AU2011307953B2 - Tetracyclic indole derivatives for treating hepatitis C virus infection - Google Patents

Abstract

Tetracyclic indole derivatives of formula (I), pharmaceutically acceptable salts and the pharmaceutical compositions thereof are provided, wherein A, A', G, R

Description

WO 2012/041014 1 PCT/CN2011/001638 TETRACYCLIC INDOLE DERIVATIVES FOR TREATING HEPATITIS C VIRUS INFECTION FIELD OF THE INVENTION The present invention relates to novel Tetracyclic Indole Derivatives, compositions comprising at least one Tetracyclic Indole Derivative, and methods of using the Tetracyclic Indole Derivatives for treating or preventing HCV infection in a patient. BACKGROUND OF THE INVENTION Hepatitis C virus (HCV) is a major human pathogen. A substantial fraction of these HCV-infected individuals develop serious progressive liver disease, including cirrhosis and hepatocellular carcinoma, which are often fatal. HCV is a sense single-stranded enveloped RNA virus that has been implicated as the major causative agent in non-A, non-B hepatitis (NANBH), particularly in blood-associated NANBH (BB-NANBH) (see, International Publication No. WO 89/04669 and European Patent Publication No. EP 381 216). NANBH is to be distinguished from other types of viral-induced liver disease, such as hepatitis A virus (HAV), hepatitis B virus (HBV), delta hepatitis virus (HDV), cytomegalovirus (CMV) and Epstein-Barr virus (EBV), as well as from other forms of liver disease such as alcoholism and primary biliar cirrhosis. It is well-established that persistent infection of HCV is related to chronic hepatitis, and as such, inhibition of HCV replication is a viable strategy for the prevention of hepatocellular carcinoma. Current therapies for HCV infection include a-interferon monotherapy and combination therapy comprising a-interferon and ribavirin. These therapies have been shown to be effective in some patients with chronic HCV infection, but suffer from poor efficacy and unfavorable side-effects and there are currently efforts directed to the discovery of HCV replication inhibitors that are useful for the treatment and prevention of HCV related disorders. Current research efforts directed toward the treatment of HCV includes the use of antisense oligonucleotides, free bile acids (such as ursodeoxycholic acid and chenodeoxycholic acid) and conjugated bile acids (such as tauroursodeoxycholic WO 2012/041014 PCT/CN2011/001638 2 acid). Phosphonoformic acid esters have also been proposed as potentially useful for the treatment of various viral infections, including HCV. Vaccine development, however, has been hampered by the high degree of viral strain heterogeneity and immune evasion and the lack of protection against reinfection, even with the same inoculum. In light of these treatment hurdles, the development of small-molecule inhibitors directed against specific viral targets has become a major focus of anti HCV research. The determination of crystal structures for NS3 protease, NS3 RNA helicase, NS5A, and NS5B polymerase, with and without bound ligands, has provided important structural insights useful for the rational design of specific inhibitors. Recent attention has been focused toward the identification of inhibitors of HCV NS5A. HCV NS5A is a 447 amino acid phosphoprotein which lacks a defined enzymatic function. It runs as 56kd and 58kd bands on gels depending on phosphorylation state (Tanji, et al. J. Virol. 69:3980-3986 (1995)). HCV NS5A resides in replication complex and may be responsible for the switch from replication of RNA to production of infectious virus (Huang, Y, et al., Virology 364:1-9 (2007)). Multicyclic HCV NS5A inhibitors have been reported. See U.S. Patent Publication Nos. US20080311075, US20080044379, US20080050336, US20080044380, US20090202483 and US2009020478. HCV NS5A inhibitors having fused tricyclic moieties are disclosed in International Patent Publication Nos. WO 10/065681, WO 10/065668, and WO 10/065674. Other HCV NS5A inhibitors and their use for reducing viral load in HCV infected humans have been described in U.S. Patent Publication No. US2006027651 1. SUMMARY OF THE INVENTION In one aspect, the present invention provides Compounds of Formula WO 2012/041014 PCT/CN2011/001638 3 A R 1 5 fl f\ /) A' RiW HNNIG V (I) or a pharmaceutically acceptable salt thereof, wherein: A and A' are each independently a 5 or 6-membered monocyclic heterocycloalkyl, wherein said 5 or 6-membered monocyclic heterocycloalkyl group can be optionally fused to an aryl group; and wherein said 5 or 6-membered monocyclic heterocycloalkyl group can be optionally and independently substituted on one or more ring carbon atoms with RD, such that any two R groups on the same ring, together with the carbon atoms to which they are attached, can join to form a fused, bridged or spirocyclic 3 to 6-membered cycloalkyl group or a fused, bridged or spirocyclic 4 to 6-membered heterocycloalkyl group, wherein said 5 or 6-membered monocyclic heterocycloalkyl contains from 1 to 2 ring heteroatoms, each independently selected from N(R 4 ), S, 0 and Si(R1 6

)

2 ; G is selected from -C(R 3

)

2 -0-, -C(R 3

)

2 -N(R)-, -C(O)-O-, -C(O)

N(R

5 )-, -C(O)-C(R 3

)

2 -, -C(R 3

)

2 -C(O)-, -C(=NR 5 )-N(R)-, -C(R 3

)

2

-SO

2 -, -S0 2

-C(R

3

)

2 -,

-SO

2

N(R

5 )-, -C(R 3

)

2

-C(R

3

)

2 -, -C(R 14

)=C(R'

4 )- and -C(R1 4 )=N-; U is selected from N and C(R 2 ); V and V' are each independently selected from N and C(R 5 ); W and W' are each independently selected from N and C(R'); X and X' are each independently selected from N and C(R1 0 ); Y and Y' are each independently selected from N and C(R' 0 );

R

1 is selected from H, C 1

-C

6 alkyl, 3 to 6-membered cycloalkyl, halo, OH, -O-(C 1

-C

6 alkyl), CI-C 6 haloalkyl and -O-(C 1

-C

6 haloalkyl); each occurrence of R2 is independently selected from H, Ci-C 6 alkyl, 3 to 6 membered cycloalkyl, -O-(C 1

-C

6 alkyl), CI-C 6 haloalkyl -0-(C 1

-C

6 haloalkyl); halo, -OH, aryl, and heteroaryl; each occurrence of R3 is independently selected from H, C 1

-C

6 alkyl,

CI-C

6 haloalkyl, -(C 1

-C

6 alkylene)-O-(CI-C 6 alkyl), -(C 1

-C

6 alkylene)-O-(3 to 6 membered cycloalkyl), 3 to 6-membered cycloalkyl, 4 to 6-membered WO 2012/041014 PCT/CN2011/001638 4 heterocycloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl, 9 or 10-membered bicyclic heteroaryl and benzyl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group, said 9 or 10-membered bicyclic heteroaryl group or the phenyl moiety of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from C 1

-C

6 alkyl, C 1

-C

6 haloalkyl, -O-(Ci-C 6 alkyl), -O(C 1

-C

6 haloalkyl), halo, -(C 1

-C

6 alkylene)-O-(CI-C 6 alkyl) and CN and wherein two R 3 groups attached to the same carbon atom, together with the common carbon atom to which they are attached, can join to form a carbonyl group, a 3 to 6-membered spirocyclic cycloalkyl group or a 3 to 6-membered spirocyclic heterocycloalkyl group; each occurrence of R 4 is independently selected from -[C(R 7

)

2 ]qN(R 6

)

2 , -C(O)R", -C(O)-[C(R 7

)

2 ]qN(R 6

)

2 , -C(O)-[C(R) 2 ]q-R", -C(O)-[C(R 7 )2]qN(R 6

)C(O)

R", -C(O)[C(R 7

)

2 ]qN(R 6 )SO2-R", -C(O)-[C(R 7

)

2 ]qN(R6 )C(O)O-R", -C(O)

[C(R

7

)

2 ]qC(O)O-R" and -alkylene-N(R6)-[C(R 7

)

2 ]q-N(R 6 )-C(O)O-R"; each occurrence of R5 is independently selected from H, C 1

-C

6 alkyl, (CI-C 6 alkylene)-O-(CI-C 6 alkyl), 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl and benzyl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group or the phenyl moiety of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from C 1

-C

6 alkyl, C 1

-C

6 haloalkyl, -0

(C

1

-C

6 alkyl), -0-(C 1

-C

6 haloalkyl), halo, -(C 1

-C

6 alkylene)-O-(CI-C 6 alkyl) and CN; each occurrence of R6 is independently selected from H, C 1

-C

6 alkyl, 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl and 5 or 6 membered monocyclic heteroaryl, wherein said 3 to 6-membered cycloalkyl group, said 4 to 6-membered heterocycloalkyl group, said aryl group and said 5 or 6 membered monocyclic heteroaryl group can be optionally and independently substituted with up to two R groups, and wherein two R6 groups that are attached to the same nitrogen atom, together with the common nitrogen atom to which they are attached, can join to form a 4 to 6-membered heterocycloalkyl group; each occurrence of R 7 is independently selected from H, C 1

-C

6 alkyl,

C

1

-C

6 haloalkyl, -alkylene-O-(CI-C 6 alkyl), 3 to 6-membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl, wherein said 3 to 6-membered cycloalkyl group, said 4 to 6-membered WO 2012/041014 PCT/CN2011/001638 5 heterocycloalkyl group, said aryl group and said 5 or 6-membered monocyclic heteroaryl group can be optionally substituted with up to three R groups; each occurrence of R 8 is independently selected from H, C-C 6 alkyl, halo, -C-C 6 haloalkyl, C-C 6 hydroxyalkyl, -OH, -C(O)NH-(C-C 6 alkyl), -C(O)N(C

C

6 alkyl) 2 , -O-(C-C 6 alkyl), -N-H2, -NH(CI-C 6 alkyl), -N(C-C 6 alkyl) 2 and -NHC(O)

(CI-C

6 alkyl); each occurrence of R 9 is independently selected from H, C-C 6 alkyl, C I-C 6 haloalkyl, 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl; each occurrence of R' 0 is independently selected from H, C-C 6 alkyl,

CI-C

6 haloalkyl, halo, -OH, -O-(C-C 6 alkyl) and -CN; each occurrence of R 1 is independently selected from H, C-C 6 alkyl,

CI-C

6 haloalkyl, C-C 6 hydroxyalkyl, 3 to 6-membered cycloalkyl and 4 to 6 membered heterocycloalkyl; each occurrence of R1 2 is independently selected from C-C 6 alkyl, C

C

6 haloalkyl, 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl; each occurrence of R1 3 is independently selected from H, halo, C-C 6 alkyl, C-C 6 haloalkyl, 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, -CN, -OR', -N(R )2, -C(O)R 2, -C(O)OR, -C(O)N(R 9

)

2 , NHC(O)R , -NHC(O)NHR 9 , -NHC(O)OR 9 , -OC(O)R , -SR 9 and -S(O) 2

R

2 , wherein two R1 2 groups together with the carbon atom(s) to which they are attached, can optionally join to form a 3 to 6-membered cycloalkyl group or 4 to 6-membered heterocycloalkyl group; each occurrence of R 14 is independently selected from H, halo, I-C 6 alkyl, -(C-C 6 alkylene)-O-(CI-C 6 alkyl), 3 to 6-membered cycloalkyl, CI-C 6 haloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl and benzyl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group or the phenyl moiety of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, C-C 6 alkyl, C-C 6 haloalkyl, -0

(CI-C

6 alkyl), -(CrC 6 alkylene)-O-(C-C 6 alkyl) and -O-(C-C 6 haloalkyl); each occurrence of R' 5 is independently selected from H, C-C 6 alkyl, 3 to 6-membered cycloalkyl, halo, -OH, -O-(C-C 6 alkyl), C-C 6 haloalkyl and -0

(C-C

6 haloalkyl); WO 2012/041014 PCT/CN201 1/001638 6 each occurrence of R 1 6 is independently selected from H, halo, CI-C 6 alkyl and 3 to 6-membered cycloalkyl, wherein two R 16groups that r tahdt common silicon atom can join to form a -(CH 2

)

4 - or a -(CH 2

)

5 - group; and each occurrence of q is independently an integer ranging from 0 to 4, provided that the compound of formula (1) is other than: CH H, 0 0OH, H OH,3 CH HNH IH2>I NH 0 OH,3'. NH 0 HN -. ,NH 0 N N H/ H N N NIN N X 0,

OH

3 0JCH3 0 /H CHHN HN CH3 H H N FH 0H NN_- N 0 CHH CH3 HN N H N F H N N \/ 0 NHN H pN NN /N N~ Hj C\N N HNNH 0 OH 0'~N HN OHO0 ~ H N N H-C N0 < 7H . N 0) HD CH3 0 N' 0 OH PH NH3 OHOH OH,'f C -O ,H,

CHH

3 3 H 0H OH 0 0-11 H I F N H N_ / NN N2 H HHN N HN 0 0 N-H \-O. >.O, 1 6 H, N 0 0 OHH\ HN-OH OHNH 0 H, HN O H OH 0 H, 0 OH, OH WO 2012/041014 PCT/CN2011/001638 7 NN F o O N 0N: 0 0 or H . The Compounds of Formula (I) (also referred to herein as the "Tetracyclic Indole Derivatives") and pharmaceutically acceptable salts thereof can be useful, for example, for inhibiting HCV viral replication or replicon activity, and for treating or preventing HCV infection in a patient. Without being bound by any specific theory, it is believed that the Tetracyclic Indole Derivatives inhibit HCV viral replication by inhibiting HCV NS5A. Accordingly, the present invention provides methods for treating or preventing HCV infection in a patient, comprising administering to the patient an effective amount of at least one Tetracyclic Indole Derivative. The details of the invention are set forth in the accompanying detailed description below. Although any methods and materials similar to those described herein can be used in the practice or testing of the present invention, illustrative methods and materials are now described. Other embodiments, aspects and features of the present invention are either further described in or will be apparent from the ensuing description, examples and appended claims. DETAILED DESCRIPTION OF THE INVENTION The present invention relates to novel Tetracyclic Indole Derivatives, compositions comprising at least one Tetracyclic Indole Derivative, and methods of using the Tetracyclic Indole Derivatives for treating or preventing HCV infection in a patient. Definitions and Abbreviations The terms used herein have their ordinary meaning and the meaning of such terms is independent at each occurrence thereof. That notwithstanding and except where stated otherwise, the following definitions apply throughout the specification and claims. Chemical names, common names, and chemical structures WO 2012/041014 PCT/CN2011/001638 8 may be used interchangeably to describe the same structure. If a chemical compound is referred to using both a chemical structure and a chemical name and an ambiguity exists between the structure and the name, the structure predominates. These definitions apply regardless of whether a term is used by itself or in combination with other terms, unless otherwise indicated. Hence, the definition of "alkyl" applies to "alkyl" as well as the "alkyl" portions of "hydroxyalkyl," "haloalkyl," "-O-alkyl," etc... As used herein, and throughout this disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meanings: A "patient" is a human or non-human mammal. In one embodiment, a patient is a human. In another embodiment, a patient is a chimpanzee. The term "effective amount" as used herein, refers to an amount of Tetracyclic Indole Derivative and/or an additional therapeutic agent, or a composition thereof that is effective in producing the desired therapeutic, ameliorative, inhibitory or preventative effect when administered to a patient suffering from a viral infection or virus-related disorder. In the combination therapies of the present invention, an effective amount can refer to each individual agent or to the combination as a whole, wherein the amounts of all agents administered are together effective, but wherein the component agent of the combination may not be present individually in an effective amount. The term "preventing," as used herein with respect to an HCV viral infection or HCV-virus related disorder, refers to reducing the likelihood of HCV infection. The term "alkyl," as used herein, refers to an aliphatic hydrocarbon group having one of its hydrogen atoms replaced with a bond. An alkyl group may be straight or branched and contain from about 1 to about 20 carbon atoms. In one embodiment, an alkyl group contains from about 1 to about 12 carbon atoms. In different embodiments, an alkyl group contains from 1 to 6 carbon atoms (C 1

-C

6 alkyl) or from about 1 to about 4 carbon atoms (C-C 4 alkyl). Non-limiting examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, n-pentyl, neopentyl, isopentyl, n-hexyl, isohexyl and neohexyl. An alkyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -0-alkyl, -0-aryl, -alkylene-O-alkyl, alkylthio, -NH 2 , -NH(alkyl), -N(alkyl) 2 , -NH(cycloalkyl), WO 2012/041014 PCT/CN2011/001638 9 -O-C(O)-alkyl, -O-C(O)-aryl, -O-C(O)-cycloalkyl, -C(O)OH and -C(0)O-alkyl. In one embodiment, an alkyl group is linear. In another embodiment, an alkyl group is branched. Unless otherwise indicated, an alkyl group is unsubstituted. The term "alkenyl," as used herein, refers to an aliphatic hydrocarbon group containing at least one carbon-carbon double bond and having one of its hydrogen atoms replaced with a bond. An alkenyl group may be straight or branched and contain from about 2 to about 15 carbon atoms. In one embodiment, an alkenyl group contains from about 2 to about 12 carbon atoms. In another embodiment, an alkenyl group contains from about 2 to about 6 carbon atoms. Non-limiting examples of alkenyl groups include ethenyl, propenyl, n-butenyl, 3-methylbut-2-enyl, n pentenyl, octenyl and decenyl. An alkenyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -0-alkyl, -0-aryl, -alkylene-O-alkyl, alkylthio, -NH 2 , NH(alkyl), -N(alkyl) 2 , -NH(cycloalkyl), -O-C(O)-alkyl, -O-C(O)-aryl, -O-C(O) cycloalkyl, -C(O)OH and -C(O)O-alkyl. The term "C 2

-C

6 alkenyl" refers to an alkenyl group having from 2 to 6 carbon atoms. Unless otherwise indicated, an alkenyl group is unsubstituted. The term "alkynyl," as used herein, refers to an aliphatic hydrocarbon group containing at least one carbon-carbon triple bond and having one of its hydrogen atoms replaced with a bond. An alkynyl group may be straight or branched and contain from about 2 to about 15 carbon atoms. In one embodiment, an alkynyl group contains from about 2 to about 12 carbon atoms. In another embodiment, an alkynyl group contains from about 2 to about 6 carbon atoms. Non-limiting examples of alkynyl groups include ethynyl, propynyl, 2-butynyl and 3-methylbutynyl. An alkynyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -0-alkyl, -0-aryl, -alkylene-O-alkyl, alkylthio, -NH 2 , -NH(alkyl), -N(alkyl)2, -NH(cycloalkyl), -O-C(O)-alkyl, -O-C(O)-aryl, -O-C(O)-cycloalkyl, -C(O)OH and -C(O)O-alkyl. The term "C 2

-C

6 alkynyl" refers to an alkynyl group having from 2 to 6 carbon atoms. Unless otherwise indicated, an alkynyl group is unsubstituted. The term "alkylene," as used herein, refers to an alkyl group, as defined above, wherein one of the alkyl group's hydrogen atoms has been replaced WO 2012/041014 PCT/CN2011/001638 10 with a bond. Non-limiting examples of alkylene groups include -CH 2 -, -CH 2

CH

2 -, CH 2

CH

2

CH

2 -, -CH2CH 2

CH

2

CH

2 -, -CH(CH 3

)CH

2

CH

2 -, -CH(CH 3 )- and CH 2

CH(CH

3

)CH

2 -. In one embodiment, an alkylene group has from I to about 6 carbon atoms. In another embodiment, an alkylene group is branched. In another embodiment, an alkylene group is linear. In one embodiment, an alkylene group is CH 2 -. The term "C 1

-C

6 alkylene" refers to an alkylene group having from I to 6 carbon atoms. The term "aryl," as used herein, refers to an aromatic monocyclic or multicyclic ring system comprising from about 6 to about 14 carbon atoms. In one embodiment, an aryl group contains from about 6 to about 10 carbon atoms. An aryl group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. In one embodiment, an aryl group can be optionally fused to a cycloalkyl or cycloalkanoyl group. Non limiting examples of aryl groups include phenyl and naphthyl. In one embodiment, an aryl group is phenyl. Unless otherwise indicated, an aryl group is unsubstituted. The term "arylene," as used herein, refers to a bivalent group derived from an aryl group, as defined above, by removal of a hydrogen atom from a ring carbon of an aryl group. An arylene group can be derived from a monocyclic or multicyclic ring system comprising from about 6 to about 14 carbon atoms. In one embodiment, an arylene group contains from about 6 to about 10 carbon atoms. In another embodiment, an arylene group is a naphthylene group. In another embodiment, an arylene group is a phenylene group. An arylene group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. An arylene group is divalent and either available bond on an arylene group can connect to either group flanking the arylene group. For example, the group "A-arylene-B," wherein the arylene group is: is understood to represent both: WO 2012/041014 PCT/CN2011/001638 11 A and B A. In one embodiment, an arylene group can be optionally fused to a cycloalkyl or cycloalkanoyl group. Non-limiting examples of arylene groups include phenylene and naphthalene. In one embodiment, an arylene group is unsubstituted. In another embodiment, an arylene group is: or b Unless otherwise indicated, an arylene group is unsubstituted. The term "cycloalkyl," as used herein, refers to a non-aromatic mono or multicyclic ring system comprising from about 3 to about 10 ring carbon atoms. In one embodiment, a cycloalkyl contains from about 5 to about 10 ring carbon atoms. In another embodiment, a cycloalkyl contains from about 3 to about 7 ring atoms. In another embodiment, a cycloalkyl contains from about 5 to about 6 ring atoms. The term "cycloalkyl" also encompasses a cycloalkyl group, as defined above, which is fused to an aryl (e.g., benzene) or heteroaryl ring. Non-limiting examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl. Non-limiting examples of multicyclic cycloalkyls include 1-decalinyl, norbornyl and adamantyl. A cycloalkyl group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. In one embodiment, a cycloalkyl group is unsubstituted. The term "3 to 6-membered cycloalkyl" refers to a cycloalkyl group having from 3 to 6 ring carbon atoms. Unless otherwise indicated, a cycloalkyl group is unsubstituted. A ring carbon atom of a cycloalkyl group may be functionalized as a carbonyl group. An illustrative example of such a cycloalkyl group (also referred to herein as a "cycloalkanoyl" group) includes, but is not limited to, cyclobutanoyl: 0 WO 2012/041014 PCT/CN2011/001638 12 The term "cycloalkenyl," as used herein, refers to a non-aromatic mono- or multicyclic ring system comprising from about 4 to about 10 ring carbon atoms and containing at least one endocyclic double bond. In one embodiment, a cycloalkenyl contains from about 4 to about 7 ring carbon atoms. In another embodiment, a cycloalkenyl contains 5 or 6 ring atoms. Non-limiting examples of monocyclic cycloalkenyls include cyclopentenyl, cyclohexenyl, cyclohepta-1,3-dienyl, and the like. A cycloalkenyl group can be optionally substituted with one or more "ring system substituents" which may be the same or different, and are as defined herein below. A ring carbon atom of a cycloalkyl group may be functionalized as a carbonyl group. In one embodiment, a cycloalkenyl group is cyclopentenyl. In another embodiment, a cycloalkenyl group is cyclohexenyl. The term "4 to 6 membered cycloalkenyl" refers to a cycloalkenyl group having from 4 to 6 ring carbon atoms. Unless otherwise indicated, a cycloalkenyl group is unsubstituted. The term "halo," as used herein, means -F, -Cl, -Br or -I. The term "haloalkyl," as used herein, refers to an alkyl group as defined above, wherein one or more of the alkyl group's hydrogen atoms has been replaced with a halogen. In one embodiment, a haloalkyl group has from I to 6 carbon atoms. In another embodiment, a haloalkyl group is substituted with from 1 to 3 F atoms. Non-limiting examples of haloalkyl groups include -CH 2 F, -CHIF 2 , -CF 3 , CH 2 Cl and -CCl 3 . The term "C 1

-C

6 haloalkyl" refers to a haloalkyl group having from 1 to 6 carbon atoms. The term "hydroxyalkyl," as used herein, refers to an alkyl group as defined above, wherein one or more of the alkyl group's hydrogen atoms has been replaced with an -OH group. In one embodiment, a hydroxyalkyl group has from 1 to 6 carbon atoms. Non-limiting examples of hydroxyalkyl groups include -CH 2 OH, CH 2

CH

2 OH, -CH 2

CH

2

CH

2 OH and -CH 2

CH(OH)CH

3 . The term "C 1

-C

6 hydroxyalkyl" refers to a hydroxyalkyl group having from I to 6 carbon atoms. The term "heteroaryl," as used herein, refers to an aromatic monocyclic or multicyclic ring system comprising about 5 to about 14 ring atoms, wherein from 1 to 4 of the ring atoms is independently 0, N or S and the remaining ring atoms are carbon atoms. In one embodiment, a heteroaryl group has 5 to 10 ring atoms. In another embodiment, a heteroaryl group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heteroaryl group is bicyclic and had 9 or 10 ring atoms. A heteroaryl group can be optionally substituted by one or more "ring system WO 2012/041014 PCT/CN2011/001638 13 substituents" which may be the same or different, and are as defined herein below. A heteroaryl group is joined via a ring carbon atom, and any nitrogen atom of a heteroaryl can be optionally oxidized to the corresponding N-oxide. The term "heteroaryl" also encompasses a heteroaryl group, as defined above, which is fused to a benzene ring. Non-limiting examples of heteroaryls include pyridyl, pyrazinyl, furanyl, thienyl, pyrimidinyl, pyridone (including N-substituted pyridones), isoxazolyl, isothiazolyl, oxazolyl, oxadiazolyl, thiazolyl, pyrazolyl, furazanyl, pyrrolyl, triazolyl, 1,2,4-thiadiazolyl, pyrazinyl, pyridazinyl, quinoxalinyl, phthalazinyl, oxindolyl, imidazo[1,2-a]pyridinyl, imidazo[2,1-b]thiazolyl, benzofurazanyl, indolyl, azaindolyl, benzimidazolyl, benzothienyl, quinolinyl, imidazolyl, benzimidazolyl, thienopyridyl, quinazolinyl, thienopyrimidyl, pyrrolopyridyl, imidazopyridyl, isoquinolinyl, benzoazaindolyl, 1,2,4-triazinyl, benzothiazolyl and the like, and all isomeric forms thereof. The term "heteroaryl" also refers to partially saturated heteroaryl moieties such as, for example, tetrahydroisoquinolyl, tetrahydroquinolyl and the like. In one embodiment, a heteroaryl group is a 5 or 6-membered monocyclic heteroaryl. In another embodiment, a heteroaryl group is a 6-membered monocyclic heteroaryl. In another embodiment, a heteroaryl group is a 5-membered monocyclic heteroaryl. In one embodiment, a heteroaryl group is a 9 or 10-membered monocyclic heteroaryl. In another embodiment, a heteroaryl group is a 9-membered monocyclic heteroaryl. Unless otherwise indicated, a heteroaryl group is unsubstituted. The term "heteroarylene," as used herein, refers to a bivalent group derived from an heteroaryl group, as defined above, by removal of a hydrogen atom from a ring carbon or ring heteroatom of a heteroaryl group. A heteroarylene group can be derived from a monocyclic or multicyclic ring system comprising about 5 to about 14 ring atoms, wherein from 1 to 4 of the ring atoms are each independently 0, N or S and the remaining ring atoms are carbon atoms. A heteroarylene group can be optionally substituted by one or more "ring system substituents" which may be the same or different, and are as defined herein below. A heteroarylene group is joined via a ring carbon atom or by a nitrogen atom with an open valence, and any nitrogen atom of a heteroarylene can be optionally oxidized to the corresponding N-oxide. The term "heteroarylene" also encompasses a heteroarylene group, as defined above, which is fused to a benzene ring. Non-limiting examples of heteroarylenes include pyridylene, pyrazinylene, furanylene, thienylene, pyrimidinylene, pyridonylene (including those derived from N-substituted pyridonyls), isoxazolylene, WO 2012/041014 PCT/CN2011/001638 14 isothiazolylene, oxazolylene, oxadiazolylene, thiazolylene, pyrazolylene, thiophenylene, furazanylene, pyrrolylene, triazolylene, 1,2,4-thiadiazolylene, pyrazinylene, pyridazinylene, quinoxalinylene, phthalazinylene, oxindolylene, imidazo[1,2-a]pyridinylene, imidazo[2,1-b]thiazolylene, benzofurazanylene, indolylene, azaindolylene, benzimidazolylene, benzothienylene, quinolinylene, imidazolylene, benzimidazolylene, thienopyridylene, quinazolinylene, thienopyrimidylene, pyrrolopyridylene, imidazopyridylene, isoquinolinylene, benzoazaindolylene, 1,2,4-triazinylene, benzothiazolylene and the like, and all isomeric forms thereof. The term "heteroarylene" also refers to partially saturated heteroarylene moieties such as, for example, tetrahydroisoquinolylene, tetrahydroquinolylene, and the like. A heteroarylene group is divalent and either available bond on a heteroarylene ring can connect to either group flanking the heteroarylene group. For example, the group "A-heteroarylene-B," wherein the heteroarylene group is: 0 is understood to represent both: B and A 7 B In one embodiment, a heteroarylene group is a monocyclic heteroarylene group or a bicyclic heteroarylene group. In another embodiment, a heteroarylene group is a monocyclic heteroarylene group. In another embodiment, a heteroarylene group is a bicyclic heteroarylene group. In still another embodiment, a heteroarylene group has from about 5 to about 10 ring atoms. In another embodiment, a heteroarylene group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heteroarylene group is bicyclic and has 9 or 10 ring atoms. In another embodiment, a heteroarylene group is a 5-membered monocyclic heteroarylene. In another embodiment, a heteroarylene group is a 6-membered monocyclic heteroarylene. In another embodiment, a bicyclic heteroarylene group comprises a 5 or 6-membered monocyclic heteroarylene group fused to a benzene ring. Unless otherwise indicated, a heteroarylene group is unsubstituted.

WO 2012/041014 PCT/CN2011/001638 15 The term "heterocycloalkyl," as used herein, refers to a non-aromatic saturated monocyclic or multicyclic ring system comprising 3 to about 11 ring atoms, wherein from 1 to 4 of the ring atoms are independently 0, S, N or Si, and the remainder of the ring atoms are carbon atoms. A heterocycloalkyl group can be joined via a ring carbon, ring silicon atom or ring nitrogen atom. In one embodiment, a heterocycloalkyl group is monocyclic and has from about 3 to about 7 ring atoms. In another embodiment, a heterocycloalkyl group is monocyclic has from about 4 to about 7 ring atoms. In another embodiment, a heterocycloalkyl group is bicyclic and has from about 7 to about I1 ring atoms. In still another embodiment, a heterocycloalkyl group is monocyclic and has 5 or 6 ring atoms. In one embodiment, a heterocycloalkyl group is monocyclic. In another embodiment, a heterocycloalkyl group is bicyclic. There are no adjacent oxygen and/or sulfur atoms present in the ring system. Any -NH group in a heterocycloalkyl ring may exist protected such as, for example, as an -N(BOC), -N(Cbz), -N(Tos) group and the like; such protected heterocycloalkyl groups are considered part of this invention. The term "heterocycloalkyl" also encompasses a heterocycloalkyl group, as defined above, which is fused to an aryl (e.g., benzene) or heteroaryl ring. A heterocycloalkyl group can be optionally substituted by one or more "ring system substituents" which may be the same or different, and are as defined herein below. The nitrogen or sulfur atom of the heterocycloalkyl can be optionally oxidized to the corresponding N-oxide, S-oxide or S,S-dioxide. Non-limiting examples of monocyclic heterocycloalkyl rings include oxetanyl, piperidyl, pyrrolidinyl, piperazinyl, morpholinyl, thiomorpholinyl, thiazolidinyl, 1,4-dioxanyl, tetrahydrofuranyl, tetrahydrothiophenyl, delta-lactam, delta-lactone, silacyclopentane, silapyrrolidine and the like, and all isomers thereof. Non-limiting illustrative examples of a silyl-containing heterocycloalkyl group include: WO 2012/041014 PCT/CN2011/001638 16

H

3 C~H3 H3C H3C Si F

CH

3

CH

3

H

3 C CH 3 F SSi-O 0 , O Si H3C H3C \ Si F \

CH

3

CH

3 H3C CH3 F A ring carbon atom of a heterocycloalkyl group may be functionalized as a carbonyl group. An illustrative example of such a heterocycloalkyl group is: H In one embodiment, a heterocycloalkyl group is a 5-membered monocyclic heterocycloalkyl. In another embodiment, a heterocycloalkyl group is a 6-membered monocyclic heterocycloalkyl. The term "3 to 6-membered monocyclic cycloalkyl" refers to a monocyclic heterocycloalkyl group having from 3 to 6 ring atoms. The term "4 to 6-membered monocyclic cycloalkyl" refers to a monocyclic heterocycloalkyl group having from 4 to 6 ring atoms. The term "7 to 11-membered bicyclic heterocycloalkyl" refers to a bicyclic heterocycloalkyl group having from 7 to 11 ring atoms. Unless otherwise indicated, an heterocycloalkyl group is unsubstituted. The term "heterocycloalkenyl," as used herein, refers to a heterocycloalkyl group, as defined above, wherein the heterocycloalkyl group contains from 4 to 10 ring atoms, and at least one endocyclic carbon-carbon or carbon-nitrogen double bond. A heterocycloalkenyl group can be joined via a ring carbon or ring nitrogen atom. In one embodiment, a heterocycloalkenyl group has from 4 to 6 ring atoms. In another embodiment, a heterocycloalkenyl group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heterocycloalkenyl group is bicyclic. A heterocycloalkenyl group can optionally substituted by one or more ring system substituents, wherein "ring system substituent" is as defined above.

WO 2012/041014 PCT/CN2011/001638 17 The nitrogen or sulfur atom of the heterocycloalkenyl can be optionally oxidized to the corresponding N-oxide, S-oxide or S,S-dioxide. Non-limiting examples of heterocycloalkenyl groups include 1,2,3,4- tetrahydropyridinyl, 1,2-dihydropyridinyl, 1,4-dihydropyridinyl, 1,2,3,6-tetrahydropyridinyl, 1,4,5,6-tetrahydropyrimidinyl, 2 pyrrolinyl, 3-pyrrolinyl, 2-imidazolinyl, 2-pyrazolinyl, dihydroimidazolyl, dihydrooxazolyl, dihydrooxadiazolyl, dihydrothiazolyl, 3,4-dihydro-2H-pyranyl, dihydrofuranyl, fluoro-substituted dihydrofuranyl, 7-oxabicyclo[2.2.1 ]heptenyl, dihydrothiophenyl, dihydrothiopyranyl, and the like and the like. A ring carbon atom of a heterocycloalkenyl group may be functionalized as a carbonyl group. In one embodiment, a heterocycloalkenyl group is a 5-membered heterocycloalkenyl. In another embodiment, a heterocycloalkenyl group is a 6-membered heterocycloalkenyl. The term "4 to 6-membered heterocycloalkenyl" refers to a heterocycloalkenyl group having from 4 to 6 ring atoms. Unless otherwise indicated, a heterocycloalkenyl group is unsubstituted. The term "ring system substituent," as used herein, refers to a substituent group attached to an aromatic or non-aromatic ring system which, for example, replaces an available hydrogen on the ring system. Ring system substituents may be the same or different, each being independently selected from the group consisting of alkyl, alkenyl, alkynyl, aryl, heteroaryl, -alkylene-aryl, -arylene-alkyl, alkylene-heteroaryl, -alkenylene-heteroaryl, -alkynylene-heteroaryl, -OH, hydroxyalkyl, haloalkyl, -0-alkyl, -0-haloalkyl, -alkylene-O-alkyl, -0-aryl, -0 alkylene-aryl, acyl, -C(O)-aryl, halo, -NO 2 , -CN, -SF 5 , -C(O)OH, -C(O)O-alkyl, C(O)O-aryl, -C(O)O-alkylene-aryl, -S(O)-alkyl, -S(O) 2 -alkyl, -S(O)-aryl, -S(0)2-aryl, -S(O)-heteroaryl, -S(O) 2 -heteroaryl, -S-alkyl, -S-aryl, -S-heteroaryl, -S-alkylene-aryl, -S-alkylene-heteroaryl, -S(O) 2 -alkylene-aryl, -S(O) 2 -alkylene-heteroaryl, -Si(alkyl) 2 , Si(aryl)2, -Si(heteroaryl) 2 , -Si(alkyl)(aryl), -Si(alkyl)(cycloalkyl), Si(alkyl)(heteroaryl), cycloalkyl, heterocycloalkyl, -O-C(O)-alkyl, -O-C(O)-aryl, -0 C(O)-cycloalkyl, -C(=N-CN)-NH 2 , -C(=NH)-NH 2 , -C(=NH)-NH(alkyl), -N(Y 1

)(Y

2 ), alkylene-N(Y1)(Y 2 ), -C(O)N(Y 1

)(Y

2 ) and -S(O) 2

N(Y

1

)(Y

2 ), wherein Y 1 and Y 2 can be the same or different and are independently selected from the group consisting of hydrogen, alkyl, aryl, cycloalkyl, and -alkylene-aryl. "Ring system substituent" may also mean a single moiety which simultaneously replaces two available hydrogens on two adjacent carbon atoms (one H on each carbon) on a ring system. Examples of WO 2012/041014 PCT/CN2011/001638 18 such moiety are methylenedioxy, ethylenedioxy, -C(CH 3

)

2 - and the like which form moieties such as, for example: and The term "silylalkyl," as used herein, refers to an alkyl group as defined above, wherein one or more of the alkyl group's hydrogen atoms has been replaced with a -Si(R) 3 group, wherein each occurrence of R is independently C 1

-C

6 alkyl, phenyl or a 3 to 6-membered cycloalkyl group. In one embodiment, a silylalkyl group has from 1 to 6 carbon atoms. In another embodiment, a silyl alkyl group contains a -Si(CH 3

)

3 moiety. Non-limiting examples of silylalkyl groups include

-CH

2 -Si(CH 3

)

3 and -CH 2

CH

2 -Si(CH 3

)

3 . The term "substituted" means that one or more hydrogens on the designated atom is replaced with a selection from the indicated group, provided that the designated atom's normal valency under the existing circumstances is not exceeded, and that the substitution results in a stable compound. Combinations of substituents and/or variables are permissible only if such combinations result in stable compounds. By "stable compound' or "stable structure" is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. The term "in substantially purified form," as used herein, refers to the physical state of a compound after the compound is isolated from a synthetic process (e.g., from a reaction mixture), a natural source, or a combination thereof. The term "in substantially purified form," also refers to the physical state of a compound after the compound is obtained from a purification process or processes described herein or well-known to the skilled artisan (e.g., chromatography, recrystallization and the like), in sufficient purity to be characterizable by standard analytical techniques described herein or well-known to the skilled artisan. It should also be noted that any carbon as well as heteroatom with unsatisfied valences in the text, schemes, examples and tables herein is assumed to have the sufficient number of hydrogen atom(s) to satisfy the valences. When a functional group in a compound is termed "protected", this means that the group is in modified form to preclude undesired side reactions at the WO 2012/041014 PCT/CN2011/001638 19 protected site when the compound is subjected to a reaction. Suitable protecting groups will be recognized by those with ordinary skill in the art as well as by reference to standard textbooks such as, for example, T. W. Greene et al, Protective Groups in Organic Synthesis (1991), Wiley, New York. When any substituent or variable (e.g., alkyl, R 6 , Ra, etc.) occurs more than one time in any constituent or in Formula (I), its definition on each occurrence is independent of its definition at every other occurrence, unless otherwise indicated. As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combination of the specified ingredients in the specified amounts. Prodrugs and solvates of the compounds of the invention are also contemplated herein. A discussion of prodrugs is provided in T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems (1987) 14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, (1987) Edward B. Roche, ed., American Pharmaceutical Association and Pergamon Press. The term "prodrug" means a compound (e.g., a drug precursor) that is transformed in vivo to provide a Tetracyclic Indole Derivative or a pharmaceutically acceptable salt or solvate of the compound. The transformation may occur by various mechanisms (e.g., by metabolic or chemical processes), such as, for example, through hydrolysis in blood. For example, if a Tetracyclic Indole Derivative or a pharmaceutically acceptable salt, hydrate or solvate of the compound contains a carboxylic acid functional group, a prodrug can comprise an ester formed by the replacement of the hydrogen atom of the acid group with a group such as, for example, (Ci-C 8 )alkyl,

(C

2

-C

1 2 )alkanoyloxymethyl, 1 -(alkanoyloxy)ethyl having from 4 to 9 carbon atoms, 1-methyl-i -(alkanoyloxy)-ethyl having from 5 to 10 carbon atoms, alkoxycarbonyloxymethyl having from 3 to 6 carbon atoms, 1 (alkoxycarbonyloxy)ethyl having from 4 to 6 carbon atoms, 1-methyl-I (alkoxycarbonyloxy)ethyl having from 5 to 8 carbon atoms, N (alkoxycarbonyl)aminomethyl having from 3 to 9 carbon atoms, 1-(N (alkoxycarbonyl)amino)ethyl having from 4 to 10 carbon atoms, 3-phthalidyl, 4 crotonolactonyl, gamma-butyrolacton-4-yl, di-N,N-(Ci-C 2 )alkylamino(C 2

-C

3 )alkyl (such as p-dimethylaminoethyl), carbamoyl-(Ci-C 2 )alkyl, NN-di (Ci- WO 2012/041014 PCT/CN2011/001638 20

C

2 )alkylcarbamoyl-(Ci-C 2 )alkyl and piperidino-, pyrrolidino- or morpholino(C 2 C 3 )alkyl, and the like. Similarly, if a Tetracyclic Indole Derivative contains an alcohol functional group, a prodrug can be formed by the replacement of the hydrogen atom of the alcohol group with a group such as, for example, (C 1

-C

6 )alkanoyloxymethyl, 1

((C

1

-C

6 )alkanoyloxy)ethyl, 1-methyl-1-((CI-C 6 )alkanoyloxy)ethyl, (CI C6)alkoxycarbonyloxymethyl, N-(C 1

-C

6 )alkoxycarbonylaminomethyl, succinoyl, (C1

C

6 )alkanoyl, a-amino(Ci-C 4 )alkyl, a-amino(CI-C 4 )alkylene-aryl, arylacyl and a aminoacyl, or a-aminoacyl-a-aminoacyl, where each a-aminoacyl group is independently selected from the naturally occurring L-amino acids, -P(O)(OH) 2 , P(O)(O(C1-C 6 )alkyl) 2 or glycosyl (the radical resulting from the removal of a hydroxyl group of the hemiacetal form of a carbohydrate), and the like. If a Tetracyclic Indole Derivative incorporates an amine functional group, a prodrug can be formed by the replacement of a hydrogen atom in the amine group with a group such as, for example, R-carbonyl-, RO-carbonyl-, NRR'-carbonyl wherein R and R' are each independently (Ci-Clo)alkyl, (C 3

-C

7 ) cycloalkyl, benzyl, a natural a-aminoacyl, -C(OH)C(O)OY' wherein Y1 is H, (Ci-C 6 )alkyl or benzyl, C(OY 2 )y 3 wherein Y 2 is (C 1

-C

4 ) alkyl and Y 3 is (CI-C 6 )alkyl; carboxy (C1-C 6 )alkyl; amino(CI-C 4 )alkyl or mono-N- or di-N,N-(C1-C 6 )alkylaminoalkyl; -C(Y 4

)Y

5 wherein

Y

4 is H or methyl and Y 5 is mono-N- or di-N,N-(CI-C 6 )alkylamino morpholino; piperidin-1-yl or pyrrolidin-1-yl, and the like. Pharmaceutically acceptable esters of the present compounds include the following groups: (1) carboxylic acid esters obtained by esterification of the hydroxy group of a hydroxyl compound, in which the non-carbonyl moiety of the carboxylic acid portion of the ester grouping is selected from straight or branched chain alkyl (e.g., methyl, ethyl, n-propyl, isopropyl, t-butyl, sec-butyl or n-butyl), alkoxyalkyl (e.g., methoxymethyl), aralkyl (e.g., benzyl), aryloxyalkyl (for example, phenoxymethyl), aryl (e.g., phenyl optionally substituted with, for example, halogen, C1 4 alkyl, -O-(CI 4 alkyl) or amino); (2) sulfonate esters, such as alkyl- or aralkylsulfonyl (for example, methanesulfonyl); (3) amino acid esters (e.g., L-valyl or L-isoleucyl); (4) phosphonate esters and (5) mono-, di- or triphosphate esters. The phosphate esters may be further esterified by, for example, a C 1

-

2 0 alcohol or reactive derivative thereof, or by a 2,3-di (C6- 24 )acyl glycerol.

WO 2012/041014 PCT/CN2011/001638 21 One or more compounds of the invention may exist in unsolvated as well as solvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms. "Solvate" means a physical association of a compound of this invention with one or more solvent molecules. This physical association involves varying degrees of ionic and covalent bonding, including hydrogen bonding. In certain instances the solvate will be capable of isolation, for example when one or more solvent molecules are incorporated in the crystal lattice of the crystalline solid. "Solvate" encompasses both solution-phase and isolatable solvates. Non-limiting examples of solvates include ethanolates, methanolates, and the like. A "hydrate" is a solvate wherein the solvent molecule is water. One or more compounds of the invention may optionally be converted to a solvate. Preparation of solvates is generally known. Thus, for example, M. Caira et al, J. Pharmaceutical Sci., 93(3), 601-611 (2004) describe the preparation of the solvates of the antifungal fluconazole in ethyl acetate as well as from water. Similar preparations of solvates, hemisolvate, hydrates and the like are described by E. C. van Tonder et al, AAPSPharmSciTechours. , 5(1), article 12 (2004); and A. L. Bingham et al, Chem. Commun., 603-604 (2001). A typical, non-limiting, process involves dissolving the inventive compound in desired amounts of the desired solvent (organic or water or mixtures thereof) at a higher than room temperature, and cooling the solution at a rate sufficient to form crystals which are then isolated by standard methods. Analytical techniques such as, for example IR spectroscopy, show the presence of the solvent (or water) in the crystals as a solvate (or hydrate). The Tetracyclic Indole Derivatives can form salts which are also within the scope of this invention. Reference to a Tetracyclic Indole Derivative herein is understood to include reference to salts thereof, unless otherwise indicated. The term "salt(s)", as employed herein, denotes acidic salts formed with inorganic and/or organic acids, as well as basic salts formed with inorganic and/or organic bases. In addition, when a Tetracyclic Indole Derivative contains both a basic moiety, such as, but not limited to a pyridine or imidazole, and an acidic moiety, such as, but not limited to a carboxylic acid, zwitterions ("inner salts") may be formed and are included within the term "salt(s)" as used herein. In one embodiment, the salt is a pharmaceutically acceptable (i.e., non-toxic, physiologically acceptable) salt. In another embodiment, the salt is other than a pharmaceutically acceptable salt. Salts of WO 2012/041014 PCT/CN2011/001638 22 the Compounds of Formula (I) may be formed, for example, by reacting a Tetracyclic Indole Derivative with an amount of acid or base, such as an equivalent amount, in a medium such as one in which the salt precipitates or in an aqueous medium followed by lyophilization. Exemplary acid addition salts include acetates, ascorbates, benzoates, benzenesulfonates, bisulfates, borates, butyrates, citrates, camphorates, camphorsulfonates, fumarates, hydrochlorides, hydrobromides, hydroiodides, lactates, maleates, methanesulfonates, naphthalenesulfonates, nitrates, oxalates, phosphates, propionates, salicylates, succinates, sulfates, tartarates, thiocyanates, toluenesulfonates (also known as tosylates) and the like. Additionally, acids which are generally considered suitable for the formation of pharmaceutically useful salts from basic pharmaceutical compounds are discussed, for example, by P. Stahl et al, Camille G. (eds.) Handbook of Pharmaceutical Salts. Properties, Selection and Use. (2002) Zurich: Wiley-VCH; S. Berge et al, Journal ofPharmaceutical Sciences (1977) 66(1) 1-19; P. Gould, International J. ofPharmaceutics (1986) 33 201-217; Anderson et al, The Practice ofMedicinal Chemistry (1996), Academic Press, New York; and in The Orange Book (Food & Drug Administration, Washington, D.C. on their website). These disclosures are incorporated herein by reference thereto. Exemplary basic salts include ammonium salts, alkali metal salts such as sodium, lithium, and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, salts with organic bases (for example, organic amines) such as dicyclohexylamine, t-butyl amine, choline, and salts with amino acids such as arginine, lysine and the like. Basic nitrogen-containing groups may be quarternized with agents such as lower alkyl halides (e.g., methyl, ethyl, and butyl chlorides, bromides and iodides), dialkyl sulfates (e.g., dimethyl, diethyl, and dibutyl sulfates), long chain halides (e.g., decyl, lauryl, and stearyl chlorides, bromides and iodides), aralkyl halides (e.g., benzyl and phenethyl bromides), and others. All such acid salts and base salts are intended to be pharmaceutically acceptable salts within the scope of the invention and all acid and base salts are considered equivalent to the free forms of the corresponding compounds for purposes of the invention. Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods well known to those skilled in the art, such as, for example, by chromatography and/or WO 2012/041014 PCT/CN2011/001638 23 fractional crystallization. Enantiomers can be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Mosher's acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers. Sterochemically pure compounds may also be prepared by using chiral starting materials or by employing salt resolution techniques. Also, some of the Tetracyclic Indole Derivatives may be atropisomers (e.g., substituted biaryls) and are considered as part of this invention. Enantiomers can also be directly separated using chiral chromatographic techniques. It is also possible that the Tetracyclic Indole Derivatives may exist in different tautomeric forms, and all such forms are embraced within the scope of the invention. For example, all keto-enol and imine-enamine forms of the compounds are included in the invention. All stereoisomers (for example, geometric isomers, optical isomers and the like) of the present compounds (including those of the salts, solvates, hydrates, esters and prodrugs of the compounds as well as the salts, solvates and esters of the prodrugs), such as those which may exist due to asymmetric carbons on various substituents, including enantiomeric forms (which may exist even in the absence of asymmetric carbons), rotameric forms, atropisomers, and diastereomeric forms, are contemplated within the scope of this invention. If a Tetracyclic Indole Derivative incorporates a double bond or a fused ring, both the cis- and trans-forms, as well as mixtures, are embraced within the scope of the invention. Individual stereoisomers of the compounds of the invention may, for example, be substantially free of other isomers, or may be admixed, for example, as racemates or with all other, or other selected, stereoisomers. The chiral centers of the present invention can have the S or R configuration as defined by the IUPAC 1974 Recommendations. The use of the terms "salt", "solvate", "ester", "prodrug" and the like, is intended to apply equally to the salt, solvate, ester and prodrug of enantiomers, stereoisomers, rotamers, tautomers, positional isomers, racemates or prodrugs of the inventive compounds. In the Compounds of Formula (I), the atoms may exhibit their natural isotopic abundances, or one or more of the atoms may be artificially enriched in a particular isotope having the same atomic number, but an atomic mass or mass WO 2012/041014 PCT/CN2011/001638 24 number different from the atomic mass or mass number predominantly found in nature. The present invention is meant to include all suitable isotopic variations of the compounds of generic Formula . For example, different isotopic forms of hydrogen (H) include protium ('H) and deuterium (2H). Protium is the predominant hydrogen isotope found in nature. Enriching for deuterium may afford certain therapeutic advantages, such as increasing in vivo half-life or reducing dosage requirements, or may provide a compound useful as a standard for characterization of biological samples. Isotopically-enriched Compounds of Formula (I) can be prepared without undue experimentation by conventional techniques well known to those skilled in the art or by processes analogous to those described in the Schemes and Examples herein using appropriate isotopically-enriched reagents and/or intermediates. In one embodiment, a Compound of Formula (I) has one or more of its hydrogen atoms replaced with deuterium. Polymorphic forms of the Tetracyclic Indole Derivatives, and of the salts, solvates, hydrates, esters and prodrugs of the Tetracyclic Indole Derivatives, are intended to be included in the present invention. The following abbreviations are used below and have the following meanings: Ac is acyl; AcCl is acetyl chloride; AcOH or HOAc is acetic acid; Amphos is (4-(NN)-dimethylaminophenyl)-di-tertbutylphosphine; Aq is aqueous; BF 3 -OEt 2 is boron trifluoride etherate; BOC or Boc is tert-butyloxycarbonyl; Boc20 is Boc anhydride; Boc-Pro-OH is Boc protected proline; L-Boc-Val-OH is Boc protected L valine; BOP is Benzotriazole-1-yl-oxy-tris-(dimethylamino)-phosphonium hexafluorophosphate; n-BuLi is n-butyllithium; CBZ or Cbz is carbobenzoxy; DCM is dichloromethane; DDQ is 2,3-dichloro-5,6-dicyano-1,4-benzoquinone; Dess-Martin reagent is ,1,1-Triacetoxy-1,1-dihydro-1,2-benziodoxol-3(1H)-one; DIPEA is diisopropylethylamine; DME is dimethoxyethane; DMF is NN-dimethylformamide; dppf is diphenylphosphinoferrocene; DMSO is dimethylsulfoxide; EtMgBr is ethylmagnesium bromide; EtOAc is ethyl acetate; Et 2 0 is diethyl ether; Et 3 N or NEt 3 is triethylamine; HATU is O-(7-azabenzotriazol-1-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate; HPLC is high performance liquid chromatography; HRMS is high resolution mass spectrometry; KOAc is potassium acetate; LCMS is liquid chromatography/mass spectrometry; LiHMDS is lithium hexamethyldisilazide; LRMS is low resolution mass spectrometry; Mel is iodomethane; MeOH is methanol; NBS is N-bromosuccinimide; NH 4 OAc is ammonium acetate; NMM is N- WO 2012/041014 PCT/CN2011/001638 25 methylmorpholine; Pd/C is palladium on carbon; Pd(PPh 3

)

4 is tetrakis (triphenylphosphine)palladium(O); PdCl 2 (dppf) 2 is [1,1 -Bis(diphenylphosphino) ferrocene]dichloro palladium(II); PdCl 2 (dppf) 2

-CH

2 Cl 2 is [1,1 Bis(diphenylphosphino)ferrocene] dichloro palladium(II) complex with dichloromethane; pinacol 2

B

2 is bis(pinacolato)diboron; PPTS is pyridinium p-toluene sulfonate; RPLC is reverse-phase liquid chromatography; Select-F is 1 -Chloromethyl 4-Fluoro-1, 4-Diazoniabicyclo[2.2.2]Octane Bis-(Tetrafluoroborate); SEM-Cl is 2 (trimethylsilyl)ethoxymethyl chloride; TBAF is tetrabutylammonium fluoride; TBDMSCl is tert-butyldimethylsilyl chloride; TFA is trifluoroacetic acid; Tf 2 O is triflic anhydride; THF is tetrahydrofuran; TLC is thin-layer chromatography; and TosCl is p-toluenesulfonyl chloride. The Compounds of Formula (I) The present invention provides Tetracyclic Indole Derivatives of Formula (I): A X R 15 I " V= X'--Y' N UV H /K)IN '' N A ' (I) and pharmaceutically acceptable salts thereof, wherein A, A', G, R', U, V, V', W, W', X, X', Y and Y' are defined above for the Compounds of Formula (I). In one embodiment, A and A' are each a 5-membered heterocycloalkyl group. In another embodiment, A and A' are each a 6-membered heterocycloalkyl group. In another embodiment, A and A' are each independently selected from: WO 2012/041014 PCT/CN2011/001638 26 I 1 8R4 '-0z Ni *14F , Y qCHa F F

CH

3 C CCand H C3 H 3' H CH 3 In still another embodiment, A and A' are each independently selected from: R4 R4 R4 R4 R4 R R 4 ai N '4 F , CH3 and F F

CH

3 In another embodiment, A and A' are each independently selected from: C-6 C - and j H H C H 3

CH

3 KI7 S ' iCH 3 In another embodiment, A and A' are each independently:

R

13

R

13 In another embodiment, A and A' are each independently:

R

13

R

13 wherein each occurrence of R1 3 is independently H, CH 3 , or F. In one embodiment, each occurrence of R 4 is independently -C(O)

[C(R

7

)

2 ]qN(R 6 )C(O)O-R". In another embodiment, each occurrence of R 4 is independently: WO 2012/041014 PCT/CN2011/001638 27 Rb 0H Ra , wherein Rb is H, alkyl, haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl or heteroaryl and Ra is alkyl, haloalkyl, silylalkyl, 3 to 6-membered cycloalkyl or 4 to 6-membered heterocycloalkyl, aryl or heteroaryl. In another embodiment, each occurrence of R 4 is independently: Rb-0y N Ra ,wherein Ra is H, methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH 2

CH

2 Si(CH 3

)

3 , -CH 2

CH

2

CF

3 , pyranyl, benzyl or phenyl, and Rb is methyl, ethyl or isopropyl. In still another embodiment, each occurrence of R 4 is independently C(O)CH(alkyl)-NHC(O)Oalkyl. In another embodiment, each occurrence of R4 is independently:

H

0

H

3 CO. N 0 In one embodiment, A and A' are each independently selected from: II I F ,4 3.CH3 F F

CH

3 ~CH3 C ~ a andCH andR 4 is: Rb R , wherein Rb is H, alkyl, haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl or heteroaryl and R" is alkyl, haloalkyl, silylalkyl, 3 to 6-membered cycloalkyl or 4 to 6-membered heterocycloalkyl, aryl or heteroaryl. In another embodiment, A and A' are each independently selected from: WO 2012/041014 PCT/CN2011/001638 28

R

4 R4 R4 R4 R4R F 3,(4 CH3 F F

CH

3 CraCI and

H

3 C CH 3 ' H 3 d' 'CH 3 ' ~LQ 'iCH and R 4 is: RI0 N 0 yO-N a ,wherein Ra is H, methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH 2

CH

2 Si(CH 3

)

3 , -CH 2

CH

2

CF

3 , pyranyl, benzyl or phenyl, and R' is methyl, ethyl or isopropyl. In another embodiment, A and A' are each independently selected from: R4 R4 R4 R4 R4 R4 q 4F CH , F F

CH

3 R4 R4 R4 C .. CiI > S CH and and R 4 is: CH3 0 N In another embodiment, A and A' are each independently selected from: , CH and F F CHH and R 4 is: H

H

3 C'O N In yet another embodiment, A and A' are each: WO 2012/041014 PCT/CN2011/001638 29 R4

R

13

R

13 , wherein each occurrence of R 1 3 is independently H,

CH

3 , or F; and R 4 is

H

3 C,0 N In one embodiment, G is -C(R 3

)

2 -0-. In another embodiment, G is -C(R 1 4

)=N

In another embodiment, G is -C(R) 2

-C(R)

2 - or -C(R14)=C(RI4)-. In still another embodiment, G is -C(R3)2-C(R 3

)

2 - or -C(R14)=C(R'4)-. In one embodiment. G is -C(R 3

)

2 -0- and each occurrence of R 3 is independently selected from H, C-C 6 alkyl, 3 to 6-membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl, wherein said 5 or 6-membered monocyclic heteroaryl group and said phenyl groups can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from halo, -CN, C-C 6 alkyl, CI-C 6 haloalkyl, -0-C-C 6 alkyl, -(C

C

6 alkylene)-O-C-C 6 alkyl and -O-C-C 6 haloalkyl. In another embodiment, G is -C(R 3

)

2 -0-, wherein one occurrence of

R

3 is H, and the other occurrence of R 3 is selected from C-C 6 alkyl, cycloalkyl and phenyl, wherein said phenyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from halo, -CN, Cr-C 6 alkyl, C

C

6 haloalkyl, -0-C-C 6 alkyl, -(C-C 6 alkylene)-O-C-C 6 alkyl and -O-C-C 6 haloalkyl. In one embodiment, G is -C(R 3

)

2 -0- and each occurrence of R3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, l' methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 ,

CF

3 , OCF 3 and OCH 2

CH

2 0CH 3 . In one embodiment, G is -CH(R 3 )-O-, wherein R 3 is selected from C

C

6 alkyl, phenyl, 5 or 6-membered monocyclic heteroaryl and 9 or I 0-membered WO 2012/041014 PCT/CN2011/001638 30 bicyclic heteroaryl, wherein said phenyl group, said 5 or 6-membered monocyclic heteroaryl group and said 9 or 1 0-membered bicyclic heteroaryl group can be optionally substituted with a CI-C 6 alkyl group. In another embodiment, G is -CH(R 3 )-O-, wherein R 3 is selected from methyl, phenyl, 5-methyl-thiophen-2-yl and benzothiophen-2-yl. In another embodiment, G is -C(R 3

)

2 -O-, wherein one occurrence of

R

3 is H, and the other occurrence of R 3 is selected from phenyl, methyl, thiophenyl or benzothiophenyl, wherein said benzothiophenyl can be optionally substituted witha

CI-C

6 alkyl, cycloalkyl and phenyl, wherein said phenyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from halo, -CN, CI-C 6 alkyl, Ci-C 6 haloalkyl, -0-C-C 6 alkyl, -(C 1

-C

6 alkylene)-O

CI-C

6 alkyl and -O-C 1

-C

6 haloalkyl. In one embodiment, G is -C(R 3

)

2 -0- and each occurrence of R3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, 1' methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 ,

CF

3 , OCF 3 and OCH 2

CH

2

OCH

3 . In another embodiment, G is -C(R 3

)

2 -0-, wherein one occurrence of

R

3 is H, and the other occurrence of R3 is selected from methyl, ethyl, isopropyl, cyclopropyl, 1'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 , CF 3 , OCF 3 and OCH 2

CH

2

OCH

3 . In one embodiment, G is -C(R 3

)

2 -O-, wherein both R 3 groups, together with the common carbon atom to which they are attached, join to form a carbonyl group, a 3 to 6-membered spirocyclic cycloalkyl group or a 3 to 6-membered spirocyclic heterocycloalkyl group. In one embodiment, G is -C(R 1 4 )-N-, wherein R 1 4 is selected from H,

C

1

-C

6 alkyl, cycloalkyl and phenyl, wherein said phenyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from halo, -CN, C 1

-C

6 alkyl, CI-C 6 haloalkyl, -O-Ci-C 6 alkyl, -(Ci-C 6 alkylene)-O

CI-C

6 alkyl and -O-Ci-C 6 haloalkyl.

WO 2012/041014 PCT/CN2011/001638 31 In one embodiment, each occurrence of R 3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, l'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 , CF 3 , OCF 3 and

OCH

2

CH

2

OCH

3 . In another embodiment, two R3 groups on the same carbon atom, together with the common carbon atom to which they are attached, join to form a carbonyl group, a 3 to 6-membered spirocyclic cycloalkyl group or a 3 to 6-membered spirocyclic heterocycloalkyl group. In one embodiment, U is C(R 2 ). In another embodiment, U is CH. In another embodiment, U is CF. In one embodiment, V is C(R 5 ). In another embodiment, V is CH. In another embodiment, V is CF. In another embodiment, V is N. In one embodiment, V' is C(R 5 ). In another embodiment, V' is CH. In another embodiment, V' is CF. In another embodiment, V' is N. In still another embodiment, V and V' are each CH. In one embodiment, W is C(R 5 ). In another embodiment, W is CH. In another embodiment, W is CF. In another embodiment, W is N. In one embodiment, W'is C(R 15 ). In another embodiment, W 'is CH. In another embodiment, W 'is CF. In another embodiment, W 'is N. In still another embodiment, W and W' are each CH. In a further embodiment, V, V' W and W' are each CH. In one embodiment, R 1 is absent. In another embodiment, R' is F.

WO 2012/041014 PCT/CN2011/001638 32 In one embodiment, each occurrence of R 3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, l'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 , CF 3 , OCF 3 and

OCH

2

CH

2

OCH

3 . In another embodiment, two R 3 groups on the same carbon atom, together with the common carbon atom to which they are attached, join to form a carbonyl group, a 3 to 6-membered spirocyclic cycloalkyl group or a 3 to 6-membered spirocyclic heterocycloalkyl group. In one embodiment, each occurrence of R 1 0 is independently H or F. In another embodiment, each occurrence of R' 0 is H. In one embodiment, the group: R15 RW has the structure: R2 R15 N R1 G In another embodiment, the group: R15 RI W has the structure: WO 2012/041014 PCT/CN2011/001638 33

R

2

R

15

R

15 R5

R

3

R

3

R

3

R

3 In another embodiment, the group:

R

15 _ _ U has the structure:

R

2

R

15

R

15 sJ.R's N N In still another embodiment, the group: R15 u has the structure: "N

R

3

R

3 In one embodiment, variables A, A', G, R', U, V, V', W, W', X, X', Y and Y' for the Compounds of Formula (I) are selected independently of each other. In another embodiment, the Compounds of Formula (I) are in substantially purified form.

WO 2012/041014 PCT/CN2011/001638 34 In one embodiment, the Compounds of Formula (I) have the formula (Ia): R 0R2 R15 R10 N VN G (Ia) and pharmaceutically acceptable salts thereof, wherein: A and A' are each independently a 5-membered monocyclic heterocycloalkyl, wherein said 5-membered monocyclic heterocycloalkyl group can be optionally and independently substituted on one or more ring carbon atoms with , such that any two R groups on the same ring, together with the carbon atoms to which they are attached, can join to form a fused, bridged or spirocyclic 3 to 6 membered cycloalkyl group or a fused, bridged or spirocyclic 4 to 6-membered heterocycloalkyl group, wherein said 5-membered monocyclic heterocycloalkyl contains from 1 to 2 ring heteroatoms, each independently selected from N(R 4 ) and Si(R 16)2; G is selected from -C(R 3

)

2 -, -C(R 3

)

2 -0-, -C(R1 4 )=N-, -C(R) 2

-C(R

3

)

2 and -C(R 14)=C(R1 4 )-; V and V' are each independently selected from N and C(R1 5 ); R' represents an optional ring substituent on the phenyl ring to which R' is attached, wherein said substituent is selected from C 1

-C

6 alkyl and halo; each occurrence of R2 is independently selected from H, C 1

-C

6 alkyl, 3 to 6 membered cycloalkyl, -O-(CI-C 6 alkyl), C 1

-C

6 haloalkyl -O-(C 1

-C

6 haloalkyl); halo, -OH, aryl, and heteroaryl each occurrence of R 3 is independently selected from H, C 1

-C

6 alkyl, (C 1

-C

6 alkylene)-O-(CI-C 6 alkyl), 3 to 6-membered cycloalkyl, C 1

-C

6 haloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl and benzyl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, C 1

-C

6 alkyl, C 1

-C

6 haloalkyl, -O-C 1

-C

6 alkyl, -(C 1

-C

6 alkylene)-O-C1-C 6 alkyl and -O-(C 1

-C

6 haloalkyl); WO 2012/041014 PCT/CN2011/001638 35 each occurrence of R4 is independently -C(O)-[C(R 7

)

2

]N(R

6

)C(O)O

each occurrence of R 6 is independently selected from H and C 1

-C

6 alkyl; each occurrence of R 7 is independently selected from C 1

-C

6 alkyl, CI

C

6 haloalkyl, 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl, wherein said 3 to 6-membered cycloalkyl group, said 4 to 6-membered heterocycloalkyl group, said aryl group and said 5 or 6-membered monocyclic heteroaryl group can be optionally and independently substituted with up to three R 8 groups; each occurrence of R 8 is independently selected from H, C 1

-C

6 alkyl, halo, -C 1

-C

6 haloalkyl, CI-C 6 hydroxyalkyl, -OH, -C(O)NH-(C 1

-C

6 alkyl), -C(O)N(C 1 C 6 alkyl) 2 , -O-(C I-C 6 alkyl), -NH 2 , -NH(C i-C 6 alkyl), -N(C I-C 6 alkyl) 2 and -NHC(O)

(CI-C

6 alkyl); each occurrence of R1 0 is independently selected from H and halo; each occurrence of R" is independently C 1

-C

6 alkyl; each occurrence of R 13 is independently selected from H and halo, wherein two R 13 groups, together with the carbon atom(s) to which they are attached, can optionally join to form a 3 to 6-membered cycloalkyl group or 4 to 6-membered heterocycloalkyl group; each occurrence of R 1 4 is independently selected from H, halo, C 1

-C

6 alkyl, -(C1-C 6 alkylene)-O-C1-C 6 alkyl, 3 to 6-membered cycloalkyl, C 1

-C

6 haloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl and benzyl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, C 1

-C

6 alkyl, C 1

-C

6 haloalkyl, -O-C 1

-C

6 alkyl, -(C 1

-C

6 alkylene)-O-C1-C 6 alkyl and -O-C 1

-C

6 haloalkyl; each occurrence of R1 5 is independently selected from H and halo; and each occurrence of R1 6 is independently selected from C 1

-C

6 alkyl. In one embodiment, for the Compounds of Formula (Ia), A and A' are each a 5-membered monocyclic heteroaryl group. In another embodiment, for the Compounds of Formula (Ia), A and A' are each a 6-membered monocyclic heteroaryl group.

WO 2012/041014 PCT/CN2011/001638 36 In another embodiment, for the Compounds of Formula (Ia), A and A' are each independently selected from: F F 4 R4R4 R4 R4 R4 N N OH R4 R4 R4 R4 R4 H C< CH3 and

H

3 C 'CH 3

H

3 c'r 'CH 3

CH

3 Li In still another embodiment, for the Compounds of Formula (Ia), A and A' are each independently selected from: R4 R4 R4 R4 R4 I , , F+' F R4 and s Li Si

H

3 C CH 3 In another embodiment, for the Compounds of Formula (Ia), A and A' are each independently selected from: R4 R4 R4 R R '-C6S

A

1 ) and 1 3H C H 3 C 'C 3 iCH 3 In one embodiment, for the Compounds of Formula (la), A and A' are each: R R N <z

R

1 3 " R13 wherein each occurrence of Z is independently -Si(R1 3

)

2 -, -C(R 13

)

2 - or -- WO 2012/041014 37 PCT/CN2011/001638 and each occurrence of R 13 is independently H, Me, F or two R 13 groups together with Z, can combine to form a spirocyclic 3 to 6-membered cycloalkyl group or a spirocyclic 3 to 6-membered silyl-containing heterocycloalkyl group. In another embodiment, for the Compounds of Formula (Ia), A and A' are each independently: R

R

13

R

13 In another embodiment, for the Compounds of Formula (Ia), A and A' are each independently: R

R

1 3

R

13 wherein each occurrence of R1 3 is independently H, CH 3 , or F. In one embodiment, for the Compounds of Formula (Ia), each occurrence of R 4 is independently -C(O)C(R 7

)

2 NHC(O)O-R" or -C(O)C(R 7

)

2

N(R

6

)

2 . In another embodiment, for the Compounds of Formula (la), each occurrence of R4 is independently -C(O)-[C(R )2]qN(R6)C(O)O-R". In another embodiment, for the Compounds of Formula (Ia), each occurrence of R4 is independently -C(O)CH(alkyl)-NHC(O)Oalkyl, C(O)CH(cycloalkyl)-NHC(O)Oalkyl, C(O)CH(heterocycloalkyl)-NHC(O)Oalkyl, C(O)CH(aryl)-NHC(O)Oalkyl or C(O)CH(aryl)-N(alkyl) 2 . In another embodiment, for the Compounds of Formula (Ia), each occurrence of R 4 is independently: Rb OH Ra, wherein Rb is H, alkyl, haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl or heteroaryl and Ra is alkyl, haloalkyl, silylalkyl, 3 to 6-membered cycloalkyl or 4 to 6-membered heterocycloalkyl, aryl or heteroaryl.

WO 2012/041014 PCT/CN2011/001638 38 In another embodiment, for the Compounds of Formula (la), each occurrence of R4 is independently: Rb H Ra ,wherein Ra is H, methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH 2

CH

2 Si(CH 3

)

3 , -CH 2

CH

2

CF

3 , pyranyl, benzyl or phenyl, and Rb is methyl, ethyl or isopropyl. In still another embodiment, for the Compounds of Formula (Ia), each occurrence of R 4 is independently -C(O)CH(alkyl)-NHC(O)Oalkyl. In another embodiment, for the Compounds of Formula (Ta), each occurrence of R 4 is independently:

H

0 0N

H

3 C'O N In one embodiment, for the Compounds of Formula (Ia), A and A' are each independently selected from: F F R4 R4 R4 R4 OH

R

4

R

4 4 I I~ I I Si- s Si - iCH3 and S1 \ H3C CH3 H3C' 'CH3 'CH3 and R 4 is: R N wherein R 1 is H, alkyl, haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl or heteroaryl and Ra is alkyl, haloalkyl, silylalkyl, 3 to 6-membered cycloalkyl or 4 to 6-membered heterocycloalkyl, aryl or heteroaryl.

WO 2012/041014 PCT/CN2011/001638 39 In another embodiment, for the Compounds of Formula (Ia), A and A' are each independently selected from: R4 R4 R4 R4 R4 R4 F F

R

4

R

4 R4 OH

RR

4 R4 R N/ R N and

H

3 C 'CHI H 3 C' 'CH 3

'CH

3 ZD1 andRW is: Rap , wherein Ra is H, methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH 2

CH

2 Si(CH 3

)

3 , -CH 2

CH

2

CF

3 , pyranyl, benzyl or phenyl, and R' is methyl, ethyl or isopropyl. In another embodiment, for the Compounds of Formula (Ia), A and A' are each independently selected from: F F R4~R R R* R4 R4 OH R4R4 R4 R4 R4 SC/HN and S HaC CH 3

H

3 C' CH 3 CH, and R 4 is: H H 3 C ' 0 Y

N

WO 2012/041014 PCT/CN2011/001638 40 In another embodiment, for the Compounds of Formula (Ia), A and A' are each independently selected from: R R 4 U-' 't -gq , F F

RR

4 N Q) and 1 N

H

3 C 'CH, and R 4 is:

H

0 0 CH3 O0 N) In yet another embodiment, for the Compounds of Formula (Ia), A and A' are each: R4

R

13 R 13 ,wherein each occurrence of R 13 is independently H,

CH

3 , or F; and R 4 is

H

0

H

3 C-O*. N 0 In one embodiment, for the Compounds of Formula (Ia), G is -C(R 3

)

2 0-. In another embodiment, for the Compounds of Formula (Ia), G is C(R 14)=N In another embodiment, for the Compounds of Formula (Ia), G is C(R') 2

-C(R)

2 -, -C(R 4

)=C(R

4 )-. In still another embodiment, for the Compounds of Formula (Ia), G is C(R')2-C(R')2-, -C(R) 4)=C(RI4)-. In one embodiment, for the Compounds of Formula (Ia), G is -C(R3)2 0- and each occurrence of R 3 is independently selected from H, C 1

-C

6 alkyl, cycloalkyl and phenyl, wherein said phenyl group can be optionally substituted with WO 2012/041014 PCT/CN2011/001638 41 up to 2 groups, which can be the same or different, and are selected from halo, -CN,

CI-C

6 alkyl, C-C 6 haloalkyl, -O-C 1

-C

6 alkyl, -(C 1

-C

6 alkylene)-O-C-C 6 alkyl and O-C 1

-C

6 haloalkyl. In another embodiment, for the Compounds of Formula (Ia), G is C(R 3

)

2 -0-, wherein one occurrence of R 3 is H, and the other occurrence of R 3 is selected from CI-C 6 alkyl, cycloalkyl and phenyl, wherein said phenyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from halo, -CN, CI-C 6 alkyl, CI-C 6 haloalkyl, -0-C-C 6 alkyl, -(C-C 6 alkylene)-O-C-C 6 alkyl and -O-C-C 6 haloalkyl. In one embodiment, for the Compounds of Formula (Ia), G is -C(R 3

)

2 0- and each occurrence of R 3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, l'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 , CF 3 , OCF 3 and OCH 2

CH

2 0CH 3 . In another embodiment, for the Compounds of Formula (la), G is C(R 3

)

2 -0-, wherein one occurrence of R 3 is H, and the other occurrence of R 3 is selected from methyl, ethyl, isopropyl, cyclopropyl, l'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 , CF 3 , OCF 3 and

OCH

2

CH

2 0CH 3 . In one embodiment, for the Compounds of Formula (Ia), G is C(R 14 )=N-, wherein R' 4 is selected from H, C-C 6 alkyl, cycloalkyl and phenyl, wherein said phenyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from halo, -CN, C-C 6 alkyl, C 1

-C

6 haloalkyl, -O-C-C 6 alkyl, -(C 1

-C

6 alkylene)-O-C-C 6 alkyl and -0-C-C 6 haloalkyl. In one embodiment, for the Compounds of Formula (Ia), U is C(R 2 ). In another embodiment, for the Compounds of Formula (la), U is CH. In another embodiment, for the Compounds of Formula (Ia), U is CF. In one embodiment, for the Compounds of Formula (la), V is C(R 15 ). In another embodiment, for the Compounds of Formula (la), V is CH. In another embodiment, for the Compounds of Formula (Ia), V is N. In one embodiment, for the Compounds of Formula (Ia), V' is C(R 15

).

WO 2012/041014 PCT/CN2011/001638 42 In another embodiment, for the Compounds of Formula (Ia), V' is CH. In another embodiment, for the Compounds of Formula (Ia), V' is N. In still another embodiment, for the Compounds of Formula (Ia), V and V' are each CH. In one embodiment, for the Compounds of Formula (Ia), R' is absent. In another embodiment, for the Compounds of Formula (Ia), R 1 is F. In one embodiment, each occurrence of R 3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, l'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 , CF 3 , OCF 3 and

OCH

2

CH

2

OCH

3 . In one embodiment, for the Compounds of Formula (Ia), each occurrence of R1 0 is independently H or F. In another embodiment, for the Compounds of Formula (la), each occurrence of R1 0 is H. In one embodiment, for the Compounds of Formula (Ia), the group: R2 R 15 N V R1 G has the structure: Ri5 RR R15 R15 N

R

3

R

3

R

3

R

3 In another embodiment, for the Compounds of Formula (la), the group: 2 R 15 RG has the structure: WO 2012/041014 PCT/CN2011/001638 43

R

15 ^N RN R2 In another embodiment, for the Compounds of Formula (Ia), the group: R2 R15 N V R' G has the structure: F

R

3

R

3 In one embodiment, variables A, A', G, R 1 , R 2 , R' 0 , R" 5 , U, V and V' for the Compounds of Formula (Ia) are selected independently of each other. In another embodiment, the Compounds of Formula ([a) are in substantially purified form. In one embodiment, the Compounds of Formula (I) have the formula (Ib):

R

4 R1 3 b N ~NR24 R 3a RR N 'N ~ - N / SN R13b HIa N

R

15 H R)

R

3

R

3 R (Ib) or a pharmaceutically acceptable salt thereof, wherein: R2 is H or F; each occurrence of R 3 is independently selected from H, C 1

-C

6 alkyl, Ci-C 6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, WO 2012/041014 PCT/CN2011/001638 44 5 or 6-membered monocyclic heteroaryl, 9 or I 0-membered bicyclic heteroaryl, -0

(C-C

6 alkyl), C-C 6 haloalkylene -O-(C-C 6 haloalkyl); -(C 1

-C

6 alkylene)C(=O)NH alkyl, -(Ci-C 6 alkylene)aryl, and -(C I-C 6 alkylene)heteroaryl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group, said 9 or 10-membered bicyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, C-C 6 alkyl, C-C 6 haloalkyl, -0-C-C 6 alkyl, -(C-C 6 alkylene)-O

CI-C

6 alkyl and -0-(C-C 6 haloalkyl); each occurrence of RW is independently selected from -C(0)0-(C -C 6 alkyl), -C(O)-CH(R )N(R6)2 and -C(O)-CH(R )C(O)O-R"; each occurrence of R 6 is independently H or C-C 6 alkyl; each occurrence of R 7 is independently selected from CI-C alkyl, phenyl, 4 to 6-membered heterocycloalkyl and 3 to 6 membered cycloalkyl; each occurrence of R" is independently C-C 6 alkyl; each occurrence of R1 3 a is independently H, Me or F; or two R 1 3a groups that are attached to the same carbon atom, together with the common carbon atom to which they are attached, combine to form a spirocyclic 3 to 6 membered cycloalkyl group; each occurrence of R 13b is independently H, or one or both R 13b groups and an R 1 3 a group that are attached to same ring, together with the ring carbon atoms to which they are attached, can combine to form a fused 3 to 6 membered cycloalkyl group; and R 5 represents up to 2 substituents, each independently selected from H, halo, C-C 6 alkyl, C-C 6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl, benzyl, -0-(C-C 6 alkyl), C-C 6 haloalkylene -0-(C-C 6 haloalkyl) -(CI-C 6 alkylene)C(=O)NH-alkyl, (CI-C 6 alkylene)aryl, and -(C-C 6 alkylene)heteroaryl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, C-C 6 alkyl, C 1

-C

6 haloalkyl, -0-C 1

-C

6 alkyl, -(C-C 6 alkylene)-O-C-C 6 alkyl and -0-(C-C 6 haloalkyl). In one embodiment, for the Compounds of Formula (Ib), R 2 is H. In another embodiment, for the Compounds of Formula (Ib), R 2 is F.

