MX2013003631A - Tetracyclic indole derivatives for treating hepatitis c virus infection. - Google Patents

Abstract

Tetracyclic indole derivatives of formula (I), pharmaceutically acceptable salts and the pharmaceutical compositions thereof are provided, wherein A, A', G, R¹, R¹⁵, U, V, V, W, W, X, X', Y, Y' are as defined in the invention. Use of these derivatives for treating hepatitis C virus (HCV) infection is also provided.

Description

DERIVATIVES OF TETRACYCLIC INDOL AND ITS METHODS OF USE FOR THE TREATMENT OF VIRAL DISEASES FIELD OF THE INVENTION The present invention relates to novel tetracyclic indole derivatives, compositions comprising at least one tetracyclic indole derivative and methods of using the tetracyclic indole derivatives to treat or prevent HCV infection in a patient.

BACKGROUND OF THE INVENTION The hepatitis C virus (HCV) is a very important human pathogen. A substantial fraction of people infected with HCV develop serious progressive liver disease, including cirrhosis and hepatocellular carcinoma, which are often fatal. HCV is a single-strand (+) enveloped RNA virus that has been implicated as the principal causative agent of non-A non-B hepatitis (NANBH), particularly in NANBH associated with blood (see international publication No. WO 89/04669, and European Patent Publication No. EP 381 216). NANBH is distinguished from other types of liver disease induced by viruses such as hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis delta virus (HDV), cytomegalovirus (CMV) and Epstein-Barr virus (EBV), and also other forms of liver disease such as alcoholism and primary biliary cirrhosis.

It is well established that persistent HCV infection is related to chronic hepatitis, and therefore the inhibition of HCV replication is a viable strategy for the prevention of hepatocellular carcinoma. Current therapies for HCV infection include a-interferon monotherapy and combination therapy comprising a-interferon and ribavirin. It has been shown that these therapies are effective in some patients with chronic HCV infection, but they are of low efficacy and have unfavorable side effects, and efforts are now being made to find inhibitors of HCV replication that are useful for the treatment and prevention of HCV-related disorders.

Current research efforts directed to the treatment of HCV include the use of antisense oligonucleotides, free bile acids (such as ursodeoxycholic acid and chenodeoxycholic acid) and conjugated bile acids (such as tauroursodeoxycholic acid). Esters of phosphonoformic acid have also been proposed as potentially useful agents for the treatment of various viral infections, including HCV. However, the development of vaccines has been hampered by the high degree of heterogeneity of the viral strain and immune evasion and the lack of protection against re-infection, even with the same inoculum.

In light of these obstacles, the development of inhibitors Small molecule targeting specific viral targets has become a very important focus of anti-HCV research. The determination of the crystal structures of the NS3 protease, NS3 RNA helicase, NS5A and NS5B polymerase, with and without bound ligands, has provided important new structural insights useful for the rational design of specific inhibitors.

Recently attention has been focused on the identification of HCV NS5A inhibitors. HCV NS5A is a 447 amino acid phospho-protein that lacks a defined enzyme function. It runs as the 56kd and 58kd bands in gels depending on the phosphorylation state (Tanji, et al., J. Virol. 69: 3980-3986 (1995)). HCV NS5A resides in the replication complex and may be responsible for the change of RNA replication to the production of infectious virus (Huang, Y, et al., Virolopy 364: 1-9 (2007)). Multicyclic HCV NS5A inhibitors have been reported. See U.S. Patent Publication. Nos. US2008031 1075, US20080044379, US20080050336, US20080044380, US20090202483 and US2009020478. HCV NS5 A inhibitors having fused tricyclic radicals are described in International Patent Publication Nos. WO 10/065681, WO 10/065668 and WO 10/065674.

Other inhibitors of HCV NS5A and their use to reduce viral load in humans infected with HCV have been described in U.S. Patent Publication No. US2006027651 1.

BRIEF DESCRIPTION OF THE INVENTION In one aspect, the present invention provides compounds of formula (I) or a pharmaceutically acceptable salt thereof, wherein: A and A 'are each independently a 5- or 6-membered monocyclic heterocycloalkyl, wherein said 5- or 6-membered monocyclic heterocycloalkyl group can be optionally fused to an aryl group; and wherein said 5- or 6-membered monocyclic heterocycloalkyl group can be optionally and independently substituted on one or more carbon atoms of the ring with R13, such that any of two R13 groups on the same ring, together with the carbon atoms to which they are joined, can be joined to form a cycloalkyl group of 3 to 6 fused members, with bridging or a 4 to 6 membered heterocycloalkyl group fused, bridged or spirocyclic, wherein said 5- or 6-membered monocyclic heterocycloalkyl contains from 1 to 2 heteroatoms of the ring, each independently selected from N (R4), S, O and Si (R16) 2; G is selected from -C (R3) 2-0-, -C (R3) 2-N (R5) -, -C (0) -0-, - C (0) -N (R5) -, -C (0) -C (R3) 2-, -C (R3) 2-C (0) -, -C (= NR5) -N (R5) -, -C (R3) 2-S02-, - S02-C (R3) 2-, -S02N (R5) -, -C (R3) 2-C (R3) 2-, -C (R14) = C (R14) ) - and -C (R14) = N-; U is selected from N and C (R2); V and V each is selected independently of N and C (R15); W and W each is independently selected from N and C (R1); X and X 'each is independently selected from N and C (R10); Y and Y 'each is selected independently of N and C (R10); R 1 is selected from H, C 1 -C 6 alkyl, 3 to 6 membered cycloalkyl, halo, -OH, -O- (C 1 -C 6 alkyl), C 1 -C 6 haloalkyl and -0- (C 6 C haloalkyl); each occurrence of R2 is independently selected from H, C1-C6 alkyl, cycloalkyl of 3 to 6 members, -O- (C1-C6 alkyl), haloalkyl of C-i-C6 -0- (haloalkyl of C-i-C6); halo, -OH, aryl, and heteroaryl; each occurrence of R 3 is independently selected from H, Ci-C 6 alkyl, Ci-C 6 haloalkyl, - (C 1 -C 6 alkylene-Ci-C 6 alkyl), - (CrC 6 alkylene) -O- (cycloalkyl) 3 to 6 members), 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl, 5 or 6 membered monocyclic heteroaryl, 9 or 10 membered bicyclic heteroaryl and benzyl, wherein said aryl group, said heteroaryl group monocyclic of 5 or 6 members, said 9 or 10 membered bicyclic heteroaryl group or the phenyl radical of said benzyl group can be optionally substituted with up to 3 groups, which may be the same or different, and are selected from C6 alkyl, C6 haloalkyl , -0- (C6 alkyl), -O (Ci-C6 haloalkyl), halo, - (Ci-C6 alkylene) -0- (Ci-C6 alkyl) and -CN and wherein two R3 groups attached to the same carbon atom, together with the common carbon atom to which they are attached, can be joined to form a carbonyl group, a 3 to 6 membered spirocyclic cycloalkyl group or a 3 to 6 membered spirocyclic heterocycloalkyl group; each occurrence of R4 is independently selected from - [C (R7) 2] qN (R6) 2, -C (0) R11, -C (0) - [C (R7) 2] qN (R6) 2, -CÍOHCÍR ^ Jq-R1 1, -C (O) - [C (R7) 2] qN (R6) C (0) -R11, -C (0) [C (R7) 2] qN (R6) S02-R11, -C (O) - [C (R7) 2] qN (R6) C (0) 0 -R11, -C (0) - [C (R7) 2] qC (0) 0 -R11 and -alkylene-N (R6) -IC (R7) 2] qN (R6) -C (0) 0-R11; each occurrence of R5 is independently selected from H, CrC6 alkyl, - (CrC6 alkylene) -0- (CrC6 alkyl), 3- to 6-membered cycloalkyl, 4- to 6-membered heterocycloalkyl, aryl, monocyclic heteroaryl 6 members and benzyl, wherein said aryl group, said 5- or 6-membered monocyclic heteroaryl group or the phenyl radical of said benzyl group can optionally be substituted with up to 3 groups, which may be the same or different, and are selected from alkyl of C1-C6, Ci-C6haloalkyl, -0- (C ^ -CQ alkyl), -0- (CrC6 haloalkyl), halo, - (C- -Ce-d-CeJ-O-alkyl alkylene) ) and -CN; each occurrence of R6 is independently selected from H, Ci-C6 alkyl, cycloalkyl of 3 to 6 members, heterocycloalkyl of 4 to 6 members, aryl and monocyclic heteroaryl of 5 or 6 members, wherein said cycloalkyl group of 3 to 6 members , said 4- to 6-membered heterocycloalkyl group, said aryl group and said 5- or 6-membered monocyclic heteroaryl group can be optionally and independently substituted with up to two R8 groups, and wherein two R6 groups that are bonded to the same nitrogen atom, together with the common nitrogen atom to which they are attached, they can be joined to form a 4 to 6 membered heterocycloalkyl group; each occurrence of R7 is independently selected from H, C1-C6 alkyl, Ci-C6 haloalkyl, -alkylene-0- (Ci-C6 alkyl), cycloalkyl of 3 to 6 members, heterocycloalkyl of 4 to 6 members, aryl and 5 or 6 membered monocyclic heteroaryl, wherein said 3 to 6 membered cycloalkyl group, said 4 to 6 membered heterocycloalkyl group, said aryl group and said 5 or 6 membered monocyclic heteroaryl group may be optionally substituted with a maximum of three R8 groups; each occurrence of R 8 is independently selected from H, C 6 alkyl, halo, C 1 -C 6 haloalkyl, C Ce hydroxyalkyl, -OH, -C (0) NH- (CrC 6 alkyl), -C (0) N (Ci-C6 alkyl) 2, -0- (CrC6 alkyl), -NH2, -NH (CrC6 alkyl), -N (C6 alkyl) 2 and -NHC (0) - (Cr-alkyl) C6); each occurrence of R9 is independently selected from H, Ci-C6 alkyl, Ci-C6alkyl haloalkyl of 3 to 6 members, 4- to 6-membered heterocycloalkyl, aryl, and 5- or 6-membered monocyclic heteroaryl; each occurrence of R10 is independently selected from H, CrC6 alkyl, C6 haloalkyl, halo, -OH, -O- (CrC6 alkyl) and -CN; each occurrence of R 1 1 is independently selected from H, C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, C 1 -C 6 hydroxyalkyl, 3 to 6 membered cycloalkyl and 4 to 6 membered heterocycloalkyl; each occurrence of R 12 is independently selected from C 1 -C 6 alkyl, C 1 -C 6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl, and 5 or 6 membered monocyclic heteroaryl; each occurrence of R 3 is independently selected from H, halo, C 1 -C 6 alkyl, Ci-C 6 haloalkyl 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, -CN, -OR 9, -N (R 9) 2 , -C (O) R12, -C (O) OR9, -C (O) N (R9) 2, -NHC (O) R12, -NHC (O) NHR9, -NHC (O) OR9, -OC ( 0) R12, -SR9 and -S (O) 2R12, wherein two R12 groups with the carbon atom (s) to which they are attached, can optionally be combined to form a 3-6 membered cycloalkyl group or a heterocycloalkyl group from 4 to 6 members; each occurrence of R 14 is independently selected from H, halo, C 6 alkyl, - (C 6 alkylene) -O- (C Ce alkyl), 3 to 6 membered cycloalkyl, C 1 -C 6 haloalkyl, aryl, heteroaryl 5 or 6 membered monocyclic and benzyl, wherein said aryl group, said heteroaryl group 5 or 6 membered monocyclic or the phenyl radical of said benzyl group may be optionally substituted with up to 3 groups, which may be the same or different, and are selected from halo, -CN, C6 alkyl, C1-C6 haloalkyl , -0- (Ci-C6 alkyl), - (Ci-C6 alkylene) -0- (C6 alkyl) and -0- (C6 haloalkyl); each occurrence of R15 is independently selected from H, C1-C6 alkyl, 3- to 6-membered cycloalkyl, halo, -OH, -0- (CrC6 alkyl), d-C6 haloalkyl, and -0- (haloalkyl) Ci-C6); each occurrence of R16 is independently selected from H, halo, Ci-C6 alkyl and 3 to 6 membered cycloalkyl, wherein two R16 groups that are attached to a common silicon atom can be joined to form a - (Ch ^ - or a group - (CH2) s-; each occurrence of q is independently an integer that ranges from 0 to 4. provided that the compound of formula (I) is different from: 10 or The compounds of formula (I) (also referred to herein as "tetracyclic indole derivatives") and their pharmaceutically acceptable salts may be useful, for example, to inhibit viral replication of HCV or replicon activity and to treat or prevent infection by HCV in a patient. Without being bound by any specific theory, it is believed that tetracyclic indole derivatives inhibit viral replication of HCV by inhibiting HCV NS5A.

Accordingly, the present invention provides methods for treating or preventing HCV infection in a patient, comprising administering to the patient an effective amount of at least one tetracyclic indole derivative.

The details of the invention are set forth below in the accompanying detailed description.

Although any method and material similar to those described herein can be used in the practice or testing of the present invention, illustrative methods and materials are now described. Other embodiments, aspects and features of the present invention are further described or will be apparent from the subsequent description, the examples and the appended claims.

DETAILED DESCRIPTION OF THE INVENTION The present invention relates to novel tetracyclic indole derivatives, compositions comprising at least one tetracyclic indole derivative and methods of using the tetracyclic indole derivatives to treat or prevent HCV infection in a patient.

Definitions and Abbreviations The terms used herein have their normal meaning, and the meaning of such terms is independent in each occurrence thereof. However, and except where otherwise indicated, the following definitions apply throughout the specification and claims. Chemical names, common names and chemical structures can be used interchangeably to describe the same structure. If reference is made to a chemical compound using both a chemical structure and a chemical name and there is an ambiguity between the structure and the name, then the structure predominates. These definitions apply regardless of whether a term is used alone or in combination with other terms, unless otherwise indicated. Thus, the definition of "alkyl" applies to "alkyl" as well as the "alkyl" portions of "hydroxyalkyl", "haloalkyl", "-O-alkyl", etc.

As used herein and throughout this description, unless otherwise indicated, it will be understood that the following terms They have the following meanings: A "patient" is a human or non-human mammal. In one modality, the patient is a human. In one modality, the patient is a chimpanzee.

The term "effective amount" herein refers to an amount of tetracyclic indole derivative and / or an additional therapeutic agent or a composition thereof that is effective in producing the desired therapeutic, enhancer, inhibitory or preventive effect when administered to a patient suffering from a viral infection or a disorder related to the virus. In the combination therapies of the present invention, an effective amount can be referred to each individual agent or to the combination as a whole, wherein the amounts administered of all the agents are effective together, but wherein the component agent of the combination can not be individually present in an effective amount.

The term "prevent", as used herein with respect to a viral HCV infection or HCV virus related disorder, refers to reducing the likelihood of HCV infection.

The term "alkyl", herein, refers to an aliphatic hydrocarbon group with one of its hydrogen atoms substituted with a bond. An alkyl group can be straight or branched and contain from about 1 to about 20 carbon atoms. In one embodiment, an alkyl group contains from about 1 to about 12 carbon atoms. In different modalities, an alkyl group contains from 1 to 6 carbon atoms (Ci-Ce alkyl) or from about 1 to about 4 carbon atoms (C 1 -C 4 alkyl). Non-limiting examples of alkyl groups of methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tere-butyl, n-pentyl, neopentyl, isopentyl, n-hexyl, isohexyl and neohexyl. An alkyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, cycloalkyl, cyano, hydroxy, -O-alkyl, - O-aryl, -alkylene-O-alkyl, alkylthio, -NH2, -NH (alkyl), -N (alkyl) 2, -NH (cycloalkyl), -OC (O) -alkyl, -0-C (0) -aryl, -0-C (0) -cycloalkyl, -C (0) OH and -C (0) 0-alkyl. In one embodiment, an alkyl group is linear. In another embodiment, an alkyl group is branched. Unless otherwise indicated, an alkyl group is unsubstituted.

The term "alkenyl," as used herein, refers to an aliphatic hydrocarbon group containing at least one carbon-carbon double bond and one of its hydrogen atoms substituted with a bond. An alkenyl group can be straight or branched and contains from about 2 to about 15 carbon atoms. In one embodiment, an alkenyl group contains from about 2 to about 12 carbon atoms. In another embodiment, an alkenyl group contains from about 2 to about 6 carbon atoms. Non-limiting examples of alkenyl groups include ethenyl, propenyl, n-butenyl, 3-methylbut-2-enyl, n-pentenyl, octenyl and decenyl. An alkenyl group can be substituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -O-alkyl, -O-aryl, -alkylene-O-alkyl , alkylthio, -IMH2, - NH (alkyol), -N (alkyl) 2, -NH (cycloalkyl), -0-C (0) -alkyl, -0-C (0) -aryl, -OC (O) -cycloalkyl, -C (0) OH and -C (0) 0 -alkyl. The term "C2-C6 alkenyl" refers to an alkenyl group having from 2 to 6 carbon atoms. Unless otherwise indicated, an alkenyl group is unsubstituted.

The term "alkynyl", herein, refers to an aliphatic hydrocarbon group containing at least one carbon-carbon triple bond and one of its hydrogen atoms substituted with a bond. An alkynyl group can be straight or branched and contain from about 2 to 15 carbon atoms. In one embodiment, an alkynyl group contains from about 2 to about 12 carbon atoms. In another embodiment, an alkynyl group contains from about 2 to about 6 carbon atoms. Non-limiting examples of alkynyl groups include ethynyl, propynyl, 2-butynyl, ethynyl and 3-methylbutynyl. An alkynyl group may be unsubstituted or substituted by one or more substituents which may be the same or different, each substituent being independently selected from the group consisting of halo, alkenyl, alkynyl, aryl, cycloalkyl, cyano, hydroxy, -O-alkyl , -O-aryl, -alkylene-O-alkyl, alkylthio, -NH2, -NH (alkyl), -N (alkyl) 2, -NH (cycloalkyl), -OC (0) -alkyl, -OC (O) -aryl, -OC (O) -cycloalkyl, -C (0) OH and -C (O) 0- I rent. The term "C2-C6 alkynyl" refers to an alkynyl group having from 2 to 6 carbon atoms. Unless otherwise indicated, an alkynyl group is unsubstituted.

The term "alkylene," herein, refers to an alkyl group, as defined above, wherein one of the hydrogen atoms of the alkyl group has been replaced by a bond. Non-limiting examples of alkylene groups include -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH2CH2CH2CH2-, -CH (CH3) CH2CH2-, -CH (CH3) - and -CH2CH (CH3) CH2-. In one embodiment, an alkylene group has from 1 to about 6 carbon atoms. In another embodiment, an alkylene group is branched. In another embodiment, an alkylene group is linear. In one embodiment, an alkylene group is -CH2-. The term "C 1 -C 6 alkylene" refers to an alkylene group having 1 to 6 carbon atoms.

The term "aryl," herein, refers to a monocyclic or multicyclic aromatic ring system comprising from about 6 to about 14 carbon atoms. In one embodiment, an aryl group contains from about 6 to about 10 carbon atoms. An aryl group may be optionally substituted with one or more "ring system substituents" which may be the same or different and is as defined herein below. In one embodiment, an aryl group can optionally be fused to a cycloalkyl or cycloalkanoyl group. Non-limiting examples of aryl groups include phenyl and naphthyl. In one embodiment, an aryl group is phenyl. Unless it is state otherwise, an aryl group is unsubstituted.

The term "arylene", herein, refers to a bivalent group derived from an aryl group, as defined above, by the removal of a hydrogen atom from a ring carbon of an aryl group. An arylene group can be derived from a monocyclic or multicyclic ring system composed of from about 6 to about 14 carbon atoms. In one embodiment, an arylene group contains from about 6 to about 10 carbon atoms. In another embodiment, an arylene group is a naphthylene group. In another embodiment, an arylene group is a phenylene group. An arylene group may be optionally substituted with one or more "ring system substituents" which may be the same or different and is as defined herein below. An arylene group is divalent and any link available in an arylene group can be connected to any flanking group of the arylene group. For example, the group "A-arylene-B," where the arylene group is: It is understood that they represent both: In one embodiment, an arylene group can optionally be fused to a cycloalkyl or cycloalkanoyl group. Non-limiting examples of arylene groups include phenylene and naphthalene. In one embodiment, an arylene group is unsubstituted. In another modality, an arylene group is: Unless otherwise indicated, an arylene group is unsubstituted.

The term "cycloalkyl", herein, refers to a non-aromatic mono- or multicyclic ring system consisting of about 3 to about 10 ring carbon atoms. In one embodiment, a cycloalkyl contains from about 5 to about 10 ring carbon atoms. In another embodiment, a cycloalkyl contains from about 3 to about 7 ring atoms. In another embodiment, a cycloalkyl contains from about 5 to about 6 ring atoms. The term "cycloalkyl" also encompasses a cycloalkyl group, as defined above, that is attached to an aryl (e.g., benzene) or heteroaryl ring. Non-limiting examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl. Non-limiting examples of multicyclic cycloalkyls include 1-decalinyl, norbornyl and adamantyl. A group Cycloalkyl may be optionally substituted with one or more "ring system substituents" which may be the same or different and is as defined herein below. In one embodiment, a cycloalkyl group is unsubstituted. The term "3 to 6 membered cycloalkyl" refers to a cycloalkyl group having 3 to 6 ring carbon atoms. Unless otherwise indicated, a cycloalkyl group is unsubstituted. A ring carbon atom of a cycloalkyl group can be functionalized as a carbonyl group. An illustrative example of said cycloalkyl group (also referred to herein as a "cycloalkanoyl" group) includes, but is not limited to, cyclobutanoyl: The term "cycloalkenyl", herein, refers to a non-aromatic mono- or multicyclic ring system comprising from about 4 to about 10 ring carbon atoms and containing at least one double endocyclic bond. In a modality, a cycloalkenyl contains from about 4 to about 7 ring carbon atoms. In another embodiment, a cycloalkenyl contains 5 or 6 ring atoms. Non-limiting examples of monocyclic cycloalkenyls include cyclopentenyl, cyclohexenyl, cyclohepta-l, 3-dienyl and the like. A cycloalkenyl group may be optionally substituted with one or more "ring system substituents" which may be the same or different and they are as defined here below. A ring carbon atom of a cycloalkyl group can be functionalized as a carbonyl group. In one embodiment, a cycloalkenyl group is cyclopentenyl. In another embodiment, a cycloalkenyl group is cyclohexenyl. The term "4- to 6-membered cycloalkenyl" refers to a cycloalkenyl group having 4 to 6 ring carbon atoms. Unless otherwise indicated, a cycloalkenyl group is unsubstituted.

