 3 Having described the invention in detail;, it will be apparent that modifications, variations, and equivalent embodiments are possible without departing the scope of the invention defined in the appended claims. Furthermore, it should be appreciated that all examples in the present disclosure are provided as non-limiting examples,

EXAMPLES

[0207] The-following non-limiting examples are provided to further illustrate the present invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent: approaches the inventors have found function wei l in the practice of the invention, and thus can be considered to constitute examples of modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments that are disclosed and still obtain a like or similar resul t without departing from die spirit and scope of the invention.

Example- h Smm Erase PmormimEACtm [02 081 A static prototype device was constructed composed of a 2 mil.'.polyethylene' barrier layer with a Ziploc€> reseatahic closure. A 60 sq . cm breathable panel was Incorporated into one surface, and a 225 sq, cm woven cotton fabric cultivation support, surface was placed inside. The device was sterilized by treatment 'with' 70% volume aqueous ethanol followed by drying of the device at 50°C with a stream of sterile filtered air. 30 ml of sterile BG~1 I culture media was absorbed onto the cultivation support followed by inoculation, of the growing surface with a pre-culture ©fSynechocoecus elongates PCC 7942. using an aerosol applicator. The preculture was grown in BG-l 1 media at 26 (3 for 2 days prior to inoculation. The photobioreactor was placed in an incubation chamber maintained at 33°C and illuminated at 300 microeinsteins with cool white fluorescent lamps. After 2 days, the reactor displayed active growth of organisms and was allowed to continue growth for an additional 2 days whereupon the reactor was removed from the incubator and the growth surface washed with deionized water. The water was removed by evaporation to afford 254 mg dry weight biomass.

Example'2: PmwwsTfONOFSucmmmrPmTmmrHETicMwmmfMmsMS

[020 91 The following is a prophetic example to illustrate a method for production of sucrose by photosynthetic microorganism in combination with a photobioreactor. At least one photobioreactor, for example a photobioreac tor of the current inventi on such -as. described in Example 1 or Example 3, may be run for approximately 4-7 days with either Synechocystis sp. PGG6803, or engineered Synechocystis sp. at a temperature range of between about 15 and 40°C, under illumination of between about 6D and 300 microeinsteinSj and carbon dioxide concentration of between about 0.2 and 15 volume%. Following the initial cultivation, period the growth surface may be treated with an aqueous salt solution in the concentration range of between about 0.01 and 1.5 M, more preferably between about 0.2 and 0.9 M, using an aerosol spray, The cultivation may be allowed to continue for approximately an additional one to two days to allow sucrose production. The growth surface may then be harvested by washing the surface with deionized water. In a further embodiment the wash water is sterile fresh cultivation media and the-washing stringency is such that between about 70 and 90% of the cell muss is collected. The biomass remaining on the cultivation support may then be allowed to continue growth as a subsequent : cycle, It is anticipated that the yield For these cultivations should be between about 200 and 600 tug dry biomass depending on the growth .surface pahsriai and organism employed.

Examples: "Sow CummrmN Support Cqamo mm an Λββομεντ Polymer [02103 The growth surface of a static photobioreactor of the type described in Example 1 was prepared by dtp coating the sterile dry surface-of the material with a heated solution of sterile 1.3 weight percent agar- dispersed in BG- i 1 culture media. The coated fprowth surface w;as allowed to cool and harden upon .which,the surface was inserted into a sterilized protective harrier to form a photobioteaefor device and inoculated with Syneehocoecos sp, grown in preculture as described in Example 1, Cultivation and harvesting were performed essentially as described in Example 1. EXAMPLE-4: ASF GEm target [ 0 211] Biosynthesis of sucrose in cyanobacteria was explored 'through modulation of sucrose phosphate synthase (sps) and sucrose phosphate phosphatase (spp) activities. Such activities are already present in many cyanobacteria for acclimation to osmotic and metric water stress (see e.g., Lnnn, J,E, 2002. Plant Physiol 128, 1490-1500).

[02123 Lunn, j. E. (2002. Plant Physiol .128,,1490*1500) analyzed the genomic organization of the sps and spp genes of several organisms, including SynechocysMs spp. PCC 6803 and Symehmocvm ekmgatm PCC 7942. Lunn proposed that the sucrose phosphate synthase (SPS) οΐSymchoeystis PCC 6803 ($EQ ID NO 3i has an inactive sucrose phosphate phosphatase (SPP-iike) domain and a distinct SPP activity , The SPP-Iike domain has a high, level of identity with the app, but is missi ng many; of the'conserved active site residues of the haloacid dehafogenase (HAD) superfemily. While no work has yet been done on Syneehowccuselong&amp;tus-’BCC 7942, Luna proposed that both .activities am contained within a single enzyme. An alignment of these enzymes is shown in FIG, 5.

[02133 Searches of the Smech&amp;coccmefangumsPCC 7942 genome did 'not reveal a distinct -sps gene elsewhere on the chromosome. The Simech(x:oa:m ekmgam FCQ 7942 enzyme (SEQ ID NO; 2) was utilized so as to avoid the necessity of multiple gene 'expression. While the gene from PCC 7942 has been termed ^.because it is a single enzyme fusion bearing both EPS and SPP activities, it was termed oxfibr active SPS/$PP fosion (SEQ ID NO: 1) (see below for further information on die possible expression. of a distinct SPP enzyme.) [0214] There are two approaches to expressing the Syfmhopacem eimgatm PCC 7942 u.v/'gene product (SEQ ID NO: 2).

[0215] The first approach is a pi^mid-based expression system built upon the broad host range vector pMMS67BB (Furste, 3. P., Pansegrau, Ψ., Frank, R,, Blocker, fi, Scholz, P., Bagdasarian, M. and Lanka, E. 1986. Gene 48,119-131), Plasmid pMMB67EH is a derivative of RSF101Q, which replicates m most Gram-negative and even some Gram-positive organisms, thus allowing for plasmid-based analysis of sucrose production in E. coli, Synecho<ystis spp. PGC 6803, Synechocmcm ekmgalus fCC 7942 and a variety of other cyanobacteria (Kreps, S„ Perino, F., Mosrin, €., Gerits, J . Mergeay, M. and Thuriaux, P. 1990. Mol Gen Genet 221,129133; Mattaecini, P., Buitean, S. Γa^ior-Chauvat, €,, Mermet-Bouvicr, P, and Chauvai, F, 1993, Plant Molecular Biology 23, 905-909; Gormley, E, P. and Davies, J. 1991.1 Bacteriology 173, 6705-8), [0216] The second approach is stable integration kto the chromosome of Syneckacysiis spp. PCC 6803 m&amp;Symchm.ocms elongates PCC 7942 at the upp (uracil phosphorfbosylmansferase) locus. The upp locus was chosen for reasons described below.

Expression [0217] Two plasmids were designed for plasmid-based expression of the Osfgene product, pLybA'Ll 1 (see e.g, FIG, 6; SEQ ID NO: 19) and piybAL12 (see. e.g., FIG. 7; SEQ ID NO: 20). Plasmid pLybAL 12 was constructed for expression from predetermined promoters and pLybALl 1 was constructed for expression Bom promoters selected at random.