WO 2012/041014 PCT/CN2011/001638 45 In one embodiment, for the Compounds of Formula (Ib), one occurrence of R 3 is H and the other occurrence of R 3 is selected from H, methyl, ethyl, isopropyl, cyclopropyl, l'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 , CF 3 , OCF 3 , OCH 2

CH

2 0CH 3 . In another embodiment, for the Compounds of Formula (Ib), two R3 groups that are attached to the same carbon atom, together with the common carbon atom that they are attached to, join to form a carbonyl group, a 3 to 6-membered spirocyclic cycloalkyl group or a 3 to 6-membered spirocyclic heterocycloalkyl group. In one embodiment, for the Compounds of Formula (Ib), each occurrence of R3 is C 1

-C

6 alkyl. In another embodiment, for the Compounds of Formula (Ib), one occurrence of R3 is H. In another embodiment, for the Compounds of Formula (Ib), one occurrence of R 3 is H and the other occurrence of R3 is methyl, phenyl, 5 or 6 membered monocyclic heteroaryl or 9-membered bicyclic heteroaryl. In still another embodiment, for the Compounds of Formula (Ib), one occurrence of R3 is H and the other occurrence of R3 is phenyl, methyl, KO - or I

H

3 C S S In one embodiment, for the Compounds of Formula (Ib), each occurrence of R 4 is -C(O)CH(R 7 )NHC(O)OR". In another embodiment, for the Compounds of Formula (Ib), each occurrence of R 4 is -C(O)CH(R 7 )NHC(O)OR" and each occurrence of R' is methyl. In another embodiment, for the Compounds of Formula (Ib), each occurrence of R 4 is -C(O)CH(R)NHC(O)OR' 1 ; each occurrence of R7 is isopropyl, benzyl, cyclopropyl or tetrahyropyranyl; and each occurrence of R' is methyl.

WO 2012/041014 PCT/CN2011/001638 46 In still another embodiment, for the Compounds of Formula (Ib), each occurrence of R 4 is -C(O)CH(R 7 )NHC(O)OR"; each occurrence of R 7 is isopropyl or tetrahyropyranyl; and each occurrence of R" is methyl. In another embodiment, for the Compounds of Formula (Ib), each occurrence of R 4 is -C(O)CH(R 7 )NHC(O)OR"; each occurrence of R 7 is isopropyl; and each occurrence of R 1 is methyl. In yetanother embodiment, for the Compounds of Formula (Ib), each occurrence of R is -C(O)CH(R 7 )NHC(O)OR"; each occurrence of R 7 is tetrahyropyranyl; and each occurrence of R" is methyl. In one embodiment, for the Compounds of Formula (Ib), each occurrence of Ra 13 is independently H, or F. In another embodiment, for the Compounds of Formula (Tb), two R1a groups that are attached to the same carbon atom, together with the common carbon atom to which they are attached, combine to form a spirocyclic 3 to 6 membered cycloalkyl group. In another embodiment, for the Compounds of Formula (Tb), two R1a groups that are attached to the same carbon atom, together with the common carbon atom to which they are attached, combine to form a spirocyclic cyclopropyl group. In one embodiment, for the Compounds of Formula (Ib), each occurrence of R1 3 b is H. In another embodiment, for the Compounds of Formula (Tb), one or both R 13b groups and an RI 3a group that are attached to same ring, together with the ring carbon atoms to which they are attached, can combine to form a fused 3 to 6 membered cycloalkyl group. In another embodiment, for the Compounds of Formula (Ib), one or both R '3b groups and an RI 3a group that are attached to same ring, together with the ring carbon atoms to which they are attached, can combine to form a fused 3 to 6 membered cyclopropyl group. In one embodiment, for the Compounds of Formula (Ib), each occurrence of R 15 is independently selected from H and F. In another embodiment, for the Compounds of Formula (Tb), each occurrence of R 15 is H. In one embodiment, for the Compounds of Formula (Ib), each occurrence of R 2 , R1 3 and R 15 is independently selected from H and F.

WO 2012/041014 PCT/CN2011/001638 47 In another embodiment, for the Compounds of Formula (Ib), each occurrence of R2, R 1 3 and R 15 is independently selected from H and F and one occurrence of R 3 is H. In one embodiment, variables R 2 , R3, R 13 and R 15 for the Compounds of Formula (Ib) are selected independently of each other. In another embodiment, the Compounds of Formula (Ib) are in substantially purified form. In one embodiment, the Compounds of Formula (I) have the formula (Ic): o RY 0

H

3 CO N ( H N Rz O

R

13 Z N 1 N (s) N~0 H P. H I* \ - \ N H

R

13 NN N (s )H H R

R

3 R (Ic) and pharmaceutically acceptable salts thereof, wherein: RY is isopropyl or tetrahydropyranyl; Rz is isopropyl or tetrahydropyranyl; 2 is H or halo; R3 is selected from 3 to 6-membered cycloalkyl or phenyl, wherein said phenyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from halo, -CN, C 1

-C

6 alkyl, C 1

-C

6 haloalkyl, -0

C

1

-C

6 alkyl, -(C 1

-C

6 alkylene)-O-C1-C 6 alkyl and -0-C 1

-C

6 haloalkyland each occurrence of R1 3 is independently selected from H and halo; and each occurrence of R 15 is independently selected from H and halo. In one embodiment, for the compounds of formula (Ic), R 3 is phenyl, wherein said phenyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN, CH 3 , CF 3 , OCF 3 ,

OCH

2

CH

2

OCH

3

.

WO 2012/041014 PCT/CN2011/001638 48 In another embodiment, for the compounds of formula (Ic), R 3 is cyclopropyl. In another embodiment, for the compounds of formula (Ic), R 2 and R 15 are each independently H or F. In another embodiment, for the compounds of formula (Ic), each occurrence of R1 3 is independently H or F; In one embodiment, for the compounds of formula (Ic), R 3 is phenyl; each occurrence of R 13 is independently H or F; and R 2 and R1 5 are each independently H or F, wherein said phenyl group can be optionally substituted with up to 2 groups, which can be the same or different, and are selected from F, Cl, -CN,

CH

3 , CF 3 , OCF 3 , OCH 2

CH

2

OCH

3 . In another embodiment, for the compounds of formula (Ic), R3 is cyclopropyl; each occurrence of R 13 is independently H or F; and R2 and R 15 are each independently H or F. In one embodiment, the Compounds of Formula (I) have the formula (Id): 0 O 0 0 R0

R

30 (Id) or a pharmaceutically acceptable salt thereof, wherein:

R

30 is C 1

-C

6 alkyl, aryl, 5 or 6-membered monocyclic heteroaryl or 9 membered bicyclic heteroaryl; R" is H, or R' and R, together with the ring carbon atoms to which they are attached, combine to form a fused 3 to 6-membered cycloalkyl group; R is H or F, or R" and R, together with the ring carbon atoms to which they are attached, combine to form a fused 3 to 6-membered cycloalkyl group; WO 2012/041014 PCT/CN2011/001638 49 RY is H, or RY and Rz, together with the ring carbon atoms to which they are attached, combine to form a fused 3 to 6-membered cycloalkyl group; and Rz is H or F, or RY and Rz, together with the ring carbon atoms to which they are attached, combine to form a fused 3 to 6-membered cycloalkyl group. In one embodiment, for the compounds of formula (Id), R 30 is phenyl, methyl, K )- or

H

3 C or In another embodiment, for the compounds of formula (Id), R7 and RX, together with the ring carbon atoms to which they are attached, combine to form a fused cyclopropyl group. In another embodiment, for the compounds of formula (Id), RY and Rz, together with the ring carbon atoms to which they are attached, combine to form a fused cyclopropyl group. In still another embodiment, for the compounds of formula (Id), RY and Rz, together with the ring carbon atoms to which they are attached, combine to form a fused cyclopropyl group and R" and R, together with the ring carbon atoms to which they are attached, combine to form a fused cyclopropyl group. In another embodiment, for the compounds of formula (Id), RW, R, and RY are each H and Rz is F. In another embodiment, for the compounds of formula (Id), R7 and Rx, together with the ring carbon atoms to which they are attached, combine to form a fused cyclopropyl group; RY is H and Rz is F. In one embodiment, for the compounds of formula (Id), variables R 30 , R:, R, RY, and Rz are selected independently of each other. In another embodiment, the Compounds of Formula (Ic) are in substantially purified form. Other embodiments of the present invention include the following: WO 2012/041014 PCT/CN2011/001638 50 (a) A pharmaceutical composition comprising an effective amount of a Compound of Formula (I) or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. (b) The pharmaceutical composition of (a), further comprising a second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators, and anti-infective agents. (c) The pharmaceutical composition of (b), wherein the HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and HCV NS5B polymerase inhibitors. (d) A pharmaceutical combination that is (i) a Compound of Formula (I) and (ii) a second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators, and anti-infective agents; wherein the Compound of Formula (I) and the second therapeutic agent are each employed in an amount that renders the combination effective for inhibiting HCV replication, or for treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection. (e) The combination of (d), wherein the HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and HCV NS5B polymerase inhibitors. (f) A method of inhibiting HCV replication in a subject in need thereof which comprises administering to the subject an effective amount of a Compound of Formula (I). (g) A method of treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection in a subject in need thereof which comprises administering to the subject an effective amount of a Compound of Formula (I). (h) The method of (g), wherein the Compound of Formula (I) is administered in combination with an effective amount of at least one second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators, and anti-infective agents. (i) The method of (h), wherein the HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and HCV NS5B polymerase inhibitors.

WO 2012/041014 PCT/CN2011/001638 51 (j) A method of inhibiting HCV replication in a subject in need thereof which comprises administering to the subject the pharmaceutical composition of (a), (b) or (c) or the combination of (d) or (e). (k) A method of treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection in a subject in need thereof which comprises administering to the subject the pharmaceutical composition of (a), (b) or (c) or the combination of (d) or (e). The present invention also includes a compound of the present invention for use (i) in, (ii) as a medicament for, or (iii) in the preparation of a medicament for: (a) medicine; (b) inhibiting HCV replication or (c) treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection. In these uses, the compounds of the present invention can optionally be employed in combination with one or more second therapeutic agents selected from HCV antiviral agents, anti-infective agents, and immunomodulators. The present invention also includes the use of a compound of the present invention for (i) inhibiting HCV replication or (ii) treating HCV infection and/or reducing the likelihood or severity of symptoms of HCV infection. Additional embodiments of the invention include the pharmaceutical compositions, combinations and methods set forth in (a)-(k) above and the uses set forth in the preceding paragraph, wherein the compound of the present invention employed therein is a compound of one of the embodiments, aspects, classes, sub classes, or features of the compounds described above. In all of these embodiments, the compound may optionally be used in the form of a pharmaceutically acceptable salt or hydrate as appropriate. It is further to be understood that the embodiments of compositions and methods provided as (a) through (k) above are understood to include all embodiments of the compounds, including such embodiments as result from combinations of embodiments. The Compounds of Formula (I) may be referred to herein by chemical structure and/or by chemical name. In the instance that both the structure and the name of a Compound of Formula (I) are provided and a discrepancy is found to exist between the chemical structure and the corresponding chemical name, it is understood that the chemical structure will predominate.

WO 2012/041014 52 PCT/CN2011/001638 Non-limiting examples of the Compounds of Formula (I) include (i) compounds 1-1542, as set forth in Tables 1 and 2 in the Examples Section below. Methods For Making the Compounds of Formula (I) The Compounds of Formula (1) may be prepared from known or readily prepared starting materials, following methods known to one skilled in the art of organic synthesis. Methods useful for making the Compounds of Formula (I) are set forth in the Examples below and generalized in Schemes 1-5 below. Alternative synthetic pathways and analogous structures will be apparent to those skilled in the art of organic synthesis. Scheme 1 shows methods useful for making the Compounds of formula G8, which correspond to the Compounds of Formula (I), wherein B is phenyl and the group -U-V-W- is -C(R2)=CH-N-. Scheme 1 H HCI 0 R1 N ),R's H' R 'NH 2 N G1 G2 G3 R2 R 15 R 2 R 1 5

R

2 R15 R+ H Q' R HR c G4 G5 G6 G7

R

2 R1 5 G8 Wherein Q and Q' are each independently halo, hydroxy, or a protected hydroxy such as methoxy or benzyloxy; M, M', M" are each independently halo, hydroxy, or a protected hydroxy, triflate, boronic acid or boronic ester; K represents a group that can form a bond to the indole nitrogen. One skilled in the art of organic synthesis will recognize that when G is single or multiatom bridge, K should contain all the atoms of the bridge and a reactive group capable of forming a bond to nitrogen of the indole. Examples of reactive groups capable of forming a bond to nitrogen are WO 2012/041014 PCT/CN2011/001638 53 well known to one skilled in the art of organic synthesis and non-limiting examples include an alkyl halide, vinyl halide, aldehyde group or a vicinal dihalide. Z represents an appropriate aryl coupling partner which will be well known to one skilled in the art of organic chemistry. An example of aryl coupling partners include but are not limited to halide and triflate when the other partner is an arylboron or arylstannane derivative. Tetracyclic Compounds of formula G8 can be prepared from suitably substituted indole derivatives of formula G6. An indole derivative of formula G6 is cyclized to provide tetracyclic Compounds of formula G7. Indole derivatives of formula G6 may be obtained commercially or prepared by using methods known to those skilled in the art of organic synthesis. In an illustrative example, the Compounds of formula G6 can be made via dehydration of a hydrazide of formula G1 with a ketone of formula G2 to provide hydrazones of formula G3, which can then be cyclized in the presence of a strong acid such as PPA or a Lewis acid such as aluminum chloride, to provide the hydroxyl-substituted indole Compounds of formula G4. A Compound of formula G4 can then be reacted with an aldehyde of formula R CHO to provide the cyclized Compounds of formula G8, wherein G is -CHR 3 -0-. Compounds of formula G7 can be made, for example, via the arylation of the 2-position of an indole of formula G5 with a coupling partner of formula G6. A Compound of formula G7 can then be cyclized by reacting Y and K' to provide the Compounds of formula G8. It will be obvious to one skilled in the art of organic synthesis that the Compounds of formulas G4 and G7 may undergo further functional group manipulations prior to cyclization as necessary in order to provide the scope of the Compounds of Formula (I). Scheme 2 shows a method useful for making the Compounds of formula G12, which correspond to the Compounds of Formula (I), wherein B is phenyl; X and X' are each CH; Y and Y' are each N; and the group -U-V-W- is C(R 2 )=CH-N-. Scheme 2 WO 2012/041014 54 PCT/CN2011/001638 R 2

R

1 5 PG M M' G24

R

2 R'5 GB G9 H N N 2 R' Nt i D N amide coupling R N GRD NHC GIO G11 Wherein D and D' are each independently C(R) 2 , N(R 4 ), S, 0 or Si(R 1 6)2; M and M' are each independently halo, triflate, boronic acid or boronic ester; PG is a protecting group, such as Boc or 4-methoxybenzyl; RW is -C(O)R", -C(O)

[C(R

7

)

2 ]qN(R 6

)

2 , -C(O)-[C(R) 2 ]q-R", -C(O)-[C(R 7

)

2 ]qN(R 6 )C(O)-R", C(O)[C(R 7

)

2 ]qN(R 6)SO2-R", -C(O)-[C(R 7

)

2 ]qN(R 6 )C(O)O-R" or -C(O)

[C(R

7

)

2 ]qC(O)O-R"; and G, R', R 2 and R" 5 are defined above for the Compounds of Formula (I). Scheme 3 shows a method useful for making the Compounds of formula G16, which correspond to the Compounds of Formula (I), wherein B is phenyl; X and X' are each CH; Y and Y' are each N; and the group -U-V-W- is N=CH-N-. Scheme 3 Q 2 0 R's Q N R 15 + -Q,~~~ K' H K G12 G13 G14 R 4 N% N R 1 5 R 15 (N~ z N ,N R 4 M :DC RN M' R \G HI G G16 G15 Wherein Z and Z' are each independently C(R) 2 , N(R 4 ), S, 0 or Si(R 16)2; M and M' are each independently halo, triflate, boronic acid or boronic ester; X is halo; R 4 is -C(O)R", -C(O)-[C(R) 2 ]qN(R 6

)

2 , -C(O)-[C(R)2]q-R", -C(O)- WO 2012/041014 PCT/CN2011/001638 55 [C(R 7) 2 ]qN(R 6 )C(O)-R", -C(O)[C(R 7

)

2 ]qN(R 6)SO 2 -R", -C(O)-[C(R 7

)

2 ]qN(R 6)C(O)0 R or -C(O)-[C(R 7

)

2 ]qC(O)O-R 11 ; K, Q and Q' are defined above in connection with Scheme 1; and G, R 2 and R1 5 are defined above for the Compounds of Formula (I). A 2-amino aniline derivative of formula G12 can be reacted with an acyl halide of formula G13 to provide the 2-substituted benzimidazole Compounds of formula G14. The Compounds of formula G14.can be cyclized and derivatized to provide Compounds of formula G15, using at methods analogous to those described in Scheme I for the conversion of G6 to G8. A Compound of formula G15 can then be carried forth to the Compounds of formula G16 using methods analogous to those described in Scheme 2. Scheme 4 shows a method useful for making the Compounds of formula G20, which correspond to the Compounds of Formula (I), wherein B is pyridyl; X and X' are each CH; Y and Y' are each N; and the group -U-V-W- is C(R 2 )=CH-N-. Scheme 4 G18 G H RR2 N~N RR1 G20 Wherein Z and Z' are each independently C(R' 3

)

2 , N(R 4 ), S, 0 or Si(R' 6 ) 2; M and M' are each independently halo, triflate, boronic acid or boronic ester;

R

4 is -C(O)R", -C(O)-[C(R) 2 ]qN(R 6

)

2 , -C(O)-[C(R 7

)

2 ]q-R" 1 , -C(O) 7 6( II 7 6 RI [C(R7)2]qN(R )C(O)-R", -C(O)[C(R7)2]qN(R6)SO 2 -R", -C(O)-[C(R 7

)

2 ]qN(R )C(O)O R" or -C(O)[C(R 7

)

2 iqC(O)-Rd; and G, Ri and l2 are defined above for the Compounds of Formula (1). A pyridyl hydrazone of formula G17 can be converted to the tetracyclic Compounds of formula G19 using methods analogous to those described in Scheme I for the conversion of G3 to G8. A Compound of formula G19 can then WO 2012/041014 PCT/CN2011/001638 56 be carried forth to the Compounds of G20 using methods analogous to those described in Scheme 2. Scheme 5 shows methods useful for making the Compounds of formula G24, which are useful intermediates for making the Compounds of Formula (I) wherein X and X' are each CH and Y and Y' are each N. Scheme 5 PG PG PG x N, N N (N H N z- z z H Z- H Z H G21 G22 G24 %ee >70% PG X I N~ N X H G23 Wherein Z or Z' is C(R) 2 , N(R 4 ), S, 0 or Si(R1 6

)

2 ; X is halo or triflate; and PG is a amino protecting group, such as Boc or 4-methoxybenzyl.. An appropriately functionalized aldehyde of formula G21 can be reacted with glyoxal and ammonia to provide a substituted imidazole of formula G22. A Compound of formula G22 can subsequently be selectively mono-halogenated to provide a mono-halogenated imidazole Compound of formula G24. Alternatively, a Compound of formula G24 can subsequently be di-halogenated to provide a Compound of formula G23, which is then selectively reduced to provide a mono halogenated imidazole Compound of formula G24. In some of the Compounds of Formula (I) contemplated in Schemes 1 5, amino acids (such as, but not limited to proline, 4-(R)-fluoroproline, 4-(S) fluoroproline, 4,4-difluoroproline, 4,4-dimethylsilylproline, aza-bicyclo[2.2.1 ]heptane carboxylic acid, aza-bicyclo[2.2.2]octane carboxylic acid, (S)-2-piperidine carboxylic acid, valine, alanine, norvaline, etc.) are incorporated as part of the structures. Methods have been described in the organic chemistry literature as well as in Banchard US 2009/0068140 (Published March 9th 2009) for the preparation of such amino acid-derived intermediates. One skilled in the art of organic synthesis will recognize that the synthesis of fused tetracyclic cores contained in Compounds of Formula (I) may require protection of certain functional groups (i.e., derivatization for the purpose of WO 2012/041014 PCT/CN2011/001638 57 chemical compatibility with a particular reaction condition). Suitable protecting groups for the various functional groups of these Compounds and methods for their installation and removal are well known in the art of organic chemistry. A summary of many of these methods can be found in Greene et al., Protective Groups in Organic Synthesis, Wiley-Interscience, New York, (1999). One skilled in the art of organic synthesis will also recognize that one route for the synthesis of the fused tetracyclic cores of the Compounds of Formula (I) may be more desirable depending on the choice of appendage substituents. Additionally, one skilled in the art will recognize that in some cases the order of reactions may differ from that presented herein to avoid functional group incompatibilities and thus adjust the synthetic route accordingly. One skilled in the art of organic synthesis will recognize that the synthesis of certain fused tetracyclic cores of the Compounds of Formula (I) require the construction of an amide bond. Methods useful for making such amide bonds, include but are not limited to, the use of a reactive carboxy derivative (e.g., an acid halide, or ester at elevated temperatures) or the use of an acid with a coupling reagent (e.g., HOBt, EDCI, DCC, HATU, PyBrop) with an amine. The preparation of multicyclic intermediates useful for making the fused tetracyclic ring systems of the Compounds of Formula (I) have been described in the literature and in compendia such as "Comprehensive Heterocyclic Chemistry" editions I, II and III, published by Elsevier and edited by A.R. Katritzky & R. JK Taylor. Manipulation of the required substitution patterns have also been described in the available chemical literature as summarized in compendia such as "Comprehensive Organic Chemistry" published by Elsevier and edited by DH R. Barton and W. D. Ollis; "Comprehensive Organic Functional Group Transformations" edited by edited by A.R. Katritzky & R. JK Taylor and "Comprehensive Organic Transformation" published by Wily-CVH and edited by R. C. Larock. The Compounds Formula (I) may contain one or more silicon atoms. The Compounds contemplated in this invention in general can be prepared using the carba-analog methodology unless otherwise noted. A recent review of the synthesis of silicon containing Compounds can be found in "Silicon Chemistry: from Atom to Extended Systems", Ed P. Jutzi & U. Schubet; ISBN 978-3-527-30647-3. Preparation of silyl containing amino acids has been described. See Bolm et al., Angew. Chem. Int Ed., _39:2289 (2000). Descriptions of improved cellular update WO 2012/041014 PCT/CN2011/001638 58 (Giralt, J. Am. Chem. Soc., 128:8479 (2006)) and reduced metabolic processing of silyl containing Compounds have been described ( Johansson et al., Drug Metabolism & Disposition, 38:73 (2009)). The starting materials used and the intermediates prepared using the methods set forth in Schemes 1-5 may be isolated and purified if desired using conventional techniques, including but not limited to filtration, distillation, crystallization, chromatography and alike. Such materials can be characterized using conventional means, including physical constants and spectral data. Uses of the Tetracyclic Indole Derivatives The Tetracyclic Indole Derivatives are useful in human and veterinary medicine for treating or preventing a viral infection in a patient. In one embodiment, the Tetracyclic Indole Derivatives can be inhibitors of viral replication. In another embodiment, the Tetracyclic Indole Derivatives can be inhibitors of HCV replication. Accordingly, the Tetracyclic Indole Derivatives are useful for treating viral infections, such as HCV. In accordance with the invention, the Tetracyclic Indole Derivatives can be administered to a patient in need of treatment or prevention of a viral infection. Accordingly, in one embodiment, the invention provides methods for treating a viral infection in a patient comprising administering to the patient an effective amount of at least one Tetracyclic Indole Derivative or a pharmaceutically acceptable salt thereof. Treatment or Prevention of a Flaviviridae Virus The Tetracyclic Indole Derivatives can be useful for treating or preventing a viral infection caused by the Flaviviridae family of viruses. Examples of Flaviviridae infections that can be treated or prevented using the present methods include but are not limited to, dengue fever, Japanese encephalitis, Kyasanur Forest disease, Murray Valley encephalitis, St. Louis encephalitis, Tick-borne encephalitis, West Nile encephalitis, yellow fever and Hepatitis C Virus (HCV) infection. In one embodiment, the Flaviviridae infection being treated is hepatitis C virus infection. Treatment or Prevention of HCV Infection WO 2012/041014 59 PCT/CN2011/001638 The Tetracyclic Indole Derivatives are useful in the inhibition of HCV (e.g., HCV NS5A), the treatment of HCV infection and/or reduction of the likelihood or severity of symptoms of HCV infection and the inhibition of HCV viral replication and/or HCV viral production in a cell-based system. For example, the Tetracyclic Indole Derivatives are useful in treating infection by HCV after suspected past exposure to HCV by such means as blood transfusion, exchange of body fluids, bites, accidental needle stick, or exposure to patient blood during surgery or other medical procedures. In one embodiment, the hepatitis C infection is acute hepatitis C. In another embodiment, the hepatitis C infection is chronic hepatitis C. Accordingly, in one embodiment, the invention provides methods for treating HCV infection in a patient, the methods comprising administering to the patient an effective amount of at least one Tetracyclic Indole Derivative or a pharmaceutically acceptable salt thereof. In a specific embodiment, the amount administered is effective to treat or prevent infection by HCV in the patient. In another specific embodiment, the amount administered is effective to inhibit HCV viral replication and/or viral production in the patient. The Tetracyclic Indole Derivatives are also useful in the preparation and execution of screening assays for antiviral compounds. For example the Tetracyclic Indole Derivatives are useful for identifying resistant HCV replicon cell lines harboring mutations within NS5A, which are excellent screening tools for more powerful antiviral compounds. Furthermore, the Tetracyclic Indole Derivatives are useful in establishing or determining the binding site of other antivirals to the HCV replicase. The compositions and combinations of the present invention can be useful for treating a patient suffering from infection related to any HCV genotype. HCV types and subtypes may differ in their antigenicity, level of viremia, severity of disease produced, and response to interferon therapy as described in Holland et al., Pathology, 30(2):192-195 (1998). The nomenclature set forth in Simmonds et al., J Gen Virol, 74(Ptl 1):2391-2399 (1993) is widely used and classifies isolates into six major genotypes, 1 through 6, with two or more related subtypes, e.g., la and lb. Additional genotypes 7-10 and 11 have been proposed, however the phylogenetic basis on which this classification is based has been questioned, and thus types 7, 8, 9 and 11 isolates have been reassigned as type 6, and type 10 isolates as type 3 (see WO 2012/041014 PCT/CN2011/001638 60 Lamballerie et al., J Gen Virol, 78(Ptl):45-51 (1997)). The major genotypes have been defined as having sequence similarities of between 55 and 72% (mean 64.5%), and subtypes within types as having 75%-86% similarity (mean 80%) when sequenced in the NS-5 region (see Simmonds et al., J Gen Virol, 75(Pt 5):1053-1061 (1994)). Combination Therapy In another embodiment, the present methods for treating or preventing HCV infection can further comprise the administration of one or more additional therapeutic agents which are not Tetracyclic Indole Derivatives. In one embodiment, the additional therapeutic agent is an antiviral agent. In another embodiment, the additional therapeutic agent is an immunomodulatory agent, such as an immunosuppressive agent. Accordingly, in one embodiment, the present invention provides methods for treating a viral infection in a patient, the method comprising administering to the patient: (i) at least one Tetracyclic Indole Derivative, or a pharmaceutically acceptable salt thereof, and (ii) at least one additional therapeutic agent that is other than a Tetracyclic Indole Derivative, wherein the amounts administered are together effective to treat or prevent a viral infection. When administering a combination therapy of the invention to a patient, therapeutic agents in the combination, or a pharmaceutical composition or compositions comprising therapeutic agents, may be administered in any order such as, for example, sequentially, concurrently, together, simultaneously and the like. The amounts of the various actives in such combination therapy may be different amounts (different dosage amounts) or same amounts (same dosage amounts). Thus, for non limiting illustration purposes, a Tetracyclic Indole Derivative and an additional therapeutic agent may be present in fixed amounts (dosage amounts) in a single dosage unit (e.g., a capsule, a tablet and the like). In one embodiment, the at least one Tetracyclic Indole Derivative is administered during a time when the additional therapeutic agent(s) exert their prophylactic or therapeutic effect, or vice versa.

WO 2012/041014 PCT/CN2011/001638 61 In another embodiment, the at least one Tetracyclic Indole Derivative and the additional therapeutic agent(s) are administered in doses commonly employed when such agents are used as monotherapy for treating a viral infection. In another embodiment, the at least one Tetracyclic Indole Derivative and the additional therapeutic agent(s) are administered in doses lower than the doses commonly employed when such agents are used as monotherapy for treating a viral infection. In still another embodiment, the at least one Tetracyclic Indole Derivative and the additional therapeutic agent(s) act synergistically and are administered in doses lower than the doses commonly employed when such agents are used as monotherapy for treating a viral infection. In one embodiment, the at least one Tetracyclic Indole Derivative and the additional therapeutic agent(s) are present in the same composition. In one embodiment, this composition is suitable for oral administration. In another embodiment, this composition is suitable for intravenous administration. In another embodiment, this composition is suitable for subcutaneous administration. In still another embodiment, this composition is suitable for parenteral administration. Viral infections and virus-related disorders that can be treated or prevented using the combination therapy methods of the present invention include, but are not limited to, those listed above. In one embodiment, the viral infection is HCV infection. The at least one Tetracyclic Indole Derivative and the additional therapeutic agent(s) can act additively or synergistically. A synergistic combination may allow the use of lower dosages of one or more agents and/or less frequent administration of one or more agents of a combination therapy. A lower dosage or less frequent administration of one or more agents may lower toxicity of therapy without reducing the efficacy of therapy. In one embodiment, the administration of at least one Tetracyclic Indole Derivative and the additional therapeutic agent(s) may inhibit the resistance of a viral infection to these agents. Non-limiting examples of additional therapeutic agents useful in the present compositions and methods include an interferon, an immunomodulator, a viral replication inhibitor, an antisense agent, a therapeutic vaccine, a viral polymerase inhibitor, a nucleoside inhibitor, a viral protease inhibitor, a viral helicase inhibitor, a WO 2012/041014 PCT/CN2011/001638 62 virion production inhibitor, a viral entry inhibitor, a viral assembly inhibitor, an antibody therapy (monoclonal or polyclonal), and any agent useful for treating an RNA-dependent polymerase-related disorder. In one embodiment, the additional therapeutic agent is a viral protease inhibitor. In another embodiment, the additional therapeutic agent is a viral replication inhibitor. In another embodiment, the additional therapeutic agent is an HCV NS3 protease inhibitor. In still another embodiment, the additional therapeutic agent is an HCV NS5B polymerase inhibitor. In another embodiment, the additional therapeutic agent is a nucleoside inhibitor. In another embodiment, the additional therapeutic agent is an interferon. In yet another embodiment, the additional therapeutic agent is an HCV replicase inhibitor. In another embodiment, the additional therapeutic agent is an antisense agent. In another embodiment, the additional therapeutic agent is a therapeutic vaccine. In a further embodiment, the additional therapeutic agent is a virion production inhibitor. In another embodiment, the additional therapeutic agent is an antibody therapy. In another embodiment, the additional therapeutic agent is an HCV NS2 inhibitor. In still another embodiment, the additional therapeutic agent is an HCV NS4A inhibitor. In another embodiment, the additional therapeutic agent is an HCV NS4B inhibitor. In another embodiment, the additional therapeutic agent is an HCV NS5A inhibitor WO 2012/041014 PCT/CN2011/001638 63 In yet another embodiment, the additional therapeutic agent is an HCV NS3 helicase inhibitor. In another embodiment, the additional therapeutic agent is an HCV IRES inhibitor. In another embodiment, the additional therapeutic agent is an HCV p7 inhibitor. In a further embodiment, the additional therapeutic agent is an HCV entry inhibitor. In another embodiment, the additional therapeutic agent is an HCV assembly inhibitor. In one embodiment, the additional therapeutic agents comprise a viral protease inhibitor and a viral polymerase inhibitor. In still another embodiment, the additional therapeutic agents comprise a viral protease inhibitor and an immunomodulatory agent. In yet another embodiment, the additional therapeutic agents comprise a polymerase inhibitor and an immunomodulatory agent. In another embodiment, the additional therapeutic agents comprise a viral protease inhibitor and a nucleoside. In another embodiment, the additional therapeutic agents comprise an immunomodulatory agent and a nucleoside. In one embodiment, the additional therapeutic agents comprise an HCV protease inhibitor and an HCV polymerase inhibitor. In another embodiment, the additional therapeutic agents comprise a nucleoside and an HCV NS5A inhibitor. In another embodiment, the additional therapeutic agents comprise a viral protease inhibitor, an immunomodulatory agent and a nucleoside. In a further embodiment, the additional therapeutic agents comprise a viral protease inhibitor, a viral polymerase inhibitor and an immunomodulatory agent. In another embodiment, the additional therapeutic agent is ribavirin. HCV polymerase inhibitors useful in the present compositions and methods include, but are not limited to, VP-19744 (Wyeth/ViroPharma), PSI-7851 (Pharmasset), RG7128 (Roche/Pharmasset), PSI-938 (Pharmasset), PSI-7977 (Pharmasset), PF-868554/filibuvir (Pfizer), VCH-759 (ViroChem Pharma), HCV-796 (Wyeth/ViroPharma), IDX-184 (Idenix), IDX-375 (Idenix), NM-283 WO 2012/041014 PCT/CN2011/001638 64 (Idenix/Novartis), R-1626 (Roche), MK-0608 (Isis/Merck), INX-8014 (Inhibitex), INX-8018 (Inhibitex), INX-189 (Inhibitex), GS 9190 (Gilead), A-848837 (Abbott), ABT-333 (Abbott), ABT-072 (Abbott), A-837093 (Abbott), BI-207127 (Boehringer Ingelheim), BILB-1941 (Boehringer-Ingelheim), MK-3281 (Merck), VCH222 (ViroChem), VCH916 (ViroChem), VCH716(ViroChem), GSK-71185 (Glaxo SmithKline), ANA598 (Anadys), GSK-625433 (Glaxo SmithKline), XTL-2125 (XTL Biopharmaceuticals), and those disclosed in Ni et al., Current Opinion in Drug Discovery and Development, 7(4):446 (2004); Tan et al., Nature Reviews, :867 (2002); and Beaulieu et al., Current Opinion in Investigational Drugs, 5:838 (2004). Other HCV polymerase inhibitors useful in the present compositions and methods include, but are not limited to, those disclosed in International Publication Nos. WO 08/082484, WO 08/082488, WO 08/083351, WO 08/1 36815, WO 09/032116, WO 09/032123, WO 09/032124 and WO 09/032125. Interferons useful in the present compositions and methods include, but are not limited to, interferon alfa-2a, interferon alfa-2b, interferon alfacon-1 and PEG interferon alpha conjugates. "PEG-interferon alpha conjugates" are interferon alpha molecules covalently attached to a PEG molecule. Illustrative PEG-interferon alpha conjugates include interferon alpha-2a (Roferona, Hoffman La-Roche, Nutley, New Jersey) in the form of pegylated interferon alpha-2a (e.g., as sold under the trade name Pegasys T m ), interferon alpha-2b (Intronm, from Schering-Plough Corporation) in the form of pegylated interferon alpha-2b (e.g., as sold under the trade name PEG Introns from Schering-Plough Corporation), interferon alpha-2b-XL (e.g., as sold under the trade name PEG-Intron m ), interferon alpha-2c (Berofor Alpham, Boehringer Ingelheim, Ingelheim, Germany), PEG-interferon lambda (Bristol-Myers Squibb and ZymoGenetics), interferon alfa-2b alpha fusion polypeptides, interferon fused with the human blood protein albumin (Albuferonm, Human Genome Sciences), Omega Interferon (Intarcia), Locteron controlled release interferon (Biolex/OctoPlus), Biomed-5 10 (omega interferon), Peg-IL-29 (ZymoGenetics), Locteron CR (Octoplus), IFN-a-2b-XL (Flamel Technologies), and consensus interferon as defined by determination of a consensus sequence of naturally occurring interferon alphas (Infergen , Amgen, Thousand Oaks, California). Antibody therapy agents useful in the present compositions and methods include, but are not limited to, antibodies specific to IL-10 (such as those disclosed in US Patent Publication No. US2005/0101770, humanized 12G8, a WO 2012/041014 PCT/CN2011/001638 65 humanized monoclonal antibody against human IL- 10, plasmids containing the nucleic acids encoding the humanized 12G8 light and heavy chains were deposited with the American Type Culture Collection (ATCC) as deposit numbers PTA-5923 and PTA-5922, respectively), and the like). Examples of viral protease inhbitors useful in the present compositions and methods include, but are not limited to, an HCV protease inhibitor. HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, those disclosed in U.S. Patent Nos. 7,494,988, 7,485,625, 7,449,447, 7,442,695, 7,425,576, 7,342,041, 7,253,160, 7,244,721, 7,205,330, 7,192,957, 7,186,747, 7,173,057, 7,169,760, 7,012,066, 6,914,122, 6,911,428, 6,894,072, 6,846,802, 6,838,475, 6,800,434, 6,767,991, 5,017,380, 4,933,443, 4,812,561 and 4,634,697; U.S. Patent Publication Nos. US20020068702, US20020160962, US20050119168, US20050176648, US20050209164, US20050249702 and US20070042968; and International Publication Nos. WO 03/006490, WO 03/087092, WO 04/092161 and WO 08/124148. Additional HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, SCH503034 (Boceprevir, Schering Plough), SCH900518 (Schering-Plough), VX-950 (Telaprevir, Vertex), VX-500 (Vertex), VX-813 (Vertex), VBY-376 (Virobay), MK-7009 (Merck), MK-5172 (Merck), BI-201335 (Boehringer Ingelheim), TMC-435 (Medivir/Tibotec), ABT-450 (Abbott), TMC-435350 (Medivir), ITMN-191/R7227 (InterMune/Roche), EA-058 (Abbott/Enanta), EA-063 (Abbott/Enanta), GS-9132 (Gilead/Achillion), ACH-1095 (Gilead/Achillon), IDX-136 (Idenix), IDX-316 (Idenix), ITMN-8356 (InterMune), ITMN-8347 (InterMune), ITMN-8096 (InterMune), ITMN-7587 (InterMune), BMS 650032 (Bristol-Myers Squibb), VX-985 (Vertex) and PHX1766 (Phenomix). Further examples of HCV protease inhbitors useful in the present compositions and methods include, but are not limited to, those disclosed in Landro et al., Biochemistry, 36(31):9340-9348 (1997); Ingallinella et al., Biochemistry, 37(25):8906-8914 (1998); Llinis-Brunet et al., Bioorg Med Chem Lett, 8(13):1713 1718 (1998); Martin et al., Biochemistry, 37(33):11459-11468 (1998); Dimasi et al., J Virol, 71(101:7461-7469 (1997); Martin et al., Protein Eng, 10(5):607-614 (1997); Elzouki et al., JHepat, 27(1):42-48 (1997); Bio World Today, 9(217):4 (November 10, 1998); U.S. Patent Publication Nos. US2005/0249702 and US 2007/027495 1; and WO 2012/041014 PCT/CN2011/001638 66 International Publication Nos. WO 98/14181, WO 98/17679, WO 98/17679, WO 98/22496 and WO 99/07734 and WO 05/08773 1. Further examples of HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, the following compounds: r OCH 3 * H 0 00 0- 0 N H 000 N N N O. N 0 H N 000Oi NJ N

OCH

3 N N NN N NN N O H 0 0 O O H 0NN OOCH N N H 07 ON0 00 WO 2012/041014 67 PCT/CN2011/001638 HH NH 2 NH 0 0 SNHH -VO OH HH NH OH H H O 0H ±H H H 0H HN N H H - 0 J jV %~~ WO 2012/041014 PCT/CN2011/001638 68 ci ci H H H H H O N 00 O N 00, H H OO O O,. yN 0 0 ON NH 0 O NH N NH %HHand 0 H 0 H HN I) H

-

0 NH 0 Y Y 0 OYKWNH 00 HyN y H NHO$NH YArK Viral replication inhibitors useful in the present compositions and methods include, but are not limited to, HCV replicase inhibitors, IRES inhibitors, NS4A inhibitors, NS3 helicase inhibitors, NS5A inhibitors, NS5B inhibitors, ribavirin, AZD-2836 (Astra Zeneca), BMS-790052 (Bristol-Myers Squibb, see Gao et al., Nature,_465:96-100 (2010)), viramidine, A-831 (Arrow Therapeutics); an antisense agent or a therapeutic vaccine.

WO 2012/041014 PCT/CN2011/001638 69 HCV NS4A inhibitors useful in the useful in the present compositions and methods include, but are not limited to, those disclosed in U.S. Patent Nos. 7,476,686 and 7,273,885; U.S. Patent Publication No. US20090022688; and International Publication Nos. WO 2006/019831 and WO 2006/019832. Additional HCV NS4A inhibitors useful in the useful in the present compositions and methods include, but are not limited to, AZD2836 (Astra Zeneca) and ACH-806 (Achillon Pharmaceuticals, New Haven, CT). HCV replicase inhibitors useful in the useful in the present compositions and methods include, but are not limited to, those disclosed in U.S. Patent Publication No. US20090081636. Therapeutic vaccines useful in the present compositions and methods include, but are not limited to, IC41 (Intercell Novartis), CSL 123 (Chiron/CSL), GI 5005 (Globeimmune), TG-4040 (Transgene), GNI-103 (GENimmune), Hepavaxx C (ViRex Medical), ChronVac-C (Inovio/Tripep), PeviPROTM (Pevion Biotect), HCV/MF59 (Chiron/Novartis) and Civacir (NABI). Examples of further additional therapeutic agents that may be useful in the present compositions and methods include, but are not limited to, Ritonavir (Abbott), TT033 (Benitec/Tacere Bio/Pfizer), Sirna-034 (Sirna Therapeutics), GNI 104 (GENimmune), GI-5005 (GlobeImmune), IDX-102 (Idenix), Levovirin"m (ICN Pharmaceuticals, Costa Mesa, California); Humax (Genmab), ITX-2155 (Ithrex/Novartis), PRO 206 (Progenics), HepaCide-I (NanoVirocides), MX3235 (Migenix), SCY-635 (Scynexis); KPE02003002 (Kemin Pharma), Lenocta (VioQuest Pharmaceuticals), IET - Interferon Enhancing Therapy (Transition Therapeutics), Zadaxin (SciClone Pharma), VP 50406M (Viropharma, Incorporated, Exton, Pennsylvania); Taribavirin (Valeant Pharmaceuticals); Nitazoxanide (Romark); Debio 025 (Debiopharm); GS-9450 (Gilead); PF-4878691 (Pfizer); ANA773 (Anadys); SCV-07 (SciClone Pharmaceuticals); NIM-881 (Novartis); ISIS 14803' (ISIS Pharmaceuticals, Carlsbad, California); Heptazymem (Ribozyme Pharmaceuticals, Boulder, Colorado); Thymosins (SciClone Pharmaceuticals, San Mateo, California); Maxaminem (Maxim Pharmaceuticals, San Diego, California); NKB-122 (JenKen Bioscience Inc., North Carolina); Alinia (Romark Laboratories), INFORM-I (a combination of R7128 and ITMN-191); and mycophenolate mofetil (Hoffman LaRoche, Nutley, New Jersey).

WO 2012/041014 PCT/CN2011/001638 70 The doses and dosage regimen of the other agents used in the combination therapies of the present invention for the treatment or prevention of HCV infection can be determined by the attending clinician, taking into consideration the approved doses and dosage regimen in the package insert; the age, sex and general health of the patient; and the type and severity of the viral infection or related disease or disorder. When administered in combination, the Tetracyclic Indole Derivative(s) and the other agent(s) can be administered simultaneously (i.e., in the same composition or in separate compositions one right after the other) or sequentially. This particularly useful when the components of the combination are given on different dosing schedules, e.g., one component is administered once daily and another component is administered every six hours, or when the preferred pharmaceutical compositions are different, e.g., one is a tablet and one is a capsule. A kit comprising the separate dosage forms is therefore advantageous. Generally, a total daily dosage of the at least one Tetracyclic Indole Derivative(s) alone, or when administered as combination therapy, can range from about 1 to about 2500 mg per day, although variations will necessarily occur depending on the target of therapy, the patient and the route of administration. In one embodiment, the dosage is from about 10 to about 1000 mg/day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dosage is from about 1 to about 500 mg/day, administered in a single dose or in 2-4 divided doses. In still another embodiment, the dosage is from about 1 to about 100 mg/day, administered in a single dose or in 2-4 divided doses. In yet another embodiment, the dosage is from about 1 to about 50 mg/day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dosage is from about 500 to about 1500 mg/day, administered in a single dose or in 2-4 divided doses. In still another embodiment, the dosage is from about 500 to about 1000 mg/day, administered in a single dose or in 2 4 divided doses. In yet another embodiment, the dosage is from about 100 to about 500 mg/day, administered in a single dose or in 2-4 divided doses. In one embodiment, when the additional therapeutic agent is INTRON A interferon alpha 2b (commercially available from Schering-Plough Corp.), this agent is administered by subcutaneous injection at 3MIU(12 mcg)/0.5mL/TIW for 24 weeks or 48 weeks for first time treatment. In another embodiment, when the additional therapeutic agent is PEG INTRON interferon alpha 2b pegylated (commercially available from Schering- WO 2012/041014 PCT/CN2011/001638 71 Plough Corp.), this agent is administered by subcutaneous injection at 1.5 mcg/kg/week, within a range of 40 to 150 mcg/week, for at least 24 weeks. In another embodiment, when the additional therapeutic agent is ROFERON A interferon alpha 2a (commercially available from Hoffmann-La Roche), this agent is administered by subcutaneous or intramuscular injection at 3MIU(l 1.1 mcg/mL)/TIW for at least 48 to 52 weeks, or alternatively 6MIU/TIW for 12 weeks followed by 3MIU/TIW for 36 weeks. In still another embodiment, when the additional therapeutic agent is PEGASUS interferon alpha 2a pegylated (commercially available from Hoffmann-La Roche), this agent is administered by subcutaneous injection at 180 mcg/1mL or 180 mcg/0.5mL, once a week for at least 24 weeks. In yet another embodiment, when the additional therapeutic agent is INFERGEN interferon alphacon- 1 (commercially available from Amgen), this agent is administered by subcutaneous injection at 9 mcg/TIW is 24 weeks for first time treatment and up to 15 mcg/TIW for 24 weeks for non-responsive or relapse treatment. In a further embodiment, when the additional therapeutic agent is Ribavirin (commercially available as REBETOL ribavirin from Schering-Plough or COPEGUS ribavirin from Hoffmann-La Roche), this agent is administered at a daily dosage of from about 600 to about 1400 mg/day for at least 24 weeks. In one embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from: an interferon, an immunomodulator, a viral replication inhibitor, an antisense agent, a therapeutic vaccine, a viral polymerase inhibitor, a nucleoside inhibitor, a viral protease inhibitor, a viral helicase inhibitor, a viral polymerase inhibitor a virion production inhibitor, a viral entry inhibitor, a viral assembly inhibitor, an antibody therapy (monoclonal or polyclonal), and any agent useful for treating an RNA dependent polymerase-related disorder. In another embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV protease inhibitor, an HCV polymerase inhibitor, an HCV replication inhibitor, a nucleoside, an interferon, a pegylated interferon and ribavirin. The combination therapies can include any combination of these additional therapeutic agents.

WO 2012/041014 PCT/CN2011/001638 72 In another embodiment, one or more compounds of the present invention are administered with one additional therapeutic agent selected from an HCV protease inhibitor, an interferon, a pegylated interferon and ribavirin. In still another embodiment, one or more compounds of the present invention are administered with two additional therapeutic agents selected from an HCV protease inhibitor, an HCV replication inhibitor, a nucleoside, an interferon, a pegylated interferon and ribavirin. In another embodiment, one or more compounds of the present invention are administered with an HCV protease inhibitor and ribavirin. In another specific embodiment, one or more compounds of the present invention are administered with a pegylated interferon and ribavirin. In another embodiment, one or more compounds of the present invention are administered with three additional therapeutic agents selected from an HCV protease inhibitor, an HCV replication inhibitor, a nucleoside, an interferon, a pegylated interferon and ribavirin. In one embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor. In another embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor. In another embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and ribavirin. In one embodiment, one or more compounds of the present invention are administered with one additional therapeutic agent selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor. In another embodiment, one or more compounds of the present invention are administered with ribavirin. In one embodiment, one or more compounds of the present invention are administered with two additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon, and a viral replication inhibitor.

WO 2012/041014 PCT/CN2011/001638 73 In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and another therapeutic agent. In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and another therapeutic agent, wherein the additional therapeutic agent is selected from an HCV polymerase inhibitor, a viral protease inhibitor, and a viral replication inhibitor. In still another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and a viral protease inhibitor. In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and an HCV protease inhibitor. In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and boceprevir or telaprevir. In a further embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and an HCV polymerase inhibitor. In another embodiment, one or more compounds of the present invention are administered with pegylated-interferon alpha and ribavirin. In one embodiment, one or more compounds of the present invention are administered with from one to three additional therapeutic agents, wherein the additional therapeutic agents are each independently selected from HCV protease inhibitors, HCV NS5A inhibitors and HCV NS5B polymerase inhibitors. In one embodiment, one or more compounds of the present invention are administered with MK-5172. In another embodiment, one or more compounds of the present invention are administered with MK-7009. In another embodiment, one or more compounds of the present invention are administered with boceprevir. In still another embodiment, one or more compounds of the present invention are administered with telaprevir. In another embodiment, one or more compounds of the present invention are administered with PSI-938. In another embodiment, one or more compounds of the present invention are administered with PSI-7977.

WO 2012/041014 PCT/CN2011/001638 74 In yet another embodiment, one or more compounds of the present invention are administered with RG-7128. In one embodiment, one or more compounds of the present invention are administered with (i) a compound selected from PSI-7977, PSI-938 RG-7128; and (ii) a compound selected from boceprevir, telaprevir, MK-7009 and MK-5172. In another embodiment, one or more compounds of the present invention are administered with PSI-7977 and MK-5172. Compositions and Administration Due to their activity, the Tetracyclic Indole Derivatives are useful in veterinary and human medicine. As described above, the Tetracyclic Indole Derivatives are useful for treating or preventing HCV infection in a patient in need thereof. When administered to a patient, the Tetracyclic Indole Derivatives can be administered as a component of a composition that comprises a pharmaceutically acceptable carrier or vehicle. The present invention provides pharmaceutical compositions comprising an effective amount of at least one Tetracyclic Indole Derivative and a pharmaceutically acceptable carrier. In the pharmaceutical compositions and methods of the present invention, the active ingredients will typically be administered in admixture with suitable carrier materials suitably selected with respect to the intended form of administration, i.e., oral tablets, capsules (either solid-filled, semi-solid filled or liquid filled), powders for constitution, oral gels, elixirs, dispersible granules, syrups, suspensions, and the like, and consistent with conventional pharmaceutical practices. For example, for oral administration in the form of tablets or capsules, the active drug component may be combined with any oral non-toxic pharmaceutically acceptable inert carrier, such as lactose, starch, sucrose, cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, talc, mannitol, ethyl alcohol (liquid forms) and the like. Solid form preparations include powders, tablets, dispersible granules, capsules, cachets and suppositories. Powders and tablets may be comprised of from about 0.5 to about 95 percent inventive composition. Tablets, powders, cachets and capsules can be used as solid dosage forms suitable for oral administration. Moreover, when desired or needed, suitable binders, lubricants, disintegrating agents and coloring agents may also be incorporated in the mixture.

WO 2012/041014 PCT/CN2011/001638 75 Suitable binders include starch, gelatin, natural sugars, corn sweeteners, natural and synthetic gums such as acacia, sodium alginate, carboxymethylcellulose, polyethylene glycol and waxes. Among the lubricants there may be mentioned for use in these dosage forms, boric acid, sodium benzoate, sodium acetate, sodium chloride, and the like. Disintegrants include starch, methylcellulose, guar gum, and the like. Sweetening and flavoring agents and preservatives may also be included where appropriate. Liquid form preparations include solutions, suspensions and emulsions and may include water or water-propylene glycol solutions for parenteral injection. Liquid form preparations may also include solutions for intranasal administration. Aerosol preparations suitable for inhalation may include solutions and solids in powder form, which may be in combination with a pharmaceutically acceptable carrier, such as an inert compressed gas. Also included are solid form preparations which are intended to be converted, shortly before use, to liquid form preparations for either oral or parenteral administration. Such liquid forms include solutions, suspensions and emulsions. For preparing suppositories, a low melting wax such as a mixture of fatty acid glycerides or cocoa butter is first melted, and the active ingredient is dispersed homogeneously therein as by stirring. The molten homogeneous mixture is then poured into convenient sized molds, allowed to cool and thereby solidify. Additionally, the compositions of the present invention may be formulated in sustained release form to provide the rate controlled release of any one or more of the components or active ingredients to optimize therapeutic effects, i.e., antiviral activity and the like. Suitable dosage forms for sustained release include layered tablets containing layers of varying disintegration rates or controlled release polymeric matrices impregnated with the active components and shaped in tablet form or capsules containing such impregnated or encapsulated porous polymeric matrices. In one embodiment, the one or more Tetracyclic Indole Derivatives are administered orally. In another embodiment, the one or more Tetracyclic Indole Derivatives are administered intravenously. In another embodiment, the one or more Tetracyclic Indole Derivatives are administered topically.

WO 2012/041014 PCT/CN2011/001638 76 In still another embodiment, the one or more Tetracyclic Indole Derivatives are administered sublingually. In one embodiment, a pharmaceutical preparation comprising at least one Tetracyclic Indole Derivative is in unit dosage form. In such form, the preparation is subdivided into unit doses containing effective amounts of the active components. Compositions can be prepared according to conventional mixing, granulating or coating methods, respectively, and the present compositions can contain, in one embodiment, from about 0.1% to about 99% of the Tetracyclic Indole Derivative(s) by weight or volume. In various embodiments, the present compositions can contain, in one embodiment, from about 1% to about 70% or from about 5% to about 60% of the Tetracyclic Indole Derivative(s) by weight or volume. The quantity of Tetracyclic Indole Derivative in a unit dose of preparation may be varied or adjusted from about I mg to about 2500 mg. In various embodiments, the quantity is from about 10 mg to about 1000 mg, 1 mg to about 500 mg, 1 mg to about 100 mg, and 1 mg to about 100 mg. For convenience, the total daily dosage may be divided and administered in portions during the day if desired. In one embodiment, the daily dosage is administered in one portion. In another embodiment, the total daily dosage is administered in two divided doses over a 24 hour period. In another embodiment, the total daily dosage is administered in three divided doses over a 24 hour period. In still another embodiment, the total daily dosage is administered in four divided doses over a 24 hour period. The amount and frequency of administration of the Tetracyclic Indole Derivatives will be regulated according to the judgment of the attending clinician considering such factors as age, condition and size of the patient as well as severity of the symptoms being treated. Generally, a total daily dosage of the Tetracyclic Indole Derivatives range from about 0.1 to about 2000 mg per day, although variations will necessarily occur depending on the target of therapy, the patient and the route of administration. In one embodiment, the dosage is from about 1 to about 200 mg/day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dosage is from about 10 to about 2000 mg/day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dosage is from about 100 to about 2000 mg/day, administered in a single dose or in 2-4 divided doses. In still another WO 2012/041014 PCT/CN2011/001638 77 embodiment, the dosage is from about 500 to about 2000 mg/day, administered in a single dose or in 2-4 divided doses. The compositions of the invention can further comprise one or more additional therapeutic agents, selected from those listed above herein. Accordingly, in one embodiment, the present invention provides compositions comprising: (i) at least one Tetracyclic Indole Derivative or a pharmaceutically acceptable salt thereof; (ii) one or more additional therapeutic agents that are not a Tetracyclic Indole Derivative; and (iii) a pharmaceutically acceptable carrier, wherein the amounts in the composition are together effective to treat HCV infection. In one embodiment, the present invention provides compositions comprising a Compound of Formula (I) and a pharmaceutically acceptable carrier. In another embodiment, the present invention provides compositions comprising a Compound of Formula (I), a pharmaceutically acceptable carrier, and a second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators, and anti-infective agents. In another embodiment, the present invention provides compositions comprising a Compound of Formula (I), a pharmaceutically acceptable carrier, and wto additional therapeutic agents, each of which are independently selected from the group consisting of HCV antiviral agents, immunomodulators, and anti-infective agents. Kits In one aspect, the present invention provides a kit comprising a therapeutically effective amount of at least one Tetracyclic Indole Derivative, or a pharmaceutically acceptable salt, solvate, ester or prodrug of said compound and a pharmaceutically acceptable carrier, vehicle or diluent. In another aspect the present invention provides a kit comprising an amount of at least one Tetracyclic Indole Derivative, or a pharmaceutically acceptable salt, solvate, ester or prodrug of said compound and an amount of at least one additional therapeutic agent listed above, wherein the amounts of the two or more active ingredients result in a desired therapeutic effect. In one embodiment, the one or more Tetracyclic Indole Derivatives and the one or more additional therapeutic agents are provided in the same container. In one embodiment, the one or more WO 2012/041014 PCT/CN2011/001638 78 Tetracyclic Indole Derivatives and the one or more additional therapeutic agents are provided in separate containers.

WO 2012/041014 PCT/CN2011/001638 79 EXAMPLES General Methods Solvents, reagents, and intermediates that are commercially available were used as received. Reagents and intermediates that are not commercially available were prepared in the manner as described below. 'H NMR spectra when reported, were obtained on either a Varian VNMR System 400 (400 MHz) or a Bruker Avance 500 (500 MHz) and resonances are reported as ppm downfield from Me4Si with number of protons, multiplicities, and coupling constants in Hertz indicated parenthetically. Where LC/MS data are presented, analyses was performed using an Agilent 61 10A MSD or an Applied Biosystems API-100 mass spectrometer and Shimadzu SCL-1OA LC column: Alltech platinum C18 column, 3 micron, 33 mm x 7mm ID; typical gradient flow: 0 minutes 10% CH 3 CN, 5 minutes - 95% CH 3 CN, 5-7 minutes - 95% CH 3 CN, 7 minutes - stop. The retention time and observed parent ion are given. Chromatography was performed using partially automated systems manufactured by Gilson, ISCO or Biotage. Unless otherwise indicated, chromatography was performed using a gradient elution of hexanes/ethyl acetate, from 100% hexanes to 100% ethyl acetate. EXAMPLE 1 Preparation of Compound Int-la HO A NH2 H OMe O O Int-la To a solution of L-valine (10.0 g, 85.3 mmol) in IM aqueous NaOH solution (86 mL) at room temperature was added solid sodium carbonate (4.60 g, 43.4 mmol). The reaction mixture was cooled to 0 *C (ice bath) and then methyl chloroformate (7.20 mL, 93.6 mmol) was added dropwise over 20 minutes. The reaction mixture was then allowed to warm to room temperature, and allowed to stir at room temperature for an additional 4 hours. The reaction mixture was then diluted with diethyl WO 2012/041014 PCT/CN2011/001638 80 ether (100 mL), the resulting solution was cooled to at 0 *C, and then concentrated hydrochloric acid (18 mL, 216 mmol) was added slowly. The reaction was extracted with EtOAc (3 x 100 mL) and the combined organics were dried over MgSO 4 , filtered and concentrated in vacuo to provide Compound Int-la (13.5 g, 90%), which was used without further purification. The following intermediates can be prepared by the reaction of L-valine or L- threonine with isopropyl chloroformate, 2-methoxyethyl chloroformate or with 1 methylcyclopropyl hydroxysuccinimide respectively as above. O0 HHOOO 0OCH 3 Int-lb Int-Ic O MeO ,- O NI'> H Int-ld Int-le EXAMPLE 2 Preparation of Intermediate Compound Int-2a 0 N HO NkOMe O 0 H Int-2a To a solution of D-phenylglycine (10.0 g, 66.1 mmol) and NaOH (21.2 g, 265 mmol) in water (60 mL) at 0 'C was added methyl chloroformate (10.2 mL, 133 mmol) dropwise over 20 minutes. The resulting mixture was allowed to stir at 0 *C for 1 hour, then was acidified using concentrated hydrochloric acid (25 mL, 300 mmol). The acidic solution was extracted with EtOAc (3 x 100 mL) and the combined organics were WO 2012/041014 PCT/CN2011/001638 81 dried over MgSO 4 , filtered and concentrated in vacuo to provide Compound Int-2a (12.6 g, 9 1%), which was used without further purification. The following intermediates can be prepared by the reaction of glycine, L-Alanine and 4 F phenylglycine respectively with methyl chloroformate (Aldrich Inc.) using the method described above: F 0 0 O O O OANH H 0I 0 H Int- 2b Int-2c Int-2d EXAMPLE 3 Preparation of Intermediate Compound Int-3a H NH 2 HO 0 01 Int-3a A solution of D-phenylglycine (20.0 g, 132 mmol), 37% aqueous formaldehyde (66 mL, 814 mmol) and 5 % Pd on carbon (8.0 g, mmol) in a mixture of methanol (80 mL) and 1 N HCI (60 mL) was placed on a hydrogenation shaker and shook under an atmosphere of 35-40 psi hydrogen for 4 hours. The reaction was then flushed with nitrogen, filtered through a Celite pad and concentrated in vacuo to provide Compound Int-3a (29.7 g, quant.) as a white solid, which was used without further purification. EXAMPLE 3A WO 2012/041014 PCT/CN2011/001638 82 F F Na* 0 ~H 3 B N H+ H

NH

2 N O O Int-3b Int-3c To a solution of (R)-2-amino-2-(4-fluorophenyl)acetic acid (Int 3b) in MeOH (20 mL) at 0 'C was added sodium cyanoborohydride portionwise over ~ 20 minutes. The resulting mixture was allowed to stir for 10 minutes and then acetaldehyde was added dropwise via syringe over -10 minutes. The resulting solution was allowed to stir for 1 hour at 0 'C, and then allowed to warm to room temperature. After 12h, LC-MS indicated disappearance of Int-3b, and the mixture was recooled to 0 *C, carefully treated with water (3 mL) followed by addition of conc HCI over -40 minutes (pH -2.0). The cooling bath was removed and the mixture was allowed to stand for about 15 hours. The precipitate was collected by filtration to provide Int-3c. Intermediate Int-3d can be prepared using the procedure above from R Phenyl glycine. Na* 0 -H 3 B N + ~AH T HO (R NH HO (R) N 0 0) Phenylglycine Int-3d EXAMPLE 4 Preparation of Intermediate Compound Int-4f WO 2012/041014 PCT/CN2011/001638 83

P(O)(OCH

3

)

2 H3C NCBz OL H (S,-MeBPE)Rh)*BF4 1. Pd/C,

H

2 NH H 3 C NCBz H3C NCBz N N O H H2 (50 psi), MeOH H Int-4a I | Int-4b Int-4c 1. CI(CO)OCH 3 O LiOH H3CO., NH2 : H3CO OCH3 HNHOCH3 Int-4d Int-4e Int-4f Step A - Preparation of Compound Int-4b To a solution of methyl 2-(benzyloxycarbonylamino)-2 (dimethoxyphosphoryl) acetate (10.0 g, 30.2 mmol, made as decribed in Hamada et al., Organic Letters; English, 20:4664-4667 (2009)) in THF (100 mL) at -20 'C was added tetramethylguanidine (4.20 mL, 33.2 mmol). The reaction mixture was allowed to stir at -20 'C for 1 hour then dihydro-2H-pyran-4(3H)-one (4a) was added (3.1 mL, 33.2 mmol) in THF (5 mL) and the reaction mixture was warmed to room temperature and allowed to stir for about 15 hours. EtOAc (200 mL) was added and the organic mixture was washed with water (3 x 50 mL) and brine (50 mL). The organic layers were combined and dried with Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using flash chromatography on an ISCO 330 g Redi-Sep column using 0 35% EtOAc/hexanes as the eluent to provide Compound Int-4b as a white solid (615 mg, 45%). 1 H NMR (CDC 3 ) 5 7.40 7.30 (in, 5H), 6.00 (br s, 1H), 5.12 (s, 2H), 3.80 3.65 (in, 7H), 2.92 (in, 2H), 2.52 2.48 (m, 2H). Step B - Preparation of Compound Int-4c To a solution of Int-4b (2.43 g, 7.96 mmol) in methanol (160 mL) previously purged with N 2 was added (-)-1,2-Bis((2S,5S)-2,5-dimethylphospholano) WO 2012/041014 PCT/CN2011/001638 84 ethane (cyclooctadiene)rhodium(I) tetrafluoroborate (487 mg, 0.880 mmol) under N 2 . The mixture was shaken in a Parr shaker apparatus for 18 hours at 50 psi of H 2 . After evacuating the hydrogen, the suspension was filtered and the filtrate was concentrated in vacuo to provide Compound Int-4c as a white solid (1.30 g, 53%). 'H NMR (CDCl 3 ) 5 7.40 7.30 (in, 5H), 5.32 (br s, 1H), 5.12 (s, 2H), 4.40 4.30 (in, 1H), 4.00 3.95 (m, 2H), 3.75 (s, 3H), 3.40 3.25 (m, 2H), 2.10 1.95 (in, 1H), 1.50 1.45 (in, 4H). Step C - Preparation of Compound Int-4d To a suspension of 50% palladium on carbon (10% wet, 200 mg) in absolute ethanol (20 mL) under nitrogen was added Int-4c (1.06 g, 3.45 mmol). With stirring, the solution was placed in vacuo for 30 seconds and then was opened to a hydrogen gas balloon for 2 hours. After evacuating the hydrogen, the suspension was filtered through a Celite pad and the pad was washed with ethanol (2 x 20 mL). The filtrate was concentrated in vacuo to provide Compound Int-4d as a colorless oil (585 mg, 98%). 'H NMR (CDCl 3 ) 6 4.06 3.96 (in, 2H), 3.73 (s, 3H), 3.48 3.28 (m, 3H), 1.92 1.78 (m, IH), 1.61 1.47 (m, 6H). Step D - Preparation of Compound Int-4e To a solution of Compound Int-4d (585 mg, 3.37 mmol) and triethylamine (0.710 mL, 5.09 mmol) in CH 2 Cl 2 (6 mL) was added methyl chloroformate (0.290 mL, 3.76 mmol). The reaction was allowed to stir at room temperature for about 15 hours, then water (15 mL) was added and the aqueous mixture was extracted with

CH

2 Cl 2 (3 x 20 mL). The combined organic extracts were dried over Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using flash chromatography on an ISCO 24 g Redi-Sep column using 0 3% MeOH/CH 2 C1 2 as the eluent to provide Compound Int-4e as a colorless oil (600 mg, 77%). 'H NMR (CDCl 3 ) 8 5.27 5.18 (in, 1H), 4.38 4.28 (in, IH), 4.06 3.96 (in, 2H), 3.75 (s, 3H), 3.69 (s, 3H), 3.39 3.30 (m, 2H), 2.09 1.94 (in, IH), 1.59 1.48 (m, 4H). Step E - Preparation of Compound Int-4f WO 2012/041014 PCT/CN2011/001638 85 To a solution of Compound Int-4e (600 mg, 2.59 mmol) in THF (5 mL) was added lithium hydroxide monohydrate (218 mg, 5.19 mmol) in water (5 mL). The reaction was allowed to stir at room temperature for 2 hours then was concentrated in vacuo to half of its original volume. The concentrated mixture was then acidified with 6N HCl and extracted with EtOAc (7 x 50 mL). The combined organic extracts were dried over Na 2

SO

4 , filtered and concentrated in vacuo to provide Compound Int-4f as an off-white solid (485 mg, 86%). 1 H NMR (CD 3 0D) 8 4.09 4.07 (in, 111), 3.96 3.92 (in, 2H), 3.65 (s, 3H), 3.40 3.34 (in, 2H), 2.10 1.99 (in, 1H), 1.56 1.47 (in, 4H). EXAMPLE 5 Preparation of Intermediate Compound Int-5f

P(O)(OCH

3

)

2 BocBz Boc Boc Boc Ho NN N N 0 (S,S-Me-BPE)- N Pd/C, H2 Rh)*BF 4 - Pd, Ha a NH H 3 CO ,CBz H 3 CO NCBz H3CO NH2 N N 0 H H2 (50 psi), MeOH IN 0 Int-5a Int-5b Int-5c Boc Ac Ac INNN

CI(CO)OCH

3 1. A a LiOH -.. H 3 CO NA-OCH 3 H3C N OCH 3 HO NOCH 3 0 0H Int-5d Int-5e Int-5f Step A - Preparation of Compound Int-Sa To a solution of methyl 2-(benzyloxycarbonylamino)-2 (dimethoxyphosphoryl) acetate (1.50 g, 4.52 mmol) in THF (5 mL) at -20 'C was added tetramethylguanidine (625 pL, 4.98 mmol). The reaction mixture was allowed to stir at 20 'C for 1 hour then tert-butyl 4-oxopiperidine-1-carboxylate was added (992 mg, 4.97 mmol) in THF (2 mL) and the reaction mixture was warmed to room temperature and allowed to stir for about 15 hours. EtOAc (90 mL) was added and the organic mixture was washed with water (3 x 20 mL) and brine (25 mL). The combined organic extracts WO 2012/041014 PCT/CN2011/001638 86 were dried over Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using flash chromatography on an ISCO 40 g Redi-Sep column using 0 35% EtOAc/hexanes as the eluent to provide Compound Int-5a as a white semi-solid (1 .1 g, 61%). 'H NMR (CDCl 3 ) 5 7.40 7.30 (in, 5H), 6.02 (br s, 1H), 5.12 (s, 2H), 3.80 3.40 (in, 7H), 2.90 2.80 (in, 2H), 2.45 2.35 (in, 2H), 1.45 (s, 9H). Step B - Preparation of Compound Int-5b To a solution of Int-5a (1.30 g, 3.21 mmol) in methanol (90 mL) previously purged with N 2 was added (-)-1,2-Bis((2S,5S)-2,5-dimethylphospholano) ethane(cyclooctadiene)rhodium(I) tetrafluoroborate (197 mg, 0.3 54 mmol) under N 2 . The mixture was then shaken in a Parr shaker apparatus for 18 hours at 50 psi of H 2 . After evacuating the hydrogen, the suspension was filtered and the filtrate was concentrated in vacuo to provide Compound Int-5b as colorless oil (1.00 g, 77%). 1 H NMR (CDCl 3 ) 8 7.40 7.30 (in, 5H), 5.35 5.25 (in, 1H), 5.10 (s, 2H), 4.40 4.35 (in, 1H), 4.20 4.10 (in, 2H), 3.70 (s, 3H), 2.70 2.55 (in, 2H), 2.00 1.90 (in, 1H), 1.65 1.40 (in, 11H), 1.30 1.20 (in, 2H). Step C - Preparation of Compound Int-5c To a solution of 50% palladium on carbon (10% wet, 250 mg) in absolute ethanol (20 mL) under nitrogen was added Int-5b (1.00 g, 2.46 mmol). The reaction was evacuated, then put under an H2 atmosphere using a hydrogen-filled balloon and allowed to stir for 2 hours. The hydrogen was evacuated and the resulting suspension was filtered through a Celite pad and the pad washed with ethanol (2 x 20 mL). The filtrate and ethanol washings were combined and concentrated in vacuo to provide Compound Int-5c as a colorless oil (670 mg, quant.). 1H NMR (CDCl 3 ) 8 4.21 4.08 (in, 2H), 3.73 (s, 3H), 3.31 (d, J= 6.0 Hz, 1H), 2.75 2.57 (m, 2H), 1.84 1.70 (in, 1H), 1.68 1.56 (m, 1H), 1.45 (s, 9H), 1.45 1.20 (in, 5H). Step D - Preparation of Compound Int-5d To a solution of Compound Int-5c (670 mg, 2.46 mmol) and triethylamine (0.520 mL, 3.73 mmol) in CH 2 Cl 2 (10 mL) was added methyl chloroformate (0.210 mL, WO 2012/041014 PCT/CN2011/001638 87 2.72 mmol). The reaction mixture was allowed to stir at room temperature for about 15 hours. Water (20 mL) was added and the aqueous mixture was extracted with CH 2 Cl 2 (2 x 15 mL). The combined organic extracts were dried over Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using flash chromatography on an ISCO 24 g Redi-Sep column using 0 3% MeOH/CH 2

CI

2 as the eluent to provide Compound Int-5d as an off-white solid (515 mg, 63%). '1H NMR (CDC1 3 ) 8 5.26 5.17 (m, 111), 4.38 4.30 (m, 1H), 4.20 4.07 (m, 2H), 3.75 (s, 3H), 3.68 (s, 3H), 2.71 2.57 (m, 2H), 2.00 1.85 (m, 1H), 1.87 1.48 (m, 2H), 1.44 (s, 9H), 1.35 1.18 (m, 2H). Step E - Preparation of Compound Int-5e Compound Int-5d (300 mg, 0.908 mmol) was dissolved in a mixture of TFA (2 mL) and CH 2 Cl 2 (10 mL) and the solution was allowed to stir at room temperature for 1 hour, then was concentrated in vacuo. To the resulting residue was added triethylamine (0.760 mL, 5.45 mmol) in CH 2 Cl 2 (10 mL), then acetic anhydride (0.086 mL, 0.915 mmol). The reaction was allowed to stir at room temperature for about 15 hours then concentrated in vacuo. The residue obtained was purified using flash chromatography on an ISCO 12 g Redi-Sep column using 0 4% MeOH/CH 2

CI

2 as the eluent to provide Compound Int-Se as colorless oil (247 mg, 99%). '1H NMR (CDCl 3 ) 6 5.27 5.21 (m, 1H), 4.73 4.62 (m, 1H), 4.42 4.32 (m, 1H), 3.69 (s, 3H), 3.18 (s, 3H), 3.18 3.09 (m, 1H), 3.07 2.95 (m ,1H), 2.55 2.41 (m, 1H), 2.07 (s, 3H), 1.78 1.49 (m, 3H), 1.38 1.21 (m, 2H). Step F - Preparation of Compound Int-5f To a solution of Compound Int-5e (247 mg, 2.59 mmol) in THF (3 mL) was added lithium hydroxide monohydrate (77 mg, 1.83 mmol) in water (3 mL). The reaction mixture was allowed to stir at room temperature for about 15 hours then concentrated in vacuo to 50% of its original volume. The concentrated solution was then acidified with IN HCl to pH 4 and extracted with EtOAc (7 x 15 mL). The combined organic extracts were dried over Na 2

SO

4 , filtered and concentrated in vacuo to provide Compound Int-5f as an off-white solid (106 mg, 45%). '1H NMR (CD 3 0D) 6 5.52 5.43 WO 2012/041014 PCT/CN2011/001638 88 (I, 1H), 4.71 4.62 (m, 1H), 4.44 4.31 (m, IH), 3.91 3.81 (M, 1H), 3.70 (s, 3H), 3.12 2.99 (m, 1H), 2.58 2.46 (m, 1H), 2.10 (m, 4H), 1.86 1.54 (m, 2H), 1.50 1.21 (m, 3H). EXAMPLE 6 Preparation of Intermediate Compound Int-6f OH Me EtO OH OEt H-,N0 Z15.- k N 0 HN PPTS, benzene EtOMe

INBF

3 *OEt 2 -M reflux 0 / TFA, -78 *C Int-6a Int-6b Int-6c exo: endo 9:1 O~t O~t H2, Pd/C Boc20 EtOAc, EtOH NH 0 (j N Opsat. Na 2

CO

3 (l THF, O*C to rt Boc Int-6d Int-6e OH LiOH-H 2 0

H

2 0, THF 0 Boc Int-6f Step A - Preparation of Compound Int-6c OE (S) N 0 ",Me exo :endo 9 : 1 Int-6c A stirred mixture of D-(+)-a-methylbenzyl amine Int-6a (50.0 g, 0.412 mol), ethyl glyoxylate (81.5 mL, 50% in toluene, 0.412 mol) and PPTS (0.50 g, 2.00 mmol) in benzene (600 mL) was heated to reflux in a Dean-Stark apparatus and allowed to remain at reflux until no further water (~8 mL) azeotroped from the reaction (- 4 hours). The resulting mixture was concentrated in vacuo to provide Compound Int-6b, WO 2012/041014 PCT/CN2011/001638 89 which was used without further purification: 1H NMR (300 MIIz, CDCl 3 ) 6 7.72 (s, 1H), 7.36 7.24 (m, 5H), 4.61 (q, J= 6.9 Hz, 1H), 4.35 (q, J= 7.2 Hz, 2H), 1.62 (d, J= 6.6 Hz, 3H), 1.34 (t, J= 7.2 Hz, 3H). To a stirred solution of crude Int-6b in methylene chloride (600 mL) at 78 'C were added the following in 10 minutesute intervals: TFA (31.0 mL, 0.416 mol), boron trifluoride etherate (51.3 mL, 0.416 mol) and freshly distilled cyclopentadiene (32.7 g, 0.494 mol). After less than 2 minutes following the addition of cyclopentadiene, the reaction mixture formed a thick brown mass, which was allowed to stir for 6 hours at -78 'C. The reaction mixture was then allowed to warm to room temperature on its own and stir for an additional 15 hours. The resulting dark brown reaction mixture was quenched with sat. aq. Na 2

CO

3 (- 900 mL) and allowed to stir for 30 minutes. The resultant suspension was filtered through a pad of Celite* and the filtrate was extracted with methylene chloride (3 x 100 mL). The combined organic extracts were washed with sat. aq. NaCI (2 x 75 mL), dried over Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using flash column chromatography (silica; 8 x 18 cm, 10% to 25% ethyl acetate/hexanes as the eluent) to provide endo Int-6c (10.9 g, 9%) as a brown oil: 'H NMR (300 MHz, CDCl 3 ) 6 7.34 7.19 (m, 5H), 6.00 5.95 (in, 1H), 4.18 (q, J= 7.1 Hz, 3H), 3.47 (s, 1H), 3.03 (s, IH), 2.97 (q, J= 6.5 Hz, 1H), 2.41 (s, 1H), 1.86 (d, J= 8.2 Hz, 1H), 1.26 (t, J= 6.6 Hz, 3H), 1.17 (t, J= 6.6 Hz, 3H). Exo Int-6c (84.3 g, 74%) was also collected as a brown oil: 'H NMR (300 MHz, CDCl 3 ) 6 7.34 7.19 (in, 5H), 6.36 6.33 (in, 1H), 6.22 6.18 (m, 1H), 4.37 (s, lH), 3.87 (q, J= 6.8 Hz, 2H), 3.10 (q, J= 6.5 Hz, 1H), 2.96 (s, 1H), 2.27 (s, 1H), 2.20 (d, J= 8.4 Hz, IH), 1.48 (d, J= 6.5 Hz, 3H), 1.01 (d, J= 7.0 Hz, 3H), 1.00 (in, IH). Step B- Representative Example for the Preparation of Compound Int-6d A mixture of exo-Int-6c (15.8 g, 0.582 mol) and 10% Pd/C (4.07 g, 50% wet) in a 1:2 mixture of EtOH/EtOAc (150 mL) was shaken for 23 hours in a Parr hydrogenation apparatus under an atmosphere of H 2 (50 psi). The reaction mixture was then filtered through Celite* and the filtrate was concentrated in vacuo. 'H NMR analysis of the residue (10.8 g) showed some aromatic resonances present. Repetition of the hydrogenation procedure using 10% Pd/C (2.0 g) provided Int-6d (10.0 g, quant.) as WO 2012/041014 PCT/CN2011/001638 90 a brown oil, which was used without further purification. 'H NMR (300 MHz, CDCl 3 ) 6 4.18 (q, J= 7.2 Hz, 3H), 3.54 (s, 1H), 3.32 (s, 1H), 2.62 (s, 1H), 2.23 (s, 1H), 1.64 1.39 (in, 5H), 1.31 1.20 (in, 4H). Step C - Preparation of Compound Int-6e To a solution of Int-6d (36.6 g, 0.236 mol) and sat. aq. Na 2

CO

3 (300 mL) in THF (600 mL) at 0 'C was added di-tert-butyl dicarbonate (59.0 g, 0.270 mol). The resulting reaction was allowed to slowly warm to room temperature with stirring over 6 hours, then was allowed to stir at room temperature for an additional 68 hours. The reaction mixture was diluted with EtOAc (250 mL) and water (250 mL) and the aqueous layer was extracted with EtOAc (2 x 200 mL). The combined organic extracts were washed with sat. aq. NaCl (2 x 75 mL), dried over Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using flash column chromatography (silica; 16 x 10 cm) using 10 20% ethyl acetate/hexanes as the eluent to provide Compound Int-6e (49.0 g, 84%) as a pale yellow oil: 'H NMR (300 MHz, CDCI 3 ) 6 4.35 (s, 0.6H), 4.22 4.10 (m, 2.4H), 3.81 (s, 0.45H), 3.71 (s, 0.55H), 2.66 (s, 1H), 1.96 1.90 (in, 1H), 1.76 1.50 (in, 3H), 1.55 1.45 (in, 5H), 1.39 (s, 5H), 1.30 1.23 (in, 4H). Step D- Preparation of Compound 2.2.1 Bicyclic Acid Intermediate Int-6f To a stirred mixture of Int-6e (49.0 g, 0.182 mmol) in 1:1 THF/water (600 mL) was added LiOH-H 2 0 (15.3 g, 0.364 mol). The reaction mixture was heated to 60 *C and allowed to stir at this temperature for 47 hours. The reaction mixture was then cooled to room temperature, concentrated in vacuo, and the residue obtained was diluted with CH 2 Cl 2 (200 mL) then acidified with 2N HCl to pH - 4. The acidic solution was extracted with CH 2 Cl 2 (4 x 100 mL) and the combined organic extracts were washed with sat. aq. NaCl (25 mL), dried over Na 2

SO

4 , filtered and concentrated in vacuo to provide Compound Int-6f, (IR, 3S, 4S)-N-Boc-2-azabicyclo[2.2.1]heptane-3-carboxylic acid (41.2 g, 93%) as an off white solid, which was used without further purification: 1H NMR (400 MHz, DMSO-d 6 ) 6 12.44 (s, 1H), 4.13 (s, 0.56H), 4.06 (s, 0.47H), 3.61 (d, J= 4.0 Hz, 1H), 2.59 (s, 1H), 1.75 1.45 (m, 5H), 1.39 (s, 4H), 1.32 (s, 5H), 1.23 (t, J= 8.4 Hz, IH); Optical Rotation: [a]D 25 -169.0' (c = 1.1, CHCl 3

).