The term "halo", as used herein, means -F, -Cl, Br or -l.

The term "haloalkyl", herein, refers to an alkyl group as defined above, wherein one or more of the hydrogen atoms of the alkyl group has been replaced by a halogen. In one embodiment, a haloalkyl group has from 1 to 6 carbon atoms. In another embodiment, a haloalkyl group is substituted with 1 to 3 carbon atoms. Non-limiting examples of haloalkyl groups include -CH2F, -CHF2, -CF3, -CH2CI and -CCI3. The term "CrCV haloalkyl" refers to a haloalkyl group having 1 to 6 carbon atoms.

The term "hydroxyalkyl," herein, refers to an alkyl group as defined above, wherein one or more hydrogen atoms of the alkyl group have been replaced by an -OH group. In one embodiment, a hydroxyalkyl group has from 1 to 6 carbon atoms. Non-limiting examples of hydroxyalkyl groups include -CH 2 OH, -CH 2 CH 2 OH, -CH 2 CH 2 CH 2 OH and -CH 2 CH (OH) CH 3. The term "C1 to C6 hydroxyalkyl" refers to a hydroxyalkyl group having from 1 to 6 carbon atoms. carbon.

The term "heteroaryl", herein, refers to a monocyclic or multiciclic aromatic ring system composed of about 5 to about 14 ring atoms, wherein 1 to 4 of the ring atoms is independently O, N or S and The remaining ring atoms are the carbon atoms. In one embodiment, a heteroaryl group has 5 to 10 ring atoms. In another embodiment, a heteroaryl group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heteroaryl group is bicyclic and has 9 or 10 ring atoms. A heteroaryl group may be optionally substituted by one or more "ring system substituents" which may be the same or different and is as defined herein below. A heteroaryl group is attached via a ring carbon atom, and any nitrogen atom of a heteroaryl optionally can be oxidized to the corresponding N-oxide. The term "heteroaryl" also embraces a heteroaryl group, as defined above, which is fused to a benzene ring. Non-limiting examples of heteroaryls include pyridyl, pyrazinyl, furanyl, thienyl, pyrimidinyl, pyridone (including N-substituted pyridones), isoxazolyl, isothiazolyl, oxazolyl, oxadiazolyl, thiazolyl, pyrazolyl, furazanyl, pyrrolyl, triazolyl, 1,4-thiadiazolyl , pyrazinyl, pyridazinyl, quinoxalinyl, phthalazinyl, oxindolyl, imidazo [1,2-a] pyridinyl, imidazo [2,1-b] thiazolyl, benzofurazanyl, indpyl, azaindolyl, benzimidazolyl, benzothienyl, quinolinyl, midazolyl, benzimidazolyl, thienopyridyl, quinazolinyl, thienopyrimidyl, pyrrolopyridyl, imidazopyridyl, isoquinolinyl, benzoazaindolyl, 1,4-triazinyl, benzothiazolyl and the like and all isomeric forms thereof. The term "heteroaryl" also refers to partially saturated heteroaryl radicals such as, for example, tetrahydroisoquinolyl, tetrahydroquinolyl, and the like. In one embodiment, a heteroaryl group is a 5- or 6-membered monocyclic heteroaryl. In another embodiment, a heteroaryl group is a 6-membered monocyclic heteroaryl. In another embodiment, a heteroaryl group is a 5-membered monocyclic heteroaryl. In one embodiment, a heteroaryl group is a 9 or 10 membered monocyclic heteroaryl. In another embodiment, a heteroaryl group is a 9-membered monocyclic heteroaryl. Unless indicated otherwise, a heteroaryl group is unsubstituted.

The term "heteroarylene", herein, refers to a bivalent group derived from a heteroaryl group, as defined above, by the removal of a hydrogen atom from a carbon of the ring or ring heteroatom of a heteroaryl group. A heteroarylene group can be derived from a monocyclic or multicyclic ring system composed of from about 5 to about 14 ring atoms, wherein from 1 to 4 of the ring atoms are each independently O, N or S and the ring atoms remaining are carbon atoms. A heteroarylene group may be optionally substituted by one or more "ring system substituents" which may be the same or different and are as defined herein below. A heteroarylene group is linked by means of a ring carbon atom or by a nitrogen atom with an open valence, and any nitrogen atom of a heteroarylene may optionally be oxidized to the corresponding N-oxide. The term "heteroarylene" also includes a heteroarylene group, as defined above, which is fused to an benzene benzyl. Non-limiting examples of heteroarylenes include pyridylene, pyrazinylene, furanylene, thienylene, pyrimidinylene, pyridonylene (including those derived from N-substituted pyridonyl), isoxazolylene, isothiazolylene, oxazolylene, oxadiazolylene, thiazolylene, pyrazolylene, thiophenylene, furazanylene, pyrrolylene, triazolylene, 1, 2,4-thiadiazolylene, pyrazinylene, pyridazinylene, quinoxalinylene, phthalazinylene, oxindolylene, imidazo [1,2-a] pyridinylene, imidazo [2,1-b] thiazolylene, benzofurazanileno, indolileno, azaindolileno, benzimidazolileno, benzotienileno, quinolinileno, imidazolileno, benzimidazolylene, thienopyridylene, quinazolinylene, thienopyrimidylene, pyrrolopyridylene, imidazopyridylene, isoquinolinylene, benzoazaindolylene, 1,4-triazinylene, benzothiazolylene and the like, and all isomeric forms thereof. The term "heteroarylene" also refers to partially saturated heteroarylene radicals such as, for example, tetrahydroisoquinolylene, tetrahydroquinolylene, and the like. A heteroarylene group is divalent and any available link in a heteroarylene ring can be connected to any of the groups flanking the heteroarylene group. For example, the group "A-heteroarylene-B," wherein the heteroarylene group is.

It is understood that they represent both: One embodiment, a heteroarylene group is a monocyclic heteroarylene group or a bicyclic heteroarylene group. In another embodiment, a heteroarylene group is a monocyclic heteroarylene group. In another embodiment, a heteroarylene group is a bicyclic heteroarylene group. In still another embodiment, a heteroarylene group has from about 5 to about 10 ring atoms. In another embodiment, a heteroarylene group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heteroarylene group is bicyclic and has 9 or 10 ring atoms. In another embodiment, a heteroarylene group is a 5-membered monocyclic heteroarylene. In another embodiment, a heteroarylene group is a 6-membered monocyclic heteroarylene. In another embodiment, a bicyclic heteroarylene group comprises a 5- or 6-membered monocyclic heteroarylene group fused to a benzene ring. Unless otherwise indicated, a heteroarylene group is unsubstituted.

The term "heterocycloalkyl", herein, refers to a monocyclic or multicyclic unsaturated non-aromatic ring system comprising 3 to about 11 ring atoms, wherein from 1 to 4 Ring atoms are independently O, S, N or Si, and the rest of the ring atoms are carbon atoms. A heterocycloalkyl group can be attached by a ring carbon, ring silicon atom or ring nitrogen atom. In one embodiment, a heterocycloalkyl group is monocyclic and has from about 3 to about 7 ring atoms. In another modality, a heterocycloalkyl group is monocyclic having from about 4 to about 7 ring atoms. In another embodiment, a heterocycloalkyl group is bicyclic and has from about 7 to about 11 ring atoms. In still another embodiment, a heterocycloalkyl group is monocyclic and has 5 or 6 ring atoms. In one embodiment, a heterocycloalkyl group is monocyclic. In another embodiment, a heterocycloalkyl group is bicyclic. There is no adjacent oxygen and / or sulfur atoms present in the ring system. Any -NH group in a heterocycloalkyl ring may exist protected as, for example, as a group -N (BOC), -N (Cbz), N (Cough) and the like; said protected heterocycloalkyl group is considered part of this invention. The term "heterocycloalkyl" also encompasses a heterocycloalkyl group, as defined above, that is fused to an aryl (e.g., benzene) or heteroaryl ring. A heterocycloalkyl group may be optionally substituted by one or more "ring system substituents" which may be the same or different and are as defined herein below. The nitrogen or sulfur atom of the heterocycloalkyl may optionally be oxidized to the corresponding N-oxide, S-oxide or S, S-dioxide. Examples non-limiting monocyclic heterocycloalkyl rings include oxetanyl, piperidyl, pyrrolidinyl, piperazinyl, morpholinyl, thiomorpholinyl, thiazolidinyl, 1,4-dioxanyl, tetrahydrofuranyl, tetrahydrothiophenyl, delta-lactam, delta-lactone, silacyclopentane, silapyrrolidin and the like and all its isomers. Illustrative non-limiting examples of a heterocycloalkyl group containing silyl include: A carbon atom of the ring of a heterocycloalkyl group can be functionalized as a carbonyl group. An illustrative example of such a heterocycloalkyl group is: In one embodiment, a heterocycloalkyl group is a 5-membered monocyclic heterocycloalkyl. In another modality, a group Heterocycloalkyl is a 6-membered monocyclic heterocycloalkyl. The term "3-6 membered monocyclic cycloalkyl" refers to a monocyclic heterocycloalkyl group having 3 to 6 ring atoms. The term "4- to 6-membered monocyclic cycloalkyl" refers to a monocyclic heterocycloalkyl group having 4 to 6 ring atoms. The term "7 to 11 membered bicyclic heterocycloalkyl" refers to a bicyclic heterocycloalkyl group having from 7 to 11 ring atoms. Unless otherwise indicated, a heterocycloalkyl group is unsubstituted.

The term "heterocycloalkenyl", herein, refers to a heterocycloalkyl group, as defined above, wherein the heterocycloalkyl group contains from 4 to 10 ring atoms and at least one carbon-carbon or carbon-nitrogen double bond endocyclic. . A heterocycloalkenyl group can be attached via a carbon atom or ring nitrogen atom. In one embodiment, a heterocycloalkenyl group has from 4 to 6 ring atoms. In another embodiment, a heterocycloalkenyl group is monocyclic and has 5 or 6 ring atoms. In another embodiment, a heterocycloalkenyl group is bicyclic. A heterocycloalkenyl group may be optionally substituted by one or more substituents of the ring system, wherein "ring system substituent" is as defined above. The nitrogen or sulfur atom of the heterocycloalkenyl may optionally be oxidized to the corresponding N-oxide, S-oxide or S, S-dioxide. Non-limiting examples of heterocycloalkenyl groups include 1, 2,3,4-tetrahydropyridinyl, 1,2-dihydropyridinyl, 1,4-dihydropyridinyl, 1, 2,3,6- tetrahydropyridinyl, 1,4,6,6-tetrahydropyrimidinyl, 2-pyrrolinyl, 3-pyrrolinyl, 2-imidazolinyl, 2-pyrazolinyl, dihydroimidazolyl, dihydrooxazolyl, dihydrooxadiazolyl, dihydrothiazolyl, 3,4-dihydro-2H-pyranyl, dihydrofuranyl, fluoro- substituted dihydrofuranyl, 7-oxabicyclo [2.2.1] heptenyl, dihydrothiophenyl, dihydrothiopyranyl, and the like. A ring carbon atom of a heterocycloalkenyl group can be functionalized as a carbonyl group. In one embodiment, a heterocycloalkenyl group is a 5-membered heterocycloalkenyl group. In another embodiment, a heterocycloalkenyl group is a 6-membered heterocycloalkenyl group. The term "4- to 6-membered heterocycloalkenyl" refers to a heterocycloalkenyl group having 4 to 6 ring atoms. Unless otherwise indicated, a heterocycloalkenyl group is unsubstituted.

The term "ring system substituent," as used herein, refers to a substituent group attached to an aromatic or non-aromatic ring system that, for example, replaces a hydrogen available in the ring system. The substituents of the ring system can be the same or different, each being independently selected from the group consisting of alkyl, alkenyl, alkynyl, aryl, heteroaryl, -alkylene-aryl, -arylene-alkyl, -alkylene-heteroaryl, -alkenylene -heteroaryl, -alkynylene-heteroaryl, -OH, hydroxyalkyl, haloalkyl, -OH, hydroxyalkyl, haloalkyl, -O-alkyl, -O-haloalkyl, -alkylene-O-alkyl, -O-aryl, -O-alkylene-aryl , acyl, -C (O) -aryl, halo, -NO2, -CN, -SF5, -C (O) OH, -C (O) O-alkyl, -C (O) O-aryl, -C ( 0) O-alkylene-aryl, -S (O) -alkyl, -S (O) 2-alkyl, - S (0) -aryl, -S (0) 2-aryl, -S (0) -heteroaryl, -S (0) 2 -heteroaryl, -S-alkyl, -S-aryl, -S-heteroaryl, -S-alkylene-aryl, -S-alkylene-heteroaryl, -S (0) 2-alkylene-aryl, -S (0) 2-alkylene-heteroaryl, -Si (alkyl) 2, -Si (aryl) 2, Si (heteroaryl) 2, -Si (alkyl) (aryl), -Si (alkyl) (cycloalkyl), Si (alkyl) (heteroaryl), cycloalkyl, heterocycloalkyl, -0-C (0) -alkyl, -0- C (0) -aryl, -0-C (0) -cycloalkyl -C (= N-CN) - NH2, -C (= NH) -NH2, -C (= NH) - NH (alkyl), -? ^ ??), -alkylene-NYY ^), -0 (0) 1 ^) ^) and - S (ON (Y,) (Y2) t where Yi and Y2 may be the same or different and are independently selected from the group consisting of hydrogen, alkyl, aryl, cycloalkyl, and alkylene-aryl. "Ring system substituent "may also mean a single radical which at the same time replaces two available hydrogens on two adjacent carbon atoms (one H on each carbon) in a ring system Examples of such a radical are methylenedioxy, ethylenedioxy, -C (CH3) 2 and similar that form radicals such as, for example: The term "silylalkyl", herein, refers to an alkyl group as defined above, wherein one or more hydrogen atoms of the alkyl group has been replaced by a -Si (Rx) 3, wherein each occurrence of R x is independently C 1 -C 6 alkyl, phenyl or a group 3 to 6-membered cycloalkyl. In one embodiment, a silylalkyl group has from 1 to 6 carbon atoms. In another embodiment, an alkyl silyl group contains a radical -Si (CH3) 3. Non-limiting examples of silylalkyl groups include -CH2-Si (CH3) 3 and -CH2CH2-Si (CH3) 3.

The term "substituted" means that one or more hydrogens on the designated atom is replaced by a selection of the indicated group, provided that the normal valence of the designated atom under the existing circumstances is not exceeded, and that the substitution results in a stable compound. Combinations of substituents and / or variables are allowed only if such combinations give rise to stable compounds. By "stable compound" or "stable structure" is meant a compound that is sufficiently strong to survive isolation in a useful degree of purity of a reaction mixture and formulation into an effective therapeutic agent.

The expression "in substantially purified form," herein, refers to the physical state of a compound after the compound is isolated from a synthetic process (e.g., from a reaction mixture), a natural source or a combination of these . The term "in substantially purified form" also refers to the physical state of a compound after the compound is obtained from a purification process or methods described herein or are well known to one skilled in the art (eg, chromatography, recrystallization and the like), in sufficient purity to be characterized by standard analytical techniques described or well known to one skilled in the art.

It should also be noted that it is assumed that any carbon and also heteroatom with valences not satisfied in the text, the schemes, examples and tables of the present, has a sufficient number of hydrogen atoms to satisfy the valences.

When a functional group in a compound is called "protected", this means that the group is in modified form to avoid unwanted side reactions at the protected site when the compound is subjected to a reaction. Suitable protection groups will be recognized by persons of ordinary skill in the art, as well as by reference to standard textbooks such as, for example, T. W. Greene et al, Protective Groups in Organic Synthesis (1991), Wiley, New York.

When any substitute or variable (for example, alkyl, R6, Ra, etc.) occurs more than once in any component or in the formula (I), its definition in each occurrence is independent of its definition in each other occurrence, unless otherwise stated.

As used herein, the term "composition" is intended to encompass a product composed of the specified ingredients in the specified amounts, as well as any product that results, directly or indirectly, from the combination of the specified ingredients in the specified amounts.

Also contemplated in the present description are the prodrugs and solvates of the compounds of the invention. A discussion of prodrugs is provided in T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems (1987) 14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, (1987) Edward B. Roche, ed., American Pharmaceutical Association and Pergamon Press. The term "prodrug" means a compound (e.g., a drug precursor) that is transformed in vivo to provide a tetracyclic indole derivative or a pharmaceutically acceptable salt or solvate of the compound. The transformation can occur by several mechanisms (for example, by metabolic or chemical procedures), as, for example, by hydrolysis in blood. For example, if a tetracyclic indole derivative or a pharmaceutically acceptable salt, hydrate or solvate of the compound contains a carboxylic acid functional group, a prodrug may consist of an ester formed by the substitution of the hydrogen atom of the acid group with such a group. such as, for example, (C 4 -Ce) alkyl, (C 2 -C 12) alkanoyloxymethyl, 1- (alkanoyloxy) ethyl having from 4 to 9 carbon atoms, 1-methyl-1- (alkanoyloxy) -ethyl which it has from 5 to 10 carbon atoms, alkoxycarbonyloxymethyl having from 3 to 6 carbon atoms, 1- (alkoxycarbonyloxy) ethyl having from 4 to 6 carbon atoms, 1-methyl-1- (alkoxycarbonyloxy) ethyl having 5 to 10 carbon atoms. at 8 carbon atoms, N- (alkoxycarbonyl) aminomethyl having from 3 to 9 carbon atoms, 1- (N- (alkoxycarbonyl) amino) ethyl having from 4 to 10 carbon atoms, 3-phthalidyl, 4-crotonolactonyl , gamma-butyrolacton-4-yl, di-N, N- (Ci-C2) alkylamino (C2-) C3) alkyl (such as β-dimethylaminoethyl), carbamoyl- (Ci-C2) alkyl, N, Nd (Ci- C2) alkylcarbamoyl- (C-C2) alkyl and piperidino-, pyrrolidino - or morpholin (C2-C3) alkyl, and the like.

Similarly, if a tetracyclic indole derivative contains an alcohol functional group, a prodrug can be formed by the replacement of the hydrogen atom of the alcohol group with a group such as, for example, (d-C6) alkanoyloxymethyl, 1 - ((Ci -C6) alkanoyloxy) ethyl, 1-methyl-1 - ((Cr C6) alkanoyloxy) ethyl, (CrC6) alkoxycarbonyloxymethyl, N- (dC6) alkoxycarbonylaminomethyl, succinoyl, (Ci-C6) alkanoyl, a-amino (Ci-C4) alkyl, a-amino (CrC4) alkylene-aryl, arylacyl and a-aminoacyl, or a-aminoacyl-a-aminoacyl, wherein each a-aminoacyl group is independently selected from the naturally occurring L-amino acids, -P (0) (OH) 2, -P (0) (0 (CrC6) alkyl) 2 or glycosyl (the radical resulting from the removal of a hydroxyl group from the hemiacetal form of a carbohydrate), and the like.

If a tetracyclic indole derivative incorporates an amine functional group, a prodrug can be formed by the replacement of a hydrogen atom in the amine group with a group such as, for example, R-carbonyl-, RO-carbonyl-, NRR ' -carbonyl- wherein R and R 'each is independently (Ci-Cio) alkyl, (C3-C7) cycloalkyl, benzyl, a natural a-aminoacyl, -C (OH) C (0) OY1 wherein Y1 is H , (C C6) alkyl or benzyl, -C (OY2) Y3 wherein Y2 is (d-C4) alkyl and Y3 is (Ci-C6) alkyl; carboxy (C C6) alkyl; amino (Ci-C4) alkyl or mono-N- or di-N, N- (C C6) alkylaminoalkyl; -C (Y4) Y5 where Y4 is H or methyl and Y5 is mono-N- or d, N, N- (Ci-C6) alkylamino morpholino; piperidin-1-yl or pyrrolidin-1-yl, and the like.

Pharmaceutically acceptable esters of the present compound include the following groups: (1) carboxylic acid esters obtained by esterification of the hydroxy group of a hydroxyl compound, wherein the non-carbonyl portion of the carboxylic acid moiety of the ester group is selected from alkyl straight or branched chain (e.g., methyl, ethyl, n-propyl, isopropyl, t-butyl, sec-butyl or n-butyl), alkoxyalkyl (e.g. methoxymethyl), aralkyl (e.g. benzyl), aryloxyalkyl (e.g. phenoxymethyl), aryl (for example phenyl optionally substituted, for example, with halogen, Ci. 4 alkyl) -O-alkyl (Ci-4) or amino); (2) sulfonate esters, such as alkyl- or aralkylsulfonyl (e.g., methanesulfonyl); (3) amino acid esters (for example L-valyl or L-isoleucyl); (4) phosphonate esters; and (5) mono-, di- or triphosphate esters. The phosphate esters may be further esterified, for example, by a Ci-2o alcohol or reae derivative thereof, or by a 2,3-di-acyl (C6-24) glycerol.

One or more compounds of the invention may exist in unsolvated forms and also in solvated forms with pharmaceutically acceptable solvents, such as water, ethanol, etc., and it is considered that the invention encompasses both solvated and unsolvated forms. "Solvate" means a physical association of a compound of this invention with one or more solvent molecules. This physical association It includes varying degrees of ionic and covalent bonds, including hydrogen bonds. In certain cases the solvate will be susceptible to isolation, for example when one or more solvent molecules are incorporated into the crystal lattice of the crystalline solid. "Solvate" covers solvates both in the solution phase and in isolators. Non-limiting examples of the solvates include ethanolates, methanolates, et cetera. A "hydrate" is a solvate in which the solvent molecule is water.