[021S1 Both plasmids were constructed as follows. The av/'gene from Syneehacaccm elongates. PCC 7942 was amplified by PCR with the oligonncieotides 5 ’ -ACAGTACAm^GGCGTTTTCTGTGAG-S' (the JTfoi restriction endonuclease site is nucleotide positions 7-12) (SEQ ID NO: 7) and 5'-€TTACGTGCC(mi’Cmc^TCTmTTCTGAAAaqQTIAM3GG&amp;TCSC;CTC~3' (SBQ ID Np: 8) using· whole ceils as the template, peldmg the product of SEQ ID NO; 1, £ 02193 The gene encoding for ehbraniphemcol aeetytmmferase (cat% both with and without the upstream promoter, was amplified from pBeloBACl 1 (GenSank Accession 051113). £02203 The cat gene lacking the promoter was amplified from pBeloBACl I by PGR with the oligonucleotides S'- TT&amp;T€GCGRT€QTCRGCLAGCTA&amp;GGAAG€TAAJuATGGAG~3 ' (SEQ ID NO: 9) and S '-GGRCCAATTGACGTGTTTGRCRGCTTRTC-S' (SEQ ID NO: 10) (the JAwl and /W1 restriction endonuclease sites are at nucleotide positions 4-9 aod 10-15, respectively) to yield the product of SEQ ID NO: II, £ 02213 The cat gene bearing the promoter was amplified fropi pBeloBACl 1 by PGR with the oligonucleotides 5 '-TTTTGGCGATCGTGRGACGTTGATCGGCACGTAAG-3 ' (SEQ ID NO: 12) and S'-CGM:GARTTCAG0TGTTTGAGAGCTTATC-3 ' (SEQ ID NO: 13) (the PvAfand PmB restriction endonuclease sites are at nucleotide positions .7-.12 and 10-15, respectively) to jftbld the product of SEQ ID NO: 14, £02221 The FCR products bearing themt geue were digested with Pv«| and the ends blunted with Τ4 DNA polymeiuse. They were then individually ligated to the av/'PCR preduct. The resultant products were purified by agarose 0dl:demrophoi^iSj/dtg^ed:widi-^#I and Pmil and then ligated with T4 DNA ligase to die 6.6 Kbp product of pMMB67 EH digested with EcoM and Ifpal. The ligation products were transformed into chemically competent NEBSa (New England Biolabs; Ipswich, MA) and selected for at 3?°Con LB agar supplemented with 1 OOug/ml ampkillin. Selected candidates were grown, at 37SC in IB supplemented with: lOOpg/mi amplciliis far miaiprep, analyzed by restriction endonuclease digest and then verified by sequence analysis with the oligonucleotides 5 '-GCTTCTGGGTTGTG&amp;TTTAATGTGmTCftG-3' (SEQ ID NO: 15), 5AtaT(^TTATTCAGGCGTAGCAACCAG-3 ' (SEQ ID NO: .1.6),. S'-GTCGTTAGTGACATCGACAACAGACTG-3' (SEQ ID NO; 17), and 5'- GATCGCGATACTGATCGAGATAGGTC-3' (SEQ ID NO: 18). Candidate number 5 of pLyb.AU I (pLybALl 1-3) (SEQ ID NO: 19) and Candidate number 1 of pLybAL12 (pEybA02-l) (SEQ ID NO: 20) were chosen for further study.

[0223] Based upon plasmid yield during mini preps, it appears that the copy number of these plasmids is greatly reduced when propagated in the £. coii strain NEB Turbo (New England Biolabs; Ipswich, MA), suggesting the importance in choice of host strain for these plasmids.

EmMttM 6; PmMQTm INSERTION

[0224] Six promoters were chosen for insertion in to pLybAL J2-5. The presumed promoter fr»r S^eph$cy$tis:®&amp;$, PCC 6803 carB encoding carbamoyl phosphate synthase, which is likely to be immediately upstream of the gene/pri? where they would be co-transcribed as an operoii, was chosen because it is likely to be strong due to its role in both pyrimidine and arginine biosynthesis. The nitrate reductase (nrod) promoters from both l^echoc^stis-spp^ PCC 6803 (Aichi, M,s Takatani, N. and Omata, T.200L J BaoterioL 183, 5840---5847) and Syneckoc&amp;ecus eimgafm PCC 7942 (Maeda, S-L eiai 1998, J Baeteriol 180,4080-4088) were chosen for their ability to be regulated by the source of nitrogen. The strong light-phase promoter for the photosystem IID! protein (psbAJi). from Synechocmxus ekmgatm PCC 7942 (Golden, S, S,, Brusslan, J, and Haselkorn, R, 1986, EMBO Journal 5,2789-2798) and two darfe-

SyntehOcyMts spp. PCC 6803 {4mK(Aoki, S,> Kondo, T, and Ishiura M. 1995,1 Bacteriol 177,5606-11.) and k&amp;M (Kucho, K-I. etal 2063, J Baeteriol 187,2190--2199)] were also selected as regulated cyanobacteria! derived promoters. Lastly, the λρκ. temperature-regulated promoter, which has been shown to be active in cyanobacteria, was chosen (Eerino, F, and Chauvat, E. 1989. Gene 84,257-66; Mermet-Bouvier, P. and. Chauvat, E 1994. Current 'Microbiology 28, 145-148), [0225] The following oligonucleotides were used to amplify the promoters by PCR using whole ceils its the template, yielding the products shown, The restriction endonuclease sites incorporated for cloning are provided in the sequence.

[02261 Synechocystis spp. PCC 6803 pyrR (SpM/Κρηϊ) (SEQ ID N0; 23) was amplified froth whole cells by PCR with the oligotmcleotides 5'-CGGTGTGCATCjCCGTTATTGATGGAATGA' (SBQ ID NO: 2!) and 5’- TGAO'AG0MC0FAAATTAGCTGGGAAGCCAG-3' (SBQ ID MO: 22), having restriction endomsdcsse sites at nucleotide positions 7-12 tor both.

[0227 J Symchocysm spp, PCC 6803 mrA (Sphl/lvpnl} (SEQ ID NO: 26) was amplified from whole cells by PCR with the ofigontieleotides 5'-.CCCAAGGCATGCAGGAAAACAAGCTCAGAATGCTG-3 (SEQ ID NO: 24) and 5'-mATTG.GTACCAACGCTTCAA.GCCAGATAACAGTAGAGATC^' (SEQ ID NO: 25), having restriction endonuclease sites at nucleotide positions 7-12 for both, [02283 Synech&amp;coccus elongates PCC 7942psbAII(Spkl/Kpnl) (SEQ ID NO: 29) was amplified.ftom whole ceils by PGR with the oligonucleotides 5 -ATCTTTGCGTFCCGTGACGGCTACTG-3' (SEQ ID NO: 27) and 5'-GCAG ATGGTACCGGTCAGCAGAGTG-3 ’ (having restriction endonuclease sites at nucleotide positions 7-12) (SEQ ID NO: 28), [02293 Syneehomccus elongates PCC 7942 nirA (Sphf/KpnT) (SEQ ID NO: 32) was amplified from whole cells by PCR with the oligonucleotides 5 C AGCCAGCAJGCAT AAATTrCrf GTT ΠΌ ACC A AACCATCC-3' (SEQ ID NO: 30) and 5'-GYGGCTGGTACCATGGATTCATCf GCCTACAAAG*3' (SEQ ID NO: 3 .1), having restriction endonuclease sites at nucleotide positions 7-12 for both, [02303 h>K (XhaUKpni) (SEQ ID NO: 35) was amplified from.wholecells by PCR with the oligonucleotides 5 '-GTGCATTCTAGATGGCTACGAGGGCAGACAGTAAG-3' (SEQ ID NO; 33) and 5'-

TTCTGTGGTACCATATGGATCCT'CCTTCTT AAGAYGCAAGCATTATCACC-3 * (SEQ ID NO; 34), .having restriction endonuclease sites at nucleotide positions 7-12 for both.