WO 2012/041014 PCT/CN2011/001638 91 EXAMPLE 7 Preparation of Intermediate Compound Int-7h 0 O N N Br HN Int-7h Step A - Preparation of Compound Int-7b Boc Oxalyl Chloride Bo 0 O OH DMSO/NEt 3 H Int-7a Int-7b A 2 L, 3-necked round bottomed flask equipped with an overhead stirrer and a N 2 inlet was charged with a solution of oxalyl chloride (130 mL, 0.26 mol) in dichloromethane (250 mL). The solution was cooled to -78 'C, and a solution of DMSO (20 mL, 0.28 mol) in dichloromethane (30 mL) was added dropwise. After 30 minutes, a solution of (S)-N-Boc-prolinol, Int-7a (40 g, 0.20 mol) in dichloromethane (200 mL) was added dropwise. After 30 minutes, triethylamine (140 mL, 1.00 mol) was added to the solution, and the flask was transferred to an ice/water bath and allowed to stir for another 30 minutes. The reaction mixture was diluted with dichloromethane (200 mL) and washed successively with H20, IM HCl, saturated NaHCO 3 , and brine. The organic layer was dried over Na 2

SO

4 , filtered, and concentrated in vacuo to provide crude (S)-2 formyl-pyrrolidine-1-carboxylic acid tert-butyl ester, Int-7b (40 g) as oil, which was used without further purification.

WO 2012/041014 PCT/CN2011/001638 92 Step B - Preparation of Compound Int-7c 0 JO O O Hyl H > o O0 N H O N

NH

3 , H 2 0 C H Int-7b Int-7c To (S)-Boc-prolinal, Int-7b (crude, 80g, 0.4 mol) was added a solution of ammonia in MeOH (prepared from 150 mL of 7 N ammonia/MeOH and 200 mL MeOH, 1.05 mol, 260 mol%). An exotherm was noted with the internal temperature rising to 30 'C. The solution was allowed to stir for 0.5 hours at room temperature, then glyoxal (76 g, 0.52 mol, 130 mole%) was added over 5 minutes in portions, with the internal temperature rising to - 60 'C and then returning to room temperature after 1 hour. The reaction was allowed to stir for an additional 15 hours and the reaction mixture was concentrated in vacuo. The resulting residue was diluted with dichloromethane (1 L) and water (0.5 L) were added and the organic phase was washed with water (0.25 L), dried over MgSO 4 , filtered and concentrated in vacuo. The residue obtained was slurried with warm ethyl acetate (- 100 mL) and Hexane (100 mL), then was cooled and filtered. The solid obtained was washed with 30%ethyl acetate/Hexane to provide Compound Int-7c (66.2g, 70% yield). Step C - Preparation of Compound Int- 7d N NBS O O N Br N N H H Int-7c Int-7d N-Bromosuccinimide (838.4 mg, 4.71 mmol) was added in portions over 15 minutes to a cooled (ice/water) CH 2 Cl 2 (20 mL) solution of imidazole Int-7c (1.06 g, 4.50 mmol). The reaction mixture was allowed to stir for 75 minutes and concentrated in WO 2012/041014 PCT/CN2011/001638 93 vacuo to oil. The residue obtained was purified using silica-gel RPLC (Acetonitrile/ water/ 0.1% TFA) to separate the mono bromide from its dibromo analog (over bromination) and the starting material. The RPLC elute was neutralized with excess

NH

3 /MeOH, and the volatile component was removed in vacuo. The residue obtained was partitioned between CH 2 Cl 2 and water, and the aqueous layer was extracted with water. The combined organic phase was dried (MgSO 4 ), filtered, and concentrated in vacuo to provide Compound Int-7d as a white solid (374 mg). 'H NMR (DMSO) 6: 12.12 (br s, 1H), 7.10 (m, 1H), 4.70 (m, 1H), 3.31 (m, IH; overlapped with water signal), 2.25-1.73 (m, 4H), 1.39/1.17 (s, 3.8H + 5.2H). Step D - Alternative Synthesis of Int-7d Br NBS jK Br Int-7b Int-7e To a suspension of Int-7b (140 g, 0.59 mol) in THF (2000 mL) was added N-bromosuccinimide (200 g, 1.1 mol). The mixture was allowed to stir at room temperature under N 2 gas for about 15 hours. The solvent was then removed in vacuo, and the residue obtained was purified using silica-gel chromatography (ethyl acetate eluent) to provide 230 g of the desired dibromo Compound Int-7e. MS (ESI) m/e (M+H*): 396. Br Br Na 2

SO

3 QN Br ___N H H Int-7e Int-7d To a suspension of Int-7e (230 g, 0.58 mol) in EtOH/H 2 0 (1:1 ratio, 3000 mL) was added Na 2

SO

3 (733 g, 5.8 mol). The resulting mixture was allowed to stir at mild reflux for about 15 hours. After cooling to room temperature, the mixture was extracted with dichloromethane twice and the combined organic layer was concentrated WO 2012/041014 PCT/CN2011/001638 94 in vacuo to a semi-solid. The residue obtained was purified using chromatography on silica gel to provide the desired Compound Int-7d. MS (ESI) m/e (M+H+): 317. Step E - Preparation of Compound Int-7f SEM SEM CX?,,Br Br N Br Boc Boc Int-7e Int-7f Compound Int-7e (2.63 g, 5.0 mmol) was dissolved in THF (30 mL) and cooled to - 78 'C, n-BuLi (IM in hexane, 2.2 mL, 5.5 mmol) was added and the reaction was allowed to stir for 20 minutes. N-fluorodibenzenesulfonamide (1.6 mL, 5.0 mmol) was added at -78 *C and the reaction mixture was allowed to warm slowly to room temperature again. The reaction was quenched with aq. NH 4 Cl then partitioned between water and ethyl acetate. The organic layer was dried over Na 2

SO

4 and concentrated in vacuo. The residue obtained was purified using flash column chromatography (Gradient Ethyl acetate:petroleum ether from 0-20% Ethyl acetate) to provide Compound Int-7f. (63 % yield). MS (ESI) m/z (M+H) : 464, 466. 19 F NMR = 151.8 ppm. Step F - Preparation of Compound Int-7g Br Br Boc N Bo TFA Of HH Int-7d Int-7g Intermediate 7d (2.51 g, 7.94 mmol, 1.0 eq) was dissolved in 20 mL of

CH

2 Cl 2 and to the resulting solution was added trifluoroacetic acid (5 mL). The reaction mixture was allowed to stir for about 15 hours at room temperature under N 2 , and the reaction was diluted with hexanes (15 mL) and concentrated in vacuo to provide a yellow oil. CH 2

C

2 and toluene were added and the solution was re-concentrated in vacuo. This step was repeated until excess TFA was removed, giving a solid which was dried in vacuo for 1 hour to provide 3.5 g of solid Int-7g. MS (ESI) m/z (M+H)*:217/ 218.1.

WO 2012/041014 PCT/CN2011/001638 95 Step G - Preparation of Compound Int-7h Br O H) ... ~N HATU ON N Br N OMe +N H O H HN N 0 N DMF/DIPEA H Int-la Int-7g Int-7h Int-7g (3.0 1g, 6.78 mmol, 1.0 eq) and Int-la (1.202 g, 6.86 mmol, 1.01 eq) were added to a 250 mL round-bottomed flask equipped with a stir bar. DMF was added, and the flask was connected to a vacuum line. The flask was cycled between vacuum and

N

2 twice, then cooled in an ice-methanol bath for 10 minutes. HATU (2.75 g, 7.23 mmol, 1.07 eq) was added, followed by diisopropylethyl amine (2.80 mL). The reaction mixture was allowed to stir at -15 'C for 20 minutes. Additional diisopropylethyl amine (2.0 mL) was added. The reaction mixture was allowed to stir for 40 minutes, then quenched with water (1.5 mL). The resulting solution was diluted with EtOAc (100 mL) and Et 2 O (100 mL), then washed with water (6 x 15 mL) and brine (2 x 25 mL). The organic layer was dried with MgSO 4 , filtered, and concentrated in vacuo yielding 2.23 g of a clear oil. The residue obtained was purified via chromatography using an 80 g Isco Gold SiO 2 cartridge with a 0.5%-2.5% MeOH/ CH 2

CI

2 gradient as the mobile phase. The major peak was collected to provide 1.28 g Int-7h as a white foam. This material was further purified via sgc on an 80 g Isco Gold SiO 2 cartridge using a 45%-65% gradient of (5% methanol in EtOAc)/hexanes. Triethylamine 1% by volume was added to the MeOH/EtOAc solution. The fractions were assayed via TLC using Hanessian's stain. (See Example 13 below for more information on Hanessian's stain.) The major peak was collected as product to provide 1.18 g of Int-7h as a white foam. MS (ESI) m/z (M+H)*:373.1. EXAMPLE 7B Preparation of Intermediate Compound Int-7i WO 2012/041014 PCT/CN2011/001638 96 NU)-Br _ _ ) (N N~~ o J OH BrOOB 0 ,NH + I,,- N___ .0o In4 InHATU H 0 Int-4f int-79 Int-7h N-Moc-(S)-tetrahydropyranyl glycine (Int-4f) (252 mg, 1.160 mmol), Int-7g (354 mg, 1.225 mmol), DMF (6 mL), and DIPEA (0.7 mL, 4.01 mmol) were added to a 40 mL screw cap vial equipped with a stir bar. The reaction mixture was placed under a blanket of N 2 and the vial was capped. The vial was cooled in an ice methanol bath for 10 minutes. HATU (445 mg, 1.215 mmol) was added, and the reaction mixture was left stirring at -15 *C. After 3 hours, the bath temp was 10 'C. The reaction mixture was diluted with ethyl acetate and aqueous ammonium chloride. The layers were separated. The organic layer was washed with water and brine, gravity filtered, dried with MgSO4, and filtered again. The solvent was evaporated under reduced pressure on the rotovap to provide a clear oil-(458 mg). The crude product was purified via flash silica gel column chromatography on an Isco 24 g SiO 2 Gold cartridge, using a MeOH(NH 3

)/CH

2 Cl 2 gradient (0-5%) as the mobile phase to provide Int-7h as a clear oil. Weight = 246 mg Took I H NMR and LC/MS. Obsd M+H = 415.1. 0 0 -Br 0 N +'. __N___ 0H N4B OH F HATU F Int-4g Int-10g Int-7i N-Moc (S)-tetrahydropyranyl glycine Int-4f (236 mg, 1.086 mmol) and Int-10g (333 mg, 1.085 mmol), DMF (5 mL), and DIPEA (0.6 mL, 3.44 mmol) were added to a 40 mL screw cap vial equipped with a stir bar. The reaction mixture was placed under a blanket of N 2 and the vial was capped. The vial was cooled in an ice methanol bath for 15 minutes. HATU (418 mg, 1.141 mmol) was added, and the reaction mixture was left stirring at -15 *C. After 3h, the bath temp was 10 *C. The reaction mixture was diluted with ethyl acetate and water. The layers were separated. The organic WO 2012/041014 PCT/CN2011/001638 97 layer was washed with water and brine, gravity filtered, dried with MgSO4, and filtered again. The solvent was evaporated under reduced pressure on the rotovap to provide a clear oil. The crude product was dissolved in methanol and left standing at room temperature over the weekend. The reaction mixture was concentrated in vacuo. The crude product was purified via flash silica gel column chromatography on an Isco 40 g SiO 2 Gold cartridge. The column was initially eluted (mistakenly) with a 0%-50% EtOAc/hexanes gradient, then flushed with 5% (MeOH/(1%NHED(Aq.)))/CH 2 CI2.The fractions were combined to provide 0.50 g of impure product as a clear oil. The impure product was purified via flash silica gel column chromatography on an Isco 24 g SiO 2 Gold cartridge, using a 0%-5% MeOH/CH 2

C

2 gradient as the mobile phase to provide Int-7i as a clear oil-(0.306g). When a sample was dissolved in deuterated methanol, a white solid formed in the flask. Took 'H NMR and LC/MS. Obsd M+H = 433.1 EXAMPLE 8 Preparation of Intermediate Compound Int-8h

H

3 C H Br Boc Int-8h Step A - Preparation of Compound Int-8b 0 0 EtMgBr N N-0 1 N Boc Boc Int-8a Int-8b A solution of Int-8a (11.0 g, 42.6 mmol) in THF (50 mL) was cooled to 0 'C and to the cooled solution was added EtMgBr (82 mmol). After addition was complete, the cooling bath was removed and the resulting reaction was allowed to stir at room temperature for 6 hours. 3 N HCl was then added and the reaction mixture was WO 2012/041014 PCT/CN2011/001638 98 extracted with ethyl acetate (2 x 50 mL). The combined organic extracts were washed with water, brine, dried over Na 2

SO

4 , and concentrated in vacuo. The residue obtained was purified using flash column chromatography on silica gel to provide Compound Int 8b (7.5 g, 50% yield). Step B - Preparation of Compound Int-8c 00 TFA NC N Boc H Int-8b Int-8c Int-8b (7.5 g, 21.3 mmol) was dissolved in 100 mL of dichloromethane and cooled to 0 *C. TFA (100 mL) was added and the reaction was allowed to stir to room temperature over 2h. The solvent was removed and the residue obtained was redissolved in EtOAc then washed with saturated bicarbonate solution then brine. The extracts were dried over magnesium sulfate, filtered and concentrated in vacuo to provide Compound Int-8c as an oil, which was used without further purification. Step C - Preparation of Compound Int-8d 0 0 H Trt Int-8c Int-8d To a solution of Compound Int-8c(4.2 g, 33 mmol) in THF (30 mL) was added Et 3 N (4.1 g, 49 mmol) and then trityl chloride (8.7 g, 40 mmol). The mixture was allowed to stir at room temperature for 2 hours, then concentrated in vacuo. The residue obtained was purified using flash chromatography on silica gel to provide Compound Int-8d (8.7 g, 71% yield). MS (ESI) m/z (M+H)+: 370. Step D - Preparation of Compound Int-8e WO 2012/041014 PCT/CN2011/001638 99 LiHMDSB 0 0 NNBS CN Br Trityl Trityl Int-8d Int-8e To a solution of Compound Int-8d (3.6 g, 10.0 mmol) in THF (30 mL) was added LiHMDS (11.0 mmol) and then NBS (1.8 g, 10 mmol) at 0 *C. The mixture was allowed to stir at room temperature for 2 hours and then 3 N HCl was added to the mixture and the resulting solution was extracted with ethyl acetate (2 x 25 mL). The combined organic extracts were concentrated in vacuo and the residue obtained was purified using chromatography to provide Compound Int-8e (1.98 g, 44% yield). MS (ESI) m/z (M+H)*: 478, 480. Step E - Preparation of Compound Int-8f

H

3 C 0 CN Br N N H Trt H 3 C Trt Int-Be Int-8f To a solution of Compound Int-8e (3.6 g, 10.0 mmol) in THF (30 mL) was added LiHMDS (11.0 mmol) and then NBS (1.8 g, 10 mmol). The mixture was allowed to stir at room temperature for 2 hours and then 3 N HCl was added to the mixture and extracted with ethyl acetate twice. The organic layer was concentrated in vacuo. The residue obtained was purified using chromatography to provide the Int-8f (1.98 g, 44% yield). MS (ESI) m/z (M+H)*: 478, 480. Step F - Preparation of Compound Int-8g WO 2012/041014 PCT/CN2011/001638 100

H

3 C

H

3 C j NBS N N N H N N Trt N H B r Trt Int-8f Int-8g To a solution of Compound Int-8f (3.9 g, 10 mmol) in chloroform (30 mL) was added NBS (1.76 g, 10 mmol) and the mixture was allowed to stir at room temperature for 2 hours. The reaction mixture was then concentrated in vacuo and the residue obtained was purified using flash chromatography to provide Compound Int-8g (2.2 g, 47% yield). Step G - Preparation of Compound Int-8h

H

3 C

H

3 C STFA H Br Boc 2 0 N N Br Trt Boc Int-Bg Int-8h To a solution of Compound Int-8g (1.28 g, 2.7 mmol) in dichloromethane (10 mL) was added TFA (10 mL) and the mixture was allowed to stir at room temperature for 2 hours. Then the mixture was concentrated in vacuo and used in the next reaction directly. The residue obtained was dissolved in THF (20 mL) and Et 3 N (5 mL) and to the resulting solution was added BOC anhydride (590 mg, 2.7 mmol). The mixture was allowed to stir at room temperature for 2 hours and concentrated in vacuo. The residue obtained was purified using chromatography to provide Compound Int-8h (600 mg, 67% yield). MS (ESI) m/z (M+H)*: 331. EXAMPLE 9 Preparation of Intermediate Compound Int-9g WO 2012/041014 PCT/CN2011/001638 101 Cbz I Br SEM Int-9g Step A - Preparation of Compound Int- 9b Cbz ,Cbz ______ N -N 2 N OH

-

SLN

CH

2

N

2 N Int-9a Int-9b To a solution of Compound Int-9a (50 g, 0.2 mol) in THF (500 mL) and Et 3 N (20 mL) was added dropwise isopropyl chloroformate (25 g, 0.22 mol) at ice water bath. Then the resulting solution was allowed to warm to room temperature and allowed to stir for lh. Then a solution of CH 2

N

2 (0.22 mol) in ether was added slowly until no N 2 gas evolution was noted. Acetic acid (4 mL) was added and the reaction mixture was allowed to stir for 10 minutes. NaHCO 3 solution was then added and the reaction mixture extracted three times with ethyl acetate. The organic layers were combined, dried over Na 2

SO

4 , and concentrated in vacuo to provide crude product. The crude product was then purified using column chromatography on silica gel (Pet Ether: Ethyl.Acetate = 3:1) to provide Compound Int-9b (38 g, 70% yield) Step B - Preparation of Compound Int-9c Cbz Cbz I HBr I N N2 N r C0 0 Int-9b Int-9c To a solution of Int-9b (38 g, 0.14 mol) in HOAc (20 mL) was added dropwise an aqueous HBr solution (11.2 g, 0.14 mol). After 10 minutes, the mixture was WO 2012/041014 PCT/CN2011/001638 102 poured into an aqueous NaHCO 3 solution and extracted three times with ethyl acetate. The combined organic extracts were washed with brine, water, dried over Na 2

SO

4 and concentrated in vacuo to provide the product Int-9c (30 g, 68% yield). Step C - Preparation of Compound Int-9e Cbz Cbz Cb H 2 NyNH K 2 C0 3 N N Br + HAcOH 1N N -CO H Int-9c 9d Int-9e To a solution of Int-9c (10 g, 32 mmol) and Compound 9d (8.4 g, 64 mmol) in DMF (70 mL) was added K 2

CO

3 (18 g, 126 mmol). The mixture was allowed to stir at 100 'C in a sealed tube for about 15 hours. The solvent was removed and the residue obtained was purified using column chromatography on silica gel (dichloromethane: MeOH = 20:1) to provide the product Int-9e. (6 g, 59% yield). Step D - Preparation of Compound Int-9f Cbz Cbz SEMCI H iSEM Int-9e Int-9f To a solution Int-9e (4 g, 14.7 mmol) in THF (40 mL) was added NaH (6.6 g, 60 % content, 16.17 mmol) at 0 'C. The mixture was allowed to stir at room temperature for 30 minutes. and then cooled to 0 *C, and SEM-Cl (2.4 g, 14.7 mmol) added dropwise. The resulting mixture was allowed to stir at 0 *C for 2 hours. The solvent was removed in vacuo and the residue obtained was purified using column chromatography on silica gel (dichloromethane: MeOH =20:1) to provide the product Int-9f. (2 g, 34 % yield). Step E - Preparation of Compound Int-9g WO 2012/041014 PCT/CN2011/001638 103 Cbz Cbz N n-BuLi N N % NBS I Br SEM SEM Int-9f Int-9g To a solution of Int-9f (2 g, 5 mmol) in THF (20 mL) was added dropwise n-BuLi (2.5 mL, 6.3 mmol) at -78 'C (bath) under N 2 protection. The resulting solution was allowed to stir at this temperature for 30 minutes. Then a solution of NBS (0.89 g, 5 mmol) in THF (10 mL) was added dropwise at -78 'C. The mixture was allowed to stir at -78 'C for I hour and then aqueous NH 4 Cl solution was added. The organic layer was separated and concentrated off to provide a crude residue, which was purified using column chromatography on silica gel (petroleum ether :EA=3:1 as the fluent) to provide Compound Int-9g (400 mg, 16.5% yield). EXAMPLE 10 Preparation of Intermediate Compound Int-10f Boc Boc Boc Boc

HO

2 C. step A HOH2C step B OHC step C N F F F F Int-10a Int-10b Int-10c int-10d Br Boc Boc step D Br-t N step E Br N H H Int-10e Int-1 Of Step A - Preparation of Compound Int-1Ob (2S,4R)-1-(tert-butoxycarbonyl)-4-fluoropyrrolidine-2-carboxylic acid (Int-10a, 20 g, 85.75 mmol) was dissolved in anhydrous THF and cooled to 0 *C.

BH

3 THF (1M in THF, 171 mL, 171 mmol) was added via an addition funnel. The WO 2012/041014 PCT/CN2011/001638 104 solution was gradually warmed up to room temperature and allowed to stir at room temperature for about 15 hours. MeOH was added until no bubbles came out. The solution was concentrated in vacuo and the residue obtained was purified using flash column chromatography on silica gel (330g, 0% to 60% of EtOAc in Hexane) to provide Compound Int-10b (15.1 g, 80.3%) Step B - Preparation of Compound Int-1Oc To a dry 1000 mL round bottom flask was added oxalyl chloride (7.50 mL, 88.9 mmol) and dry dichloromethane (250 mL). After the solution was cooled to -78 *C, DMSO (6.80 mL, 95.8 mmol) in dichloromethane (20 mL) was added dropwise. The solution was allowed to stir at -78 'C for 30 minutes. Int-10b (15.0 g, 68.4 mmol) in dichloromethane (50 mL) was added via syringe. After the solution was allowed to stir at - 78 *C for 30 minutes, TEA (38.1 mL, 273.6 mmol) was added. The solution was allowed to stir at -78 *C for 30 minutes and at 0 *C for one hour. The solution was diluted with dichloromethane (300 mL) and washed with water, IN HCI, sat NaHCO 3 , and brine. It was dried over anhydrous Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was dried in vacuo for 1 hour to provide Compound Int-10c which was used without further purification. Step C - Preparation of Compound Int-10d To a 1000 mL round bottom flask was added Int-10c and NH3 (7N in MeOH, 150 mL). Glyoxal (15 mL, 40% in water, 131 mmol) was added slowly. The solution was allowed to stir at room temperature for about 15 hours. Additional glyoxal (5 mL, 44 mmol) was added and the reaction was allowed to stir at room temperature for another 24 hours. The solution was concentrated in vacuo and the residue obtained was purified using flash column chromatography on silica gel (240g, 0% to 5% of MeOH in dichloromethane, with 0.1% NH 3

-H

2 O) to provide Compound Int-10d (8.5 g, 48.7% from 2) Step D - Preparation of Compound Int-10e WO 2012/041014 PCT/CN2011/001638 105 To a 100 mL round bottom flask was added Int-10d (8.5 g, 33.3 mmol) and CH3CN (250 mL). More CH 3 CN was added to form a clear solution. NBS (11.3 g, 63.3 mmol) was added in one portion and the solution was allowed to stir at room temperature for about 15 hours. CH3CN was removed in vacuo and dichloromethane (50 mL) was added with stirring. The solid was filtered and washed with dichloromethane twice. The filtrate was concentrated in vacuo to about 30 mL and filtered again. The filtrate was purified using flash column chromatography on silica gel (120g, 20% to 80% of EtOAc in Hexane) to provide Compound Int-10e (11.88 g, 86.4%). Step E - Preparation of Compound Int-1 Of To a 1000 mL round bottom flask was added Int-10d (11.88 g, 28.76 mmol), sodium sulfite (Na 2

SO

3 , 36.0 g, 288 mmol), EtOH (270 mL) and water (130 mL). The solution was allowed to stir at reflux for about 15 hours. More Na 2

SO

3 (10 g, 79 mmol) was added and the solution was allowed to stir at reflux for another 24 hours. After cooling down, the solid was filtered and washed with EtOAc three times. The filtrate was concentrated in vacuo and the residue obtained was dissolved in a mixture of EtOAc (300 mL) and water (200 mL). The organic layer was separated and washed with brine, dried over anhydrous Na 2

SO

4 , filtered, and concentrated in vacuo. The residue obtained was purified using flash column chromatography on silica gel (240g, 0% to 33% of EtOAc in Hexane) to provide Compound Int-10f (5.12 g, 53.3%). EXAMPLE 11 Preparation of Intermediate Compound Int-11c Br Boc N NN F H F Int-11c Step A - Preparation of Compound Int-ib WO 2012/041014 PCT/CN2011/001638 106 Boc H NH 3 / MeOH Boc N * H N N Glyoxal/H 2 0 H F F F F Int-11a Int-11b The aldehyde Int-11a was prepared from the commercially available alcohol using the method described in Example 10. A flask was charged with aldehyde Int-11a (82g, 0.35 mol) and a 2.33 N ammonia/MeOH solution was added with good stirring (600 mL, 4.0 eq., prepared from 200ml 7N ammonia/MeOH diluted with 400 mL MeOH). The reaction was then heated to 35 'C and allowed to stir at this temperature for 2 hours, after which time a solution of 40 wt% glyoxal in water (80 mL, 2.0 eq.) was added dropwise over about 15 minutes. After stirring for an additional 2 hours, a solution of 7N ammonia/MeOH (100 mL, 2.0 eq.) was added and the reaction was allowed to stir at 35 *C for 1 hour. Additional glyoxal (40 mL, 1.0 eq.) was then added dropwise over 5 minutes and the resulting reaction was allowed to stir at 35 'C for 1 hour. The reaction mixture was then allowed to cool room temperature and stir for about 15 hours. Additional 7N ammonia/MeOH (50 mL, 1.0 eq.) was then added and the reaction reheated to 35 'C and allowed to stir at this temperature for 1 hour. An additional amount of glyoxal (20 mL, 0.5 eq.) was then added and the resulting reaction was allowed to stir at 35 "C for 1 hour, then the reaction mixture was cooled to room temperature and filtered. The filtrate was concentrated in vacuo and the residue obtained was diluted with dichloromethane and water (2 L, 1:1). The organic layer was separated, washed with IL of water, then brine and dried (MgSO 4 ), filtered and concentrated in vacuo. The brown foam residue obtained was further purified using being passed through a short silica gel column to provide Compound Int l1b (60g, 62%). Step B - Preparation of Compound Int-11c WO 2012/041014 PCT/CN2011/001638 107 Boc NBS Boo Br F H F F Int-11b F Int-11c Int-11c was prepared from Int-1lb using the method described in Example 10. Intermediate Compounds Int-11d, Int-lie and Int-11f can be prepared using the methods described in Example 10 and Example 11. Br Br Br Boc BN N~LN Bc H H H B SCH3 (S) Int-1ld int-11e Int-11f EXAMPLE 12 Preparation of Intermediate Compound Int-12i Br Boc HN N N Int-121 Step A - Preparation of Compound Int-12b 0 Boc 0 oqN O LHMDS O O Mel O Int-12a Int-12b To a solution of Compound Int-12a (60 g, 0.24 mol) in dry THF (1 L) allowed to stir at -78 'C was added lithium hexamethyldisilazide (82 g, 0.49 mol, I M in THF). After the reaction mixture had been allowed to stir at -78 'C for 1 hour, the iodomethane (66 g, 0.46 mol) dissolved in dry THF (100 mL) was added at -78 *C and the WO 2012/041014 PCT/CN2011/001638 108 mixture was allowed to stir for 15 minutes at this temperature and 2 hours at 25 'C. The reaction mixture was quenched with saturated ammonium chloride solution and extracted with dichloromethane (3 x 300 mL). The combined organic phases were dried over MgSO 4 , filtered, and concentrated in vacuo. The products were purified using flash column chromatography on silica gel to provide Compound Int-12b (18.3 g, 27% yield). 1 H NMR 8: 4.38-4.34 (in, I H), 4.08-4.05 (in, 2 H), 2.09-2.03 (in, 1 H), 1.77-1.73 (in, 1 H), 1.35 (s, 9 H), 1.12 (t, J= 8 Hz, 3 H), 1.06 (s, 6 H). Step B - Preparation of Compound Int-12c Boc O H TEA N " N 0 0 Int-12b int-12c To a solution of Compound Int-12b (18.3 g, 60 mmol) in dichloromethane (150 mL) was added TFA (15 mL) and the mixture allowed to stir at room temperature for 30 minutes. The solvent was removed to provide Compound Int-12c (11.2 g, 100% yield). Step C - Preparation of Compound Int-12d 0 H H N O N-70OH Int-12c Int-12d A suspension of LiAlH4 (16.2 g, 0.44 mol) and Compound Int-12c (11.2 g, 54.8 mmol) in THF (200 mL) was allowed to stir under reflux for 8 hours. After successive addition of 17 mL of water, 17 mL of 10% aq NaOH, and 51 mL of water, and filtration, the filtrate was concentrated in vacuo to provide Compound Int-12d (6.7 g, 94% yield). Step D - Preparation of Compound Int-12e WO 2012/041014 PCT/CN2011/001638 109 H Boc N-Y OH (Boc) 2 0 N OH Int-12d Int-12e Compound Int-12D was dissolved in THF and Et 3 N, (Boc) 2 0 were added. The mixture was allowed to stir at room temperature for 2 hours and concentrated in vacuo. The residue obtained was purified using chromatography to provide Compound Int-12e (14 g, 100% yield). Step E - Preparation of Compound Int-12f Boc, Boc H N- ,7-OH Dess-mart n N Int-12e Int-12f To a solution of Compound Int-12e (14g, 65.4 mmol) in dichloromethane was added Dess-Martin reagent (41.6 g, 98.1 mol). After stirring at room temperature for about 15 hours, the solvent was removed and the residue obtained was purified using flash column chromatography on silica gel to provide Compound Int-12f (7 g, 47% yield). 1H NMR 6: 9.40 (s, I H), 4.05-4.03 (in, 1 H), 3.14-3.11 (m, 2 H), 1.83-1.79 (in, I H), 1.66 1.63 (m, 1 H), 1.36 (s, 9 H), 1.02 (s, 6 H). Step F - Preparation of Compound Int-12g BocN H O Boc HN NJ_0 N- N Int-12f Int-12g Glyoxal (1.75 mL of 40% in water) was added dropwise over 11 minutes to a solution of NH 4 0H (26 mL) and Compound Int-12f (6.1 g, 28.8 mmol) in methanol WO 2012/041014 PCT/CN2011/001638 110 and allowed to stir at room temperature for 19 hours. The volatile component was removed in vacuo and the residue obtained was purified using a flash chromatography on silica gel to provide Compound Int-12g (3 g, 39% yield). MS (ESI) m/z (M+H)+: 266. Step G - Preparation of Compound Int-12h Br Boc HN B HN \ N N NBS oc Br - THE Int-12g Int-12h A mixture of Compound Int-12g (2.2 g, 8.3 mmol), N-bromosuccinimide (2.66 g, 14.9 mmol) in anhydrous THF (80 mL) was heated at reflux for about 15 hours. After cooling to room temperature, the solids are removed by filtration and the filtrate was concentrated in vacuo and the residue obtained was purified using chromatography to provide Compound Int-12h (2.0 g, 57% yield). 'H NMR (J000120117 H10170-003-1 CDCl 3 varian 400 MHz) 8: 11.03 (s, 1 H), 4.79 (t, J= 8 Hz, I H), 3.25 (t, J= 12 Hz, I H), 2.96 (t, J= 12 Hz, 1 H), 2.58-2.53 (m, 1 H), 2.95-1.90 (m, 1 H), 1.34 (s, 9 H), 1.05 (s, 3 H), 0.99 (s, 3 H). MS (ESI) m/z (M+H)*: 422. Step H - Preparation of Compound Int-12i Br Br Boc HN Boc HN : Br .% N N N N Int-12h Int-12i To a solution of Compound Int-12h (1.9 g, 4.5 mmol) in H 2 0/EtOH (40 mL /20 mL) was added Na 2

SO

3 (5.6 g, 4.5 mmol) and the mixture was allowed to stir at room temperature for about 15 hours. The reaction mixture was concentrated in vacuo and the residue obtained was dissolved in ethyl acetate, washed with brine, dried over MgSO 4 , filtered, and concentrated in vacuo. The residue obtained was purified using WO 2012/041014 PCT/CN2011/001638 111 chromatography on silica gel to provide Compound Int-12i (0.75 g, 48% yield). 'H NMR 8: 6.92 (s, 1 H), 4.71-4.67 (m, 1 H), 3.26-3.21 (in, 2 H), 2.01-1.96 (in, I H), 1.78-1.72 (m, 1 H), 1.13 (s, 9 H), 1.00 (s, 3 H). EXAMPLE 12A Preparation of Intermediate Compound Int-12o 0 t-Boc Step 1 t-Boc Step 2 H t-Boc Step 3 N t-Boc H N HOO N - N N HO HH Int-12j Int-12k Int-121 int-12m Br Br / N t-Boc / N t-Boc Step 4 N NN Step5 Br -~H H~s int-12n Int-12o(R) Step A Acid Int-12j (22.7 g, 100 mmol) was dissolved in dry THF (400 ml) in a 1000 mL flask, and cooled with an ice-water bath. Borane tetrahydrofuran complex (1.0 M in THF, 200 ml, 200 mmol) was added via an additional funnel dropwise over a period of 80 minutes. After 1 hour at 0 'C the reaction was allowed to warm to room temperature and stir for about 15 hours. Methanol was then added dropwise via an additional funnel (-100 ml) and then the reaction was then concentrated in vacuo. The residue was purified on a 300 g ISCO silica column/ Combi-Flash Rf system using a gradient of 0-70% ethyl acetate in hexanes to provide alcohol Int-12k as a colorless oil (18.2 g, 85%). Step B Oxalyl chloride (14.08 g, 111 Immol) was dissolved in methylene chloride (340 ml) in a 1000 mL flask and cooled to -78 'C under nitrogen atmosphere. DMSO (9.33 g, 119 mmol) was added slowly via syringe over a period of 10 minutes. The resulting solution was allowed to stir at -78 'C for 45 minutes prior to the slow addition of the alcohol Int-12k (15.2 g, 85 mmol) in methylene chloride (50 ml) and stirred at - WO 2012/041014 PCT/CN2011/001638 112 78 'C under nitrogen for 45 minutes before addition of triethylamine (34.5 g, 341 mmol). After 40 minutes at -78 'C, then reaction was warmed to 0 'C and stirred at 0 *C for an additional 1 hour. After addition of 500 mL of methylene chloride, the organic solution was washed with water, IN HCl solution (300 ml), and water. The organic layer was dried over sodium sulfate, concentrated in vacuo to provide aldehyde Int-121 as a colorless oil (18.14 g, -100%). This crude product was used for the next reaction without purification. Step C The aldehyde Int-121 (18.14 g, 86 mmol) was dissolved in methanol (37 ml) and the resulting solution was cooled with a RT water bath. A 7N ammonia solution in methanol (31.9 ml, 223 mmol) was then added dropwise via an additional funnel over a period of 15 minutes. The reaction mixture was allowed to stir at room temperature for 20 minutes before a 40% aqueous solution of glyoxal (16.2 g, 112 mmol) was added. The reaction mixture was allowed to stir at room temperature for about 15 hours and then concentrated in vacuo. The residue was purified using a 220 g ISCO silica column/Combi-Flash Rf system (0-7% methanol in dichloromethane eluent) to provide Compound Int-12m as a slightly yellow solid (10.8 g, 51.5%). Step D Intermediate Int-12m (10.81 g, 43.4 mmol) was dissolved in THF (200 ml) in a 250 mL flask and NBS (15.43 g, 87 mmol) was added slowly at room temperature. The resulting solution was allowed to stir at room temperature for 4.5 hours and concentrated to semi-solid. The residue was dissolved in ethyl acetate (300 ml), washed with brine (3X100 ml), dried over sodium sulfate, and concentrated in vacuo. The crude material was purified using crystallization from dichloromethane to provide Compound Int-12n as a white solid (7.68 g, 43.5%). The mixture from mother liquid was purified using a 220 g ISCO silica column/Combi-Flash Rf system using 0-70% ethyl acetate in hexanes as the eluent to provide a second batch of Int-12n as a pale solid (7.73g, 43.8). Step E WO 2012/041014 PCT/CN2011/001638 113 Intermediate Int-12n (14.4 g, 35.4 mmol) was dissolved in methanol (45 ml) and water (16 ml) and placed in a water bath. EDTA (10.34 g, 35.3 mmol) followed by 7N ammonia in methanol (20.21 ml, 141 mmol) were then added. Zinc powder (2.314 g, 45.4 mmol) was then added and the resulting solution was allowed to stir at room temperature. After 6 hours the reaction was then concentrated and the residue was redissolved with ethyl acetate (100 ml), washed with water (2x50 ml), dried over sodium sulfate, and concentrated in vacuo. The crude product was purified on a 80 g silica column with a Combi-Flash Rf system using a gradient of 0-70% ethyl acetate in hexanes to provide Int-12o as a white solid (7.56 g, 65%). EXAMPLE 13 Preparation of Intermediate Compounds Int-13d and Int-13e N 0 - N O N 0 1) Column diast 0 1) n-BuLiITHF +_________N 0 N 0 N 2) HCl/MeOH N I .- 3) DIPEA/Nal. Int-13a Si S 3) Boc2O/ r \ r \3)oO/ CI C1 80-90% ClISi ._Cl 60% Int-13b Int-13c Int-13c' Int-13d Step A - Preparation of Compound Int - 13c A 5 L- 3 necked round bottomed flask, equipped with a mechanical stirrer, temperature probe, addition funnel and N 2 inlet, was charged with the Schollkopf chiral auxiliary-(Int-13a, 200 g, 1.09 mol, 1.0 eq), bis(chloromethyl) dimethylsilane (Int-13b, 256 g, 1.63 mol, 1.5 eq), and THF (2 L, Aldrich anhydrous). The flask was cooled in a dry ice/ 2-propanol bath until the internal temperature reached -75 'C. n-Butyllithium (Aldrich 2.5 M in hexanes , 478 mL, 1.19 mol, 1.09 eq) was added via a dropping funnel over 1 hour while maintaining the internal reaction temperature between -67 'C and 76 'C. The resulting orange-red solution was allowed to gradually warm to room temperature for about 15 hours. The reaction mixture was then re-cooled to 0 'C and quenched with 500 mL of water. Diethyl ether (2L) was added and the layers were WO 2012/041014 PCT/CN2011/001638 114 separated. The aqueous layer was extracted with I L of diethyl ether. The combined organic extracts was washed with water and brine, dried with MgSO 4 , filtered, and concentrated in vacuo, giving 480 g of orange oil. This material was left in vacuo for about 15 hours to provide 420 g of oil. The crude product was split into two batches and purified via silica gel chromatography on a 1.6 kg flash column. The column was eluted with gradient of 0-4% Et 2 0 in hexanes. The product fractions were concentrated in vacuo at a bath temperature at or below 40 'C giving 190 grams of Int-13c-(60%yield). Step B - Preparation of Compound Int-13d A 5 L, 3-necked round bottomed flask equipped with a mechanical stirrer, addition funnel, temperature probe, external water bath and N 2 inlet was charged with Compound Int-13c (196 g, 0.643 mol, 1.0 eq) and methanol (1.5 L). Aqueous HCl (500 mL of 10% by volume) was added at room temperature over 30 minutes, with a mild exotherm observed. The temperature increased to 37 oC then dropped back down. The reaction mixture was allowed to stir at room temperature for 3 hours and was monitored by TLC and LC/MS. The reaction mixture was then concentrated in vacuo to an oil. Additional methanol (3 x 200 mL) was added and the reaction mixture was concentrated in vacuo again. The resulting crude product was dried under house vacuum for about 15 hours. The crude product was then dissolved in CH 2 Cl 2 (750 mL) and Et 2 O (1250 mL) and sodium iodide (96.4 g, 0.643 mol, 1.0 eq) was added. Diisopropylethylamine (336 mL, 1.929 mol, 3.0 eq) was added slowly over 25 minutes with stirring, causing the temperature to increase to 35 *C then decrease to room temperature again. The reaction mixture was allowed to stir at room temperature for 2 hours, after which time the MS of an aliquot indicated consumption of the starting material. The reaction mixture was allowed to stir for an additional 2 hours and then Boc-anhydride (281 g, 1.286 mol, 2.0 eq) was added. The reaction mixture was then allowed to stir at room temperature. After two days, the reaction mixture was diluted with EtOAc (2 L) and water (1 L), and he layers were separated. The aqueous phase was extracted with 500 mL of EtOAc. The combined organic extracts were washed with water (500 mL) and brine (500 mL), dried with MgSO 4 , filtered, and concentrated in vacuo to a yellow oil (380 g). The crude product was split into two 180 g portions for convenience and each portion was purified WO 2012/041014 PCT/CN2011/001638 115 via flash silica gel chromatography. Column conditions for a 180 g portion of crude product are as follows. The 180 gram sample of crude product was loaded onto a 191 g SiO 2 cartridge and purified on a 1.5 kg SiO 2 column. The column was eluted using a 0% 20% EtOAc/hexanes gradient as the mobile phase to provide 52 grams of pure Int-13d and additional fractions of Int-13d that contained a small amount of a Boc-valine impurity. The impure fractions from the two columns were recombined and re-purified. After chromatography, Compound Int-13d was obtained as an oil which solidified to a white solid on standing (128 g, 65 % yield over the three steps.) Step C - Preparation of Compound Int-13e O BOC LiOH 0 BOC Si- Si Int-13d Int-13e A solution of Int-13d (8.5 g, 31.1 mmol) in methanol (100 mL) and 1.0 M aqueous KOH solution (48 mL, 48 mmol) was allowed to stir at room temperature for about 15 hours. The reaction was then neutralized with 48 mL of 1.0 M aqueous HCl solution to pH -5, and partially concentrated in vacuo. The aqueous layer was then extracted twice with dichloromethane (2 x 100 mL). The combined organic solutions were concentrated in vacuo to provide Compound Int-13e as a gel (7.74 g, 96%). Note: The above reactions were monitored by TLC using Hanessian's stain. To prepare the visualization stain, combine 450 mL of H 2 0, 25 g ammonium molybdate, 5 g of ceric sulfate, and 50 mL of conc. HCl or conc. H 2

SO

4 . EXAMPLE 14 Preparation of Intermediate Compound Int-14d WO 2012/041014 PCT/CN2011/001638 116 0 Boc Boc O Boc N Step A Step B H Si H/ HSi Int-13e Int-14a Int-14b N Boc -N Boc Step C N Step D /\ N H SiH SKi Int-14c Int-14d Step A - Preparation of Compound Int-14a To a mixture of carboxylic acid Int-13e (20 g, 77 mmol) in THF (400 mL) at 0 0 C was added IM BH 3 in THF ( 0.17 L) via addition funnel at 0 0 C. The mixture was allowed to warm to room temperature and stir for about 15 hours. The reaction was carefully quenched by addition of MeOH (- 75 mL) until bubbling ceased. The reaction mixture was concentrated in vacuo whereupon the residue obtained was partitioned between EtOAc and H 2 0. The layers were separated and the aqueous layer was extracted with EtOAc (2x). The organic layers were combined, washed with brine, dried (Na 2

SO

4 ), and concentrated in vacuo to provide Compound Int-14d (18 g, 99%) as a clear oil, which was used without further purification. MS (ESI) m/e (M+H+Na) +: 268. Step B - Preparation of Compound Int-14b To a dry 2-necked flask equipped with a stir bar was added oxalyl chloride (8.2 mL, 96 mmol) and CH 2 Cl 2 (280 mL). The solution was cooled to -78 *C whereupon a solution of DMSO (7.4 mL, 0.10 mol) in CH 2

CI

2 (22 mL) was added and the mixture was allowed to stir for 30 minutes at -78 'C. A solution of alcohol Int-14a (18 g, 74 mmol) from Step A in CH 2 Cl 2 (60 mL) was added dropwise via addition funnel over 30 minutes. The resulting solution was allowed to stir for an additional 30 minutes at -78 *C whereupon Et 3 N (42 mL, 0.30 mol) was added dropwise. The mixture was allowed to stir for 30 minutes at -78 'C, warmed to 0 'C, and allowed to stir for an additional 1.5 hours. The mixture was diluted with CH 2 Cl 2 (400 mL) and was transferred to a separatory funnel. The organic layer was washed with sat. aq NH 4 Cl (2 x 100 mL) and brine (2 x 100 mL). The organic layer was dried (Na 2 S0 4 ), filtered, and concentrated in vacuo to provide Compound Int-14b,18 g (99%) as a clear oil, which was used without further purification.

WO 2012/041014 PCT/CN2011/001638 117 Step C - Preparation of Compound Int-14c To a round bottom flask charged with aldehyde Int-14b (18 g, 74 mmol) from Step B was added a 7N NH 3 in MeOH solution (28 mL, 0.19 mol) in MeOH (37 mL) at room temperature. The mixture was allowed to stir for 30 minutes at room temperature whereupon a solution of glyoxal (14 g, 96 mmol) was added over 5 minutes. The resulting solution was allowed to stir for 12 hours at room temperature and was concentrated in vacuo. The residue obtained was purified using column chromatography using a gradient of 100% CH 2 Cl 2 to 97.5% CH 2 Cl 2 /2.5% MeOH to provide Compound Int-14c, 9.9 g (48%) as yellow oil. MS (ESI) m/e (M+H) +: 282. Step D - Preparation of Compound Int-14d To a solution of imidazole Int-14c (1.0 g, 3.6 mmol) from Step C in

CH

2

C

2 (5 mL) at 0 0 C, was added NBS (0.44 g, 2.5 mmol) in CH 2 Cl 2 (10 mL) dropwise via addition funnel. The resulting mixture was allowed to stir for 90 minutes at 0 'C whereupon the mixture was concentrated in vacuo. The crude residue obtained was partitioned between CHC1 3 (10 mL) and water (3 mL) and the layers were separated. The organic layer was washed with water (3 x 3 mL), dried (Na 2

SO

4 ), filtered, and concentrated in vacuo. The residue obtained was purified using column chromatography (80g) using a gradient of 100% hexanes to 65% hexanes/35% EtOAc to provide Compound Int-14d, (0.35 g, 27%) as a white solid. MS (ESI) m/e (M+H)+: 360/362. EXAMPLE 15 Preparation of Intermediate Compound Int-15c 0 HO ,Boc N H "H Si Int-15c Step A -Preparation of Compound Int-15a WO 2012/041014 PCT/CN2011/001638 118 H, H /Si" Int-15a To a solution of dichlorozirconocene (Cp 2 ZrCl 2 ) (4.2 g, 14.2 mmol) in 40 mL THF at -78 0 C was added n-BuLi (1.6 M in hexane, 18 mL, 28.4 mmol). The resulting reaction was allowed to stir for 1 hour, then diphenyldiallylsilane (2 g, 14.2 mmol) in 17 mL of THF was added at -78 C . The reaction was allowed to stir for I hour at -78 'C and for 18 hours at 25 *C. Iodine (9 g, 35.5 mmol) in 20 mL THF was then added at -78 'C and the mixture was allowed to stir for 1 hour. The reaction was quenched with 10% aqueous H 2

SO

4 and the organic phase was extracted by ether. The organic solution was washed with saturated aqueous NaHCO 3 solution, brine solution, and dried (Na 2

SO

4 ). After filtration, the filtrate was concentrated in vacuo and the residue obtained was purified using an ISCO 120 g column (hexane) to provide Compound Int-15a, 2.75 g (49%). 'H NMR (CDCl 3 ) 8 3.44 (dd, J= 2.2, 10.0 Hz, 2H), 3.33 (dd, J= 4.7, 10.0 Hz, 2H), 1.20 (m, 2H), 0.93 (dd, J= 5.9, 14.7 Hz, 2H), 0.63 (dd, J = 11.1, 14.2 Hz, 2H), 0.19 (s, 6H). Step B - Preparation of Compound Int-15b MeO N N OMe H~ Int-15b To a solution of (2R)-(-)-2,5-dihydro-3,6-dimethoxy-2-isopropylpyrazine (0.61 g, 4.36 mmol) in THF (8 mL) was added n-BuLi (2.5 M in hexane, 1.8 mL, 4.58 mmol) at -78 'C. After allowed to stir for 0.3 hours, Compound Int-15a (2.75 g, 6.98 mmol) in 2 mL of THF was added and the mixture was allowed to stir at the temperature for 4 hours. The reaction was quenched by saturated aqueous NH 4 CI solution and the WO 2012/041014 PCT/CN2011/001638 119 organic layers were extracted with EtOAc. The combined organic solution was washed with brine solution, dried (Na 2

SO

4 ), and concentrated in vacuo. The residue obtained was purified using an ISCO 40 g column (gradient from 0% to 2.5% ether in hexane) to provide Compound Int-15b, 783 mg (44%). 'H NMR (CDCl 3 ) 5 4.05 (m, 1H), 3.96 (t, J = 3.4 Hz, IH), 3.72 (s, 3H), 3.71 (s, 3H), 3.49 (dd, J= 2,8, 0.4 Hz, 1H), 3.26 (dd, J= 6, 9.4 Hz, IH), 2.30 (m, 1H), 1.96 (m, IH), 1.60 (m, 2H), 1.37 1.17 (m, 3H), 1.08 (d, J 6.9 Hz, 3H), 0.99 0.86 (in, 2H), 0.72 (d, J= 6.6 Hz, 3H), 0.49 (dd, J= 11.0, 14.4 Hz, IH), 0.35 (dd, J= 11.0, 14.2 Hz, 1H), 0.16 (s, 6H). Step C - Preparation of Compound Int-1 c To a solution of Compound Int-15b (780 mg, 1.92 mmol) in MeOH (9 mL) was added 10% aqueous HCI (3 mL) at 0 'C and the mixture was allowed to stir at 25 'C for 18 hours. The mixture was concentrated in vacuo and the residue obtained was reconcentrated in vacuo with MeOH twice. The resulting white foam was dissolved in ether (6 mL) and CH 2

CI

2 (9 mL), and diisopropylethylamine (I mL, 5.7 mmol) was added. After allowed to stir at 25 'C for 18 hours, di-t-butyl dicarbonate (922 mg, 4.22 mmol) was added and the resulting mixture was allowed to stir at 25 *C for 2 days. The mixture was added to cold water and the organic layers were extracted with EtOAc. The combined organic solution was washed with brine solution, dried (Na 2 SO4), and concentrated in vacuo. Then the residue obtained was dissolved in MeOH (8 mL) and treated with aqueous 1 M KOH solution (3.3 mL, 3.3 mmol). After allowed to stir at 0 'C to 25 *C, the reaction mixture was acidified with 10% aqueous HCl and the organic layers were extracted with CH 2 Cl 2 . The combined organic solution was washed with brine solution, dried (Na 2

SO

4 ), and concentrated in vacuo to provide Compound Int-15c, which was used without further purification. EXAMPLE 16 Preparation of Intermediate Compound Int-16e WO 2012/041014 PCT/CN2011/001638 120 N- OMe -Si step C step B 10 05 MeO Cij Int-16a Int-16b Int-16c Boc Boc MeO 2 C N HO 2 C N step C step D 0 0 Int-16d Int-16e Step A - Preparation of Compound Int-16b To a 1000 mL flame dried flask was added 1, 1-dichlorosilolane (Int-16a, 28.09 g, 181.1 mmol), bromochloromethane (23.5 mL, 362.2 mmol), and anhydrous THF (400 mL). The solution was cooled to -70 'C, then n-BuLi (2.5M in hexane, 145 mL, 362 mmol) was added slowly over a period of 1 hour. The resulting reaction was allowed to stir at -70 to -60 'C for 20 minutes, then was allowed to warm to room temperature over 1 hour. Saturated NH 4 CI solution (200 mL) and Et 2 O (200 mL) were then added and the organic layer was separated and the aqueous layer was extracted with Et 2 O (100 mL) twice. The organic layers were combined, washed with brine, dried over Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using SiO 2 chromatography (240 g, eluted with hexane) to provide Compound Int-16b (17.2 g, 51.9%). Step B - Preparation of Compound Int-16c To a 500 mL flame dried flask was added (R)-2-isopropyl-3, 6 dimethoxy-2,5-dihydropyrazine (10.0 g, 54.3 mmol) and anhydrous THF (200 mL). The solution was cooled to -78 *C. n-BuLi (2.5M in hexane, 24.0 mL, 59.7 mmol) was added dropwise. After the solution was allowed to stir at -78 'C for 30 minutes, Compound Int-16b (in 5 mL anhydrous THF) was added dropwise. After the solution was allowed to stir at -78 'C for 1 hour, it was allowed to warm up to room temperature in two hours. Water (100 mL) and Et 2 O (150 mL) were added. The organic layer was WO 2012/041014 PCT/CN2011/001638 121 separated and the aqueous layer was extracted with Et 2 0 (100 mL) twice. The organic layers were combined, washed with brine, dried over Na 2 SO4, filtered and concentrated in vacuo. The residue obtained was purified using SiO 2 chromatography (40 g, eluted with Et 2 O in Hexane: 0% to 3%) to provide Compound Int-16c (10.43 g, 58.0%). Step C - Preparation of Compound Int-16d To a 500 mL flask was added Compound Int-16c (11.5 g, 34.8 mmol) and MeOH (80 mL). 10% HCI (20 mL) was added. The solution was allowed to stir at room temperature for 5 hours and concentrated in vacuo. The residue obtained was dissolved in 20 mL MeOH and concentrated again to remove water and HCl. This process was repeated three times. The residue obtained was dissolved in dichloromethane (50 mL) and Et 2 O (70 mL). DIPEA (15.4 mL, 86.9 mmol) and Nal (5.2 g, 34.75 mmol) were added. The solution was allowed to stir at room temperature for about 15 hours. Di-tert-butyl dicarbonate (18.9 g, 86.9 mmol) was added. The solution was allowed to stir at room temperature for 4 hours. Water (100 mL) and EtOAc (100 mL) were added. The organic layer was separated and the aqueous layer was extracted with EtOAc (100 mL) twice. The organic layers were combined and washed with brine, dried over anhydrous Na 2

SO

4 , filtered, and concentrated in vacuo. The residue obtained was purified using SiO 2 chromatography (220g, Hexane/EtOAC: 0% to 20%) to provide Compound Int-16d (7.9 g, 75.9%). Step D - Preparation of Compound Int-16e Compound Int-16d (7.9 g, 26.4 mmol) was dissolved in MeOH (100 mL) and cooled to 0 *C. KOH (IM in water, 39.6 mL, 39.6 mmol) was added. The solution was allowed to stir at 0 'C for 2 hours, and then at room temperature for 3 hours. HCI (2 N, 20 mL) was added, then additional HCl was added slowly to adjust the solution to pH 4. The acidified solution was concentrated in vacuo and to the residue obtained was added water (150 mL) and EtOAc (200 mL). The organic layer was separated and the aqueous layer was extracted with EtOAc (2 x 100 mL). The combined organic extracts were washed with brine, dried over anhydrous Na 2

SO

4 , filtered, and concentrated in WO 2012/041014 PCT/CN2011/001638 122 vacuo. The residue obtained was dried in vacuo for 48 hours to provide Compound Int 16e (7.45 g, 99%), which was used without further purification. EXAMPLE 17 Preparation of Intermediate Compounds Int-17c and Int-17d Step A - Preparation of Compound Int-17b Br OH Br q OAc F F Int-17a Int-1 7b To a 500 mL flask was added Int-17a (25.0 g, 130 mmol), dry dichloromethane (250 mL) and DIPEA (25.37 g, 195 mmol). The solution was cooled to 0 'C and acetyl chloride (13.27g, 169 mmol, in 30 mL dry dichloromethane) was added dropwise. The resulting reaction was allowed to stir at 0 'C for one hour and then at room temperature for about 15 hours. The solution was diluted with EtOAc and washed with water. The organic phase was dried over anhydrous Na 2

SO

4 , filtered, and concentrated in vacuo. The residue obtained was purified using flash column chromatography on silica gel (330g, 0% to 50% of EtOAc in Hexane) to provide Compound Int-17b (22.58 g, 74.5%) Step B - Preparation of Compound Int-1 7c Br OAc Br OH FF Int-17b int-17c To a 500 mL flask was added Int-17b (21.45 g, 92.05 mmol) and dry dichloromethane (200 mL). It was cooled to 0 'C and aluminum trichloride (A1Cl3, 36.82 g, 276.2 mmol) was added in portions. After the solution was allowed to stir at 0 C for 30 minutes, it was concentrated in vacuo. The semi-solid residue obtained was heated at 140 'C for three hours. After it was cooled to 80 'C, water (10 mL) was added dropwise.

WO 2012/041014 PCT/CN2011/001638 123 It was then cooled to 0 'C and EtOAc (300 mL) and water (200 mL) were added. The suspension was allowed to stir at 0 'C until the entire solid dissolved. More EtOAc was added and the organic layer was separated. The organic layer was washed with water, dried over anhydrous Na 2

SO

4 , filtered, and concentrated in vacuo. The residue obtained was purified using flash column chromatography on silica gel (330g, 0% to 10% of EtOAc in Hexane)to provide Compound Int-17c (18.76 g, 87%). Step C - Preparation of Compound Int-1 7d 0 HO Br Int-17d Compound Int-17d was prepared using the method described above for the synthesis of Compound Int-17c and substituting 2-bromophenol for Compound Int 17a in Step A EXAMPLE 18 Preparation of Intermediate Compound Int-18c Br

H

3 C Br Int-18c Step A - Preparation of Compound Int-18b 0

H

3 C OH

H

3 C H 0 0 Int-18a Int-18b To a stirred solution of (3-methyloxetan-3-yl)methanol (Int-18a,10.0 g, 97.9 mmol) in methylene chloride (400 mL) at 0 'C, under inert atmosphere, was added silica gel (20 g). PCC (29.5 g, 137 mmol) was then added in portions over a 2 minutesute WO 2012/041014 PCT/CN2011/001638 124 period. The solution was allowed to slowly warm to room temperature and stirred for 6.5 hours. The reaction mixture was then filtered through a mixture of Celite:silica gel (1:1, 400 g total) and the Celite:Silica gel was washed with methylene chloride (4 L). The filtrate and washing were combined and concentrated in vacuo to provide 4.98 g (51%) of Int-18b as a clear solution (48.5 wt%) in methylene chloride. 'H NMR (CDC 3 500 MHz): & 9.94 (s, 1H), 4.89 4.83 (in, 2H), 4.52 4.46 (in, 2H), 1.48 (s, 3H). Step B - Preparation of Compound Int-18c O Br

H

3 C H

H

3 C Br 0 0 Int-18b Int-18c To a stirred solution of triphenylphosphite (5.10 mL, 19.5 mmol) in methylene chloride (9 mL) at 0 *C, under inert atmosphere, was added bromine (1.00 mL, 19.5 mmol) dropwise at 0 'C. A solution of Compound Int-18b (1 00 g, 9.99 mmol) in methylene chloride (1 mL) was then added and the resulting reaction was allowed to stir for 40 minutes at 0 'C. The reaction mixture was diluted with hexanes (10 mL) and the solution was passed through a plug of silica gel (4 g). The solids were washed with MTBE (20 mL). The filtrate and washing was combined and concentrated in vacuo to -10 mL and purified using flash column chromatography on silica gel (methylene chloride/pentane) to provide 1.06 g (44%) of Compound Int-18c as clear colorless oil. 1 H NMR (CDC 3 ,500 MHz): 6 5.98 (s, IH), 3.76 (d, J= 10.5 Hz, 2H), 3.65 (d, J= 10.5 Hz, 2H), 1.44 (s, 3H). EXAMPLE 19 Preparation of Intermediate Compound Int-19e F Br Br N \/ Br H HO Int-19e WO 2012/041014 PCT/CN2011/001638 125 Step A - Preparation of Compound Int-19a NC H_ Br AcOH,EtOH NH Br Br NrK ' H HO a r BrBr~a HO~Br Int-17d Int-19a A mixture of Int-17d (4.2 g, 20 mmol) and 4-bromophenyl hydrazine hydrochloride (4.4 g, 20 mmol) in AcOH and EtOH (1:10, 100 mL) was heated to reflux and allowed to stir at this temperature for 6 hours. The reaction mixture was cooled to room temperature and concentrate in vacuo to provide Compound Int-19a as a solid, which was used without further purification (9.2 g). MS (ESI) m / e (M+H*): 383. Step B - Preparation of Compound Int-19b PPA Br \ /B Br H Br H HO int-19a Int-19b A mixture of Int-19a (9.2 g) in PPA was heated to 80 'C and allowed to stir at this temperature for 2 hours. After cooling to room temperature, the reaction mixture was poured into ice water. The resulting solution was extracted with dichloromethane and the organic extract was washed with brine, dried over Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using column chromatography to provide Compound Int-19b (4.8 g). MS (ESI) m / e (M+H*): 368. Step C - Preparation of Compound Int-19c F Br N - select Br BrBr DM _H3 N Br Br H HO DMSO,CH 3 CN N H HO Int-I9b Int-19c WO 2012/041014 PCT/CN2011/001638 126 To a solution of Int-19b (6 g, 16.3 mmol) in DMSO/CH 3 CN (1:1, 24 mL) was added Select-F (5.8 g, 16.3 mmol) in portions. The reaction was allowed to stir for 1 hour at room temperature, then the reaction mixture was concentrated in vacuo and the residue obtained was purified using HPLC to provide Compound Int-19c as a solid (1.0 g). MS (ESI) m / e (M+H*): 386. Step D - Preparation of Compound Int-19d 0 F HHCI N H H BrNH 2 AcOH,EtOH Br NNB HO Br Br Br0 HO.r int-17c Int-19d A suspension of Int-17c (51.6 g, 221 mmol, 1.0 eq) in 910 mL of absolute ethanol and 100 mL of glacial acetic acid was heated to 40 *C and 4-chlorophenyl hydrazine hydrochloride (41.66 g/232 mmol/1.05 eq) was added in portions, with stirring, followed by 3 Angstrom molecular sieves (23 g) and additional acetic acid (350 mL). The reaction mixture was placed under a N 2 atmosphere, heated to 70 'C and allowed to stir at this temperature for 4 hours. The reaction mixture was allowed to cool to room temperature and was allowed to stand for about 15 hours, without stirring, under N 2 . The reaction mixture was filtered, the filtrate was concentrated in vacuo and the residue obtained was taken up in toluene (230 mL) and absolute ethanol (100 mL). The resulting solution was then concentrated in vacuo. The residue obtained was diluted with absolute ethanol (400 mL) and the resulting solution was allowed to stand in a 54 *C water bath for 45 minutes, then was allowed to cool to room temperature with stirring. The resulting precipitate was filtered and the collected solid was washed with 30 mL of absolute ethanol and 75 mL of hexanes, then dried in vacuo to provide Compound Int 19d as an off white solid (50.2 grams (63%)). This material was used without further purification. MS (ESI) m / e (M+H*): 357.0, 359.0. Step E - Preparation of Compound Int-19e WO 2012/041014 PCT/CN2011/001638 127 H Br y N .NPA Br H Br H HO Int-19d Int-19e Polyphosphoric acid (111.8 g) and xylenes (260 mL) were added to a I liter 3-necked flask. The flask was placed in a 100 'C oil bath, connected to a N 2 inlet, and equipped with a mechanical stirrer. The PPA/xylenes mixture was allowed to stir for 30 minutes to bring the internal temperature up to 100 'C. Compound Int-19d was then added in portions over 10 minutes. The reaction was placed under N 2 atmosphere, capped, stirred for 30 minutes at 100 'C, and then stirred for 2.5 hours at 110 *C. The flask was lifted out of the oil bath and allowed to cool for 15 minutes. Ice (750 mL) was added in portions to the reaction mixture with stirring. After about 15 minutes, the reaction mixture was suction filtered through fiberglass filter paper in a Buchner funnel and an orange solid was collected. The collected solid was dissolved in EtOAc, and the resulting purple solution was washed with water and brine, then dried over MgSO 4 , filtered, and concentrated in vacuo. The residue obtained was purified using flash chromatography on a 345 g SiO 2 column using 5%-25% EtOAc/hexanes gradient, to provide Compound Int-19e (11.22 g) as a yellow solid (47%). The following 2-aryl indole intermediates can be made using the method described above and substituting the appropriate reactants: WO 2012/041014 PCT/CN2011/001638 128 F ,F Br Br Br r Br - Br N BrN \ BrN /B HO HHO HHO Int-19b nt-i9i F F Br Br Cl Br C HO HHO HHO F ,F Br Cl Br I Br HHO HO HO Int-19g Int-19h Int-19j N NN HHO HHO HHO F F MeO CMeO CIMeO Cl N N HHO HHO HHO F F MeO OeMeO MeO OMe \/7\\/eOMe l N ~ NN~ HO HO HO EXAMPLE 19a Preparation of Intermediate Compound Int-19i WO 2012/041014 PCT/CN2011/001638 129 CI CI e Me step A [I1 J' H ste B stepC I110 ; HO'.Br HHO Int-19d Int-19f Int-99 Sstep D - P of C F Br -Br H HO Me Int-19h Int-191 Step A - Preparation of Compound Int-i 9f To a solution of Int-17d (14.0 g, 65.1 mmol), (4-chlorophenyl)hydrazine (23.3g, 130 mmol) in EtOH (400 mL) was added glacial acetic acid (40 mL). The reaction was heated to 90 *C and allowed to stir at this temperature for about 15 hours. The reaction mixture was cooled to room temperature, filtered, and the filtrate was concentrated in vacuo and dried in vacuo for 15 minutes. The resulting residue was diluted with dichloromethane (600 mL) and the resulting suspension was allowed to stir at room temperature for 30 minutes. The solid was removed by filtration and washed with dichloromethane five times. The filtrate was concentrated in vacuo and MeOH (100 mL) was added. The suspension was allowed to stir at room temperature for 15 minutes and filtered. The solid was dried in vacuo for two hours to provide Compound Int-19f (17.9 g, 81.0%). Step B - Preparation of Compound Int-19g To a 250 mL three-neck flask with a mechanic stirrer was added polyphosphoric acid (PPA, 100g). PPA was heated to 110 C and Int-19f (10.3 g, 30.3 mmol) was added in small portions. The reaction mixture gradually became dark green. The reaction mixture was allowed to stir at 110 'C for two hours. After cooling down, crushed ice was added slowly with stirring until the dark green color disappeared. Water was added and the suspension was transferred into a 1000 mL beak. The suspension was allowed to stir for 10 minutes and filtered. The solid was washed with water (100 mL) WO 2012/041014 PCT/CN2011/001638 130 three times and dried in vacuo at 60 *C for about 15 hours to provide Compound Int-19g (9.72 g, 99.4%). Step C - Preparation of Compound Int-19h To a 100 mL round bottom flask was added Int-19g (2.62 g, 8.12 mmol), DMSO (15 mL), and MeCN (15 mL). The solution was cooled to 0 'C and Select-F (2.3 g, 6.5 mmol) was added in three portions. The reaction was allowed to stir at 0 0 C for 1.5 hours, then gradually warmed up to room temperature in one hour. The reaction mixture was then diluted with 20 mL MeOH and filtered. The filtrate was concentrated in vacuo to about 20 mL and purified using C18 chromatography (150g, 50% to 100% of MeCN in water, with 0.05% TFA) to provide Compound Int-19h (964 mg, 35%). Step D - Preparation of Compound Int-19i A solution of Int-19h (2.05 g, 6.02 mmol), DMF (120 mL), Cs 2

CO

3 (10.0 g, 31.0 mmol), and dibromoethane (5.2 mL, 60.2 mmol) was heated to 100 'C and allowed to stir at this temperature for about 15 hours. Additional dibromoethane (4.0 ml, 46 mmol) and Cs 2

CO

3 (3.0 g, 9.2 mmol) were added and the reaction was allowed to stir at 100 'C for 8 hours. The reaction mixture was cooled to room temperature and water (200 nL) and EtOAc (250 mL) were added. The organic layer was separated and the aqueous layer was extracted with EtOAc (100 mL). The organic layers were combined, washed with water (2 x 100 mL) and brine, dried over anhydrous Na 2

SO

4 , filtered and concentrated in vacuo. The resulting residue was purified using flash column chromatography on silica gel (0% to 50% of EtOAc in Hexane) to provide Compound Int-19i (1.24 g, 56.2%). EXAMPLE 20 Preparation of Compound 37 WO 2012/041014 PCT/CN2011/001638 131 CI F F BoC CllBr step A C Nc step 5)- O H H k4lH Me Me Me Int-19i Int-20a FInt-20b 00 step C NF step D H F AN FMe F Int-20c Compound 37 Step A - Preparation of Compound Int-20a To a 40 mL vial was added Int-19i (329 mg, 0.898 mmol), bis(pinacolato)diboron (228 mg, 0.898 mmol), Pd(dppf) 2 Clrdichloromethane (146 mg, 0.18 mmol), and KOAc (264 mg, 2.7 mmol). The vial was degassed, refilled with N 2 , and capped. Dioxane was added via a syringe and the solution was allowed to stir at 90 0 C for 2 hours. (2S,4R)-tert-butyl-2-(5-bromo-1IH-imidazol-2-yl)-4-fluoropyrrolidine 1-carboxylate praline (300 mg, 0.90 mmol), Pd(dppf) 2 Clydichloromethane (83 mg, 0.1 mmol), and K 2

CO

3 (1M, 3.3 mL, 3.3 mmol) were added and the reaction was allowed to stir at 90 0 C for 2 hours. The reaction mixture was cooled to room temperature, diluted with 5 mL EtOAc, and the aqueous layer was separated and extracted with 3 mL EtOAc. The combined organic extracts were dried over anhydrous Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using flash column chromatography on silica gel (24 g, 15% to 70% of EtOAc in Hexane) to provide Compound Int-20a (387 mg, 79.7%). Step B - Preparation of Compound Int-20b To a 40 mL vial was added Int-20a (182 mg, 0.336 mmol), bis(pinacolato)diboron (89.7 mg, 0.353 mmol), Pd 2 (dba)r CHCl 3 (35 mg, 0.034 mmol), X-phos (32 mg, 0.067 mmol), and KOAc (98 mg, 1.0 mmol). The vial was degassed, refilled with N 2 , and capped. Dioxane was added via a syringe and the solution was allowed to stir at 120 0 C for 2 hours. (S)-tert-butyl-2-(5-bromo-1H-imidazol-2 yl)pyrrolidine-1-carboxylate (116.9 mg, 0.37 mmol), Pd(dppf) 2 C1r dichloromethane (28 mg, 0.034 mmol), and K 2

CO

3 (1M, 1.0 mL, 1.0 mmol) were added. The reaction was WO 2012/041014 PCT/CN2011/001638 132 allowed to stir at 80 *C for about 15 hours, then was cooled to room temperature. The aqueous layer were separated and extracted with 5 mL EtOAc. The organic extracts were combined and dried over Na 2

SO

4 , filtered and concentrated in vacuo. The residue obtained was purified using flash column chromatography on silica gel (43 g, A: dichloromethane; B: 10% MeOH in EtOAc: A/B: 0% to 80%) to provide Compound Int 20b (191 mg, 89.9%). Step C - Preparation of Compound Int-20c To a 40 mL vial was added Int-20a (190 mg, 0.256 mmol), MeOH (2 mL), and HCl (4M in dioxane, 6 mL, 24 mmol). The solution was allowed to stir at room temperature for two hours, then was concentrated in vacuo and the residue obtained was dried in vacuo for 30 minutes to provide Compound Int-20c, which was used without further purification. Step D - Preparation of Compound 37 To a 40 mL vial was added Int-20c (- 0.256 mmol), (S)-2 (methoxycarbonylamino)-3-methylbutanoic acid (90.0 mg, 0.512 mmol), HATU (214 mg, 0.56 mmol), and DMF (3 mL). The resulting solution was cooled to 0 *C and DIPEA (0.32 ml, 1.79 mmol) was added. The reaction was allowed to stir at 0 *C for 2 hours, then was diluted with water (0.2 mL) and the resulting solution was purified using a C18 column (43g, 10% to 60%, of CH 3 CN in water with 0.05% TFA) to provide Compound 37 (46 mg, 21.4% from Int-20b). MS 874.4 [M+H]* The following Compounds of the present invention were made using the method described in Example 20. Compound Structure MS o ' Ao" 864.3

HIC

WO 2012/041014 PCT/CN201 1/001638 133 62 Hr)~ 83. FJ N N

H

3 C ' H [M+H]+ 0 o& N)KN N 0y -N-or 856.3 63 H N N hlN N H &* -o H2 [M+H]+

H

3 C F N0 (o F No' 856.4 H N :\ F H N N N H - [M+H]+

H

3 C 66 N~ Hk0 F N N)c 874.3 IJLN rH' 676 N N F H - 'N [M+H]+

H

3 C NH r 856.4 67 NN ) H [M+H]+

H

3 C H) 0 N-V 856.4 32 N ,N H F- Hi~N~ [M+H]+

H

3 C H NC 69 N 07\H HN. N F /N oA o 9. F -o [M ]+

H

3 C F F 0~ NX- 8790.5 rY H CH 1M1+H WO 2012/041014 PCT/CN2011/001638 134

H

3 COk: HN 900.5 92 H NH 0 (S) 92N N'-JN 93 F C= [M+H]* H3CO N 900.5 93 N0H 96r. FOCH 3 [M+H]* EXAMPLE 21 Preparation of Intermediate Compound Int-21a CI BrC Br H HO Int-19h Int-21a To a 20 mL microwave vial was added Int-19h (1.16 g, 3.41 mmol), anhydrous toluene (15 mL), cyclopropane-carboxaldehyde (1.28 mL, 17.1 mmol), and p toluenesulfonyl chloride (65 mg, 0.34 mmol). The vial was capped and sealed, then placed in a microwave reactor and heated to 170 *C for three hours. The reaction mixture was cooled to room temperature and concentrated in vacuo. The residue obtained was dissolved in dichloromethane (40 mL) and filtered through a short pad of Celite. The filtrate was concentrated in vacuo and purified using flash column chromatography on silica gel (80 g, hexane) to provide Compound Int-21a (778 mg, 58.1%). EXAMPLE 22 Preparation of Intermediate Compound Int-22c WO 2012/041014 PCT/CN2011/001638 135 CI Br Br < O int-22c Step A - Preparation of Compound Int-22a CI Br -NCS Br N Br 1:1 CH 2

CI

2 - rN Br HHOTHIF HH HO HO Int-19b Int-22a Int-19b (5.82 g, 0.016 mmol) was dissolved in dichloromethane (50 mL) and THF (50 mL) and the mixture was allowed to stir at room temperature until all solids dissolved. The resulting solution was cooled in an ice-water bath for 30 minutes, after which NCS (2.13 g, 0.016 mmol) was added to the stirred reaction mixture in portions over -10 minutes. The reaction mixture was allowed to stir at 0 *C for 30 minutes and then at room temperature for 2 hours. The reaction mixture was concentrated in vacuo to provide a brown semi-solid, which was dissolved in dichloromethane (-300 mL). The organic solution was washed sequentially with water (1 x -200 mL), 10% (w/v) aq. sodium thiosulfate (1 x -200 mL), and brine (1 x -200 mL), then dried over anhydrous magnesium sulfate, filtered, and concentrated in vacuo. The resulting solid residue was purified using column chromatography (330 g Teledyne-Isco RediSep* silica column, 0-30% EtOAc/hexanes over 12 column volumes at 200 mL/min) to provide 2.97 g of Int-22a (47% yield) as a brown solid. MS (ESI) m / e (M+H*): 400. Step B - Preparation of Compound Int-22b Br Cl >-CHO Br CI Br p-TsCI, toluene N Br H HO microwave, 170 *C 0 Int-22a n Int-22b WO 2012/041014 PCT/CN2011/001638 136 In a 20-mL microwave tube, Int-22a (1.075 g, 2.68 mmol) was dissolved in dry toluene (13 mL). Cyclopropanecarboxaldehyde (1.0 mL, 0.94 g, 13.4 mmol),p toluenesulfonyl chloride (51 mg, 0.27 mmol), and a magnetic stir bar were added. The tube was sealed and the reaction mixture was heated at 170 'C (microwave) with stirring for 3 hours. The reaction mixture was cooled to room temperature, the tube opened, and further aliquots of each of cyclopropanecarboxaldehyde (1.0 mL, 0.94 g, 13.4 mmol) and p-toluenesulfonyl chloride (51 mg, 0.27 mmol) were added. The tube was re-sealed and the reaction was again subjected to microwave heating at 170 'C for 4 hours, then cooled to room temperature and concentrated in vacuo to provide a brown solid residue. The brown solid residue was adsorbed onto silica gel (19 g) using EtOAc (-100 mL), followed by evaporation of the solvent, and then loaded onto a 100 g Biotage* KP-Sil SNAP cartridge. Elution with 100% hexanes over 13 column volumes at 85 mL/min provided 600 mg of Int-22b (50% yield) as a light brown solid. MS (ESI) m / e (M+H): 452. EXAMPLE 23 Preparation of Compound 23A MeO kN N SN OMe (S) Aom 23A Step A - Preparation of Compound Int-23a Br Br BrBr PhCHBr 2 Br H HO K 2 C03 O Int-19b Int-23a WO 2012/041014 PCT/CN2011/001638 137 A mixture of Compound Int-19b (1.1 g, 3 mmol), (dibromomethyl)benzene (2.25 g, 9 mmol) and K 2 C0 3 (1.2 g, 9 mmol) in 15 mL of DMF was heated to 100 'C and allowed to stir at this temperature for 3 hours. The reaction mixture was cooled to room temperature, concentrated in vacuo and the residue obtained was dissolved with dichloromethane and water. The aqueous phase was extracted with dichloromethane. The combined organic extracts were washed with brine, dried over Na 2

SO

4 , filtered and concentrated in vacuo. The resulting residue was purified using flash column chromatography on silica gel to provide Compound Int-23a (380 mg, 28 %) as a white solid. 'H NMR (CDCl 3 ): 6 7.72 (bs, I H), 7.44 - 7.46 (d, J= 8.4 Hz, 1 H), 7.21 - 7.28 (in, 3 H), 7.09 - 7.12 (in, 3 H), 7.04 (s, 1 H), 6.99 - 7.01 (bs, J= 6.8 Hz, 2 H), 6.78 (s, 1 H), 6.63 - 6.65 (d, J= 8.4 Hz, 1 H). MS (ESI) m/e (M+H): 456. Step B - Preparation of Compound Int-23b Br B B / Br Pd(dppf)C1 2 0 -B NKOAc N 9tB Int-23a Int-23b To a solution of Int-23a (456 mg, 1.0 mmol) in 1,4-dioxane was added bis pinacol borate (2.2 mmol) , Pd(dppf)C1 2 (0.04 mmol) and KOAc (4 mmol). The reaction mixture was put under N 2 , heated to 110 C and allowed to stir at this temperature for 3 hours. The reaction mixture was cooled to room temperature, concentrated in vacuo, and the residue obtained was purified using column chromatography on silica gel to provide Compound Int-23b (590 mg, 87 % yield). 'H NMR (CDCl 3 ): 5 8.13 (s, 1 H), 7.60 (d, J= 7.6 Hz, 1 H), 7.52 (d, J= 8.0 Hz, 1H), 7.36 - 7.39 (m, 1 H), 7.14 -7.19 (in, 4 H), 6.93 6.95 (m, 3 H), 6.90 (s, 1 H), 1.26 - 1.29 (s, 24 H). MS (ESI) m / e (M+H+): 550.