Optionally, one or more compounds of the invention can be converted into a solvate. The preparation of the solvates is generally known. Thus, for example, M. Caira et al, J. Pharmaceutical Sci., 93 (3), 601-611 (2004) describes the preparation of antifungal fluconazole solvates in ethyl acetate as well as water. Similar preparations of solvates, hemisolvates, hydrates and the like are described by E. C. van Tonder et al, AAPS PharmSciTechours. , 5 (1), article 12 (2004); and A. L. Bingham et al, Chem. Commun., 603-604 (2001). A typical non-limiting method includes dissolving the compound of the invention in the desired amounts of the desired solvent (organic, or water, or mixtures thereof), at a temperature higher than room temperature, and cooling the solution at a rate sufficient to form crystals that are then isolated by standard methods. Analytical techniques such as for example IR spectroscopy, show the presence of the solvent (or water) in the crystals as a solvate (or hydrate).

The tetracyclic indole derivatives can form salts that they are also within the scope of this invention. Reference to a tetracyclic indole derivative herein is meant to include reference to its salts, unless otherwise indicated. The term "salt (s)", as used herein, denotes acid salts formed with inorganic and / or organic acids, as well as basic salts formed with organic and / or inorganic bases. Further, when a tetracyclic indole derivative contains both a basic radical, such as, but not limited to a pyridine or imidazole and an acidic radical, such as, but not limited to a carboxylic acid, zwitterions ("internal salts") may be formed and are included in the term "salt (s)" as used herein. In one embodiment, the salt is a pharmaceutically acceptable salt (ie, non-toxic, physiologically acceptable). In another embodiment, the salt is different from a pharmaceutically acceptable salt. Salts of the compounds of formula (I) can be formed, for example, by reacting a tetracyclic indole derivative with an amount of acid or base, as an equivalent amount, in a medium such as One in which the salt precipitates or in a medium aqueous followed by lyophilization.

Exemplary acid addition salts include acetates, ascorbates, benzoates, benzenesulfonates, bisulfites, borates, butyrates, citrates, camphorates, camphorsulfonates, fumarates, hydrochlorides, hydrobromides, iodides, lactates, maleates, methanesulfonates, naphthalenesulfonates, nitrates, oxalates, phosphates, propionates , salicylates, succinates, sulfates, tartarates, thiocyanates, toluenesulfonates (also known as tosylates) and the like. In addition, acids that are generally considered adequate for the formation of pharmaceutically useful salts of basic pharmaceutical compounds are discussed, for example, by P. Stahl et al, Camille G. (eds.) Handbook of Pharmaceutical Salts. Properties, Selection and Use. (2002) Zurich: Wiley-VCH; S. Berge et al, Journal of Pharmaceutical Sciences (1977) 66 (1) 1-19; P. Gould, International J. of Pharmaceutics (1986) 33 201-217; Anderson et al, The Practice of Medicinal Chemistry (1996), Academic Press, New York; and The Orange Book (Food &Drug Administration, Washington, D.C. on their website). Whose descriptions are incorporated here for reference to this.

Exemplary basic salts include the ammonium salts, alkali metal salts such as sodium, lithium and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, salts with organic bases (for example organic amines) such as dicyclohexylamine, t-butylamine, choline, and salts with amino acids such as arginine, lysine, and so on. Groups containing basic nitrogen can be quaternized with agents such as lower alkyl halides (for example, methyl, ethyl and butyl chlorides, bromides and iodides), dialkyl sulfates (for example, dimethyl, diethyl and dibutyl sulfates), long chain (for example, chlorides bromides and decyl, lauryl and stearyl iodides), aralkyl halides (for example, benzyl and phenethyl bromides) and others.

All of these acid salts and base salts are intended to be pharmaceutically acceptable salts within the scope of the invention and all acid and base salts are considered equivalent to the free forms of the salts. corresponding compounds for the purposes of the invention.

The diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physicochemical differences, by methods known to those skilled in the art, such as, for example, chromatography and / or fractional crystallization. The enantiomers can be divided by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (for example, a chiral auxiliary such as a chiral alcohol or Mosher acid chloride), separating the diastereomers and converting (for example, hydrolyzing) the individual diastereomers to the corresponding pure enantiomers. Stereochemically pure compounds can also be prepared using chiral starting materials, or using salt resolution techniques. In addition, some of the tetracyclic indole derivatives may be atropisomers (e.g., substituted biaryls) and are considered as part of this invention. The enantiomers can also be separated directly using chiral chromatography techniques.

It is also possible that the tetracyclic indole derivatives may exist in different tautomeric forms, and all these forms are included within the scope of the invention. For example, all the keto-enol and the mine-enamine forms of the compounds are included in the invention.

All stereoisomers (eg, geometric isomers, optical isomers, etc.) of the present compounds (including those of the salts, solvates, hydrates, esters and prodrugs of the compounds, as well as as well as the salts, solvates and esters of the prodrugs), such as those that may exist due to asymmetric carbons on several substituents, including enantiomeric forms (which may exist even in the absence of asymmetric carbons), rotameric forms, atropoisomers and diastereomeric forms , are contemplated within the scope of this invention. If a tetracyclic indole derivative incorporates a double bond or a fused ring, both the cis- and trans- forms, as well as mixtures, are included in the scope of the invention.

The individual stereoisomers of the compounds of the invention may, for example, be substantially free of other isomers, or may be mixed, for example, as racemates or with all others, or other selected stereoisomers. The chiral centers of the present invention can have the S or R configuration, as defined by the recommendations of the IUPAC 1974. The use of the terms "salt", "solvate", "ester", "prodrug" and the like is conceived to be equally applied to the salt, solvate, ester and prodrug of the enantiomers, stereoisomers, rotamers, tautomers, positional isomers, racemates or prodrugs of the compounds of the invention.

In the compounds of formula (I), the atoms can exhibit their natural isotopic abundance, or one or more of the atoms can be artificially enriched in a particular isotope having the same atomic number, but an atomic mass or atomic mass number different from the atomic mass or predominant mass number found in the nature. The present invention relates to including all suitable isotopic variations of the compounds of generic formula I. For example, different forms of hydrogen isotopes (H) include protium (1H) and deuterium (2H). Protium is the predominant hydrogen isotope in nature. Enrichment for deuterium can produce certain therapeutic advantages, such as an increase in half-life in vivo or reduction in dose requirements, or it can provide a useful compound as a standard for the characterization of biological samples. The isotopically enriched compounds of formula (I) can be prepared without undue experimentation by conventional techniques well known to those skilled in the art or by procedures analogous to those described in the schemes and examples herein using appropriate isotopically enriched reagents and / or intermediates. In one embodiment, a compound of formula (I) has one or more of its hydrogen atoms substituted with deuterium.

The polymorphic forms of the tetracyclic indole derivatives and the salts, solvates, hydrates, esters and prodrugs of the tetracyclic indole derivatives are intended to be included in the present invention.

The following abbreviations are used below, and have the following meanings: Ac is acyl; AcCl is acetyl chloride; AcOH or HOAc is acetic acid; Amphos is (4- (N, N) -dimethylaminophenyl) -di-tert-butylphosphine; Aq is aqueous; BF3 «OEt.2 is boron trifluoride etherate; BOC or Boc is tert-butyloxycarbonyl; Boc20 is Boc anhydride; Boc-Pro-OH is BOC protected proline; L-Boc-Val-OH is BOC protected L-valine; BOP is benzotriazol-1-yl-oxy-tris- (dimethylamino) -phosphonium hexafluorophosphate; n-BuLi is n-butyl lithium; CBZ or Cbz is carbobenzoxy; DCM is dichloromethane; DDQ is 2,3-dichloro-5,6-dicyano-1,4-benzoquinone; Dess-Martin reagent is 1,1-triacetoxy-1,1-dihydro-l, 2-benziodoxol-3 (1 H) -one; DIPEA is diisopropylethylamine; DME is dimethoxyethane; DMF is?,? - dimethylformamide; DPPF is diphenylphosphinoferrocene; DMSO is dimethylsulfoxide; EtMgBr is ethylmagnesium bromide; EtOAc is ethyl acetate; Et20 is diethyl ether; EÍ3N or NEt3 is triethylamine; HATU is 0- (7-azabenzotriazol-1-yl) -N, N, N ', N'-tetramethyluronium hexafluorophosphate; HPLC is high performance liquid chromatography; HRMS is high resolution mass spectrometry; KOAc is potassium acetate; LCMS is liquid chromatography / mass spectrometry; LiHMDS is lithium hexamethyldisilazide; LRMS is low resolution mass spectrometry; Mel is iodomethane; MeOH is methanol; NBS is N-bromosuccinimide; NH4OAc is ammonium acetate; NMM is N-methylmorpholine; PD / C is palladium on carbon; Pd (PPh3) 4 is tetrakis (triphenylphosphine) palladium (0); PdCl 2 (dppf) 2 is [1, 1'-Bis (diphenylphosphino) ferrocene] dichloro palladium (II); PdCl2 (dpp 2'CH2Cl2 is complex [1, 1 '-Bis (diphenylphosphino) ferrocene] dichloro palladium (II) with dichloromethane, pinacol2B2 is bis (pinacolato) diboro, PPTS is pyridinium sulfonate p-toluene, RPLC is chromatography of reverse phase liquid, Select-F is 1-chloromethyl-4-fluoro-1,4-diazoniabicyclo [2.2.2] octane Bis- (tetrafluoroborate); SEM-CI is 2- (trimethylsilyl) chloride ethoxymethyl, TBAF is tetrabutylammonium fluoride, TBDMSCI is tert-butyldimethylsilyl chloride, TFA it is trifluoroacetic acid; Tf2Ü is triflic anhydride; THF is tetrahydrofuran; TLC is thin layer chromatography; and TosCI is p-toluenesulfonyl chloride.

The compounds of formula (I) The present invention provides tetracyclic indole derivatives of formula (I): and pharmaceutically acceptable salts thereof, wherein A, A ', G, R1, U, V, V, W, W, X, X', Y and Y 'are defined above for the compounds of formula (I).

In one embodiment, A and A 'are each a 5-membered heterocycloalkyl group.

In another embodiment, A and A 'are each a 6-membered heterocycloalkyl group.

In another embodiment, A and A 'are each selected independently of: In still another embodiment, A and A 'are each selected independently of: In another embodiment, A and A 'are each selected independently of: In another embodiment, A and A 'are each independently: In another modalida each independently: wherein each occurrence of R13 is independently H, CH3 or F.

In one embodiment, each occurrence of R4 is independently -C (0) - [C (R7) 2] qN (Rs) C (0) 0-R 1.

In another modality, each occurrence of R4 is independently: . wherein R is H, alkyl, haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl or heteroaryl and Ra is alkyl, haloalkyl, silylalkyl, 3- to 6-membered cycloalkyl or 4 to 6 membered heterocycloalkyl, aryl or heteroaryl.

In another modality, each occurrence of R4 is independently: , wherein R is H, methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH 2 CH 2 Si (CH 3) 3, -CH 2 CH 2 CF 3, pyl, benzyl or phenyl and R b is methyl, ethyl or isopropyl.

In yet another embodiment, each occurrence of R 4 is independently -C (0) CH (alkyl) -NHC (0) Oalkyl.

In another modality, each occurrence of R4 is independently: In one embodiment, A and A 'are each selected independently of: Y uilo of 3 to 6 members, heterocycloalkyl of 4 to 6 members, aryl or heteroaryl and Ra is alkyl, haloalkyl, silylalkyl, cycloalkyl of 3 to 6 members or heterocycloalkyl of 4 to 6 members, aryl or heteroaryl.

In another embodiment, A and A 'are each selected independently of: and R4 is: wherein Ra is H, methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH2CH2Si (CH3) 3, -CH2CH2CF3l pyl, benzyl or phenyl, and R1 is methyl, ethyl or isopropyl.

In another embodiment, A and A 'are each selected independently of: and R4 e In another embodiment, A and A 'are each selected independently of: Still in another modality, A and A 'are each: , where each occurrence of R13 is independently H, CH3 or F: and R4 is In one embodiment, G is -C (R3) 2-0-.

In another embodiment, G is -C (R1) = N-.

In another embodiment, G is -C (R3) 2-C (R3) 2- or -C (R1) = C (R14) -. Still in another embodiment, G is -C (R3) 2-C (R3) 2- or -C (R) = C (R14) -.

In one embodiment, G is -C (R3) 2-0- and each occurrence of R3 is independently selected from H, C1-C6 alkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl, and monocyclic heteroaryl of 5 or 6 members, wherein said 5 or 6 membered monocyclic heteroaryl group and said phenyl groups may be optionally substituted with up to 2 groups, which may be the same or different, and are selected from halo, -CN, Ci alkyl -C6, C1-C6haloalkyl, -O-C6alkyl, - (C6alkylene) -0-C6alkyl and -O-haloalkyl of Ci-C6. In another embodiment, G is -C (R3) 2-0-, where one occurrence of R3 is H, and the another occurrence of R3 is selected from C6 alkyl, cycloalkyl and phenyl, wherein said phenyl group may be optionally substituted with up to 2 groups, which may be the same or different, and are selected from halo, -CN, C1- alkyl C6, haloalkyl of C1-C6, -O-C6alkyl, - (alkylene of d-Ce -O-alkyl of d-C6 and -O-haloalkyl of Ci-C6.

In one embodiment, G is -C (R3) 2-0- and each occurrence of R3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, 1'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said Phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which may be the same or different and are selected from F, Cl, -CN, CH3l CF3, OCF3 and OCH2CH2OCH3.

In one embodiment, G is -CH (R3) -0-, wherein R3 is selected from C6 alkyl, phenyl, 5- or 6-membered monocyclic heteroaryl and 9- or 10-membered bicyclic heteroaryl, wherein said phenyl group, said 5- or 6-membered monocyclic heteroaryl group and said 9- or 10-membered bicyclic heteroaryl group may optionally be substituted with a C 1 -C 6 alkyl group.

In another embodiment, G is -CH (R3) -0-, wherein R3 is selected from methyl, phenyl, 5-methyl-thiophen-2-yl and benzothiophen-2-yl.

In another embodiment, G is -C (R3) 2-0-, where one occurrence of R3 is H, and the other occurrence of R3 is selected from phenyl, methyl, thiophenyl or benzothiophenyl, wherein said benzothiophenyl can be optionally substituted with d-Ce alkyl, cycloalkyl and phenyl, wherein said group phenyl may be optionally substituted with up to 2 groups, which may be the same or different and are selected from halo, -CN, Ci-C6 alkyl, haloCalkyl CrC6l -O-Ci-C6 alkyl, - (CrC6 alkylene) - 0-C6 alkyl- and -O-C6 alkyl.

In one embodiment, G is -C (R3) 2-O- and each occurrence of R3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, 1'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said Phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which may be the same or different and are selected from F, Cl, -CN, CH3, CF3, OCF3 and OCH2CH2OCH3.

In one embodiment, G is -C (R3) 2-0- and wherein one occurrence of R3 is H, and the other occurrence of R3 is selected from methyl, ethyl, isopropyl, cyclopropyl, 1'-methylcyclopropyl, methylenecyclopropyl, phenyl , pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which may be the same or different and are selected from F, Cl, -CN, CH3, CF3, OCF3 and OCH2CH2OCH3.

In one embodiment, G is -C (R3) 2-O-, wherein both R3 groups, together with the common carbon atom to which they are attached, come together to form a carbonyl group, a spirocyclic cycloalkyl group of 3 to 6 members or a 3 to 6-membered heterocycloalkyl spirocyclic group: In one embodiment, G is -C (R14) = N-, wherein R14 is selected from H, C1-C6 alkyl, cycloalkyl and phenyl, wherein said phenyl group may be optionally substituted with up to 2 groups, which may be same or different, and are selected from halo, -CN, Ci-C6 alkyl, haloalkyl of d-C6, -O-alkyl of C C6, - (alkylene of d-C6) -0-alkyl of d-C6 and -0-haloCalkyl CrC6.

In one embodiment, each occurrence of R3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, G-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups , which may be the same or different and are selected from F, Cl, -CN, CH3, CF3, OCF3 and OCH2CH2OCH3.

In another embodiment, two R3 groups on the same carbon atom, together with the common carbon atom to which they are attached, come together to form a carbonyl group, a 3 to 6-membered spirocyclic cycloalkyl group or a 3-membered heterocycloalkyl spirocyclic group. to 6 members.

In one embodiment, U is C (R2).

In another modality, U is CH.

In another modality, U is CF.

In one embodiment, V is C (R15).

In another modality, it is CH.

In another modality, V is CF.

In another modality, V is N.

In one embodiment, V is C (R15).

In another modality, V is CH.

In another modality, V is CF.

In another modality, V is N.

In still another embodiment, V and V are each CH.

In one embodiment, W is C (R15).

In another modality, W is CH.

In another modality, W is CF.

In another modality, W is N.

In one embodiment, W 'is C (R15).

In another modality, W 'is CH.

In another modality, W 'is CF.

In another modality, W 'is N.

In yet another embodiment, W and W are each CH.

In one embodiment, V, V W and W are each CH.

In one embodiment, R1 is absent.

In another modality, R is F.

In one embodiment, each occurrence of R3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, 1'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2. groups, which may be the same or different and are selected from F, Cl, -CN, CH3l CF3, OCF3 and OCH2CH2OCH3.

In another embodiment, two R3 groups on the same carbon atom, together with the common carbon atom to which they are attached, come together to form a carbonyl group, a spirocyclic cycloalkyl group of 3 to 6 members or a 3 to 6 membered spirocyclic heterocycloalkyl group.

In one embodiment, each occurrence of R1 (independently H or F.

In another embodiment, each occurrence of R10 is H.

In one modality, the group: has the structure In another modality, the group: has the structure: In another modality, the group: or has the structure: Still in another modality, the group: has the structure: In one embodiment, variables A, A ', G, R1, U, V, V, W, W, X, X', Y and Y 'for the compounds of formula (I) are independently selected one from another.

In another embodiment, the compounds of formula (I) are in substantially purified form.

In one embodiment, the compounds of formula (I) have the formula (the): (the) and pharmaceutically acceptable salts thereof, wherein: A and A 'are each independently a 5-membered monocyclic heterocycloalkyl, wherein said 5-membered monocyclic heterocyclic alkyl group may be optionally and independently substituted on one or more ring carbon atoms with R13, such that either of the two R13 groups in the same ring, together with the carbon atoms to which they are attached, can be joined to form a fused spirocyclic cycloalkyl group, with a 3 to 6 membered spirocyclic or bridged or a fused, bridged or spirocyclic 4 to 6-membered heterocycloalkyl group members, wherein said 5-membered monocyclic heterocycloalkyl contains 1 to 2 ring heteroatoms, each independently selected from N (R4) and Si (R16) 2; G is selected from -C (R3) 2-, -C (R3) 2-0-, -C (R14) = N-, - C (R3) 2-C (R3) 2- and -C (R14) = C (R1) - V and V each is selected independently of N and C (R15); R1 represents a substituent of the optional ring on the phenyl ring to which R1 is attached, wherein said C6 alkyl substituent and halo; each occurrence of R2 is independently selected from H, C1-C6 alkyl, 3 to 6 membered cycloalkyl, -0- (Ci-C6 alkyl), Ci-Cg haloalkyl -0- (CrC6 haloalkyl); halo, -OH, aryl, and heteroaryl each occurrence of R3 is independently selected from H, CrC6 alkyl, - (CrC6 alkylene) -O- (C1-C6 alkyl), 3 to 6 membered cycloalkyl, Ci haloalkyl -Ce, aryl, 5- or 6-membered monocyclic heteroaryl and benzyl, wherein said aryl group, said 5- or 6-membered monocyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which can be same or different, and are selected from halo, -CN, C1-C6 alkyl, C1-C6 haloalkyl, -O-C1-C6 alkyl, - (Ci-C6 alkylene) -O-C1-C6 alkyl and -O- (haloalkyl of C Ce); each occurrence of R4 is independently -C (O) - [C (R7) 2] N (R6) C (O) O-R11; each occurrence of R6 is selected independently of H and C1-C6 alkyl; each occurrence of R7 is selected independently of Ci-C6 alkyl, CrC6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl and 5 or 6 membered monocyclic heteroaryl, wherein said cycloalkyl group of 3 to 6 membered, said heterocycloalkyl group of 4 to 6 members, said aryl group and said 5 or 6 membered monocyclic heteroaryl group can optionally and independently be substituted with up to three R8 groups; each occurrence of R8 is independently selected from H, Ci-C6 alkyl, halo, Ci-C6 haloalkyl, Ci-C6 hydroxyalkyl, -OH, -C (0) NH- (C6 alkyl), -C (0) N (Ci-C6 alkyl) 2, -0- (C6 alkyl), -NH2, -NH (Ci-C6 alkyl), -N (Ci-C6 alkyl) 2 and -NHC ( 0) - (Ci-C6 alkyl); each occurrence of R10 is selected independently of H and halo; each occurrence of R 11 is independently CrC 6 alkyl; each occurrence of R13 is independently selected from H and halo, wherein two R13 groups, together with it or the carbon atoms to which they are attached, can optionally be joined to form a cycloalkyl group of 3 to 6 members or a heterocycloalkyl group of 4 to 6 members; each occurrence of R14 is independently selected from H, halo, Ci-C6 alkyl, - (CrC6 alkylene) -0-Ci-C6 alkyl, 3 to 6 membered cycloalkyl, Ci-C6 haloalkyl, aryl, monocyclic heteroaryl of 5 or 6 members and benzyl, wherein said aryl group, said heteroaryl group 5 or 6 membered monocyclic or the phenyl group of said benzyl group may be optionally substituted with up to 3 groups, which may be the same or different and are selected from halo, -CN, C1-C6 alkyl, C6 haloalkyl, - O-C-alkyl, - (C 1 -C 4 alkylene-O-C 1 -C 6 alkyl, and Ci-C 6 -O-haloalkyl; each occurrence of R15 is selected independently of H and halo; Y each occurrence of R16 is independently selected from C6 alkyl.

In one embodiment, for the compounds of formula (la), A and A1 are each a 5-membered monocyclic heteroaryl group.