[02313 SymchocystisPCC 6803 dnaK (Sphi/Kpnl) (SEQ ID NO; 38) was amplified from whole cells by PCR with the oligonucleotides·5'-GCCCCAGCATGCACGAGTAAACATAAATCTC-3J (SEQ ID NO; 36) andS'-ATTGGTGGTACCGAGGTCAA.TCCCAAC AAC-8 * (SEP ID NO: 37), having restriction endonuclease sites at nucleotide positions 7-12 for both.

[02323 Syneckocysiis spp. PCC 68© kiaA (Sphl/Kpnl) (SEQ ID NO: 41) was amplified from whole cells by PCR with the oligonucleotides 5'- GCCAGAGCMt|€AAAGCT€ACTAAGTCjG-3' (SEQ ID NO: 39) aiid 5'~ GGAAAAGGTAOC’IGAOTCTAi GCiCjC'AACGTG-3' (SEQ ID NO: 40), having restriction endomtcbass sites at nucleotide positions 7-12 for both, [023 31 After amplification, the PGR products were digested with the restriction, endonucleases shorn) above,-gel purified, and ligated into similarly digested pLybAL12-.1 to yield plasmids pLybAL 15 (SEQ ID NO: 44), pLybAL 16 (SEQ ID NO: 45), pLybALl? (SEQ ID NO: 46), pLybAL I 8 (SEQ ID NO: 47), pLybAL 19 (SEQ ID NO: 48), pLybAL21 (SEQ ID NO; 49), and pLybAL21 (SEQ ID NO: 50), respectively. The ligation products' were transformed into electrocompetent NEBSn (New England Biolabs; Ipswich. MA) and selected for at'3Q°C on LB agar supplemented with 10%tg/mS ampictiim, 34 pg/ml chloramphenicol, and 5% sucrose.

Selected candidates were grown at 3 OX in LB supplemented with IOGgg/mlam|Hciiii&amp;, 34 pg/rnl chloramphenicol and 5% sucrose for miaiprep, analysed by restriction endonuclease digest, and then: verified by sequence analysis with the oligonucleotides 5 '-GCTTerGCGTTCTGAT3,TMTCT6TATCAG-3' (SEQ ID NO: 42) and 5'-ATGGGTCTGAATGTGCA<3AATGTAGAG-3' (SEQ ID NO: 43). Candidates 6 and 7 (pLybAL 15-6 and pLyhA.Ll.5~7), 2 (pLybAL 16-2), 4 and 5 (pLybALt?-4 and .pLybALl7-5), 1 and 2 (pLybALl8-1 and pLybAL .18-2), I and 2 (pLybAL 19-1 and pLybALl9-2), 3 and 5 (pLyhAL21:-3 and pLybAL21-5) and 4 and 8 (pLyb.AL22-4 and pLybAL22-8) were' chosen for plasmids pLybAL 15 (SEQ ID NO: 44), pLybALl 6 (SEQ ID NO: 45), pLybALl? (SEQ ID NO: 46), pLybAL 18 (SEQ ID NO: 47), pLybAL 19 (SEQ ID NO: 48), pLybAL21 (SEQ ID NO: 49), and pLybAL2I (SEQ ID NO: 50), respectively.

[ 0.2343 Selection and growth of these plasmids on LB supplemented with sucrose and both antibiotics was essential to obtaining clones. Selection was- originally conducted on LB . supplemented with ampiciffin alone, but plasmids containing a promoter could not be isolated.

Isolates were either re-ligation of the vector alone or of varying size and lacking the ability to be propagated in the presence chloramphenicol. I t is thought that internal sucrose was being produced, creating an osmotic shock for the cells that leads to deletions preventing sucrose production. Subsequent experiments indicated that, once isolated, the plasmids may be stable in the absence t>f sucrose, possibly through the eventual i nducti on of osmotic stress machinery and/or sucrose consumption enzymes.

Example 7; 7^ANSFmMATmM0FS¥NBcm>CYsmAmSmBCffawccus [02353 The prenKWer-eoniaimsg plasmids, pLybALI S ($BQ ID NO: 44), pLyhALM (SEQ ID MO: 45), pLybALl? (SEQ ID NO: 46), pI.ybAI.18 (SEQ IB NO: 47), pLybAL19 (SEQ ID MO: 48), pLybA;L2I (SEQ ID MO: 49), and. pLyhAEll (SEQ ID NO: 50), as well as the promoterfess pLybAL12~l vector (SEQ ID NO: 20} (see Examples 5-6), were placed into hold Syneehocystk spp. PCC 6%Q3 md ^meckococcm efe»^^.PCC:7942'by':tppiarmtai conjugation, performed consistent with. Elhai, J. and Wolk, C. P. 1988.'Methods in Inxymology 167,747-754, unless indicated otherewise.

[023 S3 Overnight cultures of the cargo strains (NEBSa beating tlte plasmids to he transferred), as well as air overnight culture of HB10J bearing the helper plasmid pRK2Q13 (ATCC 37159) grown at 30°C were pelleted by centrifugation, washed twice with LB and then resuspended in LB in one-tenth the original volume. Each cyanobacterium was grown at 30° t in BGI.1 -A, which 1$ the same as BGI1 except the trace elements have been replaced wdth NitsehM trace elements (NItsch, J. P, and Nhseh, G. 1956. American Journal of Botany 43,-839-851) under constant illumination to an QB730 of approximately 0,5. The cells were pelleted by centrifugation, washed twice with BGI 1-A, and resuspended in BGI 1-A with a 7,5-fold increase in concentration. A series of 10-fold dilutions of the cyanobacteriu m BGT1-A were prepared down to .1 O'5. At each dilution, 100 μΙ of the cyanobacterium was combined with 50 μ! each of the cargo and helper strains of Is. eoii, 150 μ 1 of each mixture was then plated onto BG I I-A agar (1.5%) plates supplemented with 5% L B 1 he plates were incubated at 26-28f;C under constant illumination for 16 to 24 hours. The agar (app. 30 ml) on each plate was lifted and300 μ!of a Ι00Χ chloramphenicol solution was added. The final concentration, of chloramphenicol was 25 pgdnl for Synechocystis spp. PCX' 6803 and 7.5 μ§.ήη1 for Synechococcm elongates-PCC 7942. incubation continued for 8-12 days. Individual colonies of transconjngants were purified away horn contaminating: E.-coli by iwstreakmg onto BG11 -A supplemented with the appropriate amount of chloramphenicol to, again, obtain isolated colonies.

Example- 8: Promoter Library in pI mAlll-S

[0237] The following example describes construction of a library of cyanobacteria! DNA for promoter selection using pLybALl l-5 (SEQ ID NO: 19) (see Example 5). A modified, scaled up version of the chromosomal DNA isolation protocol of Wilson, K. (1997. Preparation of Genomic DNA from Bacteria. /«Current Protocols in Molecular Biology. John Wiley and Sons Vol. l,pp. 2.4.1-2,4.5) was employed, where the primary.differences were much longer incubation times and the replacement of SDS with Sarkosyl. The DNA Isolated was of sufficient quality for partial Sau3 ΑΪ digest for insertion into &amp;e firimBl site ofpLybAL 11-5, As shown in FIG, 8, some of the fragments would have promoters and others would not. £02383 During the process of library construction, a possible promoter within the -asf gene was discovered. To function as a promoter cloning vector, plasmid pLybAXll-S (SEQ ID NO: 19) is supposed to only be ..resistant to chloramphenicol when a promoter has been inserted in front of the asf gene, as the marker lacks its normal promoter and the promoter upstream of asf was not included, Once constructed, however, tlte chloramphenicol resistance conferred by this plasmid was examined in E. miL When NEBSa bearing pLybALI X~5 was cultured on LB agar (1,5%) supplemented with 34 pg/ml chloramphenicol at 373G, growth was observed, When cultured in liquid LB medium supplemented with 34 pg/ml chloramphenicol, however, little-tone growth, was observed, NEBSa bearing pLybAW 2-1. (SEQ ID NO: 20) grows in the presence of chloramphenicoS on both solid and in liquid LB medium.