WO 2012/041014 PCT/CN2011/001638 138 Step C - Preparation of Compound Int-23c 9 8 N I - P Pd(dppf)C1 2 H 0aCO BocH '-NCN O Ot H~o' e e BOc' Int-23b Int-23c A suspension of Int-23b (550 mg, 1.0 mmol), tert-butyl 2-(2-bromo-1H imidazol-5-yl) pyrrolidine-1-carboxylate (2.4 mmol), Pd(dppf) Cl 2 (200 mg), Na 2

CO

3 (3 mmol) and in THF/H 2 0 (10:1, 33 mL) was allowed to stir at reflux for about 15 hours under N 2 . The reaction mixture was cooled to room temperature and filtered, and the filtrate was washed with water (50 mL) and extracted with EtOAc (100 mL). The organic extract was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting residue was purified using column chromatography on silica gel to provide Compound Int-23c (160 mg). MS (ESI) m / e (M+H*): 768. Step D - Preparation of Compound Int-23d NN HCI NN Bo H I 'C I HC H I ' ~ ' Bo -N '' N . N, N.. 0 H o H Boc' HN int-23c Int-23d Int-23c (0.10 g, 0.13 mmol) was added to HCl/CH 3 0H (5 mL, 3M) and the resulting reaction was allowed to stir at room temperature for about 3 hours. The reaction mixture was then concentrated in vacuo to provide Compound Int-23d, which was used without further purification. MS (ESI) m / e (M+H*): 568.

WO 2012/041014 PCT/CN2011/001638 139 Step E - Preparation of Compound 23A MeuN'j 0 C;N H N , N H h 1 H BopDIEA N N OMe H ) H N N~ Int-23d Compound 23A To a solution of Int-23d (56.8 mg, 0.10 mmol), (S)-2 (methoxycarbonylamino)-3-methylbutanoic acid (35.0 mg, 0.20 mmol) and DIPEA (0.8 mmol) in CH 3 CN (1 mL) was added BOP (98 mg, 0.22 mmol). The resulting reaction was allowed to stir at room temperature and monitored using LC/MS. After LC/MS showed the starting material to be consumed, the reaction mixture was filtered, and the filtrate was purified using HPLC to provide Compound A as a white solid. 1H NMR (MeOD): 6 7.94 (s, 1 H), 7.85 (d, J= 8.0 Hz, 1 H), 7.74 (s, 1 H), 7.63 (s, I H), 7.48 (s, 1 H), 7.35 - 7.37 (m, 2 H), 7.31 (s, 1 H), 7.17 - 7.18 (m, 4 H), 7.11 (s, 1 H), 6.96 - 6.98 (d, J = 7.6 Hz, 2 H), 5.09 - 5.17 (m, 2 H), 4.13 (t, J 8.0 Hz, 2 H), 3.99 (bs, 2 H), 3.78 (bs, 2 H), 3.56 (s, 6 H), 2.44 - 2.47 (m, 2 H), 1.92 - 2.19 (in, 8 H), 0.77 - 0.85 (m, 12 H). MS (ESI) m / e (M+H'): 882. The diastereomers were separated on a chiral SFC column: Isomer A: 'H NMR (MeOD): 6 8.08 (s, 1H), 7.91 - 7.93 (in, 1 H), 7.72 (s, I H), 7.56 (s, I H), 7.24 - 7.43 (m, 7 H), 7.19 (s, 1 H), 7.03 - 7.05 (m, 2 H), 5.16 - 5.24 (in, 2 H), 3.81 4.21 (m, 6 H), 3.62 (s, 6 H), 2.52 - 2.54 (in, 2 H), 2.00 - 2.25 (m, 8 H), 0.84 - 0.91 (m, 12 H). MS (ESI) m/z (M+H)*: 882. Isomer B: 1H NMR (MeOD): 6 7.90 (s, 1 H), 7.81 - 7.83 (m, 1 H), 7.72 (s, I H), 7.62 (s, 1 H), 7.45 (s, 1 H), 7.14 - 7.33 (in, 6 H), 7.09 (s, I H), 6.93 - 6.95 (in, 2 H), 5.06 - 5.14 (m, 2 H), 3.71 - 4.11 (in, 6 H), 3.52 (s, 6 H), 2.41 - 2.44 (in, 2 H), 1.90 - 2.15 (m, 8 H), 0.74 - 0.86 (in, 12 H). MS (ESI) m/z (M+H)*: 882.

WO 2012/041014 PCT/CN2011/001638 140 The Compounds of the present invention depicted in the table below were made using the method described in Example 23 and substituting the appropriate dibromotoluene derivative in Step A

H

3 CO N H OCH 3 N IIN y-x Cpd W X Y Z MS 95 CH CH C(OCH 3 ) CH 912 99 CH CH CF CH 900 916, 103 CH CH CCl CH 918 104 CH CH C(CF 3 ) CH 950 108 CH N CH CH 883 109 N CH CH CH 883 110 CH CF CH CH 900 916, 117 CH CCl CH CH 918 121 CH CH N CH 883 125 CH CH C(OCF 3 ) CH 966 126 CH CF CF CH 918 129 CH CH C(CH 3 ) CH 896 130 CCl CH CH CH 916, 918 133 CF CF CH CH 918 136 CH CH CCN CH 907 WO 2012/041014 PCT/CN2011/001638 141 143 CH CF CH CF 918 145 CH C(OCH 3 ) CH CH 912 149 CF CH CH CH 900 150 CH C(CF 3 ) CH CH 950 153 CF CH CH C(OCH 3 ) 930 EXAMPLE 24 Preparation of Compound 16 16 Step A - Preparation of ComipoundlInt-24b 00 Br Br 3~O~ BrC Int-24a Int-24b To a solution of Compound Int-24a(1.48 g, 3.76 mmol) in 11 mL THF at -78 0 C was added n-BuLi (2.5 M in hexane, 1.66 mL, 4.14 mmol). The reaction was allowed to stir at -78 0 C for 30 minutes, then 2-chloro-N-methoxy-N methylacetamide(1.1 g, 7.52 mmol) in 2 mL of THF was added at -78 *C . The reaction was allowed to stir for 1 hour at -78 0 C, then was quenched with saturated aqueous

NHI

4 Cl. The resulting solution was extracted with EtOAc and the organic extract was washed with brine solution, dried (Na 2

SO

4 ), filtered and concentrated in vacuo. The resulting residue was purified using an ISCO 80 g column (hexane to 50% EtOAc-hexane, gradient) to provide Compound Int-24b, 503 mg (35%). LRMS: (M+H)* = 390.

WO 2012/041014 PCT/CN2011/001638 142 Step B - Preparation of Compound Int-24d + HBr Int-24b Int-6f Int-24c To a solution of Compound Int-24b (97 mg, 0.25 mmol) and Int-6f (91 mg, 0.38 mmol) in DMF (2 mL) was added Cs 2

CO

3 (163 mg, 0.50 mmol). The resulting reaction was heated to 40 'C, allowed to stir at this temperature for I hour, then cooled to 25 'C. The reaction mixture was poured into ice-water and the organic phase was extracted with EtOAc. The organic extract was washed with brine, dried (Na 2

SO

4 ), filtered and concentrated in vacuo. The residue obtained was purified using an ISCO 24 g column (gradient from hexane to 40% EtOAc in hexane) to provide Compound Int-24c, 135 mg (91%). Step C - Preparation of Compound Int-24d Br Boc BrCc Int-24c Int-24d To a solution of Compound Int-24c (135 mg, 0.23 mmol) in o-xylene (2 mL) was added ammonium acetate (107 mg, 1.38 mmol) and the resulting reaction was allowed to stir at 140 'C for 3 hours. After being cooled to 25 *C, the reaction mixture was added to aqueous NaHCO 3 solution and the organic layer were extracted with EtOAc. The combined organic solutions was washed with brine, dried (Na 2

SO

4 ), filtered and concentrated in vacuo. The residue obtained was purified using an ISCO 24 g column (gradient from hexane to 50% EtOAc in hexane) to provide Compound Int-24d, 84 mg (64%). LRMS: (M+H)*= 575 Step D - Preparation of Compound Int-24g WO 2012/041014 PCT/CN2011/001638 143 Br 0c + /\ Br o H nt-7d Int 24g To a solution of Compound Int-24d (81 mg, 0.14 mmol), bis pinacolatodiborane (53 mg, 0.21 mmol), PdCI 2 (dppf) 2

CH

2

CI

2 complex (11.5 mg, 0.014 mmol) in 1,4-dioxane (2 mL) was added potassium acetate (41 mg, 0.42 mmol). The reaction was degassed and allowed to stir at 100 *C for 2 hours. After being cooled to 25 *C, the reaction mixture was diluted with EtOAc and filtered through a Celite pad. The filtrate was concentrated in vacuo to provide Compound Int-24f, which was combined with Int-7d (66 mg, 0.21 mmol), and PdCI 2 (dppf) 2

CH

2

CI

2 complex (11.5 mg, 0.0 14 mmol) and dissolved in 1,4-dioxane (2 mL). The resulting solution was treated with aqueous 2 M Na 2

CO

3 solution (0.21 mL, 0.42 mmol) and the reaction mixture was degassed and allowed to stir at 100 *C for 2 hours. After being cooled to 25 0 C, the reaction mixture was diluted with EtOAc and filtered through a Celite pad. The filtrate was concentrated in vacuo and the residue obtained was purified using an ISCO 24 g column (gradient from 0% to 100% EtOAc in hexane) to provide Compound Int-24g (40 mg, 39%). LRMS: (M+H) = 732. Step E - Preparation of Compound Int-24h Int-24g Int-24h WO 2012/041014 PCT/CN2011/001638 144 To a 0 *C solution of Compound Int-24g (40 mg, 0.054 mmol) in dichloromethane (2 mL) was added TFA (0.4 mL). The reaction was allowed to stir at 0 'C for 0.5 hours and then was warmed to 25 'C and allowed to stir for 2 additional hours. The reaction mixture was concentrated in vacuo and the residue obtained was dissolved in MeOH (2 mL) followed by addition of 4N HCI in dioxane (0.3 mL). The solution was concentrated in vacuo to provide Compound Int-24h as its HCI salt (40 mg), which was used without further purification. LRMS: (M+H)* = 532. Step F - Preparation of Compound 16 HOH NHCO2 Int-24h Int-la 16 To a -30 'C solution of Compound Int-24h (41 mg, 0.068 mmol), Compound Int-la (36 mg, 0.20 mmol), and diisopropylethylamine (83 IL, 0.48 mmol) in DMF (1.5 mL) was added HATU (103 mg, 0.27mmol). The mixture was allowed to stir at -30 'C to 0 'C for 1 hour and for an additional 2 hours at 0 'C. The reaction was then quenched by addition of cold water and the resulting mixture was purified using Gilson HPLC (CH3CN-H20, 0.1% TFA) to provide Compound 16. Compound 16 was dissolved in MeOH (10 mL) and treated with 4N HCL in dioxane (0.3 mL) followed by concentration in vacuo to provide the HCI salt of Compound 16 as a -1: 1 mixture of diastereomers, 16 mg (28%). The diastereomers were separated by chiral HPLC using Chiral OD (Lux Cellulose-1) Semi-prep column (20% EtOH-hexane, 0.1% DEA) to provide Compound 16A (retention time: 44 minutes), 6 mg, and Compound 37B (retention time : 66 minutes), 3 mg. EXAMPLE 25 Preparation of Compound 17 WO 2012/041014 PCT/CN2011/001638 145 H N H N C N 0 0 H'N a HN-I N H0 17 Step A - Preparation of Compound Int-25a O Boc Br C H Br N0 HOlj Ek0 ~_N N/~ 00 Int-24b Int-25a Compound Int-25a was prepared from Compound Int-24b using the method described in Example 24, Step B (100%). Step B - Preparation of Compound Int-25b Br o Boc Br Int-25a Int-25b !7 Compound Int-25b was prepared from Compound Int-25a using the method described in Example 24, Step C yield (45%). LRMS (M+H)* = 589. Step C - Preparation of Compound Int-25d WO 2012/041014 PCT/CN2011/001638 146 00 Br oc B r N H B o Int-25b Int-25c Boo ~H~Br H\ N Pooo + N~ H N /r O N I Int-7d Int-25d Compound Int-25d was prepared from Compound Int-25b using the method described in Example 24, Step D yield (44%). LRMS: (M+H) t 746. Step D - Preparation of Compound Int-25e Boo H ~HN N H N N N H N /N N H -N H/ B~4oo HNN HN- N 0 Int-25d Int-25e Compound Int-25e was prepared from Compound Int-25d using the method described in Example 24, Step Eyield (100%). Step E - Preparation of Compound 17 t7 H N HO~cf;-NHCO0e H N I L.F'N H~ H N 0 ~ Int-25e mnt-1 a Cmpdj 17 Compound 17 (HCI salt) was prepared from Compound Int-25e using the method described in Example 24, Step F yield (50%). The diastereomers were separated by chiral HPLC using Chiral Lux C-2 Semi-prep column (50% EtOH-hexane, 0. 1% DEA) to provide Compound 17A (retention time: 45 minutes) and Compound 17B (retention time: 59 minutes).

WO 2012/041014 PCT/CN2011/001638 147 EXAMPLE 26 Preparation of Compound 23 N) O F 23 Step A - Preparation of Compound Int-26a 0 Boc HO Br CFF B N 0r ~~N~ /FN HI. FF Int-24b Int-26a Compound Int-26a was prepared from Compound Int-24b using the method described in Example 24, step B (87%). Step B - Preparation of Compound Int-26b Br O F Br

-

0 H H N' 0 F N0 FF Int-26a Int-26b F Compound Int-26b was prepared from Compound Int-26a using the method described in Example 24, step C (72%). LRMS (M+H)= 585. Step C - Preparation of Compound Int-26d WO 2012/041014 PCT/CN2011/001638 148 Br ~ N BoL B / Bo 0N HN N~O HN Int-26b F F Int-26c F -F Boc Br N N HN Br O -- </f N 11HlHN BoN H 0 Int-7d F Int-26d F To a solution of Compound Int-26b (243 mg, 0.42 mmol), bis-pinacolato diborane (127 mg, 0.50 mmol), PdCl 2 (dppf) 2 CH2C 2 complex (34 mg, 0.042 mmol) in 1,4-dioxane (3 mL) was added potassium acetate (83 mg, 0.84 mmol). The mixture was degassed and allowed to stir at 100 'C for 2 hours. After being cooled to 25 'C, Int-7d (265 mg, 0.84 mmol), PdCl 2 (dppf) 2

CH

2 Cl 2 complex (34 mg, 0.042 mmol), and K 2 CO3 (IN aqueous solution, 1.2 mL, 1.2 mmol) were added. The mixture was degassed and allowed to stir at 90 'C for 18 hours. After being cooled to 25 *C, the mixture was diluted with EtOAc and filtered through a Celite pad. The filtrate was concentrated in vacuo and the residue obtained was purified using Prep TLC (5% MeOH in CH 2 Cl 2 ) to provide Int-26d, 146 mg (47%). LRMS: (M+H)* = 742. Step D - Preparation of Compound Int-26e Boc H NHN H N I /N H I / N 0 HN -~ HN 1 N F F Int-26d F Int-26e F Compound Int-26e was prepared from Int-26d using the method described in Example 24, step E (100%). LRMS: (M+H)*= 542.6. Step E - Preparation of Compound 23 WO 2012/041014 PCT/CN2011/001638 149 H N \'Ak0.4 N N HO 2

HNHCO

2 Me N /N L"N I -. = 0 H (s) N N F N N H,~q Int-26e Int-la 23 F Compound 23 (HCl salt) was prepared from Compound Int-26e using the method described in Example 24, step F (53%). The diastereomers were separated by chiral HPLC using Chiral Lux C-2 Semi-prep column (50% EtOH-hexane, 0.1% DEA) to provide Compound 23A (retention time: 16 minutes) and Compound 23B (retention time: 27 minutes). EXAMPLE 27 Preparation of Compound 26 H NN L. N N 0I1~ 26 Step A - Preparation of Compound Int-27a BrC 0 Boc Br Boc 0)- Ci Si-. 0 Int-24b Int-13e Int-27a Compound Int-27a was prepared from Compound Int-24b using the method described in Example 24, step B (85%). Step B - Preparation of Compound Int-27b Br Br Int-27a Int-27b WO 2012/041014 PCT/CN2011/001638 150 Compound Int-27b was prepared from Compound Int-27a using the method described in Example 24, step C (75%). LRMS (M+H)* = 593. Step C - Preparation of Compound Int-27d B r Ncu k\ ~ ~ o F , \ o N~ N~J §,I BocH Int-27b F / Int-27c Boc Boc -Y r C 4 Boc Br~~ HH/'Jj Int-7d Int-27d Compound Int-27d was prepared from Compound Int-27b using the method described in Example 24, step D (40%). LRMS (M+H)* = 750. Step D - Preparation of Compound Int-27e ___ H N N N N. H I " HN N.. N 0 NN HHR) I Int-27e Int-27d Compound Int-27e was prepared from Compound Int-27d using the method described in Example 24, step E (100%). LRMS: (M+H)*= 550. Step E - Preparation of Compound 26 WO 2012/041014 PCT/CN2011/001638 151 H N O N, IH N 'N 0 H NA Int-27e Cmpd 26 Compound 26 (HCI salt) was prepared from Compound Int-27e using the method described in Example 24, step F (50%). The diastereomers were separated by chiral HPLC using a Chiral Lux C-2 Semi-prep column (35% EtOH-hexane, 0.1% DEA) to provide Compound 26A (retention time: 38 minutes) and Compound 26B (retention time:50 minutes). EXAMPLE 28 Preparation of Compound 240 0 N O O H )=N H

H

3 C F Cmpd 240 Step A - Preparation of Compound Int-28c B(OH)2 B CI Boc 2 Boc 0 2 N Int-28a Int-28b Int-28c A solution of Int-28a (13.2 g, 46mM), Int-28b (9.Og, 38 mM), Pd(PPh 3

)

4 (4.4 g, 3.8 mM), K 2 CO3(13.1g, 95 mmol) in 28 mL H 2 0 and 140 mL DME was purged with nitrogen. The reaction was allowed to stir at refluxed for 3 hours. Another portion of boronic acid (0.5 equiv.), Pd(PPh 3

)

4 (0.01 eq) were added and the reaction was allowed to stir at reflux for an additional 4 hours. The reaction mixture was diluted with EtOAc and filtered through a small Celite plug. The filtrate was concentrated in vacuo and the WO 2012/041014 PCT/CN2011/001638 152 residue obtained was purified using flash LC ( 0%-10% EtOAc/Hexane) to provide Compound Int-28c (14.5 g). MS (ESI) m / e (M+Na*): 425. Step B - Preparation of Compound Int-28d 0CI 1.TFA ~ CI OKC 2 Zn NH 4 CI KC SN N Boc NO 2 H NH 2 Int-28c Int-28d To a suspension of Compound Int-28c (2 g, 5 mM) in CH 2

CI

2 (8 mL), TFA (4 mL) was added dropwise and the reaction was allowed to stir at room temperature for 14 hours. The reaction mixture was concentrated in vacuo and the resulting residue was suspended in a solvent mixture of THF (25 mL), ethanol (6 mL) and water (2.5 mL). Zn dust (3.25 g, 50 mmol) and NH4C (1.3 g, 25 mmol) were added and the reaction was allowed to stir at reflux for 1 hour. The reaction mixture was diluted with EtOAc and filtered through a small Celite plug. The filtrate was washed with water and brine, dried over MgSO 4 , filtered and concentrated in vacuo to provide Compound Int-28d (1.9 g). MS (ESI) m / e (M+H*): 273. Step C - Preparation of Compound Int-28e 1. SelectF F -2. AC 2 0 '" O/CI - O CI

H

2 N H H2N N Int-28d Int-28e To a suspension of Int-28d (1 g, 3.6 mM) in DMSO (5 mL)/ Acetonitrile (5 mL) was added Select-F (1.53 g, 4.3 mmol). The reaction was allowed to stir for 30 minutes, then was diluted with EtOAc and washed with water and brine, and the organic phase was dried over MgSO 4 , filtered and concentrated in vacuo. The residue obtained was suspended in acetic anhydride (4 mL) and allowed to stir at room temperature for 2 hours. The reaction mixture was then diluted with EtOAc and washed with NaHCO 3 WO 2012/041014 PCT/CN2011/001638 153 solution and water. The organic phase was dried over MgSO 4 , filtered and concentrated in vacuo and the residue obtained was suspended in EtOAc (10 mL). To the resulting suspension was added 4M HCl in dioxane (4 mL) and the reaction was allowed to stir at room temperature for 2 hours. The reaction mixture was filtered and the collected solid was washed with hexane, then recrystallized from ethanol to provide Compound Int-28e (200 mg). MS (ESI) m / e (M+H*): 315. Step D - Preparation of Compound Int-28f F 1. BBr 3 O F a2. Tf 2 O 'B O- CI 3.bron -B CI N N Int-28e Int-28f To a 0 'C suspension of Int-28e (200 mg, 0.63 mM) in CH 2 Cl 2 (5 mL) was added IM solution of BBr 3 in CH 2 Cl 2 (5 mL) at 0 'C. The reaction was allowed to stir at 0 'C for 1.5 hours, then an additional 5 mL of IM solution of BBr 3 in CH 2 Cl 2 was added and the reaction was heated to 40 *C and allowed to stir at this temperature for 5 hours. The reaction mixture was then diluted with EtOAc (200 mL) and the resulting solution was washed with NaHCO 3 solution and NaOH solution. The organic layer was then washed with water and brine, dried over MgSO 4 , filtered and concentrated in vacuo to provide a residue which was subsequently suspended in CH 2

CI

2 (5 mL) cooled at 0 'C. To this solution was added Et 3 N (0.6 mL) and Tf 2 O (0.5 mL) and the resulting reaction was allowed to stir at 0 'C for 1.5 hours. The reaction was then diluted with dichloromethane and quenched with 10 % citric acid. The organic layer was washed with water and brine, dried over MgSO 4 , filtered and concentrated in vacuo. The residue obtained was suspended in dioxane (8 mL) and to the resulting solution was added bis pinacolatodiborane (265 mg), PdCl 2 (dppf) 2

CH

2

CI

2 complex (26 mg) and potassium acetate (206 mg). The mixture was degassed, purged with nitrogen and allowed to stir at 100 'C for 1.6 hours. The reaction mixture was cooled to 25 'C, diluted with EtOAc and filtered through a Celite pad. The filtrate was concentrated in vacuo and the residue WO 2012/041014 PCT/CN2011/001638 154 obtained was purified using flash LC (0-100 % EtOAc-Hex) to provide Compound Int 28f (100 mg). Step E - Preparation of Compound 240 0 YO O F OQ N F 0 N O ' O C1 H N H N N HF Int-28f 240 Compound 240 was prepared from Compound Int-28f using the method described in Example 20. EXAMPLE 29 Preparation of Intermediate Compound Int-29a 1. 0 0 1 O O CI C H H 2 N 2. HCI N Int-28d Int-29a To a suspension of Compound Int-28d (0.51 g, 1.87 mmol) in CH 2 Cl 2 (3 mL) was added cyclopropyl anhydride (2 mL). The resulting reaction was allowed to stir at room temperature for 2 hours, then a solution of 4M HCl in dioxane ( 3 mL) was added and the reaction was allowed to stir at room temperature for 2 hours. The reaction mixture was then filtered and the collected solid was washed with hexane and dried in vacuo to provide Compound Int-29a (590 mg). MS (ESI) m / e (M+H*): 323. EXAMPLE 30 WO 2012/041014 PCT/CN2011/001638 155 C O Step 1 H3CI- N CI A6CI OH H Int-30a Int-30b Int-30c Br SC r Step 4 CI CI H HO Int-30d Int-30e Int-30f Step A Commercially available phenol Int-30a (125.g, 73.3 mmol), hydrazine Int-30b (13.1 g, 73.3 mmol) and methanol (200 mg) were charged to a 500 mL flask. To the suspension was added potassium acetate (14.5 g, 148 mmol) and the resulting reaction mixture was allowed to stir at reflux. After 3 hours, the reaction was cooled, and the solid collected by filtration, washed with methanol (50 ml) and water (2x50 ml), and dried in vacuo to provide hydrazone Int-30c as a slightly orange solid (18.5 g, 50%). Step B Int-30c (18.5 g, 62.7 mmol) and polyphosphoric acid (50 g) were added to a 250 mL flask equipped with mechanical stirrer. The mixture was allowed to stir at 120 'C for 30 minutes and cooled to room temperature. To the mixture were added ice and water. The solid was collected by filtration, washed with water (2x 100 ml) and then dissolved in ethyl acetate (200 ml), and washed with water (2x200 ml) again. The solution was then dried over sodium sulfate, and concentrated in vacuo to provide Indole Int-30d as a solid (17 g, 98%). Step C Indole Int-30d (18.3 g, 65.8 mmol), cesium carbonate powder (356.6 g, 117 mmol), and DMSO (100 ml) were charged into a 500 mL flask. To the resulting suspension was added diiodomethane (134.4 g, 36 mmol) via a syringe. The reaction mixture was allowed to stir at room temperature for about 15 hours, treated with water WO 2012/041014 PCT/CN2011/001638 156 (300 ml) and filtered. The solid was purified using a 120 g silica column/Combi-Flash Rf system using a gradient of 0-20% ethyl acetate in hexanes to provide Int-30e as a white solid (8.5 g, 45%). Step D Int-30e (2.4 g, 8.27 mmol), NBS (1.47 g, 8.27 mmol), and THF (50 ml) were added to a 100 mL flask and stirred at room temperature. After 5h the reaction was concentrated in vacuo to a semi-solid and the residue was treated with water (100 ml), stirred at room temperature for about 15 hours, and filtered. The filter cake was washed with water (3X20 ml) and dried to provide indole Int-30f as a pale solid (2.7 g, 88%). EXAMPLE 31 Preparation of Compound 1525 & Compound 1541 ,\ 0 cB Br + Step1 IC H C '-0 I C I Br \_0 H Int-30f Int-31a Int-31b Int-7h / \ O Step O N) N I H NNO O UZN \ - / T 'N H N N N H \O H Compound 1525 NO Step 3 O' N); O H N Us N 0N -' H N N H 0 Compound 1541 Step A WO 2012/041014 PCT/CN2011/001638 157 To a 35 mL microwave reaction tube were added Int-30f (500 mg, 1.36 mmol), bis(triphenylphosphine)palladium (II) dichloride (95 mg, 0.135 mmol), copper iodide (258 mg, 1.355 mmol), and DMF (10 mL). The resulting suspension was degassed and heated to 100 'C, and then Int-31a was then added in portions via a syringe. The resulting mixture was allowed to stir at 100 *C for additional 6 hours under nitrogen. After cooling, the solution was diluted with 10 mL of ethyl acetate, filtered, and concentrated in vacuo. The residue was purified using a 40 g silica column/Combi-Flask Rf system (0-15% ethyl acetate in hexanes eluent) to provide Int-31b as a wax (370 mg, 65%). Step B Int-31b (120 mg, 0.286 mmol), bis(pinacolato)diboron (152 mg, 0.6 mmol), potassium acetate (280 mg, 2.86 mmol), Pd 2 (dba) 3 -CHCl 3 (59.1 mg, 0.057 mmol), X-PHOS (54.4 mg, 0.114 mmol), and dioxane (4 ml) were added to a 35 mL microwave reaction tube. The sealed mixture was degassed and stirred at 110 'C under nitrogen atmosphere for 8 hours then cooled to room temperature. To this mixture were added bromide Int-7h (246 mg, 0.658 mmol), PdCl 2 (dppf)-CH 2 Cl 2 (46.7 mg, 0.0057 mmol), 1.5 M aqueous solution of sodium carbonate (1.9 ml, 2.9 mmol). The resulting mixture was degassed and stirred at 95 'C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated, purified using Gilson reverse phase chromatography (10-80% acetonitrile in water with 0.1% TFA eluent) to provide Compound 1525 as a wax (68 mg, 20%). LC/MS anal. called. for: C 52

H

53

N

9 0 8 935.4; Found: 937.1 (M+H)*. Step C Compound 1525 (16 mg, 0.014 mmol) and 10% palladium on activated carbon (5 mg, 4.7 pM) were added to 8 mL of methanol in a 250 mL pressure vessel and the reaction was shaken at room temperature under 35 psi hydrogen atmosphere using PARR hydrogenation apparatus for 6 hours. The reaction mixture was filtered through celite, concentrated in vacuo to provide Compound 1541 as a solid (15 mg, 93%). LC/MS anal. calcd. for: C 52

H

6 1

N

9 0 8 939.4; Found: 939.7 (M+H)*.

WO 2012/041014 PCT/CN2011/001638 158 EXAMPLE 32 Preparation of Compound 752 e NHO n 3dN N ' N 'P-fN -' N N H - N/ tN N nrt-3d H - N A 4 NI NL int-32a Cmpd 752 A round bottom flask was charged with Int-32a (89 mg, 0.14 mmol), (R) 2-(diethylamino)-2-phenylacetic acid hydrochloride (66 mg, 0.32 mmol), HATU (58 mg, 0.153 mmol) and 2 mL DMF provided 50 mg (34%) of the title Compound 752 using the capping procedure as in Step D of Compound 752. LC-MS (M+H) 946.8. EXAMPLE 33 Preparation of Compound 1359 CI- rBr Br Int-19g Int-33a Chiral ~c Resolution I N Br xr c Int-7d Enantiomer A Enantiomer B Int-33b Int-33a' Int-33a" NI (S] N i A N //NHB VNH BO int-33c Int-33d Int-33e H cHa HC Oc0O N C - oiO CHp _6 H Int-33f Compound 1359 WO 2012/041014 PCT/CN2011/001638 159 Step A Cs-C0 3 (48.5g, 150 mmol)and dibromoethane (28g, 150mmol) was added to a stirred, solution of Int-19g (9.6g, 30mmol) in DMSO (100 mL) and the mixture was allowed to stir at 90 'C for for about 15 hours. The mixture was cooled, diluted with water (-200 mL). and extracted with EtOAc (3 x 1 OOmL). The combined organic extracts and a EtOAc washing was washed with brine (1 x 80 mL), dried over Na 2

SO

4 . The dried layer was evaporated, the solid residue solid was triturated with methylene chloride, filtered to provide first crop of Int-33a as off white solid (4.33g). The filtrate was purified using column chromatography on silica gel 330g column, eluting with Hex/EtOAc (0 to 10% then 20%) to provide the 2nd crop of Int-33a as a off white solid (2.5g) yield 62.3%. Step B Int-33a (6.4g) was resolved on SFC (Chiral AD, 30% MeOH/AcCN (2:1) in CO 2 , to provide Int-33a' (-3g) and Int-33a" (-2.8g). Step C Int-33a" (0.51 g, 1.463 mmol), bis(pinacolato)diboron 0.446 g, 1.755 mmol), KOAc(O.431 g, 4.40 mmol) and PdCl 2 (dppf) 2 (0.107 g, 0.146 mmol) were added into a microwave tube. After the flask was flashed with N 2 , dioxane (5 mL) was added. The mixture was allowed to stir at 95 'C for 4 hours. The crude Int-33b was used in the next step without purification Step D Int-7d (0.51 g, 1.61 mmol), PdCl 2 (dppf) 2 (0.107 g, 0.146 mmol) and

K

2

CO

3 (1 N aq., 5 ml) were added to the reaction mixture of above mentioned Int-33b . The tube was sealed and degassed and heated to 100 'C for about 15 hours. After cooling, EtOAc (30mL) was added and it was extracted with Brine (30 mL). The organic layer was separated and dried and concentrated in vacuo. The crude material was purified on a ISCO column (40 g) and eluted with Hex:EtOAc 0% to 70% to provide the Int-33c (350 mg, 45%).

WO 2012/041014 PCT/CN2011/001638 160 Step E Int-33c (160mg, 0.317 mmol), Pd 2 (dba) 3 , (44mg, 0.048 mmol), X-phos (45.3mg, 0.095 mmol), KOAc (93mg, 0.950 mmol), bis(pinacolato)diboron (88 mg, 0.349 mmol) and dioxane (3 mL) are added into a 25 mL sealed tube. After the tube was degassed in vacuo followed by flashing with N 2 for three times. The mixture was allowed to stir at 120 'C for for about 15 hours. LC-MS indicated that the reaction was complete, the crude product Int-33d was used in the next step without further purification. Step F Int-33d (131 mg, 0.392mmol), PdCI 2 (dppf) 2 , (26 mg, 0.036mmol) and 1 M K 2

CO

3 (-3 mL) were added to the above mentioned mixture of Int-7e. The mixture was allowed to stir at 90 'C for 4 hours. After cooling down, the aqueous layer was separated and extracted with 10 mL EtOAc. The organic layers were combined and dried over anhydrous Na 2

SO

4 . The solution was filtered and concentrated in vacuo. The product was purified using SiO 2 chromatography (24 g, solvent A: DCM; solvent B:0 50%) to provide Int-33e as desired product (95 mg, 37%). Step G I Int-33e (95 mg) was allowed to stir in dioxane (10 mL). HCl (4N in dioxane, 3 mL) was added and it was allowed to stir at room temperature for 1.5 hr. The solvent was removed and the Int-33f was isolated without further purification (95 mg, 100%). Step H Int-33f (50 mg, 0.075 mmol) was dissolved in DMF (1.5 mL) and cooled to 0 0 C. HATU(68.2 mg, 0.179 mmol) Compound 10A (34.1 mg, 0.157 mmol were added followed by addition of Hunig's base (0.062 mL, 0.45 mmol). The reaction was allowed to stir at 0 0 C for 45 minutes. Water was added to quench the reaction. The mixture purified using RPHPLC (AcCN/H20,0-80%) to provide title Compound 1359 11 45 mg (52.4%).

WO 2012/041014 PCT/CN2011/001638 161 EXAMPLE 34 Preparation of Compound 851 0 C 0 c IS,R,R] DMF(10 I) 40C/4h, Int-34a Int-12j Int-34b iTFA 0 0. NH40AC I Xylene H I - =I Hl 12OC/4hms NH 0~~X,.t 34c NHOCH, Int-34c HHC Compound 851 Step A A mixture of Int-34a (0.3G,0.773 mmol), cesium carbonate (0.755g, 2.318mmol) and 1R,3S,5R)-2-(tert-butoxycarbonyl)-2-azabicyclo[3.1.0]hexane-3 carboxylic acid (0.386g, 1.7mmol) in DMF(1Oml) were combined in a microwave tube and heated at 40 'C. After 4 hrs. TLC indicated complete reaction. The reaction was diluted with EtOAc (30ml) washed with water (3x20ml), brine(1x2Oml), dried (Na 2

SO

4 ), filtered and concentrated under reduced pressure to provide Int-34b as red oil. Int-34b was used in the next step with out additional purification. Step B Int-34b (0.59g, 0.766mmol), ammonium acetate (1. 182g, 15.33mmol) and xylenes (1 5ml) were charged in a microwave tube and heated at 120 'C (oil bath) for 4 hrs. (Note: This reaction should be carried out in afume-hood with shield protection). The reaction was cooled and then diluted with EtOAc (25ml) and water (25ml). The organic layer were washed with water (2x20ml), brine (lx2Oml), dried (Na2SO4), filtered and concentrated to provide crude Int-34c which was purified on a ISCO chromatography system using 5%MeOH/ CH 2

CI

2 .The relevant fraction were collected WO 2012/041014 PCT/CN2011/001638 162 and concentrated to provide Int-34c as an orange solid, Step C Standard capping procedure was used as for the Compound 851 from Int 34c as above (41%). EXAMPLE 35 Preparation of Intermediate Compound Int-35e SCl I CI NBr CIBr H HO (0 Int-I 9g Int-35a Step A The indole phenol Int-19-g (10.0 g, 31.0 mmol), cesium carbonate (40.g, 123 mmol), and DMSO (77 ml) were added to a 500 mL round bottomed pressure flask equipped with a stir bar. 1, 1-Dichloropropane (10.09 g, 89 mmol) was added to the reaction mixture, N 2 was blown over the reaction mixture, and the flask was capped. The flask was placed in a 90 'C oil bath which was then heated to 110 *C. After -16 hours at 110 'C, the reaction mixture was allowed to cool to room temperature. Additional 1,1 dichloropropane was added (4 g, 35 mmol), the reaction mixture was blanketed with N 2 and reheated to 110 *C. After 4.5 hours, the reaction was cooled to room temperature, and poured into 300 mL of water. EtOAc was added (500 mL) and the layers were separated. The aq. layer was extracted with additional EtOAc. The combined organic layer was washed with water and brine, gravity filtered and dried over MgSO4. The mixture was filtered and the solvent concentrated under reduced pressure to provide 11.62 g of a tan solid. The crude product Int-35a was dissolved in CH 2 Cl 2 , Silica gel was added (62 g) and the mixture was concentrated in vacuo. The silica gel containing the crude product was dry loaded on a silica gel column (262 g) that had been packed with hexanes. The column was eluted with an EtOAc/hexanes gradient (0%-1.5%). The WO 2012/041014 PCT/CN2011/001638 163 first major peak was collected as product to provide Int-35a as an off white solid (3.11 g). LC/MS. Obsd. M+H = 361.8. Step B P .HC. CCI I N--o o CI 1 -HCC CCH Br K- O C O H C - OC H , B-B, Int-35a 0 O Int-35b Int-35a (1.59 g, 4.38 mmol), PdCl 2 (dppf) (0.493 g, 0.674 mmol), Bis(pinacolato)diboron (1.08 g, 4.26 mmol), and potassium acetate (1.49 g, 15.18 mmol) were added to a 20 mL microwave vial equipped with a stir bar. The vial was cycled between vacuum and nitrogen five times. Dioxane (16 ml) was added via syringe, and the vial was cycled between vacuum and nitrogen three more times. The vial was placed in a preheated reaction block and the reaction mixture was left stirring at 85 'C. After 2.5 hours, the reaction mixture was allowed to cool to room temperature. The reaction mixture was diluted with ethyl acetate and water and the layers separated. The organic layer was washed with water and brine, filtered through a pad of Celite, dried with MgSO4, and filtered again. The solvent was evaporated under reduced pressure to provide Int-35b as a yellow oil. The crude product was further purified via silica gel column chromatography on an 80 g Isco Gold SiO 2 cartridge, using a MeOH/CH 2 Cl 2 gradient (0%-5%) as the mobile phase to provide Int-35b (1.29 g) as an off white foam. LC/MS. Obsd M+H = 410.11. Step C WO 2012/041014 PCT/CN2011/001638 164 ,HC& CH N - (0j d ,L Br K -c ( F Int-35b Int-1Of Int-35c F Int-35b (0.66 g, 1.611 mmol), Int-10f (0.658 g, 1.682 mmol) and PdCl 2 (dppf) (0.120 g, 0.164 mmol) were added to 100 mL round bottomed flask equipped with a stir bar. The flask was capped with a septum, connected to a vacuum line via needle and tubing and cycled between vacuum and nitrogen five times. Dioxane (8 nl) was added via syringe, and the flask was cycled between vacuum and nitrogen three more times. Aqueous 2.0 M potassium carbonate (2.8 ml, 5.60 mmol) was added and the flask was cycled between vacuum and nitrogen five times and the flask was heated at 85 'C in a heating block. After 16.5 hours, the reaction mixture was allowed to cool to room temperature, diluted with ethyl acetate and water and the layers were separated. The organic layer was washed with water and brine, gravity filtered, dried with MgSO4, and filtered again. The solvent was evaporated under reduced pressure to provide Int-35c (1.16 g) as a brown foam. The crude product was purified further via flash silica gel column chromatography on an ISCO 80 g SiO 2 Gold cartridge, using a MeOH/CH 2 Cl 2 (0%-5%) gradient as the mobile phase. The major peak was isolated as product to provide Int-35c (0.41 g) as a tan foam. LCIMS- Obsd M+H = 594.2. Step D Y N KPd 2 (dbaCHCI X-Phos B HK O A c Ck H iN (It3CFInt35d WO 2012/041014 PCT/CN2011/001638 165 X-Phos (0.116 g, 0.243 mmol), Pd 2 (dba) 3 chloroform adduct (0.110 g, 0.106 mmol), Bis-(pinacolato)diboron (0.175 g, 0.689 mmol), and potassium acetate (0.254 g, 2.59 mmol) were added to a 5 mL microwave tube equipped with a stir bar. The tube was capped and connected to a vacuum line via needle and tubing. The tube was cycled between vacuum and nitrogen five times. Dioxane (0.3 mL) was added via syringe and the tube was cycled between vacuum and nitrogen five times. After five minutes, a solution of Int-35c (0.44 g, 0.741 mmol) in 2.2 mL of dioxane was added via syringe. The tube was cycled between vacuum and nitrogen five more times and the tube was placed in a heating block at 120 *C. After 4h the reaction mixture was allowed to cool to room temperature and was used in the next step without further purification. Step E NJI B hHA~ PdCl 2 dppfI K 2 Co 3 H wane/ water Int-7d nt-35c ['-nt-35d F PdCl 2 (dppf) (81 mg, 0.111 mmol) and Int-7d (246 mg, 0.777 mmol) were added to a 5 mL microwave tube equipped with a stir bar. The tube was capped and connected to a vacuum line via needle and tubing. The tube was cycled between vacuum and nitrogen five times. The crude Int-35c was added via syringe to the tube containing the Suzuki reaction. The tube was cycled between vacuum and nitrogen three times. Aq. 2.0 M potassium carbonate (1.480 ml, 2.96 mmol) was added via syringe. The tube was cycled between vacuum and nitrogen three more times. The tube was placed in an 85 'C heating block and left stirring for about 15 hours. After -1 6h, the reaction was cooled and the aq layer was removed via pipette. The remaining organic layer was diluted with 1.5 mL of DMF and 0.3 mL of water. The resulting material was passed through a micron syringe filter while injecting it directly onto an ISCO Gold C-1 8 cartridge. The cartridge had been conditioned with 15% acetonitrile in water. TFA (0.1%) was added to WO 2012/041014 PCT/CN2011/001638 166 each component of the mobile phase. The column was eluted with an acetonitrile/water gradient (15%-90% with and isocratic hold at 45% acetonitrile while the main peak eluted. Int-35d was obtained as an off white solid (262 mg). LC/MS Obsd M+H = 795.3. Step F H- NN 0 0 N ~ 0' a0 H I H N / N' .>H I Int-35 Fint-35e Int-35d (257 mg, 0.323 mmol) and Methanol (15 ml) were added to a round bottomed flask equipped with a stir bar. HC1 in Dioxane (4.0 M) (5 ml, 20.00 mmol) was added, and the reaction mixture stirred at room temperature. After ~ 45 minutes the reaction mixture was concentrated in vacuo. Int-35e was obtained as a colored solid (Int-5060. LC/MS. Obsd M+H = 695.3. The product was used in the subsequent reactions without further purification. EXAMPLE 36 Preparation of Compounds 814, 1450, and 1451 o o Yoo Y o o 0 Int. H OH OO' 0 H0 >o-9 H int-35e 0 814 F Amino acid Int-4f (44.6 mg, 0.205 mmol) and a solution containing Int 35e (57 mg, 0.082 mmol), acetonitrile (410 pl), THF (410 pl), and DIPEA (71.6 pl, 0.410 mmol) were added to a 1 dram vial equipped with a stir bar. Propylphosphonic anhydride (aka T3P) (164 pl, 0.246 mmol) was added, and the reaction mixture was allowed to stir at room temperature. After 4 hours, the reaction mixture was diluted with EtOAc and water and the layers were separated. The organic layer was washed with water and brine, dried with MgSO 4 , filtered, and concentrated to a brown oil. The aqueous layer was then basified with 2.0 M potassium carbonate and extracted with EtOAc and CH 2 Cl 2 . The WO 2012/041014 PCT/CN2011/001638 167 combined organic layer was filtered, dried with MgSO 4 , filtered again, and concentrated to dryness. The crude product was purified via silica gel column chromatography on an ISCO 4 g SiO 2 cartridge, using a MeOW CH 2

CI

2 gradient as the mobile phase to provide an off white solid Compound 814 LC/MS. Obsd. M+H = 894.3. 0~0 o4 oN-\ O 0 ) N - N Chiral HPLC 0 814 F r-O N HN N O'H 1451 Compound 814 (isomer mixture at ethyl position) was separated on a Chiralcel OD column using 30% ethanol in hexanes as the mobile phase. Diethyl amine (0.1% by volume) was added to each component of the mobile phase. Two peaks were isolated that contained a molecular ion at 894.4 in the LC/MS. LC/MS. Obsd. M+H = 895.0. Peak A = Compound 1450; Peak B = Compound 1451. EXAMPLE 37 cBK PdC I (dpp N nt3 Fint-7i B Int-35b (113 mg, 0.276 mmol), Int-7b (103 mg, 0.238 mmol), and PdCI 2 (dppf) (26 mg, 0.036 mmol) were added to a 2 mL microwave vial equipped with a stir bar. Using the procedure for Example 35, Step C provided 129 mg of Int-37a as a clear oil. LC/MS. Obsd M+H = 636.1 WO 2012/041014 PCT/CN2011/001638 168 0 0 C t C-- NIZ KOAC oiN 0 B-B Pd 2 (dba) 3 / X-Phos B Nt.

n-.t-37a F rnt-37b X-Phos (30 mg, 0.063 mmol), Pd 2 (dba) 3 (31 mg, 0.034 mmol), Bis(pinacolato)-diboron (47mg, 0.185 mmol), and potassium acetate (65 mg, 0.662 mmol) were added to a 2 mL microwave vial equipped with a stir bar. The vial was capped and connected to a vacuum line via needle and tubing. The vial was cycled between vacuum and nitrogen five times. A solution of Int-37a (125 mg, 0.197 mmol) in dioxane (800 pl) was added via syringe, and the vial was cycled between house vacuum and nitrogen five times. The vial was placed in a preheated reaction block and the reaction mixture was left stirring at 120 'C, for 3.5 hours. The reaction mixture was allowed to cool to room temperature and left stirring for about 15 hours at room temperature. The crude reaction mixture, which contains intermediate compound Int-37b, was used without further purification. EXAMPLE 38 Preparation of Compound 1453 0~0 X N N Br BH C d H N FPdCI 2 (dppo F Int-71 Int-37b Cmpd 1453 The microwave vial containing the Int-37b crude reaction mixture was charged with Int-7i (0.063 g, 0.145 mmol) and PdCl 2 (dppf) (17 mg, 0.023 mmol). The vial was recapped, and connected to a vacuum line via syringe needle and tubing. Using the procedure for Example 35, step C provided Compound 1453 as a tan solid-(43 mg). LC/MS. Obsd. M+H = 936.4. EXAMPLE 39 Preparation of Compound 1452 WO 2012/041014 PCT/CN2011/001638 169 00 0 0 00000 o 2 0 HNA K 0 7.)-J K:N' -NH NO'BBr CC H ONHNAO flt-7i ( 1453 F 1452.F Int-7i (0.070 g, 0.169 mmol) and PdCl 2 (dppf) (0.024 g, 0.033 mmol) were added to a 2 mL microwave tube equipped with a stir bar. The vial was capped and connected to a vacuum line via needle and tubing. The vial was cycled between vacuum and nitrogen five times. A solution of compound 1453 (0.135 g, 0.185 mmol) in dioxane (0.9 mL) was added via syringe into the reaction vial. Using the procedure for Example 35, step C provided Compound 1452 as a tan solid-(49 mg). LC/MS. Obsd. M+H = 936.4. EXAMPLE 40 Preparation of Compound 751 Br e Step A e r -, 0 N_ _ _ _ _ _ -IBM-'I then N / Int-10a B NInt-40a Int-7d 0 H0 Step B HOHp O Int-2b H ~Step Int-40b 0 O H C \')5/ O N O O Cmpd 751 Step A Using the method described in Example 35, step B, Int-10a (0.34 g, 0.83 mmol) was converted to Int-40a (0.24 g, 40% yield) as a brown solid. LC/MS Obs M+H = 720.4.

WO 2012/041014 PCT/CN2011/001638 170 Step B Using the method described in Example 35, step F, Int-40a (78 mg, 0.11 mmol) was converted to Int-40b 72 mg (99%) as a dihydrochloride salt. LC/MS Obs M+H = 521.2. Step C Using the method described in Example 36, step A, Int-40b (72 mg, 0.11 mmol) was treated with Int-2b (49 mg, 0.23 mmol) to provide Compound 751 (80 mg, 75% yield) as the dihydrochloride salt. LC/MS Ohs M+H = 918.5. EXAMPLE 41 Preparation of Compound 1491 Br Br H rr N HH Step A Step B Int-22a Int-41a Int-41b Iz H H H H H Ai \ H H Int-41c Int-41d -4HCI H H H StepE H Cmpd 1491 Step A In a 20-mL Biotage* microwave tube, cyclopropylacetaldehyde (2.0 g, 24 mmol) was dissolved in toluene (10 mL) to provide a milky mixture. Int-22a (1.78 g, 4.43 mmol) was added and the resulting red-brown suspension was allowed to stir at room temperature for 10 minutes. p-Toluenesulfonyl chloride (85 mg, 0.443 mmol) and WO 2012/041014 PCT/CN2011/001638 171 toluene (2 mL) were added and the tube was flushed with nitrogen. The sealed reaction was heated and stirred under microwave conditions (Biotage* Initiator 8, reaction temperature = 170 'C; total heating time = 12 h), after which the reaction mixture was allowed to cool to room temperature. The reaction mixture was concentrated under reduced pressure (bath temperature -50-60 C) and then coevaporated with EtOAc (2 x 100 mL) to provide a dark-brown semi-solid as crude product. The crude product was adsorbed onto 6.0 g silica gel and purified using flash silica gel chromatography (ISCO*; 200 g RediSep* Gold silica gel column; Eluent of 0-30% EtOAc/hexanes gradient @ 150 mL/min) to provide Int-41a as a light orange-yellow solid (710 mg, 34% yield). Step B In a 125-mL round-bottom flask, Int-41a (0.707 g, 1.51 mmol), bis(pinacolato)-diboron (0.806 g, 3.18 mmol), (dppf)PdCl2-CH 2 Cl 2 (111 mg, 0.151 mmol) and KOAc (445 mg, 4.54 mmol) were admixed. A magnetic stir bar was added, the flask was sealed and alternately evacuated and refilled with nitrogen (5x). Dry dioxane (7.5 mL) was added and the flask was immersed in a preheated 90 'C oil bath. After 1.5 hours the reaction mixture was allowed to cool to room temperature, diluted with EtOAc (-1 00 mL) and washed with brine (-50 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure (water bath temperature -50 60 C) to provide a dark brown semi-solid as crude product. The crude product was purified using flash silica gel chromatography (ISCO*; 120 g RediSep* Gold silica gel column; Eluent 0-70% EtOAc/hexanes gradient @ 85 mL/min) to provide Int-41b as a beige solid (630 mg, 74% yield). Step C In a 125-mL round-bottom flask, Int-41b (618 mg, 1.10 mmol), bromo imidazole Int-7d (731 mg, 2.31 mmol), (dppf)PdCl 2 -CH2

C

l 2 (81 mg, 0.110 mmol) were admixed. A magnetic stir bar was added and the flask was sealed with a rubber septum. The flask was alternately evacuated and refilled with nitrogen (5x). Dioxane (11 mL) was added and the reaction mixture was allowed to stir at room temperature for 5 minutes after which aqueous potassium carbonate solution (5.5 mL, 1 M aqueous, 5.5 mmol) was WO 2012/041014 PCT/CN2011/001638 172 added. The reaction mixture was allowed to stir at 90 *C for 18 hours. The reaction mixture was allowed to cool to room temperature and was diluted with EtOAc (-100 mL). The resulting solution was poured into a separatory funnel containing EtOAc (-50 mL) and water (-50 mL). The organic layer was washed with brine (-50 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide an orange-brown as crude product. The crude product was purified using flash silica gel chromatography (ISCO*; 80 g RediSep* Gold silica gel column; 0 100% EtOAc-hexanes gradient @ 60 mL/min). Product-containing fractions were collected, concentrated, and re-purified using reverse-phase chromatography (Gilson*; Phenomenex Gemini 150 x 21.20 mm x 5 gm column; Eluent of 10-70% MeCN/water (+0.1% TFA) gradient over 20 minutes) to provide Int-41c as a beige solid (467 mg, 54% yield). Step D In a 50-mL round-bottom flask, Int-41c (411 mg, 0.527 mmol) was dissolved in methanol (5.0 mL) and hydrogen chloride solution (1.5 mL, 4 M in dioxane, (1.8 g, 6 mmol) was added. The reaction mixture was allowed to stir at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure to provide Int-41d as a beige (396 mg, quantitative yield). Step E Int-4f (85 mg, 0.392 mmol), was weighed into a pre-tarred vial and transferred to a 50-mL round-bottom flask containing Int-41d (142 mg, 0.196 mmol) with the aid of dry DMF (4 x 500 jiL). Diisopropylamine (200 pL, 148 mg, 1.15 mmol) was added by syringe. The mixture was allowed to stir at room temperature for -1 minutes, during which time all solids dissolved. The flask was cooled in an ice-water bath for -10 minutes. Solid HATU (157 mg, 0.412 mmol) was added in one portion at 0 'C but gradually allowed to warm to room temperature as the cooling bath expired. After 24 hrs methanol (2 mL), water (0.2 mL) and potassium carbonate (135 mg, 0.980 mmol) were added sequentially. The reaction mixture was extracted with EtOAc (2 x 50 mL), the combined extracts were washed with brine (-50 mL), and dried over anhydrous WO 2012/041014 PCT/CN2011/001638 173 MgSO 4 . After filtration, the organic layer was concentrated under reduced pressure to provide a light brown solid as the crude product. Further purification by reverse-phase chromatography (Gilson*; Phenomenex* Gemini 150 x 21.20 mm x 5 pm column; 10 70% MeCN/water (+0.1% TFA) gradient over 15 minutes) provided Compound 1491 as a beige solid (164 mg, 86% yield). EXAMPLE 42 Preparation of Compound 1490 H Int-la O H 0-4' HCH Int-41d '"'1490 In a 50-mL round-bottom flask, Int-41d (196 mg, 0.270 mmol) and Int-la (95 mg, 0.540 mmol) were admixed. A magnetic stir bar was added and the solids were dissolved in dry DMF (2.7 mL). Diisopropylethylamine (283 pL, 209 mg, 1.62 mmol) was added, the reaction mixture cooled to 0 *C (ice-water bath) and then stirred for 15 minutes. Solid HATU (216 mg, 0.567 mmol) was added in one portion and the reaction mixture was allowed to stir at 0 'C for 24 hours. Methanol (2 mL), water (0.2 mL) and potassium carbonate (187 mg, 1.35 mmol) were added and the reaction was allowed to stir at room temperature for 18 hours. Water (20 mL) was added and the reaction mixture was extracted with EtOAc (2 x 50 mL). The combined organic extracts were washed with brine (-50 mL), dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide a light brown solid as crude product. The crude product was purified directly by reverse-phase chromatography (Gilson*; Phenomenex* Gemini 150 x 21.20 mm x 5 gm column; 10-70% MeCN/water (+0.1% TFA) gradient over 15 minutes to provide Compound 1490 as a beige solid (151 mg, 63% yield). EXAMPLE 43 Preparation of Compound 1499 WO 2012/041014 PCT/CN2011/001638 174 H H N N N AN 0 e N H NAOkN 1490 1499 In a 5-mL Biotage* microwave tube, Compound 1490 (128 mg, 0.143 mmol), bis(pinacolato)diboron (73 mg, 0.286 mmol), Pd 2 (dba) 3

-CHC

3 (15 mg, 0.014 mmol) and X-Phos (14 mg, 0.029 mmol) were admixed. A magnetic stir bar was added and the tube was alternately evacuated and back-filled with nitrogen (5x). Dry dioxane (1.0 mL) was added and the reaction mixture immersed into a preheated 120 'C oil bath. After 2 hours the reaction mixture was diluted with EtOAc (-50 mL) and washed with brine (-25 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide an orange-red as crude product. The crude product was purified using reverse-phase chromatography (Gilson"; Phenomenex* Gemini 150 x 21.20 mm x 5 im column; 10-70% MeCN/water (+0.1% TFA) gradient over 15 minutes) to provide Compound 1499 as a beige solid (75 mg, 61% yield). EXAMPLE 44 Preparation of Compound 1500 0 0 000 H N N C 0N N0 0 N 0' NN N - -o-0 o'~ UN' NF_____NN 1491 1500 Using the method described in Example 43, Compound 1491 was transformed to Compound 1500 and the crude product was purified directly by reverse phase chromatography (Gilson*s ; Phenomenex* Gemini 150 x 21.20 mm x 5 ptm column; 10-70% MeCN/water (+0.1% TFA) gradient over 15 minutes) to provide Compound 1500 as a beige solid (89 mg, 64% yield).

WO 2012/041014 PCT/CN2011/001638 175 EXAMPLE 45 Preparation of Int-45a and Int-45b Br Chiral SFC B + e O int-23a int-45a Int45b Chiral SFC separation (Chiral AD, 30% MeOH/AcCN (2:1) in C0 2 ) of Int-23a yielded Compounds Int-45a and Int-45b. EXAMPLE 46 Preparation of Compound 728 Br Step A B - 1 0 int-45a BInt-46a Int-2a Step B H \ 40 int-4 OCompound 728 Step A To a 250 mL round bottomed flask with a stir bar under N 2 was added dibromoindole Int-45a (3 g, 6.6 mmol) followed by bis(pinacolato)diboron (3.7 g, 14.5 WO 2012/041014 PCT/CN2011/001638 176 mmol), KOAc (1.9 g, 20 mmol), and PdCl 2 (dppf)-CH 2 Cl 2 (1.6 g, 2.0 mmol). Dioxane (-45 mL) was added to the mixture which was degassed six times under house vacuum filling with N 2 after each evacuation. The reaction flask was affixed with a reflux condenser and the mixture was heated to 90 'C. After 5 hours the mixture was deemed to be complete by LC-MS, and the crude bisboronate used as is. To a cooled flask containing the crude bisboronate above was added bromo imidazole Int-4f (4.6 g, 14.5 mmol), PdCl 2 dppf-CH 2 Cl 2 (1.6 g, 1.98 mmol), and 1 M K 2 C0 3 (-20 mL). The flask was flushed with N 2 , capped, and heated to 95 'C. After 12 hours at 95 'C and the mixture was cooled to room temperature and the mixture diluted with EtOAc (100 mL) and water (20 mL). The layers were separated and the aqueous layer was extracted with EtOAc (3 x 75 mL). The organic layers were combined and were washed with brine (1 x 50 mL), dried (Na 2

SO

4 ), filtered, and concentrated under reduced pressure. The crude material was purified using RS ISCO Gold 220 gm column using a gradient of 100% CH 2 Cl 2 to 92/8 % CH 2

CI

2 /MeOH to provide 2.0 (39%) of Int-46a as a brown solid. LC-MS M+H = 769.2. Step B To a solution of Int-46a (0.11 g, 0.14 mmol) in CH 2 Cl 2 (1.5 mL) under N 2 was added excess TFA (1 mL) and the resultant mixture stirred at room temperature for 2 hours. The reaction was concentrated in vacuo and then taken up in - 2-3 mL 4.0 M HCI in dioxane and concentrated to dryness to yield Int-46b (75 mg, 99% yield) as the HC salt. LC-MS M+= 568.2. Step C To a solution of Int-46b (75 mg, 0.13 mmol) in 1.5 mL DMF (1.5 mL) at 15 'C was added (S)-2-(methoxycarbonylamino)-2-(tetrahydro-2H-pyran-4-yl)acetic acid Int-4f (60 mg, 0.28 mmol) and HATU (0.105 g, 0.277 mmol). The mixture was allowed to stir for - 15 minutes whereupon DIPEA (0.17 mL, 0.925 mmol) was added. The mixture was allowed to stir at - 15 'C for 90 minutes whereupon H 2 0 (3 mL) and EtOAc WO 2012/041014 PCT/CN2011/001638 177 (15 mL) were added. The organic layer was washed with H 2 0 (3 X 3 mL), brine (3 x 3 mL), dried (Na 2

SO

4 ), filtered, and concentrated under reduced pressure. The crude material was purified using reverse-phase HPLC (Gilson) using a C18 column with a gradient: 0% ACN to 90% ACN/10% water (both with 0.1% TFA) to provide 120 mg (87%) of the title Compound 728 as a light yellow dihydrochloride salt after treatment with HCl. LC-MS (M+H) = 966.6. EXAMPLE 47 Preparation of Compound 538 0B-B'V N N Br yBr Step A B0O O I N Int-45b then N-% N+K$ Int-47a Int-2a 0 H HO N CN 0 Int-4f Step B H C t-N _____ h N_ H- Step C Int-47b 0 N N 0 538 Step A Using the procedure for the preparation of Int-46a, Int-45b (2.5 g, 5.5 mmol) was converted to 2.5 g (56%) of Int-47a as a brown solid. LC-MS M+H 768.4. Step B WO 2012/041014 PCT/CN2011/001638 178 Using the procedure for the preparation of Int-46b, Int-47a (0.10 g, 0.14 mmol) was converted to 98 mg (99%) of Int-47b as the hydrochloride salt. LC-MS (M+H) = 568.3. Step C Using the method described in Example 46, step C, Int-47b (98 mg, 0.14 mmol) was treated with (S)-2-(methoxycarbonylamino)-2-(tetrahydro-2H-pyran-4 yl)acetic acid Int-4f (65 mg, 0.30 mmol) to provide 39 mg (26%) of Compound 538 as the dihydrochloride salt after HCl treatment. LC-MS M+H 966.4. EXAMPLE 48 Preparation of Compound 725 H N HO N O CN\Step Int-2c N N H I H -N\9 N NN Step A NN N-\ 0 H N N N N K Int-47b e 725 Step A Following the procedure for Example 46, Step C, treatment of Int-47b (75 mg, 0.13 mmol) with (R)-2-(diethylamino)-2-phenylacetic acid hydrochloride Int-2c (68 mg, 0.28 mmol) provided 0.12 g (83%) of the title Compound 725. LC-MS (M+H) = 946.8. EXAMPLE 49 ci ci ci 1\ Br Chiral SFC CIBr + CI/Br "/ Int-49 Int-49a Int-49b Chiral SFC separation (Chiral AD, 30% MeOH/AcCN (2:1) in C0 2 ) of Int-49 yielded Compounds Int-49a and Int-49b.

WO 2012/041014 PCT/CN2011/001638 179 Optical rotation: Int-49b [alpha]D 23 -362.4o EXAMPLE 50 Preparation of Compound 758 C f Br Step A 0B-B C - Step B e int-49a then \ N It-23 Int-50a 1 O tfB-B' CIHO N H 0H nt 1, CI 2UStep D ~i / Hnt-laH NN N Step C I' O nt-0b int-50c 2. Int-2a No 1. HCI HN N ' N N 0 H 2. HOIrN O Int-4f Int-50d 0 Step E 0 N0V NO N~N O - o' 758 Step A Using the procedure for the preparation of Int-46a, Int-49a (1.0g, 2.4 mmol) was converted to 0.73 g (49%) of Int-50a as a brown solid. LC-MS M+H 567.2. Step B To a round bottom flask charged with Int-50a (0.25 g, 0.44 mmol) and a stir bar was added MeOH (1 mL) to provide a yellow, heterogeneous mixture. 4 N HCI WO 2012/041014 PCT/CN2011/001638 180 in dioxane (-1 mL) was added dropwise and the resulting solution was allowed to stir for 2.5 hours at room temperature. The mixture was concentrated under reduced pressure to provide an orange solid. The solid was triturated with Et 2 O (4 x 4 mL), concentrated under reduced pressure, and placed under high vacuum to provide Int-50b (206 mg ,99%) of a light yellow solid. LC-MS M+H = 467.2. This material was taken without any further characterization or purification. Step C To a solution of Int-50b (0.24 g, 0.44 mmol) in DMF (2.5 mL) at -10 *C (ice/acetone) was added (S)-2-(methoxycarbonylamino)-3-methylbutanoic acid Int-2d (85 mg, 0.49 mmol), HATU (0.18 g, 0.49 mmol), followed by dropwise addition of DIPEA (0.23 mL, 1.3 mmol) to provide an orange, homogenous solution. The resulting solution was allowed to stir for 1 hour at -10 'C whereupon the reaction mixture was diluted with water (1.5 mL) and EtOAc (4 mL) and the layers were separated. The aqueous layer was extracted with EtOAc (3 x 4 mL) and the organic layers were combined. The organic layer was washed with brine (1 x 3 mL), dried (Na 2

SO

4 ), filtered, and concentrated under reduced pressure. The resulting orange/brown semisolid was placed under high vacuum to provide a yellow semisolid. The crude material was taken up in CH 2

C

2 (2 mL) and was loaded onto a 40 g silica gold column. A gradient of 100%

CH

2 Cl 2 to 85% CH 2 Cl 2 /15% MeOH was run over roughly 35 minutes. The major fraction that was collected was concentrated under reduced pressure to provide 0.27 g (95%) of Int-50c an off-white solid. LC-MS (M+H)= 624.2. Step D To a 20 mL pressure tube with a stir bar was added Int-50c (0.30 g, 0.48 mmol) in dioxane (4 mL). Bis(pinacolato)diboron (0.13 g, 0.53 mmol), KOAc (0.14 g, 1.4 mmol), and Pd 2 (dba) 3 .CHCl 3 (75 mg, 0.07 mmol), and X-phos (69 mg, 0.14 mmol) were added to the tube to provide a heterogeneous mixture. The reaction mixture was degassed under house vacuum and filled with N 2 five times. The tube was capped, the reaction was heated to 120 'C. After 4 hours LC-MS (M+H 716.2) in dicated that the reaction was complete. To the cooled pressure tube containing the crude boronate was WO 2012/041014 PCT/CN2011/001638 181 added bromo imidazole Int-2a (0.18 g, 0.58 mmol), PdCl 2 dppf-CH 2 Cl 2 (79 mg, 0.096 mmol), and 1 M K2CO 3 (1.4 mL). The tube was flushed with N 2 , capped, and heated to 95 *C for 12 hours. The reaction was then cooled to room temperature, diluted with EtOAc (100 mL) and water (20 iL). The layers were separated and the aqueous layer was extracted with EtOAc (3 x 75 mL). The organic layers were combined and were washed with brine (1 x 50 mL). dried (Na 2

SO

4 ), filtered, and concentrated under reduced pressure. The crude material was purified using RS ISCO Gold 40 gm column using a gradient of 100% CH 2 Cl 2 to 90/10 % CH 2 Cl 2 /MeOH to provide 0.16 (37%) of Int-50d as a brown solid. LC-MS (M+H) = 825.4. Step E Using the procedure for the preparation of Int-3b, Int-50d (71 mg, 0.086 mmol) was converted to 71 mg (99%) of the free diamine as the hydrochloride salt. LC MS (M+H)= 726.2. Using the procedure in example 45, step C, The diamine intermediate Int 50d' (71 mg, 0.086 mmol) was treated with (S)-2-(methoxycarbonylamino)-2 (tetrahydro-2H-pyran-4-yl)acetic acid Int-4f (20 mg, 0.094 mmol) to provide 70 mg (82%) of Compound 758 as the dihydrochloride salt after HCI treatment. LC-MS (M+H) = 966.4. Preparation of Compound 734 ---.- #, 0 o N Steps A-E; Ex. 7 H C I N :P IN Compound 734 Using the methods described in Example 7, Steps A-E, compound Int-49b was converted into Compound 734. LC-MS (M+H) = 925.3.