In another embodiment, for the compounds of formula (la), A and A 'are each a 6-membered monocyclic heteroaryl group.

In another embodiment, for the compounds of formula (la), A and A 'is each selected independently of: In yet another embodiment, for the compounds of formula (la), A and A 'is each selected independently of: In another embodiment, for the compounds of formula (la), A and A 'is each selected independently of: In one embodiment, for the compounds of formula (la), A and A * is each: wherein each occurrence of Z is independently -Si (R13) 2-. -C (R13) 2- or -S-, and each occurrence of R13 is independently H, Me, F or two R13 groups together with Z, can be combined to form a cycloalkyl group from 3 to 6 spirocyclic members or a heterocycloalkyl group containing spirocyclic silyl of 3 to 6 members.

In another embodiment, for the compounds of formula (la), A and A 'are each independently: In another embodiment, for the compounds of formula (la), A and A 'are each independently: wherein each occurrence of R13 is independently H, CH3, or F.

In one embodiment, for the compounds of formula (la), each occurrence of R4 is independently -C (0) C (R7) 2NHC (0) 0 -R11 or -C (0) C (R7) 2N (R6) 2 .

In another embodiment, for the compounds of formula (la), each occurrence of R4 is independently -C (0) - [C (R7) 2] qN (R6) C (0) 0-R11.

In another embodiment, for compounds of formula (la), each occurrence of R 4 is independently -C (0) CH (alkyl) -NHC (0) Oalkyl, C (0) CH (cycloalkyl) -NHC (0) Oalkyl, C (0) CH (heterocycloalkyl) -NHC (0) Oalkyl, C (0) CH (aryl) -NHC (0) Oalkyl or C (0) CH (aryl) -N (alkyl) 2.

In another embodiment, for the compounds of formula (la), each occurrence of R4 is independently: wherein Rb is H, alkyl, haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl or heteroaryl and Ra is alkyl, haloalkyl, silylalkyl, 3- to 6-membered cycloalkyl or 4 to 6 membered heterocycloalkyl , aryl or heteroaryl.

In another embodiment, for the compounds of formula (la), each occurrence of R4 is independently: wherein Ra is H, methyl, ethyl, propyl, isopropyl, t-butyl, cyclopropyl, -CH2CH2Si (CH3) 3, -CH2CH2CF3, pyranyl, benzyl or phenyl and Rb is methyl, ethyl or isopropyl.

In yet another embodiment, for the compounds of formula (la), each occurrence of R 4 is independently -C (0) CH (alkyl) -NHC (0) Oalkyl.

In another embodiment, for the compounds of formula (la), each occurrence of R4 is independently: In one embodiment, for the compounds of formula (la), A and A 'is each selected independently of: Y 3 a 6 members, 4- to 6-membered heterocycloalkyl, aryl or heteroaryl and Ra is alkyl, haloalkyl, silylalkyl, 3- to 6-membered cycloalkyl or 4- to 6-membered heterocycloalkyl, aryl or heteroaryl.

In another embodiment, for the compounds of formula (la), A and A 'is each selected independently of: Y ,,,,, ilo, t-butyl, cyclopropyl, -CH2CH2Si (CH3) 3t -CH2CH2CF3, pyranyl, benzyl or phenyl, and R1 is methyl, ethyl or isopropyl.

In another embodiment, for the compounds of formula (la), A and A 'is each selected independently of: and R4 is: In another embodiment, for the compounds of formula (la), A and A 'is each selected independently of: and R Still in another embodiment, for the compounds of formula (la), A and A 'are each: , where each occurrence of R13 is independently H, CH3 or F: and R4 is In one embodiment, for the compounds of formula (la), G is -C (R3) 2-0-.

In another embodiment, for compounds of formula (la), G is -C (R14) = N- In another embodiment, for compounds of formula (la), G is -C (R3) 2-C (R3) 2 -, -C (R14) = C (R14) -.

In still another embodiment, for the compounds of formula (la), G is -C (R3) 2-C (R3) 2-, -C (R4) = C (R14) -.

In another embodiment, for the compounds of formula (la), G is -C (R3) 2-0-, wherein each occurrence of R3 is independently selected is H, C1-C6 alkyl, cycloalkyl, and phenyl, wherein said Phenyl group can be optionally substituted with up to 2 groups, which may be the same or different, and are selected from halo, -CN, C1-C6 alkyl, Ci-C6 haloalkyl, -O-Ci-C6 alkyl, - ( C6-C6 alkylene) -0-Ci-C6-alkyl and -O-C1-C6-haloalkyl.

In another embodiment, for the compounds of formula (la), G is -C (R3) 2-0-, wherein one occurrence of R3 is H, and the other occurrence of R3 is selected from Ci-C6 alkyl, cycloalkyl and phenyl, wherein said phenyl group may be optionally substituted with up to 2 groups, which may be the same or different, and are selected from halo, -CN, d-C6 alkyl, haloalkyl from C ^ Ce, -O-alkyl from C -CQ, - (alkylene of d-C6) -0-alkyl of CrOs and -O-haloalkyl of C1-C6.

In one embodiment, for compounds of formula (la), G is -C (R3) 2-0- and each occurrence of R3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, 1-methylcyclopropyl, methylenecyclopropyl , phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which may be the same or different and are selected from F, Cl, -CN, CH3, CF3, OCF3 and OCH2CH2OCH3.

In another embodiment, for the compounds of formula (la), G is -C (R3) 2-0- and wherein one occurrence of R3 is H, and the other occurrence of R3 is independently selected from H, methyl, ethyl, Isopropyl, cyclopropyl, 1-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl, and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which may be the same or different and are selected from F, Cl, -CN, CH3, CF3, OCF3 and OCH2CH2OCH3.

In one embodiment, for compounds of formula (la), G is -C (R14) = N-, wherein R14 is selected from H, C1-C6 alkyl, cycloalkyl and phenyl, wherein said phenyl group may optionally be substituted with up to 2 groups, which may be the same or different, and are selected from halo, -CN, Ci-C6 alkyl) Ci-C6l haloalkyl -O-Ci-C6 alkyl- (CrC6 alkylene) -0- alkyl of d-C6 and -O-haloalkyl of Ci-C6.

In one embodiment, for compounds of formula (la), U is C (R2).

In another embodiment, for the compounds of formula (la), U is CH.

In another embodiment, for the compounds of formula (la), U is CF.

In one embodiment, for the compounds of formula (la), V is C (R15).

In another embodiment, for compounds of formula (la), V is CH.

In another embodiment, for compounds of formula (la), V is N. In one embodiment, for compounds of formula (la), V is C (R15).

In another embodiment, for compounds of formula (la), V is CH.

In another embodiment, for compounds of formula (la), V is N. In one embodiment still, for compounds of formula (la), V and V are each CH.

In one embodiment, for the compounds of formula (la), R1 is absent.

In one embodiment, for compounds of formula (la), R1 is F.

In one embodiment, each occurrence of R3 is independently selected from H, methyl, ethyl, isopropyl, cyclopropyl, 1'-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl and pyrimidyl wherein said phenyl, pyridyl and pyrimidinyl group may be optionally substituted with up to 2 groups, which may be the same or different and are selected from F, Cl, -CN, CH3, CF3, OCF3 and OCH2CH2OCH3.

In one embodiment, for compounds of formula (la), each occurrence of R10 is independently H or F.

In another embodiment, for the compounds of formula (la), each occurrence of R10 is H.

In one embodiment, for the compounds of formula (la), the group: has the structure: In another embodiment, for the compounds of formula (la), the group: has the structure In another embodiment, for the compounds of formula (la), the group: has the e In one embodiment, the variables A, A ", G, R1, R2, R10, R15, U, V and V for the compounds of formula (la) are independently selected from each other.

In another embodiment, the compounds of formula (la) are in substantially pure form.

In one embodiment, the compounds of formula (I) have the Formula (Ib): (Ib) or a pharmaceutically acceptable salt thereof, wherein: R2 is H or F; each occurrence of R 3 is independently selected from H, C 6 alkyl, C 1 -C 6 haloalkyl, 3- to 6-membered cycloalkyl, 4- to 6-membered heterocycloalkyl, aryl, 5- or 6-membered monocyclic heteroaryl, bicyclic heteroaryl 9 or 10 members, -0- (C-C alkyl), CrC6-0 haloalkylene (C1-C6 haloalkyl); - (alkylene of d-C6) C (= 0) NH-alkyl, - (alkylene of Ci-C6) aryl and - (alkylene of d-C6) heteroaryl, wherein said aryl group, said monocyclic heteroaryl group of 5 or 6 members, said 9 or 10 membered bicyclic heteroaryl group or the phenyl group of said benzyl group can optionally be substituted with up to 3 groups, which may be the same or different, and are selected from -CN, Ci-C6 alkyl, haloalkyl of Ci-C6, -O-C ^ -CQ alkyl, - (Ci-C6 alkylene) -0-Ci-C6 alkyl, and Ci-C6-haloalkyl. each occurrence of R4 is independently selected from -C (0) 0- (C-alkyl, -C6), -C (0) -CH (R7) N (R6) 2 and -C (0) -CH (R7) C (0) 0-R11; each occurrence of R6 is independently H or Ci- C6 alkyl; each occurrence of R7 is independently selected from C1-C6 alkyl, phenyl, 4- to 6-membered heterocycloalkyl and 3-6 membered cycloalkyl; each occurrence of R 11 is independently C 1 -C 6 alkyl; each occurrence of R13a is independently H, Me or F; or two R13a groups that are attached to the same carbon atom, together with the common carbon atom to which they are attached, combine to form a 3-6 membered spirocyclic cycloalkyl group; each occurrence of R13b is independently H, or both groups R13b and a group R13a that are attached to the same ring, together with the ring carbon atoms to which they are attached, can be combined to form a fused cycloalkyl group of 3 to 6 members; Y R15 represents up to 2 substituents, each independently selected from H, halo, CrC6 alkyl, Ci-C6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl, 5 or 6 membered monocyclic heteroaryl, benzyl , -0- (Ci-C6 alkyl), CrC6-0 haloalkylene (C6 haloalkyl); - (Cr C6 alkylene) C (= 0) NH-alkyl, - (CrC6 alkylene) aryl and - (C6-C6 alkylene) heteroaryl, wherein said aryl group, said monocyclic heteroaryl group of 5 or 6 members or the phenyl group of said benzyl group may be optionally substituted with up to 3 groups, which may be the same or different, and are selected from halo, -CN, C1-C6 alkyl, C6 haloalkyl, - 0- Ci-C6 alkyl, - (Ci-C6 alkylene) -0-Ci-C6 alkyl and -O-haloalkyl of CrC6.

In one embodiment, for the compounds of formula (Ib), R2 is H. In another embodiment, for compounds of formula (Ib), R2 is F.

In one embodiment, for the compounds of formula (Ib), one occurrence of R3 is H and the other occurrence of R3 is selected from H, methyl, ethyl, isopropyl, cyclopropyl, r-methylcyclopropyl, methylenecyclopropyl, phenyl, pyridyl and pyrimidyl in wherein said phenyl, pyridyl and pyrimidinyl group can be optionally substituted with up to 2 groups, which may be the same or different and are selected from F, Cl, -CN, CH3, CF3, OCF3 and OCH2CH2OCH3.

In another embodiment, for the compounds of formula (Ib), two R3 groups that are bonded to the same carbon atom, together with the common carbon atom to which they are attached, come together to form a carbonyl group, a spirocyclic cycloalkyl group of 3 to 6 members or a 3 to 6 membered spirocyclic heterocycloalkyl group.

In one embodiment, for the compounds of formula (Ib), each occurrence of R 3 is C 1 -C 6 alkyl.

In another embodiment, for the compounds of formula (Ib), an occurrence of R3 is H.

In another embodiment, for the compounds of formula (Ib), one occurrence of R3 is H and the other occurrence of R3 is methyl, phenyl, 5- or 6-membered monocyclic heteroaryl or 9-membered bicyclic heteroaryl.

In still another embodiment, for the compounds of formula (Ib), one occurrence of R3 is H and the other occurrence of R3 is phenyl, methyl, In one embodiment, for the compounds of formula (Ib), each occurrence of R 4 is -C (0) CH (R 7) NHC (0) OR 11.

In another embodiment, for the compounds of formula (Ib), each occurrence of R 4 is -C (0) CH (R 7) NHC (0) OR 11 and each occurrence of R 11 is methyl.

In another embodiment, for the compounds of formula (Ib), each occurrence of R 4 is -C (0) CH (R 7) NHC (0) OR 11; each occurrence of R7 is isopropyl, benzyl, cyclopropyl or tetrahydropyranyl; and each occurrence of R11 is methyl.

In yet another embodiment, for the compounds of formula (Ib), each occurrence of R 4 is -C (0) CH (R 7) NHC (0) OR 11; each occurrence of R7 is isopropyl or tetrahydropyranyl; and each occurrence of R11 is methyl.

In another embodiment, for the compounds of formula (Ib), each occurrence of R 4 is -C (0) CH (R 7) NHC (0) OR 11; each occurrence of R7 is isopropyl; and each occurrence of R11 is methyl.

In still another embodiment, for the compounds of formula (Ib), each occurrence of R 4 is -C (0) CH (R 7) NHC (O) OR 11; each occurrence of R7 is tetrahydropyranyl; and each occurrence of R11 is methyl.

In one embodiment, for the compounds of formula (Ib), each occurrence of R13a is independently H or F.

In another embodiment, for the compounds of formula (Ib), two R13a groups that bind to the same carbon atom, together with the common carbon atom to which they are attached, combine to form a cycloalkyl group of 3 to 6 spirocyclic members .

In another embodiment, for the compounds of formula (Ib), two R13a groups that bind to the same carbon atom, together with the common carbon atom to which they are attached, combine to form a spirocyclic cyclopropyl group.

In one embodiment, for the compounds of formula (Ib), each occurrence of R13b is H.

In another embodiment, for the compounds of formula (Ib), one or both R 3b groups and a R 13a group that bind to the same ring, together with the ring carbon atoms to which they are attached, can be combined to form a group fused cycloalkyl of 3 to 6 members.

In another embodiment, for the compounds of formula (Ib), one or two R13b groups and a R13a group are attached to the same ring, together with the carbon atoms of the ring to which they are attached, can be combined to form a cyclopropyl group of 3. to 6 members.

In one embodiment, for compounds of formula (Ib), each occurrence of R15 is independently selected from H and F.

In another embodiment, for the compounds of formula (Ib), each occurrence of R 5 is H.

In one embodiment, for the compounds of formula (Ib), each occurrence of R2, R13 and R15 is independently selected from H and F.

In another embodiment, for the compounds of formula (Ib), each occurrence of R2, R13 and R15 is independently selected from H and F and an occurrence of R3 is H.

In one embodiment, the variables R2, R3, R13 and R15 for the compounds of formula (Ib) are independently selected from each other.

In another embodiment, the compounds of formula (Ib) are in substantially purified form.

In one embodiment, the compounds of formula (I) have the formula (le): (you) and pharmaceutically acceptable salts thereof, wherein: Ry is isopropyl or tetrahydropyranyl; Rz is isopropyl or tetrahydropyranyl; R2 is H or halo; R3 is selected from 3 to 6 membered cycloalkyl or phenyl, wherein said phenyl group may be optionally substituted with up to 2 groups, which may be the same or different, and are selected from halo, -CN, C6 alkyl, haloalkyl CrC6 , -O-alkyl of CrC6, - (alkylene of CC ^ -O- C6 alkyl, and -O-haloalkyl of C ^ -Ce each occurrence of R 3 is selected independently of H and halo; Y each occurrence of R15 is selected independently of H and halo.

In one embodiment, for compounds of formula (le), R3 is phenyl, wherein said phenyl group may be optionally substituted with up to 2 groups, which may be the same or different, and are selected from F, Cl, -CN, CH3, CF3, OCF3, OCH2CH2OCH3.

In another embodiment, for the compounds of formula (le), R3 is cyclopropyl.

In another embodiment, for the compounds of formula (le), R2 and R15 each is independently H or F.

In another embodiment, for compounds of formula (le), each occurrence of R 13 is independently H or F; In one embodiment, for the compounds of formula (le), R3 is phenyl; each occurrence of R13 is independently H or F, and R2 and R15 each one is independently H or F, wherein said phenyl group can be optionally substituted with up to 2 groups, which may be the same or different and are selected from F, Cl, -CN, CH3, CF3l OCF3 and OCH2CH2OCH3.

In another embodiment, for the compounds of formula (le), R3 is cyclopropyl; each occurrence of R13 is independently H or F; and R2 and R15 each independently is H or F.

In one embodiment, the compounds of formula (I) have the formula (Id): (Id) or a pharmaceutically acceptable salt thereof, where: R30 is Ci-C6 alkyl, aryl, 5- or 6-membered monocyclic heteroaryl or 9-membered bicyclic heteroaryl; Rw is H, or Rw and R, together with the ring carbon atoms to which they are attached, combine to form a fused cycloalkyl group of 3 to 6 members; Rx is H or F, or Rw and Rx, together with the carbon atoms of the ring to which they join, combine to form a fused cycloalkyl group of 3 to 6 members; Ry is H, or Ry and Rz, together with the ring carbon atoms to which they join, combine to form a fused cycloalkyl group of 3 to 6 members; R is H or F, or Ry and Rz, together with the carbon atoms of the ring to which they are attached, combine to form a fused cycloalkyl group of 3 to 6 members; In one embodiment, for compounds of formula (Id), R 30 is phenyl, methyl, In another embodiment, for the compounds of formula (Id), Rw and Rx, together with the ring carbon atoms to which they are bound, combine to form a fused cyclopropyl group.

In another embodiment, for the compounds of formula (Id), Ry and Rz, together with the ring carbon atoms to which they are bound, combine to form a fused cyclopropyl group.

In still another embodiment, for the compounds of formula (Id), Ry and Rz, together with the ring carbon atoms to which they are bound, combine to form a fused cyclopropyl group and Rw and Rx, together with the carbon atoms of the ring to which they bind, combine to form a fused cyclopropyl group.

In another embodiment, for compounds of formula (Id), Rw, Rx and Ry are each H and Rz is F.

In another embodiment, for the compounds of formula (Id), Rw and Rx, together with the ring carbon atoms to which they are bound, combine to form a fused cyclopropyl fused group; Ry is H and Rz is F, In one embodiment, for the compounds of formula (Id), the variables R30, Rw, Rx, Ry and Rz are independently selected from each other.

In another embodiment, the compounds of formula (le) are in substantially purified form.

Other embodiments of the present invention are the following: (a) A pharmaceutical composition comprising an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. (b) The pharmaceutical composition of (a), further comprising a second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators and anti-infective agents. (c) The pharmaceutical composition of (b), wherein the HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors and the HCV NS5B polymerase inhibitors. (d) A pharmaceutical combination that is (i) a compound of formula (I) and (ii) a second therapeutic agent selected from the group consisting of antiviral agents of HCV, immunomodulators and anti-infective agents; wherein the compound of formula (I) and the second therapeutic agent are each employed in an amount that makes the combination effective to inhibit the replication of HCV, or to treat HCV infection and / or reduce the likelihood or severity of the symptoms of HCV infection. (e) The combination of (d), wherein the HCV antiviral agent is an antiviral selected from the group consisting of inhibitors of HCV protease and inhibitors of HCV NS5B polymerase. (f) A method for inhibiting the replication of HCV in a subject in need thereof comprising administering to the subject an effective amount of a compound of formula (I). (g) A method for treating HCV infection and / or reducing the likelihood or severity of symptoms of HCV infection in a subject in need thereof comprising administering to the subject an effective amount of a compound of formula (I) . (h) The method of (g), wherein the compound of formula (I) is administered in combination with an effective amount of at least one second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators and anti-infective agents. . (i) The method of (h), wherein the HCV antiviral agent is an antiviral selected from the group consisting of HCV protease inhibitors. and inhibitors of HCV NS5B polymerase. (j) A method for inhibiting the replication of HCV in a subject in need thereof comprising administration to the subject of the pharmaceutical composition of (a), (b) or (c) or the combination of (d) or (e) . (k) A method for treating HCV infection and / or reducing the likelihood or severity of symptoms of HCV infection in a subject in need thereof comprising administration to the subject of the pharmaceutical composition of (a), (b) ) or (c) or the combination of (d) or (e).

The present invention also includes a compound of the present invention for use (i) in (ii) as a medicament for, or (iii) in the preparation of a medicament for: (a) medicine; (b) inhibiting HCV replication or (c) treating HCV infection and / or reducing the likelihood or severity of the symptoms of HCV infection. In these uses, the compounds of the present invention optionally can be used in combination with one or more other therapeutic agents selected from HCV antiviral agents, anti-infective agents, immunomodulators.

The present invention also includes the use of a compound of the present invention to (i) inhibit HCV replication or (ii) HCV infection treatment and / or reduce the likelihood or severity of the symptoms of HCV infection.

Additional embodiments of the invention include the pharmaceutical compositions, combinations and methods set forth in (a) - (k) above and the uses set forth in the preceding paragraph, wherein the compound of the present invention employed therein is a compound of one of the embodiments, aspects, classes, subclasses or characteristics of the compounds described above. In all these embodiments, the compound can optionally be used in the form of a pharmaceutically acceptable salt or hydrate as appropriate.

It should further be understood that the embodiments of the compositions and methods provided as (a) to (k) above are understood to include all modalities of the compounds, including those embodiments as a result of combinations of modalities.

The compounds of formula (I) can be referred to herein by chemical structure and / or chemical name. In the case that the structure and name of a compound of formula (I) are provided and it is found that there is a discrepancy between the chemical structure and the corresponding chemical name, it is understood that the chemical structure will predominate.

Non-limiting examples of the compounds of formula (I) include compounds 1-1542, as set forth in tables 1 and 2 in the examples section below.

Methods for the manufacture of the compounds of formula (I) The compounds of formula (I) can be prepared from known or readily prepared starting materials, following methods known to one skilled in the art of organic synthesis. Useful methods for the manufacture of the compounds of formula (I) are set forth in the examples below and generalized in the schemes 1-5 below. Alternative synthetic routes and analogous structures will be apparent to those skilled in the art of organic synthesis.