[0239] To verify there was no missed promoter upstream of the asf gene but downstream of the transcription terminators, the insert placed into pMMB67EH to make pLybALIl -was cloned into Lucigen Corp.N (Middleton, Wl) pSMART-LCKan blnnt-end cloning vector using Lucigen's CkmeSnrart kit with the Lucigen strain of E. coli (A eloni 10G) competent ceils (see eg., FIG,.9). Because it was blunt-ended cloning, the inserts could ligate to die plasmid in either direction to create pLybAL13f (SEQ ID NO: 51) and pLyALOr (SEQ ID NO: 52), This vector is specifically designed to eliminate transcription read through from the vector by surrounding the cloning site with terminators. As a control, the insert used to construct f*LybALi.2 was also placed Into this vector, creating-p'LybAL14f (SEQ ID NO: 53) and pLybAL I4r (SEQ ID NO; 54), The plasmids looked to be the appropriate size on an agarose gel but inserts were not verified by DNA sequencing to. confirm the integrity of the clones, 'Similar .results, however* were seen'for E.chni 10G bearing pLybAL13 and pLybALl4 (withthe cloned DNA ligated in either direction f or r) as were seen for NEBS a bearing pLyb AL 11 (SEQ ID NO: 19} and pLybALI 2 (SEQ ID NO: 2D), respectively. This indicates that the activity of this promoter is weak in £. eolL

[02403 Many E, colt promoters do not fhnetlonin cyanobacteria, and vice versa. It is possible that this promoter activity would not be observed· in Syneckoeystk spp. PCC 6803 or Synecbocoecm ekmgatus PCC 7942. To check this, pLybALI 1-5 (SEQ ID NO: 19) was inserted into both organisms by conjugation, as described above. On BG1l-A agar (1,5¾.) supplemented with chloramphenicol (25 pg/rnt and 7,5 {ighnl for 'Sywchocystis.&amp;pp. PCC 6803 and Synechococms elongatus PCC 7942, respectively), growth was observed, [02413 Growth of these organisms bearing pLybALI 1-5 (SEQ ID NO: 19) on liquid BGII-A supplemented with chloramphenicol was examined- It is possible that this activity is very weak and is oniy observable when present on a multiple-copy plasmid - This may be the ease with E. call, but is not likely with the cyanobacteria. RSP10I0 is a relatively iow-eopy plasmid, having only 12 copies in E. colt (Froy, L, Sagdasarian, Μ, M. aitd Bagdasarian, .ΜΙ 992). Gene 113,101-106). &amp; call undergoing rapid division has atmost 2 copies·of:its chromosome, thus at least a b-foid increase in copy number. A comparable copy number in cyanobacteria for this plasmid is likely. The chromosomal copy numbers of Syneohocystis spp. PCC 6803 and Syneehecoccm ekmgitim PCC 7942 of 10-12 and 16, respectively, are similar (Laharre, J.,Cfcaavat. F. and Thuriaux, P. 1989, J Bacteriol .171, 3449-57). The results above suggest the presence of a promoter within the off gene- of cyanobacteria, [ 02423 FIG, 10 shows a possible location of a promoter (or promoters) within the asf gene. Transcription initiation elements have been described by Curtis, S. E. [1994, The transcription apparatus and the regulation of transcription initiation, in The Molecular Biology of Cyanobacteria, Bryant, D, A. (ed). fCluwer Academic Publishers pp, 613-699], Translation initiation elements have been defined by Sazuka* T. and Ohara, O. (1996, DNA Research 3,225232). to243] Based upon alignment to known SPS enzymes and the presence of a stop codon only two codons upstream, the translation mitiaiionof the asf gene is predicted to start at a GTG start codon. While ATG start codons are the most common, GTG and TTG are less common, but not rare, A typical E. eofr-like Shine-Deigamo sequence (GGAG or GAGG) cbmplemeatary the 3 -end of the iC>S tRNA. for which the adenine nucleotide is optimally 9~!2 bp away from the first nucleotide .of the start codon is also present, except with somewhat longer spacing. This sequence is found in about half the genes studied by Sazuka and Ohara. Less optima! spacing is not uncommon, but often leads to reduced levels of expression. There is too little sequence upstream of tire Shine-Deigamo sequence but downstream of the M0 site to incorporate a promoter. It is possible that a partial promoter may be incorporated, hut the rest of the promoter would have to produced by the vector sequence of all three plasmids (pLybAL! 1-5 (SEQID NO: 19); pEybALlSf (SEQID NO; 51); and pLybAIO 3r (SEQID NO: 5.2)), which is improbable. C02441 Thus it likely thatthe promoter activity is located within the ns/'gene. If-the promoter is within the asf gene, one potential position is in front of the SPP domain of asf This would give the sucrose biosynthetic enzymes of Synechococem eMngatvs VCC 7942 ® similar quaternary structure to those from Symechocystisspp, PCC 6803. Each organism would have-two proteins, an SPS domain with a franslatfonally fused SPP or SPP-like domain and a distinct SPP that may (or may not) interact with each other.

[02453 First, it was determined whether the SPP domain of os/could even be translated separately. As can be seen in FIG. 10 and T able l . there is a TTG start codon immediately upstream of the SPP domain t hat is preceded by a Shine-Deigamo sequence.

Fable l: Nucleotides immediately surrounding the proposed spp start codon. The nucleotides immediately surrounding the proposed spp start codon are compared to the consensus of 72 cyanobacteria! genes. Nucleotides matching the consensus are italicized, whereas nucleotides that do not match the consensus are underlined. Nucleotide numbers arc relative to the first nucleotide of the start codon. tmt -20 -3 -8 -7 -6 -5 -4 -3 -2 -1 123 4 5 6

Consensus a/g a/g a/t a./t a/t a/t a/t a/t c/t t/c atg a/g c c/t

Sel07942 asf T G A C 7 A G C G C GTG G C A

Selo7942. Spp T C <3 C A A A C G C TTG A T 7 £ 02463 The region surrounding the start codon matches the consensus determined by Sazuka and Ohara for 72 cyanobacteria! genes almost as well as die native start codon. While determining .cyanobacteria! promoters· based upon rules established Sir E.MU promoters, the typical -35' and-10 elements were searched for since the promoter does appear to he acti ve in E. call Two possible promoters were identified, as seen in FIG. 10. There remains die possibility of an additional promoter^) -elsewhere in asfi

Example 9; Τμλ^βεέρ οεριμμπ>$ fromE com w cyanqbactbxm £0247] Conjugation was used for transfer of the pMMB$7EH-based plasmids into cyanobacteria. Protocols exist for the transformation of these organisms (Zang, X., Liu, B., Liu, S., Arunakumara, K. Kb 3. U. and Zhang, X. 2007. Journal of Microbiology 45,243-245; Golden, 8. S. and Sherman, L, A.3984, Journal of Bacteriology 158,36-42), but such approaches were unsuccessful for placing these plasmids into Symchacystis spp, PCC 6803 and Syneeh&amp;mscus ehngatm PCC 7942 using natural transformation.