WO 2012/041014 PCT/CN2011/001638 182 EXAMPLE 51 Preparation of Compound 760 CI Step A N A O N O O N 0 h StepBH N N O /Int-Ina 0Step C Int-51b O N- b 0 0 K 0 0 Ste BrH N H0..<N)y Int-4f Step A pStep C Using the method describinEape5,It5a(6m,01mo) NN 0) Step A Using the method described in Example 50, Int-50a (0.40 g, 0.71 mmol) was treated with Int-7b (0.32 g, 0.85 mmol) after initial boronate formation to provide 0.27 g (44%) of Int-5la as an off-white solid. LC-MS (M+H) = 825.2. Step B Using the method described in Example 5o, Int-51 a (86 mg, 0.10 mmol) was converted to 86 mg (99%) of Int-Sib as the hydrochloride salt. LC-MS (M+H) 725.4. Step C Using the procedure in example 50, Tnt-Sib (86 mg, 0. 10 mmol) was treated with (S)-2-(methoxycarbonylamino)-2-(tetrahydro-2H-pyran-4-yl)acetic acid Int- WO 2012/041014 PCT/CN2011/001638 183 4f (25 mg, 0.12 mmol) to provide 65 mg (62%) of Compound 760 as the dihydrochloride salt after HCl treatment. LC-MS (M+H) = 924.5. Preparation of Compound 731 Br Steps A-C; Example 8 HN N Ok0 C 1N1 N N Int-49b Cmpd 731 In an analogous procedure, Int-50a was converted into Compound 731. LC-MS (M+H)= 924.5. EXAMPLE 52 Preparation of Compound 762 0, ON N HN N 1 HO N kO. int-ie Int-51b Step A 0 0 N O H N N H - N~O/-N 'U01 H 762 'Using the method described in Example 50, Int-51b (86 mg, 0.10 mmol) was treated with (2S,3R)-3-methoxy-2-(methoxycarbonylamino)butanoic acid Int-le (22 mg, 0.12 mmol) to provide 70 mg (69%) of Compound 762 as the dihydrochloride salt after HCl treatment. LC-MS (M+H) = 899.4. EXAMPLE 53 Preparation of Compound 732 WO 2012/041014 PCT/CN2011/001638 184 C Steps A-C; Example 50 /N N Int-49b 732 In an analogous procedure to Example 50 using (R)-2-(diethylamino)-2 phenylacetic acid hydrochloride Int-2c, and Int-49b was converted into Compound 732. LC-MS (M+H) = 914.4. EXAMPLE 54 Preparation of Compound 1178 & compound 1179 Boc CB N NB stepA C Bc NtNBF N Bo step AstN p B -CJN N ' O F H PO H F +Int-lOf 0 H IF Int-54a Int-10f Int-54b Int-54c H 0 0YZ step C FN stepD F N N '0 F H N N ' -, H FF H Int-54d int-54e O O ste E O F N0- F N O ' 1178 (Isomer A) 1179 (isomer B) Step A Int-54a (prepared from Int-19i, 800 mg, 1.87 mmol), bis(pinacolato)diboron (474 mg, 1.87 mmol), PdCl 2 (dppf) 2 (273 mg, 0.37 mmol), and KOAc (549 mg, 5.6 mmol) were added into a 100 mL flask. After the flask was flashed with N 2 , dry dioxane (18 mL) was added and the reaction was allowed to stir at 90 'C for 2 hours. After cooling down, Int-10f (624 mg, 1.87 mmol), PdCI 2 (dppf) 2 (136 mg, 0.19 mmol) and IM K 2 C0 3 solution (IM, 5.6 mL, 5.6 mmol) were added. The mixture was allowed to stir at 90 'C for 4 hours and allowed to cool to room temperature . The aqueous layer was separated and extracted with 10 mL EtOAc. The organic layers were combined WO 2012/041014 PCT/CN2011/001638 185 and dried over anhydrous Na 2

SO

4 . filtered and concentrated in vacuo. The product was purified using silica-gel chromatography (80 g, Eluent:EtOAc in Hexane: 0% to 80%) to provide Int-54b (791 mg, 70.3%). Step B Int-54b (791 mg, 1.31 mmol), bis(pinacolato)diboron (333 mg, 1.31 mmol), Pd 2 (dba) 3 (120 mg, 0.13 mmol), dicyclohexyl(2',4',6'-triisopropylbiphenyl-2-yl)phosphine (125 mg, 0.262) and KOAc (386 mg, 3.93 mmol) were added into a 100 mL flask. After the flask was flashed with N2, dioxane (13 mL) was added. The mixture was allowed to stir at 110 'C for 2 hours. After cooling down, Compound Int-10f (438 mg, 1.31 mmol), PdCl2 (dppf)2 (96 mg, 0.13 mmol) and IM K 2 C0 3 solution (IM, 3.9 mL, 3.9 mmol) were added. The mixture was allowed to stir at 90 *C for an additional 4 hours and allowed to cool to room temperature. The aqueous layer was separated and extracted thrice with 10 mL EtOAc. The combined organic extracts, dried over anhydrous Na 2

SO

4 , filtered and concentrated in vacuo. The product was purified using silica-gel chromatography (40 g, Eluent: EtOAC (10% MeOH) in CH 2 Cl 2 : 0% to 80% to provide Int-54c (364 mg, 33.8%). Step C Int-54c was charged in a 50 mL flask, MeOH (0.5 mL) was added and the reaction was allowed to stir at room temperature for 1 minutes. HCl (4M in dioxane, 6.6 mL, 26.4 mmol) was then added and the solution was allowed to stir at room temperature. After 1 hr the solution was concentrated and the residue was dried in vacuo to provide Int-54d (364 mg, 100%) which were used in the next step without further purification. Step D Int-54d (364 mg, 0.443 mmol), (S)-2-(methoxycarbonylamino)-3-methylbutanoic acid (155 mg. 0.886 mmol), HATU (337 mg, 0.886 mmol), and DMF (4.5 mL) were added into a 40 mL flask. The reaction mixture was cooled to 0 'C and DIPEA (0.55 mL, 3.1 mmol) was added. After 1 hour, water (0.7 mL) and TFA (0.7 mL) were added at 0 'C. The solution was then stirred at room temperature for an additional 30 minutes, before concentration to an oil.. The WO 2012/041014 PCT/CN2011/001638 186 solution was purified using C18 column (80 g, CH 3 CN/water 10% to 70%, with 0.05% TFA) to provide Int-54e (312 mg, 60.5%). Step E Int-54e was resolved by Chiral SFC (Chiracel AS-H, 20x250 mm, Eluent: 40% MeOH (0.2% DEA)/C0 2 , 50 mL/min) to provide isomer A (Compound 1178, 1 S peak, 110 mg, 35.2%) and B (Compound 1 1 7 9 , 2"d peak, 108 mg, 34.6%). The following Compounds were prepared as described above o N~I~ F Nsingle 1463 O N * isomer o V mixture 00 1.1- N 0 m ixture NN 1507 F H Of two isomers O0 0 N N F mixture 1508 of two /O isomers 0 0 00 H -O F OrVK A0 single 1508 H\A _ H " F isomer EXAMPLE 55 Preparation of Compound 1353 WO 2012/041014 PCT/CN2011/001638 187 CI, 0B , cl - "' Br Step A B-B C N nN 0 0 then O O Int-a BrN NInt-65a Br N Int-7d B-BO ON N Step B 5 00 tnt-14d H O H N N O 00 0hn ONN N N O' 0 0 H \/ Compound 1353 Step A Using the method described in Example 50 step A, Int-5a (1.0 g, 2.4 mmol) was converted to the boronate and was treated with Int-7d (0.92 g, 2.9 mmol) to provide 0.92 g (67%) of Int-55a as a brown solid. LC-MS (MH)= 566.7. Step B Using the method described in Example 50, Int-55a (0.70 g, 0.1.2 mmol) was converted to the intermediate boronate followed by treatment with Int-7d (0.53 g, 1.5 mmol) to provide 0.25 g (25%) of Int-55b. LC-MS (M+H) = 811.6. Step C WO 2012/041014 PCT/CN2011/001638 188 Using the method described in Example 50, Int-55b (0.25 g, 0.31 mmol) was converted to 0.23 g (99%) of Int-55c as the hydrochloride salt. LC-MS (M+H) = 611.8. Step D Preparation of Compound 1353 Using the procedure Example 50 step E, Int-55c (23 mg, 0.31 mmol) was treated with (S)-2-(methoxycarbonylamino)-3-methylbutanoic acid Int-la (0.11 g, 0.65 mmol) to provide 0.19 g (66%) of Compound 1353 as the dihydrochloride salt. LC-MS (M+H) = 926.2. EXAMPLE 56 Preparation of Intermediate Compound Int-56b OMe Br O Br H Int-56a Int-56b A 500-mL round-bottom flask was charged with triphenyl phosphite (31 mL, 37 g, 120 mmol), dichloromethane (250 mL) and cooled for 15 minutes in a dry ice acetone bath that was maintained at -50 to -60 'C. Bromine (6.2 mL, 19 g, 120 mmol) was added dropwise over 15 minutes through an addition funnel. Triethylamine (19 mL, 13 g, 132 mmol) and 3,5-dimethoxybenzaldehyde (Int-56a; 10.0 g, 60.2 mmol) were added sequentially. The reaction mixture was allowed to stir at -60 'C for 1 hour. The cold bath was removed and the reaction mixture was allowed to stir for a further 18 hours as the temperature was allowed to reach RT. The reaction mixture was concentrated by rotary evaporation under reduced pressure (water bath temperature -50-60 *C) to provide a dark brown, viscous liquid as crude product. The crude product was taken up in EtOAc (-100 mL) and filtered. The filtrate was concentrated under reduced pressure (water bath temperature -50-60 'C) to provide a dark brown, crude Int-56b as a viscous liquid. Int 56b was loaded directly onto a pre-equilibrated 330 g RediSep@ Gold silica gel column WO 2012/041014 PCT/CN2011/001638 189 and purified using flash chromatography (Isco@; Eluent: 0-5% EtOAc/hexanes gradient, to 5-70% EtOAc/ hexane to provide Int-56b as a white solid (12.8 g, 68% yield). In the same manner, the following 1,1 -dibromo intermediates were prepared from the corresponding aldehydes. [0 Br C Br N OMe Br BO Br Br Br Br K Int-56c Int-56d Int-56e Int-56f 0 F Br O Br I OMe Br Int-56g Br Int-56h EXAMPLE 57 Preparation of Compound 1286 WO 2012/041014 PCT/CN2011/001638 190 CI ci Cl CI~~..~ B CI H B Step A CIB tpBCl N B r N O Ci CI N BOC BO e CI C BrC Step D S C - HO S Int-12o Int-57c BON BH Ote StpA Int-57d tepn- Int-57e '0 StepF F N O O -O H O(H N HOe H -1'Se int-1e , t1286 Step A Int-19g (10.0 g, 31 mmol), NCS (4.14 g, 31 mmol), dichloromethane (300 ml), and THF (300 ml) were added to a 1 L flask and the resulting mixture was allowed to stir at 0 0 C for 1 hour and then at room temperature for 2 hours. The reaction mixture was then concentrated to a semi-solid and the residue was suspended in dichloromethane (150 ml) and filtered. The solid was washed with dichloromethane (2x15 ml) and dried to provide Int-57a as a solid (6.4 g, 5 8%). Step B Int-57a (1.0 g, 2.8 mmol), 3-methoxybenzaldehyde (0.572 g, 0.58 mmol), p-toluenesulfonic acid (0.0053 g, 0.28 mmol), and o-xylene (10 ml) were added to a 35 mL pressure vessel. The resulting mixture was allowed to stir at 170 0 C for about 15 hours under protection of a shield, cooled to room temperature, and purified on a 80 g WO 2012/041014 PCT/CN2011/001638 191 silica column/ Combi-Flash Rf system (Eluent: 0-5% ethyl acetate in hexanes eluent) to provide Int-57b as a gel (0.2 g, 15%). Step C Int-57b (200 mg, 0.421 mmol), bis(pinacolato)diboron (118 mg, 0.421 mmol), potassium acetate (207 mg, 2.1 mmol), PdCl2(dppf)-CH 2 Cl 2 (34.4 mg, 0.042 mmol), and dioxane (5 ml) were added to a 35 mL microwave reaction tube. The sealed tube was degassed and stirred at 95 'C under nitrogen atmosphere for 4 hours then cooled to room temperature. To this mixture were added bromide Int-7d (160 mg, 0.505 mmol), PdCl 2 (dppf)-CH 2

C

2 (34.4 mg, 0.042 mmol), 1.5 M aqueous solution of sodium carbonate (1.4 ml, 2.1 mmol). The resulting mixture was degassed and stirred at 95 'C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated, purified using a 12 g silica column on Combi-Flash Rf system (0-60% ethyl acetate in hexanes eluent) to provide Int-57c as a wax (114 mg, 43%). Step D Int-57c (65 mg, 0.103 mmol), bis(pinacolato)diboron ( 57.5 mg, 0.226 mmol), potassium acetate (101 mg, 1.03 mmol), Pd 2 (dba) 3

-CHC

3 (21.3 mg, 0.02 mmol), X-PHOS (19.6 mg, 0.04 mmol), and dioxane (3 ml) were added to a 35 mL microwave reaction tube. The sealed mixture was degassed and stirred at 110 'C under nitrogen atmosphere for 8 hours then cooled to room temperature. To this mixture were added bromide 27 (85 mg, 0.258 mmol), PdCl 2 (dppf)-CH 2

C]

2 (16.8 mg, 0.02 mmol), 1.5 M aqueous solution of sodium carbonate (0.7 ml, 1.05 mmol). The resulting mixture was degassed and stirred at 95 *C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated, purified using a 4 g silica column / Combi-Flash Rf system (0 100% ethyl acetate in hexanes eluent) to provide Int-57d as a solid (39 mg, 47%). Step E Int-57d (39 mg, 0.048 mmol), TFA (1 ml) and dichloromethane (1 ml) were added to a 25 mL flask and stirred at room temperature for 4 hours and concentrated in vacuo. The residue was dissolved in methanol (2 ml), treated with 0.1 mL of 4.0 M WO 2012/041014 PCT/CN2011/001638 192 HCl (0.4 mmol) solution in dioxane and concentrated again in vacuo to provide Int-57e as a white solid. This crude product was used for the next reaction without purification. Step F Diamine Int-57e, Valine-MOC acid Int-la (14.3 mg, 0.081 mmol), and DMF (1 ml) were added to a 50 mL flask and cooled to 0 *C. To this cooled solution was added HATU (30 mg, 0.08 mmol) and the reaction was allowed to stir at 0 *C over a period of 1 hour, quenched with water (3 drops). The reaction mixture was purified using reverse phase chromatography (0-90% acetonitrile in water with 0.1% TFA eluent) to provide Compound 1286 as a wax (13 mg, 31%). LC/MS anal. calcd. for: C 5

IH

57

N

9 0 8 923.4; Found: 924.5 (M+H) 4 . EXAMPLE 58 Preparation of Compound 1198 & Compound 1199 F/O H N NZ H F H - F H - H F H F 0- 0 1198 1199 Compound 1198 (20 mg, 0.020 mmol), trimethylboroxine (7.67 mg, 0.061 mmol), Pd 2 (dba) 3 (3.73 mg, 4.07 pmol), and dicyclohexyl(2',4',6'-triisopropylbiphenyl-2 yl)phosphine (3.88 mg, 8.14 pmol) are added into a 50 mL flask. After the flask was flashed with N 2 , 1,4-Dioxane (204 pl) and K 2 C0 3 (61.1 pl, 0.061 mmol) was added. The mixture was allowed to stir at 110 'C for 16 hours. After cooling down, the aqueous layer was separated and extracted with 5 mL EtOAc. The organic layers were combined and dried over anhydrous Na 2

SO

4 . The solution was filtered and concentrated in vacuo. The solution was concentrated and purified using SiO2 chromatography (24 g, MeOH (Eluent: 10% concentrated MeOH/NH3-H 2 O) in CH 2

CI

2 , 0% to 80%) to provide Compound 1199 (15 mg, 77%).

WO 2012/041014 PCT/CN2011/001638 193 The following compound was made using the method described in the Example above: O NNO O mixture H N ,N N Of ^N'O' 1199 F H ' / N H of two isomers 0 EXAMPLE 59 Preparation of Compound 1014 WO 2012/041014 PCT/CN2011/001638 194 Br Br Br CI 5 BrBr Se B I - int-59a-56c H HO Step B Int-19b Int-59a ~ CI O O N NNN Ste-teStep CE nt9Int-59c C N O "I' ~ N N1 SN N N Step D a HStep E Int-59d S H N N H I N / N N H 0 H Int-59e t4HC Step F MeO 2 C- 0 N N Hl LIII.N - / N -X0M H N N 0 H4 /S Cmpd 1014 Step A In a 250-mL round-bottom flask, Int-19b (2.006 g, 5.47 mmol) was dissolved in DMSO (22 mL). Neat dibromide Int-56c (1.710 g, 6.01 mmol) was added, followed by solid cesium carbonate (5.34 g, 16.4 mmol). The reaction mixture was immersed into a preheated 90 'C oil bath and stirred for 18 hours, then allowed to cool to room temperature, and poured into water (-100 mL), whereupon a tan solid precipitated. The aqueous mixture was extracted with EtOAc (2 x 100 mL). The combined organic phases were washed with brine (-50 mL), then dried over anhydrous MgSO 4 , filtered, WO 2012/041014 PCT/CN2011/001638 195 and concentrated in vacuo to provide a tan-brown solid as crude product. The crude product was purified using flash silica gel chromatography (Isco*; 220 g RediSep* Gold silica gel column; Eluent: 0-30% EtOAc/hexanes gradient to provide Int-59a as a pale yellow solid (683 mg, 26% yield). Step B In a 20-mL Biotage@ microwave tube was charged with stir basr was added Int-59a (670 mg, 1.37 mmol), bis(pinacolato)diboron (695 mg, 2.74 mmol), (dppf)PdCl 2

-CH

2

CI

2 (68 mg, 0.083 mmol) and potassium acetate (403 mg, 4.11 mmol). The tube was alternately evacuated and back-filled with nitrogen 5 times. Dioxane (14 mL) was added and the tube was immersed into a preheated 90 'C oil bath. After 1.5 hours, then reaction was allowed to cool to room temperature, diluted with EtOAc (-20 mL) and filtered through a Celite* pad. The pad was rinsed with EtOAc (-50 mL) and the combined filtrate were washed with brine (-25 mL), dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide an light brown solid as crude product. The crude product was purified using flash silica gel chromatography (Isco*; 40 g RediSep* Gold silica gel column; Eluent 0-50% EtOAc/hexanes gradient) to provide Int-59b as a beige solid (705 mg, 88% yield). Step C A 20-mL Biotage@ microwave tube was charged with a stir bar, Int-59b (700 mg, 1.20 mmol), bromoimidazole Int-7d (834 mg, 2.64 mmol), and (dppf)PdC2-CH 2 Cl 2 (49 mg, 0.060 mmol). The tube was alternately evacuated and refilled with nitrogen (5x). Dioxane (8 mL) was added and the reaction mixture was allowed to stir at room temperature for 5 minutes. Aqueous potassium carbonate solution (6 mL, 1 M aqueous, 6 mmol) was then added and the reaction was immersed into a preheated 90 'C oil bath. After 18 hours the reaction was allowed to cool to room temperature and was diluted with EtOAc (-50 mL), filtered through a polyethylene filter frit and the filtrate was washed with brine (-25 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide an orange-brown solid as crude product. The crude product was purified using flash silica WO 2012/041014 PCT/CN2011/001638 196 gel chromatography (Isco*; 120 g RediSep* Gold silica gel column; Eluent 0-10% MeOH/CH2CI2 gradient) to provide Int-59c as a beige solid (719 mg, 75% yield). Step D A 5-mL Biotage* microwave tube was charged with a stir bar, Int-59c (130 mg, 0.162 mmol), (dba) 3 Pd 2

-CHC

3 (25 mg, 0.024 mmol) and X-Phos (23 mg, 0.049 mmol). The tube was sealed and alternately evacuated and back-filled with nitrogen (5x). 5-methylthienyl-2-boronate (36 mg, 0.16 mmol), dissolved in dioxane (1.6 mL), and potassium carbonate (0.8 mL, 1 M aqueous; 0.8 mmol) were added by syringe. The tube was immersed in preheated 120 'C oil bath and stirred for 4 hours. The reaction mixture was then cooled, diluted with EtOAc (-50 mL), filtered, and washed with brine (-25 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide the crude product as a golden yellow solid. Further purification by reverse-phase chromatography (Gilson*; Phenomenex* Gemini 150 x 21.20 mm x 5 [Lm column; 10-70% MeCN/water (+0.1% TFA) gradient over 20 minutes) to provide Int-59d as a beige solid (26 mg, 19% yield). Step E In a 50-mL round-bottom flask Int-59d (20 mg, 0.03 mmol) was dissolved in methanol (500 L) and HCl solution (60 jiL, 4 M in dioxane, 0.240 mmol) was added. The clear, pale yellow tinged solution was allowed to stir at room temperature for 24 hours. The reaction mixture was concentrated in vacuo to provide Int-59e a beige solid (15.6 mg, 83% yield). Step F In a 50-mL round-bottom flask, Int-59e (16 mg, 0.019 mmol) and Int-la (7 mg, 0.040 mmol) were dissolved in DMF (200 ptL). Diisopropylethylamine (20 jiL, 15 mg, 0.118 mmol) was added and the reaction mixture was cooled in an ice-water bath for 15 minutes. Solid HATU (15 mg, 0.039 mmol) was added slowly and the reaction allowed to warm slowly to room temperature. After 3 hours the reaction was purified directly by reverse-phase chromatography (Gilson*; Phenomenex* Gemini 150 x 21.20 WO 2012/041014 PCT/CN2011/001638 197 mm x 5 gm column; 10-70% MeCN/water (+0.1% TFA) gradient over minutes) to provide Compound 1014 as a beige solid (12 mg, 62% yield). EXAMPLE 60 Preparation of Compound 1005 NN N~ NZ \r~/ - N 0o H StepA 0 C Int-59c \OA 1 Int-60a Step B Se / \ +4HCI / \ Compound 1005 - int-60b Step A A 5-mL Biotage* microwave tube equipped with a magnetic stir bar was added, Int-59c (254 mg, 0.317 mmol), phenylboronic acid (77 mg, 0.634 mmol), Pd 2 (dba) 3 -CHCl 3 (66 mg, 0.063 mmol) and X-Phos (61 mg, 0.127 mmol). The tube was sealed and alternately evacuated and back-filled with nitrogen (5x). Dioxane (3 mL) and potassium carbonate (0.78 mL, 1 M aqueous; 0.78 mmol) were added and the reaction immersed in a preheated 110 0 C oil bat. After 22 hours the reaction was allowed to cool, diluted with EtOAc (~-30 mL), and washed sequentially with water (~20 mL) and brine (~'20 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated in vacuo to provide the crude product as a light brown solid. The crude product was purified using flash silica gel chromatography (Isco*; 40 g RediSep* Gold silica gel column; Eluent 0-10% MeOH/CH 2 Cl 2 gradient) to provide Int-60a (134 mg, 50% yield) as a pale yellow-orange solid. Step B WO 2012/041014 PCT/CN2011/001638 198 In a 125-mL round-bottom flask, Int-60a (100 mg, 0.118 mmol) was dissolved in methanol (1.2 mL). Hydrogen chloride solution (0.300 mL, 4 M in dioxane, 1.2 mmol) was added and the reaction mixture was allowed to stir at room temperature. After 17 hours the reaction mixture was concentrated under reduced pressure to provide a golden-brown solid, which was dried in a vacuum oven (house vacuum, -60 'C) for 20 hours to provide Int-60b as a golden brown solid (99 mg, quantitative yield). Step C To a 50-mL flask equipped with a stir bar was added Int-60b (39 mg, 0.047 mmol) and Int-la (17 mg, 0.094 mmol) , and dry DMF (472 gL). Diisopropylethylamine (41 pL, 31 mg, 0.236 mmol) was added and the reaction mixture was cooled to 0 'C in an ice-water bath. After -15 minutes, solid HATU (40 mg, 0.104 mmol) was added and the reaction mixture stirred at 0 'C, After 2 hours the reaction was quenched by addition of water (20 mL), whereupon a beige solid precipitated. The solid was collected by vacuum filtration and washed further with water (-50 mL). The solid was dissolved in EtOAc (-100 mL) and the resulting solution was washed with brine (-25 mL). The organic layer was collected, dried over MgSO 4 , filtered, and concentrated under reduced pressure to provide a beige crude product. Further purification by reverse phase C18 chromatography (Gilson*, Phenomenex* Gemini C18 5 tm 150 x 21.20 mm column, Eluent:10-70% MeCN/water + 0.1% TFA over 20 minutes @ 20 mL/min} afford Compound 1005 as a beige solid (28.4 mg, 63% yield). EXAMPLE 61 Preparation of Compounds 1166, 1171 & 1173 WO 2012/041014 PCT/CN2011/001638 199 BoC N BOON NBoc N N oc H O H N Step A F O H' Step B H N 0 H~ F e~- F CI Int-61a Int-61b H NI '1 N\ _ l H0) NN N 0 H N N O N O '' O F 0 H F tep C HF N' O F H 0 H"_ Int-61c / Compound 1166 -i 0 0 \ / O NN ' N 0 Step D0F HF O' \/ Compound 1171 \ / Compound 1173 Step A Compound Int-61a (150 mg, 0.179 mmol, prepared by a similar route as in example 59), biphenyl-4-ylboronic acid (35.4 mg, 0.179 mmol), Pd 2 (dba) 3 (18.5 mg, 0.0 18 mmol), and dicyclohexyl(2',4',6'-triisopropylbiphenyl-2-yI)phosphine (17 mg, 0.036 mmol) were added into a 40 mL flask. The flask was put in vacuo and filled with N2 This process was repeated once. Dioxane (1.8 mL) and K 2

CO

3 (1M, 0.9 mL, 0.9 mmol) were added, and the sealed flask was allowed to stir at 110 0 C. After 3 hours the reaction was cooled, the aqueous layer was separated and extracted with 3 mL EtOAc. The organic layers were combined and dried over anhydrous Na 2

SO

4 , filtered and concentrated to provide crude product. Further purification by Silica-gel chromatography (Eluent: EtOAC (10% MeOH) in CH 2 Cl 2 : 0% to 80%) gave Compound Int-61a (137 mg, 80%).

WO 2012/041014 PCT/CN2011/001638 200 Steps B to D were carried out using the methods described in Example 50. The following compound was made using the method described in the Example above: H N N 0 NolT~o F N N N S0 H single 1172 isomer EXAMPLE 62 Preparation of Compound 1528 WO 2012/041014 PCT/CN2011/001638 201 F C1 CI HO B rBr i Step A Int-19g Int-56h int-62a Br NC C CO Br O F-cI Int62bInt-7b Step B F 0' in-2 Step C 00 N ONC F nt62 F nt-62dy O 'N O Or- N O0N O'N Dn-2 Int- 62d Sp AInt-62 S 0 \00 OH H N Step A To a 250 mL flask were added Int-19g (5.0 g, 15.5 mmol), dibromide Int 56h (5.8 g, 80% purity, 15.5 mmol), cesium carbonate (25.3 g, 77 mmol), and acetonitrile (50 ml) and the resulting suspension was allowed to stir at 60 C for about 15 hours. Ethyl acetate (200 ml) was then added, and the organic layer was washed with water (2x150 ml), dried over sodium sulfate, and concentrated in vacuo. The residue was purified on a 120 g silica column! Combi-Flash Rf system(Eluent: 0-10% ethyl acetate in hexanes) to provide Int-62a as a white solid (3.7 g, 52%). Step B WO 2012/041014 PCT/CN2011/001638 202 Intermediate Int-62a (500 mg, 1.09 mmol), bis(pinacolato)diboron ( 304 mg, 1.2 mmol), potassium acetate (535 mg, 5.45 mmol), PdCI 2 (dppf)-CH 2 Cl 2 (89 mg, 0.109 mmol), and dioxane (8 ml) were added to a 35 mL microwave reaction tube. The sealed mixture was degassed and stirred at 95 *C under nitrogen atmosphere for 4 hours and then cooled to room temperature. To this mixture were added bromide Int-12o (429 mg, 1.31 mmol), PdCl 2 (dppf)-CH 2

CI

2 (89 mg, 0.109 mmol), 1.5 M aqueous solution of sodium carbonate (3.6 ml, 5.4 mmol). The resulting mixture was degassed and stirred at 95 *C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated, to provide crude product. Further purification was accomplished on by a 40 g pre-packed silica gel column/ Combi-Flash Rf system (Eluent: 0-90% ethyl acetate in hexanes) to provide Int-62b as a wax (530 mg, 78%). Step C Int-62b (130 mg, 0.207 mmol), bis(pinacolato)diboron ( 58 mg, 0.23 mmol), potassium acetate (102 mg, 1.04 mmol), Pd 2 (dba) 3 -CHCl 3 (21.5 mg, 0.02 mmol), X-PHOS (19.8 mg, 0.04 mmol), and dioxane (2 ml) were added to a 35 mL microwave reaction tube. The sealed mixture was degassed and stirred at 110 'C under nitrogen atmosphere for 8 hours then cooled to room temperature. To this mixture were added bromide Int-7b (78 mg, 0.21 mmol), PdCl 2 (dppf)-CH 2 Cl 2 (14.2 mg, 0.02 mmol), 1.5 M aqueous solution of sodium carbonate (0.6 ml, 0.9 mmol). The resulting mixture was degassed and stirred at 95 *C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated to provide crude product. Further purification on a 4 g silica gel pre-packed column/ Combi-Flash Rf system (Eluent: 0-100% ethyl acetate in hexanes) provided Int-62c as a solid (105 mg, 68%). Step D Int-62c (98 mg, 0.11 mmol), TFA (1 ml) and dichloromethane (1 ml) were added to a 25 mL flask. The resulting solution was allowed to stir at room temperature for 4 hours and concentrated in vacuo. The residue was dissolved in methanol (2 ml), treated with 0.1 mL of 4.0 M HCI (0.4 mmol) solution in dioxane and concentrated again in vacuo to provide Int-62d as a solid (99 mg, 100%).

WO 2012/041014 PCT/CN2011/001638 203 Step E Int-62d (30 mg, 0.034 mmol), acid Int-la (6.5 mg, 0.04 mmol), and DMF (1 ml) were added to a 25 mL flask and the resulting solution was cooled to 0 'C. To this cooled solution was added HATU (13 mg, 0.034 mmol) and the reaction was allowed to stir at 0 'C, After lh , water (3 drops) was added and the reaction directly purified using reverse phase chromatography (10-80% acetonitrile in water with 0.1% TFA eluent ) to provide Compound 1528 as a white solid (5 mg, 13%). LC/MS anal. calcd. for:

C

51

H

5 6

FN

9 0 8 941.4; Found: 942.5 (M+H)*. EXAMPLE 63 Preparation of Compound 1496 Br~Br Br Int-56c Br Br Step B F Step A eFp\ Int-19b Int-63a Int-63b S te p C FSFe-4 H C Int-63c Int-63d O-4 N N Ny O-N H Q OA 00 Step E 1496 Step A Into a 250-mL round-bottom flask equipped with a stir bar, dibromoindole Int-19b (4.41 g, 12.02 mmol), Int-56c (4.47 g, 14.4 mmol) were added WO 2012/041014 PCT/CN2011/001638 204 and dissolved in dry DMSO (50 mL). Solid cesium carbonate (20 g, 61 mmol) was added. The reaction mixture was allowed to stir at 100 'C for 14 hours. Water (-150 mL) was added to the reaction mixture, whereupon a beige solid precipitated. The suspension was extracted with EtOAc (3 x 250 mL). Combined extracts were washed with brine (-250 mL). The organic layer was dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure to provide the crude product as a light orange-brown solid. The crude product was adsorbed onto silica gel (10.0 g), and then further purified using flash silica gel chromatography (Isco*; 330 g RediSep* Gold silica gel column; Eluent: 0-10% EtOAc/hexanes gradient) to provide Int-63a as a light brown solid (2.77 g, 46% yield). Step B A 125-mL round-bottom flask equipped with a stir bar was charged with Int-63a (1.46 g, 2.90 mmol), bis(pinacolato)diboron (1.55 g, 6.09 mmol), (dppf)PdCl 2

-CH

2

CI

2 (106 mg, 0.145 mmol) and KOAc (854 mg, 8.71 mmol). The reaction was sealed and alternately evacuated and refilled with nitrogen (5x). Dry dioxane (19 mL) was added and the flask was immersed in a preheated 90 *C oil bath. After 1 hour the reaction mixture was allowed to cool to room temperature, diluted with EtOAc (100 mL), filtered through a polyethylene frit and washed with brine (-50 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated to provide the crude product as a dark-brown semi-solid. The crude product was purified using flash silica gel chromatography (Isco*; 220 g RediSep* Gold silica gel column; Eluent: 0-30% EtOAc/hexanes gradient) to provide Int-63b (1.09 g, 63% yield). Step C A 125-mL round-bottom flask equipped with a stir bar was charged with Int-63b (707 mg, 1.184 mmol), bromoimidazole Int-7d (786 mg, 2.49 mmol), (dppf)PdCl 2

-CH

2

CI

2 (87 mg, 0.118 mmol). The flask was alternately evacuated and refilled with nitrogen (5x). Dioxane (12 ml) was added and the reaction mixture was allowed to stir at room temperature for 5 minutes. Aqueous potassium carbonate solution (6 mL, 1 M aqueous, 6 mmol) was then added. The reaction mixture was allowed to stir WO 2012/041014 PCT/CN2011/001638 205 at 90 *C for 2.5 hours, cooled to room temperature and was diluted with EtOAc (-50 mL). The resulting solution was poured into a separatory funnel containing EtOAc (-50 mL) and water (-50 mL). The organic layer was washed with brine (-50 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide the crude product as an orange-brown solid. The crude product was further purified using flash silica gel chromatography (Isco*; 120 g RediSep" Gold silica gel column; Eluent: 0-100% {10% MeOH/EtOAc}-hexanes gradient) to provide Int 63c a light brown solid (644 mg, 67% yield). Step D In a 50-mL round-bottom flask, Int-63c (633 mg, 0.776 mmol) was dissolved in methanol (8.0 mL) and hydrogen chloride solution (2.0 mL, 4 M in dioxane, (2.4 g, 8 mmol) was added. The reaction mixture was allowed to stir at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure to provide Int-63d as a beige solid (572 mg, 97% yield). Step E Int-4f (57 mg, 0.263 mmol) was dissolved in dry DMF (1.3 mL). The resulting solution was added to a 50-mL round-bottom flask containing solid Int-63d (100 mg, 0.131 mmol). NN-Diisopropylethylamine (140 pL, 104 mg, 0.802 mmol) was added and the mixture agitated by sonication until no more solid adhered to the walls of the flask. The reaction mixture was allowed to stir at 0 'C (ice-water bath) for -15 minutes. Solid HATU (110 mg, 0.289 mmol) was added and the reaction mixture was allowed to stir at 0 'C. After 1.5 hours the reaction was diluted with methanol (1 mL), and water (-0.1 mL) and solid potassium carbonate (36 mg, 0.263 mmol) were added sequentially. After 24 hours the reaction mixture was partitioned between EtOAc (-100 mL) and brine (-25 mL). The aqueous layer was extracted with a second portion of EtOAc (-25 mL). The combined extracts were washed with brine (-25 mL), dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide crude product as a light brown solid.. The crude product was purified directly by reverse-phase chromatography (Gilson*; Phenomenex Gemini 150 x 21.20 mm x 5 pm column; Eluent: WO 2012/041014 PCT/CN2011/001638 206 0-70% MeCN/water (+0.1% TFA) gradient over 15 minutes) to provide the targeted product Compound 1496 as a white solid (84 mg, 63% yield). EXAMPLE 64 Preparation of Compounds 1002, 1024, & 1025 OMe Br N0 Br OMe B I ~ Br Br Int-56g Br N N N O_ N 0 H HO Step A O Step B 0 Int-19b int-64a / Int-64b 0- O H nt1 HN N Br / N r Stp \E / N CHmpON N N WN Ha ON OH t-la N Step . _ SepD N N O-- 1002 Step A A 250-mL round-bottom flask was charged with Int-19b (3 g, 8.2 mmol) and DMSO (35 mL). The 1,1-dibromide Int-56g (2.5 g, 8.1 mmol) and cesium carbonate (8.0 g, 25 mmol) were added and the mixture was heated with stirring at 90 *C for 18 hours. The reaction mixture was poured into water (-300 mL) and extracted with EtOAc (3 x 250 mL). Combined extracts were washed with brine (~250 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide the crude product as a brown oil. The crude product was adsorbed onto 8.5 g silica gel and further purified using flash silica gel chromatography (Isco@; 300 g RediSep@ Gold silica gel column; Eluent: 0-50% EtOAc/hexanes gradient) to provide Int-64a (751 mg, 18% yield).

WO 2012/041014 PCT/CN2011/001638 207 Step B In a 20-mL Biotage* microwave tube, Int-64a (276 mg, 0.535 mmol), bis(pinacolato)diboron (220 mg, 0.866 mmol), (dppf)PdCl2-CH 2

CI

2 (34 mg, 0.042 mmol) and KOAc (122 mg, 1.24 mmol) were added. The tube was sealed and alternately evacuated and refilled with nitrogen (5x). Dry dioxane (3.5 mL) was added and the reaction mixture was allowed to stir until homogeneity was achieved (< 1 minutes). The tube was immersed in a preheated 90 'C oil bath and stirred for 45 minutes. The reaction mixture was cooled, diluted with EtOAc (-10 mL) and filtered through a Celite@ pad with washing (EtOAc). The combined filtrates were washed with brine (-25 mL), dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide the crude product as an orange-brown solid. Further purification by flash silica gel chromatography (Isco*; 40 g RediSep@ Gold silica gel column; Eluent: 0-30% EtOAc/hexanes gradient) to provide Int-64b as an off-white solid (127 mg, 39% yield). Step C In a 20-mL Biotage* microwave tube, Int-64b (122 mg, 0.200 mmol), bromoimidazole Int-7d (133 mg, 0.420 mmol), and (dppf)PdCl 2

-CH

2

C]

2 (16 mg, 0.020 mmol) were mixed. The tube was sealed and alternately evacuated and back-filled with nitrogen (5x). Dioxane (2 mL) and potassium carbonate (0.60 mL, 1 M aqueous; 0.60 mmol) were added and the reaction immersed in a preheated 90 'C oil bath. After 17 hours the reaction mixture was allowed to cool, diluted with EtOAc (-100 mL) and was washed with brine (-50 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide a light brown solid. The crude product was purified using flash silica gel chromatography (Isco*; 24 g RediSep Gold silica gel column; Eluent: 0-60% MeOH/CH 2 Cl 2 gradient) to provide Int-64c as a beige solid (111 mg, 67% yield). Step D In a 50-mL round-bottom flask, Int-64d (101 mg, 0.122 mmol) was dissolved in methanol (2.0 mL) and HCl solution (300 jtL, 4 M in dioxane, 1.2 mmol) was added. The pale yellow solution was allowed to stir at room temperature for 23 WO 2012/041014 PCT/CN2011/001638 208 hours, then concentrated under reduced pressure to provide Intermediate 900D (100 mg, -100% yield) as a pale yellow powder.. Step E A 50-mL flask was charged with Int-64d (55 mg, 0.072 mmol) and Int-la (25 mg, 0.143 mmol) and dissolved in dry DMF (716 pL). Diisopropylethylamine (61 L, 46 mg, 0.358 mmol) was added and the reaction mixture was cooled to 0 *C in an ice-water bath. After -15 minutes, solid HATU (57 mg, 0.150 mmol) was added. After 3 hours at 0 'C the reaction was quenched by addition of water (20 mL), whereupon a beige solid precipitated. The solid was collected by vacuum filtration and washed again with water (-50 mL). The solid was dissolved in EtOAc (-100 mL) and the resulting solution was washed with brine (-25 mL). The organic layer was collected, dried over MgSO4, filtered, and concentrated under reduced pressure to provide the crude product. Further purification by reverse phase C 18 chromatography (Gilson*, Phenomenex Gemini C18 5 pm 150 x 21.20 mm column, Eluent: 10-70% MeCN/water + 0.1% TFA) provided Compound 1002 as a beige solid (26 mg, 39% yield). Step F: Isomer separation by HPLC. Compound 1002 (48.8 mg) was dissolved in abs. EtOH (1.0 mL) and the solution was filtered through a Whatman Puradisc 13 mm syringe filter. The sample was injected onto a Phenomenex Lux Cellulose-2 (5 Im, 150 x 21.20 mm) semi-preparative column; detection wavelength = 350 nm. Elution with 50% EtOH/hexane @ 10 mL/min provided the first peak (eluted between t = 0.5 minutes and t = 35 minutes) which was collected and concentrated to provide Compound 1024 (15 mg) as an off-white solid. The eluent solvent polarity was increased to 60% EtOH/hexane at t = 120 minutes while maintaining a flow rate of 10 mL. The second component, (between t = 125 minutes and t = 185 minutes), was collected and concentrated to provide Compound 1025 (15 mg) as an off-white solid. EXAMPLE 65 Preparation of Compound 1019 WO 2012/041014 PCT/CN2011/001638 209 OMe OMe ci ~Brnt-56g c cO N

O

S StepA StepB 0 IInt-65a n6 OO6-- Int-65d N O N Int-7d N /N N N H H O Step C Step o 6 Int-65c 0 \O Int-65d 0- 0- 2HC 0 0 O O H Step G Step H O x Int-65e O Int-65f O

O

0- 0 Br/ N N NHNK N0 H- -N 0~ F _,N, N 0rKN 0 Int-10f 'F H IW NH/ __ __ __ _ ' N H / N IN N StepG t StepH A H I 2 -mL Int-65g fe Int-65h 0 0 H ' 0 0r OH N )J ~ 01 (3.03 a g, 9. mmH n e-irmd n-6 87g 8mo)wr ie n Step i d 0 The Compound 1019 0 Step A In a 250-mL round-bottom flask, the 2-(hydroxyphenyl)indole Int-19g (3.03 g, 9.4 mmol) and gem-dibromide Int-56g (8.7 g, 28 mmol) were mixed and dissolved in dry DMS0 (94 mL). Solid cesium carbonate (21 g, 66 mmol) and a magnetic stir bar were added. The reaction mixture was allowed to stir at 100 'C for 21 hours. Water (-500 mL) was added to the reaction mixture, whereupon a beige solid precipitated. The suspension was extracted with EtOAc (3 x 250 mL) and the combined extracts were washed with brine (-250 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide the crude product as WO 2012/041014 PCT/CN2011/001638 210 a dark orange-brown solid. The crude product was adsorbed onto silica gel (10 g), and then purified using flash silica gel chromatography (Isco*; 120 g RediSep* Gold silica gel column; Eluent 0-50% EtOAc/hexanes gradient) to provide Int-65a as a light brown solid (1.80 g, 41% yield). Step B In a 125-mL round-bottom flask, Int-65a (2.644 g, 6.18 mmol), bis(pinacolato)diboron (1.57 g, 6.18 mmol), (dppf)PdCl 2

-CH

2

C]

2 (138 mg, 0.168 mmol) and KOAc (1.65 g, 16.85 mmol) were mixed. The reaction was alternately evacuated and refilled with nitrogen (5x) followed by dry dioxane (38 mL). The flask was immersed in a preheated 90 'C oil bath and the reaction mixture, was allowed to stir at 90 'C for 2 hours. The reaction mixture was allowed to cool to room temperature, diluted with EtOAc (-300 mL) and washed with brine (-200 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated in vacuo to provide a dark yellow solid, which was purified using flash silica gel chromatography (Isco*; 120 g RediSep* Gold silica gel column; Eluent: 0-50% EtOAc/hexanes gradient) to provide Int-65b as yellow solid (1.99 g, 68% yield). Step C In a 125-mL round-bottom flask, the boronate Int-65b (1.14 g, 2.21 mmol), bromoimidazole Int-7d (750 mg, 2.37 mmol), (dppf)PdCl2-CH 2

CI

2 (90 mg, 0.110 mmol) were mixed. The flask was alternately evacuated and refilled with nitrogen (5x) and dry dioxane (15 mL) was added. The reaction mixture was allowed to stir at room temperature for 5 minutes and then aqueous potassium carbonate solution (11 mL, 1 M aqueous, 11 mmol) was added. The flask was immersed into a preheated 90 *C oil bath and stirred at 90 *C for 3 hours. The reaction mixture was allowed to cool to room temperature, diluted with EtOAc (-100 mL) and the resulting solution was filtered and washed with brine (-50 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated ration under reduced pressure to provide an orange-brown solid. The crude product was purified using flash silica gel chromatography (Isco*; 220 g WO 2012/041014 PCT/CN2011/001638 211 RediSep* Gold silica gel column; Eluent: 0-100% EtOAc/hexanes) to provide Int-65c as a golden yellow solid (1.06 g, 76% yield). Step D In a 150-mL round-bottom flask, substrate Int-65c (754 mg, 1.202 mmol) was dissolved in methanol (12 mL) and HCl solution (3 mL, 4 M in dioxane, 12 mmol) was added. The clear, pale yellow solution was allowed to stir at room temperature for 18 hours. The reaction mixture was concentrated by rotary evaporation under reduced pressure to provide Intermediate Int-65d as a pale yellow solid (728 mg, quantitative yield). Step E In a 50-mL round-bottom flask, Int-65d (719 mg, 1.20 mmol) and Int-la (231 mg, 1.318 mmol) were dissolved in dry DMF (12 mL). Diisopropylethylamine (1.0 mL, 774 mg, 5.99 mmol) was added and the he reaction mixture cooled to 0 'C (ice water bath). After 15 minutes., solid HATU (684 mg, 1.80 mmol) was added in one portion. The reaction mixture was allowed to stir at 0 'C for 1 hour. Water (-20 mL) was added and the precipitated solid was collected by vacuum filtration. The collected solid was washed with water (-5 mL) and air-dried. The crude product was subsequently purified using flash silica gel chromatography (Isco*; 40 g RediSep* Gold silica gel column; Eluent: 0-10% MeOH/CH 2 Cl 2 gradient). All product-containing fractions were collected, concentrated, and re-purified using flash silica gel chromatography (Isco*; 80 g RediSep* Gold silica gel column; Eluent: 0-3.5% MeOH/CH 2

CI

2 gradient) to provide Int-65e (286 mg, 35% yield). Step F In a 50-mL round-bottom flask, Int-65e (285 mg, 0.417 mmol), bis(pinacolato)diboron (127 mg, 0.500 mmol), Pd 2 (dba) 3

-CHC

3 (43 mg, 0.042 mmol), X-Phos (40 mg, 0.083 mmol) and KOAc (123 mg, 1.25 mmol) were mixed. The flask was alternately evacuated and refilled with nitrogen (5x). Dioxane (3 mL) was added and the reaction was allowed to stir at 120 'C for 1.5 hours. The reaction mixture was WO 2012/041014 PCT/CN2011/001638 212 allowed to cool slowly to room temperature for 12 hours. The reaction mixture was diluted with EtOAc (-100 mL) and washed with brine (-50 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide an orange solid as crude product. The crude product was purified using flash silica gel chromatography (Isco*; 40 g RediSep* Gold silica gel column; Eluent: 0-9% MeOH/CH2Cl 2 gradient) to provide Int-65f as an orange-yellow foamy solid (253 mg, 78% yield). Step G In a 5-mL Biotage* microwave tube, Int-65f (123 mg, 0.159 mmol), bromoimidazole Int-1 Of (64 mg, 0.190 mmol), (dppf)PdCl 2

*CH

2 Cl 2 (13 mg, 0.016 mmol) were mixed. The tube was alternately evacuated and refilled with nitrogen (5x), dry dioxane (1.5 mL) was added and the reaction mixture stirred at room temperature for 5 minutes. Aqueous potassium carbonate solution (0.800 mL, 1 M aqueous, 0.8 mmol) was then added. The tube was immersed into a preheated 90 'C oil bath and the reaction was allowed to stir for 16 hours. The reaction mixture was allowed to cool to room temperature, diluted with EtOAc (-50 mL), and filtered through a polyethylene filter frit. The filtrate was washed with brine (-25 mL), dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide a light brown solid. The crude product was purified using flash silica gel chromatography (Isco*; 24 g RediSep* Gold silica gel column; Eluent: 0-9% MeOH/CH 2

CI

2 gradient) to provide Int-65g as a beige solid (92 mg, 64% yield). Step H: In a 50-mL round-bottom flask, the Int-65g (73 mg, 0.081 mmol) was dissolved in methanol (0.8 mL) and hydrogen chloride solution (200 plL, 4 M in dioxane, (240 mg, 0.800 mmol) was added. The reaction mixture was allowed to stir at room temperature for 18 hours. The reaction mixture was concentrated under reduced pressure to provide Int-65h as a beige solid (77 mg, quantitative yield). Step I: WO 2012/041014 PCT/CN2011/001638 213 In a 50-mL round-bottom flask, Int-65h (73 mg, 0.080 mmol) and Int-la (17 mg, 0.096 mmol) were mixed and dry DMF (1 mL) was added. Diisopropylethylamine (70 pL, 53 mg, 0.412 mmol) was added and the reaction cooled to 0 'C (ice-water bath). After 15 minutes. solid HATU (46 mg, 0.120 mmol) was added in one portion. The reaction mixture was allowed to stir at 0 *C for I hour. Water (-20 mL) was added and the precipitated solid was collected by vacuum filtration. The collected solid was washed with water (-5 mL), air-dried briefly, dissolved in DMF (-1 mL) and purified using reverse-phase C 18 chromatography (Gilson*, Phenomenex* Gemini C 18 5 Rim 150 x 21.20 mm column, Eluent: 10-70% MeCN/water + 0.1% TFA) to provide Compound 1019 (21 mg, 28% yield) as a beige solid. EXAMPLE 66 Preparation of Compound 1033 OMe F Br OMe F 0 F Br Br Int-56g Br B HO StepA 0 StepB 0 Int-19c o- /_6 int-66a \-Cl nt-66b 0- 0 O Ne2N N 0 SHIt-d CO 2I H N a NN N H Step C 0 StepD I 2 m ak c Int-e\ (1.64 Int46d 0 MeO2, 8.5 0 N HV 0 N N N 0H F COr~e OH 0 0 mnt-la N - N~ H N N N Step E H 0 < / 1033 0 Step A In a 200-mL pear-shaped flask was charged with Int-19c (1.64 g, 4.26 mmol), Lnt-56g (2.64 g, 8.52 mmol), DMSO (17 mL) and stirred until homogeneous.

WO 2012/041014 PCT/CN2011/001638 214 Solid cesium carbonate (10 g, 66 mmol) was added, the flask fitted with a condenser and then immersed into a preheated 100 *C oil bath. After 18 hours the reaction mixture was poured into water (-400 mL) and Extracted with EtOAc (2 x 150 mL, 1 x 300 mL). The aqueous layer was diluted with brine (-200 mL) and was extracted with EtOAc (-150 mL). The combined organic phases were washed with brine (-100 mL), dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide an orange-red semi-solid. The crude product was adsorbed onto silica gel (10.0 g) and was purified using flash silica gel chromatography (Isco*; 220 g RediSep* Gold silica gel column; Eluent: 0-40% EtOAc/hexanes gradient) to provide Int-66a (1.09 g, 48% yield) as a beige solid. Step B In a 125-mL round-bottom flask, Int-66a (1.03 mg, 1.93 mmol), bis(pinacolato)diboron (1.08 g, 4.25 mmol), (dppf)PdCl 2

-CH

2

C

2 (158 mg, 0.193 mmol) and KOAc (569 mg, 5.80 mmol) were mixed. The tube was sealed and alternately evacuated and refilled with nitrogen (5x) and dry dioxane (13 mL) was added. The flask was immersed in a preheated 90 'C oil bath and the reaction mixture was allowed to stir for 1 hour. The reaction mixture was allowed to cool to room temperature, diluted with EtOAc (100 mL), filtered and washed with brine (-50 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated to provide a light brown solid. The crude product was purified using flash silica gel chromatography (Isco*; 120 g RediSep* Gold silica gel column; Eluent: 0-40% EtOAc/hexanes gradient) to provide Int-66b as a dark beige (1.00 g, 83% yield). Step C A 125-mL round-bottom flask was charged with intermediate Int-66b (992 mg, 1.58 mmol), bromoimidazole Int-7d (1100 mg, 3.48 mmol), and (dppf)PdCl2 CH2Cl2 (129 mg, 0.158 mmol). The flask was sealed and alternately evacuated and refilled with nitrogen (5x). Dioxane (11 mL) was added and the reaction mixture was allowed to stir at room temperature for 5 minutes. Aqueous potassium carbonate solution (5 mL, I M aqueous, 5 mmol) was added and the flask immersed into WO 2012/041014 PCT/CN2011/001638 215 a preheated 90 'C oil bath. After 22 hours the reaction was allowed to cool to room temperature, diluted with EtOAc (-100 mL) and the resulting solution washed with brine (-50 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide a light brown solid. The crude product was purified using flash silica gel chromatography (Isco*; 80 g RediSep* Gold silica gel column; Eluent: 0-6% MeOH/CH 2

CI

2 gradient) to provide Int-66c as an orange-yellow solid (867 mg, 65% yield). Step D In a 100-mL round-bottom flask, Int-66c (690 mg, 0.816 mmol) was dissolved in methanol (8 mL) and hydrogen chloride solution (2 mL, 4 M in dioxane, (2.4 g, 8 mmol) was added. The reaction mixture was allowed to stir at room temperature for 12 hours. The reaction mixture was concentrated under reduced pressure to provide Int 66d as a beige solid (648 mg, quantitative yield). Step E In a 50-mL round-bottom flask was charged with Int-66d (200 mg, 0.253 mmol) and Int-la (97 mg, 0.556 mmol) and dry DMF (2.5 mL). Diisopropylethylamine (265 1 iL, 196 mg, 1.5 mmol) was added and the reaction cooled to 0 'C (ice-water bath). After 15 minutes. solid HATU (240 mg, 0.632 mmol) was added in one portion. The reaction mixture was allowed to stir at 0 'C for 10 hours. Water (20 mL) was added to quench the reaction. The cream-colored suspension was extracted with EtOAc (2 x 50 mL) and the combined extracts were washed with brine (-25 mL). The organic layer was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide a light yellow-brown solid. The crude product was purified using reverse-phase chromatography (Gilson*; Phenomenex* Gemini 150 x 21.20 mm x 5 gm column; Eluent: 10-70% MeCN/water (+0.1% TFA) gradient) to provide Compound 1033 as a beige solid (79 mg, 33% yield). EXAMPLE 67 Preparation of Compound 1038 WO 2012/041014 PCT/CN2011/001638 216 0 0 O O 0 O Br N NN X-2O NCO 2 Me H O -CO2Me H _ _ _ _ N N H N __ __ __ -B H StepA 0 Int-65f 0_ Int-67a QNH N ~, N Oy NICO2Me Step B HH -3HCI 0 eO O 0- Int-67b o N - Me02C OH H N N Step ' CH _ 1038 Step A In a 250-mL round-bottom flask was charged with Int-65f (1.51 g, 1.95 mmol), bromoimidazole Int-7d (739 mg, 2.34 mmol), (dppf)PdC2-CH 2 Cl 2 (143 mg, 0.195 mmol). The flask was alternately evacuated and refilled with nitrogen (5x) and dry dioxane (19 mL) was added. After 5 minutes. aqueous potassium carbonate solution (10 mL, 1 M aqueous, 10 mmol) was added and the reaction immersed into a preheated 90 'C oil bath. After 10 hours, the reaction was allowed to cool to room temperature and was diluted with EtOAc (-100 mL) and water (-50 mL). The organic layer was washed with brine (-50 mL), dried over anhydrous MgSO 4 , filtered, and concentrated by rotary evaporation under reduced pressure to provide an orange-brown solid. The crude product was purified using flash silica gel chromatography (Isco*; 220 g RediSep* Gold silica gel column; Eluent: 0-100% EtOAc/hexanes gradient) to provide Int-67a as a golden yellow solid (1.23 g, 71% yield). Step B WO 2012/041014 PCT/CN2011/001638 217 In a 50-miL round-bottom flask, Int-67a (1.222 g, 1.381 mmol) was dissolved in methanol (14 mL) and hydrogen chloride solution (3.5 mL, 4 M in dioxane, (4.20 g, 14 mmol) was added. The reaction mixture was allowed to stir at room temperature for 9 hours, and then concentrated under reduced pressure to provide Int-67b as a beige solid (1.222 g, 99% yield). Step C A 50-mL round-bottom flask was charged with Int-67b (155 mg, 0.73 mmol), Int-4f (45 mg, 0.208 mmol) and the solids were dissolved in a solution of diisopropylethylamine (151 gL, 112 mg, 0.867 mmol) in dry DMF (1.7 mL). The reaction mixture was cooled to 0 'C (ice-water bath) and stirred for 15 minutes. Solid HATU (99 mg, 0.260 mmol) was added in one portion. The reaction mixture was allowed to stir at 0 'C for 2 hours. Methanol (1 mL) and TFA (56 pL) were added sequentially at room temperature and the reaction mixture was allowed to stir at room temperature for an additional 2 hours. Water (20 mL) and aqueous sodium bicarbonate solution (-10 mL) were added, and the aqueous phase was extracted with EtOAc (2 x -50 mL). The combined organic phase was washed with brine (~25 mL), dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure to provide a light brown solid. The crude product was purified directly by reverse-phase chromatography (Gilson@; Phenomenex Gemini 150 x 21.20 mm x 5 gm column; Run 1: Eluent: 10-70% MeCN/water (+0.1% TFA) gradient; Run 2: 10-60% MeCN/water (+0.1% TFA) gradient) to provide Compound 1038 as a beige solid (80 mg, 47% yield). EXAMPLE 68 Preparation of Compound 1048 0 Int-4f O H 0 0 - ~0Ny_ 00 N N H N N -0 0*O 0'N .4HC H O 0 O- - HN On 4HCt 1048 0- 0 Int-64d 1048 WO 2012/041014 PCT/CN2011/001638 218 A 50-mL round-bottom flask was charged with Int-64d (167 mg, 0.216 mmol), Int-4f (103 mg, 0.475 mmol) and the solids were dissolved in dry DMF (2 mL). Diisopropylethylamine (226 IL, (167 mg, 1.30 mmol) was then added to the reaction at 0 'C (ice-water bath) and stirred for 15 minutes. Solid HATU (204 mg, 0.537 mmol) was then added in one portion and the reaction was allowed to stir at 0 *C for 1 hour. Methanol (1 mL) and trifluoroacetic acid (200 tL) were added and the reaction was allowed to stir at room temperature for 30 minutes. Water (20 mL) was added to quench the reaction. The reaction mixture was extracted with EtOAc (2 x 50 mL), the combined organic phase was washed with brine (-50 mL), dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide a light orange-yellow solid. The crude product was purified directly by reverse-phase chromatography (Gilson@; Phenomenex Gemini 150 x 21.20 mm x 5 gm column; Eluent: 10-60% MeCN/water (+0.1% TFA)) to provide the Compound 1048 as a beige solid (135 mg, 61% yield) EXAMPLE 69 Preparation of Compound 1488 N O O _ O _ 0 Br FN N N BN N EI ~ Int-lof F ~ N \0H ~ O Step A 0 H N \ StepB 0_ Int-64b 0 Int-69a 0 Int-4f H <0 0 Ni 0 N N N H N N - 0 [ 0 NN H INO -4C Step C 0N .4HCI O\/ OH 0~ Int-69b 0 1488 Step A A 20-mL Biotage* microwave vial was charged with Int-64b (392 mg, 0.643 mmol), bromoimidazole Int-10f (451 mg, 1.35 mmol), and (dppf)PdCl 2

-CH

2

CI

2 WO 2012/041014 PCT/CN2011/001638 219 (47 mg, 0.064 mmol). The flask was alternately evacuated and refilled with nitrogen (5x) and dry dioxane (6.5 mL) was added and stirred vigorously. After 5 minutes aqueous potassium carbonate solution (3 mL, I M aqueous, 3 mmol) was added and the reaction immersed into a preheated 90 *C oil bath. After 18 hours the reaction was allowed to cool to room temperature, and diluted with EtOAc (-100 mL) and water was added. The reaction was extracted thrice with EtOAc (-50 mL), and the combined organic phase was washed with brine (-50 mL). The organic phase was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide an orange-brown solid. The crude product was purified using flash silica gel chromatography (Isco*; 40 g RediSep* Gold silica gel column; Eluent: 0-100% EtOAc/hexanes gradient) to provide Int-69a as a golden yellow solid (409 mg, 74% yield). Siep B In a 50-mL round-bottom flask, the Int-69a (375 mg, 0.434 mmol) was dissolved in methanol (4.5 mL) and a hydrogen chloride solution (1.0 mL, 4 M in dioxane, (1.2 g, 4 mmol) was added. The reaction mixture was allowed to stir at room temperature for 24 hours. The reaction mixture was concentrated under reduced pressure to provide Int-69b as a beige solid (344 mg, 98% yield). Step C Int-4f (99 mg, 0.454 mmol) was weighed into a pre-tarred vial and transferred using DMF solvent (4 x 500 pL) to a 50-mL round-bottom flask containing Int-69b (167 mg, 0.206 mmol)). Diisopropylethylamine (220 IL, 163 mg, 1.26 mmol) was added by syringe. The mixture was allowed to stir at room temperature for -1 minutes, during which time all solids dissolved. The flask was cooled in an ice-water bath for -15 minutes and solid HATU (196 mg, 0.516 mmol) was added in one portion. After 1.5 hours at 0 'C, Methanol (1 mL) and TFA (190 gL) were added sequentially and the reaction mixture was allowed to stir for an additional 2 hours. Water (-20 mL) was added and the reaction mixture was extracted with EtOAc (2 x -50 mL). The combined organic phases was washed with brine (-50 mL), dried over anhydrous MgSO4, filtered, and concentrated under reduced pressure to provide a light orange solid. The crude WO 2012/041014 PCT/CN2011/001638 220 product was purified directly by reverse-phase chromatography (Gilson*; Phenomenex Gemini 150 x 21.20 mm x 5 gm column; Eluent: 0-60% MeCN/water (+0.1% TFA) gradient over 15 minutes. Major components that eluted were Compound 1488 and a TFA adduct of same. The total yield of the final product was 146 mg, 67% yield. EXAMPLE 70: Preparation of Compound 1492 O N O N 71 NN OH -HCI -4HCI O -4HCI O- Int-64d 0 1492 A 50-mL round-bottom flask was charged with Int-64d (183 mg, 0.237 mmol) and (R)-NN-diethylphenylglycine hydrochloride (127 mg, 0.520 mmol) and the solids were dissolved in dry DMF (2.5 mL). Diisopropylethylamine (400 pL, 296 mg, 2.29 mmol) was added, the reaction cooled to 0 *C (ice-water bath) and stirred for 15 minutes. Solid HATU (225 mg, 0.591 mmol) was added in one portion. After 1 hour methanol (1 mL) and trifluoroacetic acid (365 pL) were added and the reaction was allowed to stir at room temperature for 30 minutes. The reaction was quenched with water (20 mL) and the product was extracted into EtOAc (2 x 50 mL). The combined organic phase were washed with brine (-50 mL), dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide a light orange-yellow solid. The crude product was purified directly by reverse-phase chromatography (Gilson@; Phenomenex Gemini 150 x 21.20 mm x 5 gm column; Eluent: 10-60% MeCN/water (+0.1% TFA) gradient over 15 minutes) to provide fractions containing Compound 1492 and a TFA adduct of same. Retreatment of the TFA-adduct fractions with methanol as above, provided additional amounts of the desired Compound. Total yield of Compound 1492 was 201 mg, 74% yield.

WO 2012/041014 PCT/CN2011/001638 221 EXAMPLE 71 Preparation of Compound 1044 0 N N O N O N O OH -HCIN 0-0 \ 0-3HC \0 Int-67b 0 1044 A 50-mL round-bottom flask was charged with Int-67b (123 mg, 0.138 mmol) and (R)-NN-diethylphenylglycine hydrochloride (40 mg, 0.165 mmol) and the solids were dissolved in a solution of diisopropylethylamine (240 AL, 178 mg, 1.375 mmol) in dry DMF (1.4 mL). The reaction mixture was cooled to 0 "C (ice-water bath) and stirred for 15 minutes. Solid HATU (78 mg, 0.206 mmol) was added in one portion. After I hour the reaction mixture was concentrated under reduced pressure to provide brown, viscous oil, which was purified using reverse-phase chromatography (Gilson*; Phenomenex* Gemini 150 x 21.20 mm x 5 gm C-18 column; Run 1: 450 sL injection; 10-70% MeCN/water (+0.1% TFA) gradient over 15 minutes. Run 2: 600 pL injection; 10-60% MeCN/water (+0.1% TFA) gradient over 20 minutes) to provide Compound 1044 as a beige solid (88 mg, 66% yield). EXAMPLE 72 Preparation of Compound 1039 Me2C'N O COMe N 0~ N N H _ _ _ _N 2 N 020 -3HCtep O- Int-67b 0- 1039 A 50-mL round-bottom flask was charged with Inter Int-67b (104 mg, 0.116 mmol), Int-le (27 mg, 0.140 mmol) and a solution of diisopropylethylamine (102 WO 2012/041014 PCT/CN2011/001638 222 gL, 75 mg, 0.581 mmol) in dry DMF (1 mL). The reaction mixture was cooled to 0 *C (ice-water bath) and stirred for 15 minutes. Solid HATU (66 mg, 0.174 mmol) was added in one portion and the reaction mixture was allowed to stir for 2 hours and allowed to warm to room temperature. Methanol (1 mL) and TFA (56 tL) were added sequentially at room temperature and the reaction was allowed to stir at room temperature for 2 hours. Water (20 mL) followed by aqueous sodium bicarbonate solution (-10 mL) were then added. The reaction was extracted with EtOAc (2 x -50 mL) and the combined extracts were washed with brine (-25 mL). The organic phase was dried over anhydrous MgSO 4 , filtered, and concentrated under reduced pressure to provide a light brown solid. The crude product was purified directly by reverse-phase chromatography (Gilson*; Phenomenex* Gemini 150 x 21.20 mm x 5 gm column; Run 1: 10-70% MeCN/water (+0.1% TFA) gradient over 20 minutes. Run 2: 10-60% MeCN/water (+0.1% TFA) gradient over 20 minutes) to provide Compound 1039 as a beige solid (65 mg, 82% yield). EXAMPLE 73 Preparation of Compounds 959, 950, & 951 WO 2012/041014 PCT/CN2011/001638 223 HBoo H N Nl C1 C (R) N Br B O C OnF Br \/Br NN N rV ____ N N 00 o 3It HO Int-22a Int73a Int-73b S0 2 cI CI 1) B O BocHN C1 /NHc Br F/NHHC/Dioxane N N -p N N NH N 02) BN J- \IR o0 _ -(I r ~ Br -(R) Int-73 c F 0 - Intl1f Int-73d F I-- H3CO t IaO OC- a NS N H ~ NO ~ ,S NN ISN H3 H OH Int-73e 959 chral Iseparation Compound 950 and Compound 951 Step A Int-22a (1g, 2.8 mmol), 2-methyl thiophenecarboxaldehyde (1.06g, 8.4 mmol) and p-tosyl chloride were dissolved in toluene (10 mL) and stirred in a pressure tube at 150 'C for 6 hr. After cooling, the crude material was purified using an ISCO silica gel column (pre-packed, 80 g) eluted with EtOAc : Hex (0% to 5%) to yield Int 73a (500 mg, 38%). Step B Int-73a (0.5 g, 1.08 mmol), bis(pinacolato)diboron (0.3 g, 1.2 mmol), KOAc (316 mg, 3.2 mmol) and PdCl 2 (dppf) 2 (88 mg g, 0.11 mmol) were added into a microwave tube. After the flask was flashed with N 2 , and dioxane (3 mL) was added. The mixture was allowed to stir at 110 *C for 1 hour. The crude reaction containing Int 73b was used without further purification.

WO 2012/041014 PCT/CN2011/001638 224 Step C To the reaction flask charged with Int-73b was added Int-10f (430 mg, 1.3 mmol), PdCl 2 (dppf) 2 (88 mg, 0.11 mmol) and K 2

CO

3 (1 N aq., 3.23 ml). The tube was sealed, degassed and stirred at 90 *C for about 15 hours. After cooling, EtOAc (1 OOmL) was added , the layers separated and the organic phase washed with brine (100 mL). The organic phase dried and concentrated to provide a semi-solid. The crude product was purified on a ISCO column (pre-packed silica gel, 40 g) and eluted with Hex:EtOAc 0% to 70% gradient to provide product Int-73c 650 mg (94%). Step D Int-73c (640 mg, 1.0 mmol), bis(pinacolato)diboron (508 mg, 2 mmol), Pd 2 dba 3 (155 mg, 0.15 mmol), X-Phos (143 mg, 0.3 mmol) and KOAc (491 mg, 5 mmol) were added to a 20 mL microwave tube. The tube was sealed, degassed and the reaction was allowed to stir at 117 *C for 8 hr. To this reaction mixture was added Int-10f (259 mg, 0.78 mmol), PdCl 2 (dppf) 2 (106 mg, 0.13 mmol) and K 2

CO

3 (1 N aq., 1.9 ml) The tube was sealed and degassed and heated to 100 'C for an additional 24 hr. After cooling, EtOAc (1 OOmL) was added, the layers separated, and the organic phase washed with Brine (100 mL). The organic phase was dried and concentrated to provide a solid. The crude material was purified on an ISCO column (pre-packed silica gel, 24 g) and eluted with DCM: DCM/MeOH/NH 3 .MeOH (90:10:1) 0% to 80% to provide the product Int 73d 130 mg (24%). Step E Int-73d (145 mg, 0.18 mmol) was dissolved in dioxane (2 mL) and HCl (4N in dioxane, 0.9 mL) was added at room temperature. After 1.5 hours, the reaction was concentrated in vacuo in vacuo. The product Int-73e was isolated without further purification (123 mg, 100%). Step F WO 2012/041014 PCT/CN2011/001638 225 Int-73e (123 mg, 0.18 mmol) was dissolved in DMF (5 mL) and cooled to 0 'C. HATU(154 mg, 0.41 mmol), Int-la (71.1 mg, 0.41 mmol ) were added followed by addition of Hunig's base (0.19 mL, 1.06 mmol). After 1.5 hours at 0*C, water was added to quench the reaction. The mixture was diluted with EtOAc and extracted with NaClaq. The organic pahse was dried and concentrated to affors a solid. Further purification with by silica- gel chromatography (pre-packed column, 23 g) eluted with DCM and EtOAC/MeOH/NH 3

.H

2 0 (90:10:1) 0% to 80% to gave Compound 959 103 mg (62%). Compounds 950 & 951 The diastereomers of Compound 959 (103 mg) were separated by chiral SFC separation on a AS-H column (50% MeOH (0.2% DEA)/C02, 50 ml/min, 100 bar), to provide isomer A Compound 950 (27 mg, 35%) and isomer B Compound 951 (28 mg). EXAMPLE 74 Preparation of Compound 1464 CI CI S)( N Br r F Int-10f I Br NN Int-19b C s2COnt-74a - B nt-74b 0I 0 ) aj . eparetion H R NH Bo nt-4' int-7d" NN F 4. S Int-74d F Int-74c CI YICo H S)OHNW \ OHNN HHO CH H F N( )N OCH 3 N ' N ~IN HF RN FIRN- F L)- )R FAR R) 0

N

9 7 0 F 464

CI

WO 2012/041014 PCT/CN2011/001638 226 Step A 2-Chloro-5-dichloromethylthiophene prepared from 2-chlorothiophene aldehyde (5 g, 13.62 mmol) and Cs 2

CO

3 (19.97 g, 61.3 mmol) was charged in a flask and dissolved in DMSO (50 mL). Int-19b (5.49 g, 27.2 mmol) was added and the reaction was heated to 100 0 C. After 1 hour, the reaction was filtered and the filtrated was extracted with NaCl aq. The organic phase was dried and concentrated in vacuo to a semi-solid. The crude material was purified using flash column chromatography on silica gel (220 g column) eluted with EtOAc in Hex 0% to 5% to provide Int-74a (1.35g, 20%). Step B Int-74a (1.53 g, 3.09 mmol), dipinacolatoborane (1.8 g, 7.1 mmol), KOAc( 1.52 g, 15.44 mmol) and PdCl 2 (dppf) 2 (0.504 g, 0.62 mmol) were charged into a microwave tube. After the flask was flashed with N 2 , dioxane (20 mL) was added. The mixture was allowed to stir at 95 'C for 4 hours. The crude reaction was diluted with EtOAc (100 mL) and it was extracted with NaCl aq. The organic phase was dried and concentrated in vacuo. The crude material was purified using flash column chromatography on silica gel with EtOAc in Hex (0% to 20%) eluent to provide Int-74b (990 mg, 54%). Step C Int-74b (990 mg, 1.68 mmol), Int-10f (1.35 g, 4.03 mmol), PdCl 2 (dppf) 2 (0.274 g, 0.342 mmol) and K 2 C0 3 (1 N aq., 8.4 ml) were added to a 20 mL microwave tube. The tube was sealed, degassed with nitrogen and stirred at 100 'C for about 15 hours. After cooling, EtOAc (1OOmL) was added and the reaction was extracted with brine (100 mL). The organic phase was separated, dried and concentrated in vacuo. The crude material was purified on a ISCO silica-gel column (40 g) and with EtOAc/Hex (0% to 70%) eluent to provide product Int-74c 500 mg (33%). Int-74c (504 mg) was subjected to SFC chiral separation on OD-H column (IPA (0.05%

DEA)/CO

2 ) to provide isomers Int-74c' and Int-74c" (176 mg, 35%).

WO 2012/041014 PCT/CN2011/001638 227 Step D Int-74c" ((176 mg) was dissolved in dioxane (10 mL) and HCI (4N in dioxane, 0.53 mL) was added and stirred at room temperature. After 1.5 hr. the solvent was removed in vacuo. Int-74d was isolated without further purification (167 mg, 100%). Step E Int-74d (diastereomer B, 167 mg, 0.21 mmol) was dissolved in DMF (3 mL) and cooled to 0 'C. HATU(169 mg, 0.44 mmol), Int-10f (74.1 mg, 0.423 mmol were added followed by addition of Hunig's base (0.22 mL, 1.27 mmol) and the reaction was allowed to stir at 0 0 C. After 1.5 hours, water was added and the reaction diluted with EtOAc and extracted with NaClaq. The organic phase was dried and concentrated in vacuo to provide a solid.. Purification by silica gel chromatography (23 g) with DCM and EtOAC/MeOH/NH3 (90:10:1 - 0% to 100%) eluent provided the title Compound 970 (140 mg, 69.1%). Compound 1464 (diastereomer B). Compound 970 (60 mg, 0.063 mmol), cyclopropylboronic acid (81 mg, 0.94 mmol), Pd 2 dba 3 (6.5 mg, 6.26 pmol), X-Phos (5.97 mg, 0.013 mmol) and K 2 C0 3 (1 N aq., 188 pl) were added to a 20 mL microwave tube. The tube was sealed and degassed with nitrogen. The reaction was allowed to stir at 110 *C for 5 hr. The crude material was purified on silica gel using DCM to EtOAc/MeOH/NH3.H 2 0 (100:10:1 - 0% to 90%) eluent to provide Compound 1464 (40 mg, 62%). EXAMPLE 75 Preparation of Compound 1459 WO 2012/041014 PCT/CN2011/001638 228 Cs 2

CO

3

/CH

3 CN B, Pd(dppf)Cl 2

CH

2

C

2 Dioane Br 55Cc/ 15hrs Bispinacolodiboron Pd(dppf)C 2

CH

2

CI

2 '9N KOAC/Dioxane N N-Boc-proline Int-19b ~imidazolebromide Int-75b Int-75c (Int-7d) Int-75a N ~~1. TFA, Neat, 00 to r.t H 2. 4M HCl n Dioxane N Int-75d Int-75e 1. HATU, N,N-diisopropyl,ethyl amine/ DMF /-15C /1.5h 0 Int-4a H," NH 2. 2MHCI in Ether(XS) asci S 1459 Step A To a solution of 4-Methyl-2-thiazole-2-carboxaldehyde (2.0g, 15.73mmol) in CH 2 Cl 2 (40 mL) at -200C, added pyridine(O.254ml, 3.15mmol) followed by addition of PCl 5 (6.55g, 31.5mmol) . The mixture was allowed to stir at -20 *C for 30 minutes. NaHCO 3 (13.2g, 1Oeq.) was added as solid to the reaction mixture. After stirring for additional 30 minutes the reaction was filtered through celite and washed with 2 X 25 mL CH2Cl2. The filtrate was concentrated under reduced pressure to provide the crude. It was re-dissolved in CH 2 Cl 2 and filtered through a pad of silica-gel. Filtrate on concentration and drying gave Int-75a as brown oil. (32%) Step B The dibromo indole (Int-19b, 0.5g, 1.362mmol), 2-(dichloromethyl)-4 methylthiazole(Int-75a, 0.496g, 2.72mmol) and Cesium carbonate (0.976g, 3.00mmol) were combined in acetonitrile (10ml) in a 50mL round bottomed flask equipped with condenser and heated at 55'C for 15 hrs. TLC analysis showed consumption of starting WO 2012/041014 PCT/CN2011/001638 229 material. The reaction was diluted with EtOAc, washed with water(3X20ml), brine (1 x20ml), dried(Na2SO4), filtered and concentrated under reduced pressure to provide brown semi-solid crude. It was allowed to stir with ether and filtered to provide Int-75b as yellow solid. The filterate was concentrated and purified using ISCO silica-gel column. The combined yield of 4 was 0.32g (49%). Step C Intermediate Int-75b (0.095g, 0.2mmol), bis(pinacolato)diboron ( 0.106g, 0.419mmol), potassium acetate( 0.1 17g, 1. 197mmol) and PdCl2(dppf).CH2Cl2 (0.065g, 0.08mmol) and Dioxane (2.Oml) were combined in a microwave tube and sealed and purged with nitrogen (3 x). The reaction was heated at 90'C for 2hrs. TLC showed complete reaction. The reaction mixture containing Int-75c was used without additional workup. Step D To the above reaction mixture (Intermediate Int-75c (0.1 14g, 0.2mmol) in the microwave tube, was added N-Bocproline imidazole bromide(Int-7d, 0.139g, 0.44mmol), PdCI2(dppf).CH2Cl2 (0.033g, 0.04mmol) and Potassium carbonate ( 1.199ml of 1M aqueous solution, 1.199mmol) . Sealed and purged with nitrogen (3 x). The reaction was heated at 90 0 C for 4hrs. Reaction was worked up by diluting with EtOAc (25ml) and water (20ml). The resulting mixture was vigorously stirred for 10 minutes and then filtered through Celite. Filtrate was partitioned. The organics were washed with water (3x15ml) and brine(1x15ml), dried(Na 2

SO

4 ), filtered and concentrated in vacuo. The resulting crude was purified using preparatory silica gel column chromatography, using 5%MeOH/CH2Cl2 to provide desired product Int-75d ( 79%). Step E Trifluoroacetic acid (0.25ml, 3.24mmol) was added to Intermediate Int 75d at 0 C. The mixture was allowed to warm room temperature and stirred for additional 1 hour. The solvent was removed under reduced pressure. The product was treated with WO 2012/041014 PCT/CN2011/001638 230 0.36ml of 4MHCl in dioxane (1.44mmol). After 10 minutes of stirring, excess acid and solvent removed and the product Int-75e was dried for about 15 hours. Preparation of Compound 1459 To a solution of Intermediate Int-75e (0.035g, 0.045mmol) in DMF (1.4ml) was added (S)-2-(methoxycarbonylamino)-2-(tetrahydro-2H-pyran-4-yl) acetic acid (0.022g, O.1mmol), HATU(0.038g, 0.1mmol). The reaction was cooled to -154C and Hunig's base (0.051ml, 0.363mmol) was added drop-wise. The resulting mixture was allowed to stir for 1.5 hrs at -1 5 0 C. The reaction was quenched with water (20ml). The product was extracted with EtOAC (3x20ml). The organics were washed with water (3x20ml), brine (1 x20ml), dried (Na 2

SO

4 ), filtered and concentrated under reduced pressure to provide crude which was purified using Gilson reverse phase chromatography using gradient elution of 0% to90% CH 3 CN with 0.1 %TFA and water with 0.1% TFA. The desired fractions were collected and concentrated under reduced pressure and then treated with 0.3ml of 2MHCl in ether. The solvent was removed and the sample was dried for about 15 hours to provide Compound 1459 as an orange brown solid. (32%). EXAMPLE 76 Preparation of Intermediate Compound Int-76d WO 2012/041014 PCT/CN2011/001638 231 CHO Br Br Boc Step AStepB B tp C 1 C S tep, C Int-76a IInt-76b BoC B BoBr CI NBrN Boc N Int-N HO-dH -- step D S F | Int-76c Int76dF Step A - Preparation of Int- 76a To a cooled mixture of thionyl chloride (20 ml, 274 mmol) and DMF (0.7 ml) at 0 0 C, benzothiophene 2-carboxaldehyde (4.7 g, 29.0 mmol) was added in 3 portionas, and stirred at 0 *C for 30 minutes and then a;lowed to warm for about 15 hours. The mixture was poured into ice and aqueous 1N sodium hydrogen carbonate and then extracted with EtOAc. The combined organic solution was washed with brine and dried (Na 2

SO

4 ) and concentrated in vacuo to provide Int-76a (6.1 g, 28.1 mmol, 97 % yield). Step B - Preparation of Compound Int-76b Int-19g (4.5 g, 13.95 mmol), Int-76a (6.06 g, 27.9 mmol) , and cesium carbonate (18.18 g, 55.8 mmol) in DMSO (22 ml) was allowed to stir at 80 0 C for 2 hours. The mixture was then added to cold water and the resulting solid was filtered off and washed with water to provide a 1.55 g of a solid . The filtrate was concentrated and the residue was allowed to stir with 1:1 MeOH-MC to provide crude solid material which was further purified using silica-gel Chromatography (Pre-packed Biotage column, 80g solid loading, Eluent: 1000% Hex to 15% EtOAc/Hex) to provide the desired product Int-76b (650 mg, Yield 33.8%). Step C - Preparation of Int- 76c WO 2012/041014 PCT/CN2011/001638 232 A mixture of Int76b(0.418 g, 0.90 mmol), bis(pinacolato)diboron (0.25 g, 0.99 mmol), KOAc (0.176 g, 1.80 mmol), and Pd(dppf)C1 2 (0.066 g, 0.09 mmol) in 1,4 Dioxane (3 ml) was degassed (by N 2 flush) and heated to 100 'C. After 4h , the reaction was cooled to room temperature, and Int-10f (329 mg, 0.99 mmol), Pd(dppf)Cl 2 (66 mg, 0.09 mmol) and IN K 2

CO

3 (1.8 ml, 1.8 mmol) were added. The mixture was degassed and heated at 100 'C for 2 hours. The mixture was cooled to room temperature, diluted in EtOAc, and filtered through celite pad. The filtrate was concentrated in vacuo and the residue was purified on an ISCO 80 g gold column (Eluent: CH 2

CI

2 -5%MeOH/ CH 2 C1 2 ) to provide Int-76c (503 mg, 0.785 mmol, 88 % yield) as a pale yellow solid. LC/MS (M+H) = 641.2. Step D - Preparation of Int-76d A mixture of Int-76c (0.292 g, 0.455 mmol), bis(pinacolato)diboron (0.127 g, 0.50 mmol), KOAc (0.089 g, 0.91 mmol), X-Phos (0.043 g, 0.091 mmol), and Pd~dba 3 (0.047 g, 0.046 mmol) in 1,4-Dioxane (3.5 ml) was degassed (by N 2 flush) and heated to 100 'C. After 18 hours, the reaction was cooled to room temperature, the crude mixture was treated with Int-7d (160 mg, 0.51 mmol), Pd(dppf)C1 2 (34 mg, 0.046 mmol) and IN K 2

CO

3 (0.92 ml, 0.92 mmol). The mixture was degassed and stirred at 100 'C for 6 hours, cooled to room temperature, diluted in EtOAc, and filtered through celite pad. The filtrate was concentrated in vacuo and the residue was purified on an ISCO 40 g gold column (Eluent: Hex-EtOAc 100:1 to 85:15 gradient) to provide Int-76d (225 mg, 58 % yield) as a pale yellow solid. LC/MS (M+H)= 842.3. EXAMPLE 77 Preparation of Compounds 792, 422 & 423 WO 2012/041014 PCT/CN2011/001638 233 BocH OO .. O ' 1N SF HH | o H N opon 2 NN N N N N H SoH AStep A dv Int-77a iwa 00

H

2 C H pi fao Int-4a 0 N H N N L) SFC Step B 0 Diastereomers A rN Compound 422 H N \ / / 7 0 Compound 43 NN- N H o H I 792 Step A Trifluoroacetic acid (- ml, 12.98 mol) was added to a stirred, cooled 0 NC solution of Int-76d (0.171 g, 0.203 mmol) in n 2 d 2 (3 nl). After 5 minutes the reaction was allowed to warm to room temperature and stir an additional 90 minutes.. The mixture was concentrated in vacuo and the residue was dissolved in MeOH followed by treatment with 2N HCl in ether. The methanol solution was then concentrated to dryness providing Int-77a (0.145 g, 0.203 mmol, 100 % yield) which was used without further purification. LCIMS (M±H) =642.3. Step B A round flask was charged with Int-77a (145 mg, 0.203 mmol), DMF (1.5 ml) and hnt-4a (88 mg, 0.406 nimol) and cooled to -15 0 C. To the reaction mixture were added N,N-diisopropylethylamine (0.248 ml, 1.42 mmol) and HATU (154 mg, 0.406 mmol). After 10 minutes and the reaction was allowed to warm to 0 'C. After 3 hours, the reaction was quenched by 0.5 mL of water and the mixture was filtered and purified WO 2012/041014 PCT/CN2011/001638 234 on a Gilson HPLC (Eluent: Acetonitrile/Water + 0.1% TFA) to provide Compound 792 (106 mg, 41 % yield) as a diastereomeric mixture (-1:1). The diastereomers of Compound 792 were separated by SFC to provide pure diastereomers Compound 422 and Compound 423. LC/MS (M+H) = 1041.4. SFC separation condition: Instrument: Thar 80 SFC ; Column: Chiral Cel OJ, 20pm ,Daicel Chemical Industries, Ltd 250x30mmI.D. Mobile phase: A: Supercritical CO 2 , B:ETOH(contained 0.2% DEA) , A:B =45:55 at 80ml/min; Column Temp: 38 'C EXAMPLE 78 Preparation of Intermediate Compound Int-78a Boc Boc 7-N N NF NN CI oc F F Boc NNN A6.