Scheme 1 shows useful methods for the manufacture of the compounds of formula G8, which correspond to the compounds of formula (I), wherein B is phenyl and the group -U-V-W - is -C (R2) = CH-N-.

SCHEME 1 Where Q and Q 'each independently is halo, hydroxy, or protected hydroxy such as methoxy or benzyloxy; M,? ', M "are each independently halo, hydroxy, or a protected hydroxy, triflate, boric acid or boronic ester, K represents a group that can form a bond with the indole nitrogen One skilled in the art of organic synthesis will recognize that when G is a single or multiple atom bridge, K must contain all the bridge atoms and a reactive group capable of forming a bond to the indole nitrogen. Examples of reactive groups capable of forming a bond to nitrogen are well known to one skilled in the art of organic synthesis and non-limiting examples include an alkyl halide, vinyl halide, aldehyde group or a vicinal dihalide. Z represents an appropriate aryl coupling partner that will be known to one skilled in the art of organic chemistry. An example of aryl coupling partners include but is not limited to halide and triflate when the other partner is a derivative of aryl boron or arylstannane.

Tetracyclic compounds of formula G8 can be prepared from suitably substituted indole derivatives of formula G6. An indole derivative of formula G6 is cyclized to provide tetracyclic compounds of formula G7. Indole derivatives of formula G6 can be obtained commercially or prepared by methods known to those skilled in the art of organic synthesis. In an illustrative example, compounds of formula G6 can be made through the dehydration of a hydrazide of formula G1 with a ketone of formula G2 to provide hydrazones of formula G3, which can be cyclized in the presence of a strong acid such as PPA or a Lewis acid such as aluminum chloride, to provide the hydroxyl-substituted indole compounds of formula G4. A compound of formula G4 can then be reacted with an aldehyde of formula R3-CHO to provide the cyclized compounds of formula G8, wherein G is -CHR3-0-.

Compounds of formula G7 can be made, for example, by the arylation of the 2-position of an indole of formula G5 with a coupling partner of formula G6. A compound of formula G7 can then be cyclized by means of the reaction of Y and K 'to provide the compounds of formula G8. It will be apparent to one skilled in the art of organic synthesis that the compounds of formulas G4 and G7 may undergo further manipulations of the functional group before cyclization as necessary to provide the scope of the compounds of formula (I).

Scheme 2 shows a useful method for the manufacture of compounds of formula G12, corresponding to the compounds of formula (I), wherein B is phenyl; X and X 'are each CH; And e 'are each N; and the group U-V-W- is -C (R2) = CH-N-.

SCHEME 2 Where D and D 'are each independently C (R13) 2, N (R4), S, O or Si (R16) 2; M and M 'are each independently of halo, triflate, boronic acid or boronic ester; PG is a protection group, such as Boc or 4-methoxybenzyl; R 4 is -C (0) R 11, -C (0) - [C (R 7) 2] q N (R 6) 2, -C (0) - [C (R 7) 2] q-R 11, -C (0) - [C (R7) 2] qN (R6) C (0) -R11, -C (0) [C (R7) 2] qN (R6) S02-R11, -C (O) - [C (R7) 2] qN (R6) C (0) 0 -R11 or -C (0) - [C (R7) 2] qC (0) 0-R11; and G, R1, R2 and R5 are as defined above for the compounds of Formula (I).

Scheme 3 shows a method useful for the manufacture of the compounds of formula G16, corresponding to the compounds of formula (I), wherein B is phenyl; X and X 'are each CH; And e 'are each N; and the group U-V-W- is -N = CH-N-.

SCHEME 3 Where Z and Z 'are each independently C (R) 2, N (R), S, O or Si (R16) 2; M and M * each are independently halo, triflate, acid boronic or boronic ester; X is halo; R4 is -C (0) R11, -C (0) - [C (R7) 2] qN (R6) 2, -C (OHC (R7) 2] q-R11, -C (0) - [C ( R7) 2] qN (R6) C (0) -R11, -C (0) [C (R7) 2] qN (R6) S02-R11, -C (0) - [C (R7) 2] qN ( R6) C (0) 0 -R11 or -C (0) - [C (R7) 2] qC (0) 0 -R11; K, Q and Q 'are defined above in relation to scheme 1, and G, R2 and R15 are defined as mentioned before the compounds of formula (I).

A 2-amino-aniline derivative of formula G12 can be reacted with an acyl halide of formula G13 to provide the 2-substituted benzimidazole compounds of formula G14. The compounds of formula G14 can be cyclized and derivatives to provide the compounds of formula G15, using methods analogous to those described in scheme 1 for the conversion of G6 to G8. A compound of formula G15 can then be carried forward to the compounds of formula G16 using methods analogous to those described in scheme 2.

Scheme 4 shows a useful method for the manufacture of the compounds of formula G20, corresponding to the compounds of formula (I), wherein B is pyridyl; X and X 'are each CH; And e 'are each N; and the group U-V-W - is -C (R2) = CH-N-.

SCHEME 4 G20 Where Z and? ' are each independently C (R 3) 2, N (R 4), S, O or Si (R 16) 2; M and M 'are each independently halo, triflate, boronic acid or boronic ester; R 4 is -C (0) R 11, -C (0) - [C (R 7) 2] q N (R 6) 2, -C (O) - [C (R 7) 2] q-R 11, -C (0) - [C (R7) 2] qN (R6) C (0) -R11, -C (0) [C (R7) 2] qN (R6) S02-R11, -C (0) - [C (R7) 2] qN (R6) C (0) 0 -R11 or -C (0) - [C (R7) 2] qC (0) 0-R11; and G, R1 and R2 are as defined above for the compounds of formula (I).

A pyridyl hydrazone of formula G17 can be converted to the tetracyclic compounds of formula G19 using methods analogous to those described in scheme 1 for the conversion of G3 to G8. A compound of formula G19 can then be carried forward to the G20 compounds using methods analogous to those described in scheme 2.

Scheme 5 shows useful methods for the manufacture of the compounds of formula G24, which are useful intermediates for the manufacture of the compounds of formula (I) wherein X and X 'are each CH and Y and Y' they are each N.

SCHEME 5 Where Z or Z 'is C (R13) 2, N (R4), S, O or Si (R16) 2; X is halo or triflate; and PG is an amino protecting group, such as Boc or 4-methoxybenzyl.

A suitably functionalized aldehyde of formula G21 can be reacted with glyoxal and ammonia to provide a substituted imidazole of formula G22. A compound of formula G22 may subsequently be mono-halogenated selectively to provide a mono-halogenated imidazole compound of formula G24. On the other hand, a compound of formula G24 can be subsequently di-halogenated to provide a compound of formula G23, which is then selectively reduced to provide a mono-halogenated imidazole compound of formula G24.

In some of the compounds of formula (I) contemplated in schemes 1-5, amino acids (such as, but not limited to proline, 4- (R) - fluoroproline, 4- (S) -fluoropropanol, 4,4-difluoroproline, 4,4-dimethylsilylproline, aza-bicyclo [2.2.1] heptane carboxylic acid, aza-bicyclo [2.2.2] octane carboxylic acid, (S) -2-piperidine carboxylic acid, valine, alanine, norvaline, etc.) are incorporated as part of the structures. Methods have been described in the organic chemistry literature as well as in Banchard US 2009/0068140 (Published on March 9, 2009) for the preparation of these intermediate amino acid derivatives.

A person skilled in the art of organic synthesis will recognize that the synthesis of fused tetracyclic nuclei contained in compounds of formula (I) may require protection of certain functional groups (i.e., derivation for chemical compatibility purpose with a particular reaction condition). ). Suitable protection groups for the different functional groups of these compounds and methods for their installation and disposal are well known in the art of organic chemistry. A summary of many of these methods can be found in Greene et al., Protective Groups in Organic Synthesis, Wiley-Interscience, New York, (1999).

A person skilled in the art of organic synthesis will also recognize a route for the synthesis of the fused tetracyclic nuclei of the compounds of formula (I) may be more desirable depending on the choice of substituents in the appendix. Additionally, a person skilled in the art will recognize that in some cases the order of the reactions presented here may differ. to avoid functional group incompatibilities and thus adjust the synthetic route accordingly.

A person skilled in the art of organic synthesis will recognize that the synthesis of certain fused tetracyclic nuclei of the compounds of formula () requires the construction of an amide bond. Useful methods for the manufacture of said amide bonds include, but are not limited to, the use of a reactive carboxy derivative (eg, an acid or ester halide at elevated temperatures) or the use of an acid with a coupling reagent. (for example, HOBt, EDCI, DCC, HATU, PyBrop) with an amine.

The preparation of multicyclic intermediates useful for making the fused tetracyclic ring systems of the compounds of formula (I) have been described in the literature and in compilations such as "Comprehensive Heterocyclic Chemistry" editions I, II and III, published by Elsevier and edited by AR Katritzky & R. JK Taylor. The manipulation of the required substitution patterns have also been described in the available chemical literature as summarized in compilations such as "Comprehensive Organic Chemistry" published by Elsevier and edited by DH R. Barton and W. D. Ollis; "Comprehensive Organic Functional Group Transformations" edited by edited by A.R. Katritzky & R. JK Taylor and "Comprehensive Organic Transformation" published by Wily-CVH and edited by R. C. Larock.

The compounds of formula (I) may contain one or more silicon atoms. The compounds contemplated in this invention in can be prepared using the carba-analogue methodology unless otherwise indicated. A recent review of the synthesis of silicon-containing compounds can be found in "Silicon Chemistry: from Atom to Extended Systems", Ed P. Jutzi & U. Schubet; ISBN 978-3-527- 30647-3. The preparation of silyl-containing amino acids have been described. See Bolm et ai, Angew. Chem. Int Ed., 39: 2289 (2000). Descriptions of the improved cell update (Giralt, J. Am. Chem. Soc, 128: 8479 (2006)) and reduced metabolic processing of silyl-containing compounds have been described (Johansson et al., Drug Metabolism &Disposition, 38: 73 (2009)).

The starting materials used and the intermediates prepared using the methods set forth in Schemes 1-5 can be isolated and purified if desired using conventional techniques, including but not limited to filtration, distillation, crystallization, chromatography and the like. Such materials can be characterized using conventional means, including physical constants and spectral data.

Uses of tetracyclic indole derivatives Tetracyclic indole derivatives are useful in human and veterinary medicine to treat or prevent a viral infection in a patient. In one embodiment, the tetracyclic indole derivatives can be inhibitors of viral replication. In another embodiment, the tetracyclic indole derivatives can be inhibitors of HCV replication. Accordingly, the tetracyclic indole derivatives are useful for the treatment of infections viral, such as HCV. According to the invention, the tetracyclic indole derivatives can be administered to a patient in need of treatment or prevention of a viral infection.

Accordingly, in one embodiment, the invention provides methods for the treatment of a viral infection in a patient comprising administering to the patient an effective amount of at least one tetracyclic indole derivative or a pharmaceutically acceptable salt thereof.

Treatment or Prevention of a Flaviviridae Virus The tetracyclic indole derivatives may be useful for treating or preventing a viral infection caused by the Flaviviridae family of viruses.

Examples of Flaviviridae infections that can be treated or prevented using the present methods include, without limitation, dengue fever, Japanese encephalitis, Kyasanur disease, Murray Valley encephalitis, St. Louis encephalitis, West Nile encephalitis, yellow fever. and infection with hepatitis C virus (HCV).

In one embodiment, the infection of Flaviviridae treated is infection by hepatitis C virus.

Treatment or Prevention of HCV infection Tetracyclic indole derivatives are useful in the inhibition of HCV (eg, HCV NS5A), the treatment of HCV infection and / or reduction of the probability or severity of the symptoms of HCV infection and the inhibition of viral replication of HCV and / or viral production of HCV in a cell-based system. For example, the tetracyclic indole derivatives are useful in the treatment of HCV infection after suspending the past exposure to HCV by such means as blood transfusion, exchange of body fluids, bites, accidental needle sticking, or exposure to HCV. the patient's blood during surgery or other medical procedures.

In one modality, the hepatitis C infection is acute hepatitis C. In another modality, the hepatitis C infection is chronic hepatitis C.

Accordingly, in one embodiment, the invention provides methods for treating HCV infection in a patient, methods comprising administering to the patient an effective amount of at least one tetracyclic indole derivative or a pharmaceutically acceptable salt thereof. In a specific embodiment, the amount administered is effective to treat or prevent HCV infection in the patient. In another specific embodiment, the amount administered is effective to inhibit viral replication of HCV and / or viral production in the patient.

The tetracyclic indole derivatives are also useful in the preparation and execution of assays for classifications for antiviral compounds. For example tetracyclic indole derivatives are useful for identifying mutations harboring HCV replicon cell lines within NS5A, which are excellent projection tools for more powerful antiviral compounds. In addition, the tetracyclic indole derivatives are useful for establishing or determining the binding site of other antivirals to the HCV replicase.

The compositions and combinations of the present invention may be useful for the treatment of a patient suffering from an infection related to any HCV genotype. Types and subtypes of HCV may differ in their antigenicity, level of viremia, severity of the disease produced and response to interferon therapy as described in Holland et al., Pathology, 30 (2): 192-195 (1998). The nomenclature established in Simmonds et al., J Gen Virol, 74 (Pt1 1): 2391-2399 (1993) is widely used and classifies the isolates into six main genotypes, 1 to 6, with two or more related subtypes, for example , 1a and 1 b. Additional genotypes 7-10 and 11 have been proposed, however the phylogenetic base on which this classification is based has been questioned, and thus isolates of type 7, 8, 9 and 1 1 have been reassigned as isolates type 6 and type 10 as type 3. (see Lamballerie et al., J Gen Virol, 78 (Pt1): 45-51 (1997)). The main genotypes have been defined as having sequence similarities of between 55 and 72% (mean 64.5%) and subtypes within the types that have 75-86% similarity (average 80%) when sequenced in the NS region -5 (see Simmonds et al., J Gen Virol, 75 (Pt 5): 1053-1061 (1994)).

Combination therapy In another embodiment, methods present for treating or preventing HCV infection may further comprise administration of one or more additional therapeutic agents that are not tetracyclic indole derivatives.

In one embodiment, an additional therapeutic agent is an antiviral agent.

In another embodiment, the additional therapeutic agent is an immunomodulatory agent, such as an immunosuppressive agent.

Accordingly, in one embodiment, the present invention provides methods for the treatment of a viral infection in a patient, the method comprising administering to the patient: (i) at least one tetracyclic indole derivative, or a pharmaceutically acceptable salt thereof, and (ii) at least one additional therapeutic agent that is different from a tetracyclic indole derivative, wherein the amounts administered together are effective to treat or prevent a viral infection.

When a combination therapy of the invention is administered to a patient, therapeutic agents in the combination, or a pharmaceutical composition or compositions comprising therapeutic agents, can be administered in any order such as, for example, sequentially, at the same time, together, simultaneously and the similar. The amounts of several active in said combination therapy may be different amounts (different amounts of dosage) or the same amounts (same dosage amounts). Thus, for non-limiting purposes of illustration, a tetracyclic indole derivative and an additional therapeutic agent may be present in fixed amounts (dosage amounts) in a single dosage unit (e.g., a capsule, a tablet and the like).

In one embodiment, the at least one tetracyclic indole derivative is administered for a time when the additional therapeutic agents exert their prophylactic or therapeutic effect, or vice versa.

In another embodiment, the at least one tetracyclic indole derivative and the additional therapeutic agents are administered at commonly used doses when said agents are used as monotherapy for the treatment of a viral infection.

In another embodiment, the at least one tetracyclic indole derivative and the additional therapeutic agents are administered at lower doses than commonly used doses when said agents are used as monotherapy for the treatment of a viral infection.

In yet another embodiment, at least one tetracyclic indole derivative and the additional therapeutic agents act synergistically and are administered at lower doses than commonly used doses when said agents are used as monotherapy for the treatment of a viral infection.

In one embodiment, at least one tetracyclic indole derivative and the additional therapeutic agents are present therein composition. In one embodiment, this composition is suitable for oral administration. In another embodiment, this composition is suitable for intravenous administration. In another embodiment, this composition is suitable for subcutaneous administration. In yet another embodiment, this composition is suitable for parenteral administration.

Viral infections and virus-related disorders that can be treated or prevented using the combination therapy methods of the present invention include, without limitation, those indicated above.

In one modality the viral infection is the HCV infection.

The at least one tetracyclic indole derivative and it or the additional therapeutic agents can act additively or synergistically. A synergistic combination may allow the use of lower doses of one or more agents and / or the less frequent administration of one or more agents of a combination therapy. A lower dose or less frequent administration of one or more agents may reduce the toxicity of the therapy without reducing its efficacy.

In one embodiment, the administration of at least one tetracyclic indole derivative and he or the additional therapeutic agents can inhibit the resistance of a viral infection to these agents.

Non-limiting examples of additional therapeutic agents useful in the present compositions and methods include an interferon, an immunomodulator, a viral replication inhibitor, an antisense agent, a ? d therapeutic vaccine, a viral polymerase inhibitor, a nucleoside inhibitor, a viral protease inhibitor, a viral helicase inhibitor, a virion production inhibitor, a viral entry inhibitor, a viral mount inhibitor, an antibody therapy (monoclonal or polyclonal) and any agent useful for the treatment of a disorder related to RNA-dependent polymerase.

In one embodiment, the additional therapeutic agent is a viral protease inhibitor.

In another embodiment, the additional therapeutic agent is an inhibitor of viral replication.

In another embodiment, the additional therapeutic agent is an NS3 protease inhibitor of HCV.

In yet another embodiment, the additional therapeutic agent is an inhibitor of HCV polymerase NS5B.

In another embodiment, the additional therapeutic agent is a nucleoside inhibitor.

In another embodiment, the additional therapeutic agent is an interferon.

In yet another embodiment, the additional therapeutic agent is an inhibitor of HCV replicase.

In another embodiment, the additional therapeutic agent is an antisense agent.

In another embodiment, the additional therapeutic agent is a therapeutic vaccine.

In a further embodiment, the additional therapeutic agent is an inhibitor of virion production.

In another embodiment, the additional therapeutic agent is an antibody therapy.

In another embodiment, the additional therapeutic agent is an NS2 inhibitor of HCV.

In yet another embodiment, the additional therapeutic agent is an NS4A inhibitor of HCV.

In another embodiment, the additional therapeutic agent is an NS4B inhibitor of HCV.

In another embodiment, the additional therapeutic agent is an NS5A inhibitor of HCV.

In yet another embodiment, the additional therapeutic agent is an NS3 helicase inhibitor of HCV.

In another embodiment, the additional therapeutic agent is an IRES inhibitor of HCV.

In another embodiment, the additional therapeutic agent is a p7 HCV inhibitor.

In a further embodiment, the additional therapeutic agent is an HCV entry inhibitor.

In another embodiment, the additional therapeutic agent is an inhibitor of the HCV assembly.

In one embodiment, additional therapeutic agents comprise a viral protease inhibitor and a viral polymerase inhibitor.

In yet another embodiment, additional therapeutic agents comprise a viral protease inhibitor and an immunomodulatory agent.

In yet another embodiment, additional therapeutic agents comprise a polymerase inhibitor and an immunomodulatory agent.

In another embodiment, the additional therapeutic agents comprise a viral protease inhibitor and a nucleoside.

In another embodiment, additional therapeutic agents comprise an immunomodulatory agent and a nucleoside.

In one embodiment, additional therapeutic agents comprise an HCV protease inhibitor and an HCV polymerase inhibitor.

In another embodiment, additional therapeutic agents comprise a nucleoside and inhibitor NS5A of HCV.

In another embodiment, the additional therapeutic agents comprise a viral protease inhibitor, an immunomodulatory agent and a nucleoside.

In a further embodiment, the additional therapeutic agents comprise a viral protease inhibitor, a viral polymerase inhibitor and an immunomodulatory agent.

In another embodiment, the additional therapeutic agent is ribavirin. HCV polymerase inhibitors useful in the compositions present and methods include, but are not limited to, VP-19744 (Wyeth / ViroPharma), PSI-7851 (Pharmasset), RG7128 (Roche / Pharmasset), PSI-938 (Pharmasset), PSI-7977 (Pharmasset), PF- 868554 / filibuvir (Pfizer), VCH-759 (ViroChem Pharma), HCV-796 (WyethA iroPharma), IDX-184 (Idenix), IDX-375 (Idenix), NM-283 (Idenix / Novartis), R-1626 ( Roche), MK-0608 (Isis / Merck), INX-8014 (Inhibitex), INX-8018 (Inhibitex), INX-189 (Inhibitex), GS 9190 (Gilead), A-848837 (Abbott), ABT-333 ( Abbott), ABT-072 (Abbott), A-837093 (Abbott), BI-207127 (Boehringer-lngelheim), BILB-1941 (Boehringer-lngelheim), MK-3281 (Merck), VCH222 (ViroChem), VCH916 (ViroChem) ), VCH716 (ViroChem), GSK-71 185 (Glaxo SmithKIine), ANA598 (Anadys), GSK-625433 (GlaxoSmithKine), XTL-2125 (XTL Biopharmaceuticals), and those described in Ni et al., Current Opinion in Drug Discovery and Development, 7 (4): 446 (2004); Tan et al., Nature Reviews, 1: 867 (2002); and Beaulieu et al., Current Opinion in Investigational Drugs, 5: 838 (2004).

Other inhibitors of HCV polymerase useful in the present compositions and methods include, but are not limited to, those described in international publication Nos. WO 08/082484, WO 08/082488, WO 08/083351, WO 08/136815, WO 09/032116, WO 09/032123, WO 09/032124 and WO 09/032125.