[ 0 2 48 3 The presence of the plasmids in the cyanobacteria was verified, Transeonjugants were analyzed for the presence of plasmid by PCR of the apical gene combination with the ollgonudeotldes 5'-AGACT ACAATTG GGGCG TTTTCTGTGAG-3' (SEQ ID NO: 7) and 5 '-GGTGGTTGTGTTTtmcmGCTTATCC' (SEQ ID NO: 55), yielding a 3.1 kb product. In addition, plasmids were isolated and analyzed. Cultures of cells grown in BG.M-A supplemented with chloramphenicol (at the concentrations described above) are pelleted by centrifugation, resuspended in TE, heat-treated and miniprepped by the Promega Wizard S V Plus miniprep kit. But with poor yield, direct plasmid analysis is difficult. As such, the isolated DNA is transformed into £. call NEBSa, re-isolated using the Promega Wizard SV Plus maiiprep kit, and then subjected to restriction endonuclease analysis.

Example i&amp;: SucRmE PsoDifcrmN ASSA 9Am anal mis [02493 Synechococcus transformed with pLybAL 19 or pLybALl 7 (see Example'7) was assayed for sucrose accumulation. Sucrose is measured with Bio Vision, Inc.’s (Mountain

View, C- A) sucrose assay kit. Assays were run following a 4 hour induction period (increased light to ISO microetnsiems from 50-microeinsteins for pLybAl.1 7 (SEQ ID NO: 46) and increased temperature from 26 to 39°G for pLybAL19 (SEQ ID NO: 48)). Data was corrected for background glucose present in foe cells, [0250] Results showed Syaechococcus transformed- with pLybAL 19 (SEQ I D NO; 48) accumulated 0.78 nanomoles of sucrose per mg of dry' biomass. Results also showed that Synechococcus transformed with piybALl? (SEQ ID NO: 46) accumulated 0.95 nanomoles of sucrose per mg of dry biomass.

[02513 Further analysis for plasmid-based sucrose production in £. eo/i,

Syneehoeystis spp, FCC 6803, and ''Syaechococcus eiongatm FCC 7942 was performed. Because bacteria can consume sucrose, detection may be difficult As such, cells are grown under suppressing conditions aird then assayed shortly after induction:. The pfrR promoter may be suppressed by growth, with uracil and induced by transfer medium lacking uracil. ThehirA promoters can be suppressed by growth with ammonium ions as the nitrogen source and induced by transfer to medium with nitrate as the nitrogen source. The psh.411 promoter can be shifted from low light to high tight. The dark phase promoters can be shifted from light to dark. And, the Xus promoter can be shifted from: low (25®C) to high (39°C) temperature.

Example IT: Expiu&amp;s&amp;n nmoumSTMLE ty'HOMQSOkUtT^eWTiW

[0252] Insertion of sucrose biosynthetic genes can cause a negative impact oh .cell growth, leading to difficul ties in obtaining complete segregation of the 10-16 chromosomes.

With normal, selection for air antibiotic resistance marker, having additional copies of the marker does not dramatically impact foe cel ls ability'· to survive in the presence of antibiotic, Therefore, complete chromosomal segregation can be difficult to achieve using·: antibiotic selection when faced with a negative phenotype.

[02 S3 3 Deletion of the upp gene (encoding for uracil phosphoribosyltransferase) in most organisms leads to resistance to the otherwise toxic S-ftuorouracil, To obtain complete resistance, all copi es of the upp gene must be deleted. Thus integrating into the upp locus of Syneehoeystis' spp. FCC 6803 (SEQ ID NO: 56) mdSymehococcus eiongatm FCC 7942 (SEQ ID NO: 58) will lead to 5-fluoreuracil resistance and allow for positive selection of complete segregation, even in the presence of a negative phenotype.

Example 12: The ιψρΜαναμυ€μ resistance cassette [02541 A general strategy for genomic manipulation using a itpp/k&amp;mmycm resistance cassette is outlined in FIG. 1L .Deletion of a gene is depicted, but the strategy can easily be modified at the ‘‘replacement5* step for insertions and mutations, [02553 An w/ip/kanarayein resistance cassette was constructed. The cassette was constructed in Epicentre Biotechnologies CopyControI cloning kit with biunt-end cloning vector pCC l andh. noli strain EPI3G0 according to imaufacturer pro toco is. The ιφρ gene from Bacillus mbit Us 168 was amplified from whole cells using the oligonucleotides 5 -JDlC3SAGCAAQACAG€GTGTAGCTGCTCTC3ACTG-3' (SEQ ID NO; 60) and 5 N TCCCGGGATTTGgTACCTTATTTTGTTGCAAACATGCGGTCA!CCCgCRTC-3> (having restriction endonuclease sites at nucleotide positions 2-7 and 12-1?) (SEQ ID NO: 61), yielding the product of SEQ ID NO ; 62, [0 2 563 The PGR product was cloned into pCC 1 and those bearing the insert were selected for on LB supplemented with chloramphenicoi as described in Epicentre Biotee&amp;iolosjteis’' protocol. The forward orientation, retail ve to ImZ, was screened for by restriction endonuclease digest, yielding pLybALTf (SEQ ID NO: 63). The exact sequence of toe insert was verified by DNA sequencing with the oligonucleotides 5"-GTAATftCGACTCACTATRGGGC-3' (SEQ ID NO: 63) and 5'- CACACAGGAAAGAGCmTGACCAT-3 '(SEQ ID NO: 64) for candidates 3 and 8 (pLybAL?-3 and pLybAL?-8).

[02573 The kananiycm resistance marker from the Lybmdyn vector pLybAAl [originally derived from pACYCl?? (Rose, R, E. 1988. Nucleic Acids Res. 16,356] was amplified with the oligonucleotides S'-GTCAOTG€ACTG€TCTGCCAGTGTTACAACC-3' (having'Jpahl restriction endonuclease sites at nucleotide positions.5-10) (SEQ ID NO: 66) and 5 '-CTC1AGTGGCGQC.A A A ACTCACCfFTA AGOGATiTTOGTC-S' (SEQ ID NO: 67) (having

Narl restriction endonuclease sites at nucleotide positions 7-12), yielding the product of SEQ ID NO: 68, £02583 The PCR product was digested with ApaU and Ναή and ligated into similarly digested pLybAL7f, creating pLybALSf (SEQ ID NO; 69). The proper plasmid was selected for on LB supplemented with 50 pg/rai neomycin and examined by restriction endonuclease digestion.

Example B; VPP Deletion- £0 2593 One strategy to force segregation of chromosomal inserts for the expression of sugars, including sucrose, trehalose, giucosylglycerol, and nranuosylfructose, utilizes deletion of app from the chromosome leading to resistance to 5-fluorouraeiL White this has been established in many organisms (such as E. eoli and B. subtffls), it has not previously been established for cyanobacteria, sack as Synechocystis spp. PCC 6801 "and SynecMococcus elongaim PCC 7942, £02 601 Tes ting showed that growth of each of these organisms was completely inhibited by 1 pg/ml, 5-fluorouxaciL Growth'of Synechocystis spp. PCC 6893 is completely inhibited by 0.5 pg/ml, 5-fluorouracil and is sensitive to as little as little as 0.1 ggrinl, 5-finorouracil, [02613: The upp gene and surrounding sequences of both Synechocystis spp, PCC 6803 'was amplified with the Oligonucleotides Sspupp-F (SEQ ID NO; 96} and Sspupp-R (SEQ ID NO; 97). The upp gene and surrounding sequences of Synechococcus elongatusPCC 7942 was amplified with the oligonucleotides Seloupp-F (SEQ ID NO; 98) and Seioupp-R (SEQ ID NO; 99). The PCR'products (upp of Synechocystis spp. PCC 6893, SEQ ID NO; 100; upp of SymeeBvmcem eJmgams PCC 7942, SEQ ID NO: 101) were then cinned into the Epicentre Biotechnologies5 (Madison, W!) blunt cloning vector pCC 1, as per the manuiaeturerts instructions, £02623 While the PCR product (SEQ ID NO; 100 or SEQ 3D NO; 101) can ligate info pCCl in. either direction, the forward orientation relative to the he promoter was chosen, generating pLybAUf (SEQ ID NO: 102) ((xmt^nmg'upp'· of Synechocystis spp. PCC 6803) and p.LybAL5f(S£Q ID NO: 103) (containing upp-olSiyneckococeu$-elongatiis PCC 7942), respectively. The inserts were sequenced using oligonucleotides T7loag (SEQ I'D NO: 104) and MI3rey (SEQ ID NO; 105), The nucleotide sequence of upp of Synechocystis 8pp. PCC 6803 is represented by SEQ ID NO: 111 and the polypeptide sequence by SEQ ID NO: 112. The nucleotide sequence of upp of Synechocoecm elongates PCC 7042'isrepresented by SEQ ID NO: 113 and the polypeptide sequence by SEQ ID NO: 114.