0 .. t10 N, -'bD 0 Step A0 S Int-76c F S Int-78a F Int-78a (248 mg, 0.288 mmol, 62 % yield) was prepared from Int-76c (343 mg, 0.47 mmol) using the method described in Example 50.. LC/MS (M+H) = 860.3. EXAMPLE 79 Preparation of Compounds 791, 703 & 704 WO 2012/041014 PCT/CN2011/001638 235 Boc N N N N LDocN N F H !~C F' H ' ' H N NN Step A N N 0 H H Int-78a F HC salt Int-79a F 6 f 00

HO

2 C N 0 O Nnt040 SFC int4f N N - Diastereomers Step B F HN4 N N O 703 and 704 N N H 0 H/ S F 791 Step A Compound Int-79a (211 mg, 0.29 mmol, 100% crude yield).was prepared from Int-78a (248 mg, 0.29 mmol) following the method described in Example 77 Step A LC/MS (M+H) = 660.3. Step B Compound 791 (112 mg, 0.087 mmol, 44% yield) was prepared from Int 79a (147 mg, 0.20 mmol) using the method described in Example 77, Step B SFC separation provided the pure diastereomers Compound 703 and Compound 704 LC/MS (M+H) = 1058.2. SFC Separation condition: (Thar 80 SFC , Chiral Pak AS, 20hm, Daicel Chemical Industries, Ltd 250x3OmmI.D. Mobile phase: A: Supercritical CO 2 , B:ETOH(contained 0.2% DEA) , A:B =60:40at 80ml/min EXAMPLE 80 Preparation of Compound 789 WO 2012/041014 PCT/CN2011/001638 236 N N N N -1~ N N HO 2 NO N 1 0 H H H o HStep A 0 F -s Int-77a 789 Compound 789 (106 mg, 0.084 mmol, 41% yield) was prepared from Int 77a (145 mg, 0.203 mmol) using Int-1a using the method described in Example 77, Step B LC/MS (M+H) = 1041.4. EXAMPLE 81 Preparation of Intermediate Compound Int-81d CI Br -( N \ Br C H HO Br N NN~ Int-22a N h Br O Br Step A CHO Step B Int-81a Int-81b / Int-81c -N 0 Boc Boc Br N F N Cc H1 N N N nt-I Of 0 H Step C F -- N int-81d Step A n-BuLi (5.79 ml, 14.47 mmol) was added to a stirred, cooled -78 'C solution of 7-bromo-4-methyl-3,4-dihydro-2H-1,4-benzoxazine (Int-81a, 3 g, 13.15 mmol) in THF (24 ml). After stirring 1h at -78 'C for 1 hour., DMF (2.037 ml, 26.3 WO 2012/041014 PCT/CN2011/001638 237 mmol) was added dropwise and the mixture allowed to warm slowly over 2 hours to room temperature. The reaction was quenched with aqueous ammonium chloride, and the product extracted into ethyl acetate. The organic phase was washed with brine, dried (Na 2

SO

4 ), filtered and under reduced pressure to provide Int-81b (2.32 g, 13.09 mmol, 100 % yield) as a green solid. Step B A 0.2-0.5 mL microwave tube was charged with Int-22a (1g, 2.491 mmol), Int-81b (1.12 g, 6.32 mmol), p-TsCl (0.142 g, 0.747 mmol) and Toluene (8 ml). The reaction was heated in the microwave reactor at 170 'C for 6 hours. The mixture was cooled, concentrated in vacuo and the residue was purified on an ISCO 24 g gold column (Eluent: 100% Hex to 50% EA/Hex gradient) to provide Int-81c (190 mg, 0.339 mmol, 13.61 % yield). Step C A mixture of Int-81c (350 mg, 0.624 mmol), bis(pinacolato)diboron (349 mg, 1.373 mmol), KOAc (245 mg, 2.497 mmol), and Pd(dppf)C1 2 (45.7 mg, 0.062 mmol) in 1,4-Dioxane (5 ml) was degassed (by N 2 flush) and heated to 100 'C. After I 8h, the reaction wascooled to room temperature, the mixture was treated with Int-10f (438 mg, 1.3 10 mmol), IN K 2

CO

3 (2.5 ml, 2.5 mmol) and Pd(dppf)C 2 (45.7 mg, 0.062 mmol). The mixture was degassed and heated to 100 *C for 18 hours. The mixture was cooled, diluted in EtOAc and filtered through celite pad, and the filtrate was concentrated in vacuo to provide a solid. The crude product was purified using flash column chromatography on silica gel on (ISCO 40g gold, Eluent:Hex-EtOAc 100:0 to 85:15) to provide Int-81d (233 mg, 0.256 mmol, 41.1 % yield) as a pale yellow solid. LC/MS (M+H) = 909.4. EXAMPLE 82 Preparation of Compound 793 WO 2012/041014 PCT/CN2011/001638 238 Boc H oc F H - N s otH N F O Hh Ial NC' It-2 - 0N 7 0 Step A CopondInt-82a wa preare fro t1 (100 82 mgF.1 m H0 2 C N 0 HO N)o F H - N N H H 'C NN 0 S, o F H H Step A Compound Int-82a was prepared from Int-81d (100 mg, 0.11 mmol) using the method described in Example 77, Step A (86 mg, 0.11 mmol, 100% yield). LC/ MIS (M+H) = 709.3. Step B Compound 793 was prepared from Int-82a (86 mg, 0. 11 mmol) using the method described in Example 77, Step B (63 mg, 0.050 mmol, 46% yield). LC/ MS (M+H) = 1024.4. EXAMPLE 83 Preparation of Compound 794 0 H); N \ I-4 N H N Nl NN H H N NNN 0 H / Step A 0 H - F 07-3 794 WO 2012/041014 PCT/CN2011/001638 239 A mixture of X-Phos (4.27 mg, 8.95 [tmol), Compound 793 (56 mg, 0.045 mmol), Pddba 3 (4.63 mg, 4.47 pmol), KOAc (10.98 mg, 0.112 mmol) and bis(pinacolato)diboron (17.04 mg, 0.067 mmol) in 1,4-Dioxane (1 ml) was degassed and heated to 100 'C for about 15 hours. The mixture was the then cooled to room temperature, filtered and the crude reaction mixture purified on a Gilson HPLC (Eluent: Acetonitrile/Water + 0.1% TFA) to provide Compound 794 (30.5 mg, 0.025 mmol, 56% yield). LC/MS (M+H)= 989.5. EXAMPLE 84 Preparation of Compounds 1051, 1061 & 1062 GI CI CI Br Br Br Br O B N Step A NStep B O N H HO 0 0 Int-22a Int-84a Int-84b O N Cl F H BrN N O Int-lOf F H NNN Step C 0 H Step D Int-84c H C 'N N NI H O.(.J~M~.~ F lH O H IONC O 2 M e - StepE -4HC \/ Int-84d \/ 1051 Me 2 C4O HN N A: compound 1061 Step F F N HStep G B: cOmpound 1082 N N 0 H~ H Int-84e Step A A 20-mL microwave tube was charged with Int-22a (1.0 g, 2.5 mmol), 3 phenylpropanal (3.3 mL, 3.3 g, 25 mmol) and p-toluenesulfonyl chloride (48 mg, 0.25 WO 2012/041014 PCT/CN2011/001638 240 mmol) and toluene (8 mL). The reaction mixture was heated and stirred at 170 *C in a microwave for 12 hours. The reaction mixture was concentrated in vacuo in vacuo, and the residue adsorbed onto silica gel. Purification by by silica gel chromatography (Eluent:0-15% EtOAc/hexanes) provided Int-84a as a yellow oil (901 mg, 70% yield) Step B A 20-mL microwave tube was charged with Int-84a (901 mg, 1.74 mmol), bis(pinacolato)diboron (1.1 g, 4.4 mmol), (dppf)PdC2-CH 2 Cl 2 (142 mg, 0.17 mmol) and KOAc (512 mg, 5.22 mmol). Dioxane (10 mL) was added, and the sealed reaction degassed with dry nitrogen. The reaction was allowed to stir at 90 'C for 2 hours, then allowed to cool to room temperature, and diluted with EtOAc (100 mL). The organic phase was washed sequentially with water (10 mL) and brine (10 mL). The organic phase was dried over MgSO 4 , filtered, and concentrated in vacuo to provide a solid. The crude product was purified using flash column chromatography on silica gel (Eluent: 0 20% EtOAc/hexanes) to provide Int-84b (1.3 g). Step C A 20-mL microwave tube was charged with Int-84b (572 mg, 0.93 mmol), Int-10f (687 mg, 2.05 minol), and (dppf)PdCl2-CH 2

CI

2 (38 mg, 0.047 mmol). The tube was sealed, dioxane (8 mL) was added, degassed with nitrogen. and aqueous potassium carbonate (6 mL, 1 M, 6 mmol) added. The reaction mixture was heated at 90 *C for 16 hours, cooled to room temperature and diluted with EtOAc (100 mL). The aqueous layer was extracted with EtOAc (2 x 20 mL), and the combined organic extracts were washed with brine (20 mL), dried over MgSO 4 , filtered, and concentrated in vacuo. The crude product was purified using flash column chromatography on silica gel (Eluent: EtOAc (containing 10% MeOH): hexanes of 10:90 to 90:10) to provide Int-84c (580 mg, 72% yield). Step D A 125-mL round-bottom flask was charged with Int-84c (411 mg, 0.47 mmol) and methanol (9 mL). HCI (9.4 mL, 2 M in diethyl ether, 19 mmol) was added WO 2012/041014 PCT/CN2011/001638 241 and the reaction mixture was allowed to stir for about 15 hours at room temperature. The reaction mixture was concentrated in vacuo to provide Int-84d (384 mg, quantitative yield). Step E In a 125-mL round-bottom flask, Int-84d (382 mg, 0.52 mmol) and Int-la (228 mg, 1.3 mmol) were dissolved in DMF (7.5 mL) and diisopropylethylamine (0.63 mL, 0.47 g, 3.6 mmol) was added. The reaction mixture was cooled to 0 *C and was allowed to stir for 15 minutes. HATU (395 mg, 1.04 mmol) was added and the reaction mixture was allowed to stir at 0 *C for 30 minutes, and then at room temperature for 2.5 hours. The reaction mixture was poured into water (30 mL). The precipitate was collected by filtration, then dissolved in methylene chloride (200 mL), dried over MgSO 4 , filtered, and concentrated in vacuo. The resulting crude product was purified using reverse-phase C18 chromatography (Gilson, 0-90% CH 3 CN (+ 0.1% TFA)-water (+ 0.1% TFA) over 15 minutes) to provide Compound 1051 as a yellow foam (199 mg, 39% yield). Step F Compound 1051 (247 mg, 0.251 mmol) was dissolved in methanol (13 mL) and palladium (268 mg, 10 wt% on carbon, containing 50 wt% water) was added. The reaction mixture was hydrogenated for 71 hours, at which point LC/MS analysis showed a 4:1 mixture of desired product and starting mixture. The hydrogenation was continued for a further 92 hours. The reaction mixture was filtered and the catalyst was rinsd with methanol (-100 mL). The filtrate was concentrated, adsorbed onto silica gel (15 mL), then purified using flash column chromatography on silica gel (0-10% MeOH (+1% NH 4 0H)/CH 2 Cl 2 ) to provide Int-85e (164 mg, 69% yield). Step G The isomers of Int-85e were separated by HPLC. Int-85e (164 mg) was dissolved in abs. EtOH (6.0 mL) and the solution was filtered. The sample was divided into four equal portions, each of which was injected onto a Phenomenex Lux Cellulose-2 WO 2012/041014 PCT/CN2011/001638 242 (5 gm, 150 x 21.20 mm) semi-preparative column; detection wavelength = 350 nm. Initial elution with 25% EtOH/hexane @ 10 mL/min for 159 minutes gave Compound 1061 (tR= 83 minutes; 62 mg). The solvent polarity was increased to 35% EtOH/hexane, and further elution at 10 mL/min gave Compound 1062 (tR = 163 minutes; 72 mg). EXAMPLE 85 Preparation of Compounds 1049, 1054, 1059 & 1060 B'1( Int-7d NC0I O N No o N o Br Int-84b Step A Int-85a Step B NN c N 01 H 0 0 C0MeN2C'N HOe N MeCO2Me ~- N N 0 Int-la H N N--T -4HCI .F Step C Int-85b 1049 Me 2 C'NO NN A: Compound 1059 Step A In a 20-mL microwave tube, Int-84b (229 mg, 0.37 mmol), Int-7d (261 mg, 0.82 mmol), and (dppf)PdCl 2

-CH

2

CI

2 (15 mg, 0.019 mmol) were combined. The tube was sealed, evacuated, and placed under nitrogen atmosphere. Dioxane (4 mL) and aqueous potassium carbonate (3 mL, 1 M, 3 mmol) was added. The reaction mixture was allowed to stir for about 15 hours at 90 'C, then allowed to cool to room temperature. The reaction mixture was diluted with EtOAc (50 mL). The aqueous layer was extracted with EtOAc (2 x 10 mL). The combined organic extracts were washed with brine (20 mL), dried over MgSO 4 , filtered, and concentrated in vacuo. The residue was purified WO 2012/041014 PCT/CN2011/001638 243 using flash column chromatography on silica gel (0-100% EtOAc(containing 10% MeOH)-hexanes) to provide Int-85a (212 mg, 69% yield). Step B In a 125-mL round-bottom flask, Int-85a (456 mg, 0.55 mmol) was dissolved in methanol (I1 mL). HCl (5.5 mL, 2 M in diethyl ether, 11 mmol) was added and the reaction mixture was allowed to stir for about 15 hours at room temperature. The reaction mixture was concentrated in vacuo to provide Int-85b (425 mg, quantitative yield). Step C In a 125-mL round-bottom flask, Int-85b (439 mg, 0.62 mmol) and Int-la (274 mg, 1.56 mmol) were dissolved in DMF (8 mL) and diisopropylethylamine (0.76 mL, 0.56 g, 4.3 mmol) was added. The reaction mixture was cooled to 0 *C and was allowed to stir for 15 minutes. HATU (475 mg, 1.24 mmol) was added and the reaction mixture was allowed to stir at 0 'C for 30 minutes, and then at room temperature for 2 hours. The reaction mixture was poured into water (30 mL). The precipitate was collected by filtration, then dissolved in EtOAc (200 mL), dried over MgSO 4 , filtered, and concentrated in vacuo. The resulting crude product was purified using reverse-phase C18 chromatography (Gilson, 0-90% CH 3 CN (+ 0.1% TFA)-water (+ 0.1% TFA) over 15 minutes) to provide Compound 1049 as a yellow foam (362 mg, 62% yield). Step D Compound 1049 (362 mg, 0.383 mmol) was dissolved in methanol (20 mL) and palladium (163 mg, 10 wt% on carbon, containing 50 wt% water) was added. The reaction mixture was hydrogenated for 71 hours, at which point LCMS analysis showed only a trace amount of remaining starting material. The reaction mixture was filtered and the catalyst was rinsed with methanol (-100 mL). The filtrate was concentrated, adsorbed onto silica gel (15 mL), then purified using flash column chromatography on silica gel (0-10% MeOH (+ I1% NH 4 0H)/CH 2 C12) to provide Compound 1054 (231 mg, 66% yield).

WO 2012/041014 PCT/CN2011/001638 244 Step E The isomers comprising Compound 1054 were separated by HPLC. Compound 1054 (222 mg) was dissolved in abs. EtOH (6.0 mL) and the solution was filtered. The sample was divided into two equal portions, each of which was injected onto a Phenomenex Lux Cellulose-2 (5 pm, 150 x 21.20 mm) semi-preparative column; detection wavelength = 350 nm. Elution with 45% EtOH/hexane (+ 0.1% diethylamine) @ 10 mL/min gave Fraction A: Compound 1059 (tR = 32 minutes, 91 mg) and Fraction B: Compound 1060 (tR = 97 minutes, 68 mg). EXAMPLE 86 Preparation of Compound 1100 WO 2012/041014 PCT/CN2011/001638 245 CI CI CI Br- Q Br. N M - Step Dr-: H HO0a IntInt-86 Step86 En Me Me Ne-, O C 2M1COM -C CI C i nNt0NC02Me O Br N NI 0 N Me IInt-7d Step A S Q N ~ OC N N HN~ N H ~N~ A 2 tH H wh IN 0 H 36 -n-6 Stop86E MOf- MOCN4 INt-o N' NH N N N -~~ Copon 110 Me02e Stepp A A-mL microwae tuewscagdwih. t2a(.0g . ml,3 (3'-methoxyphenyl)propanal (2.3 g, 14 mmol), p-toluenesulfonyl chloride (53 mg, 0.280 mmol) and dissolved in toluene (9 mL). The tube was sealed and heated in a microwave with stirring at 170 0 C. After 12 hours the reaction was concentrated partially in vacuo, WO 2012/041014 PCT/CN2011/001638 246 and the residue was adsorbed onto silica gel (20 mL). The crude product was purified using flash column chromatography on silica gel (Eluent: 0-10% EtOAc: hexanes) to provide Int-86a (1.39 g, 99% yield) Step B A20-mL microwave tube was charged with, Int-86a (1.39 g, 2.76 mmol), bis(pinacolato)diboron (772 mg, 3.04 mmol), (dppf)PdCl 2

-CH

2 Cl 2 (202 mg, 0.276 mmol) and KOAc (813 mg, 8.29 mmol). The tube was sealed, evacuated, and placed under nitrogen atmosphere. Dioxane (11 mL) was added, the reaction was allowed to stir at 90 'C for 2 hours, and then allowed to cool to room temperature. EtOAc (40 mL) and water ( 40 mL) were added . The aqueous layer was extracted with EtOAc (2 x 40 mL). Combined organic layers were washed with brine (40 mL), dried over MgSO 4 , filtered, and concentrated in vacuo. The crude product was purified using flash column chromatography on silica gel (Eluent 0-30% EtOAc/hexanes) to provide Int-86b (1.07 g, 70% yield). Step C A 20-mL microwave tube was charged with Int-86b (500 mg, 0.91 mmol), Int-7h (373 mg, 0.999 mmol), and (dppf)PdC2-CH 2 Cl 2 (67 mg, 0.091 mmol). The tube was sealed, evacuated, and placed under nitrogen atmosphere. Dioxane (9 mL) and aqueous potassium carbonate (2.7 mL, 1 M, 2.7 mmol) was added and the reaction was allowed to stir for about 15 hours at 80 *C. After cooling to room temperature, EtOAc (50 mL) and water (50 mL) were added. and the layers separated. The aqueous layer was extracted with EtOAc (2 x 10 mL), and the combined organic extracts were washed with brine (20 mL), dried over MgSO 4 , filtered, and concentrated in vacuo. The crude product was purified using flash column chromatography on silica gel (Eluent: 0-100% EtOAc/hexanes) to provide Int-86c (385 mg, 59% yield). Step D In a 20-mL microwave tube, Int-86c (380 mg, 0.530 mmol), bis(pinacolato)diboron (336 mg, 1.3 mmol), (dba) 3 Pd 2 -CHCl 3 (55 mg, 0.053 mmol), X- WO 2012/041014 PCT/CN2011/001638 247 Phos (51 mg, 0.106 mmol) and KOAc (156 mg, 1.61 mmol) were combined. The tube was sealed, evacuated, and placed under nitrogen atmosphere. Dioxane (5.3 mL) was added and the reaction was allowed to stir at 120 'C for 1 hour, then allowed to cool to room temperature. The reaction mixture was diluted with EtOAc (20 mL) and washed sequentially with water (5 mL) and brine (5 mL). The organic layer was dried over MgSO 4 , filtered, and concentrated in vacuo. The crude product was purified using flash column chromatography on silica gel (Eluent: 0-100% EtOAc/hexanes) to provide Int 86d (382 mg, 93% yield). Step E In a 20-mL microwave tube, Int-86d (302 mg, 0.391 mmol), Int-7d (124 mg, 0.391 mmol), and (dppf)PdCl 2

-CH

2 Cl 2 (32 mg, 0.039 mmol) were combined. The tube was sealed, evacuated, and placed under nitrogen atmosphere. Dioxane (8 mL) and aqueous potassium carbonate (1.2 mL, 1 M, 1.2 mmol) was added. The reaction was allowed to stir for about 15 hours at 80 'C, then allowed to cool to room temperature. The reaction mixture was diluted with EtOAc (200 mL). The aqueous layer was extracted with EtOAc (2 x 10 mL). The combined organic extracts were washed with brine (50 mL), dried over MgSO 4 , filtered, and concentrated in vacuo. The crude product was purified using flash column chromatography on silica gel (Eluent: 0-100% EtOAc (containing 10% MeOH)-hexanes) to provide Int-86e (78 mg, 22% yield). Step F A 125-mL round-bottom flask was charged with Int-86e (81 mg, 0.092 mmol) and methanol (2 mL). HCI (0.84 mL, 2 M in diethyl ether, 1.7 mmol) was added and the reaction was allowed to stir for about 15 hours at room temperature. The reaction mixture was concentrated in vacuo to provide Int-86f (109 mg, quantitative yield). Step G A 25-mL round-bottom flask was charged with Int-le (53 mg, 0.067 mmol), Int-86f (15.5 mg, 0.081 mmol) and DMF (1 mL). Diisopropylethylamine (82 uL, 61 mg, 0.472 mmol) was added to the solution. The reaction mixture was cooled to 0 'C, WO 2012/041014 PCT/CN2011/001638 248 stirred for 15 minutes and HATU (395 mg, 1.04 mmol) was added. The reaction mixture was allowed to stir at 0 'C for 30 minutes, and then at room temperature for 2 hours. Additional diisopropylethylamine (20 uL, 2 eq) was added and the reaction was allowed to proceed for an additional 1 hour. The reaction mixture was diluted with EtOAc (30 mL) and poured into water (30 mL). The aqueous layer was extracted with EtOAc (2 x 10 mL). The combined organic phase were dried over MgSO 4 , filtered, and concentrated in vacuo. The resulting crude product was purified using reverse-phase C18 chromatography (Gilson, 0-90% CH 3 CN (+ 0.1% TFA)-water (+ 0.1% TFA) over 15 minutes) to provide Compound 1100 as a yellow solid (31 mg, 48% yield). EXAMPLE 87 Preparation of Compound 1099 0O MeO 2 C H HO2C N O H COM H N H N N' -~*c: StH' N -3HCI Me - Int-86f MeO 1099 A 25-mL round-bottom flask was charged with Int-86f (53 mg, 0.067 mmol), Int-4f (18 mg, 0.081 mmol), DMF (1 mL) and diisopropylethylamine (82 uL, 61 mg, 0.47 mmol). The reaction mixture was cooled to 0 'C and was allowed to stir for 15 minutes. HATU (26 mg, 0.067 mmol) was added and the reaction mixture was allowed to stir at 0 *C for 30 minutes, and then at allowed to warm to room temperature over 2 hours. Additional Int-4f (8.8 mg, 0.6 eq), HATU (5 mg, 0.2 eq) and diisopropylethylamine (20 uL, 2 eq) were added and the reaction was allowed to proceed for an additional 1 hour. The reaction was diluted with EtOAc (30 mL) and poured into water (30 mL). The aqueous layer was extracted with EtOAc (2 x 10 mL) and the combined organic phase were dried over MgSO 4 , filtered, and concentrated in vacuo. The crude product was purified using reverse-phase C18 chromatography (Gilson, 0-90%

CH

3 CN (+ 0.1% TFA)-water (+ 0.1% TFA) over 15 minutes) to provide Compound 1099 as a yellow solid (28 mg, 43% yield).

WO 2012/041014 PCT/CN2011/001638 249 EXAMPLE 88 Preparation of Compounds 1502 and 1505 H O N N F N- ~ H N -1 NN0 0 1S~~ 0 0 NI NN HO 0~ N HH I~ 0H H 0 N H 0 H F -F 793 793 $' Compounds oI 1502 and 1505 Compound 793 (prepared as above in example 57 from Int-14d and Int-19j) (38 mg, 0.039 mmol) and Int-la (7.5 mg, 0.04 mmol) using the method described in Example 57, step E to provide Isomeric Compounds 1502 and 1505 (19 mg, 46% yield). EXAMPLE 89 Cell-Based HCV Replicon Assay To measure cell-based anti-HCV activity of selected Compounds of the present invention, replicon cells were seeded at 5000 cells/well in 96-well collagen I coated Nunc plates in the presence of the test Compound. Various concentrations of test Compound, typically in 10 serial 2-fold dilutions, were added to the assay mixture, with the starting concentration ranging from 250 pM to I pM. The final concentration of DMSO was 0.5%, fetal bovine serum was 5%, in the assay media. Cells were harvested on day 3 by the addition of lx cell lysis buffer (Ambion cat #8721). The replicon RNA level was measured using real time PCR (Taqman assay). The amplicon was located in 5B. The PCR primers were: 5B.2F, ATGGACAGGCGCCCTGA (SEQ ID NO. 1); 5B.2R, TTGATGGGCAGCTTGGTTTC (SEQ ID NO. 2); the probe sequence was FAM-labeled CACGCCATGCGCTGCGG (SEQ ID NO. 3). GAPDH RNA was used as endogenous control and was amplified in the same reaction as NS5B (multiplex PCR) using primers and VIC-labeled probe recommended by the manufacturer (PE Applied Biosystem). The real-time RT-PCR reactions were run on ABI PRISM 7900HT Sequence Detection System using the following program: 48'C for 30 minutes, 95'C for 10 minutes, 40 cycles of 95'C for 15 sec, 60'C for 1 minutes. The ACT values (CT5B-CTGAPDH) were WO 2012/041014 PCT/CN2011/001638 250 plotted against the concentration of test Compound and fitted to the sigmoid dose response model using XLfit4 (MDL). EC 50 was defined as the concentration of inhibitor necessary to achieve ACT= 1 over the projected baseline; EC 9 0 the concentration necessary to achieve ACT=3.2 over the baseline. Alternatively, to quantitate the absolute amount of replicon RNA, a standard curve was established by including serially diluted T7 transcripts of replicon RNA in the Taqman assay. All Taqman reagents were from PE Applied Biosystems. Such an assay procedure was described in detail in e.g. Malcolm et al., Antimicrobial Agents and Chemotherapy 50: 1013-1020 (2006). HCV replicon assay EC 9 0 data was calculated for selected Compounds of the present invention using this method and is provided in the table immediately below and in Table 2 in Example 89. Compound la WT lb WT la Y93H 2a WT 3a WT No. (nM) (nM) (nM) (nM) (nM) 31 0.004 0.003 15 0.05 1.2 32 0.002 0.002 3 0.007 0.3 61 0.036 0.011 14.6 0.27 2.7 62 0.011 0.006 8.4 0.12 3 63 0.005 0.003 1.8 0.045 2.7 64 0.013 0.008 6.2 0.083 4.8 66 0.006 0.004 27 0.06 2.7 67 0.005 0.008 29 0.1 2.5 68 0.002 0.002 0.02 0.21 1.0 69 0.001 0.001 0.6 0.11 1.8 75 0.005 0.006 28.937 0.006 0.465 76 0.010 0.005 68.123 0.018 5.367 79 0.004 0.004 28.273 0.010 1.357 84 0.012 0.007 6.086 NA 1.239 86 0.004 0.004 1.619 0.298 0.402 87 0.007 0.006 13 0.22 1.7 WO 2012/041014 PCT/CN2011/001638 251 88 0.004 0.002 13.648 0.133 0.727 89 0.014 0.022 77.94 0.682 3.921 90 0.012 0.004 2.840 NA 2.301 91 0.003 0.004 0.401 0.306 0.354 92 0.011 0.007 6 0.46 1.2 93 0.026 0.009 14.7 0.36 3 94 0.003 0.004 0.06 0.3 0.35 95 0.02 0.01 100 0.11 0.98 99 0.004 0.007 39 0.022 0.17 103 0.015 0.016 38 0.032 0.16 104 0.005 0.003 14 0.023 0.09 108 0.014 0.015 68 0.13 5.4 109 0.015 0.016 139 0.13 0.4 110 0.006 0.006 68 0.02 0.25 117 0.004 0.003 44 0.063 0.08 121 0.027 0.021 256 0.15 3.5 125 0.020 0.016 18 0.04 0.14 126 0.003 0.005 20 0.066 >10 129 0.016 0.009 80 0.047 0.65 130 0.03 0.006 211 0.3 5.8 133 0.002 0.002 32 0.15 0.58 136 0.006 0.006 78 0.07 0.31 143 0.020 0.013 26 0.23 0.31 145 0.004 0.005 8 0.007 0.1 149 0.004 0.004 29 0.04 0.4 150 0.001 0.003 7 0.11 0.21 153 0.003 0.003 12 0.008 0.074 WO 2012/041014 PCT/CN2011/001638 252 EXAMPLE 90 Additional Compounds of the Invention Additional illustrative compounds of the present invention are set forth below in Table 2. The Replicon data provided for selected compounds depicted in Table 2 was generated using the method described in Example 89.

WO 2012/041014 PCT/CN2011/001638 253 Table 1 Compound Structure MS No. H3CO N FO 1 H C HOCa 880 2 F Dr$-CL s~ 897 F 3 N H912 4 820 5 niJcF861 H,CN %H 6 806 H OH, 9, "\N82 10 " 825 11 (M+1) F VF 14 "N 820 WO 2012/041014 PCT/CN201 1/001638 254 0 -o N C , H0 C"00 >0o 0,c 18 0,o(~847.5 19 847.5 20 '0p856.5 21 0 SC860.5 Ir N 22 860.5 WO 2012/041014 PCT/CN2O1 1/001638 255 23 856.5 24 H$N 856.5 -,oyo CM 25 o N-\ CkM 864.5 26 -c, 864.5 NTN - o H,C 27 NcNmO ~ 864.5 2-\§$ CH, N\c

NM

WO 2012/041014 PCT/CN2O1 1/001638 256 28 ,'89. 29 ~ N9N '?, 2jAw~ 0 ,~,892.2 F ~ F N N 30 F QNH NA 32 NA H N N F2 NA. 3 N- NA 4 7- N F

N,

/ N-n oN F H NA 35Oi NA-' 36 H NA 37 \ a856 38 K 9 ___________F F 39 ~ 875 40 897 WO 2012/041014 PCT/CN201 1/001638 257

-,JN

41 W C $ -{tW O .91 42 911 N- 911 F >-d -loA 46 - 863 45 N-k 49 895 H5N 895 04N 53 N 869 __________ Y.o WO 2012/041014 PCT/CN2011/001638 258 HCOff 2 ' -j 55 H 849 56 G$849 57 I . 883 58 883 scw 59 H 835 60 835 o0 61 864.3 HO 0 o/ O N OrO 62 HON ~ / 838.4 HN\' N' "F H H

H

3 C 0 -o O N - _ O N 63 H O _ / N N 856.4

H

3 C F O H N O F N 64 "F H 856.4

H

3 C 6HF H

H

3 C F 6. F N. F H - N F 0 H

H

3 C k- 0" OO H Nl N\N 874.3 6O N ' ON 67 F H H H

_______________H

3

C

WO 2012/041014 PCT/CN2011/001638 259 O\ F O N 87 6 8 H H N NO N O F H

H

3 C F ON \N F 69 7891.4 H H 00 70 N O 856.2 71 N A 87. NN 71 N N N 72 N N NA/5 . N N N 72 FN O 856.2 N O 0 N 0 73 FN. N/O 891.4 74 Io,897 75 C'o 847 76 881 77 ,, 847 78 H N JW'O cH, 847 79 H H 865 WO 2012/041014 PCT/CN2011/001638 260 jI 80 865 81 865 82 83 916 900.5 84 84 (M+1) F 900.5 85 o (M+) ,o 86 N~ A 0 918.3 86 N ,o N F -N 0 917.8 87 F N 0 oZ N F N 9 3 5 .8 88 F2 N N 89 F- 2N NN o 935.8 WO 2012/041014 PCT/CN201 1/001638 261 0 0 90 ~N N0 N N 935.8 91 p1A N W 901 HNc N ~ 4~ HC H & HN 92 NH MNN - 0 N N--1N 900 KCO .- HN 93 900 94 ~ N 90N0 F PM' N, N HN ~o-yy0 95 NA 96 H NN 0~( NA 9 7_ F N f NN 99N HN , > N- ~N 98 HN 0N NH F N NA N~ 101 NN o~ NA N H0- H F N N

NC

WO 2012/041014 PCT/CN2O1 1/001638 262 HNb N N NH H H 103 NA <0 104 NiY> N NA 105 05NA 1064 ~H NA <00 - Y 107 (hH NA <0 f-N H H N 108 1\,N N W NA 109 NH H j NA WO 2012/041014 PCT/CN2O1 1/001638 263 0<1 110 V NNA 111 NA 113 ~ N H NA 112 ~ OIQ~ NA ' -< 0 11 H NA 113_ & NN _____________ CI WO 2012/041014 PCT/CN2O1 1/001638 264 118 NA C~h HNA 120 cH H NA \ N 122N NA <0 123 N N N NA NN H N ) 121NN 124T- NNAc 0 I HN 125 I-CLN7>Nvo NA 0 WO 2012/041014 PCT/CN2O1 1/001638 265 126 H N o 040 HN--0' (NH HNh 129 NN 11 N2 N NA oor o-CNA H HNA N~ 0 oo (I 134 N Nr T0 WO 2012/041014 PCT/CN2011/001638 266 00 135 NA FF " O 136 NA 00 / H .

H H 137 NA 138 N NA 14 0 0 HNt -0- 142 NA NN -O 1430 NA F o WO 2012/041014 PCT/CN2011/001638 267 144 NA F 145 NA -o 0 146 NA 147 NA 149 N NA ~0N0 0_ i H 148 NA FA 151 NA co 152 NA 149 Nro F WO 2012/041014 PCT/CN2011/001638 268 153 N NA 154 NA NN 155 F NA 1 N 500 16NA N O 157 C NA 00 159 0 NA ~N~N 160 NA 161 NA 162 NA WO 2012/041014 PCT/CN2011/001638 269 163 NA 164 NA 165 gJ NA 166 NA 167 NLNJ NA 168 NNNA F 169 NA Fi *o' o o< 17H N o' H o o ( 'H 171 N NA N N WO 2012/041014 PCT/CN201 1/001638 270 'a 0 172 NNNA 173 /ZN N N NA <0o 00 174 NA 174 NilN Q$-P NA 176 NA 177 NA 178 NA 0~ NN 179 ~ N Ny NA 00 180 0A WO 2012/041014 PCT/CN201 1/001638 271 181 NC NA 182 NA 183 NA 0 F F ~ NH 186 N NA 0 A> F 188 NHNN 18 N 183Y N -" 190 18 NT ' NA 191 N NA

I---IF

WO 2012/041014 PCT/CN2011/001638 272 192 9 NA 193 NA 194 NA 00 195 ,,NA H o 196 F NA 197 F N NA 198 F NA 199 F NA - o-N 200 NA F 6 0 201 s NA 202 HH NA 203 NA _ _ _ _ ~F _ _ (_ _ WO 2012/041014 PCT/CN2O1 1/001638 273 204 0 NA N 205 -0KO NA NN 0'C 0 206 NA C'N 'NN,N H 0 209 NA HN 209K~ O('~ NA N NN N N HO<- H F N N HN g 211 <' O-('P J NA N N O N ~ N F N N N 0 HN 213 o 1 NA / ON N ~ 0N 214 N H NA ______________0 NI N___--________ WO 2012/041014 PCT/CN2O1 1/001638 274 215 NNA 0 0- H NN 216 ~ N HH NN H NA N_ N 0<1 218 \-_C--~ NA 220 NAC 0_ ,NA 221 NNN 222 NN H NA 60 0 0 0F ______________[-N__ H H_________N____ WO 2012/041014 PCT/CN2O1 1/001638 275 0 226 -' NA , 00 2257N N NA HN~-<o . H o 2268 N N NAN HNA 0<1 229 NA 0< 230 NA- N> N H H N1 231 NF H NA F ______________ WO 2012/041014 PCT/CN2O1 1/001638 276 232 NA N _____________ NN N NN 233 N( 60 N N> NA H (NN 235 N-- NN NA N NA 236 Q h QkN NA 237 918 238 954 239 H<\ (O835 240 853 ~ 241 N\ - 7 861.4 242 ( 12'_ 880 WO 2012/041014 PCT/CN2011/001638 277 243 804.4 244 818.4 245 748.4 246 " Q 837.5 NA Not Available WO 2012/041014 PCT/CN2011/001638 278 Cmpd # Structure EC50 EC5O EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer la 1aY93H 1aL31V lb 2b [M+H)* Designation N H ~HN_ F r Mixture of 247 N 0.003 1.4 0.1 0.004 8 984.15 985.1 isomers 0 0 248 N..F 0.013 2.54 0.005 17 948.05 948.5 Mxueo N H N N Mitreo 24 N1A~ .00 0. .0 5.1 99 isomers o N 250 N j~L IF 0.013 0. 2.5 0.003 36 946.04 966.7 Sigle ome 25 .0311 0042I960N667Snl isomer 0 6),0 HN NF 0 N N Mixture of 249 N N 0.009 0.8 0.004 4 958.11 959 isomers 249 0 NH ,0 0 0 M.- 0~ 251 IN F D030.3 14.12 0004 25 966.04 966.7 Single isomer N N 0 0 0 WO 2012/041014 PCT/CN2011/001638 279 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL3 b 2b [M+H]* Designation F N N..~. N 253 ~0 1 N HN 0 56.000 500 918.02 918.6 Single isomer 0 N HN F F F 254 -0 N H / HN 0 127.000 489 918.02 918.6 Single isomer F 0, NHN 255 N ~ F 0N 251 N I N 0.008 3.2 0.28 0.004 4 984.03 985 Single isomer 0 0 FF 0 F N O 256 NF F . 3.0.007 12.9 14 984.03 984.8 Single isomer 0 0 FH _\ N 0 1N, F0 N 25 H - N F 0.030 0.44 4.73 0.003 110 1020.01 1021 Single isomer N N 0 CFF 0. F F 0 0

FFH

WO 2012/041014 PCT/CN2011/001638 280 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H]* Designation cd 0 HN t0 0 rN-o HN 259 N 1 0 958.11 959 Mixureof 0 N somers 0 0rO O , 0r614 N N H HNH 260 N9-N8 .1 4 1002 Mixture of 0 isomers 0 HN ) * 6 H H (N F N .1 . Mixture of 261 N 0.010 50.3 0.918 0.009 21.5 1001.14 1002 isomer $ 0 isomers 0 O HN 263 8..01 1 0 .00553. 954.15 955.19 smr 0 0

NN-

HN H 263 - N 8.1 .1 0..55 4. 954.15 955.1 O -r WO 2012/041014 PCT/CN2011/001638 281 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Cac.M.S. Obs.M.S. Isomer la 1aY93H 1aL31V ib 2b [M+H]* Designation HN F H~ Mixture of 2 N O 0.009 6.7 0.411 0.008 6.9 916.03 917 ONH OH HN 265 I 1 0.012 6.39 0.2 0.005 3.3 926.09 9267 NH O 0 '0 (70 OO HN 266 ~ 0.009 4.8 0.35 0.006 4 1002.17 1003 NH F Mixture of 0 HN 267 F NN O Wk..F 0.006 0.5 0.459 0.005 40 1038.15 1003 26 -N \ isomers NH 0 0 OOr C O HN 268 N~ 0.009 0.6 0.205 0.005 1 964.15 965.1 Single isomer 0 0 N O_ H H 269 N 0.004 10.86 0.3 0.004 16.8 984.15 986.1 Single isomer

O

0 F N/ 0 F_ _ __ _ _ _ _ _ _ WO 2012/041014 PCT/CN2011/001638 282 EC50 EC50 EC50 EC50 EC50 Obs .M.S. Isomer Cmpd # Structure 1a 1aY93H 1aL31V lb 2b alc.M.S. [M+H]* Designation F HN 270 N -F 0.027 0.9 6.659 0.006 47 948.05 949 Single isomer N Or F N H H N 27 NF .06 .2 222 000 3N98.5 94 Snge soe 0 ,0 F NHHN 0 00 272 N F 97.1 977 H 0d O0 FP N H 4N N N 9 1 Mixture of 272 1- 1 976.10 977 ismr N NH isomers HN F NN 273 O N \ N 98814 988.9 Mixture of NH i 0somers O-r ,yO HN F N O I K FF 274 O N O N 994.09 995 Single isomer NH m O= H 00 0 H S - N 1 3Mixture of 275 0>01.3 01. NH ...- isomers 00

HN

WO 2012/041014 PCT/CN2011/001638 283 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0O HN F,, NF F 276 H-XO N N 0.045 2.1 11.9 0.014 98.3 1037.12 1019.9 isomers NH ismr ,0 0 J O HN N y-O rNJ H HN 277 N 940.12 941 Single isomer 278 , 940.12 941 Single isomer e0 0 Or -N 0 ), O H N N 278 N 1940.12 941 Single isomer 0 -1 OtO HN~ a6r H N NF 279 d 0 N 1001.14 1002 Single isomer 0 O HN 0 (NO, rN, F H N__ N - F 280 ~ N 0~ N 1001.14 1002 Single isomer 0 N!

HN

WO 2012/041014 PCT/CN2011/001638 284 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation

N

0 HK .. 281 N N 0.003 58.4 0.7 0.006 13.7 956.12 956.8 Single isomer 0 0 O N 282 N 956.12 956.8 Single isomer 0 0), O)~ NHN e N I F N 283 O H N \N 958.11 958.9 Single isomer 0 NH O 0 HN 284 O N \ N 0.026 24.3 0.007 9.4 958.11 959 Single isomer 0 0NH O'F H N F N jjN F 0 F F 285 O N N 0.015 3.4 0.005 47.7 994.09 995 Single isomer NH 0O WO 2012/041014 PCT/CN2011/001638 285 Cmpd Structure EC50 EC5 EC50 EC5O EC50 Calc.M.S ObsM ]* Isomer Cmd Srutuela laY93H laL31V lb 2b CacM.[M+H]' Designation 0'yo HN N F HN 286 F 4Mixture of 286 N 0.016 5.8 0.4 0.006 14.6 972.14 973.1 isomers NH ,0 HN N -K 287 HMixture of 287 N 0.028 0.7 0.009 9.8 984.18 984 s o 28 NH isomerss ,00 0 HN F N F HN 28 NN.)~ NN Mixture of 290 ooH N O 0.006 0.3 3.9 0.005 32.4 1020.16 1021 isomers oN 0)~ HN F N0N - I H 'F 289: ),2~ ' N l / N 0.058 0.4 9.7 0.010 > 100 992.10 993 Mxueo 28o isomers 0(NH ,0 0 HN< 2N 290 N i Mixture of NN H 0.016 10 1.2 0.010 11.6 940.12 940.8 00 0H WO 2012/041014 PCT/CN2011/001638 286 Cmpd # Structure ECSO EC5O ECSO EC50 EC5O CalcM.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N ON m 1l F N Mixture of 291 O N 998.18 999 isomers NH ,0 $ 0 O HN N H <~NMixture of 292 N' N O N \ 0.015 13.5 0.3 0.007 13.7 954.15 955.1 00 ONH O0 06 N H HN O 2,4 N 0.013 18.9 0.6 0.005 18.9 958.11 958.9 Single isomer jH HN4 NN 295 o N/ 983.15 984 Single isomer 0 0 HO N 0 WO 2012/041014 PCT/CN2011/001638 287 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation rJ N 296 N N 983.15 984 Single isomer 0 0 HN 0 Ord d 297 N ~ 944.09 945 Single isomer 0 - N 6O ON- H HN_I 0 298 F 944.09 944.9 Single isomer (NO HN 299 .- N~/~0.009 40.3 0.004 14.4 954.15 954.9 Single isomer NN 40 0 0 O H HN, 300 N0.014 5.1 0.7 0.004 12.4 954.15 955 Single isomer 0 WO 2012/041014 PCT/CN2011/001638 288 EC5O EC50 EC5O EC50 EC5O Obs.M.S. Isomer Cmpd # Structure 1 a ULM lb 2b Cac.M.S.[M+H Designation HN N HN N O-O 302O NH 0,1O. .0 . 1002.17 1003 Single isomer ,0 0 o-r HN NH F N N HN 303 NH 108.1 1038 Single isomer 0 ,00 4N F NH N 0 )00 0 WO 2012/041014 PCT/CN2011/001638 289 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H] Designation 0)yo HN NHN 306 NH O 0.007 4.8 0.3 0.006 6.6 984.18 985 Single isomer ,o HN F N N 307 NH 0 1020.16 1021 Single isomer ,00 0 HN F N O ' F 308 NH N 1020.16 1021 Single isomer -H 00 HN F N F F 309 o 0.029 22.9 0.015 >100 1037.12 1038 Single isomer oNH 01( ,0 0 O-r HN F ;N HN N O " 310 / H N / 0 N0.143 13.3 19.1 0.018 > 100 1037.12 1038 Single isomer 0< ,00 0N HN O2r WO 2012/041014 PCT/CN2011/001638 290 Cmpd # Structure EC5O EC50 EC50 EC5O EC50 Calc.M.S Obs.M.S. Isomer 1a IaY93H 1aL31V lb 2b [M+H]* Designation ~0 OkN OO, N 0 311 NN O 1102.05 Single isomer 0 -N NT, goH 0 NH F N ~H IN Mixture of 312 N 0.01361 0.04242 2.006 104.5 1024.12 1024.9 somers 0 0 HN 313 - Mixure of 313 N O 0.01139 22.11 0.4472 5.979 898.04 899..1 H N \ isomers 00 ONH OH L ro F HH 314 N F 0.05816 1.466 2.87 87.12 976.10 976.7 Single isomer N N 01 H 0 0 0 HF 316 N N N,' N 005 1.2.036 23.24 988.14 988.9 Single isomer NH 0 0 WO 2012/041014 PCT/CN2011/001638 291 EC50 ECSO ECO E5 COObs.M.S. Isomer Cmpd # Structure EC EC50 EC50 M. la 1aY93H 1aL31V lb 2b ~ [M+H]* Designation HN N ON 317 N 0 N 0.00817 1.184 0.195 6.912 988.14 988.9 Single isomer ,00 0 O)~ HN 318 0.015 0.5 0.3209 13.88 916.03 916.8 Single isomer OH 0),0 HNy NH F NN 319 C ; \1 0.004 41.02 0.3329 9 916.03 916.8 Single isomer OH 0 N O HN 320 1 F 0.01128 0.1398 1.207 87.61 994.09 995 bueo N O NHN 321 N 0.00982 2.132 0.195 2.146 944.09 945.1 Mre of -~N N 0 0

(N-Q

F NH Mixture of 322 NI~ 0.0162 0.4183 0.1426 1.192 942.07 943.1 isomers -N N 0 WO 2012/041014 PCT/CN2011/001638 292 Cmpd # Structure EC5O EC5O EC5D EC50 EC5O CaIc.M.S. Obs.M.S. Isomer 1a IaY93H iaL31V ib 2b [M+H] Designation 0 'rO 2 F, NF 0.01563 0.02 2674 68.32 980.07 981 Mixture of N N H I N k 9 isomers NH ,0 0 O , HN 2 F N 0.02436 6.242 1.81 25.43 948.05 948.9 Single isomer 3 N H 0 N HN F IHN-\ 325 N - F 1 100 100 100 948.05 948.9 Single isomer 0 N 0 \/ NH ~0 O HN F N O F, Mixture of 326 O N O N 0.02664 2.77 49.99 976.10 977 isomers NH ,00 0 HN NI F 0 N~ 32 ~ ~ . NH ' Mixture of N N 0.01 2.3 0.1873 1.328 946.12 947 sxturo - O NH0 ,0 S O0 HN F N FM ix tu re o f 328 0 N O N 0.01029 0.04 2.205 73 1008.12 1009.1 isomers 0 ONH ,0 WO 2012/041014 PCT/CN2011/001638 293 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Caic.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation O)zo HN I - lf NMixture of 329 F N 0.0056 1.517 1.656 1849 984.03 985 uremof 00 NH ,0 0 FOF HN F N 330 NH 0.003 1.486 0.2152 7.645 1050.21 1051.1 ixtur *00 OS 0 O HN N

O

0 N 331( NNN Mixture of 33 N N 0.004 7.523 0.2071 4.54 928.13 928.8 isomers NH S O HN N O 332 > O N \ /NN 0.01225 43.76 0.4942 17.35 972.14 973 Single isomer NH ,0 HN 333 0 N O / N 0.01234 1.19 0.195 5.178 972.14 973 Single isomer 0 NH $0 ,0 HN N 0 N 334 N HIN/ 0.005 52.66 0.2183 12.86 926.09 926.8 Single isomer 0( NH 0O WO 2012/041014 PCT/CN2011/001638 294 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 12 1aY93H 1aL31V 1b 2b [M+H]* Designation NO HN N335 N 33 N NN 0.01505 1.8 0.2346 0.37 926.09 927.1 Single isomer NH ~0 0 H N 0 N NHO HN O 336 N N 0.01157 13.82 0.1904 5.211 906.06 907.1 istur HN 337 N 0.0035 0.1841 0.195 7.701 948.05 949 Single isomer NH NH 0-yO 338 N O N F 0.01346 0.3647 0.195 7.558 948.05 949.1 Single isomer NH ,0 00 HN F NF 339 O->O N 0.953 100 100 100 1019.13 1020 Single isomer 0 HO

HN

WO 2012/041014 PCT/CN2011/001638 295 Cmpd # Structure ECSO EC50 EC50 EC5O EC5O Calc.M.S. Obs .M.S Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation OyO HN F N 0 F 340 N o 1 100 100 100 1019.13 1020.2 Single isomer NH 0 0 HO HN 0 NH yO HN N 341 H \ N 0.01328 54.63 0.2997 11.13 940.12 941.2 Single isomer NH ,0 ),O HN N 342 N O 0.01308 2.627 0.2881 2.418 940.12 941 2 Single isomer 0 NH ,00 0 HN F~~ F ixur o 343 N N O N0.02634 0.07918 3.088 61.91 1020.13 1021 Siisomers N " HN 00 0 344 N 15.9 469.9 724.87 725.5 Single isomer N HN 6O 345 N N10.01349 8.592 1.789 31.37 926.09 926.6 Single isomer 0 WO 2012/041014 PCT/CN2011/001638 296 Cmd #Structure EC50 EC50 EC50 ECSO EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V 1b 2b [M+Hf Designation HN N N 346 0 0.01386 6.028 0.4267 2.64 970.15 971 Single isomer NH 0 0 O'F HN F N O F 347H ~J' N k' N Mixture of N N 0.028 0.1566 6.892 188.4 1006.13 1007 NH -isomers O0 0 HN 3N- N 0.01713 7.981 0.4534 2.465 966.04 967.1 ure of 348 >..<)' " N 0 N . .. isomers NH 0F-( ,0 0 F HN NNF Mixture of 349 >.OH N N 0.01237 0.2279 2.721 84.03 990.13 991.1 isomers O NH 60 HN I F Mixture of 350 N O N F 0.01097 0.8042 0.7204 8.253 930.06 931 iremof ,00 INH 0. 0 H WO 2012/041014 PCT/CN2011/001638 297 Cmpd # Structure EC50 ECSO EC50 EC50 ECSO Calc.M.S. Obs.M.S. Isomer 1a 1IaY93H iaL31V lb 2b [M+H]* Designation y-o HN 351 F N 0.02156 04577 0.1775 9.245 930.06 931.1 Mixture of 351 4' oH I -I\'N \ isomers 0 oNH 0, HN N *-F Mixture of 352 N O "F 0.00976 0.04956 0.5672 9.561 978.05 979.2 isomers -N 0 NH ~0 0 N0ro 353 N 0 8.626 366 824.99 825.9 Single isomer O -. N 'N HN 0 354 N -1.179 678.1 824.99 825.9 Single isomer N N N 0 (NH HN H0 355 N M 12.16 110.2 724.87 725.8 Single isomer 'N N 0 O HN 0 336 N, 0.01505 3.088 0.2035 379 926.09 927 Single isomer

(-O

WO 2012/041014 PCT/CN2011/001638 298 Cmpd # Structure EC50 EC5O EC50 EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 N yO

N

0 H HN 357 N 0.0162 20.67 0.3557 2.697 942.07 943 Single isomer O N " N 0 0

(N

0 HN, 358 N 0.02086 1.514 0.03596 0.5689 942.07 943 Single isomer -N N 0 0 HN F,. N O F 359 N 0 0.02836 0.5365 4.157 76.52 1024.12 1025.2 Single isomer NH 0 0 O HN N N O F 360 - 0 0.01321 0.06267 2.885 111.6 1024.12 1025.2 Single isomer ONH HH NH O ,00 )0 HN F 361 N H- N O/ N 0.01345 20.71 0.572 33.65 998.18 999.1 Single isomer 0 NH 0 0 WO 2012/041014 PCT/CN2011/001638 299 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation N HN N - N 363 OH N N 0.018 43.3 0.4796 10.63 954.15 955 Single isomer NHH HN -jN -- N 364 OH IN O N 0.028 48.67 0.6579 10.78 954.15 955 Single isomer 0 NH ,0 HN

N

0 F N F 365 0 N \ N 0.00804 0.04587 2.188 68.84 1008.12 1009.1 Single isomer 0 NH ,0 OOr HN F N F 0 366 O N NN 0.0389 0.2949 2.96 79.37 1008.12 1009.1 Single isomer 00 ONH O0 HN N ~ Mixture of 367 -N O " 'N 0.01121 5.385 0.2396 7.747 954.15 955.2 isomers O NH N H N 368 O N 002062 7579 0.363 32.25 97214 973 ige of 0 NH 0 -5_ __ _ __ _ __ __ _ _ WO 2012/041014 PCT/CN2011/001638 300 Cmpd # Structure EC5O EC5O EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H]* Designation od N y O H HN 369 N 0.02 15.21 0.112 3.65 928.07 929.2 Single isomer HN 370N .8 . 0 00 N Of~ H HN 370 N 0.01857 7.238 0.028 0.55 946.06 946.7 ,0 0 N 0 371 N , N 0.01427 2.28 0.2345 11.7 944.09 944.6 ixtur HO O )0 0 1 N 0H HN 372 N F N 0.02522 1.79 0.055 946.06 947.8 Mixture of ,0 O 0 N N N~Mixture of 0 N N 0r 374 \>0 -N O /\N 0.0105 8.422 0.3063 8.9 974.11 975 ixturers 0 isomers NH 0 0 WO 2012/041014 PCT/CN2011/001638 301 Cmpd # Structure EC50 EC50 EC50 EC5O EC50 Cac.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation HN H FMixture of 375 N F F 0.09597 1.528 6.8 198 934.02 935 isomers SNH OH H N N7 0 -1C- Mixtueof 376 O AN N 0.00973 2.25 0.035 11.21 972.14 973 isomers 0 O 0 'ro H N F F 0 N N M '~\Mixture of 377 N 0.00736 0.025 1.792 59.8 1008.12 1009 O NH 0 O ~rr4 F HN 378 N F 0.023 0.43 2.018 73.85 994.09 995 Single isomer OO N NO A79 N F 0.005 0.0098 2.687 71.51 994.09 995 Single isomer ( O 0 0 CN 0 HN. 380 N 0.01344 3.12 0.1024 0.4612 928.07 929 Single isomer NO N 0 0 WO 2012/041014 PCT/CN2011/001638 302 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer la 1aY93H iaL31V 1b 2b [M+H] Designation HN OF NN 381 FNo O F 0.04486 0.3468 3.283 71.4 980.07 981 Single isomer 0 NH ,0 0 $ HN F' 38N \N 1 0.0036 0.0181 1.202 57.74 980.07 981 Single isomer ~~0 00 383 LN~N 1 -. O N 898.04 899.1 Single isomer ONN H 0 OH H N 384 N O \ N 898.04 899.1 Single isomer N 0 N NH 0'r O HN 385 N 984.03 984.8 Single isomer 0 NH ,0 FF HN IF N? 386 N \/ N 984.03 985 Single isomer O NH N NH ,00 0

FIF

WO 2012/041014 PCT/CN2011/001638 303 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 rO H N HN 387 F N N 930.06 931 Single isomer ON 0 HN 388 93006 931 Single isomer >~0 N "N 0 NH H 00 r0 ~J~t-O HN- HN 389 N 926.09 926.9 Single isomer NN N H 0 0 391 N O 5.0 5 ueo *,, 0 6 y HN 390 N O1928.07 928.1 Single isomer O NH 0 H N 0 F /N 39- N N 95408 955 Mixture of NH -isomers p 0? NH N

FF

WO 2012/041014 PCT/CN2011/001638 304 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O CalCM.S. Obs.M.S. Isomer 1a 1aY93H iaL31V ib 2b [M+H] Designation NN 393 N O0 FN8.0 8 H H, N 39 -O 984.03 985 isomers 394 F0 O 102.2 1 M3ixture of NH ,0 0 FF O'ro HN Mkj Mixture of 394 \ N / 1002.02 1003 isomeof -; N -yoN N 00 0 I FF HN NF N '. - N.

1 2~' Mixture of 3, NH 9002.02 1003 isomer d o76~ NH 396 N~ 944.09 944.8 Single isomer 398 92609 97-Sigle some 0 0 -7-0 N 396 N N,<-2 944.09 944.8 Single isomer 0 0 , 00 WO 2012/041014 PCT/CN2011/001638 305 EC50 EC50 EC50 EC5O EC50 Obs.M.S. Isomer Cmpd # Structure la 1aY93H 1aL31V lb 2b M [M+H] Designation rOo N 'HN 0N H HIN H 399 928.07 929 Single isomer N NH N HN N O N 400 O<~ N N 970.15 971 Single isomer NH N 0N $ 0N HN N O F 401 H <Y NO N 970.15 971 Single isomer NH 0 HN P N 402 H N 1006.13 1007 Single isomer NH -O 00 )0 I HN F N 0 403 >.)0 N _0 1006-13 1007 Single isomer NH -H 0 0 WO 2012/041014 PCT/CN2011/001638 306 Cmpd # Structure EC5O EC50 EC5O EC50 EC50 CalcM.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation HN 404 >O O H N O 992.10 992.9 Single isomer SNH ,00 0 N HN Fj F 405 >..O N O 992.10 992.9 Single isomer O NH ,00 0 O)~ N HN N N 0 406 ,.. 976.10 977 Single isomer NH HNt F N 0 -'N: 407 O H N N 976.10 977 Single isomer NH 0( 0 O O NH 409 946.12 947 Single isomer O NH -s WO 2012/041014 PCT/CN2011/001638 307 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Cac.M.S. Obs.M.S. Isomer 1a 1aY93H IaL31V lb 2b [M+H] Designation 0 yo HN F' FF 410 >.4o H I-N ~ N 1020.13 1020.9 Single isomer SNH ,00 0)0 HN F N F F F H N 411 N N 1020.13 1020.9 Single isomer 0 o (NH H N NN F 412 >-O H | N N 966.04 967 Single isomer

F-

N HN 41 N 966.04 967 Single isomer 0 O NH 0 F-( F H N N 414 H N O 954.15 955 Single isomer SNH HN N0 415 N H I -N \ ' N 954.15 955 Single isomer 0 NH ,0= 4 0 WO 2012/041014 PCT/CN2011/001638 308 EC50 EC50 EC50 EC50 EC50 Obs.M.S. Isomer Cmpd #a 1aY93H iaL31V lb 2b [M+H)* Designation 0 o HN F N 0 N F ..... 416 O H N 990.13 990.8 Single isomer 0 NH ,0 HN F 0 F IH H 417 o N kN 990.13 990.8 Single isomer 0 NH ,0 HN NN N 418 NH 1050.21 1051 Single isomer 9O < N 0 419 NH -1050.21 1051 Single isomer Or ,yo HN NN 420 N OH"F 930.06 931 Single isomer H0 0 WO 2012/041014 PCT/CN2011/001638 309 Cmpd # Structure EC5O EC5O ECSO EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation yO HN N 0 N -- ' IH 'F 421 CN N N 930.06 931 Single isomer O H 422 F -1040.19 1041 Single isomer NH 0N 423 N N1040.19 1041 Single isomer Q O HN4 N 424 >4o s' N ~ N 0.00389 27 0.6629 6.776 972.14 973.1 Single isomer 0 NH yO N- HN N \ F 425 O H N O N 0.01474 1.047 0.1416 16.74 972.14 973.1 Single isomer NH 0 HN 426 Fr ~,N O 'F 0.006490.2636 10.16 977.05 978 Single isomer ,0, H

N

WO 2012/041014 PCT/CN2011/001638 310 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Cac.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation F N 0 H 2 Mixture of 427 o NH N 0.002 3.4 9.8 0.001 44 865.40 866.5 0IN isomers 0 HN0 O0 HN F N~ 0.1 7 53 00 428 F NN 0.012 7 5.3 0.001 6 897.40 898.5 Single isomer NH 0 H N 429 F N 0.003 0.8 5.9 0.001 41 897.40 898.5 Single isomer >4 00N ~ " O (NH 10 O)r0 HN F N F 0 N Mixture of 430 N H 0.010 2.7 9.8 0.020 17.1 883.40 883.9 O NH 0 O)r0 H N F 0 N Mixture of 43, N O 0.010 11 0.7 0.020 2.4 865.40 866.2 isomers NH ,0 H N 432 FQ N1 0.004 3.55 2.14 0.001 11 883.40 883.9 Single isomer > O NH i NH O-r 433 N' N. '- N H ."</ / < 0.001 0.2 4.86 0.001 89 883.40 884.5 Single isomer WO 2012/041014 PCT/CN2011/001638 311 Cmpd # Structure EC50 EC5O ECSO EC50 EC50 Calc.M.S. Obs.M.S Isomer 1a 1aY93H iaL3V ilb 2b [M+H] Designation F N 434 0 NH o 0.011 4 1 0001 10 865.40 867.2 Single isomer F NN 435 0 NH o NJ 0.002 0.5 2 0.001 32 865.40 866.5 Single isomer HN 0 o N N H H 436 F H N 0.002 30 1 0.001 5 865.40 866.5 Single isomer 0 0 0 O~o 0 ,N O), H HN 436 N F H N 0.003 60 1 0.001 2 865.40 866.5 Single isomer F N \ N ,00 olo F N 439 o NH o N 0.0 . 0.002 6.1 879.40 880.7 Single isomer ,N0 O O O \ HN ' \, lo WO 2012/041014 PCT/CN2011/001638 312 Cmpd # Structure EC50 EC50 EC50 EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a iaY93H 1aL31V lb 2b [M+H]* Designation F NI LN H N >~0 -N N 0 H N. 440 0 NH N 0.002 24.2 4.05 0.001 52.7 879.40 880.8 Single isomer O HNk HN 441 N F ' 0.010 14.2 0.020 22.9 911.40 912.7 Single isomer 0 -o -N 0y O N HN F 0 4 N F 0.010 18 0.020 151.8 911.40 912.7 Single isomer N 0 443 0 NH O N 0.019 1.95 42.864 0.008 883.40 884.8 ismr 0 r N HN OO 444 1.320 14.582 2.81286 0.792 6.101 792.40 793.4 isomer 0 N N N 0- > Mixture of 44s N\ > 10 >1000 855.868 >2 682.615 825.40 826.4 00 0 WO 2012/041014 PCT/CN2011/001638 313 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+Hf Designation .N y O NH Mixture of 446 - N 1.000 4.26 1.95 0.200 2 906.40 907.4 isomers N N 0 N N 00 H H - Mixture of 447 N\1.950 1.95 1.95 0.200 2 939.40 940.4 0 0 0 ~ 00 'N 0 HN 448 NH2.830 1000 212.36 2.400 1000 925.40 926.5 i(** -N N isomers 0 0O CNH u HN N Mixture of 449 0 N > 2000 > 5000 592.30 593.3 isomers N 20 - Mixture of 450 N/365.116 5099 811.40 812.3 0 OH 0

CN

451 N 131.553 670.918 788.30 789.7 so N

N

WO 2012/041014 PCT/CN2011/001638 314 Cmpd # Structure ECSO EC50 EC50 EC50 EC5O Calc.M.S. Obs.M.S. Isomer la laY93H laL31V lb 2b [M+H]* Designation F N0 N N N - N 'F Mixture of 452 N NF 909.000 > 5000 828.40 829.3 isomers 0 N N Mixture of 453 N 294.000 > 5000 824.40 825.4 454 N N.6 14i9s.1o2m9840 93. HN 00 C o o O'r

(N

4 H N H Mixture of 454 N N I N 72.0699 556 018.40 81. isomers 0 0 \ HN 00 N 455 o N 293.000 659.44 810.40 811.4 isomers

NH

2 0O

CN-

4 0 0 -~~~~- NN ixueo 456 0N ' 72.699 588.56 850.40 851.4 iomerso HN

(N

0 457 N0 140.477 1225.95 854.40 855.4 iomerso HN

OH

WO 2012/041014 PCT/CN2011/001638 315 Cmpd # Structure EC50 EC50 EC5O EC5O EC50 CaIc.M.S. Obs M.S Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation N O N N Mixture of 458 188.892 227.88 788.40 789.7 0 N ~o HN I Mixture of 459 N 0NN 0.246 19.21 18.4 0.027 200 968.50 968.8 isomers HN OHI 0 N 0 ONNH 460 N N -O 512.000 > 20000 838.40 839.4 460 - Nisomers 0 H 0 -N / 461 N~Mixture of 461 0.097 >200 14 0.151 99.105 964.50 965.5 0 - -t isomers H- M i t r of H 0N 462 N -NN 0.018 > 200 88.9 0.022 76.8 882.40 883.4 0 0 -6 6 0/ WO 2012/041014 PCT/CN2011/001638 316 Cmpd # Structure EC50 EC5O EC50 EC50 EC50 Calc.M.S Obs.M.S. Isomer 1a 1aY93H laL31V lb 2b [M+H]' Designation 1 Mixture of 463 "N ON0024 >200 0.4 0.014 41 952.50 953.5 isomers 00 -N0 N 0 464 485.000 2619 881.50 882.1 HNO N-N 0 N N 46 ~ 4I \C 0.073 > 200 0.27 0.033 0.2 970.50 971.1 Mxueo N O N0 N .isomers 'yo HN F N 0NZ. HIN Mixture of 466 F N 'F 0.005 0.2 3.2 0.002 49 942.40 943.4 46 O N 14 isomers N HN NO 0 i :N \N Mixture of 467 0 >1 >100 >100 0.130 >100 995.50 996.5 0 qC0 HN

,N-

WO 2012/041014 PCT/CN2011/001638 317 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0-yo H N N ~ ~ -i--Mixture of 468 0 N 0 N 0.073 24.86 1 0.063 26.5 939.40 940.5 isomers 2NH ~0 H NHN 469 MNMixture of 469 0.090 18.89 7 0.011 >100 924.40 925.4 * oN NHmN NH 0 NN N 0 470 o- H N N 177.000 1884 810.40 811.4 0 0-smr N 0 HN 4721 0.002 1.31 0.22 0.002 7.5 9249.40 925.4 Mxure of N 472 \Nr 0.002 1.31 0.22 0.002 7.5 949.40 95.45 Mu >~0 N 0 ~N isomers o1 NH 00 NN HN F Ho N Mixture of 473 0.003 0.88 0.19 0.004 2 963.40 964.5 NH *0

NN

WO 2012/041014 PCT/CN2011/001638 318 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H] Designation NN 476 NH N 2 0.0100 11.929 830.40 831.4 Single isomer N ~ - / N OT' N 477 ' H O N 003 9. 5 003>10814 2. igeioe N /N 476 N- 0 0 8.400 10000 707.40 709.4 Single isomer 0 NH y -rz N N 477 \- 0 A. 0.023 97.1 95 0.013 > 100 821.40 822.5 Single isomer NO NH 0 N0 478 N N. 0.004 18 0.41 0.004 4 906.40 908.4 Single isomer 0 'N 0N 00 ,0 N N

________________________

WO 2012/041014 PCT/CN2011/001638 319 EC50 EC50 EC50 EC50 EC50 Obs.M.S. Isomer Cmpd la 1aY93H 1aL31V lb 2b [M+H]* Designation N 480 - N##### 1227.6 691.30 692.3 single isomer N 481 H N 0.124 62.1 109.g 0.012 110 805.40 806.4 Single isomer ,00 HN 482 N - 0.028 0.382 0.014 2.7 738.40 739.3 N NHN H I N 48 0900>10 2.4 2.3sni isomer 484 0 NH A 0.0246.1. 179.3 0.019 >100 835.40 836.4 Single isomer 0H - 0 0 HN HN N 0 NN > 483 0028 0.32 00.04 >.3 73.40 79.3 Si e o o NHN NN 484 N 60.06 11.90 173 0.1210 13.40 823 Single isomer HyN 0 N

N

WO 2012/041014 PCT/CN2011/001638 320 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N O

N

0 Mixture of 486 0 H N N 934.400 >1000 822.40 823.4 -o\ N 0 488 N~ '' 0.011 114.2 1.62 35.93 931.40 9332 2 smr O NH N- \ N NN 489 NH N0.090 1152 36.2 30 93.40 921.3 Single isomer NN 0 N H 490 0 1NH N 060 .52 26.2 100 920.40 921.3 Single isomer OO N -N C.--<'N WO 2012/041014 PCT/CN2011/001638 321 Cmpd # Structure EC50 EC5O EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation Fyo HN 492 0.010 21.62 0.17 12.37 924.40 925.3 Single isomer O NH 0 N 0'/"0002,2 01 00 NN N L.N J4 j S0 F 493 0 NH HN-F 0.006 26 16 0.003 >200 943.40 85.4 Sisomer ,0

SF

N N 494 /rNH 0 N 0.005 19.2 4.3 0.000 410 863.41 865.4 Single isomer o 0 NHN 497 N 0.019 5.2 >2 0.190 227 895.44 896.4 isomer N N 00

NN

WO 2012/041014 PCT/CN2011/001638 322 Cmpd # Structure EC50 EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer la 1aY93H 1aL31V lb 2b [M+Hf Designation N tN/ N 02~ N \/ Nk 498 H F- > 10 > 1000 > 1000 >2 > 1000 837.40 8384 ixtur

O

0 -or HN 499 F N O i F 0.013 1.55 0.005 10 975.30 975.9 Mxueo 0 NH F rNH 500 F NONH O 0.028 0.2 2.826 0.022 50.6 1018.38 1019.0 isomers 0 N 0 NH N F 50Fp\ 1 Mixture of 501NH F NO 0.007 0.31 0.004 8.3 1017.38 1018.0 isomers 00 NH 502 F N O 0.007 1.5 0.005 17.1 941.35 941.9 isomers FO 0 N1 WO 2012/041014 PCT/CN2011/001638 323 Cmpd# Structure EC50 EC50 EC50 EC50 EC50 CalcM.S. Obs.M.S. Isomer 1a 1aY93H laL31V lb 2b [M+H]* Designation 0 O NH y k,'-o H O H F N N-C 503 1',"~ N< \ 001 Mixture of 5 N 0.1102 >100 1.021 0.007 31.4 1018.38 1019.3 isomer 00 N0S 0 NH o N 504 NIN >~N. 2 109.9110.9 0.007 3310 955.37 958.2 igle ofe HN 00 NH 0i2N 505 N \ 1 / 0.110 > 100 42 0.023 863.43 864.5 Single isomer HN 010 N N 506 N 0 >2 109.9 109.9 0.157 110 747.38 748.2 Single isomer xO 01 0H 0 N0 N 507 N N 0080 > 100 43 0.029 57.9 863.43 864.2 Single isomer HNY OIL0

O--

WO 2012/041014 PCT/CN2011/001638 324 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b ' [M+H]* Designation 0 o NH N 508 N '- N > 1 > 100 > 100 0.154 > 100 747.39 748.2 Single isomer N\x N' 0

H

>(NH 0 oi NH OH 509 N N N 0.070 > 100 > 100 0.026 > 100 793.35 794.3 Single isomer , N HN 9AO

H

2 NO NH O. H N" N N 510 N N4IN 0.015 > 100 25 0.017 99.5 820.37 821.4 Single isomer N 0 H O N HN O H '110 HN 0 H N N 511 - N 0.020 110 50 0.015 69.3 845.33 846.3 Single isomer HN 9A'O N1x -- / N - N \ 0.043 109.9 44.71 0.020 110 859.35 860.4 Single isomer O N HN OAO O O H 513 N N IN 513 N N 0.140 109.9 109.9 0.030 110 859.35 860.4 Single isomer '0 H HN

AO..