Interferons useful in the present compositions and methods include, but are not limited to, conjugates interferon alfa-2a, interferon alfa2b, interferon alfacon-1 and PEG-interferon alfa. The "PEG-interferon conjugates" alpha "are alpha interferon molecules covalently linked to a PEG molecule." Illustrative alpha PEG-interferon conjugates include interferon alfa-2a (Roferon ™, Hoffman La-Roche, Nutley, New Jersey) in the form of pegylated interferon alfa-2a (e.g., sold under the Pegasys ™ brand), interferon alfa-2b (Intron ™, from Schering-Plow Corporation) in the form of pegylated interferon alfa-2b (e.g., sold under the PEG-Intron ™ brand of Schering-Plow Corporation), interferon alfa-2b-XL (for example, sold under the brand PEG-Intron ™), interferon alfa-2c (Berofor Alpha ™, Boehringer Ingelheim, Ingelheim, Germany), PEG-interferon lambda (Bristol -Myers Squibb and ZymoGenetics), interferon alpha-2b alpha fusion polypeptides, interferon fused with human blood protein albumin (Albuferon ™, Human Genome Sciences), interferon Omega (Intarcia), Locteron controlled release interferon ( Biolex / OctoPlus), Biomed-510 (interferon omega), Peg-IL-29 (ZymoGenetics), Locteron CR (Octoplus), IFN-D-2b-XL (Flamel Technologies) and interferon consensus as defined by the determination of a consensus sequence of alphas interferon of natural origin (Infergen ™, Amgen, Thousand Oaks, California).

Antibody therapy agents useful in the present compositions and methods include, but are not limited to, antibodies specific for IL-10 (such as those described in U.S. Patent Publication No. US2005 / 0101770, humanized 12G8, an antibody humanized monoclonal against human IL-10, plasmids containing the nucleic acids encoding the heavy and light chains of 12G8 humanized are deposited with the American Type Culture Collection (ATCC) as deposit numbers PTA-5923 and PTA-5922, respectively) and the like).

Examples of viral protease inhibitors useful in the present compositions and methods include, but are not limited to, an HCV protease inhibitor.

HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, those described in US Pat. Nos. 7,494,988, 7,485,625, 7,449,447, 7,442,695, 7,425,576, 7,342,041, 7,253,160, 7,244,721, 7,205,330, 7,192,957, 7,186,747, 7,173,057, 7,169,760, 7,412,066, 6,914,122, 6,911,428, 6,894,072, 6,846,802, 6,838,475, 6,800,434, 6,767,991, 5,017,380, 4,933,443, 4,812,561 and 4,634,697; Patent Publication of E.U.A. Nos. US20020068702, US20020160962, US20050119168, US20050176648, US20050209164, US20050249702 and US20070042968; and International Publication No. WO 03/006490, WO 03/087092, WO 04/092161 and WO 08/124148.

Additional HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, SCH503034 (Boceprevir, Schering-Plow), SCH900518 (Schering-Plow), VX-950 (Telaprevir, Vertex), VX-500 ( Vertex), VX-813 (Vertex), VBY-376 (Virobay), MK-7009 (Merck), MK-5172 (Merck), BI-201335 (Boehringer Ingelheim), TMC-435 (Medivir Tibotec), ABT-450 (Abbott), TMC-435350 (Medivir), ITMN-191 / R7227 (InterMune / Roche), EA-058 (Abbott / Enanta), EA- 063 (Abbott / Enanta), GS-9132 (Gilead / Achillion), ACH-1095 (Gilead / Aehillon), IDX-136 (Idenix), IDX-316 (Idenix), ITMN-8356 (InterMune), ITMN-8347 ( Inter une), ITMN-8096 (InterMune), ITMN-7587 (InterMune), BMS-650032 (Bristol-Myers Squibb), VX-985 (Vertex) and PHX1766 (Phenomix).

Additional examples of HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, those described in Landro et al., Biochemistry, 36 (31): 9340-9348 (1997); Ingallinella et al., Biochemistry, 37 (25): 8906-8914 (1998); Llinás-Brunet et al., Bioorg Meó Chem Lett, 8 (13): 1713-1718 (1998); Martin et al., Biochemistry, 37 (331: 1459-1 1468 (1998); Dimasi et al., J Virol, 71 (10) 7461-7469 (1997); Martin et al., Protein Eng, 10 (5). ): 607-614 (1997), Elzouki et al., J Hepat, 27 (1): 42-48 (1997), BioWorid Today, 9 (217): 4 (November 10, 1998); US Patent Publication Nos. US2005 / 0249702 and US 2007/0274951; and International Publication Nos. WO 98/14181, WO 98/17679, WO 98/17679, WO 98/22496 and WO 99/07734 and WO 05/087731.

Additional examples of HCV protease inhibitors useful in the present compositions and methods include, but are not limited to, the following compounds: 105 Inhibitors of viral replication useful in the present compositions and methods include, but are not limited to, HCV replicase inhibitors, IRES inhibitors, NS4A inhibitors, NS3 helicase inhibitors, NS5A inhibitors, NS5B inhibitors, ribavirin, AZD-2836 (Astra Zeneca), BMS-790052 (Bristol-Myers Squibb, see Gao et al., Nature, 465: 96-100 (2010)), viramidine, A-831 (Arrow Therapeutics); an antisense agent or a therapeutic vaccine.

HCV NS4A inhibitors useful in the present compositions and methods include, but are not limited to, those described in U.S. Pat. Nos. 7,476,686 and 7,273,885; Patent publication of E.U.A. No. US20090022688; and International Publication Nos. WO 2006/019831 and WO 2006/019832. Additional HCV NS4A inhibitors useful in utility in the present compositions and methods include, but are not limited to, AZD2836 (Astra Zeneca) and ACH-806 (Achillon Pharmaceuticals, New Haven, CT).

HCV replicase inhibitors useful in the utility in the present compositions and methods include, but are not limited to, those described in U.S. Patent Publication. No. US20090081636.

The therapeutic vaccines useful in the present compositions and methods include, but are not limited to, IC41 (Intercell Novartis), CSL123 (Chiron / CSL), Gl 5005 (Globeimmune), TG-4040 (Transgen), GNI-103 (GENimmune) , Hepavaxx C (ViRex Medical), ChronVac-C (Inovio / Tripep), PeviPROTM (Pevion Biotect), HCV / MF59 (Chiron / Novartis) and Civacir (NABI).

Examples of additional therapeutic agents that may be useful in the present compositions and methods include, but are not limited to, Ritonavir (Abbott), TT033 (Benitec Tacere Bio / Pfizer), Sirna-034 (Sirna Therapeutics), GNI-104 (GENimmune ), GI-5005 (Globelmmune), IDX-102 (Idenix), Levovirin ™ (ICN Pharmaceuticals, Costa Mesa, California); Humax (Genmab), ITX-2155 (Ithrex / Novartis), PRO 206 (Progenies), HepaCide-l (NanoVirocides), MX3235 (Migenix), SCY-635 (Scynexis); KPE02003002 (Kemin Pharma), Lenocta (VioQuest Pharmaceuticals), IET - Interferon Enhancing Therapy (Transition Therapeutics), Zadaxin (SciClone Pharma), VP 50406 ™ (Viropharma, Incorporated, Exton, Pennsylvania); Taribavirin (Valeant Pharmaceuticals); Nitazoxanide (Romark); He owed 025 (Debiopharm); GS-9450 (Gilead); PF-4878691 (Pfizer); ANA773 (Anadys); SCV-07 (SciClone Pharmaceuticals); NIM-881 (Novartis); ISIS 14803 ™ (ISIS Pharmaceuticals, Carlsbad, California); Heptazyme ™ (Ribozyme Pharmaceuticals, Boulder, Colorado); Thymosin ™ (SciClone Pharmaceuticals, San Mateo, California); Maxamine ™ (Maxim Pharmaceuticals, San Diego, California); NKB-122 (JenKen Bioscience Inc., North Carolina); Alinia (Romark Laboratories), INFORM-1 (a combination of R7128 and ITMN-191); and mycophenolate mofetil (Hoffman-LaRoche, Nutley, New Jersey).

The dosages and dosing regimen of the other agents used in the combination therapies of the present invention for the treatment or prevention of HCV infection can be determined by the attending physician taking into consideration the approved doses and the regimen of dosage of the container insert; the age, sex and general health of the patient; and the type and severity of the viral infection or related disease or disorder. When administered in combination, the tetracyclic indole derivatives and the other agents can be administered simultaneously (i.e., in the same composition or in separate compositions one right after another) or sequentially. This is particularly useful when the components of the combination are given in different dosage schemes, for example, one component is administered once a day and another component is administered every six hours, or when the preferred pharmaceutical compositions are different, for example, one is a tablet and one is a capsule. Therefore, a kit comprising the separate dosage forms is convenient.

Generally, a total daily dose of at least one tretracyclic indole derivative (s) alone, or when administered as a combination therapy, may vary from about 1 to about 2500 mg per day, although variations will necessarily occur depending on the purpose of the treatment. therapy, the patient and the route of administration. In one embodiment, the dose is from about 10 to about 1000 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dose is from about 1 to about 500 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dose is from about 1 to about 100 mg / day, administered in a single dose or in 2-4 divided doses. In other modality, the dose is from about 1 to about 50 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dose is from about 500 to about 1500 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dose is from about 500 to about 1000 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dose is from about 100 to about 500 mg / day, administered in a single dose or in 2-4 divided doses.

In one embodiment, when the additional therapeutic agent is INTRON-A interferon alfa 2b (commercially available from Schering-Plow Corp.), this agent is administered by subcutaneous injection in 3MIU (12mcg) /0.5ml/TIW for 24 weeks or 48 weeks for the first time treatment.

In another embodiment, when the additional therapeutic agent is PEG-INTRON pegylated interferon alpha 2b (commercially available from Schering-Plow Corp.), this agent is administered by subcutaneous injection at 1.5 mcg / kg / week, within a range of 40 to 150 mcg / week, for at least 24 weeks.

In another embodiment, when the additional therapeutic agent is ROFERON A interferon alpha 2a (commercially available from Hoffmann-La Roche), this agent is administered by subcutaneous or intramuscular injection in 3MIU (11.1 mcg / ml) / TIW for at least 48 to 52 weeks, or alternatively 6MIU / TIW for 12 weeks followed by 3MIU / TIW for 36 weeks.

In another embodiment, when the additional therapeutic agent is PEGASUS pegylated interferon alpha 2a (commercially available from Hoffmann-La Roche), this agent is administered by subcutaneous injection at 180 mcg / 1 ml or 180 mcg / 0.5 ml, once a week for minus 24 weeks In yet another embodiment, when the additional therapeutic agent is INFERGEN interferon alfacon-1 (commercially available from Amgen), this agent is administered by subcutaneous injection at 9 mcg / TIW is 24 weeks for treatment for the first time and up to 15 mcg / TIW for 24 weeks for relapse or non-responsive treatment.

In a further embodiment, when the additional therapeutic agent is ribavirin (commercially available as ribavirin REBETOL from Schering-Plow or ribavirin COPEGUS from Hoffmann-La Roche), this agent is administered in a daily dose of approximately 600 to approximately 1400 mg / day for at least 24 weeks.

In one embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from: an interferon, an immunomodulator, a viral replication inhibitor, an antisense agent, a therapeutic vaccine, a viral polymerase inhibitor, a nucleoside inhibitor, a viral protease inhibitor, a viral helicase inhibitor, a viral polymerase inhibitor an inhibitor of virion production, a viral entry inhibitor, an inhibitor of assembly viral, an antibody therapy (monoclonal or polyclonal) and any agent useful for the treatment of an RNA-dependent polymerase related disorder.

In another embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV protease inhibitor, an HCV polymerase inhibitor, an inhibitor of HCV replication, a nucleoside, an interferon, a pegylated interferon and ribavirin. The combination therapies may include any combination of these additional therapeutic agents.

In another embodiment, one or more compounds of the present invention are administered with an additional therapeutic agent selected from an inhibitor of HCV protease, an interferon, a pegylated interferon and ribavirin.

In yet another embodiment, one or more compounds of the present invention are administered with two additional therapeutic agents selected from an HCV protease inhibitor, an inhibitor of HCV replication, a nucleoside, an interferon, a pegylated interferon, and ribavirin.

In another embodiment, one or more compounds of the present invention are administered with a protease inhibitor of HCV and ribavirin. In another specific embodiment, one or more compounds of the present invention are administered with pegylated interferon and ribavirin.

In another embodiment, one or more compounds of the present invention are administered with three additional therapeutic agents selected from a protease inhibitor of HCV, an inhibitor of HCV replication, a nucleoside, an interferon, a pegylated interferon and ribavirin.

In one embodiment, one or more compounds of the present invention is administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon and a viral replication inhibitor. In another embodiment, one or more compounds of the present invention is administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon and a viral replication inhibitor. In another embodiment, one or more compounds of the present invention are administered with one or more additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon and ribavirin.

In one embodiment, one or more compounds of the present invention are administered with an additional therapeutic agent selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon and a viral replication inhibitor. In another embodiment, one or more compounds of the present invention are administered with ribavirin.

In one embodiment, one or more compounds of the present invention are administered with two additional therapeutic agents selected from an HCV polymerase inhibitor, a viral protease inhibitor, an interferon and a viral replication inhibitor.

In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and another therapeutic agent.

In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon, and another therapeutic agent, wherein the additional therapeutic agent is selected from an HCV polymerase inhibitor, a viral protease inhibitor and a replication inhibitor. viral.

In yet another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and a viral protease inhibitor.

In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and a HCV protease inhibitor.

In another embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and boceprevir and telaprevir.

In a further embodiment, one or more compounds of the present invention are administered with ribavirin, interferon and an inhibitor of HCV polymerase.

In another embodiment, one or more compounds of the present invention are administered with pegylated alpha interferon and ribavirin.

In one embodiment, one or more compounds of the present invention are administered with one to three additional therapeutic agents, wherein the additional therapeutic agents are each independently selected from HCV protease inhibitors, NS5A HCV inhibitors. and inhibitors of HCV NS5B polymerase.

In one embodiment, one or more compounds of the present invention are administered with MK-5172.

In another embodiment, one or more compounds of the present invention are administered with MK-7009.

In another embodiment, one or more compounds of the present invention are administered with boceprevir.

In yet another embodiment, one or more compounds of the present invention are administered with telaprevir.

In another embodiment, one or more compounds of the present invention are administered with PSI-938.

In another embodiment, one or more compounds of the present invention are administered with PSI-7977.

In yet another embodiment, one or more compounds of the present invention are administered with RG-7128.

In one embodiment, one or more compounds of the present invention are administered with (i) a compound selected from PSI-7977, PSI-938 RG-7128; and (ii) a compound selected from boceprevir, telaprevir, MK-7009 and MK-5172.

In another embodiment, one or more compounds of the present invention are administered with PSI-7977 and MK-5172.

Compositions and Administration Due to their activity, the tetracyclic indole derivatives are useful in human and veterinary medicine. As described above, the tetracyclic indole derivatives are useful for treating or preventing HCV infection in a patient in need thereof.

When administered to a patient, the tetracyclic indole derivatives can be administered as a component of a composition comprising a pharmaceutically acceptable carrier or vehicle. The present invention provides pharmaceutical compositions comprising an effective amount of at least one tetracyclic indole derivative and a pharmaceutically acceptable carrier. In the pharmaceutical compositions and methods of the present invention, the active ingredients will usually be administered in admixture with suitable carrier materials suitably selected with respect to the intended form of administration, i.e., oral tablets, capsules (either solid filled, semi-solid). solid filling or liquid filling), powders for constitution, oral gels, elixirs, dispersible granules, syrups, suspensions and the like and consistent with conventional pharmaceutical practices. For example, for oral administration in the form of tablets or capsules, the active component can be combined with any innocuous pharmaceutically acceptable inert carrier, such as lactose, starch, sucrose, cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, talc , mannitol, ethyl alcohol (liquid forms), etcetera. Solid preparations include powders, tablets, dispersible granules, capsules, pills and suppositories. The powders and tablets may be comprised from about 0.5 to about 95 percent of the composition of the invention. Tablets, powders, pills and capsules can be used as solid dosage forms suitable for oral administration.

In addition, when desired or required, suitable binders, lubricants, disintegrating agents and coloring agents may also be incorporated into the mixture. Suitable binders include starch, gelatin, natural sugars, corn sweeteners, natural and synthetic gums such as acacia, sodium alginate, carbiximethylcellulose, polyethylene glycol and waxes. Among the lubricants there may be mentioned for use in these dosage forms boric acid, sodium benzoate, sodium acetate, sodium chloride, and the like. The disintegrants include starch, methylcellulose, guar gum, and so on. Sweetening, flavoring and preservative agents may also be included where appropriate.

Liquid preparations include solutions, suspensions and emulsions, and may include water or water-propylene glycol solutions for parenteral injection.

Liquid preparations may also include solutions for intranasal administration.

Aerosol preparations suitable for inhalation may include solutions and solids in powder form, which may be in combination with a pharmaceutically acceptable carrier, such as a gas inert tablet.

Also included are solid preparations intended to be converted, shortly before use, into liquid preparations for oral or parenteral administration. Such liquid forms include solutions, suspensions and emulsions.

To prepare suppositories, a low-melting wax, such as a mixture of fatty acid glycerides or cocoa butter, is first melted, and the active ingredient is dispersed homogeneously therein, for example by stirring. Then, the molten homogeneous mixture is emptied into conveniently dimensioned molds, allowed to cool and thereby solidify.

Additionally, the compositions of the present invention can be formulated in sustained release form to provide controlled rate release of one or more of the components or active ingredients to optimize the therapeutic effects, i.e., antiviral activity and the like. Suitable dosage forms for sustained release include layered tablets containing disintegration rate variation layers or controlled release polymer matrices impregnated with the active components and in tablet form or capsules containing said impregnated or encapsulated porous polymer matrices.

In one embodiment, one or more of the tetracyclic indole derivatives are administered orally.

In another embodiment, one or more of the tetracyclic indole derivatives are administered intravenously.

In another embodiment, one or more of the tetracyclic indole derivatives are administered topically.

In yet another embodiment, one or more tetracyclic indole derivatives are administered sublingually.

In one embodiment, a pharmaceutical preparation comprising at least one tetracyclic indole derivative is in unit dosage form. In such form, the preparation is subdivided into unit doses containing effective amounts of the active components.

Compositions may be prepared according to conventional mixing, granulating or coating methods, respectively, and the present compositions may contain, in one embodiment, from about 0.1% to about 99% tetracyclic indole derivative (s) by weight or volume. In various embodiments, the present compositions may contain, in one embodiment, from about 1% to about 70% or from about 5% to about 60% tetracyclic indole derivative (s) by weight or volume.

The amount of tetracyclic indole derivative in a unit dose of preparation can be varied or adjusted from about 1 mg to about 2500 mg. In various embodiments, the amount is from about 10 mg to about 1000 mg, 1 mg to about 500 mg, 1 mg to about 100 mg and 1 mg to about 100 mg.

For convenience, the total daily dose can be divided and Administer in portions during the day as required. In one embodiment, the daily dose is administered in one portion. In another embodiment, the total daily dose is administered in two divided doses over a period of 24 hours. In another embodiment, the total daily dose is administered in three divided doses over a period of 24 hours. In yet another embodiment, the total daily dose is administered in four divided doses over a period of 24 hours.

The amount and frequency of administration of the tetracyclic indole derivatives will be regulated according to the judgment of the physician attending, considering such factors as the age, condition and size of the patient as well as the severity of the symptoms to be treated. Generally, a total daily dose of the tetracyclic indole derivatives ranges from about 0.1 to about 2000 mg per day, although variations will necessarily occur depending on the therapy objective, the patient and the route of administration. In one embodiment, the dose is from about 1 to about 200 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dose is from about 10 to about 2000 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dose is from about 100 to about 2000 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dose is from about 500 to about 2000 mg / day, administered in a single dose or in 2-4 divided doses.

The compositions of the invention may comprise one or more additional therapeutic agents, selected from those indicated above. Accordingly, in one embodiment, the present invention provides compositions comprising: (i) at least one tetracyclic indole derivative or a pharmaceutically acceptable salt thereof; (ii) one or more additional therapeutic agents that are not a tetracyclic indole derivative; and (iii) a pharmaceutically acceptable carrier, wherein the amounts in the composition together are effective for treating HCV infection.

In one embodiment, the present invention provides compositions comprising a compound of formula (I) and a pharmaceutically acceptable carrier.

In another embodiment, the present invention provides compositions comprising a compound of formula (I), a pharmaceutically acceptable carrier and a second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators and anti-infective agents.

In another embodiment, the present invention provides compositions comprising a compound of formula (I), a pharmaceutically acceptable carrier and additional therapeutic agents of wto, each of which is independently selected from the group consisting of antiviral agents of HCV, immunomodulators and anti-infective agents.

Kits In one aspect, the present invention provides a kit comprising a therapeutically effective amount of at least one tetracyclic indole derivative, or a pharmaceutically acceptable salt, solvate, ester or prodrug of said compound and a pharmaceutically acceptable carrier, vehicle or diluent.

In another aspect, the present invention provides a kit comprising an amount of at least one tetracyclic indole derivative, or a pharmaceutically acceptable salt, solvate, ester or prodrug of said compound and an amount of at least one additional therapeutic agent listed above, wherein the amounts of two or more active ingredients result in a desired therapeutic effect. In one embodiment, one or more tetracyclic indole derivatives and one or more additional therapeutic agents are provided in the same container. In one embodiment, one or more tetracyclic indole derivatives and one or more additional therapeutic agents are provided in separate containers.

EXAMPLES General methods Solvents, reagents and intermediates that are commercially available are used as received. Reagents and intermediates that are not commercially available are prepared in the manner as described below. The 1H NMR spectra when reported, are obtained in a Varn VNMR 400 (400 MHz) or a Bruker Avance 500 (500 MHz) system and the resonances are reported as downfield ppm of Me4Si with the number of protons, multiplicities, and constants coupling in Hertz indicated in parentheses. Where LC / MS data are presented, analyzes are performed using an Agilent 6110A MSD or an API-100 mass spectrometer from Applied Biosystems and SCL-10A Shimadzu column: C18 column from Alltech platinum C18, 3 microns, 33 mm x 7 mm ID; typical gradient flow: 0 minutes - 10% CH3CN, 5 minutes - 95% CH3CN, 5-7 minutes - 95% CH3CN, 7 minutes - high. The retention time and the ion of origin observed are provided. Chromatography is performed using partially automated systems manufactured by Gilson, ISCO or Biotage. Unless otherwise indicated, chromatography is performed using a gradient elution of hexanes / ethyl acetate, from 100% hexanes to 100% ethyl acetate.