[02631 Plasmid pI.ybAL4f (SEQ ID NO: 106). was created from pLybAOf (SEQ ID NO: 102) by removal of the Blpl-mP ApaLI fragment, blunt ending with T4 DNA polymerase and then reeircuSariztng with T4 DNA ligase. Part of the Synechoeystis spp. PCC 6803 .upp gene was then deleted by digesting pLybAIAf with ,4vrII and Sgf.I, blunt ending with T4 DNA polymerase and then redtcuiaming with T4 DNA ligase, creating pLybAL9f (SEQ 'ID NO; 107), The Sach'Sphl fragment (SEQ ID NO; 108) bearing the cyanobacteria! DNA was excised from pLybAL9i (SEQ ID NO: 107) and ligated into similarly digested pARO 180'(sequence not completely known; Parke, D, 1990, Construction of mobilizable vectors derived from plasmids RP4, pUC18 and pUCl9. Gene 93:135-137;· ATCC 77123), creating pLybAL25. Plasmid piybALbfb (SEQ ID NO: 109) was created from plybALSfby removal of the Sapl and AptM -fragment», blunt ending with T4 DNA polymerase and then rccircuiarfzing with T4 DNA ligase. Part of the Syneehococem etangatus PCC 7942 upp gone was then deleted by digesting pLybAL6fb'with BssHH and Sswl, blunt ending with T4 DNA polymerase and then recircularizingwith T4 DNA ligase, creating pLybALiOtb (SEQ ID NO: 110). The Sael/Sphl fragment (SEQ ID NO: 138) bearing the cyanobacteria! DNA was excised from pLyhALl Ofb and ligated into similarly digested pAROISO, creating pLybA.L26.

[0264] Plasmids pLybAL2S and pLybAL26 were placed in E. coil S17-1 (ATCC 47055). Plasmids pLybAE25 and pLybAL26 are to be transferred t&amp;.SynechoCystis. spp. PCC 6803 md Synechoeoccm efongam PCC 7942 by blparenta! cojqnption. Since these plasmids do not replicate in cyanobacteria, they should function as suicide vectors and cross over into the chromosome, deleting upp on one of the copies of the chromosome. An optimized protocol will enable speeding of segregation without killing the cells by premature exposure to too math 5~ fluorouracii.

Example.14: ΜομψκλτιονofsvcmsB degRABATmmenzymes [0265] Cyanobacteria transformed with: asf are further--engineered to improve sucrose production- by modulation of sucrose degradation activity.

[02663 The inventors have identified genes encoding invertase homologues in' both Synechocystis spp. PCC 6803 (nucleotide sequence SEQ ID NO: 70; polypeptide sequence SEQ ID NO: 73 ) and Syneckacoccus elongatus PCC 7942 (nucleotide sequence SEQ ID NO: 72; polypeptide sequence SEQ ID NO: 73), Synechocystis spp. PCC 6803 also encodes a sucrasefemedoxin-like protein (nucleotide sequence SEQ ID NO: 74; polypeptide sequence SEQ ID NO: 75) (M&amp;chray G,C. et al 1994, FEBS Lett 354,123-127).

[02 671 These genes are deleted using the markertess deletion protocol described in FIG. 11.

Example IS: Mobificatiom of StmmEliMamoAm^ "£mmj$s [02681 Cyanobacteria trartstormed with asf-are further engineered to promote sucrose secretion from the ceils, [ 02 691 When in. a low osmotic environment, the sucrose may be automatically expunged from toe cells, as done with osomoprotectants by some organisms when transitioning from high to low salt environments (Schleyer, M„ Schmidt, R. and Bakker, E, P. 1993, Arch Microbiol 160.424-43; Koo, $. P,, Higgins, C. F. and Booth, l R . 1991.1 Gen Microbiol 137, 2617-2625; Lamark, T,, Styrvold, Ο. B. and Strgim, A, R, 1992, FEMS Microbiol. Lett 96, 149154). Engineering of cyanobacteria can promote such a process.

[02701 Cyanobacteria transformed with asf are further engineered to express sucrose permease, such as- those used by E. coti and Salmonella or in the transport of sucrose to n itrogen-fixing cysts of certain cyanobacteria (Jahreis K, et at. 2002, J Bacteriol 1.84» 5307-5316;

Cumino, A, C, 2007, Plant Physiol 143, 1385-97), "These genes are cloned and transformed into cyanobacteria according to techniques described above.

EmMMM M: SumeSB SECM£naN3¥ CmimMACTERiA T«AmF0SMED mrHPcwm £02711 Sucrose secretion from 'Synechocystis spp, PCC 6803 and Synechoeoccus ehngatus PCC 7942 can be facilitated by transformation widv sucrose porin, [0272 ] The gene encoding sucrose pork (scrY) from Entembacter sakmakil ATC€ BAA-894 was cloned for expression in Synechocystis spp. PCC 6803 and Symchomccus ekmgatm PCC 7942. The function of this, gene has been inferred from its sequence and those of its neighbors. Entembacter-sakazakii sctYwas amplified from chromosomal' DNA by PCR with the oligonucleotides EsscrYBamHI-F (SEQ ID NO: 88) andEsserYSacl-R (SEQ ID NO: 89). The PCR product (SEQ ID NO; 90) was digested with and See!-and ligated into similarly digested pLybAL 19 and cloned into NEBSo, creating pLybA.I.,32 (SEQ ID NO: 91). The serf gene (nucleic acid SEQ ID NO: 94; polypeptide .Sequence,. SEQ ID NO: 95 ) was then sequenced with the oligonucleotides EsserY rmdseq-F (SEQ ID NO: 92) and EsscrYmidseq-R (SEQ ID NO: 93). When introduced into the host, this construct allows tor the co-expression of the genes serf-and mf under the control of the temperature-inducible promoter. This plasmid was transferred by tri-parental conjugation (as described above) into Symchocystis spp. PCC 6803. The transformed Syneck&amp;cyms spp, PCC 6803 is tested for efficacy in the secretion of sucrose. Similar transformation and testing of Synechococcus elongates·-?CC 7942 follows.