WO 2012/041014 PCT/CN2011/001638 325 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+HJ Designation 0

O

4 NH 'Od o~r H ON N 514 N \ / 0.040 109.9 15.53 0.022 110 835.40 836.4 Single isomer O N 'ON 0 NH ( N - /N 515 N \/ . 0.088 109.9 40.23 0.060 110 835.40 836.4 Single isomer 0 N HNO N /N Mixture of 516 N '/845.33 846.3 ismr '-0isoer HN oNH 2 517 N / >1 > 100 51.2 0.118 > 100 834.38 835.4 Single isomer HN ol o o . N HN 00 518 NN .14 >100 5100 0.067 > 100 803.38 8054 Single isomer HN ''(

ONO

WO 2012/041014 PCT/CN2011/001638 326 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer la 1aY93H 1aL31V lb 2b [M+H] Designation 0 NH OH N 59N I 0.038 >100 8.7 0.034 > 100 821.39 822.4 Mixture of 519 N isomers ON HN 00 0 0 NH HOf-I 0JM 520 I N ' / 0.165 1.6 0.082 > 100 807.37 808.4 Single isomer N HN \-O H 0< I HN 0 '0 0 NH H 0 6 N/N 521 N \ / 0.044 > 100 4.6 0.020 > 100 835.40 836.4 Single isomer o 0 HN o- o O NH 522 N N - 0.054 > 100 24.1 0.022 > 100 833.42 834.4 Single isomer HN-0 00 H NN H N 523 N "~ii~.. 0.085 > 100 27.9 0.040 > 100 817.39 818.3 Single isomer \-0 H 01N W ." WO 2012/041014 PCT/CN2011/001638 327 Cmpd # Structure EC5O EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H) Designation 'o -N, N 524 N N N 820.40 NA Single isomer O N HN H~1N O 525 NIN 25.000 1000 592 1000 923.45 924.2 Single isomer HNT, F F HzN 0 526 0 N N IN 1.680 377 195 823.40 824.3 Single isomer o~o NNO 0 r~ N C1 527 ci N 0.050 13 0.7 15 949.34 950.2 Single isomer o H HN F F HN O 528 H NN N 0.420 143 108 >1000 880.42 881.7 Single isomer N, o0 H HN " WO 2012/041014 PCT/CN2011/001638 328 EC50 EC50 EC50 EC50 EC50 Obs .M.S. Isomer Cmpd ia 1aY93H 1aL31V lb 2b [M+H]* Designation F F HN OH 529 N N 0.057 42 11 246 881.40 881.7 Single isomer HNk olo 0~, FF HN 530 HN O- - 0.060 69 29 210 939.41 940.6 Single isomer 0-' N O-\/ NN SH N 5 0N 0NH 531 N 961.49 962.5 Single isomer HN 533 N~ -0.001 8.4 0.2 0.001 7 895.4 896.4 smr N N 0 WO 2012/041014 PCT/CN2011/001638 329 Cmpd # Structure EC50 EC50 EC5O ECSO EC5O Calc.M.S. Obs.M.S. Isomer la 1aY93H iaL31V lb 2b [M+H]* Designation CNHN N 0 N -p 0Mixture of 534 N 9 0.013 12 9.11 0.005 9 9015 901.8 ixtur Nt isomers 0 or 06 IN 'gro j6) H rN o HN 535 N, 0 'N 0.020 27.82 1.1 0.002 111 859.4 859.9 Single isomer N 536 N / 890.530 10000 787.4 768.4 Single isomer 06 0~ N H N 537 No 0013 109.9 18 914 915.5 Single isomer 53HIo0.0 0.9 0.020 0.2 965.4 966.4 Single isomer 5 '-o o

N.N

WO 2012/041014 PCT/CN2011/001638 330 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 6 o H NH0 539 0.180 >100 93 >1 824.4 825.4 Single isomer )O 540 N0500 >100 71 >1 8244 8252 Single isomer o NH 0o 541 ~' -478.000 >1000 >1000 360.000 763.40 765.0 Single isomer OI NHN 5420c 0.003 19.19 1.815 0.002 44.5 868.4 869.6 M isomers N s oN

*

WO 2012/041014 PCT/CN2011/001638 331 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation 543 NHi-IHO N 0.005 12.18 4.748 0.004 3 834.0 834.7 O HN O1 O 0 (N H 544 N 0.005 2.26 1.724 0.002 1.1 888.1 889 Single isomer o N e0 0~J Mixture of 545 N I -N0.004 4.69 0.5041 0.002 1 908.5 909.6 545 - I -U.U'f '.O~U.~'f U.UL I~UOO ~isomers -N N \ 0 HN 546 N 0.006 19.64 0.6745 0.003 1.3 874.1 875 ixtur .N 8 99 9 e0 S0 547 CI4 F 0.005 16.84 0.619 0.002 8.7 898.4 899.4 Mixture of N - P . . . isomers N N~\ 10 WO 2012/041014 PCT/CN2011/001638 332 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S Obs.M.S. Isomer 1a 1aY93H 1aL31V ib 2b ~ [M+H]* Designation N H 9O F N Mixture of NN Tsomers 54. H N .' 0.013 312 .05 547 0.003 > 100 823.9 824.8 is m r o oHN( o O

N

0 549 F N N 0.003 1.97 0.9988 0.003 1.3 864.0 865 Mixture of N - J.5>isomers (NHNN 0 0 550 N O 0.00961 7 6.055 0.0094 0 818.0 81. Mixtreof ON.-I isomers N HN 00 552 e- 000 21 Mixture of 0 NH0 N~* .3 .8 . 5. 5. isomers HN 0~ WO 2012/041014 PCT/CN2011/001638 333 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H IaL31V lb 2b [M+H]* Designation o 6o HN 553 F N 0.010 101.1 16.66 0.002 78.1 886.4 887.2 Mixture of NF isomers N I' ~N N H 554 0 .NH TN 0.001 27.79 0.7867 0.002 7.7 900.0 901 Single isomer - HN< 0~ j~r0 o 55 4 02 277 37H , Mixture of -5 N' N F isomers -~ NN~ 00 (N'O H N 56CIF 0N0.002 47.82 5.848 0.002 27.7 886.4 887.2 Mixture of N ..-. . . ... isomers N ~ N 0r HN 557 N /N0.017 93.26 2.586 0.005 51.2 938.1 938 Single isomer 0 WO 2012/041014 PCT/CN2011/001638 334 Cmpd # Structure EC50 EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 558 F N F 0.001 3.04 2.004 0.001 33.6 936.0 937 isomers N 1-0 .. N N 0.003 25.61 0.5109 0.001 7.2 682.0 882.9 Single isomer NHN F/N N HN o- N. Mixture of 560 0 1<NH 0 1 0.007 4.8 0109 0.002 2 852.0 852.8 isomers 0,0 N F Na HN 0 Mixture of 562 0.012 167.4 10.22 0.005 13.6 866.0 866.8 ixtur 0 WO 2012/041014 PCT/CN2011/001638 335 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a iaY93H 1aL31V 1b 2b [M+H]* Designation N- HN 563 F 0.001 12.15 1.339 0.001 4.5 866.0 866.8 Mixture of 56 N yO N Fisomers F N HN 0 N N 566N HF N 0.022 >8100 3.9 0.002 1.0 864.0 85 ingle o 564 N -isomers - N N F.$N H HN 565 N F N 0.002 0.93 1.06 0.001 61.1 918.0 919 Mixture of N F isomers -00 0 H 566 N. N H, O 0.022 > 100 33.97 0.006 > 100 858.0 858.7 Single isomer N N iK(( 0 F,.. N H HN 567 N 0.033 > 100 12.3 0.003 > 100 902.0 903 Mxueo N IF I <J F. .. isomers -N r,\' WO 2012/041014 PCT/CN2011/001638 336 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 CalcM.S Obs.M.S. Isomer la 1aY93H 1aL31V lb 2b [M+H]* Designation N 7 -0 F N H HN 568H ~ Mixture of 568 N 0.011 0.22 11.63 0.001 43.7 902.0 903 N31o isomers O NH O HN 569 F O 0.023 >100 11.76 0.010 60.5 846.0 846.8 Mixture of F isomers HN ONH ,0 570 aMixture of 572 NH ' N 0.012 0.2 12.86 0.001 76 888.0 868.8 isomers HN N0N 571 0.001 4.02 0.3006 0.001 3.7 882.0 882.6 Single isomer NO 0~ FlIN N 0 NH 0 572 O CNH 0 0.003 22.65 1.359 0.001 2.6 864.0 865 Single isomer 0x 0 ~ HNtI 573 N 882.0 883 Single isomer -N N~\~ e0 WO 2012/041014 PCT/CN2011/001638 337 Cmpd # Structure EC50 EC50 EC5O EC5O EC50 Calc.M.S Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H] Designation 0O NN 0 i NN H N N 574 N H 0.010 > 100 43.2 0.001 336.4 793.9 794.5 Single isomer HN 0 1 0 r~ 0r 0 H N N 575 0 N 0.019 0.81 19.86 0.002 44 884.0 884.6 Single isomer -N N\ 0 F NF F N NF H"/ N ,0 0 576 oNH T N 0.011 0.41 45.42 0.001 90.8 870.0 870.7 Single isomer O HN F N HN 0 577 A'0N F 0.004 5.64 1.526 0.001 104.4 938.0 938.6 Single isomer N F FF F F HN F OHNQ 57NNF0.011 26.56 2.158 0.009 918.0 919 Single isomer NN N 0 57 (H0N .02 10 5110.0 029 93. 2 Snl ioe WO 2012/041014 PCT/CN2011/001638 338 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O Calc.M.S. Obs .M.S. Isomer 1a iaY93H 1aL31V lb 2b [M+H]* Designation 0 NN 580 0 MNH o N 0.005 6012 5.531 0.002 2.2 8460 846.8 Single isomer HN" yro 0HN 581 N F 0.020 0.39 11.49 0.001 70.5 902.0 902.8 Single isomer N F~ N N F NF 582 o NH O H F 0.013 1.11 83.06 0.002 93.9 888.0 889 Single isomer 0,1O F O HN 583 0 NH 0 N 864.0 865 Single isomer 0 H H N F .N H 584 NF N 900.0 900.8 Single isomer N N 1?0 WO 2012/041014 PCT/CN2011/001638 339 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL3V lb 2b [M+HJ Designation F .N N HN 585 0 2NH 0 N F 0.014 0.2 23.5 0.007 64 888.0 888.8 Single isomer ;O HN F F HN N H O ~ >4 o N-k N 586 FNH ( H ONF 0.002 4.2 1.4 0.001 41.7 906.0 906.7 Single isomer F HN N F 587 FNH( jN-.F 0.001 1.2 2.6 0.001 5.4 906.0 906.7 Single isomer ? F N F F'N N 588 0-( N NO F 0.002 4.8 1.6 0.001 15.4 93.0 924.7 Single isomer "' F F -H 0 rr FrN-,. 0HN 589 N' - N 0.002 1.23 2. 0.001 1.6 923.9 924.7 Single isomer -N N ror F$F 0 HN 59 F o_' 0.003 142 1.7 0.001 159.4 93.0 938.7 Single isomer N k\ 0 F JOt- 6 591 0 HN F 0.002 4 1.6 0.001 159.4 938.0 938.7 Single isomer -N " N F 0 '0 WO 2012/041014 PCT/CN2011/001638 340 EC50 EC50 EC50 EC50 EC5O Obs.M.S. Isomer Cmpd # Structure 1a 1aY93H iaL31V lb 2b Calc.M.S. [M+H]* Designation F N FtJ- I IF N ~j N 592 0 NH 6 NO F 0.007 53 4 0.001 151.3 923.9 924 Single isomer O HNT F N N F

-

N 593 0 NH ( N F 0.003 59.04 9.4 0.001 209.9 923.9 925 Single isomer HN 594 N F 0.002 9.6 1.3 0.001 3.1 920.0 921 Single isomer N F) F N H N 0 H 595 FN O I 0.001 0.9 0.001 5.4 920.0 920.8 Single isomer N O ,N FN 0 HN 596 0>4N 0.005 9.18 0.001 134.8 936.0 936.7 Single isomer ~ F -N N, \ WO 2012/041014 PCT/CN2011/001638 341 EC50 EC50 EC50 EC50 EC50 Obs .M.S. Isomer Cmpd #a 1aY93H 1aL31V lb 2b [M+H]* Designation NH N N N I I 0 H 597 0 =NH oN 0.002 31.3 1.18 0.001 5.7 866.0 866.7 Single isomer F0 NN 0 O N F FF H HN , 598 0 6 NH N:F 0.002 35 0.5 0.001 2 866.0 866.7 Single isomer F HN' 666 0001 218 938.0 938 S some N- F F N 600 N,. *. -F <2F 0.0017 297 .53 0.000111.3 936.0 936. Single isomer N FN -0 F N HN 60F 0.071 6.53 0.001 251. 936.0 938 Single isomer NF N ,/ "N 10 F Or Fri H N,< 602 - F 0N 0.0178 197 6.63 0.001 2518 938.0 939 Single isomer FF <"N N 0 ~ 603 0 N F 0.013 18.78 7.4 0.002 517 938.0 93. Single isomer N. F 0 WO 2012/041014 PCT/CN2011/001638 342 EC50 EC50 EC50 EC50 EC50 Obs.M.S. Isomer Cmpd # Structure 1a 1aY93H 1aL31V lb 2b [M+Hf Designation N F4 - N 604 0 =NH ( 0 N> 0.014 0.008 852.0 852.8 Single isomer HN olo N 605 e NH 0 N 0.003 21.58 1.9 0.002 2 848.0 848.8 Single isomer o HN' 0~ N 0O NJH HN 606 M0 N 0.002 15.22 2.1 0.001 2 834.0 835 Single isomer N N NN -N ~ N NH N H H N 607 0 NH 0 N 0.001 16.54 1.7 0.002 7 848.0 849 Single isomer N~ 0, N 608 e NH O "N 0.002 24.82 3. 0.002 1 834.0 834.8 Single isomer N H olo HF LNl - - N 1 69 0 N NJ 0.002 24.89 8.6 0.003 71 852.0 852.8 Single isomer NH 00 - WO 2012/041014 PCT/CN2011/001638 343 Cmpd # Structure EC5O EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation N HN 611 N N 1.950 27.45 1.95 0.200 12 884.0 885 Mixture of 611 N, - ~ somers 0 N N N / N H N-kMitur o 612 N-0 H) 1.950 241.5 7.47 0.200 200 846.1 846.9 so NH N 0 0 00 N H N!,J H N 613 N U 0.023 359 10 13.2 884.0 885 Single isomer "N N -0 N O ). HN 614 N 0.004 12 10 9.8 884.0 885 Single isomer N N N H H00 '' OkO' WO 2012/041014 PCT/CN2011/001638 344 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation NH 616 CN-0 0.003 23 14.92 0.003 58 846.1 846.9 Single isomer O HNT< O\ N N N 617 N 703.9 704.9 Mixture of 0,,,< 11' Nisomers 'O 0 NH O 618 0HN 1.000 152.82 832.0 833 N o' isomers N N N 0 0 Mixture of 619 N N o( 717.9 718.9 H N- isomers N 6' N\ F32 NH OIL, HN

-O

WO 2012/041014 PCT/CN2011/001638 345 EC50 EC5O EC50 EC50 EC50 Obs.M.S. Isomer Cmpd # Structure 1a 1aY93H 1aL31V lb 2b Calc.M.S. [M+H]* Designation '0 oNH I0 621 HN 0.004 34.08 14.7 0.004 43.5 832.0 833 Single isomer CN N N\ NN '0 NHN 622 HN 0.005 > 200 9.9 0.003 47 832.0 833 Single isomer N N N 623 N 0 0.006 > 200 6.6 0.005 92.2 832.0 833 Mixture of 0 ND isomers NH O HN /\ N N L /N Mixture of 624 N- 717.9 718.9 62 NOH isomers 0 O N o A N Mixture of ~-N isomers 625 N' 0 20>20055. 5 WO 2012/041014 PCT/CN20111/001638 346 Cmpd # Structure EC5O EC5O ECSO EC50 EC50 Calc.M.S Obs .M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation ,\N N - / ZN F Mixture of 626 F ONH N F 0.007 41.8 5.3 5.000 >200 904.0 905 isomers o oHN' N ZN 627 F F 789.9 790.9 of 628 -0.296 > 200 29.1 0.066 > 200 864.0 865 0 H3 ,isomers O -N \ N F HN NH F N628 " Mixture of 0N.0 068 1. 1. isomers 629 N' --0 NHN - o 6310 FF >Ot2 004 145 457 200>02 > 200 753.9 861 Mitreo 00 00 N Z/\Z Mixture of 6319 F N~ >2 >200 3.0 0862>200 7 .8 isomers 0 0 00 WO 2012/041014 PCT/CN2011/001638 347 Cmpd # Structure EC50 EC5O EC50 ECSO EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H IaL31V lb 2b [M+H]* Designation /\ N AN 632 0.003 >200 2.1 0.004 54.1 832.0 833 Single isomer i NH O1 N O OHN~' N / N H N 633 N O ND 0.003 82.89 14.2 0.003 53.1 832.0 832.9 Single isomer NH 0p 4 0 0 HN /~ N IN 634 F' O 0.036 1.87 89.97 0.009 > 200 882.0 882.9 Single isomer YNH Nj-N NH

HN

/\ N 635 F' NF 0.277 1.26 35.724 0.008 >200 882.0 882.9 Single isomer NH O OHNT \ N N 636 F N O rY F 0.012 86.77 3.2 0.004 > 200 904.0 904.9 Single isomer NH ON F 0 HN 0 NN F N N 637 F )N OF 0.003 78.42 22.7 0.002 > 200 904.0 905.1 Single isomer NH 0 N F O0 HN O HN F, N 0 N 638 F N O 'F 0.050 4.6 21.7 0.007 47.6 920.0 921 Single isomer NHN N N 0 NHo " WO 2012/041014 PCT/CN2011/001638 348 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation HN 639 F N O <F 0.008 26.9 0.005 41.9 920.0 921 Single isomer 0 N N O-(N N N O= N H 640 F N /N 868.0 868.8 ismr 0N F HN O H 0 N H N H - Mixture of 64 N N 868.0 868.8 HN o oK 00 O0H -ON N N . Mixture of 641 N Z / N 832.0 832.9 isomers HN 00 NHH N" 3 NN 00N 00 WO 2012/041014 PCT/CN2011/001638 349 Cmpd # Structure EC50 EC50 EC50 EC5O EC50 Calc.M.S Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation '0 NH Fh N N 644 N I N 868.0 868.9 ise of 0 N F HN O OH 00 H 645 N N 832.0 833 Mixture of N- isomers 0 ND HN 0 0 0oo oH /\ N 646 N Z N 832.0 833 Mixture of rly isomers SN3 HN 0 0 '0 NH CN Mixture of 647 N N 832.0 833 M of _ isomers - N

HN

90 0N N 64- HN 0 Mixture of 648 / H 0.340 38 34 0.006 67 882.0 883 ixturs N isomers WO 2012/041014 PCT/CN2011/001638 350 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+Hf Designation HNQO 649 - N / N 406.000 2295 882.0 883 Mixture of o isomers N HN 0 F 0 650 o HN 0 # 274 918.0 919.1 isomers N isomers 0 0 NHN / HNJ Mixture of 651 0 0.003 2.42 20 0.005 46 836.0 837 (N N ' 4 isomers F N HN HH ,00 65 - 1 N'f0 00 >10 .02 00 82. 829 Mit0eo -M 0 O isomer 0 - FF WO 2012/041014 PCT/CN2011/001638 351 EC50 EC50 EC50 EC50 EC50 Obs .M.S. Isomer Cmpd # structure 1a iaY93H 1aL31V lb 2b alc.M.S. [M+H]* Designation 0 N 04 NH N N 6N4 N / 0.037 > 100 37 0.003 65.2 882.0 882.9 Single isomer I, 0 0 N O 0NH "N N 655 HN0 0.673 > 100 42 0.011 >100 882.0 882.8 Single isomer O N 03 C ,; \N smr NH Or HNQ 65H 0.006 5 0.2 0.003 1.9 930.1 931 Mixture of 65 NH OO H Nim NH O F, NF_ F Mixture of 658 H H N 0.004 0.2 1.6 0.004 30.5 1020.0 1021 iomer N isomers HN 69 F N O "F 0.006 1F .0 29 020 10 NH 0 0 FF NN - W42Y Mixture of 659 '-CC -0\ 0.006 1 7 0.002 42.9 1002.0 1003 isomers (NH O 0H 0 F F WO 2012/041014 PCT/CN2011/001638 352 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation O NH PO 660 HN 0.006 8 5.7 0.005 43 836.0 836.9 Single isomer 0 661 H NN 0.004 > 100 11.8 0.004 25.2 836.0 837.1 Single isomer N F F Ny > NH \ 662 HN 6N O F 0.004 1 6 0 9.6 0.004 2100 96.0 916.9 Single isomer O NH NH F N ,0 664 O HN 0.002 16 0.2 0.002 8.3 966.0 966.9 Single isomer F NH 00

)F

WO 2012/041014 PCT/CN2011/001638 353 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation O H No N HN 665 H N N 0.005 6 0.2 0.003 2.9 966.0 966.8 Single isomer NHN 0 FF F a- 0. isomers 0 HN yO N--LN 6 H HN 667 N. ~i~\ 4. 4. smr 0 0 N OF N H H N 669 N O. .6 2 . . 930.1 910.9 Single isomer NL is-ome0s N O IF HH H 669 N 0.00 5 0.2 0.005 0. 930.1 931.9 Single isomer N OXI / 0 N O O6 _TH 'N 0 H NJ 67069 0.006 5. 0.2 0.005 2.9 930.1 931. Single isomer 0 )0 WO 2012/041014 PCT/CN2011/001638 354 EC50 EC50 EC50 EC5O EC50 Obs .M.S. Isomer Cmpd # Structure 1a 1aY93H 1aL31V lb 2b Calc.M.S. [M+H]* Designation 0 r0 FCN H HN 671 NF 0.016 0.6 2.4 0.005 52.5 1002.0 1002 Single isomer FN NN 672 N O F 0.006 0.22 2.1 0.005 26.8 1002.0 1003 Single isomer 0 0 FF Syo "r- N 0HN 670 N O0.00685 1.4 0.1408 isomers.0 9 NH F HN 674 N- 0 N 0.01579 7.6 .3 6930.1 931 Mxueo I / "'omr O NHN 00. FI N H N - 675 H N N 001313 5.192 0.1423 980.2 981.1 0 isomers NH 0 0 00 WO 2012/041014 PCT/CN2011/001638 355 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H]* Designation O H N N O N >- 0 Mixture of 676 NH 0.01146 9.211 0.2883 1032.2 1033.2 '0 0 O O HNZ F N O F ~ N 677 H 0 0.02203 0.1319 3.906 1078.2 1079.1 Mixture of ,00 HN F H N O 678 NH O 0.02197 5.034 0.3629 1042.2 1043.1 ixtmero N H HNsoer ,00 0 0 r HN 'N'' \ - Q> Mixture of 679 -N 0 k\ N 0.01418 0.1566 2.77 990.1 991 ismr 0

N

0 680 N N0.01 43.4 0.5746 972.1 973 Single isomer 0

O

WO 2012/041014 PCT/CN2011/001638 356 Cmpd # Structure EC50 EC5O EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation o d N 0H CN-'H HN F 0 N O 682 N N 0.0088 3.58 0.1225 974.1 975.1 Single isomer NH $ 0 0~ HN N \0 NH ,o 684 ," 0.00554 0.947 0.02844 954.1 97551 Single isomer 0 N/ NHO O~S 6845 > N 0 N 0.0025 0.97 0.1684 954.1 955 Single isomer NH -H ,0 F HN 683 N 0.0511.5 0.158 954.1 9755 Single isomer NH 00 ,0- WO 2012/041014 PCT/CN2011/001638 357 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O Calc.M.S. Obs.M.S. Isomer 1a IaY93H iaL31V lb 2b [M+H]* Designation 0 ro FF N 686 H N O N 0.00799 0.01904 1.958 1002.0 1003 Single isomer 0 o NH 0 F 0'r HN F N F 0 687 > M N N 0.02801 0.197 2.78 1002.0 1003 Single isomer o N H O0 k NH H '0 0 FF Fy. 688 N 0.00919 15.96 0.9876 984.0 984.8 Single isomer 0 , NH 0O F F HN 689 N N O / 0.00254 1.935 2.455 984.0 984.8 Single isomer 00 O-r F F HN F 690 H N N 0.00529 0.467 0.9878 1002.0 1003 Single isomer 0 NH 0

F

WO 2012/041014 PCT/CN2011/001638 358 EC50 EC50 EC50 EC50 EC50 Obs.M.S. Isomer Cmpd # Structure 1a 1aY93H 1aL31V lb 2b Ca~c.M.S. [M+H]* Designation 0)ro H N 691 > OH iN N 0.00274 5.758 1.067 1002.0 1003 Single isomer SNH ,00 0 (N0 FF HN N F_. F 692 > H I N N 0.01126 0.3635 0.7222 1002.0 1003 Single isomer 0 '0 SNH O F F 0)'0 N HN N ~ F N 693 0 N N 0.00297 1.13 0.5323 1002.0 1003 Single isomer 0 NH 0 FF 6.ro HN> 694 N O 0.00191 1.68 0.4014 928.1 929.9 Single isomer O l N N 00 NH S HN 696 N i 1 0.00523 1.498 0.2222 928.1 929.1 Single isomer /\-O H N 0 "N ONH

S

WO 2012/041014 PCT/CN2011/001638 359 Cmpd # Structure EC50 EC50 EC50 EC5O EC5O Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation HN 696 F NO 0.7761 14.77 9.446 934.0 935.1 Single isomer NH OH HNZ~ 697 F ''N O 0.2843 0.8465 13.44 934.0 935.1 Single isomer 0(NH OH HN S- 0 H N FI.-..,.N 0 ~N 698 0 .NH- 0.02305 48.17 0.1533 1032.2 1033 Single isomer H HN 699~ NH 0.21 114N.2 022 13 igeioe oNH ,0 0 HN F N O 'FN _0 691 O NNN 0.02913114 0. 229 .1 1032.2 1033. Single isomer ,0 (0 0 ONH 0 0 0r 0), NH F 0 WO 2012/041014 PCT/CN2011/001638 360 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H] Designation

HNQ

1 IF, N0 702 No . N O N 0.06167 0.06878 1.535 1008.1 1008.9 Single isomer H NN, 0 N 703 ' 5 F 0.130 0.52 0.094 1058.2 1058.9 Single isomer N 0 N ~Z'H 704 o H F N 0.031 0.4 0.036 1058.2 1058.9 Single isomer H O H N 705 F- Mixture of N \ N isomers o NH 706 NH H w0.7 Mixture of 706 0 ,(NH 0 N-0 0.007 58 3.447 0.002 11.9 902.10 903.4 isomers HNN 707 0 , NH 0 N 0.017 3.414 0.001 8.3 902.10 903.4 Single isomer O9 HN~ "' g?,o WO 2012/041014 PCT/CN2011/001638 361 Cmpd # Structure EC50 EC50 EC50 EC50 EC60 Calc.M.S. Obs.M.S. Isomer 1a iaY93H iaL31V lb 2b [M+H]* Designation 709 HN ~ 0.008 91 1 0.005 9 860.00 861.3 Mixture of N isomers 710 0050 >1000 216615 0016 890515 977.42 978.7 iureof HN 711 N 0019 5.02934 1.9555 0002 25.9449 909.45 910.7 isomer 0 (NOr cN HNI 7N 0.019 2.93552 1.9555 0 007 22.3421 909.45 651.8 Mixture of N N 00 9 1 00 9 86.isomers -00 WO 2012/041014 PCT/CN2011/001638 362 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S Obs.M.S. Isomer Sa 1aY93H 1aL31V lb 2b C [M+H]* Designation 0 o NH Y-roN N N 713 N 0.019 11.559 3.693 0.002 37.251 849.40 850.7 Single isomer N HN O0 0 o NH N N N N O-S NH 715 0 925.43 925.8 Single isomer d 1. HN O~o 0 0H NH N N r HN 717 N 0.002 18.59 9.11 0.002 85.53 925.43 925.8 Single isomer HN 0

N

0 H 717 'H 0.005 6.5023 497 0.005 130.23 909.45 910.8 Single isomer N N 0 WO 2012/041014 PCT/CN2011/001638 363 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 - W-C>Mixture of 718 N O 6.200 17 441 795.41 796.7 ) 0O Hl N /N ixturso Sl N N 719 0 ) 574.000 996.05 811.39 812.2 isomers - 0 9 720 N 302.830 10000 801.36 802.2 Mixture of N isomers ~N N,\ 0 0 (N4 721 0 N 2.000 36.79 890.43 891.7 N ..- isomers 0 N O 722 N 1.950 188.88 989.51 990.9 Mixture of ~-N WN isomers 0 H~J 0 ND 0 N ' NN_ Mixture of 723 667.33 668.3 -N \ 0 WO 2012/041014 PCT/CN2011/001638 364 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+Hj Designation N' N N_ 724 N 945.51 946.3 Single isomer NIO 725 1 949.39 950.6 Single isomer & D 9 726 803.36 803.9 Single isomer 0N HN 727 / 825.36 826.7 Single isomer NH 0 N ^ 728 N O 965.44 966.7 Single isomer oV2~0 N ' N 0 N Q-0, 729 0.013 47 12.2 0.009 12 915.41 916.4 M * Hisomers ,0 - WO 2012/041014 PCT/CN2011/001638 365 Cmpd # Structure EC50 EC50 EC5O EC5O EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 3No HN N0 1 730 NN 0.016 > 100 1.6 0.009 0.254 853.39 855.4 Mxueo NH ,o Oz 0 H 0 731 CN'N M 0.013 4.287 0.2 0.012 1.031 923.43 924.5 Hi I NI,~ isomers SNH 0 0 732 0.029 55.72 0.39 0.019 2.354 913.46 914.4 isomero 732 ~' CNiomr 0 o NH O)F0 HN> 733 N 0.371 > 100 44.8 0.035 32.027 766.36 767.3 iour 0 0 N HN H Mixture of 734 N 0.008 0.71 0.19 0.009 0.9 923.43 924.3 H3N N I N isomers 0- N N 00 WO 2012/041014 PCT/CN2011/001638 366 Cmpd # Structure EC5O EC50 EC50 EC50 EC5O Calc.M.S Obs.M.S. Isomer 1a IaY93H 1aL31V lb 2b [M+H]* Designation O0 HN 735 0.008 19.11 0.008 1.911 913.41 914.4 Single isomer 0 NH 736 i - 0.005 49 1.7 0.006 41.4 933.45 934.7 Single isomer <Y 0 N O 0 O HN 737 NN 0.018 11 0.2 0.010 913.46 916.4 M xueo 738 N 965.44 967.5 Single isomer N O 0 N 'ZN HN 739 N 909.45 911.4 Single isomer 0 (N ~ HN 740 N 0.007 32 1 0.004 16.8 909.45 911.4 Single isomer N 0 WO 2012/041014 PCT/CN2011/001638 367 Cmpd # Structure EC50 EC50 EC50 EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N -! N 741 'b Oa I - 0.011 97 > 100 0.005 60 877.39 878.3 Single isomer HH 0o HN 742 0.016 7 0 0.007 52 915.41 916.4 N ~ IyQ - . - isomers 0 N 0 NN 743 N 128.990 678.6 767.38 768.4 Single isomer 0 _0 N 0 00 r OH N Not 744 N >1 > 100 85 >1 > 100 885.38 obsee Single isomer N N Ho ,0 WO 2012/041014 PCT/CN2011/001638 368 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a iaY93H 1aL31V lb 2b [M+H] Designation bN ~I ~ N- N 745 H ND 0.014 3.18 0.8 0.010 5 847.40 848.5 Single isomer OO 0 HNI 'A N N 749 N O 0.082 3.45 0.4 0.038 5.9 889.41 890.5 Single isomer 0 NNk~ 747 a ND 0.014 41.65 9 0.010 <100 803.38 804.4 Single isomer HN (~ NH N -J N N Y' 748 U 1 NH 0 N-/ 0.022 92.12 2.3 0.017 16 837.38 838.4 Single isomer HN " 9?,-0 0 N Mixture of 749 N NN.../ 0.020 20.05 0.3 0.007 6.1 897.42 899.3 smr 0 NH 6a WO 2012/041014 PCT/CN2011/001638 369 Cmpd # Structure EC50 EC50 EC5O EC50 EC50 CaC.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V 1b 2b [M+H] Designation H I " ~ -0 '0 HI 750 H NHN 0030 6.3 0.007 38.1 831.41 832.3 Single isomer 910O N HN 7-O Mixture of 751 N 0.055 3.5 0.3 0.044 1.6 917.44 918.5 isomers 750N\-N .27 >10 16 008 06 6.7 803 Snl isomer 0 j0' 0 NN ( N N oN H 752 N 0.227 > 100 1.6 0.038 0.6 869.47 870.3 Single isomer NN N N, 753 N N:N 0.021 1.5 0.013 4.5 837.43 839.3 Single isomer N Q) M 11 CL I N 754 N N> 0.026 5.3 1.4 0.750 15 847.40 848.3 Single isomer c 9 9N N 0 (N~ N /N kO N > Mixture of 750 J.LUU 10 >100 0.85 0.120 0.52 697.51 899.5 isomers WO 2012/041014 PCT/CN2011/001638 370 Cmpd # Structure EC5O EC5O EC5O EC50 EC50 CalcM.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 756 >1 >100 51.6 >1 >100 763.35 764.3 Single isomer - Ny 0 N COc 0 HN N Or 757 0.009 16.2 0.85 0.410 33 853.39 854.4 Single isomer \-O NH0 NHH 0~ H O, HN 758 N O 0.036 1.3 0.12 0.120 036 923.43 925.5 Single isomer ON N 00 HN N 760 CNN N 0.028 13.3 0.076 0.021 2. 93.43 894 Single isomer

NN

WO 2012/041014 PCT/CN2011/001638 371 Cmpd # Structure EC50 EC50 EC50 EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation O)-O NH 761 N O 0.025 5.5 2.1 0.350 11 895.44 896.3 Single isomer o NH 0O HN 0)~ _ _ NH0_ NN 763 0N 0.027 71.5 7.5 6.300 >100 961.49 963.3 Single isomer F e0 F N H N C";I IJ.Z 001 14. Not 765 0 N 0.02 > 14 . 0.21 31.2 1033.45 Single isomer irOH observed H 765 N O' 0.024 >100 11.9 0.004 15.3 873.40 874.3 Single isomer 0 0 O0 WO 2012/041014 PCT/CN2011/001638 372 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 767 N HN | O 0.019 1.95 1.95 0.096 11.879 921.40 922.5 Single isomer 00 N 767 N'N,--N 0 768 N H H 0.019 12.546 1.95 0.057 139.906 921.40 922.5 Single isomer N N 00 N oo 769 H 0 0.0219 12562 109 1.57 1.10 921.40 922.5 ixtre ofe N * 770 N 0 o 1.950 17.34 1.95 0.200 178 831.40 832.5 Single isomer P :, 77N NN ,-/ Mixture of 0 . . . isomers / \

S

-0,4 0 WO 2012/041014 PCT/CN2011/001638 373 Cmpd Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation F HF H -_ H

N

772 0 > 2000 > 20000 995.40 996.3 Mixture of isomers S" Ol F N N 773 N > 2000 > 20000 935.40 936.3of "'~ isomers S F 0 H F F N 774 O 0 N > 2000 > 20000 953.40 954.3 Mixtureof isomers S FF M O N'H I N ' 7750 N N o- 165.000 > 20000 751.30 752.3 ',H N -o N 0 ' 776 0.036 1.8 3.8 0.005 46.59 1109.40 1110.3 Mitre of F o isomers 0

F

WO 2012/041014 PCT/CN2011/001638 374 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation F 0 o NN O S 779 1.953 454.2 865.40 867.0 t 011N 0 F N N Mixture of 780 0N 0.4 10.308 30.4 861.30 862.0 isomers 000 oA~ NI -F o~ ~ jS< \ NN /'Mixture of 7800 78 )- 0.0608 2.340 . 00 > 800 97.40 962.4 isomers F N 0 -o -o N NN"O Mi~Ure of 000 783 o 0.161 >100 3196 0.053 38.607 939.40 940.4 isomers 0 0 WO 2012/041014 PCT/CN2011/001638 375 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 CalcM.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation H N N MI~ture of 784 0 478.067 3990.18 825.40 826.4 isomers 00N CIA H * , NN N H O 78 N 0 N Mixture of 786 72562o 1701 843.40 845.4 smr isomers 00' iu N F 787 N 0 N 2.000 12710 841.30 842.3 Mixture of / isomers H N F Q 0 N,~ - -1 H Z 04 N 0 N 2Mixture of H8 . y~) ~ N "/ ~Mixture of 788 F N 0.008 0.2 2.8 0.004 15.382 973.40 974.4 isomers WO 2012/041014 PCT/CN2011/001638 376 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation F0 F "0 N H IMixture of 789 o 0 0.005 0.227 0.003 0.761 955.40 956.4 isomers 0 F, N 0" N N F Mixture of 790 0)*o N 0 /\ N 619.000 1000 908.40 909.4 isomers

A

N H Mixture of 791 F N N 0.015 0.2 0.195 0.006 0.353 1057.40 1058.4 isomers 0 F OH NN I Mixture of 792 o N 0.011 0.3 0195 0005 0.195 1039.40 1040.4 isomers N CI1 F C ~' ~' K~ NMixture of 793 o 0.024 0.1 > 100 0.006 18.45 1022.40 1024.4 isomers MN FN o H 794 F No 0.031 0.04 > 100 0.008 10.43 988.40 989.5 iomerso isomer WO 2012/041014 PCT/CN2011/001638 377 Cmpd # Structure EC50 EC50 EC50 EC50 EC0 Calc.M.S. Obs.M.S. Isomer 1a IaY93H 1aL31V lb 2b [M+H] Designation 0 N Mixture of 795 F .910.01006.4 ismr F Na.91054 isomers

N

5 Mixture of 797 N N 0.023 2.234 0.26 987.40 988.4 0H H - I N Mixture of 798 N 0 >1 >100 >100 839.40 840.4 isomers F N yO F 'N H H N 799 NF N F 0.018 13.2 2.1 0.006 380 971.40 972.6 Mixture of 0 WO 2012/041014 PCT/CN2011/001638 378 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation F N HN 800 N F 0 N F 0.005 9 9 0.004 > 5000 971.40 972.6 Mixture of 800 o2 3 17isomers -N N 0 J~r 6 6 HN 801 N N 1.100 403 63.5 0.020 138.3 902.50 903.2 ixturso N ' N 8 O N ('Io 802 -H N F >2 953 1091 >2 430 727.30 728.3 Single isomer HN 00L N 803 'HN-O> 115.000 334.42 597.30 598.2 Single isomer 0 - - F1 Mixture of 804' 0.(N < 0 l 0.012 6 17.62 0.012 22 867.40 868.4 isomers a HN 3 F N/ - 0 H .:>. F Mixture of 805 0 zNH 0 NI~ 0.031 0.6 32.69 0.010 85 885.40 886.4 isomers aHN I a1 0 WO 2012/041014 PCT/CN2011/001638 379 Cmpd # Structure EC5O EC50 EC5O EC5O EC50 Calc.M.S. Obs .M. S. Isomer 1a 1aY93H 1aL-31V 1b 2b [M+H]* Designation 806 0 NH N F 0.021 11 16.84 0.016 12 883.40 884.4 ixtur F N 807 0 NH (0 .06 2.6s90.12 <10e8740 85. O HN HN \-0 H~> Mixture of 8080 ' 0.065 2.76 39 0.012 <100 857.40 854 isomers o Ho 9'0 H N N N Mixture of 8N0 F 0.009 1182 10.9 0.009 92 839.40 840.4 0 00 F N -N5-- NN 0. H ~ isomers 0 F HN 04O N0 Mixture of 811 0 yN 0.036 17.18 5.03 16.9 865.40 866.54 smr H HN O1 O WO 2012/041014 PCT/CN2011/001638 380 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation F NI HN 'I /N\N 812 NH 0.045 3.576 5.465 10.04 893.40 894.4 Mixture of 0:H 0 N-Q isomers

N

0 ' H o O N HN 815 0 O 64.40 75. Mixture of 830N-- 1.160 11.25 794omers5. HN ' 816 'D NHN 0.035 1.57 1. 0214 893.40 894.32 smr 01 O NH 817 F HN0 0-00 3.76 2 . 1 0.3 896.40 897.3 Mixture of Oisomers NH 00 N 81 (0 ,0.4 2.7 1.424 86.0 6.2 Mixture of HNH N. >F isomers NN N ~- 0 N Mitreo WO 2012/041014 PCT/CN2011/001638 381 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Cac.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H] Designation N NH 81 H N N N 0.019 12.462 0.003 49.8 886.03 887.0 Single isomer NH ,0 0 N O N N 819 N F 1 0.012 6.5 11.269 0.002 18.7 885.98 887.0 - ~ *Y.' .isomers - N N OfN F 0 N-N )p N Mixture of 820 N.. NH 101 .700 581 788.35 788.7 smr 0 OrZN N> NN. Mixture of 821LX 140.019 1.9555 1.9555 0.003 2.06206 902.39 902.7 N 0LSN - MiWreo 822 , N " \ H 0 - 208.251 1170.9 824.35 824.8 Misomerso 0 A w 0 823 NN-N /\H 432.198 1102.4 824.33 824.8 Misomerso 0 o- H smr A- 5', WO 2012/041014 PCT/CN2011/001638 382 Cmpd # Structure EC5O ECSO EC50 EC50 ECSO Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation O 0 NH Yr-'roj 0 4, l-[,: -- \, - . nMixture of 824 N 0.004 0.27 0.19 0.003 0.8 938.39 938.7 ureeof 0 N H F NO 825 O N NH 0 O 0.004 19.5 3 0.005 76.8 938.37 938.7 Mixture of NHJj -i isomers N0 0 O N FN 826 S N O NH O O 1.953 19.5 938.37 938.7 re of NH 8 NH - isomers do N H F N 2 NH 5131 624.24 6248 Mixture of 827 Fi NH 407 1. 2.2 648 somers 6- N / ~ HMxueo 828 N j 5.13 8. .7 001 7 92.24 92.78 in isomer 0 NH 829 £9N .~0.013 80.1 0.674 0,011 0.74 902.39 902.7 Single isomer -N NH O 0 w1 H 0 WO 2012/041014 PCT/CN2011/001638 383 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation 0o1 NH 830 N 0.015 6.149 1 0.013 0.881 902.39 902.7 Single isomer N H N CN N \ 831 HN CNH O > 1000 1480 884.32 884.6 0 A~- isomers SFN 0 F, - N F - NyA 2 IF Mixture of 832 N0 N O NH 518.300 1953 860.33 860.6 isomers

-S

A- N 0ZN I ' NHHN 833 > 1000 3481 684.22 684.6 S .N isomers F IF - k\ NH Mixture of 834 s 0 > 1000 7347 660.22 660.7 isomers 0 NHN O NH N- ,,-<1 835 F-- N \ - N- . N 0.008 0.15 2.7 0.007 35 974.37 975.2 Mixture of F N / \ isomers )0 0 0 S- H 0- WO 2012/041014 PCT/CN2011/001638 384 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H laL31V lb 2b [M+H] Designation 04NH I NN N Mixture of 836 N / \ 0.008 4 0.2 0.007 15 998.37 998.6 8N NH ___"iomr o NH NHN 837 0 I NHN 0.022 6 > 100 0.009 2.549 964.41 964.7 iso * S N 0 Wk NH O H 838 L N / N 0 0.033 9.27 54.7 0.010 < 100 835.4 836.3 isomers 2 -0\- N N OH HO,[, N HO N HNN Mixture of 839 -0N OH 5.900 212 737.35 738.2 isomers ON 0N H N 8409N NH 5.000 91 721.36 No8M+ Mixture of 8- Ny N N 9HNisomers HOH 0 NN /N Mixture of 10 85. 6.3[(M-OH isomers NH 2-0 HO 0H WO 2012/041014 PCT/CN2011/001638 385 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 842 I- 32.000 1000 52125 522.2 Mixture of 842 'CCN NkH 3.0 00512 2. isomers OH F,. 1 F N NH 843 0N N*-0 N N 0H 895.000 1000 739.35 740.2 N...!isomers HO,. N NHOM Mixture of 844 N O N NON NH 0.990 5.99 17.58 99.99 935.42 0.3[(M-16) isomers 6H 00 OOH NH (.1 845 0 N Nh,.C'> 0.032 10 2 2 939.09 939.3 Single isomer O N 0 010 0 NH )1rO H 846 N 0.020 5 0.09 0 939.09 939.6 Single isomer

ONH

WO 2012/041014 PCT/CN2011/001638 386 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 NH 847 N 0.530 5 415 999 853.39 854.3 Mixture of N3N 1,Jj isomers 6H 0 dNH 0 NH 848 Mixture of 848N ON\~l 0.010 1 1 31 843.97 844.3 isomers -oN N NH NH Mixture of 849 N 278.000 1000 529.26 Not Obs isomers N0 IN N Mixture of 850 N 212.020 601 729.36 730.3 0 0~ rN- 0P Mixture of 851 N - 0.040 0.21 0.11 0.56 927.43 928.3 S - NAi isomers N NH 0 oNH H O H NMixture of 852 NNN 0.010 8.14 0.64 2.62 875.4 876.3 es -N NH WO 2012/041014 PCT/CN2011/001638 387 EC50 EC50 EC50 EC50 EC50 Obs.M.S. Isomer Cmpd # Structure la 1aY93H 1aL31V 1b 2b CacMS. H Designation CN 0F 853 F 0.005 1.4 3.7 0.001 18 910.04 911.0 Mixture of N o N somers 0 :o (No 854 0 O.010 1 2.6 0.020 7.7 922.05 923.1 Mixture of N somers N I ~H 0-1 0 NH O H F 855 0.010 0+5 1+2 0.020 8.3 95410 955.1 0 ' N/ r 0 N-N \isomers N NHd 0HN N MiNreo 856 HNN F >0.2 >100 63 > 0.2 369 839.99 841.0 iure of C o HN .. o F 0.002 619.1 0.79 0.002 9.4 940.10 941.1 Mueo 8576N N N > 0. > 10 isomers N 8> F NO N WO 2012/041014 PCT/CN2011/001638 388 ECSO EC5O EC5O EC50 ECO Obs.M.S. Isomer Cmpd # Structure Ia 1aY93H iaL31V lb 2b CalMS.[M+H] Designation NHO N-4 859 F" N 0 N- 0 0.026 >2000 36.47 0.001 696.3 850.01 851.0 Single isomer i NH O.ro N Mixture of 860 F 0.003 360 0.76 0.002 3.4 936.11 937.1 ixtur N I somers HN 861 N /0.002 210.3 1.73 0.001 8.4 908.05 909.1 Single isomer 862 N' F ~~F 0.002 1.8 0.001 156.8 946.08 947.1 Single isomer N N 0 O , F N N F 863 o NH N 0.005 4.1 1 0.001 14 926.09 927.1 isomer O N WO 2012/041014 PCT/CN2011/001638 389 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation I

N

0 HrY' Mixture of 864 o <NH H ND 0.002 5.6 1 0.002 2.2 890.11 891.1 somers lo 014 865 -N " N o 0.005 31 4.2 0.001 13 940.10 941.1 Single isomer >$~H 0H FF N 866 0 NH oJN> 0.003 4 1 0.001 42 841.92 842.9 Single isomer t' N O HN N N 'N 867 N - 0.002 19.4 1.6 0.001 4 924.07 925.1 isomer F OL 0 7-00 N HN 868 0.002 6.3 1.4 0.000 79 859.91 880.9 Single isomer FF N IN F6F H NN, ,0 869 o HoN IF 0.002 3.3 2. 0.002 68 841.92 842.9 Single isomer ONH N ,o WO 2012/041014 PCT/CN2011/001638 390 ECSO EC50 EC50 EC50 ECSO Obs.M.S. Isomer Cmpd #a 1aY93H 1aL31V lb 2b [M+H]* Designation F N FNI F 870 HO NN 01HN.O 0.003 0.6 1 0.001 106 871.92 872.9 Single isomer O0 0 F N o 871 F N F 0.027 7.64 31 0.002 2 899.98 901.0 Single isomer HN O 0, Or6 N NO N H H N 872 H 00.034 > 200 91.9 0.008 200 817.83 818.8 Single isomer 873 O N~ > 2 > 200 200 0.045 200 730.87 731.9 Single isomer NHN \O 874 0 0 N >2 > 200 200 0.034 92.8 732.89 733.9 Single isomer HN O0 ~>N HN

O

874 N j N >211 > 200 200 0.031 920 812.9 813.9 Sigesor 0-0 Mixture of 875 / ~isomers - HN> WO 2012/041014 PCT/CN2011/001638 391 Cmpd # Structure EC50 EC50 EC50 EC5O EC50 Calc.M.S. Obs .M.S Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation NN 876 0 N >2 > 200 200 0.033 200 780.94 781.9 Single isomer HN~<

O

0 o NN N H S0 or-N N 877 oNH O, NO 0.354 > 200 200 0.123 200 839.96 841.0 Single isomer N-) HN HN 0 N 878 HN NH 0 _N >2 > 200 200 0.070 200 760.86 761.9 Single isomer Ho HN~( N HN 0 N N 879 0 NJ HO 0 , ND >2 > 200 200 0.037 200 788.87 789.9 Single isomer NFI y4p N N 880 NH ON 0.316 > 200 200 0.028 200 819.97 821.0 Single isomer NHN 881 OH _-a HNO 0-0.777 > 200 200 0.030 200 720.84 721.8 Single isomer HN- ' WO 2012/041014 PCT/CN2011/001638 392 Cmpd # Structure EC50 EC5O EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H IaL31V lb 2b [M+H] Designation NN 0Y( 4 H NN 882 oN 0 N > 2 > 200 > 200 0.463 > 200 846.01 847.0 Single isomer HN -N J 883 HN 0 N > 2 > 200 > 200 0.098 > 200 834.00 835.0 Single isomer O H 0 NH0 HN N HN 0 N \/ I ' NN O NH 885 O N 0 N > 2 > 200 200 0.036 > 200 758.84 759.8 Single isomer

NH

2 HN Olo N HN -N-<H N \ 886 H2N O N >2 > 200 > 200 0.056 > 200 733.88 734.9 Single isomer

H

2 o N H N~~ N-O H T 887 HO o > 2 > 200 > 200 0.020 > 200 734.86 735.9 Single isomer HN 00- WO 2012/041014 PCT/CN2011/001638 393 Cmpd # Structure EC5O EC5O EC50 EC60 EC5O Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation L N I 888 CNH o N 0.500 > 200 > 200 0.116 > 200 745.89 746.9 Single isomer HN 01o -- H N 889 0 N . 2.037 875.07 876.1 Single isomer o' HN H C 0 I N " -< \- H ) 890 0y N N: 816.88 817.9 Single isomer OrNH HN -.0 9?,'O 891 c - o 0 N 822.76 823.8 Single isomer HN el ' NHN Cl e\ 0 "-0 H ) 893 NH o 805.94 806.9 Single isomer NN NN ".,()0 N -0 H ,"Y 894 0 oNH oN 0.018 42 16.1 0.010 112 819.97 821.0 Single isomer 0 HN '0 HN0 WO 2012/041014 PCT/CN2011/001638 394 Cmpd # Structure EC5O EC5O EC50 EC5O EC50 Calc.M.S. Obs.M.S. Isomer ia 1aY93H iaL31V lb 2b [M+H]* Designation 895 0 NH 0.014 7 6.5 0.013 96 791.92 792.9 Single isomer o0 N H 896 0=NH 0 0.013 32.89 10.1 0.007 1.166 819.97 821.0 Single isomer NHN 898 o7 N 32.000 401 782.95 784.0 Single isomer HN 899 e (NH o ND 21.04 2483 3 002 5. 819.97 821.0 Single isomer N HN O O-0 H 899 0 > 320.00 431 3700 1 8.9578.0 Single isomer 0 8H 0 0L N 0 NH 89 o=NH0 N:. 02334 43 10 3 0.0702 11 89.078925.1 Single isomer 0 HN 010 WO 2012/041014 PCT/CN2011/001638 395 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b C [M+H]* Designation N N 901 H 1.910 591 951.15 952.1 Single isomer HN HN 0 - ~ N o N I N . H NN ._ 902 0 N 53.000 1891 809.98 811.0 Single isomer HN O~o N rI K j CNI 0 -0 1$N 903 NH 0 oNO 1.910 285 761.89 762.9 Single isomer HN 0 O

N

904 N-0 2.000 532 852.01 853.0 Single isomer HN 9 O N CN <N N JN )-0 H N NA 905 _N 2.000 258 868.03 869.0 Single isomer F HN( O0 \-O H 906 :)0 2.000 586 853.99 855.0 Single isomer WO 2012/041014 PCT/CN2011/001638 396 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S Obs.M.S. Isomer la 1aY93H iaL31V 1b 2b [M+H]* Designation N ' _9 -0 H< N 907 O OND 7.000 2977 809.98 811.0 Single isomer HN FO0 N HI~ o- H' N /Y A 908 F NH 0 ND 0.032 96.78 29.62 0.020 >100 845.89 846.9 Single isomer N o 910 ONN\O N2. Mixture of \-0 HN 909 ND 2.000 493 809.98 811.0 F HN OlO oN N N4~ 912 No 24.000 1081 852.01 853.0 igle om 0- isomers HN 0 NH N H No N 0 -N N \-0 H Mixture of 911 0 T. N 2.000 183 827.97 829.0 isomers F HN' N / N N / 0 N~ HH 912 > N" § 0) 0 .ND 5.700 1854 933.05 934.0 Single isomer HN ( 011.0 WO 2012/041014 PCT/CN2011/001638 397 Cmpd # Structure EC5O EC50 EC50 EC5O EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H]* Designation N/ HHN H2N \O HT 913 o N 533.300 2192 733.92 734.9 Single isomer HN ' o o 914 oz NH 0N 43.100 1355 791. 96 793.0 ismr HN N0H IN 915 O NH H N 0.020 >100 12 0.010 89.2 819.97 821.0 Single isomer FF >O H N I FF Mixture of 916 0 NH H 0.010 81 > 100 0.009 831.86 832.9 isomers 917 NH Ho 0020 >100 26 0.009 831.86 832.9 isomers HNo O0 WO 2012/041014 PCT/CN2011/001638 398 EC50 EC50 EC5O EC50 EC50 Obs.M.S. Isomer Cmpd # Structure 1a 1aY93H 1aL31V lb 2b Calc.M.S. [M+H]* Designation N H \-O H 918 N 0.131 109.9 109.9 0.019 110 914.00 915.0 Single isomer 9180 H 0 - HN 0-0 H N 919 N N 0.30 2 109 109 0.068 1 84 05.9 Single isomer HN > 0 N N oloo 9210 N 0.136 109.9 109.9 0.068 110 804.96 85.0 Single isomer HN> O1 0 ON'H 921 N \ N N 0.136 109.9 109.9 0.036 110 855.00 895.0 Single isomer OHNHN NoN 922 H 0. o H- 0.134 109.9 65.2 0.034 110 895.00 896.0 Single isomer OH l? HNY

N~

WO 2012/041014 PCT/CN2011/001638 399 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N 923 o NJ 690.81 691.8 Single isomer HN olo N 924 0 N-oN 838.03 839.0 Single isomer HN Olo (N NHOI 925 0 N 866.09 867.1 Single isomer HN T r 92 O o832.07 833.1 Mixture of -~ isomers HN olo N ~ N N N 927N0 H 3.0 331 Mixture of 925 NH 0 832.07 833.1 Sigleisomers HN o(0 N I 926 NH - Mixture of HN10 isomers OkO WO 2012/041014 PCT/CN2011/001638 400 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S Obs .MS. Isomer ra 1aY93H 1aL31V lb 2b C [M+H]* Designation 'O N b' -0 N N 929 - O H 860.03 861.0 Miture of isomers HN 90 N 0, 930 - O Ho 876.03 877.0 Mixture of O H0 isomers O H CI~;~1 0~Mixture of 931 NN >10 > 1000 > 1000 >2 > 1000 734.86 735.9 xturs ~isomNrs H2 20 0 rOI O HNM 932 NA0N 0.362 > 1000 524 0.205 > 1000 862.99 863.8 Mixture of isomers NN 0 O NH F,. N O 933 NF >10 >1000 > 1000 >2 > 1000 770.84 771.7 ixtuers H12N O rO N N 0 FtNJ H HN( H 0 Mixture of 934N N H/7-N N > 10 465.092 > 1000 0.100 > 1000 884.95 885.9 ixours N F isomers H2N-O

O

WO 2012/041014 PCT/CN2011/001638 401 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+Hf Designation CNo HN 935 0 IN 1.950 1000 457.51 0.200 1000 848.97 850.0 Mixture of N isomers H20

O

0 rO 936 s o 836.09 836.7 Single isomer O N OT NH 937 sN IN HNZN > 1 > 100 92 0.407 > 100 950.19 950.5 Single isomer Si IN H H O N 0 N 938 HN OHNN ~< 0.004 23.48 1 0.001 5.504 919.40 920.4 ismr F H F F F AH O 'r NH 99 N NH 0.002 5.61 7 0.001 25.107 851.40 852.3 Mixture of N - isomers HN 010 04NH N40 N -** 0- Mixture of 94 H-'~ 0,/1 0.006 8.63 1.83 0.002 5 901.40 902.4 isomers NN F F WO 2012/041014 PCT/CN2011/001638 402 Cmpd # Structure EC5O EC50 EC50 ECSO EC50 Calc.M.S. Obs.M.S. Isomer 1a IaY93H laL31V lb 2b [M+H]* Designation 941 N N 'NH 0008 79.27 12.87 0.002 162 939.40 940.0 iure of 942 H H 0.008 6 2 0.003 4 913.50 914.5 Mitro N 00 isomers 3O O0 ONH I Mixture of 943 N N 0.003 0.4 0.001 2 919.40 920.5 00 C NH 9443N 0.0103 04 . 0.00 11 913.40 914.5 Sigisomer 0 'l N H _ N> 9N HH 0 0.010 48 2.1 0.020 11 913.40 914.5 Single isomer 945 H N N' " - 0 0.010 4 1.1 0.010 2.1 913.40 914.5 Single isomer Oo 0 N ~ /NH0 N N 946 >-) o - N0 N N001 00 6.4 0.020 111.9 957.50 959.4 Single isomer ,0 WO 2012/041014 PCT/CN2011/001638 403 Cmpd # Structure EC50 EC50 EC50 EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation / N NHO 947 N N' - 0.010 39 4 0.020 35.9 957.50 959.4 Single isomer o-'' F NI HN__I -'FMixture of N O NF 948 HNN F 332.501 5099 823.30 8234.3 reoof "S a-k' N O N HN,- F .o 33 Mixture of 949 HNF 12.500 57 843.30 844.2reo N , \-NIH isomers C1 N F ' H O -N2 950HN O N 0.011 0.4 5.3 0.007 17 937.40 938.4 Single isomer 950N 0 H F 00 0 0 0 N N 951 HNN - 0.020 9 4.6 0.049 23 937.40 938.3 Single isomer s H' WO 2012/041014 PCT/CN2011/001638 404 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a IaY93H 1aL31V lb 2b [M+H]* Designation F r'>N O - N~ N 0itueo 952 0 NN O NH - O 0.005 0.09 0.6 0.007 9.11 999.40 1002.3 Mixture of NH H 0- somers o NN 953HN ON o 0.512 15 589 0.047 275 923.40 924.3 Mixture of F N / isomers NH 0 _j Co KN 0 N Mueo 954 HN YF 0.008 0.2 4.492 0.004 6 957.30 959.2 N'11" ,. . isomers N NH ,0 CS CI F, 955 NHNH 0 0.012 0.09 2.9 0.011 49.1 1000.40 1001.3 N N F F o0 o N 956 HN0. N \ 0015 0.26 11.4 0.011 93.988 923.40 924.3 O~ NH 9 N N 0N H 0 .04 isomers s NS 0 04NH N I.L Mixture of 957 FQ N -NH 0

-(

0 0.007 1.6 0.006 19.7 1000.40 1001.0 isomers 0 N NS H0- WO 2012/041014 PCT/CN2011/001638 405 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O Calc.M.S. Obs.M.S. Isomer 1a 1aY93H IaL31V lb 2b [M+H]* Designation 0 NH )"'OH F N N 958 FP N - 0.008 1 0.003 8.4 963.40 964.4 Mixture of F N NH 0 -( isomers O S O H H F N Mixture of 959 FN F 0.005 > 100 1 0.004 7.8 937.40 938.4 0 N N H 0 SNH 0 O NH 960 F N N N 0.010 12.19 22.82 0.007 > 100 957.30 958.3 Single isomer F '~-N ~ NH 0 O 0 -S Cl 0 O NH ""FO H NN 961 N - - N- CvN 0.003 4.03 0.492 0.004 43.878 957.30 958.3 Single isomer F "N ~ NH 0 1'.

o S 0 CI 0 0 O (N31 Ny.N Mixture of 962 N / NH 0 0 114.400 322 807.30 isomers NS CI 0 0 NH 0 H -J 96 N Mixture of 963 0 r F 0.492 54.5 0.158 110 862.40 NA isomers 0 WO 2012/041014 PCT/CN2011/001638 406 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 O NH 964 H s0 N40- 1.100 36 823.40 824.3 Single isomer NNN 0 O-4NH 965 N1100 40 802.40 803.4 Single isomer N N H0 N 0NO NH 966 N 1.000 89 52.7 0.760 84.7 805.30 807.3 Mixture of -' N N isomers C 0 Cl o NH )"kro H 967 N N 0.010 0.13 0.2 0.006 0.9 919.40 920.3 is of N H smr CS 0 F N0 968 .O N / NH >1 > 100 > 100 >1 > 100 843.30 NA Single isomer 0

CI

WO 2012/041014 PCT/CN2011/001638 407 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation F, 0 FN F 969 N 0 N NH >1 > 100 > 100 >1 > 100 843.30 NA Single isomer C1 ONH N N Mixture of 970 'I N N 0.016 0.3 > 100 0.009 0.315 921.30 921.2 reoof CI 'o N 971 HN O H 0.010 8 37 0.015 76.656 946.50 947.5 Single isomer 0 NNN N N HN IO H 972 N H 0- 0.467 > 100 < 100 0.146 < 100 846.40 847.4 Single isomer N

N-

WO 2012/041014 PCT/CN2011/001638 408 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 CaIc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 OANH -S r o H 973 ,.N 0.009 43.48 4.3 0.007 21.9 837.40 838.4 Single isomer N" NH 0 0 'OO NNH -S T-kO H 974 N N H 0- 0.057 109.9 20.563 0.013 110 837.40 838.4 Single isomer N - NH N 4 y'rO HN F N 975 O N O NH 0.020 3 0.008 50.2 1000.40 1001.4 Single isomer 0 NH ,0 N o NH y"'fO H N Mixture of 976N O NH 0 0.007 2.7 0.2 0.005 2.3 964.40 965.4 isomers -s 0 N NH o NH 977 N N I N 0.018 1 0.009 2.1 887.40 688.4 isomer NO Nismr WO 2012/041014 PCT/CN2011/001638 409 Cmpd # Structure EC50 EC50 EC50 EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+Hj Designation 0 yO H HN 978 FN N - N~ "F 923.40 NA Single isomer ON ~ NH H 97FN H 0.029 0.383 0.294 3.2 1041.30 1045.1 Single isomer N 0 NH O N- N' 980 F 0.2N NH0.3 0 1000.40 1002.1 Single isomer 0

S

I N 0) H HN F, N 981 F N 0 N.0(I JF 923.40 924.2 Single isomer ONNH OS O F 982 F N N 81.700 17.19 161.6 297.56 839.30 842.1 Single isomer 0 C -0 oz NH I WO 2012/041014 PCT/CN201 1/001638 410 Cm d#SrcueEC50 EC50 EC50 EC50 ECSO Cc.S Obs.M.S. Isomer la laY9HCaaLc.MlbS2 [M+H]' Designation 0 93N l N "F 0.026 0.49 8.1 0.001 67 966.40 966.0 Mxueo I isomers SN N N ', \ o 0x 94NCI . N 006 2.8 07 000 7 904 3. Mixture of 9861 1- - .0 08 02 001 62 964 4. isomers ~ N N 0 0 98 ).<~0 H Mixture of 0 .NH 0D 0.004 8 0. 0.004 1.9 91.0 92.45 om 0 C~jo 0 9886 ~ - N > 0 27.00 9 358.1221 0.20 156.10 802.40 8062 Mixture of - N NI/ isomers 0

NI

WO 2012/041014 PCT/CN2011/001638 411 EC50 EC50 EC50 EC50 EC50 Obs.M.S. Isomer Cmpd #t 1aY93H laL31V lb 2b [M+H]* Designation N 0 H 989 N 0 N 16.000 95.7794 77.0776 > 2 845.40 845.4 ixre of 0 N NN 990 N N 143.510 1000 544.35 23.770 456 834.40 834.4 mixture of 0 isomers NNH N00? N I 991 N O N 98.590 1000 412.46 21.370 374 860.40 860.4 iure of / N

NH

2 (NH N H 992 N N 349.000 > 5000 645.30 645.3 isomers -N (NH N Hi NN 993 0 3.000 > 5000 660.30 660.3 isomers / N

NH

2 0O WO HN 994974.7 M ixtu re of 994 N N \ / 1.950 10.44 1.95 0.200 2 974.50 9747 / 'N

NH

2 WO 2012/041014 PCT/CN2011/001638 412 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer ia 1aY93H 1aL31V lb 2b [M+H]* Designation 0 NZHN ON 995 0.010 >100 10 24.8 948.40 948.3 Mixture of N ~ N-isomers '0 NNH CNo0 HN< 996 N0.007 40 10 9.8 959.50 959.4 Mxueo N N H N Mixture of 997 139.157 3562.44 861.40 861.3 isomers 0N N NH, QNo 0 0~ N N N N Mixture of 999 N O N 325.000 > 5000 875.40 875.4 isomers NNH 99 .0 29 7028 >10 844 4. isomers 0 N N WO 2012/041014 PCT/CN2011/001638 413 Cmpd # Structure EC50 EC50 EC50 ECSO EC50 CaIc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 1000 ""< 0 rNO H k I \1 \MN Mixture of 1000 N 189.210 1230.32 828.40 828.3 N N 0 1001 N N 592.717 > 20000 981.50 981.4 isomers 0 b N O (N 0H H N NH Mixture of N 0.004 1.48 0.005 0.3 942.40 942.4 O HN 100N O N isomers 0 0 0l'p HN HN N N 1003 -N "/\N 0.007 2.76 0.5 0.005 11.9 1094.50 1094.5 Mixture of 0 isomers 0 00 0 N 'r WO 2012/041014 PCT/CN2011/001638 414 Cmpd # Structure EC50 ECSO EC5O EC5O EC50 Calc.M.S Obs.M.S. Isomer la 1aY93H iaL31V lb 2b [M+H] Designation SO, 0 N'HN 1005 0.003 7.89 0.3 0.004 1 958.50 958.5 Mireof 100 "N N 300>000834 5. isomers 0 jOr 'Ne 1006 230,000 > 20000 853.40 853.3of HNN 1007 N/ ~0.006 25.94 0.2 0.008 7.5 959.50 959.5 ismr 0 O-r / NN O C O HN N' Mixture of 100. N/0.004 52.2 0.3 0.006 16.869 967.50 967.5 reoof 0 WO 2012/041014 PCT/CN2011/001638 415 EC50 EC50 EC50 EC5O EC50 Obs .M.S. Isomer Cmpd # Structure 1a 1aY93H iaL31V lb 2b Calc.M.S. [M+H]* Designation N N H ~ NMitrf 1009 0 920.40 920.4 isoes

N

0 004 -0- NN ~ 10180 86. Mixture of 1011N9864.50 864.1 isomers S CN N N N O 0 CNH NH 1 0 N 22 1e 1012 -0 720.30 720.1 Mixture of isomers WO 2012/041014 PCT/CN2011/001638 416 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 1~ CN HN 0 N 1013 N 0 N 0.006 2.1 0.256 0.003 3.3 1034.50 1034.5 Mixture of 0 isomers ~06 10 NO N 0.003 2.3 0.2 0.002 2.2 978.40 978.4 Mxueo 1014 -N ismer 0r0r 0N 0 H HN H N N0 N N N Fe Mixture of 1016 F/225.000 1390 846.40 846.4 0 0 -0 C H H05 N 0.0 22 02 .0 . 105 105 Mixture of ,0N, Np 0.24 1.63 1 0.129 21.3 844.40 844.5 isomers >O 0 0- WO 2012/041014 PCT/CN2O1 1/001638 417 Cmp # trutur EC5O ECSO EC5 CO EC5O acMS Obs .M.S. Isomer lmd#Srutr a IaY93H Ial-31V lb 2b fM+H]J Designation 0 0 N o HNZ Mixture o 1019 N F' 0.0 0 .11 0.9 0.006 071 96040 980.5 isomers N N,\ 0 0 HH ON 1020 N.. 1 0.111 40.99 885 006 .129040 88054 Mixture of *~N N~ isomers 0 N0 0N 1021 1 \ - 2.45 50.9340 90. Mixture of N \ N isomers 0 10221.. - " I12 7.450 1287 785.40 90854 Mixture of - N \ / \ isomers 0 0 (/ 0 F.NH H 103N,. N T. Mixture of 102 N / 27830 700.75 83.40 83.4 isomers 0 0- WO 2012/041014 PCT/CN2011/001638 418 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation O'F N H HN 1024 N 1 0.003 25.32 0.2 0.003 4.1 942.40 942.5 Single isomer N N~ 0 ror O-F HN 1025 N 0.003 0.68 0.31 0.002 0.2 942.20 942.2 Single isomer .- O N 0 NH O N MxturHe o 1026 N N 16.000 443 893.40 893.5 Mixture of 0 isomers

NH

2 0 NH 7 H N N Mixture of 1027 _N O 693.30 693.3 isomers 0 N 0 N N NH 1028 N > 1 > 100 > 100 >1 > 100 843.40 843.5 Mure of . N y ON 0H HN_ 1029 N 0.004 3.17 1 0.008 3.8 1007.40 1007.2 reomof O NH 2 WO 2012/041014 PCT/CN2011/001638 419 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+Hf Designation

CN

4 0 NH O N 1030 N 0 >1 > 100 > 100 >1 > 100 842.40 842.5 iureof 0

CN'

0 0 NN 1032 N 1.000 >100 >100 100 0 >100 844.40 8445 N / isomers _0 0 C~f OZHN 1033 N 0 .006 2 0.2 0.005 0.7 960.40 960.5 Mi *reo H ,04 NF oo-8 3 >1 511 4.0 845Snl isomer

N

CN -O NH N \/ N 1021.350 N F0 >.4 1 0 1.066 >.150 844.40 844.45 igeioe 0 0 -H N 0 ,0 0 NH N N 1035 N- N i / N O024 81 006 615.15 844.40 844.4 Single isomer )0 040 WO 2012/041014 PCT/CN2011/001638 420 Cmpd # Structure EC50 EC5O EC50 EC50 EC50 Calc.M. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation

(N

4 0 0N N N Mitreo 1036 0 N0 N 219.000 628 874.40 874.5 xture of 0 0)~ rO cN HN N0N 1037 - 0.010 3.2 0.005 10.4 988.50 988.5 iomr 0 __ b

CN

0 HN 1038 N 0.024 0.4 0.009 0.2 984.50 984.5 N N HN 0 0 0 000

(N

4 0 1039 N 0.009 12.1 0.007 0.6 958.40 958.5 ixtur 0 P 0 1 0 r ~ 0 CN HNJ. 1040 N t 942.40 942.2 mrs SN N,\~ 0 P0/ WO 2012/041014 PCT/CN2011/001638 421 Cmpd # Structure EC5O EC5O EC5O EC50 EC5O Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+Hf Designation 0 HN H 4N 0 N N.. H .

1 -( Mxure of 1041 N >100 39 74 884.40 884.2 uremof 0 )0 -00 O N HN 0 N.. N Mixture of O HN 1043 N 0.022 72.2 0.28 994.40 994.3 iure of 0 N 00 O' ('O 10. N 0.024 3.5 <0.195 <0.195 974.50 974.2 Mixture of 0 0- WO 2012/041014 PCT/CN2011/001638 422 Cmpd # Structure EC50 EC5O EC5O ECSO EC5O Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 0 N y-O H HN (~jHHN~<Mixture of 1045 N H >1 >100 7.2 >100 914.40 914.4 N " " HO OH 0 F4N N 1046 N F 330.000 325 864.40 864.3 ure of 0 O-(

'N-

4 0 1047 319.000 527 780.40 780.3 CI ~\ /isomers 1048 N.. -0.030 0.43 0.03 0.13 1026.50 1026.6 Mxueo N N 4 smr 0 001 N yo N', I 0 N Mixture of 1049 N O 0.004 10.5 1.1 0.001 21 944.50 944.5 i r 0 WO 2012/041014 PCT/CN2O1 1/001638 423 Cmd#SrcueECSO EC50 EC5O EC50 EC50OacMS ObsM.S. Isomer lap Is aY93H Ial-31V lb 2b [M+H]* Designation 1050p C, 0 N 0.039 < 100 12 0.003 113 910.50 910.4 Mixture of 100 NH isomers N N O "N FNH CI, F 000 0. .0 29 905 8. Mixture of 1051 N- 0N3 0is90.01 19m8050 98. 0 NN 1052 ,>0Mixture of 1020.007 48 5.5 0.001 85 876.50 876.8 isomers HO N -/07 .-- 0 0ro

('N

0 H NZ., 1053M 0N Mixture of 105 0.005 37.5 1.1 0.001 19 896.40 896.0 isomers ' "N WO 2012/041014 PCT/CN2011/001638 424 Cmpd # Structure EC50 EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation N F N F- Mixture of 1054 o NH T N 0.001 2.1 0.8 0.000 50.6 910.50 910.5 isomers / \ NN 0 H F Mixture of 1055 0 z NH o 0 0.002 0.2 11 0.001 12 946.40 946.4 ismr 3? 1056 0 N O *..D 0.020 52.58 1.3 0.001 15 876.50 876.5 Single isomer 1057 o NH e N 0.004 5.11 2.5 0.002 81 876.50 876.5 Single isomer 0 HN ' 0o WO 2012/041014 PCT/CN2011/001638 425 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation N -< H I N. Mixture of 1058 0 oNH ND 0.001 10.73 0.771 0.001 10 862.50 862.5 isomers OHN( N OH N~ N 1059 0 NH IND 0.003 27 1 0.001 2 910.50 910.5 Single isomer F N N 1 1 N H .N 1060 0 = NH oTN-/ 0.002 1.5 0 0.001 2 910.50 910.5 Single isomer 0O O F N, N9o~ N 0 H 1061 0 = NH 0 N- > 0.2 0.8 25 0.001 15 946.40 946.5 Single isomer 0 - WO 2012/041014 PCT/CN2011/001638 426 Cmpd # Structure EC50 EC50 EC5O EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+HJ Designation F N F 0 N hl -F 1062 INNH o N- 0.003 0.19 7 0.001 45 946.40 946.5 Single isomer 1063 o NH 0 .1 03 48 .0 11 825 6. igeioe O HN 1063 0 H - N 0.010 90.3 4.85 0.001 11.1 862.50 862.5 Single isomer 0 HN 0 1064 0 _NH 0 1ND~ 0.000 67.2 1.32 0.000 10.9 862.50 8625 Single isomer CN-40 C I Mixture of 1065 N N 130.383 494.969 864.30 864.2 isomers

CI

WO 2012/041014 PCT/CN2011/001638 427 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 CalcM.S. Obs.M.S. Isomer 1a laY93H 1aL31V lb 2b [M+H]* Designation N O N 0 -0 N0 A- 10.r NOMixture of 1066 0> 10 >1000 > 1000 >2 423.891 889.40 889.5 /I >(isomers

NH

2 1 0 >10 >1000 >1000 >2 > 1000 796.40 796.4of 1067 'r NOisomers - :w 0 N~i 1068 A N > 10 415.367 > 1000 >2 > 1000 830.40 830.3 ixtur 0 CI 1069 NHN-- H 1.950 13.99 1.95 0.200 2 1003.50 1003.2 N N

NH

2

-N

0 OH) 1070 N. >2 4508 978 1179.3 873.40 873.4 ixtur / 'N NH I O 1071 A- 0 >2 4801 1681 1342.2 888.50 888.4 0 isomers / 'N

NNH

2 WO 2012/041014 PCT/CN2011/001638 428 Cmpd # Structure EC5O EC50 EC5O EC50 EC50 Cac.M.S. Obs .M.S. Isomer 1a 1aY93H iaL31V 1b 2b [M+H]* Designation 0o N N - N / ~Mixture of 1072 N 7.301 642.739 896.40 896.3 isomers -N \ /H H 0 I N \ 104N 06.00 777.3t85.40 54. 1073 0 NH -- HN 0.008 3 19 9.11 0.005 9 987.50 987.4 isomer / 'N "iomr oN N N~ - N. Mixture of 1074 N 267.000 777.33 854.40 854.3 isomers 0 0 0 H 1075 0 H HNNH 0.008 36.28 148.08 .003 > 5000 968.50 968.4 isomer 0 aO 0 O OH 107 1f~: Mixture of 1076 -N \ / 27.260 45.888 898.20 898.2 *~e N I 0 .2 0 0 Mixture of 1077 0. H0N- .2 200 2 >2 20 955.50 955.3 isomers OH I WO 2012/041014 PCT/CN2011/001638 429 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+HJ Designation oNd' -If~ Mixture of 1078 N 0 N 455.503 1819.04 848.40 848.3 ixtur CI N N 1079 156.944 831.55 911.40 911.4 N3 isomers 0 1 NO 1082 33.93 30.1 86.4 868.1 ture of 100 0 _.NH 0 1.0 0.061 > 200 10.5 0.009 14 953.50 953.4 Mxueo - 3 isomers NN' \ N N0 O N 0 1081 0 =NH NN- 0.010 87.6 4.6 0.015 2.1 981.50 981.2 Mixture of a - HN( isomers -N 0 0 0N 1083 N N 13.00 >011 86.40 868. Mixture of A- isomers 3? HN 0T'0 WO 2012/041014 PCT/CN2011/001638 430 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a IaY93H 1aL31V lb 2b [M+H] Designation 0 'ro 0 0 N 0 -O H N Mixture of 1084 HN 1.000 > 100 97 0.188 97.3 882.40 882.5 0 0? NH "\/ 1085 N . 1.000 > 100 > 100 0.159 >100 806.40 806.7 N 0 Nisomers HN 0 H N<K OZNH 01 N~ Mixture of 1086 H.-( H 0.074 > 100 45.5 0.010 22.24 882.40 882.7 H N, ~ i isomers NHN 1088 \ - O 0.417 >100 94 0.237 > 100 916.40 916. N isomers WO 2012/041014 PCT/CN2011/001638 431 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation N ' 1089 0 N 194.000 2153 897.40 897.4 Mixture of - HI T (isomers -- HN OOH 0 1090 0 NH 0 HN 0.028 5.99 2.9 0.011 9.181 940.50 940.5 Mixture of HNNTH isomers \)/ HO 0 0 H 1091 _ HN 549 952.50 952.5 Mixture of 1091 3 isomers O N ' N N 0 0 OC 1092 - HN 3 " 409.900 2306 967.50 967.5 Mxueo HN

N

N / N Ni N 0 0 HH' N A- 1- 74.178 1252 966.50 966.2 Mixture of 103- isomers O O 00 N N \ H' I N 0 N 0 N / oNH 0 ND- Mixture of 1094 -NHNH 0.013 21 2.7 0.013 2.2 1009.50 1009.5 isomers 0

,'

/-

WO 2012/041014 PCT/CN2011/001638 432 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a laY93H laL31V lb 2b [M+H)* Designation 1095HN O 0.041 > 100 2.8 0.016 2.1 1024.50 1024.5 Mxueo o9 N N N -o 00N. innnH 77 T12 Nln (AA Mixture of 1097 0 H 0.041 > 100 0.8 0.005 2.9 904.50 904.5 Mxueo CO q)-Oisomers N I / 1098H 0 .20 1688.0 8. Mixture of 1096HN "r .000 > 10 7.9 0127 > 10 104.5 104.5 isomers N N' (N ~0 Hl\ - / 4 Mixture of 1099N N N~$ T",( 3.i 8.0 934 somers 0 H N0 WO 2012/041014 PCT/CN2011/001638 433 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a iaY93H 1aL31V lb 2b [M+H] Designation (N NH 110 - "- 56 Mbdureof 1100 No0.010 19.2 1.56 0.006 3.51 956.50 956.5 0 0 O~r HN 1101 N O 0.002 1.26 7.719 0.001 50.2 881.40 882.4 Single isomer NH F N F -NNF 1102 0 NH 01N 0.002 1.95 19.68 0.002 > 100 873.40 874.4 Single isomer ~O HN F yO HH Fr1N HN 1103 F 0.007 17.1 1.542 0.006 23.4 899.40 900.4 Single isomer F NN H N N 0 I r- 6 CN NT N F 0 1104 NH HN 0.004 2.26 0.588 0.003 23.7 899.40 900.4 Single isomer N HN F N F- /N N ri N N' 0 1105 0 xNH 0 N~ 2 0.003 2.97 3.046 0.005 17 855.40 856.4 Single isomer 0HN , WO 2012/041014 PCT/CN2011/001638 434 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V ib 2b [M+H] Designation F N F N ~ 04~ 1106 0 .NH ) O N 0.002 1.95 0.637 0.001 31 855.40 856.4 Single isomer HN 0,_ OrOO HN 1107 F 0.005 1.95 1.591 0.001 18.3 923.50 924.5 Mixture of N ~L>F . .. isomers N 6, O N 0HH 1108 N F 0 N 0.003 1.95 1.521 0.001 19.3 923.50 924.5 Mixture of isomers - N N 0 HN 1109 F N O 'F 0.020 43 0.3 0.001 52 899.40 900.3 Single isomer NH ,0 OSyo H N F N Mixture of 1110 N I F NO 'F 0.001 1.1 0.9 0.001 9.4 909.40 910.4 NH ,0 WO 2012/041014 PCT/CN2011/001638 435 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S Obs .M.S. Isomer 1a 1aY93H 1aL31V ib 2b [M+H]* Designation HN 1111 F 0.002 0.8 1 0.001 9.7 963.50 964.7 40 -N , N isomers 0 NH ,0 N 1112 NHO HN F 0.003 4.108 0.001 8.5 883.40 884.4 Mxueo HHN O HN F 0N Mixture of 1113 N ~ /~~jjY 0.003 11 1.2 0.001 12 941.40 942.8 ismr F F FF 1114 0:NH N N 0.002 1.2 0.4 0.001 76 859.40 860.4 Single isomer 11H N 0.064 92.5 64 0.004 64 863.40 863.7 Single isomer N 0 WO 2012/041014 PCT/CN2011/001638 436 Cmpd # Structure EC50 EC50 EC5O EC50 EC50 Calc.M.S Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 00 N y-O N H HN 1116 0' N 0.010 0.8 2.4 0.020 20.9 863.40 863.7 Single isomer N FO HN 1117 N _..HF 0.023 19.7 4.8 0.001 7 891.40 892.7 Single isomer N N' 0 r O 6 N -HN 1118 N F 0.003 0.5 2 0.001 23 891.40 892.7 Single isomer NN 0 (N H HN 1119 N N 0.011 8.8 10 0.001 31 877.40 877.7 Single isomer cNJH HN 1120 N N 0.003 0.5 4.8 0.001 21 877.40 877.7 Single isomer SN F 0 WO 2012/041014 PCT/CN2011/001638 437 Cmpd # Structure EC5O EC5O EC50 EC5O EC5O Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H] Designation N 0O 1121 F 0.030 20.2 17.5 0.001 23 877.40 877.7 Single isomer / jH F~NXN N y F N H HN 1122 N 0 N 0.002 0.8 4.9 0.001 27 877.40 877.7 Single isomer 1124 0 NHO HN 0.002 6. 2.8 9 0.001 22 883.40 874.2 ioms N HN 1124 NHa 0.002 13.5 1 0.001 6 847.40 8484.2 smr 00 H N Mitreo WO 2012/041014 PCT/CN2011/001638 438 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S- Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation - N ~H Mitreo 1126 H ON- 0.018 46.74 26.5 0.001 142 873.50 874.5 isomers HN OlO Oro F NN 1127 FNN-< - 0.003 12 12 0.001 49 881.40 882.5 Single isomer NH~ F - N N 0=NH K O ,0 IH , M 0Mixture of 1128 N - 0.002 0.8 0 0.001 9 917.40 918.5 isomers -N , N 0 F N 1129 o<NH ( ND 0.003 3 2 0.002 14 869.40 870.3 Single isomer O0o F N N HN 1130 o'NH (IN) 0.001 2 1 0.001 37 869.40 870.3 Single isomer HN 0~ WO 2012/041014 PCT/CN2011/001638 439 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H iaL31V 1b 2b [M+H]* Designation 1131 0 .NH o N 0.003 29 2 0.002 5 847.40 848.4 Single isomer HN N N H I N F 0 W" 1132 0 NH a ND 0.003 3 1 0.002 3 847.40 848.4 Single isomer HN o0 F N N 14 N >40 1133 NH 0 N:> 0.004 27 1 0.002 17 883.40 884.4 Single isomer HN

O

0 o F N F N 04 N 1134 0 NH N-/ 0.001 1 1 0.001 17 883.40 884.4 Single isomer N HN 0 O 0 1135 N H N 0.003 17 0 0.001 26 917.40 918.4 Single isomer N N" N 11367 0.002 19. 4.2 0.001 11. 917.40 918.4 Single isomer -N N C 0 01 14 HN N 0 o WO 2012/041014 PCT/CN2011/001638 440 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation -- rH 1139 N 10.010 18. 1.16 0.00 1. 957.50 958.5 itueo N Osmr -N

N

0 0 o2o 12H N 1.10 1 1.12 0.020 .1 958.50 958.5 Sigle o N N isomers 0 i0 (NO HHN N - o .. 0.2 1. 95.5 95.5 iom r 0 1140 N N 1.100 2 1.1 0.020 1.1 921.50 922.5 Mixture of I N Nisomers 0 N F I N 0-0 1142 0= NH OIN..>F 1.10 2 11. 0.020 45.1 869.40 870.5 Single isomer 0 N H0 01'0 WO 2012/041014 PCT/CN2011/001638 441 Cmpd # Structure EC50 EC5O EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation N O 1143 F N F 0.010 > 100 7.7 0.020 10.2 963.50 964.5 Single isomer N O 0 1144 NF 0.010 2 1.1 0.020 26.5 963.50 964.5 Single isomer ro -N 0' F N 1145 NH H 0.019 5.764 2.511 0.054 457.395 897.40 898.4 isomer N N' 9 0,. F HN N Mixture of 1146 =N N 0.019 .764 2.41 0.070 318.375 895.40 896.4 isomers

('N

0 HN~ 1147 N N~ 0.019 1.9555 1.9555 0.002 1.9555 1033.50 1034.4 Miomerso 00 O d F)LNXH HN 1148 N 0.019 1.9555 5.39248 0.002 67.2647 981.40 982.4 Mixture of C isomers N N 0 _j i- WO 2012/041014 PCT/CN2011/001638 442 Cmpd # Structure EC50 EC50 EC50 EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation NN oo - Mixture of 1149 N 0 N 124.000 640 845.40 846.3 isomers N 04 N 0 Co M N N Mixture of 1150 N 298.500 > 5000 883.40 884.3 isomers N N 1151 N 53.000 248 781.40 782.3 xture of FN isomers H0 1152 N N F 488.700 764 873.40 874.3 isomers O 0 (NH N isomers N (NH NHH N H M e 1154 N0 N9.300 > 5000 683.30 684.3 iomerso N \

N

WO 2012/041014 PCT/CN2011/001638 443 Cmpd # Structure EC50 EC5O EC5O EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V ib 2b [M+H]* Designation N O .,H H N 1155 0.030 16.71 3.4 0.023 11.75 959.40 960.4 N~N isomers 0 N 00 (NH N N 0O F NXH HN ~44O 1161 N006 267 . .1 44 975 9. Mixture of S0.007 0.27 6.6 0004 32 987.50 988.5 isomers N H yO 1180.032 15.22 1 0.021 4.92 989.50 990.5 0 N F HN N. N 000 Mixture of 1159 N F 0.005 0.2 4.6 0.005 20.1 1012.40 1013.3 0 WO 2012/041014 PCT/CN2011/001638 444 EC50 EC50 EC50 EC50 EC50 Obs .M.S. Isomer Cmpd # Structure 1a iaY93H iaL31V lb 2b Calc.M.S. [M+H]* Designation F N0 F ~yLC>FMixture of 1160 NN F 922.301 724.584 897.40 898.3 0 0l 0 Fd N N F 1161N- N Mixture of 1161 O 8.766 5099 973.40 974.3 \ 0 F HN NMF Mixture of 1162 N 0 N 0.006 9.111 9.111 0.005 14.818 1087.50 1088.3 isomers /

\

Hj 0,.