EXAMPLE 1 Preparation of the compound lnt-1a lnt-1a To a solution of L-Valine (10.0 g, 85.3 mmol) in aqueous 1 M NaOH solution (86 ml) at room temperature is added solid sodium carbonate (4.60 g, 43.4 mmol). The reaction mixture was cooled to 0 ° C (ice bath) and then methyl chloroformate (7.20 ml, 93.6 mmol) is added dropwise about 20 minutes. The reaction mixture is then allowed to warm to room temperature and allowed to stir at room temperature for additional 4 hours. The reaction mixture is then diluted with diethyl ether (100 ml), the resulting solution is cooled to 0 ° C, and then concentrated hydrochloric acid (18 ml, 216 mmol) is added slowly. The reaction is extracted with EtOAc (3 x 100 mL) and the combined organics are dried over MgSO4, filtered and concentrated in vacuo to provide the lnt-1a compound (13.5 g, 90%), which is used without further purification.

The following intermediates can be prepared by the reaction of L-valine or L-threonine with isopropyl chloroformate, 2-methoxyethyl chloroformate or with 1-methylcyclopropyl hydroxysuccinimide respectively as above. lnt-1d InMe EXAMPLE 2 Preparation of intermediate compound lnt-2a lnt-2a To a solution of D-phenylglycine (10.0 g, 66.1 mmol) and NaOH (21.2 g, 265 mmol) in water (60 mL) at 0 ° C is added methyl chloroformate (10.2 mL, 133 mmol) dropwise around 20 minutes. The resulting mixture is allowed to stir at 0 ° C for 1 hour, then acidified using concentrated hydrochloric acid (25 ml, 300 mmol). The acidic solution is extracted with EtOAc (3 x 100 mL) and the combined organics are dried over MgSO4, filtered and concentrated in vacuo to provide the lnt-2a compound (12.6 g, 91%), which is used without a purification. additional.

The following intermediates can be prepared by the reaction of glycine, L-Alanine and 4-F phenylglycine respectively with methyl chloroformate (Aldrich Inc.) using the method described above Int-2b lnt-2c lnt-2d EXAMPLE 3 Preparation of intermediate compound lnt-3a lnt-3a A solution of D-phenylglycine (20.0 g, 132 mmol), 37% aqueous formaldehyde (66 ml, 814 mmol) and 5% Pd on carbon (8.0 g, mmol) in a mixture of methanol (80 ml) and HCl 1 N (60 ml) are placed in a hydrogenation stirrer and shaken under a hydrogen atmosphere of 35-40 psi for 4 hours. The reaction is then rinsed with nitrogen, filtered through a pad of Celite and concentrated in vacuo to provide lnt-3a compound (29.7 g, amount) as a white solid, which is used without an additional purification.

EXAMPLE 3A lnt-3b lnt-3c To a solution of (R) -2-amino-2- (4-fluorophenyl) acetic acid (Int 3b) in MeOH (20 ml) at 0 ° C, sodium cyanoborohydride is added in a portionwise fashion over ~20 minutes. The resulting mixture is allowed to stir for 10 minutes and then acetaldehyde is added dropwise via syringe for ~ 10 minutes. The resulting solution is left stirring for 1 hour at 0 ° C and then allowed to warm to room temperature. After 12 hours, LC-MS indicates disappearance of lnt-3b, and the mixture is re-cooled to 0 ° C, treated carefully with water (3 ml) followed by the addition of concentrated HCl for -40 minutes (pH ~ 2.0). The cooling bath is removed and the mixture is allowed to stand for about 15 hours. The precipitate is collected by filtration to provide lnt-3C.

The lnt-3d intermediate can be prepared using the above glycine R-phenyl process. enlglycine lnt-3d EXAMPLE 4 Preparation of intermediate compound lnt-4f Step A - Preparation of compound lnt-4b To a solution of methyl 2- (benzyloxycarbonylamino) -2- (dimethoxyphosphoryl) acetate (10.0 g, 30.2 mmol, produced as described in Hamada et al., Organic Letters, English 20: 4664-4667 (2009)) in THF ( 100 ml) at -20 ° C is added tetramethylguanidine (4.20 ml, 33.2 mmol). The reaction mixture is allowed to stir at -20 ° C for 1 hour after dihydro-2H-pyran 4 (3H) -one (4a) is added (3.1 ml, 33.2 mmol) in THF (50 ml) and the reaction mixture is warmed to room temperature and allowed to stir for about 15 hours. EtOAc (200 mL) is added and the organic mixture is washed with water (3? 50 mL) and brine (50 mL). The organic layers are combined and dried with Na 2 SO 4, filtered and concentrated in vacuo. The residue obtained is purified using flash chromatography on an ISCO 330 g Redi-Sep column using 0-35% EtOAc / hexanes as the eluent to give the compound lnt-4b as a white solid (615 mg, 45%). 1 H NMR (CDCl 3) d 7.40-7.30 (m, 5H), 6.00 (br s, 1 H), 5.12 (s, 2H), 3.80-3.65 (m, 7H), 2.92 (m, 2H), 2.52-2.48 (m, 2H).

Step B - Preparation of the compound Int - 4c To a solution of lnt-4b (2.43 g, 7.96 mmol) in methanol (160 ml) previously purged with N2 is added (-) - 1,2-Bis ((2S, 5S) -2,5-dimethylphospholane) ethane ( cyclooctadiene) rhodium (I) tetrafluoroborate (487 mg, 0.880 mmol) under N2. The mixture is stirred on a Parr shaker for 18 hours at 50 psi H2. After evacuating the hydrogen, the suspension is filtered and the filtrate concentrated in vacuo to provide the lnt-4c compound as a white solid (1.30 g, 53%). 1 H NMR (CDCl 3) d 7.40-7.30 (m, 5H), 5.32 (br s, 1H), 5.12 (s, 2H), 4.40-4.30 (m, 1H), 4.00-3.95 (m, 2H), 3.75 ( s, 3H), 3.40-3.25 (m, 2H), 2.10-1.95 (m, 1 H), 1.50-1.45 (m, 4H).

Step C - Preparation of the compound lnt-4d To a suspension of 50% palladium on carbon (10% wet, 200 mg) in absolute ethanol (20 ml) under nitrogen is added Int-4c (1.06 g, 3.45 mmol). With stirring, the solution is placed under vacuum for 30 seconds and then opened to a balloon of hydrogen gas for 2 hours. After evacuating the hydrogen, the suspension is filtered through a pad of Celite and the pad washed with ethanol (2 * 20 ml). The filtrate is concentrated in vacuo to provide the Int-4d compound as a colorless oil (585 mg, 98%). 1 H NMR (CDCl 3) d 4.06-3.96 (m, 2H), 3.73 (s, 3H), 3.48-3.28 (m, 3H), 1.92-1.78 (m, 1H), 1.61-1.47 (m, 6H).

Step D - Preparation of the compound lnt-4e To a solution of the compound lnt-4d (585 mg, 3.37 mmol) and triethylamine (0.710 mL, 5.09 mmol) in CH 2 Cl 2 (6 mL) is added methyl chloroformate (0.290 mL, 3.76 mmol). The reaction is allowed to stir at room temperature for about 15 hours, then water (15 ml) is added and the aqueous mixture is extracted with CH2Cl2 (3 * 20 ml). The combined organic extracts are dried over Na 2 SO 4, filtered and concentrated in vacuo. The residue obtained is purified using flash chromatography on a 24 g ISCO Redi-Sep column using 0-3% MeOH / CH 2 Cl 2 as the eluent to give the lnt-4e compound as a colorless oil (600 mg, 77%). 1 H NMR (CDCl 3) d 5.27-5.18 (m, 1H), 4.38-4.28 (m, 1H), 4.06-3.96 (m, 2H), 3.75 (s, 3H), 3.69 (s, 3H), 3.39-3.30 (m, 2H), 2.09-1.94 (m, 1 H), 1. 59-1.48 (m, 4H).

Step E - Preparation of the compound lnt-4f To a solution of the compound lnt-4e (600 mg, 2.59 mmol) in THF (50 mL) is added lithium hydroxide monohydrate (218 mg, 5.19 mmol) in water (50 mL). The reaction is allowed to stir at room temperature for 2 hours then concentrated in vacuo to half its original volume. The concentrated mixture is acidified with 6N HCl and extracted with EtOAc (7 * 50 mL). The combined organic extracts are dried over Na2SO4, filtered and concentrated in vacuo to provide the lnt-4f compound as an off-white solid (485 mg, 86%). H NMR (CD3OD) d 4.09-4.07 (m, 1H), 3.96-3.92 (m, 2H), 3.65 (s, 3H), 3.40-3.34 (m, 2H), 2.10-1.99 (m, 1 H), 1.56-1.47 (m, 4H).

EXAMPLE 5 Preparation of intermediate compound lnt-5f lnt-5d | nt-Se lnt-5f Step A - Preparation of the compound lnt-5a To a solution of methyl 2- (benzyloxycarbonylamino) -2- (dimethoxyphosphoryl) acetate (1.50 g, 4.52 mmol) in THF (5 mL) at -20 ° C is added tetramethylguanidine (625 μ ?, 4.98 mmol). The reaction mixture is allowed to stir at -20 ° C for 1 hour after tere-butyl 4-oxopiperidine-1-carboxylate is added (992 mg, 4.97 mmol) in THF (2 ml) and the reaction mixture heat to room temperature and allow to stir for approximately 15 hours. EtOAc (90 mL) is added and the organic mixture is washed with water (3 * 20 mL) and brine (25 mL). The combined organic extracts are dried over a2SO4), filtered and concentrated in vacuo. The residue obtained is purified using flash chromatography on a Redi-Sep column of 40 g ISCO using 0-35% EtOAc / hexanes as the eluent to provide the lnt-5a compound as a white semi-solid (1.1 g, 61%). 1 H NMR (CDCl 3) d 7.40-7.30 (m, 5H), 6.02 (br s, 1 H), 5.12 (s, 2H), 3.80-3.40 (m, 7H), 2.90-2.80 (m, 2H), 2.45 -2.35 (m, 2H), 1.45 (s, 9H).

Step B - Preparation of compound lnt-5b To a solution of lnt-5a (1.30 g, 3.21 mmol) in methanol (90 ml) previously purged with N2 is added (-) - 1,2-Bis ((2S, 5S) -2,5-dimethylphospholane) ethane ( cyclooctadiene) rhodium (I) tetrafluoroborate (197 mg, 0.354 mmol) under N2. The mixture is then stirred on a Parr er for 18 hours at 50 psi H2. After evacuating the hydrogen, the suspension is filtered and the filtrate concentrated in vacuo to give the compound lnt-5b as a colorless oil (1.00 g, 77%). 1 H NMR (CDCl 3) d 7.40-7.30 (m, 5H), 5.35-5.25 (m, 1 H), 5.10 (s, 2H), 4.40-4.35 (m, 1 H), 4.20-4.10 (m, 2H) , 3.70 (s, 3H), 2.70-2.55 (m, 2H), 2.00-1.90 (m, 1 H), 1.65-1.40 (m, 11 H), 1.30-1.20 (m, 2H).

Step C - Preparation of the compound Int-5c To a 50% solution of palladium on carbon (10% wet, 250 mg) in absolute ethanol (20 ml) under nitrogen is added lnt-5b (1.00 g, 2.46 mmol). The reaction is evacuated, then placed under an atmosphere of H2 using a balloon filled with hydrogen and will allow stirring for 2 hours. The hydrogen is evacuated and the resulting suspension is filtered through a Celite pad and the pad washed with ethanol (2? 20 ml). The filtrate and ethanol washes are combined and concentrated in vacuo to provide the Int-5c compound as a colorless oil (670 mg, quant). 1 H NMR (CDCl 3) d 4.21-4.08 (m, 2 H), 3.73 (s, 3 H), 3.31 (d, J = 6.0 Hz, 1 H), 2.75-2.57 (m, 2 H), 1.84-1.70 (m, 1 H), 1.68-1.56 (m, 1 H), 1.45 (s, 9H), 1.45-1.20 (m, 5H).

Step D - Preparation of the Int-5d compound To a solution of the compound lnt-5c (670 mg, 2.46 mmol) and triethylamine (0.520 mL, 3.73 mmol) in CH2Cl2 (10 mL) is added methyl chloroformate (0.210 mL, 2.72 mmol). The reaction mixture is allowed to stir at room temperature for about 15 hours. Water (20 ml) is added and the aqueous mixture is extracted with CH 2 Cl 2 (2 x 15 ml). The combined organic extracts are dried over Na 2 SO 4, filtered and concentrated in vacuo. The residue obtained is purified using flash chromatography on a 24 g ISCO Redi-Sep column using 0-3% eOH / CH2Cl2 as the eluent to give the lnt-5d compound as an off-white solid (515 mg, 63%). 1 H NMR (CDCl 3) d 5.26-5.17 (m, 1 H), 4.38-4.30 (m, 1 H), 4.20-4.07 (m, 2 H), 3.75 (s, 3 H), 3.68 (s, 3 H), 2.71 -2.57 (m, 2H), 2.00-1.85 (m, 1 H), 1.87-1.48 (m, 2H), 1.44 (s, 9H), 1.35-1.18 (m, 2H).

Step E - Preparation of the lnt-5e compound The lnt-5d compound (300 mg, 0.908 mmol) is dissolved in a mixture of TFA (2 ml_) and CH2CI2 (10 ml) and the solution is allowed to stir at room temperature for 1 hour, then concentrated in vacuo. To the resulting residue is added triethylamine (0.760 mL, 5.45 mmol) in CH2Cl2 (10 mL), then acetic anhydride (0.086 mL, 0.915 mmol). The reaction is allowed to stir at room temperature for about 15 hours then concentrated in vacuo. The residue obtained is purified using flash chromatography on a 12 g ISCO Redi-Sep column using 0-4% MeOH / CH 2 Cl 2 as the eluent to provide lnt-5e compound as a colorless oil (247 mg, 99%). 'H NMR (CDCl 3) d 5.27-5.21 (m, 1 H), 4.73-4.62 (m, 1 H), 4.42 ^ .32 (m, 1H), 3.69 (s, 3H), 3.18 (s, 3H) , 3.18-3.09 (m, 1 H), 3.07-2.95 (m, 1 H), 2.55-2.41 (m, 1 H), 2.07 (s, 3H), 1.78-1.49 (m, 3H), 1.38-1.21 (m, 2H).

Step F - Preparation of the compound lnt-5f To a solution of compound lnt-5e (247 mg, 2.59 mmol) in THF (3 mL) is added lithium hydroxide monohydrate (77 mg, 1.83 mmol) in water (3 mL). The reaction mixture is allowed to stir at room temperature for about 15 hours then concentrated in vacuo at 50% of its original volume. The concentrated solution is then acidified with 1N HCl to pH 4 and extracted with EtOAc (715 mL). The combined organic extracts are dried over Na 2 SO 4, filtered and concentrated in vacuo to obtain provide the lnt-5f compound as a whitish solid (106 mg, 45%). 1 H NMR (CD3OD) d 5.52-5.43 (m.H1), 4.71-4.62 (m, 1 H), 4.44-4.31 (m, 1 H), 3.91-3.81 (M, 1 H), 3.70 (s, 3H ), 3.12-2.99 (m, 1 H), 2.58-2.46 (m, 1 H), 2.10 (m, 4H), 1.86-1.54 (m, 2H), 1.50-1.21 (m, 3H).

EXAMPLE 6 Preparation of intermediate compound lnt-6f exo: endo 9: 1 Step A - Preparation of the lnt-6c compound lnt-6c A stirred mixture of D- (+) - a-methylbenzylamine-6a (50.0 g, 0.412 mol), ethyl glyoxylate (81.5 ml, 50% in toluene, 0.412 mol) and PPTS (0.50 g, 2.00 mmol) in benzene (600 ml) is heated to reflux in a Dean-Stark apparatus and allowed to stand at reflux until no more water (~ 8 ml) forms azeotrope of the reaction (~ 4 hours). The resulting mixture is concentrated in vacuo to provide the compound lnt-6b, which is used without further purification: 1 H RN (300 MHz, CDCl 3) d 7.72 (s, 1 H), 7.36-7.24 (m, 5 H), 4.61 ( q, J = 6.9 Hz, 1 H), 4.35 (q, J = 7.2 Hz, 2H), 1.62 (d, J = 6.6 Hz, 3H), 1.34 (t, J = 7.2 Hz, 3H).

To a stirred solution of crude lnt-6b in methylene chloride (600 ml) at -78 ° C the following is added in 10 minute intervals: TFA (31.0 ml, 0.416 mol), boron trifluoride etherate (51.3 ml, 0.416 mol) and freshly distilled cyclopentadiene (32.7 g, 0.494 mol). After less than 2 minutes after the addition of cyclopentadiene, the reaction mixture forms a thick brown mass, which is allowed to stir for 6 hours at -78 ° C. The reaction mixture is then allowed to warm to room temperature by itself and is stirred for an additional 15 hours. The resulting dark brown reaction mixture is quenched with saturated aqueous Na 2 CO 3 (~ 900 ml) and allowed to stir for 30 minutes. The resulting suspension is filtered through a pad of Celite® and the filtrate is extracted with methylene chloride (3? 100 ml). The combined organic extracts are washed with saturated aqueous NaCl (2 * 75 ml), dried over Na 2 SO 4, filtered and concentrated in vacuo. The obtained residue is purified using flash column chromatography (silica; 8 x 18 cm, 10% to 25% ethyl acetate / hexanes as the eluent) to give endo-lnt-6c (10.9 g, 9%) as a brown oil: 1 H NMR ( 300 MHz, CDCI3) d 7.34- 7.19 (m, 5H), 6.00-5.95 (m, 1 H), 4.18 (q, J = 7.1 Hz, 3H), 3.47 (s, 1 H), 3.03 (s, 1 H), 2.97 (q, J = 6.5 Hz, 1 H), 2.41 (s, 1 H), 1.86 (d, J = 8.2 Hz, 1 H), 1.26 (t, J = 6.6 Hz, 3 H), 1.17 (t, J = 6.6 Hz, 3H). Exo-lnt-6c (84.3 g, 74%) was also collected as a brown oil: 1 H NMR (300 MHz, CDCl 3) d 7.34-7.19 (m, 5H), 6.36-6.33 (m, 1 H), 6.22-6.18 (m, 1 H), 4.37 (s, 1 H), 3.87 (q, J = 6.8 Hz, 2H), 3.10 (q, J = 6.5 Hz, 1 H), 2.96 (s, 1 H), 2.27 ( s, 1 H), 2.20 (d, J = 8.4 Hz, 1 H), 1.48 (d, J = 6.5 Hz, 3 H), 1.01 (d, J = 7.0 Hz, 3 H), 1.00 (m, 1 H) .

Step B - Representative example for the preparation of the lnt-6d compound A mixture of exo-lnt-6c (15.8 g, 0.582 mol) and 10% Pd / C (4.07 g, 50% wet) in a 1: 2 mixture of EtOH / EtOAc (150 mL) is stirred for 23 hours in a Parr hydrogenation apparatus under an atmosphere of H2 (50 psi). The reaction mixture is then filtered through Celite® and the filtrate is concentrated in vacuo. H NMR analysis of the residue (10.8 g) show some aromatic resonances present. Repeat the hydrogenation procedure using 10% Pd / C (2.0 g) provides lnt-6d (10.0 g, amount) as a brown oil, which is used without further purification. 1 H NMR (300 MHz, CDCl 3) d 4.18 (q, J = 7.2 Hz, 3 H), 3.54 (s, 1 H), 3.32 (s, 1 H), 2.62 (s, 1 H), 2.23 (s, 1 H) ), 1.64-1.39 (m, 5H), 1.31- 1. 20 (m, 4H).

Step C - Preparation of the compound lnt-6e To a solution of lnt-6d (36.6 g, 0.236 mol) and saturated aqueous Na2CO3 (300 mL) in THF (600 mL) at 0 ° C is added di-tert-butyl dicarbonate (59.0 g, 0.270 mol). The resulting reaction is allowed to warm slowly to room temperature with stirring for six hours, then allowed to stir at room temperature for an additional 68 hours. The reaction mixture is diluted with EtOAc (250 ml) and water (250 ml) and the aqueous layer is extracted with EtOAc (200 ml). The combined organic extracts are washed with saturated aqueous NaCl (2 * 75 ml), dried over Na 2 SO 4, filtered and concentrated in vacuo. The residue obtained is purified using flash column chromatography (silica: 16-10 cm) with 10-20% ethyl acetate / hexanes as the eluent to provide the compound lnt-6e (49.0 g, 84%) as a yellow oil pale:. 1 H NMR (300 MHz, CDCl 3) d 4.35 (s, 0.6H), 4.22 ^ .10 (m, 2.4H), 3.81 (s, 0.45H), 3.71 (s, 0.55H), 2.66 (s, 1 H ), 1.96-1.90 (m, 1 H), 1.76-1.50 (m, 3H), 1.55-1.45 (m, 5H), 1.39 (s, 5H), 1.30-1.23 (m, 4H).

Step D - Preparation of intermediate compound 2.2.1 bicyclic acid lnt-6f To a stirred mixture of lnt-6e (49.0 g, 0.182 mmol) in 1: 1 THF / water (600 ml) is added ??? • 20 (15.3 g, 0.364 mol). The mixture of The reaction is heated to 60 ° C and allowed to stir at this temperature for 47 hours. The reaction mixture is then cooled to room temperature, concentrated in vacuo, and the residue obtained is diluted with CH2Cl2 (200 ml) then acidified with 2N HCl to pH ~ 4. The acid solution is extracted with CH2Cl2 (4 × 100 ml) and the combined organic extracts are washed with saturated aqueous NaCl (25 ml), dried over Na 2 SO 4, filtered and concentrated in vacuo to provide the compound lnt-6f, acid (1 R, 3S, 4S) -N -Boc-2-azabicyclo [2.2.1] heptane-3-carboxylic acid (41.2 g, 93%) as a whitish solid, which is used without further purification: 1 H NMR (400 MHz, DMSO-efe) d 12.44 (s, 1 H), 4.13 (s, 0.56H), 4.06 (s, 0.47H), 3.61 (d, J = 4.0 Hz. 1 H), 2.59 (s, 1H), 1.75-1.45 (m, 5H), 1.39 (s, 4H), 1.32 (s, 5H), 1.23 (t, J = 8.4 Hz, 1 H); Optical rotation: [a] D25 -169.0 ° (c = 1.1, CHCI3).