Example 17i Generation of Trehatose Accumciating Cyanobacteria [02731 The trehalose biosynthetic genes encoding trehalose phosphate synthase and trehalose phosphate phosphatase (®tsA and otsB, respectively) front E. coli are found in·a· two gene operon, otsBA (SEQ ID NO: 115). The opera·» was cloned by PCR 'amplification of E. colt R12 genomic DNA with the oligonucleotides EcotsBA-F (SEQ ID NO: 116) and EcotsBA-R (SEQ ID NO : 117). The PGR product was digested with Tj® and Nhel and was cloned into pLybAL 19 (SEQ ID NO; 48), replacing most of the asfgam. The new plasmid, pLyhAL23 (SEQ ID NO : 118), places the trehalose biosynthetic genes under the control of the temperature-inducible λ?κ promoter. The genes were- sequenced to verify their integrity with the oligonucleotides BeotsBAmidseq-F (SEQ ID NO: 119) and EcotsBAmidseq-R (SEQ ID NO: 120). Expression of the otyRd operon was then placed under control of die pyrR>psbAil, dm£ and Am.4 promoters (as described above) by ligating the.AjMi (blunt -codedwith T4 DNA. polytneritsej/Ai&amp;d fragment of pLybAL-23 bearing1 the otsBA operon, into pLybALl S, pLybAt 17, pLy bAL21 and pLybAL22 digested with Sad (bSunt-ended with T4 DMA polymerase) and Nkel creating pLybAL28 (SEQ ID NO: 12 1), pLybAL29 (SEQ ID NO; 122),. pLybAL30 (SEQ ID NO; 123), and pLybAL.31 (SEQ ID NO: 124), respectively; [02743 Each of plasmids pLybAL28 (SEQ ID NO: 121), pLybAL29 (SEQ ID NO: .122), pLybAUO (SEQ ID NO: 125), andpLyb AL3.1 (SEQ ID NO: 3 24) were moved into Synechocystis spp. PCC 6803 by tri-parental conjugation (as described above).

[02751 Expression of the otsBA operon from pLybAL23 was placed under the control of the Symehoeystis spp. ECC 6803 mA Syneghocmcus eJmgmrn PCC 7942 nirA promoters (as described above) in pLybAL16 and pLybALlS in the same way as just described for the Other promoters, creating pLyhAL36 (SEQ ID NO: 125) and pLybALS? (SEQ ID NO: 126), respectively.

MxamplmM; 'TrehaloseAssay [0276] Biomass was separated from the culture broth as necessary by cehtt’ifugatioo and residual biomass was removed from the clarified culture broth by filtration through 0,2 micron fil ter. The culture broth was concentrated to a residue by evaporation under reduced pressure. The concentrated culture broth was dissolved in I ml of dedonized water and then 10 microlhers of solution was sampled in a trehalose assay . The biomass collected by centrifugation, was transferred to a weigh dish and heated to 100 °C to remove residual moisture. The dry biomass was weighed and then a 100 mg sample was dissolved in 1 ml of de-iomzed water. Hie mixture was then ground and the solids were removed by centrifugation. A 10 mieroliter sample of the clarified supernatant was-diluted 100 fold with de~lonized water and 10 microliters of the diluted sample were tested for trehalose.

[0277] The assay fin trehalose used a modified procedure of a commercially supplied sucrose assay kit available through Biovision, Inc. The modification to the standard protocol was the substitution of trehalase for the kit supplied invertase enzyme solution. The kit mvoives tire hydrolysis of trehalose with trehalase to release glucose. The glucose is oxidized by glucose oxidase to produce hydrogen peroxide which is detected by the action of peroxidase in the presence of a colored indicator. The colored indicator is quantitatively measured by its characteristic absorbance at 570otn to afford the concentration of glucose originally present in the sample. 1027 8 J Ttshaiase ..(treA nucleic acid SEQ ID MO: .134 encoding trehalase polypeptide SEQ ID NO: 135) was prepared from the recombinant E. coli treA gene which has been engineered into a plasmid and transformed ..into-an E. coli host by a similar method as described by Gutierrez C, Ardourei M, Bremer E, Middendorf A, Boos W, Ehmann U.Mol Gen Genet. 1989 Jun;2l 7(2-3):347-54. Periplasmie trehalose was cloned from E, mii Ki 2, -encoded' by treA: The treA PCR product (SEQ ID NO: 127) was digested with AflWXbfilmd then ligated into similarly digested pLybCB6, a. proprietary plasmid with a constitutive version of the strong E. coil irp promoter, creating pLybAL24 (SEQ ID NO: 330). The integrity of the insert was analyzed by sequencing with the oligonucleotides EetreAmidseq-F and EetreArnidseq-R. 102783 A C-termiaal Hise-tagged version of the trehalase was constructed. The gene was amplified by PCR with the oligonucleotides EcrreA-F2 (SEQ ID NO: 131) and EctreA-R2 (SEQ ID NO: 132). The PCR product {SEQ ID NO: 3 36) was then digested wt&amp;AfifflMat and then ligated into similarly digested pLyhAE24! creating p.LybAI.33 (SEQ ID NO: 133). 102803 Strong constitutive expression of the periplasmie trehalase is detrimental, to the cells, causing a strong growth defect at 3TC. This can be significantly alleviated by growing the cells at 30*C. 102813 The protein was expressed in E, coli B W25113 on a plasmid p LYSAL24 (SEQ ID NO: 130) which was grown in 2xYT media containing kanamycin. The protein was produced eonsfitutively using the Trp promoter and contains a signal peptide which allows the protein to be transported to the periplasm. Following fermentation and harvesting of the biomass, the enzyme was-purified· by selective periplasmie release by treatment of the washed and resuspended cel! pellet with 2 3¾ V/v dichlororaethane in 50 piM Tris buffer pfl 8. The lysate was separated from cell debris by centrifugation and further processed by concentration using an Amieoo uitrafilter fitted wi th a 10,000 Dalton membrane. The concentrated lysate may he used in assays directly or the enzyme can be further purified by metal ion affinity chromatography using the engineered 6X poly histidine tag on the C-termimis of the enzyme (SEQ ID NO: 137),

Example 19: Solid Phase Txebaiose Prodcoion [02823 A solid composite fabric covered hydrophilic foam composed of a substrate* foam used as amedia/rooisture reservoir (Foamex Aquazcme) was boun d to a fabric layer (DuPont Somara) used as a growth surface measuring 15 cm by 15 cm. The composite material was sterilized by soaking in 70% ethanol in water and then hung in a vertical Moreacior plumbed to deliver solutions to the top o f the composite material. The solutions were allowed to percolate through the growing composite surface by gravity. Residual ethanol was removed from the sterilized growing surface by passage of I liter of sterile de-ionized wafer flowing at 0.2 mibnin. The growing surface was equilibrated with culture media by flowing 0.5 litem of BG11A-growth medium containing-10 .micro^arasfail chloramphenicol through the composite material at 0.2ral/uun.

[02833 The equilibrated, sterile growth surface was inoculated by flooding the surface with 10 ml of a 4 day pre-culture of Synechocystis spp. PCC 6803 transformed by plasmid pLYBAL23. Following 30 minute incubation the reactor was turned to a vertical position and the fermentation was begun. The reactor was-illumiuated with 80 microeisteins of light from a white LED array. Temperature was maintained at 28 °C, by a resistive heating device attached to the bioreactor. The reactor was continuously purged with 0.2 micron filtered air at 0.2 lAnln and fresh culture media was-supplied by pump and gravity' percolation through the foam layer of the growth composite at -a rate of 0,2 mi/msn for 30 minutes every 6 hours. The reactor was run continuously for 4-7 days during which the growth surface of the composite was overspread with a dense lawn of cyanobacteria. Following the initial cultivation period the temperature of the biorcactor was increased to 40°C and maintained at this temperature lor an additional 24 hours. During the elevated temperature period spent culture broth was collected and processed for trehalose defermination. At the completion of the fermentation run the biomass was collected by rinsing the growth surface with de-ionized water which can be processed, for trehalose assay. (u284| 1 ho amount os trehalose produced and retained in tire biomass grown-on the solid surface was up to 2.5 wt % of the total dry weight biomass recovered from the bioreaetor tallowing temperature- induction. .0.8 wt% of the dry biomass equivalent weight of trehalose was recovered from the-culture medium following temperature induction.