(N

0 HN 1163 N 0.004 58.732 9.111 0.004 9.111 957.50 958.5 Single isomer 0 N 0ro (NHN 1164 N 0.006 9.111 9.111 0.005 9.111 957.50 958.5 Single isomer 0 WO 2012/041014 PCT/CN2011/001638 445 Cmpd # Structure EC50 EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H]* Designation _j O J 0 ro F 0 HN N - 1165 N F 0.005 0.13 889.65 0.003 99.34 1023.50 1024.4 Mixture of N N isomers 0 -0 F H HN N.0 N N FMixture of 1166 N O N 0.005 0.09 9.11 0.003 25.34 1069.50 1070.4 so 0 O -r HN. 1167 N O F 0.015 0.2 685.23 0.002 > 5000 969.40 970.3 Single isomer N N,\~ 0 CI F HN N F0 m. I I F 1168 N O N 0.005 0.19 0.9 0.006 8.6 1087.50 1088.4 Single isomer 0 J 0~6 SHN 1169 N F 0.049 0.64 9 0.002 49.8 993.40 994.5 Single isomer 0 WO 2012/041014 PCT/CN2011/001638 446 Cmpd Structure EC5O EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation F HN 1170 F<N 0F -0.002 0.2 2.3 0.003 25.3 993.40 9945 Sigesor N F 0 11710 0.015 0.67 5.5 0.003 2513 1069.50 1070.4 Single isomer N N F<N F N 1171 N O "N 0.025 0.76 10.5 0.003 51. 1069.50 1070.4 Single isomer 0 0 o 6 FNH N F N.- N - F 1173 N 0 N 0002 0.19 0.6 0.003 11.5 1087.50 1086.4 Single isomer 0 \ WO 2012/041014 PCT/CN2011/001638 447 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation FF H F F H H 1174 N NF 0.016 0.38 6.5 0.004 61 1029.40 1030.3 Single isomer O F 0 F HN 1175 -. NN H N 0.022 0.25 6.9 0.002 36.5 1047.40 1048.3 Single isomer 0 F IFH F N HN $N HN 1177 N O "F 0.00 0. 23 0.002 20 935.40 936.3 isomer O-NH 0

NHN

WO 2012/041014 PCT/CN2011/001638 448 Cmpd # Structure EC50 EC50 EC5O EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1L3 1b 2b [M+H]* Designation O6o HN> F H4'N. 1179 F N NO F 0.002 0.1 4 0.002 27.9 935.40 936.1 Single isomer N NH NH 0 o NH 0r O-F F_ HN F N4N F ." F 1180 0 H N N 0.002 5.4 0.004 39.9 1012.40 1013.0 Single isomer NH 0 HN F N O0 F F 1182 O N N 0.003 2.71 0.005 20.8 1012.40 1013.9 Single isomer 0 O NH ,0 N O-r HN , \ F N F 0N 1182 F' N N 0.003 1.245 0.004 27.4 1042.40 1043.0 Single isomer 0 NH N SNN 0). NHN F N0 WO 2012/041014 PCT/CN2011/001638 449 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer ia 1aY93H 1aL31V lb 2b [M+H] Designation y-o H N

FI

0 ~ Mixture of 1184 F N O 1 F 0.011 0.2 28.29 0.009 53 899.40 900.5 isomers o NH 0 F N F 1N 1185 0 oNH 0N1 N 0.045 0.59 39 0.005 61.2 901.40 902.4 Single isomer HN HI IF F N F 1186 0 ,, NH o N..F 0.008 0.19 22 0.005 61 901.40 902.4 Single isomer F HN H N IF N O F NH 1187 0"( 0.164 3.5 16 0.043 > 100 1252.50 1253.8 Single isomer ,0 S ___ H HH 6: H 0, IF N FF 1188 o NH ON 0.014 0.2 49 0.005 41 887.40 888.4 Single isomer HN 01o WO 2012/041014 PCT/CN2011/001638 450 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H]* Designation F N F N N 1189 0 eNH N 0.006 0.2 28 0.004 82 887.40 888.4 Single isomer O O HN ( F, N 0N 1190 FN O "F 0.220 >100 71 0.006 74.4 899.40 900.4 Single isomer O NH ,0 O ' HN/. 1191 F N O "F 0.008 0.3 17.9 0.005 56 899.40 900.4 Single isomer 0 NH ,0 O H N 119 N F 0j " 1192 F N N N 0.007 2.365 0.005 48 1011.40 1012.4 Single isomer 0 O NH O) HN,. 1193 N O "F 0.037 0.9 11.514 0.004 60 1011.40 1012.4 Singleisomer O NH 0 O 1194 H COH 533.000 943 803.30 804.4 Mixture of 1194 N "' N ismers )=H - I -- I isoNr

A-

WO 2012/041014 PCT/CN2011/001638 451 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a iaY93H laL31V lb 2b [M+H]* Designation O H N HO, N CI Mixture of 1195 H O 'OH 0.135 1 68.9 0.010 > 100 917.40 918.4 O NH HO N 1196 O=NH 0 N O 0.150 8.2 95 >100 883.40 884.4 ismr HN T 0 O O FF HI CI\" 1 H N N 608.000 >1000 867.30 868.3 Mixture of 116 0 0~. 8.4 8. isomers 0 H N ,0 118 F N O "' F 0.058 0.75 4.7 95 981.40 982.2 smr NH ,)0 o'yO H N 1199 FNN O H F 0.130 0.92 2.9 85 961.43 962.4 Mixture of N H : \ ~N isomers NH 0 H WO 2012/041014 PCT/CN2011/001638 452 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+HJ] Designation H N HO H \., 1200 F N O" 2.500 25 432 498 963.40 964.2 HI ~N \ \N isomers 0 NH F N O cSyO \ HN Mixture of 1201 0.320 4.3 4.7 37 1023.50 1024.6 N \C " isomers O NH OOro HN N 1202 HO:N O OH 0.360 32 66 >1000 913.40 914.4 Single isomer N NH 0 NH -N 1203 0.002 98 2 0.000 6.5 881.40 881.7 Single isomer N NH 0 O-r CN H H 1204H 0.011 26.4 3.8 0.001 36 845.40 845.8 Single isomer N N N -N WO 2012/041014 PCT/CN2011/001638 453 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 0 YO HN 1205 0.002 0.65 0.195 0.001 12 829.40 830.2 Single isomer 04 0 N ~ N 0=( N 1206 H HN0 0.001 1.16 0.222 0.001 9 817.40 818.2 Single isomer 0 <NH H ,0 06 OArO 1207 NN F 0.007 51 8 0.001 48 911.40 913.2 Single isomer HN N 9E HNN 0 \/ / 1209 >ONH 0 ND 0.002 0.4 2. 0.000 98 853.40 854.2 Single isomer NHe N2 P HN

\-O

WO 2012/041014 PCT/CN2011/001638 454 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Cac.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 F 1210 0 N-/F > 0.2 46.31 24 0.098 374 696.30 698.2 Single isomer HN' 0 0 1211 NH H N 1.100 2 1.1 0.020 5 893.40 894.4 Mixture of O=( 0 isomers p - HN O0 0 N HN_~. 1212 1.100 2 1.1 0.020 44.2 905.40 906.5 N31 2 1 0 3 849Nisomers NH 0-( F N 1213 N N 1.100 2 1.1 0.020 3.1 893.40 894.4 Single isomer 0 NH F N I IN 1214 \-?' -NO H H.) 0.010 134 123.5 0.760 982.1 697.30 697.2 Single isomer NH H F\ N 1215 ) .O N- 0 0 HN 0 0.010 8.48 1.1 0.020 82.3 853.40 854.3 Single isomer 0 NH ,0 WO 2012/041014 PCT/CN2011/001638 455 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O Calc.M.S. Obs.M.S- Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 0 ONH c M I N -, Mixture of 1216 0.019 2.16 1.95 0.002 32 937.40 938.2 HN 0 o NH ON NH .r'M I - \N- ,Mxueo 1218 o N H 0.019 8.242 1.95 0.003 76.7234 937.40 939.4 NH0 isomers NHN 1219 o N 0 0.019 50.879 3.065 0.002 58 937.40 938.4 Mxueo N N 120 >(~ 0 H o 0.019 1.9555 1.9555 0.002 36.2983 835.40 836.2 Single isomer O' N N. 12219 \. )O I - \ N '~ 0 0.019 1.9 1.9555 0.002 58 911.40 912.2 Mixure of 0 HNOf isomers F N 9 0- WO 2012/041014 PCT/CN2011/001638 456 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer ia 1aY93H 1aL31V lb 2b [M+H] Designation HN N 1222 N / \ 4.725 352.297 50.7592 0.301 > 1000 877.40 878.0 Single isomer N N N 1223 - 502.760 1000 1000 > 100 1000 691.40 692.3 Single isomer o N o- ,- HN 1224 (N 4 0 180.440 1000 1000 15.920 510 1002.50 1004.0 Single isomer o N N N N 0 ol N Cl- Nf~2 N HN 1225 0 645.63 1000 > 100 1000 835.30 836.3 HN N H0 N 0 1226 \/129.300 > 5000 635.20 636.2 Misomrso HN

'

WO 2012/041014 PCT/CN2011/001638 457 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+Hf Designation HN-N N 1227 \NN-'N >2 > 5000 3844 4709 991.40 992.0 Single isomer N H I NH C O NH N_ O 0 HN N HNN 1228 N >2 > 5000 4660 > 5000 1059.40 1061.0 Single isomer ON 0 1 N O H N C Mxu 1229 0 N 8.600 1254 792.30 793.2 Mixture of 0 . . * isomers HN N Ht 6-O ci - M N HN 1230 0 O >2 1827 404 948.6 951.30 952.1 Mixture of ,-F isomers HN N HN HIN N 1231 \NH - 501.958 5099 702.30 703.3 Single isomer - N H N N -0 N --0 N WO 2012/041014 PCT/CN2011/001638 458 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H] Designation 'O N HN _N O H N 1232 N O 0.025 >10 9.11 0.020 9.11 1173.60 1174.5 Single isomer N O H N N O NH 0 0 N0 N N , ~jMixture of 1233 0 0.059 29.393 9.111 0.029 9.111 1173.60 1175.4 isomers Ns NH 0

CN

0 1234 N> 2 381.08 156.186 0.075 211.543 824.40 825.3 Mueo o- 0 1 0 N HN 'A NMixture of 1235 N 0.270 155.87 65.774 0.025 81.879 824.40 825.4 somers N , N 0 WO 2012/041014 PCT/CN2011/001638 459 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H] Designation So c N NN 1236 H N 0.037 49 11 0.019 28 1058.50 1060.3 Single isomer N NN' N (N N NH 2 HN 1237 i' o~j N0.203 13 83 0.008 219 897.40 898.3 Single isomer N _ M ID N N HN 1238 o NJ ~ > 1 > 50 76.7 0.036 987.75 748.40 749.3 Single isomer HN 0 1239 0 N 0.112 >50 >5000 0.004 184.09 766.40 767.2 Single isomer HN CNO

W

WO 2012/041014 PCT/CN2011/001638 460 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N HI 1240 e o 0.606 > 50 > 5000 0.039 745.66 762.40 763.2 Single isomer HN olo 0 H N 0 1241 NH - 0.071 > 50 > 5000 0.014 325.09 763.30 764.2 Single isomer HN NN \_O i1244 H2NN 0 ND 0.366 > 50 > 5000 0.02514357.091 747.40 74.3 Single isomer NHN' o N NN qL0.320 > 50 9.11 0.021 154.83 8.40 80.2 1243 OA -N 0 f 1 N> isomers HN' 0~ 0N

O

N NN

\-O

WO 2012/041014 PCT/CN2011/001638 461 Cmpd # Structure EC50 EC5O EC5O ECSO EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 0 -N _O 1245 H N O ND 0.266 > 50 > 5000 0.019 614.1 777.40 778.3 Single isomer O HN O 0 N I/ HN 1247 H ND 0.023 > 50 911 0.004 103.13 853.40 854.3 0 N . . . isomers HN O0 N ' 1 N4 - / 1247 C a N:./ >2 > 50 612.51 0.012 217.17 853.40 854.4 iomerso HNismr OA1O NI NN \-O HK 1248 0 NO. > 1 > 50 9.11 0.053 281.25 754.30 755.3 Single isomer HN

,,:O

WO 2012/041014 PCT/CN2011/001638 462 Cmpd # Structure EC50 EC50 EC50 EC5 EC50 Calc.M.S. Obs.M.S. Isomer la 1aY93H 1aL31V lb 2b [M+H]* Designation 0 0 N -H (No -NH N( N 1249 N 0.045 > 200 43.2 0.004 57.81 1078.50 1060.4 Single isomer 0 N N -N HN 0)0 HN NH HN 1250 0 0 2.633 > 20000 > 200 0.192 > 200 937.40 938.5 Single isomer N O N \O 0 NHH NO NHN NN \ N o NH ,0 7- 0 HN O 1252 N HN. 0.019 > 200 17.8 0.004 > 200 1010.50 1011.5 Singleisomer NN N - O N -H -0H 1253 \_O 3.974 359.7 > 200 >2 > 200 758.40 759.3 Single isomer HN 0'k0 WO 2012/041014 PCT/CN2011/001638 463 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation Of0H2N NH O 1254 C 0 4.765 1234.4 > 200 0.177 > 200 978.50 979.4 Single isomer

NH

2 O N HN 1255 N \ - 0.043 46.8 200 0.022 > 200 910.50 911.2 Single isomer 0 H \N N NH O

H

2 N Oo HN,. N O 1256 N .. N- 0.100 > 200 > 200 0.014 > 200 910.50 911.1 Single isomer O H N IN NH O O HN O HN HNZJ\ 1257 N 0 0.020 > 200 200 0.092 > 200 1020.50 1023.0 Single isomer O N N \-O I NH 0 0 NH HN N 7 HN N HN~t 1258 H 0.041 > 200 56.12 0.028 12.5 1093.50 1094.9 Single isomer O N\O N O NH ,0 O) HN O NH O HNZj 1259 N 0 0.064 > 200 20 0.005 12.7 1025.50 1026.0 Single isomer N 0~ N O N N NH

O

WO 2012/041014 PCT/CN2011/001638 464 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O Calc.M.S. Obs .M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H] Designation 0)= HN NH O HN_ 1260 N 0.119 5.7 > 200 0.013 > 200 1067.50 1068.1 Single isomer N 0 N H N N ,0 N o NN 1261 N 0 N /N 0.030 82 8 0.008 991.50 992.5 Single isomer NH 0 N O HN olo 0 N 0~ F N

-

1262 - N O 0.300 59 >100 0.030 1027.50 1028.4 Single isomer NH 0 N HN o o 90 00 N "N 1263 NN 0.130 >100 >100 0.005 1025.50 1026.5 Single isomer o N\ 04= 1N Y'N o NH 0 N O HN' NHN ,00 HN 'yO H NJ 1264 NN 0.020 74 20 0.007 1067.50 1069.3 Single isomer N 0 NH 'O N N H I HN N ON

NH

O H " N O N 6F O NH

\O

WO 2012/041014 PCT/CN2011/001638 465 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+Hr Designation

H

2 N O HN O N H NH N N0 -N 1266 N H\ /N 0.458 24 37.72 0.103 47.239 962.50 963.5 Single isomer N H O >-o N \ N 0 HNH ,0 H2 N 0 0 N / 1267 F I 1 N 0.079 82 8 0.013 1.875 1010.50 1011.0 Single isomer 0.NH NDa HN

H

2 N NH 0 -N F N0 N 1268 LNN I F 1.000 >100 >100 0.423 >100 998.40 999.0 Single isomer > 30-aN \ "N o NH ,0 O jH 1269 N OH I N N 0.093 3.57 19.5 0.006 107 1046.50 1047.6 Single isomer \o H '-0N H_ N) NH~ 0 N~ 0 -r , N HNJ 1270 C~NI N, -<-~ 0.039 60.65 18 0.010 34.6 911.40 912.4 Single isomer 0 NH ~0 WO 2012/041014 PCT/CN2011/001638 466 Cmpd # Structure EC50 EC5O EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation HNJ 1271 -NN . - NJ.Ik 0.094 50.63 25.7 0.009 58.827 957.50 958.5 Single isomer N N N -0 o NH ,0 HNIJ 1272 FN'-'N O "-F 0.005 1.826 0.004 5.138 993.40 994.4 Single isomer O H N\ \ N NH ,0 HN, 1273 0.002 3 0.789 0.003 27.939 847.40 849.3 Single isomer N 'O 0 N N NH 0,0 o !~ HN N HNZJ 1274 N - ON 0.056 72 7.5 0.013 29.2 1104.60 1105.4 Single isomer o N N \-N NH ,0 0 0ro 11 HNZIX 1275 HV.N HN 0.044 99 0.9 0.013 15.1 1024.50 1026.4 Single isomer >40 -N~ 0=NH 0 WO 2012/041014 PCT/CN2011/001638 467 Cmpd # Structure EC50 EC5O EC50 EC50 EC5O Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H] Designation NH HN N HN N 0Z 1276 N >1 > 100 > 100 >1 > 100 1004.50 1005.4 Single isomer N N N O NH \-O0 OiNH H H0 HN 1277 N --- o >1 > 100 > 100 0.597 > 100 1136.50 1138.5 Single isomer o NH ,0 HN N HN 1278 N > 100 >100 0.023 1161.60 1163.0 Single isomer > O N \O N o <NH 0 &HO 1279 HN 0.052 34.3 15.603 0.026 84 1056.50 1057.3 Single isomer N - 0 \NN '-0 NH 0 HN Q N", Mixture of 1280 0.011 21.3 4.007 0.020 110 869.40 671.4 8 NH F N N 1D :N I Mixture of 1281 N0N H/ N O 0.026 2.3 134 0.009 >100 875.40 877.5 isomers NH 0 WO 2012/041014 PCT/CN2011/001638 468 Cmpd # Structure EC50 EC5O EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation F,. Mixture of N 1282 '- N >1 > 100 > 100 0.177 > 100 806.40 807.4 isomers o(N H F N N 1283 HN 0 HO >1 >100 >100 853.40 854.3 Single isomer 0.. *0 F N i 1284 N / 0 0.020 1.2 10 863.40 864.4 Mixureof NH (-0 HN .0 isomers o,. ,00 0 o HN F\NIN Mixture of 1285 0.010 1.9 1.3 857.40 858.4 0 -N N NH O=( 0? 0NH N N 128 N Mixture of 1286 N 0.002 1.2 0.2 923.40 924.5 ixturs N Oisomers ~0 O N IF NN'9, HN F N 1287 o N Mixture of NH8 -- O 0 24.000 110 217 884.40 884.7 ismr ,0NHiom r 4- WO 2012/041014 PCT/CN2011/001638 469 Cmpd # Structure EC50 EC50 EC5O EC5O EC5O Calc..S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N 1288 O 0 N 3.000 202 125 866.40 866.8 isers NH F Mixture of 1290 HN OH .010 08 03 788.40 788.8 isomers ,0 F NN 1291 0 N \N 0 >H 0.0223 0.14 941.40 924.67 iueo N 12, N-\ F 806.4 826 Mixture of 11N isomers N H C' - N -M 029 /\1 \.0F N0001 .4 914 2 Mixture of 129 0 N 80.4 80. isomers 0.< 0-6 0 N I w "I WO 2012/041014 PCT/CN2011/001638 470 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer ia 1aY93H 1aL31V lb 2b [M+H]* Designation

N~

0

I

1294 (0 H N 78840 7888 Mixture of 1294'6 N 78840 78.8 isomers HN 0)0 HN N O!Z 47Y-y \N 7 F Mixture of 1295 N 884.40 884.8 ixturs N-N isomers ,0 F N\ 1296 O N O N 902.40 902.6 Mixture of ot NH isomers ,)0 N N, 1297 o4 0 N 0 N 884.40 884.8 isomers NH ismr ,)0 yo HN 1298 F 902.40 902.8 N0 -N ~ N .isomers )0 1299 F N>- 706.30 706.8 ixtur HN ,1o WO 2012/041014 PCT/CN20111/001638 471 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 Cac.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation N 1300 688.40 688.8 Mixture of 0 68.40 88.8 somers HN F N 1301 >o-i -N N H 0.080 0.14 0.19 11 983.40 983.6 00 N 0 1 NH isomers N I N~~\i~Q)Mxueo 1302 H 0060 1 0.02 0.3 965.40 965.6 mixture of NH Oly ~ 0 NHismr N '0 01 N.6 N. . Mixture of 1303 O0.060 1.8 2.3 1.3 887.40 887.8 isomers 0'0 WO 2012/041014 PCT/CN2011/001638 472 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation

HO

O

N

0 N N C aN Mixture of 1304 N O F 0.020 0.18 0.7 2.7 905.40 905.7 isomers 0 Nsmr HN 0 o

N

0 0 S 0 C 0N Mixture of 1305 N 0.020 1 0.2 1.7 887.40 887.8 ismr 1305 N')- isomers HN 0lo 0 O NH N N NIitueo 1306 3NN 0.010 0.4 2.1 13 863.40 863.8 isomers (0N HN 0o0 0 0NH N N 1307 ( N - 0010 7 1.6 11 84540 8458 Mixture of H I N i~/~-,,somers (0 N> HN 0 0)F0 HNN F H~Y Mixture of 1308 NF 0.004 20 1.11 0.003 855.95 857.0 isomers oN N NH ,0 WO 2012/041014 PCT/CN2011/001638 473 Cmpd Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation F N HN 1309 F 0.002 4.03 0.1997 0.001 24.3 936.012 937.0 Mixture of isomers F NN H N e0 1310~ F N .0 .6 009 001 1.3 9602 970 Mxueo F - 0O N_ HN _j 0 Al- 0~ Mixture of 1310 N F N 0.001 0.46 0.019 0.001 12.3 936.012 937.0 isomers F 1soer 0 (NHN 0,0 Mixture of 1311 N' F 0.001 0.2 0.6 0.001 9 918.022 919.0 F -isomers 0 0 (^N 0H N 1312 N F 0N 0.004 5.4 0.7 0.001 42 918.022 919.0 Mixture of NF isomers d-N N 0

N

0 HN>I p 0 Mixture of 1313 N-- F MI NQ*. 0.016 7.6 3.8 0.001 10 910.042 911.0 ismr - N , N 0 WO 2012/041014 PCT/CN2011/001638 474 Cmpd # Structure EC5O EC5O EC5O EC5O EC5O Calc.M.S. Obs.M.S. Isomer 1a IaY93H iaL31V lb 2b [M+H]* Designation NO rN , HN0r 1314 F 0.001 0.3 1.1 0.001 31 910.042 911.0 Mixture of N- rk isomers -. N N 0 Or C~oHN.. Mixture of 1315 N F 0.009 7.7 3 0.001 6 924.069 925.1 isomers N O HN eN Mi0re o 1316 N F 0.002 0.3 1 0.001 30 924.069 925.1 isomers N NO 60 F N N ~N M N 0 H Mixture of 1317 N o NNN 0.020 5 100 .4 0.002 100.2 932.218 933.2 ixtur isomers 9O 0 4 0 Mxtreo N N 0 WO 2012/041014 PCT/CN2011/001638 475 EC50 EC50 EC50 EC50 EC50 Obs .MS. Isomer Cmpd # Structure 1a laY93H 1aL31V lb 2b Cac.M.S.[M+H] Designation N FOr F HN 1319 N N 0.010 2 1.1 0.020 26.1 924.069 925.1 Mixture of I - M somers O NH C 0 0 O'NH 1320 N 0.018 105 10 12 890.136 891.1 ixturme N 0 isomers HN O0 0 NH N N 1321 N 0.014 208 10 72.7 892.152 893.2 ure of N N- N > isomers -O H N HN F N O NH O 0.019 1 3.6 0.003 89 1000.48 1001.5 isomero 0 0 O'r F HN 132 N F - N. k F 0.005 0.47 9.6 0.004 9.7 970.457 971.5 isomers N C Ie

CII

WO 2012/041014 PCT/CN2011/001638 476 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaLC31V b 2b [M+H]* Designation N F 1324 N F 0.009 0.43 10.2 0.007 26.3 1016.1 1017.1 isomers a F N mHN N F 1325 N F 0.003 0.19 1.1 0.003 8.1 1021.12 1022.1 isomers a JOf~ F N mHN CO FN{HH HN - F F Mixture of 1327 1 N N I N 0.007 2.51 9.11 0.002 17.64 1042.14 1043.1 isomers NH Ord N 0 N H F H N\F 132 N N 0.007 0.36 88.43 0.006 180.29 1046.13 1047.1 iure of a

N

WO 2012/041014 PCT/CN2011/001638 477 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 00 F HN ( 1329 N F 0 F 0.003 0.09 70.44 0.002 > 5000 970.457 971.5 Mixture of ~N N 0 CI o r IF HHN ill) ,Mixture of 1330 N N N 0.006 0.19 1 0.004 18.3 1068.2 1069.2 xtur

S

O)ro HN I NM.. Mixture of 1331 F - N N 0.005 0.8 0.004 10.04 1021.12 1022.1 NH 0 ismr HN 1332 N H N O FN 0.037 0.3 7 0.002 51.1 976.505 977.5 ismr 04 0 H NH F N NlI lhlJ-F Mixture of 1333 p N N F 942.06 943.1 0HN 00

HN

1334 F,.N O ">F 1010.52 1011.5 Mixture of 13 O0 N' N isomers NH ,0 -O WO 2012/041014 PCT/CN20111/001638 478 Cmpd # Structure EC5O EC5O EC50 EC50 EC50 Calc.M.S Obs .M.S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H] Designation 6Ayo 1335 F W~cF 0.017 >100 18.1 0.008 1.248 976.077 977.1 Mxueo 0 oNHl HN 133 '.C N ,i. Mixture of 1336 N 0.032 15.67 5.4 0.008 2.38 1051.15 1052.2 isomers 0 OzNH N0 F /N M'-0 1337 >-NH o NN 0.010 0.5 19 0.007 167 859913 860.9 Single isomer NHH ,0

O

HN Hi N HN -F 1338 0 0 (NH T'N_....! 0.09 5 1.7 0.007 267 821.941 822.9 Single isomer 01 NN" 1339 0 0 H No 0.040 52.8 4.88 0.017 110 843.951 845.0 Single isomer NN 0

O

WO 2012/041014 PCT/CN2011/001638 479 Cmpd # Structure ECSO EC5O ECSO EC50 ECSO Calc.M.S. Obs .M.S. Isomer 1a 1aY93H iaL31V lb 2b [M+H]* Designation NHN 0 o 0 HN F, N6F9Mixture of 1341' >..)O N N/ 106.1 1065.2 smr 0 HN 1344 0 N .1 10. 19. 0.0 10 87 9 805.2 Sig re oe 00 0 1343 0 o 0.0264109.3 60.8 0.015 110 7840.99 841.9 ixtre sofe HN N N o 0 W-o NO 1344 0 0 0.012 109.9 19.15 0.009 110 857.978 8509 Single isomer - ~ N 0O-0 H 'N 1345 03\ 0.0564109.9 10.98 0.015 110 7890.8997 790.9 Sigl e ome

NH

WO 2012/041014 PCT/CN2011/001638 480 Cmd #Structure EC5O EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a IaY93H 1aL31V lb 2b [M+H]* Designation 1346 o N0>2 109.9 48.617 0.126 110 851.971 853.0 13470oN isomers HN

-I

1348 NH N .0 00 61 000 5.2 8191 829 igeioe 13479 ' N O~ Ho ND >.61 > 100 9101 0.238 > 100 8513.05 85024.1 r o H IN i 1348 N O N 0.01 > 100 > 100 0.010 > 100 851.941 820.9 Single isomer HN 9Oo OH H HN ooxo 138 0 H ONr 0.051 > 100 6.1 0.01055.210 805.8981 806.9 Single isomer HN 91 0 N 1N N H 'N N 0 -N 14> 1351 0o O 0.01 78. 40.1 0.006 54. 8609.986 87410Snl isomer

OHN

WO 2012/041014 PCT/CN2011/001638 481 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N 1 5 \O H 1352 N-N o 0.017 > 100 21.3 0.023 25.9 845.926 846.9 Single isomer kNk HN O HNO N H N 0 N 1353 0 NH a N. ~ 0.004 13.96 1.16 0.006 53.67 926.17 927.2 ixturso

OO

0 H N 1354 F 0 51 > 200 31.6 0.010 > 200 919.997 921.0 Single isomer 0.0 o-~ 1355 >2 > 200 200 >2 > 200 805.892 806.9 Single isomer N 0 N

NN

4 0 1356 N >2 > 200 > 200 >2 > 200 769.911 770.9 Single isomer N 0 IFi N H 135 r~a / -' ~0.178 12.01 71.7 0.004 > 200 868.005 869.0 Mxueo Or-NH N _ 0 isomer 0N~ 00 0 0 Mixture of 1358 H 0.20 1.14 1.54 0.16 80.00 922.04 923.30 isomers F 4 0 N 0- WO 2012/041014 PCT/CN2011/001638 482 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Cac.M.S. Obs.M.S. Isomer ia 1aY93H 1aL31V lb 2b [M+H] Designation O NH 1359 0 r-yoN O- 0.12 1.10 0.29 0.07 6.35 922.04 923.30 Mixture of F O isomers - ,N 0 -j H FN 130 F -N N H 9.92 413.00 465.00 0.81 955.00 891.00 891.70 Mxueo

O

O H N N ~rHN ~ ,..,~Mixture of 1361 N eoHN o3.01 269.00 159.00 0.05 475.00 855.02 855.50 isomers o NH C N N O N N 1362 (N jN 0.03 10.40 0.03 119.00 840.39 841.30 Single isomer 00 N 0 NH Cl N O HNMixture of 00 1364 H19.0 962.17 963.30 Single isomer HHo

HN

1365 N N0O 7 914.04 915.50 Single isomer H' N N- <

HN

WO 2012/041014 PCT/CN2011/001638 483 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+Hf Designation /0--< 1366 N/I0.00981 0.567 1.38 0.00765 32.2 966.16 967.0 Single isomer N 0 cFN NH 1367 t~/I0.00734 23.7 0.397 0.00568 4.85 984.03 985.0 Single isomer 1368 NH 0.00574 15.3 0.297 0.0105 10.8 930.06 931.0 Single isomer 0_ 1369 0 1449 0.044 0.706 7.05 0.0124 63.3 1018.16 1019.0 Single isomer 0 0 0 F NI F N' N 00 1370 W 133 t005 491.2 0.2 0.0195 14.3 10.15 915.0 Single isomer 0 ~O 0 ,O N O1 1371 -N I 0 0. 0282 16.4 0.358 0.00711 7 1038.24 1039.0 isomer 0 0 O0 WO 2012/041014 PCT/CN2011/001638 484 Cmpd # Structure EC5O EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a iaY93H iaL31V lb 2b [M+H]* Designation 0 N 1372 F F 0.0146 2.35 0.162 0.00674 0.888 1008.12 1009.0 0 0O N O -I 1373i/i/i~ ~ T<&Mixture of 1373 N N 0.0041 24.9 0.14 0.00852 2.65 948.05 949.0 isomers 0 F F H 0 0 N NN 17.9 15 944.06 9 Mixture of 1374 N N 0.00352 1.12 0.0433 0.00799 0.587 9isomers 0 00 NN H 0 . ~ N ~ ) Mixture of 137 N N~ N) N 0.00699 80.9 0.324 10.2 946.06 947.0 ismr )0 00 1377 FMixture of 137 N 0.007395 0.2 0.004 0.0057 0.48 944.09 945.0 ismr 0 WO 2012/041014 PCT/CN2011/001638 485 Cmpd # Structure EC5O EC5O EC50 EC50 EC50 Cac.M.S. Obs.M.S. Isomer 1a iaY93H 1aL31V lb 2b [M+H]* Designation

N

9 H F H N 137 / -, Mixture of 1378 N 0.00577 2.87 0.0649 0.00497 3.3 946.06 947.0 0 ? o O * H F 1379 N I N N 0.00754 25.3 0.211 0.00462 8.25 946.06 947.0 d o isomers 0 H 0 N H F O o (N FN N. Mixture of 1380 N N N 0.00556 0.798 0.0467 0.00628 0.874 948.05 949.0 0 0 0 N/ 0 N 1381T - 4 1 N M ixtre of 1381 N 0.0283 44.6 0.519 0.00798 11 94805 949.0 isomers 0 0 0O N H H 1382 0.00634 2.27 0.106 0.00699 0.147 930.06 931.0 e o 0 F4 00 N 0 H " - I-t-TI Mixture of 1383 N N N 0.0205 56.4 0.419 0.0139 61.8 930.06 931.0 ers

F

0 WO 2012/041014 PCT/CN2011/001638 486 EC5O EC50 EC5O EC50 EC50 Obs.M.S. Isomer Cmpd #a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 1384 0 0112 2.85 0.0125 0.00672 6.99 980.19 981.0 mixture of ,o 0-- 0 ,o-o 0 -/ J-N O I I - \ -) NMixture of 1386 ':>N ' 0.00878 2.21 0.341 0.00578 19.1 972.14 973.0 mr 0 isomers C ,0 NF 1387 N 0 0.0175 183 0.371 0.0104 7.62 972.14 973.0 Mixture of o isomers 0 0 N N 0 N 0 5 1Mixture of 1388 0.0117 10 0.294 0.0107 20.3 1018.16 1019.0 isomers 0 o 0--'00 WO 2012/041014 PCT/CN2011/001638 487 Cmpd # Structure EC5O ECSO EC60 EC50 EC50 CalcM.S. Obs.M.S. Isomer 1a IaY93H iaL31V lb 2b [M+H]* Designation IN' Mixture of 1389 0.114 0.502 3.47 0.0139 66.6 1018.16 1019.0 isomers 0-O 0 00

F-

N O N F F Mixture of 1390 o 0.00529 0.0155 1.85 0.00728 59.1 1078.21 1079.2 isomers 1391o 00236 19. o.27 00056 163 178.2 109.2 isomers 0- 00 N O F N N Mixture of 1391 0 0.0236 19.2 0.217 0.00556 16.3 1078.21 1079.2 isomers 0-\-o~ N 000 0 0N 0=11 clY~ F NC 1392 N0 IN0.00813 0.894 0.0845 0.00329 5.01 1042.23 1043.0 sMixuesf

'"

0 -0 N0 1393 N0 N56.8 252 457 3.62 934 10D42.23 1043.0 sMixueof ismr 0

D,-

WO 2012/041014 PCT/CN2011/001638 488 Cmpd # Structure EC5O EC50 EC5O EC5O EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation \ N--N M 1394 958.i. ~11 959.0 0 0 N 139s~ FN 8.1 8. O L 1395 NF 9 F Mixture of 139N F182.1983.0 isomers 0 N O 00 FFF 13960~' N 'FMixture of 1398 N 108.20 1069.2 O 1 isomers (10

S

'"0 N 0 0NI NN 139 N "N061918. Mixture of 1 3 8 0 6 .2 0 6 . is o m e rs N' H 0 WO 2012/041014 PCT/CN2011/001638 489 EC50 EC50 EC5O EC5O EC50 Obs .M.S. Isomer Cmpd # Structure ia 1aY93H 1aL31V lb 2b alc.M.S. [M+H]* Designation 0-0 <- 0 *-O N H F 1399 0 N N 980.02 981.0 N isomers 0 F 0N N H O N' N 1400 1000.17 1001.0 e isomers 0 0 F0-/ 1020 1030 Mitr 0N Ni N ON F F 0 O N O O_ N I Mixture of 1403 0 1024.24 1025.4 isomers H 0 WO 2012/041014 PCT/CN2011/001638 490 Cmpd # Structure EC50 EC50 EC50 EC50 EC5O Calc.M.S. Obs.M.S. Isomer la 1aY93H 1aL31V lb 2b [M+H]* Designation 0 N F 1404 N 0 F 1054.15 1055.0 Mixture of 140 isomers O-- 0 0 F'KCKj F HN NF' N F Mixtreof 1405 01054 15 1055.0 isomers 0 00 '" 0/ 0 NF N F0 FF10.1 109 Mixture of 1406 N F 1008.12 1009.0 isomers 0- 0 0<0 0 N Mixture of 1407 'N 0 N F1008.12 1009.0 isomers 0-- 0 0H N Y~ Mixture of 1408 N 0 N F 990.13 991.2 isomers 0 WO 2012/041014 PCT/CN2011/001638 491 Cmpd # Structure EC5O EC50 EC50 EC5O EC50 Cac.M.S. Obs.M.S. Isomer 1a iaY93H iaL31V lb 2b [M+H}* Designation N 0 N H N 1409 F I F 990.13 991.0 (7 O isomers 0 N 0 N / NMixture of 1410 0 1024.24 1025.4 isomers CHN 11 N 0 N Mixture of 1411 01024.24 1025.3 isomers 00 N 141 03 os 31* 0 0 O N NN N Mixture of 1411 -O 024.4 105.3 isomers 0O 0 1413 N 0824 13. Mixture of 0 ,0 WO 2012/041014 PCT/CN2011/001638 492 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N H N O FH 141 F'I - N<~132 Mixture of N O F Mixture of 141 N 108.24 1039.3 isomers 0 H0N N 0/ 0 F N N' N \ ~N F 1415 N0 1086.19 1087.2 Mixture of isomers 0 1 _ N ' N H' 1416 N-01086.19 1087.2 Mixture of isomers 0 1 N 1417 \0 O 0 gN- 930.06 931.0 Mxueo 0 / NH isomers /0 F.N H ' 0~ - - N F ~ k-y N 1418 N 0 1068.20 1069.3 Mixture of isomers 0

\-

WO 2012/041014 PCT/CN2011/001638 493 EC50 EC50 EC5D EC50 EC50 Obs.M.S. Isomer Cmpd #t 1aY93H 1aL31V lb 2b [M+Hf Designation 0 H 0 .y 0 NN F1 N F Mixture of 1419 01068.20 1069.3 isomers O d 0... 0 O N O- 1420 F 984.03 985.0 Mixture of N isomers 0 OF 142 O 9006 93. OONN H 0 N N \ Mixture of 1421 F NeF 984.03 985.0 0 -F 0 F W*( NN. ~ Mixture of 1422 0-i) 0 0 ND~ 930.06 931.2 isomers C NH O o0 0 N 0 0 ) 9810 93.2 Mixture of 144 N / N 'F 98.0 932 somers N 0 5- WO 2012/041014 PCT/CN2011/001638 494 EC50 EC50 EC50 EC5O EC50 Obs .M.S. Isomer Cmpd # Structure 1a 1aY93H 1aL31V lb 2b alc.M.S. [M+H]* Designation -~O N O F N 1425 N' 19812 99 Mixture of 1425 978.12 979.3 N isomers O

SO

NN 1426 N'1 ~ 3 F 1002.02 1003.0 Mxueo F H F F N 1427 N 948.05 949.2 a 0N~"isomers N N O F- 0 Mixture of 1429 948.05 949.rs 0 SOF F y00 NO 1430 942.07 943.0 Mxueo H -O 0 FF 148NI Mixture of 143 NN F 10194.07 943.0 isomers 0 0O WO 2012/041014 PCT/CN2011/001638 495 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation IF N~~ ixueo 1431 N 942.07 943.0 sor 0 0 0 N HN F 1432 N 978.12 979.2 isomers 0 0' 0 NIF 1 Mixture of 1433 N 980.02 981.0 0 OF F 0 N O N' I F N Mixture of 1434 N 980.02 981.0 OF IF N O H N N ~N 145o 00.7 10. Mixture of 1001d10. isomers 0 WO 2012/041014 PCT/CN2011/001638 496 Cmpd # Structure EC50 EC5O EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H laL31V lb 2b [M+H] Designation "00 0' 0 - YJN I \N NN 1436 1000.17 1001.0 ire of 0 0 F-C N F 1437 \/1036.16 1037.2 ismr 0 0 0 NH O H 1438 0 Mixture of FF N Hj O\ N ~ Ni 91.7 93 Mixture of 1 12.07 13.0 isomers - O ,A-T0=<? WO 2012/041014 PCT/CN2011/001638 497 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N I4 1441 9-NO 912.07 913.0 Mixture of 0NH isomers -o o N 1442 H N N 0.03 25.59 0.53 32.02 914.04 915.50 Single isomer N O N4 00 1443 N O 0.10 100.00 0.33 0.04 0.20 946.22 946.50 Single isomer -I H10 N I N 00 1444 N N 821.94 822.40 Single isomer 0 1445 N942.19 943.30 Single isomer ON 00 00 H N O 1446 0 978.13 979.30 Single isomer N040 1447 4 N 958.23 959.30 Single isomer HI- N N 0~o WO 2012/041014 PCT/CN2011/001638 498 Cmpd # Structure EC5O EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 0 N N 1448 0/1040.19 1041.40 M of N O N N 1449 F I N O 1038.29 1040.30 Mixture of L N 1 isomers N sF 140 'K...02 136 3.o326.54 894.02 895.70 ismr F 0 1451 o 110 456 004 970 89402 89540 Mixture of 1452 N 936.06 936.40 -0 H F 1453 '.or4N ~ iI 936.06 936.40 ismr 4 o- Mixture of 1454 NH 1 70.9 953 isomers WO 2012/041014 PCT/CN2011/001638 499 Cmpd # Structure EC5O EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation HO N NH 1455 HN N-1 F 2.22 1.32 76.29 162.61 938.03 938.30 N- . (NO isomers O 0 0 NO+ OK 1457 0.6 2 Mixture of 146 HN OH 496.26 999.00 999.00 999.00 733.88 734.20 1457 N N( OH 0-06 4.20 37.15 0.03 260.00 847.98 849.20 somers ~N / NH o H O 1458 965.20 965.40 Mixture of 1458 N 7NH isomers N-I N N O 0 N rN NMixture of 1461 FF975.10 975.20 1459 L/N '.. 97.6 982 isomers N /1 ~NH N-1 "is N / -..-- Mixture of N409726 973 isomers A0 -0 K NN N F J: H--C\, I Nr Mixture of 146 N / NH 975.10 975.20 ismr WO 2012/041014 PCT/CN2011/001638 500 Cmpd # Structure ECSO EC50 EC5O EC50 EC5O Calc.M.S. Obs. M S. Isomer 1a 1aY93H 1aL31V 1b 2b [M+H]* Designation O0 N o -C 0 N N N NN S SONH 143~N NA/0 Mixture of 1463 o NH N 0.02 18.45 11.59 60.56 848.02 849.07 isomers (0 H N a 9 NH NH 0 ' Mixture of 1464 o NHN 0.03 94.59 25.51 50.60 834.00 835.05 o ONNH 1465 O NN\.5 2.5 15 4.2 1.0 890 0 0N O NH 16 O N N 0.05 26.35 91.54 142.92 818.00 819.05 Mixtureof 1465 oK -' IN~ isomers 0 H NH N6 0N0. 218 Mixture of 1466 \ N 0.77 277.13 123.04 220.76 818.00 819.05 N (0 0 N H NH 0 1 N46N N ' Mixture of 147 ,~0.10 261.86 103.64 486.23 789.99 791.04 ismr 0 "0 NH N -N - Mixture of 1468 //\ri N 0.21 227.84 121.41 138.16 837.04 838.09 ismr N soer WO 2012/041014 PCT/CN2011/001638 501 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation HN 0 1469 0 N O NH 0 05 30.90 6.04 0.03 7.10 907.05 908.10 Mixture of o N isomers H H 1470 H 0 SNH 0.06 17.50 8.05 0.03 19.15 921.08 922.13 Mixture of o NH' N 0r' isomers 0 H /00 0 NH 1471 N 3.33 414.70 116.89 0.02 378.28 880.11 881.16 N N 00 N ANH 1472 N N -N 1.29 455.20 93.80 0.03 233.68 881.10 882.15 2 ~ i ~ %, / N isomers /N -O H 0 0 "PO NH 1473 N 888.05 889.10 0 < 0 ~ isomers 0 0 NH 1474 N N NO H 878.10 879.15 177. isomers N 0~ 0 /N5 676.83 677.88 Mxueo N N~-( 1 >isomers

H

WO 2012/041014 PCT/CN2011/001638 502 EC5O EC50 EC50 EC50 EC50 Obs .M.S. Isomer Cmpd # Structure ia IaY93H 1aL31V lb 2b Calc.M.S. [M+H]* Designation N N 17 N1 8 Mixture of 1476 CN HN 89611 897.16 isomers o N 1478 896.11 897.16 K-O 0 \/N80 896.11 897.16 Mxueo 14H. isomers SNN NN N I tO NH( N 1\ N0 9.1 971 Mixture of 1479 - H(\ - 1.1 202 isomers O-C ~ )N -- NJ I jo 0o0 NH 1480 N Ni0'") 896.11 897.16 Mixture of X~ N isomers 00 14814 I J N 244.15 984.80 999.00 125.00 549.30 763.90 764.95 Single isomer N/ N a 1482 0 yo N--\. 342.79 999.00 924.54 251.00 999.00 795.99 797.04 Single isomer oN 0 00 0-H 1483 N 878.01 879.06 Single isomer WO 2012/041014 PCT/CN2011/001638 503 EC50 EC50 EC50 EC50 EC50 Obs .M.S. Isomer Cmpd # Structure 1a 1aY93H 1aL31V lb 2b Cac.M.S.[M+H Designation 0 1484 N 962.08 963.13 Single isomer N H H N N NH -N N N 148 N NH O N) 0.05 13.40 2.73 23.00 945.50 946.50 Single isomer 0 HN O~O NH ~ -Mixture of 1487 N0 580.14 581.19 isomers O NN 0 1488 ,o U 0.06 0.15 0.03 1.90 1062.15 1063.20 ismr N 1490 H~ .230 3820 84Mixture of '~ N / ?"N0 .03 0.0 0.9 5210 78.0 97.13 isomers 00 H NN c C Mixture of 140r .~\7 N00 000 36 0.08448 855 isomers WO 2012/041014 PCT/CN2011/001638 504 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation 0 N N 1491 HCN 0.023 1.0 978.56 Mixture of 1491 Z' /p0o . isomers 0 -0 N 1492 . 13.6 0.10 . 0.19 100627 1007.32 Mixture of 1494 N615.72 616.77 F-&N0.1 isomers NN 00 1495 N O Y .02 48.10 1.03 0.01 123 930.06 931.11of N~' isomers 0 H F4O N] II \ iNHMixture of 1496 1014.13 1015.18 m F O WO 2012/041014 PCT/CN2011/001638 505 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.M.S Isomer 1a 1aY93H iaL31V 1b 2b [M+H]* Designation 00 1498 N o- 0 958.11 959.16 Mxueo o N N .H N -o Mixture of 1499 H '860.03 861.08 Xueo 1497N N 9980 991 isomers 0 i 1500 944.11 945.16 Mixture of 0 8 5 83 8isomers F ~o N NN 1502 S---H No 730310 80.40 83.30 Single isomer 0F O N M 1501 0 1986.88 50820 802.30 835.30 Single isomer 0- WO 2012/041014 PCT/CN2011/001638 506 Cmpd # Structure EC50 EC50 EC5O EC5O EC50 Calc.M.S Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation N O F -0 1503 NN N O 0.01 0.70 009 0.01 64.62 991.50 992.20 Single isomer O4 H -F 0 0 10 N o 1504 NF N0.18 17.70 1.23 0.03 70.00 973.40 974.10 Single isomer 150 N 0 0 1505 H - 0.11 37.20 6.26 0.01 161.00 991.40 992.20 Single isomer 0 0 nO H F 1506 N 0.01 1.40 0.35 0.01 24.00 959.40 960.20 Single isomer O 'F 0 0 ONO O0 O IL N O cl "r-N Mixture of 1507 7 N 0.03 0.08 0.03 10.00 1065.40 1066.40 F -O H F 00 *2 0 N F H1 N , N 1508 0.01 0.30 0.01 14.00 1001.42 1002.60 Single isomer 0- WO 2012/041014 PCT/CN2011/001638 507 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs.MS. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation N- H - N N O N1509/ -( Mixture of 1509 N 33.91 69.60 0.89 239.23 784.40 785.70 07 d 1, 0~~ H"'F isomers 0 F H 1511 7 N N 28.39 482.03 447.42 78440 784.80of 151N F .}l isomers o H O0 1512 F4 61.44 12.325.74 229.13 80.0 803.40 Mxueo 0 0 O -N 1513 N NH 0 .09 0.04 0.72 983.40 983.60 0d isomers O' O N F -N N 15142 N 0 F 6.041 2.6 25.11 213 1014102.3 8 0.0 ismr 0 '~oO F N NO 151 N~ Mitreo , 0.01 0.06 0.05 13.2 1001.40 1002.0 0-0 00 O H F NO 1514 N HMixture of H N ~ '-. 0.01 0.6 0.05 13.0 1001.40 1001.80 isomers 0~0 WO 2012/041014 PCT/CN2011/001638 508 Cmpd # Structure EC5O EC50 EC5O EC50 EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H]* Designation H. 0 0 N N N - Mixture of 1516 0.02 0.23 0.30 10.11 941.42 941.70 0-0 0 0 ,. ~~~ ~~ ~ ~~ F N 0.0 .5 03 56 5.1 996 N N F 1517 F--4 I ! 0.01 0.45 0.36 15.67 959.41 959.60 6< H isomers 0-0 ~O~1~O 1519 0 01 13 0.654 94.2 4.7 r 0 N N -N NO0 - N NHMixture of 1518 -- 0.06 1.17 0.17 234.90 959.41 960.60 ise 1521N 005 9.9 5.4 0.1 2.30 895.4 85.8 Siglisomer 0o H 0' 0 F N Mixture of 1519 L-NI0.01 1.31 0.06 543 941.42 941.70 H N H/N>&~ isomers 0-0 0O . 1520 -Mixture of N N 0.01 0.10 0.15 21.00 959.41 959.60 ismr 0~0 1521 INH 0.05 99.90 5.40 0.01 20.30 895.44 895.80 Single isomer ;0 0 NN F -4 1522 ID- 1 0.06 31.30 0.71 0.05 119.60 941.42 941.60 Single isomer <O H 0- WO 2012/041014 PCT/CN2011/001638 509 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs M-S. Isomer la 1aY93H laL31V lb 2b [M+Hf Designation 00 0 N, NN F0 ~N N H _N 1523 N - H 0.01 3.00 0.17 0.01 3.70 941.42 941.60 Single isomer 0 H 0' NN O 1524 N N4J.H N 0.17 128.00 0.01 146.00 858.42 859.40 Single isomer H N, OY N 0 0 1525 0.20 237.00 58.00 0.01 134.00 935.42 937.10 Single isomer 1526 N- 4.0 1301.0 120 8.0 854 F '-0 0+ 0 0 1526 F 14.60 123.00 0.10 122.00 884.40 885.40 Mixture of F 1528H isome.5rs1 .0 4.4 415 0 0 + o 1527 FN N 1'.0 37.00 0.40 337.00 902.39 903.40 Mixture of o H isomers 0-0 0 04 01N N 0 - 1528 - /NXI' 0.01 0.05 0.01 1.30 941.42 941.50 Mitro 0 H 0-0 ;0 0 4A N52 N N 0.07 47.00 0.04 640 941.42 942.50 Mxueo 0 H isomers 0- WO 2012/041014 PCT/CN2011/001638 510 Cmpd # Structure EC5O EC50 EC50 EC5O EC50 Calc.M.S. Obs.M.S. Isomer 1a 1aY93H iaL31V 1b 2b [M+HJ Designation 0 N N O N 1530 - Mixture of 153 0.02 0.90 0.01 0.40 983.43 983.60 usof isomeN F 0 F 0' 0 0 NHN H0 F 0 12 N 7 7 Mixture of 2H N 884.40 885.40 isomers F 0~ 0~0 153 H 1\,_ Mixture of 153 N 802.34 804.20 isomers F OS 0 N 0; O N ONN 1536 N 784.35 785.40 F H isomers 0 0~ .C -4Mixture of 1535 F W 802.34 803.30 ismr 0~0 0, 0 -N N N F - 7 N Mixture of 1536 N~1 H\/ H~~ 959.41 960.40 isomers 0d H 0l WO 2012/041014 PCT/CN2011/001638 511 Cmpd # Structure EC50 EC50 EC50 EC50 EC50 Calc.M.S. Obs .M.S. Isomer 1a 1aY93H 1aL31V lb 2b [M+H] Designation 0 ~0 N INO N NHMixture of 1537 F N 959.41 960.30 F O H O' 0 01 OYN% 0 ~rO H 1538 F 1N H 1001.42 1002.30 F H - Nisomers F O H 0 OH N F 1539 N O 0.01 0.08 0.01 93.00 983.40 984.40 ure of R FF 1540 F N 0-H975.40 976.40 Mixture of o H isomers F o NF N~~ NH0 1541 0.01 154.00 2.00 107.00 939.50 941.00 Single isomer 14 ' 0.07 0.06 0.08 0.13 1016.00 1018.00 Mxueo 1542,(0. isomers WO 2012/041014 PCT/CN2011/001638 512 The present invention is not to be limited by the specific embodiments disclosed in the examples that are intended as illustrations of a few aspects of the invention and any embodiments that are functionally equivalent are within the scope of this invention. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art and are intended to fall within the scope of the appended claims. A number of references have been cited herein, the entire disclosures of which are incorporated herein by reference.

Claims (15)

1. A compound having the formula: A 15 I K W > V f r \ / (I) or a pharmaceutically acceptable salt thereof, wherein: A and A' are each independently a 5 or 6-membered monocyclic heterocycloalkyl, wherein said 5 or 6-membered monocyclic heterocycloalkyl group can be optionally fused to an aryl group; and wherein said 5 or 6-membered monocyclic heterocycloalkyl group can be optionally and independently substituted on one or more ring carbon atoms with R , such that any two R' groups on the same ring, together with the carbon atoms to which they are attached, can join to form a fused, bridged or spirocyclic 3 to 6-membered cycloalkyl group or a fused, bridged or spirocyclic 4 to 6 membered heterocycloalkyl group, wherein said 5 or 6-membered monocyclic heterocycloalkyl contains from 1 to 2 ring heteroatoms, each independently selected from N(R 4 ), S, 0 and Si(R 16)2; G is selected from -C(R 3 )2-0-, -C(R 3 ) 2 -N(R)-, -C(O)-O-, -C(O)-N(R 5 )-, -C(O)-C(R) 2 -, -C(R 3 ) 2 -C(O)-, -C(=NR 5 )-N(R 5 )-, -C(R 3 ) 2 -SO 2 -, -S0 2 -C(R 3 ) 2 -, SO 2 N(R 5 )-, -C(R 3 ) 2 -C(R 3 ) 2 -, -C(R 14 )=C(R 1 4 )- and -C(R1 4 )=N-; U is selected from N and C(R2); V and V' are each independently selected from N and C(R' 5 ); W and W' are each independently selected from N and C(R'); X and X' are each independently selected from N and C(R 1 1 ); Y and Y' are each independently selected from N and C(R' 0 ); R' is selected from H, C 1 -C 6 alkyl, 3 to 6-membered cycloalkyl, halo, -OH, -O-(CI-C 6 alkyl), CI-C 6 haloalkyl and -O-(CI-C 6 haloalkyl); WO 2012/041014 PCT/CN2011/001638 514 each occurrence of R 2 is independently selected from H, C 1 -C 6 alkyl, 3 to 6 membered cycloalkyl, -O-(C 1 -C 6 alkyl), CI-C 6 haloalkyl -)-(C 1 -C 6 haloalkyl); halo, OH, aryl, and heteroaryl; each occurrence of R 3 is independently selected from H, C 1 -C 6 alkyl, C 1 C 6 haloalkyl, -(C 1 -C 6 alkylene)-O-(CI-C 6 alkyl), -(C 1 -C 6 alkylene)-O-(3 to 6 membered cycloalkyl), 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, 5 or 6 membered monocyclic heteroaryl, 9 or 10-membered bicyclic heteroaryl and benzyl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group, said 9 or I 0-membered bicyclic heteroaryl group or the phenyl moiety of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, -O-(C 1 -C 6 alkyl), -O(C 1 -C 6 haloalkyl), halo, (C 1 -C 6 alkylene)-O-(Ci-C 6 alkyl) and -CN and wherein two R3 groups attached to the same carbon atom, together with the common carbon atom to which they are attached, can join to form a carbonyl group, a 3 to 6-membered spirocyclic cycloalkyl group or a 3 to 6-membered spirocyclic heterocycloalkyl group; each occurrence of R 4 is independently selected from -[C(R 7 )2]qN(R) 2 , C(O)R", -C(O)-[C(R 7 ) 2 ]qN(R) 2 , -C(O)-[C(R 7 ) 2 ]q-R", -C(O)-[C(R) 2 ]qN(R 6 )C(O)-R", C(O)[C(R 7 ) 2 ]qN(R 6 )SO2-R", -C(O)-[C(R 7 ) 2 ]qN(R)C(O)O-R", -C(O)-[C(R 7 ) 2 ]qC(O)0 R" and -alkylene-N(R 6 )-[C(R 7 ) 2 ]q-N(R)-C(O)O-R"; each occurrence of R 5 is independently selected from H, Ci-C 6 alkyl, -(C 1 C 6 alkylene)-O-(C 1 -C 6 alkyl), 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl and benzyl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group or the phenyl moiety of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, -O-(C 1 -C 6 alkyl), O-(C 1 -C 6 haloalkyl), halo, -(C 1 -C 6 alkylene)-O-(Ci-C 6 alkyl) and -CN; each occurrence of R6 is independently selected from H, C 1 -C 6 alkyl, 3 to

6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl, wherein said 3 to 6-membered cycloalkyl group, said 4 to 6 membered heterocycloalkyl group, said aryl group and said 5 or 6-membered monocyclic heteroaryl group can be optionally and independently substituted with up to two R 8 WO 2012/041014 PCT/CN2011/001638 515 groups, and wherein two R6 groups that are attached to the same nitrogen atom, together with the common nitrogen atom to which they are attached, can join to form a 4 to 6 membered heterocycloalkyl group; each occurrence of R 7 is independently selected from H, CI-C 6 alkyl, C 1 C 6 haloalkyl, -alkylene-O-(C-C 6 alkyl), 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl, wherein said 3 to 6 membered cycloalkyl group, said 4 to 6-membered heterocycloalkyl group, said aryl group and said 5 or 6-membered monocyclic heteroaryl group can be optionally substituted with up to three R 8 groups; each occurrence of R 8 is independently selected from H, CI-C 6 alkyl, halo, -C-C 6 haloalkyl, C-C 6 hydroxyalkyl, -OH, -C(O)NH-(C-C 6 alkyl), -C(O)N(C-C 6 alkyl) 2 , -O-(CI-C 6 alkyl), -NH 2 , -NH(C-C 6 alkyl), -N(C-C 6 alkyl) 2 and -NHC(O)-(C-C 6 alkyl); each occurrence of R 9 is independently selected from H, C-C 6 alkyl, CI-C 6 haloalkyl, 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl; each occurrence of R1 0 is independently selected from H, CI-C 6 alkyl, C C 6 haloalkyl, halo, -OH, -O-(C I-C 6 alkyl) and -CN; each occurrence of R" is independently selected from H, Cr-C 6 alkyl, C 1 C 6 haloalkyl, C-C 6 hydroxyalkyl, 3 to 6-membered cycloalkyl and 4 to 6-membered heterocycloalkyl; each occurrence of RL is independently selected from C-C 6 alkyl, CI-C 6 haloalkyl, 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl; each occurrence of R 13 is independently selected from H, halo, C-C 6 alkyl, CI-C 6 haloalkyl, 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, -CN, OR 9 , -N(R 9 ) 2 , -C(O)R 12 , -C(O)OR 9 , -C(O)N(R 9 ) 2 , -NHC(O)R 12 , -NHC(O)NHR 9 , NHC(O)OR 9 , -OC(O)R , -SR 9 and -S(O) 2 R , wherein two R' groups together with the carbon atom(s) to which they are attached, can optionally join to form a 3 to 6-membered cycloalkyl group or 4 to 6-membered heterocycloalkyl group; WO 2012/041014 PCT/CN2011/001638 516 each occurrence of R 1 4 is independently selected from H, halo, C 1 -C 6 alkyl, -(C 1 -C 6 alkylene)-O-(CI-C 6 alkyl), 3 to 6-membered cycloalkyl, C 1 -C 6 haloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl and benzyl, wherein said aryl group, said 5 or 6 membered monocyclic heteroaryl group or the phenyl moiety of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, CI-C 6 alkyl, CI-C 6 haloalkyl, -O-(C 1 -C 6 alkyl), -(C 1 -C 6 alkylene)-O-(CI-C 6 alkyl) and -O-(C 1 -C 6 haloalkyl); each occurrence of R 15 is independently selected from H, CI-C 6 alkyl, 3 to 6-membered cycloalkyl, halo, -OH, -O-(Ci-C 6 alkyl), C 1 -C 6 haloalkyl and -O-(C 1 -C 6 haloalkyl); each occurrence of R1 6 is independently selected from H, halo, CI-C 6 alkyl and 3 to 6-membered cycloalkyl, wherein two R1 6 groups that are attached to a common silicon atom can join to form a -(CH 2 ) 4 - or a -(CH 2 ) 5 - group; and each occurrence of q is independently an integer ranging from 0 to 4, provided that the compound of formula (I) is other than: WO 2012/041014 PCT/CN2O1 1/001638 517 c~ 3 CH 0- CH 3 H , 0 /OH 3 '. N L~ 0HN \ -NH 0H N 4NH N N 0 H NHN N/N N \/ \k N N_ ~ N CHjCH 3 HN CH 3 CH 3 CH 3 CNZ OH 3 \0 CH3 0 \/O 0 HN CH, CH 3 - NH 6~ NH NH /-NH 0 N F C3 N N . OH3NH N N I/ NH CH 3 H /N N *'__/>' N N \H, ,. HN a H r\,, 0 K 0'N W C~~N 0 NH ,90H 3 ozz 3 <ii CH 3 OH3 H~ HN CH3 HN OH 3 OH 3 000-\ H CH, CH 3 N H - N - NN >=N OH OH HNK~ OH 3 j . NH NH ~ 0- _ CH 3 HN -OH 3 0 OH 3 o -0 CH, OH 3 N ~ F F NN NN \- 'N N N NH H o, -CH, CH 3 HN-/ - ~ K 0 CH 3 HNN~~H OH CH 3 C 3 o"~ CH, OH 3 OH% N N N - / H N', N o 0 or0H WO 2012/041014 PCT/CN2011/001638 518 2. The compound of claim 1 having the formula: RiR2 R1s R1 NN N R1 G HA (Ia) and pharmaceutically acceptable salts thereof, wherein: A and A' are each independently a 5-membered monocyclic heterocycloalkyl, wherein said 5-membered monocyclic heterocycloalkyl group can be optionally and independently substituted on one or more ring carbon atoms with R' 3, such that any two R groups on the same ring, together with the carbon atoms to which they are attached, can join to form a fused, bridged or spirocyclic 3 to 6-membered cycloalkyl group or a fused, bridged or spirocyclic 4 to 6-membered heterocycloalkyl group, wherein said 5-membered monocyclic heterocycloalkyl contains from 1 to 2 ring heteroatoms, each independently selected from N(R 4 ) and Si(R 16 ) 2 ; G is selected from-C(R 3 ) 2 -0-, or -C(R 3 ) 2 -C(R) 2 R' represents an optional ring substituent on the phenyl ring to which R' is attached, wherein said substituent is selected from C 1 -C 6 alkyl, -OCI-C 6 alkyl and halo; each occurrence of R 2 is independently selected from H, halo C 1 -C 6 alkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl, benzyl, -O-(C 1 -C 6 alkyl), C 1 -C 6 haloalkylene -O-(C 1 -C 6 haloalkyl); -(C 1 -C 6 alkylene)C(=O)NH-alkyl, -(C 1 -C 6 alkylene)aryl, and -(C 1 -C 6 alkylene)heteroaryl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, CI-C 6 alkyl, CI-C 6 haloalkyl, -O-C 1 -C 6 alkyl, -(C 1 -C 6 alkylene)-O-C 1 -C 6 alkyl and -0 (C 1 -C 6 haloalkyl); WO 2012/041014 PCT/CN2011/001638 519 each occurrence of R 3 is independently selected from H, CI-C 6 haloalkyl, C 1 -C 6 alkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, 5 or 6 membered monocyclic heteroaryl, 9 or 10-membered bicyclic heteroaryl, benzyl, -O-(C 1 C 6 alkyl), C 1 -C 6 haloalkylene -O-(C 1 -C 6 haloalkyl); -(C 1 -C 6 alkylene)C(=O)NH-alkyl, (C 1 -C 6 alkylene)aryl, and -(C 1 -C 6 alkylene)heteroaryl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group, said 9 or 1 0-membered bicyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, -O-C 1 -C 6 alkyl, -(C 1 -C 6 alkylene)-O-C-C 6 alkyl and -O-(C 1 -C 6 haloalkyl); each occurrence of R 4 is independently -C(O)-[C(R 7 ) 2 ]N(R 6 )C(O)O-R" ; each occurrence of R 6 is independently selected from H and CI-C 6 alkyl; each occurrence of R 7 is independently selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, 3 to 6-membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl and 5 or 6-membered monocyclic heteroaryl, wherein said 3 to 6-membered cycloalkyl group, said 4 to 6-membered heterocycloalkyl group, said aryl group and said 5 or 6-membered monocyclic heteroaryl group can be optionally and independently substituted with up to three R 8 groups; each occurrence of R 8 is independently selected from H, CI-C 6 alkyl, halo, -C 1 -C 6 haloalkyl, C1-C 6 hydroxyalkyl, -OH, -C(O)NH-(C 1 -C 6 alkyl), -C(O)N(C 1 -C 6 alkyl) 2 , -O-(C 1 -C 6 alkyl), -NH 2 , -NH(C 1 -C 6 alkyl), -N(C 1 -C 6 alkyl) 2 and -NHC(O)-(CI-C 6 alkyl); each occurrence of R 0 is independently selected from H and halo; each occurrence of R 1 is independently C 1 -C 6 alkyl; each occurrence of R1 3 is independently selected from H and halo, wherein two R" groups, together with the carbon atom(s) to which they are attached, can optionally join to form a 3 to 6-membered cycloalkyl group or 4 to 6-membered heterocycloalkyl group; each occurrence of R1 4 is independently selected from H, halo C 1 -C 6 alkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl, benzyl, -O-(C 1 -C 6 alkyl), C 1 -C 6 haloalkylene -O-(C 1 -C 6 520 hakalkyl); -(CrCs alkylene)C(=0))N1-alkyl, -(C-C alkylene)aryi, and -(C-C alkylene~heteroaryl, wherein said aryl group, said 5 or 6-membered monocyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, Cr-C alkyl, C-C6 halualkylO -- C-Cs alkyl, -- (CrC6 alkylene)-O-CrC-, alkyl and -0 5 (CrC ha alkyl); each occurrence of R is independently selected from H, halo CrC6 alkyl, 3 to 6 membered cycklakyl, 4 to 6-membered heterocycloalkyl, ary], 5 or 6-membered monocyclic heteroaryl, benzyl, '-(CrC alkyl), C -Ce haloalkylene -0-(C -C haloalkyl); -(Cr-C 6 alkylene)C(-)NH-alkyl, -(CrC 5 alkylene)aryI, and (Cr C alkylene)heteroarvl, wherein said aryl group, said S or 6-membered monocyclic 10 heteroaryl group or the phony] group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, CI-C: alkyl CrC haloalkyl, -O-CrQQ alkyl, 1(CrC alkylene)-Or-C-C alkyl and -0 (Ce-Cs halcalkyl); and each occurrence of R' is independently selected from C -C6 alkyl 15 3. The compound of claim I or 2 wherein the group: R 2 R 15 RIG 20 has the structure: X"N N R~ or R 4, The compound of claim I or 2, wherein the group: 521 N G has the structure: NN R14 or 5 The compound of any one of caims I to 4, wherein A and A' are 5 each independently selected from: F R R44 N S- and 15 6. The compound of 0laim 5, wherein A and A are each independently selected from: 522 F and 5 7 The compound of any one of claims 1 to 6, wherein A and N are each R 4 N 10 R) 13 wherein each occunence of Z is independently -Si(R"-, C(R h ior S-, and each occurrence of R' is independently 1, Me, F or two R' 3 groups together with Z, can cormbine to form a spirocyclic 3 to 6-mem bered cycloalkyl group or a spirocyclic 3 to 6-membered silyl-containing heterocycloalkyl group. 15 roylaktgop

8. The compound of any one of claims I to 6, wherein each occurrence of R 4 is independently -C(O)C(RthNHC(O)O-R" or -C(O)C(R5 N(R)h.

9. The compound of claim 8, wherein each occurrence of R 4 is independently -C(O)CHIalky)-NHC(O)alkyl, C(O)CH(cycloalkyl NIC(O)Oalkyl, C(O)CH(heterocycIalkyl)-NHC(O)Oalkyl, C(O)CT(aryl) 20 NI1C(0)Oalkyl or C(O)CHIfaryl)-N(alkyl) 2 .

10. 'The compound of claim I having the formula: WO 2012/041014 PCT/CN2011/001638 523 R 4 NN R13b N R2R R13a N - / N / R R 1 5 H 3 R 3 3 R13a (Ib) or a pharmaceutically acceptable salt thereof, wherein: R2 is H or F; each occurrence of R3 is independently selected from H, C 1 -C 6 alkyl, C 1 C 6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl, 9 or 10-membered bicyclic heteroaryl, -O-(CI-C 6 alkyl), C 1 -C 6 haloalkylene -O-(C 1 -C 6 haloalkyl); -(C 1 -C 6 alkylene)C(=O)NH-alkyl, -(C 1 C 6 alkylene)aryl, and -(Ci-C 6 alkylene)heteroaryl, wherein said aryl group, said 5 or 6 membered monocyclic heteroaryl group, said 9 or 1 0-membered bicyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, -O-C 1 -C 6 alkyl, -(C 1 -C 6 alkylene)-O-C1-C 6 alkyl and -O-(C 1 -C 6 haloalkyl); each occurrence of R4 is independently selected from -C(O)O-(C 1 -C 6 alkyl), -C(O)-CH(R 7 )N(R 6 ) 2 and -C(O)-CH(R 7 )C(O)O-R; each occurrence of R 6 is independently H or C 1 -C 6 alkyl; each occurrence of R 7 is independently selected from C 1 -C 6 alkyl, phenyl, 4 to 6-membered heterocycloalkyl and 3 to 6 membered cycloalkyl; each occurrence of R 1 is independently C 1 -C 6 alkyl; each occurrence of R 3 , is independently H, Me or F; or two Ra 13 groups that are attached to the same carbon atom, together with the common carbon atom to which they are attached, combine to form a spirocyclic 3 to 6 membered cycloalkyl group; each occurrence of R13b is independently H, or one or both R13b groups and an R1 3 a group that are attached to same ring, together with the ring carbon atoms to which they are attached, can combine to form a fused 3 to 6 membered cycloalkyl group; and WO 2012/041014 PCT/CN2011/001638 524 R1 5 represents up to 2 substituents, each independently selected from H, halo, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6-membered heterocycloalkyl, aryl, 5 or 6-membered monocyclic heteroaryl, benzyl, -O-(C 1 -C 6 alkyl), C 1 -C 6 haloalkylene -O-(C 1 -C 6 haloalkyl) -(C 1 -C 6 alkylene)C(=O)NH-alkyl, -(C 1 -C 6 alkylene)aryl, and -(C 1 -C 6 alkylene)heteroaryl, wherein said aryl group, said 5 or 6 membered monocyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be the same or different, and are selected from halo, -CN, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, -0-CI-C 6 alkyl, -(C 1 -C 6 alkylene) O-CI-C 6 alkyl and -O-(C 1 -C 6 haloalkyl).

11. The compound of claim 1 having the formula: 0 -O~ HN- N 0w 0 H R X<.N N- HN R R30 (Id) or a pharmaceutically acceptable salt thereof, wherein: R 30 is C 1 -C 6 alkyl, aryl, 5 or 6-membered monocyclic heteroaryl or 9 membered bicyclic heteroaryl; R' is H, or R' and RX, together with the ring carbon atoms to which they are attached, combine to form a fused 3 to 6-membered cycloalkyl group; Rx is H or F, or R' and RX, together with the ring carbon atoms to which they are attached, combine to form a fused 3 to 6-membered cycloalkyl group; R' is H, or RY and Rz, together with the ring carbon atoms to which they are attached, combine to form a fused 3 to 6-membered cycloalkyl group; and Rz is H or F, or RY and Rz, together with the ring carbon atoms to which they are attached, combine to form a fused 3 to 6-membered cycloalkyl group. 525 12, A compound of Table I or Table 2 of the above specitcation or a stereoisomer thereof, or a pharmaceutically accepiable salt thereof

13. A pharmaceutical composition comprising an effective amount of the compound of any one of claims 1 to 12 and a pharmaceutically acceptable carrier.

14. The phannaceutical composition according to claim 13 fthnber comprising a second therapeutic agent selected from the group consisting of HCV 5 " antiviral agents, immunornodulators, and anti-infective agents, 1$. The pharmaceutical composition according to claim 14, further comprising a third therapeutic agent selected from the group consising of HCV protease inhibitors, HCV NSSA inhibitors and HCV NS5B polymerase inhibitors. 10 16. The use of the compound according to any one of claims 1 to 12, or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for inhibiting HCV replication or for treating infection by HCV in a patient in need thereof.

17. A method of treating a patient infected with HCV comprising the step of administering an amount of (i) the compound according to any one of claims 1 to 12, 15 or a pharmaceutically acceptable salt thereof or (ii) the composition according to any one of claims 13 to 15 effective to treat infection by HCV in said patient.

18. The method according to claim 17, further comprising the step of administering pegylated-interferon alpha and an HCV protease to said patient.

19. The method according to claim 17 or 18, ftirther comprising the 20 step of administering ribavirin to said patient

20. The method according to clain 17 or 18, further comprising the step of administering from one to three additional therapeutic agents to said patient, 25 526 wherein the additional therapeutic agents are each independe&ly selected from HCV protease inhibitors, HCV NS5A inhibitors and HCV NS5B polymerase inhibitors

21. The method according to claim 20, wherein the one to three additional therapeutic agents comprises MK-5.172. 5

22. The method according to claim 21 or 22, wherein the one to three additional therapeutic agents comprises P.I-7977.

23. A compound having the formula: A R w W. ~ Vr-r\ / \ Y'\;2 r~ A R 10 as defined in claim 1 and substantially as hereinbefore described with reference to any one of the Examples. Merck Sharp & Dohme Corp Patent Attorneys for the Applicant/Nominated Person SPRUSON & FERGUSON