Example 29: Trehalose Pmi>ucnoN Liquid PmsE

[028 5J I liter ol stcnle BG'I IA media was prepared in a Bio How reactor to which chloramphenicol was-added to a 'concentration of 10 mierograms/mi. The reactor was then inoculated with a 5% by volume, 4 day pre-culture of Synechocystis spp. PCC 6803' transformed with plasmid pLYBAL23. The-reactor was run at 28 300 RPM, 0,2 L/rain 0,2 micron filtered air purge ..and. illuminated at 80 mlcroeinsteitis: of light using- a fluorescent bulb array. The cultivation was maintained for 4-7 days following which a 200ml sample was removed for processing and trehalose assay. The temperature of the fermentation was then elevated to 40 °C for 24 hours, A 200mt sample was then removed from the hforeaefor for processing and trehalose assay.

[0280] Following tempers! urn mdiu tipn the dried biomass produced up to 3 wt% trehalose whitofhe spent culture broth contained 0,3 wi% trehalose equivalent relative to: biomass·.

[0287] With reference to the use of the word(s) "comprise" or "comprises” or "comprising” in the foregoing description and/or in the following claims, unless the context «squires otherwise, those words are used on the basis and clear understanding that they arc to he interpreted inclusively, rather than exclusively, and that each of those words is t.> tie so interpreted in construing the foregoing description andior the following claims.

REFERENCES

[0288] All publications, patents, patent applications, and other references cited in this application are incorporated herein by reference in their entirety for all purposes to the same extent as if each indi vidual publication, patent, patent application or other reference was specifically and individually indicated to be incorporated by reference in its entirety for all purposes. Citation of a reference: herein shall notibe construed as an admission, 'that such is prior art to the present invention.

Claims (17)

1. The'claims defining the invention are as follows:

   1. A photobioreaetor comprising: a solid cultivation support, wherein the solid cultivation support comprises a nongelatinous, textured surface suitable tor culturing photosyhthetic microorganisms; a physical barrier; and a volume o f air ; wherein, the physical harrier is disposed over at least a portion of the solid cultivation support; and the volume of air is between the physical barrier and the solid eultivation support.
2. 2,. The photobioreaetor of claim 1, wherein the ptetohi©reactor comprises a plurality of eidiivation supports.
3. 3 , The photoirioreactor of claim 1 or 2, wherein the solid cultivation support is suitable lor adherence dt a photosynthetie microorganism.
4. 4, The photobioreaetor of any one of claims 1-3, wherein the solid cultivation support is suitable for culturing photosynthetie. microorganisms at a density of at least about 50 grams of dry biomass per liter equivalent.
5. 5. The photobioreoean-of any one of claims 1-4, wherein the sol id cultivation support comprises; (i) a fabric comprising a natural, modified natural, or synthetic fiber, or a combination thereof (it) a fabric comprising a woven fabric, a knitted fabric, a felt, a mesh, of cross-linked fiber polymers, or a combination thereof: (iii) a fabric comprising natural fibers selected from the group consisting.of cotton, woof, hemp, tree fiber, other cellulostc fibers* and combinations thereof; (i:v) a'fabric .comprising .modified natural fibers selected from the. group consisting oi nuroct'liulosc, cellulose acetate, cellulose sulfonate, crosslinkecl starches, and combi nations thereof; (v) a fabric comprising synthetic fibers selected from the group consisting of polyester, polyaerylale, polyamine, polyamide, poiysulfbne, and combinations, thereofi (vi) a material having loops; uiita material having loops, the material being terry cloth; or (viii)a combination thereof,
6. 6. I he photobioreactor oi any one of claims 1-5, wherein the solid cultivation support comprises; (i) a .flexible material, (ii) a rigid material, or (in) flexibly connected rigid portions, wherein the rigid portions are comprised of a rigid materials.
7. 7. The photobioreactor of any one of claims I -6, wherein the; solid cultivation support has a sheet shape and depth, of the solid cultivation support Chat is substantially less than length and width of the solid cultivation: support;
8. 8. Ihe photo bioreactor oi any one of claims 1-7, wherein the solid cultivation support: further comprises a coating of a moisture absorbent polymer is selected front the group consisting of agar, poiyacrylate, polyamide, polyamine, polyethylene gKeol. modified starches, and combinations thereof.
9. 9. The photobioreacior of any one of claims I -8, wherein the cultivation support comprises at least two layers, a first layer.adjacent-to a second: layer, wherein material of the at least two Sayers is the same: material at drtVorcnf. materials; and optionally, the first layer comprises a high-Surface, area, growth material and the second layer comprises a fluid permeable type material, Hf Ihe pltoiobioreaeior of any one of claims 1-¾ wherein the.physical barrier is releasably sealed so as to enclose the solid cultivation support.
10. 11. The photobioreacior of any one of claims 1-9, wherein the physical barrier, or a portion thereof: is a flexible physical Harrier; or is (1} substantiali\ impermeable to solid particulate or liquid and (fi) partially or substantially permeable to gas or vapor; or is substantially transparent to actinic irradiation.
11. 12. The .photobioreactor of any one of claims 1 -11, wherein the physical barrier comprises a first barrier portion and a second barrier portion, wherein the first barrier portion and the second barrier portion are different with respect to one or more of liquid permeability, gas permeability., or transparency to actinic radiation.
12. 13. The photobioreacior of any one of c kurus I -12, further comprising a suspension element, wherein the solid cultivation support is suspended from the suspension element and optionally: the solid cultivation support is suspended non-hori/ontally from, the suspension element; or the solid cultivation support is suspended substantially vertically from the suspension element; or the suspension element comprises one or more attachment points for attaching the photobioreacior to a structure.
13. 14.. I be photpbioreactor of any one of claims 1 -13, further comprising one or more of: a spray device for distributing a liquid medium'over the·: solid cultivation support; or water, nutrients, or a combination thereof on or within the solid culti vation support; or a source of actinic radiation that is (i) external to the physical harrier and the physical barrier is substantially transparent to actinic radiation or (ii) between the solid culti vation support and the physical barrier.
14. 15, The photobioreactor of any one o f claims ! -14,. further comprising- at least one of a fluid supply system, a pMrient supply system^ a gas supply -.sysiem, or mi c roorgarti sm- suppS y system. 1.6. The photobioreactor of any one of claims 1-15, further comprising pbotosynihetic microorganisms in or on the solid cultivation support,
15. 17. The photobioreactor of claim 16 . wherein the photosynthetic microorganisms comprise a transgenic photosyfcthetic microorganism cell the cell comprising an artificial DMA construct comprising, as operably associated components in the 5’ to 3' direction of transcription. a promoter functional in the photosymthetic microorganism cell, a polynucleotide comprising a true leotitle sequence encoding a polypeptide having a disaecharide biosynthetic aedvity: selected from the group consisting of a disaccharide phosphate synthase and: a disaecharide phosphate phosphatase, and a transcriptional termination sequence; wherein, the transgenic photosynthetic microorganism cell aceumulates increased le vels of the disaecharide compared to a photosynthetic niicroorganism cell not comprising the DNA construct, and the cel! is adhered to said portion of the surface ofihe cultivation support,
16. 18. A device for cultivating; pliotosynthetic microorganisms, comprising; the photobioreactor of any one of claims 1-17;: and a structure; wherein the photobioreactor is attached to the structure: and the solid cultivation support is oriented non-horbonial.ly.. ! 9. The device: of claim I8, further "comprising: at least one of a .fluid supply system, nutrient supply system, gas supplv system, or microorganism supply system; wherein the fluid supply system, nutrient supply system, gas supply system, or -microorganism supply system is operably connected to the photobioreactor.
17. 20. The. device of claim 18, wherein., the photobioreactor is suspended from the structure and. the structure is substantially covered by the physical barrier. BA IKB A A