EXAMPLE 7 Preparation of intermediate compound lnt-7h lnt-7h Step A - Preparation of compound lnt-7b lnt-7a lnt-7b A 2-necked 3-necked round bottom flask equipped with an overhead stirrer and an N 2 inlet was charged with an oxalyl chloride solution (130 ml., 0.26 mol) in dichloromethane (250 ml). The solution was cooled to -78 ° C, and a solution of DMSO (20 mL, 0.28 mol) in dichloromethane (30 mL) was added dropwise. After 30 minutes, a solution of (S) -N-Boc-prolinol, lnt-7a (40 g, 0.20 mol) in dichloromethane (200 ml) was added dropwise. After 30 minutes, triethylamine (140 ml, 1.00 mol) was added to the solution, and the flask was transferred to an ice / water bath and allowed to stir for another 30 minutes. The reaction mixture was diluted with dichloromethane (200 ml) and washed successively with H2O, 1M HCl, saturated NaHCO3 and brine. The organic layer was dried over Na2SO4, filtered and concentrated in vacuo to give (S) -2-formyl-pyrrolidine-1-carboxylic acid tert-butyl ester, lnt-7b (40 g) as oil, which was used without additional purification.

Step B - Preparation of compound lnt-7c lnt-7b lnt-7c A (S) -Boc-prolinal, lnt-7b (crude, 80g, 0.4 mol) was added a solution of ammonia in MeOH (prepared from 150 ml of ammonia / 7N MeOH and 200 ml of MeOH, 1.05 mol, 260 %). An exotherm was observed with the elevated internal temperature ~ 30 ° C. The solution was allowed to stir for 0.5 hours at room temperature, then glyoxal (76 g, 0.52 mol, 130 mol%) was added about 5 minutes in portions, with the internal temperature at which it rises to ~60 ° C and then Return to room temperature after 1 hour. The reaction was allowed to stir for an additional 15 hours and the reaction mixture was concentrated in vacuo. The resulting residue was diluted with dichloromethane (1 L) and water (0.5 L) was added and the organic phase was washed with water (0.25 L), dried over MgSO 4, filtered and concentrated in vacuo. The obtained residue was stirred with hot ethyl acetate (~ 100 ml) and hexane (100 ml), then cooled and filtered. The solid obtained was washed with 30% ethyl acetate / hexane to give the compound lnt-7c (66.2 g, 70% yield).

Step C - Preparation of the compound lnt-7d lnt-7c lnt-7d N-bromosuccinimide (838.4 mg, 4.71 mmol) was added in portions of about 15 minutes to a cooled solution (ice / water) CH2Cl2 (20 mL) of imidazole lnt-7c (1.06 g, 4.50 mmol). The reaction mixture it was allowed to stir for 75 minutes and concentrated in vacuo to the oil. The residue obtained was purified using silica gel RPLC (acetonitrile / water / 0.% of TFA) to separate the mono bromide from its dibromo analog (over bromination) and the starting material. The RPLC eluate was neutralized with excess Ha / MeOH, and the volatile component was removed in vacuo. The residue obtained was partitioned between CH2Cl2 and water, and the aqueous layer was extracted with Water. The combined organic phase was dried (MgSO 4), filtered and concentrated in vacuo to provide Int-7d compound as a white solid (374 mg). 1 H NMR (DMSO) d: 12.12 (br s, 1 H), 7.10 (m, 1 H), 4.70 (m, 1 H), 3.31 (m, 1 H, overlapped with water signal), 2.25-1.73 ( m, 4H), 1.39 / 1.17 (s, 3.8H + 5.2H).

Step D - Alternative synthesis of lnt-7d lnt-7b lnt-7e To a suspension of lnt-7b (140 g, 0.59 mol) in THF (2000 mL) was added N-bromosuccinimide (200 g, 1.1 mol). The mixture was allowed to stir Ambient temperature under N2 gas for about 15 hours. The solvent was then removed in vacuo, and the residue obtained was purified using chromatography of silica gel (eluent of ethyl acetate) to provide 230 g of desired dibromo compound lnt-7e. MS (ESI) m / e (M + H +): 396. lnt-7e lnt-7d To a suspension of lnt-7e (230 g, 0.58 mol) in EtOH / H20 (ratio 1: 1, 3000 mL) was added Na2SO3 (733 g, 5.8 mol). The resulting mixture was allowed to stir at slight reflux for about 15 hours. After cooling to room temperature, the mixture was extracted with dichloromethane twice and the combined organic layer was concentrated in vacuo to a semi-solid. The obtained residue was purified by silica gel chromatography to provide the desired Int-7d compound. MS (ESI) m / e (M + H +): 317.

Step E - Preparation of the compound lnt-7f lnt-7e lnt-7f Compound lnt-7e (2.63 g, 5.0 mmol) was dissolved in THF (30 mL) and cooled to -78 ° C, n-Buü (1 M in hexane, 2.2 mL, 5.5 mmol) was added and the reaction was left Stir for 20 minutes. N-fluorodibenzenesulfonamide (1.6 ml, 5.0 mmol) was added at -78 ° C and the reaction mixture was allowed to slowly warm to room temperature again. The reaction was tempered NH4CI aqueous was then partitioned between water and ethyl acetate. The organic layer was dried over Na2SC < 4 and concentrated in vacuo. The residue obtained was purified by flash column chromatography (gradient of ethyl acetate: petroleum ether from 0-20% ethyl acetate) to provide the compound lnt-7f. (63% yield). MS (ESI) m / z (M + H) +: 464, 466. 19 F NMR = -151.8 ppm.

Step F - Preparation of compound lnt-7g lnt-7d lnt-7g Intermediate 7d (2.51 g, 7.94 mmol, 1.0 eq) was dissolved in 20 ml of CH 2 Cl 2 and trifluoroacetic acid (5 ml) was added to the resulting solution. The reaction mixture was allowed to stir for about 15 hours at room temperature under N2, and the reaction was diluted with hexanes (15 mL) and concentrated in vacuo to give a yellow oil. CH2Cl2 and toluene were added and the solution was re-concentrated in vacuo. This step was repeated until the excess TFA was removed, giving a solid which was dried in vacuum for 1 hour to provide 3.5 g of solid lnt-7g. MS (ESI) m / z (M + H) +: 217 / 218.1.

Step G - Preparation of compound lnr-7h InMa lnt-7g lnt-7h lnt-7g (3.01 g, 6.78 mmol, 1.0 eq) and lnt-1a (1,202 g, 6.86 mmol, 1.01 eq) was added to a 250 ml round bottom flask equipped with a stir bar. DMF was added and the flask was connected to a vacuum line. The flask was cycled between vacuum and N2 twice, then cooled in an ice-methanol bath for 10 minutes. HATU (2.75 g, 7.23 mmol, 1.07 eq) was added, followed by diisopropylethyl amine (2.80 ml). The reaction mixture was allowed to stir at -15 ° C for 20 minutes. Additional diisopropylethylamine (2.0 ml) was added. The reaction mixture was allowed to stir for 40 minutes, then warmed with water (1.5 ml). The resulting solution was diluted with EtOAc (100 mL) and Et20 (100 mL), then washed with water (6 x 15 mL) and brine (2 x 25 mL). The organic layer was dried with MgSO-i, filtered and concentrated in vacuum yield 2.23 g of a clear oil. The residue obtained was purified by chromatography using a SiO2 cartridge of 80 g Isco with a 0.5% - 2.5% gradient of MeOH / CH2Cl2 as the mobile phase. The main peak was collected to provide 1.28 g lnt-7h as a white foam. This material was further purified through sgc in an Isco Gold 80 g Si02 cartridge using a 45% -65% gradient (5% methanol in EtOAc) / hexanes. Triethylamine 1% by volume was added to the solution of MeOH / EtOAc. Fractions were analyzed by TLC using Hanessian stain. (See example 13 below for more information on Hanessian staining). The main peak was collected as a product to provide 1.18 g of lnt-7h as a white foam. MS (ESI) m / z (M + H) +: 373.1.

EXAMPLE 7B Preparation of intermediate compound lnt-7i N-Moc- (S) -tetrahydropyranil glycine (lnt-4f) (252 mg, 1160 mmol), lnt-7g (354 mg, 1225 mmol), DMF (6 mL) and DI PEA (0.7 mL, 4.01 mmol) were added to a 40 ml screw cap vial equipped with a stir bar. The reaction mixture was placed under a blanket of N2 and the vial was capped. The vial was cooled in an ice-methanol bath for 10 minutes. HATU (445 mg, 1.215 mmol) was added, and the reaction mixture was allowed to stir at -15 ° C. After 3 hours, the bath temperature was 10 ° C. The reaction mixture was diluted with ethyl acetate and aqueous ammonium chloride. The layers were separated. The organic layer was washed with water and brine, filtered with gravity, dried with gSO4 and filtered again. The solvent evaporated under reduced pressure in the rotary evaporator to provide a clear oil (458 mg). The crude product was purified by flash silica gel column chromatography on an Isco Gold 24 g SiO2 cartridge, using a gradient of MeOH (NH3) / CH2Cl2 (0-5%) as the mobile phase to provide lnt-7h as a clear oil. Weight = 246 mg took 1 | H R N and LC / MS. Observed M + H = 415.1.

N-Moc (S) -tetrahydropyranyl glycine lnt-4f (236 mg, 1086 mmol) and lnt-10g (333 mg, 1085 mmol), DMF (5 ml) and DI PEA (0.6 ml, 3.44 mmol) were added to a vial with screw cap 40 ml equipped with a stir bar. The reaction mixture was placed under a blanket of N2 and the vial was capped. The vial was cooled in an ice-methanol bath for 15 minutes. HATU (418 mg, 1.141 mmol) was added, and the reaction mixture was allowed to stir at -15 ° C. After 3 hours, the bath temperature was 10 ° C. The reaction mixture was diluted with water and ethyl acetate. The layers were separated. The organic layer was washed with water and brine, filtered by gravity, dried with MgSO 4 and filtered again. The solvent was evaporated under reduced pressure in the rotary evaporator to provide a clear oil. The crude product was dissolved in methanol and allowed to stand at room temperature over the weekend.

The reaction mixture was concentrated in vacuo. The crude product was purified by flash silica gel chromatography on a Gold cartridge of 40 g SiO2 Isco. The column was eluted initially (erroneously) with a gradient of 0% -50% EtOAc / hexanes, then washed with 5% (MeOH / (1 NH [] (aq))) / CH2Cl2. The fractions were combined to give 0.50 g of the impure product as a clear oil.

The impure product was purified by flash silica gel column chromatography on an Isco 24 g gold Si02 cartridge, using a gradient of 0% -5% MeOH / CH2Cl2 as mobile phase to provide lnt-7i as a clear oil (0.306 g). When a sample was dissolved in deuterated methanol, a white solid formed in the flask. Volume 1 H NMR and LC / MS. Observed M + H = 433.1 EXAMPLE 8 Preparation of the intermediate compound Int - 8h lnt-8h Step A - Preparation of the compound lnt-8b lnt-8a lnt-8b A solution of lnt-8a (11.0 g, 42.6 mmol) in THF (50 mL) was cooled to 0 ° C and EtMgBr (82 mmol) was added to the cooled solution. After the addition was complete, the cooling bath was removed and the resulting reaction was allowed to stir at room temperature for 6 hours. 3N HCl was then added and the reaction mixture was extracted with ethyl acetate (2 x 50 mL). The combined organic extracts were washed with water, brine, dried over a2SO4 and concentrated in vacuo. The residue obtained was purified by flash column chromatography on silica gel to provide the compound lnt-8b (7.5 g, 50% yield).

Step B - Preparation of the Int-8c compound lnt-8b lnt-8c Int-8b (7.5 g, 21.3 mmol) was dissolved in 100 ml of dichloromethane and cooled to 0 ° C. TFA (100 ml) was added and the reaction was allowed to stir at room temperature for 2 hours. The solvent was removed and the residue obtained was redissolved in EtOAc then washed with a saturated bicarbonate solution then brine. The extracts were dried over sodium sulfate magnesium, filtered and concentrated in vacuo to provide the Int-8c compound as an oil, which was used without further purification.

Step C - Preparation of the compound Int - 8d To a solution of the compound lnt-8c (4.2 g, 33 mmol) in THF (30 mL) was added Et3N (4.1 g, 49 mmol) and then trityl chloride (8.7 g, 40 mmol). The mixture was allowed to stir at room temperature for 2 hours, then concentrated in vacuo. The residue obtained was purified by flash chromatography on silica gel to provide the Int-8d compound (8.7 g, 71% yield). MS (ESI) m / z (M + H) +: 370.

Step D - Preparation of the compound lnt-8e To a solution of compound lnt-8d (3.6 g, 10.0 mmol) in THF (30 mL) was added LiHMDS (1.0 mmol) and then NBS (1.8 g, 10 mmol) at 0 ° C. The mixture is allowed to stir at room temperature for 2 hours and then 3N HCl is added to the mixture and the resulting solution is extracted with ethyl acetate (2 x 25 ml). The combined organic extracts were concentrated in vacuo and the residue obtained was purified using chromatography to provide the compound lnt-8e (1.98 g, 44% yield). MS (ESI) m / z (M + H) +: 478, 480.

Step E - Preparation of the compound lnt-8f lnt-8e lnt-8f To a solution of the compound lnt-8e (3.6 g, 10.0 mmol) in THF (30 mL) was added LiHMDS (11.0 mmol) and then NBS (1.8 g, 10 mmol). The mixture was allowed to stir at room temperature for 2 hours and then 3N HCl was added to the mixture and extracted with ethyl acetate twice. The organic layer was concentrated in vacuo. The residue obtained was purified by chromatography to provide lnt-8f (1.98 g, 44% yield). MS (ESI) m / z (M + H) +: 478, 480.

Step F - Preparation of the Int 8g compound lnt-8f | nt-8g To a solution of the compound lnt-8f (3.9 g, 10 mmol) in chloroform (30 mL) was added NBS (1.76 g, 10 mmol) and the mixture was allowed to stir at room temperature for 2 hours. The reaction mixture was then concentrated in vacuo and the residue obtained was purified by flash chromatography to provide the compound lnt-8g (2.2 g, 47% yield).

Step G - Preparation of the compound Int - 8h lnt-8g lnt-8h To a solution of the compound Int-8g (1.28 g, 2.7 mmol) in dichloromethane (10 mL) was added TFA (10 mL) and the mixture was allowed to stir at room temperature for 2 hours. The mixture was then concentrated in vacuo and used in the next reaction directly. The obtained residue was dissolved in THF (20 ml) and Et3N (5 ml) and to the resulting solution BOC anhydride (590 mg, 2.7 mmol) was added. The mixture was allowed to stir at room temperature for 2 hours and concentrated in vacuo. The obtained residue was purified using chromatography to provide the compound nnt-8h (600 mg, 67% yield). MS (ESI) m / z (M + H) +: 331.

EXAMPLE 9 Preparation of intermediate compound lnt-9q lnt-9g Step A - Preparation of the compound lnt-9b lnt-9a lnt-9b To a solution of the compound lnt-9a (50 g, 0.2 mol) in THF (500 ml) and Et3N (20 ml) wasopropyl chloroformate was added dropwise (25 g, 0.22 mol) in an ice water bath. Then the resulting solution was allowed to warm to room temperature and was allowed to stir for 1 hour. Then a solution of CH2N2 (0.22 mol) in ether was slowly added until no evolution of N2 gas was observed. Acetic acid (4 mL) was added and the reaction mixture was allowed to stir for 10 minutes. NaHCO 3 solution was then added and the reaction mixture was extracted three times with ethyl acetate. The organic layers were combined, dried over Na 2 SO 4 and concentrated in vacuo to provide the crude product. The raw product then it was purified using silica gel column chromatography (Pet ether: ethyl acetate = 3: 1) to provide the compound lnt-9b (38 g, 70% yield).

Step B - Preparation of the Int-9c compound lnt-9b lnt-9c To a solution of lnt-9b (38 g, 0.14 mol) in HOAc (20 mL) was added dropwise an aqueous solution of HBr (11.2 g, 0.14 mol). After 10 minutes, the mixture was poured into an aqueous solution of NaHCO 3 and extracted three times with ethyl acetate. The combined organic extracts were washed with brine, water, dried over Na 2 SO 4 and concentrated in vacuo to provide the lnt-9C product (30 g, 68% yield).

Step C - Preparation of the compound lnt-9e lnt-9c 9d lnt-9e To a solution of lnt-9c (10 g, 32 mmol) and compound 9d (8.4 g, 64 mmol) in DMF (70 mL) was added K2CO3 (18 g, 126 mmol). The mixture was allowed to stir at 100 ° C in a sealed tube for about 15 hours. The solvent is was removed and the obtained residue was purified by silica gel column chromatography (dichloromethane: MeOH = 20: 1) to provide the lnt-9e product. (6 g, 59% yield).

Step D - Preparation of the lnt-9f compound lnt-9e lnt-9f To an lnt-9e solution (4 g, 14.7 mmol) in THF (40 mL) was added NaH (6.6 g, 60% content, 16.17 mmol) at 0 ° C. The mixture was allowed to stir at room temperature for 30 minutes and then cooled to 0 ° C, and SEM-CI (2.4g, 14.7 mmol) was added dropwise. The resulting mixture was allowed to stir at 0 ° C for 2 hours. The solvent was removed in vacuo and the obtained residue was purified using column chromatography on silica gel (dichloromethane: MeOH = 20: 1) to provide the lnt-9f product. (2 g, 34% yield).

Step E - Preparation of the lnt-9q compound lnt-9f lnt-9g To a solution of lnt-9f (2 g, 5 mmol) in THF (20 mL) was added dropwise n-BuLi (2.5 mL, 6.3 mmol) at -78 ° C (bath) under N2 protection. The resulting solution was allowed to stir at this temperature for 30 minutes. Then a solution of NBS (0.89 g, 5 mmol) in THF (10 ml) was added dropwise at -78 ° C. The mixture was allowed to stir at -78 ° C for 1 hour and then the aqueous NH 4 Cl solution was added. The organic layer was separated and concentrated to provide a crude residue, which was purified using silica gel column chromatography (petroleum ether: EA = 3: 1 as the eluent) to provide the compound lnt-9g (400 mg, 16.5% yield).

EXAMPLE 10 Preparation of intermediate int-1 Of Step A - Preparation of the compound lnt-10b (2S, 4R) -1 - (tert-butoxycarbonyl) -4-fluoropyrrolidine-2-carboxylic acid (lnt-10a, 20 g, 85.75 mmol) was dissolved in anhydrous THF and cooled to 0 ° C. BH3"THF (1M in THF, 171 mL, 171 mmol) was added via an addition funnel. The solution was gradually warmed to room temperature and allowed to stir at room temperature for about 15 hours. MeOH was added until no bubbles emerged. The solution was concentrated in vacuo and the residue obtained was purified using flash column chromatography on silica gel (330g, 0% to 60% EtOAc in hexane) to provide the compound lnt-10b (15.1 g, 80.3%) Step B - Preparation of the Int-10c compound Oxalyl chloride (7.50 ml, 88.9 mmol) and dry dichloromethane (250 ml) were added to a dry 1000 ml round bottom flask. After the solution was cooled to -78 ° C, DMSO (6.80 mL, 95.8 mmol) in dichloromethane (20 mL) was added dropwise. The solution was allowed to stir at -78 ° C for 30 minutes, lnt-10b (15.0 g, 68.4 mmol) in dichloromethane (50 ml) was added by syringe. After the solution was allowed to stir at -78 ° C for 30 minutes, TEA (38.1 ml, 273.6 mmol) was added. The solution was allowed to stir at -78 ° C for 30 minutes and at 0 ° C for one hour. The solution was diluted with dichloromethane (300 ml) and washed with water, 1N HCl, saturated NaHCO 3 and brine. It was dried over anhydrous Na2SO4, filtered and concentrated in vacuo. The residue obtained was dried under vacuum for 1 time to provide the Int-10c compound that was used without further purification.

Step C - Preparation of the compound lnt-10d InMOc and NH3 (7N in MeOH, 150 ml) were added to a 1000 ml round bottom flask. Glioxal (15 ml, 40% in water, 131 mmol) was added slowly. The solution was allowed to stir at room temperature for about 15 hours. Additional glyoxal (5 mL, 44 mmol) was added and the reaction was allowed to stir at room temperature for another 24 hours. The solution was concentrated in vacuo and the obtained residue was purified using flash column chromatography on silica gel (240g, 0% to 5% MeOH in dichloromethane, with 0.1% N I- ^ O) to provide the compound lnt- 10d (8.5 g, 48.7% of 2).

Step D - Preparation of the compound lnt-10e To a 100 ml round bottom flask was added lnt-10d (8.5 g, 33.3 mmol) and CH3CN (250 ml). More CH3CN was added to form a clear solution. NBS (11.3 g, 63.3 mmol) was added in one portion and the solution was allowed to stir at room temperature for about 15 hours. CH3CN was removed in vacuo and dichloromethane (50 ml) was added without stirring. The solid was filtered and washed with dichloromethane twice. The filtrate was concentrated in vacuo to about 30 mL and filtered again. The filtrate was purified using flash column chromatography on silica gel. silica (120g, 20% to 80% EtOAc in hexane) to provide the lnt-10e compound (11.88 g, 86.4%).

Step E - Preparation of the compound lnt-0f To a 1000 ml round bottom flask was added lnt-10d (11.88 g, 28.76 mmol), sodium sulfite (Na2S03, 36.0 g, 288 mmol), EtOH (270 mL) and water (130 mL). The solution was allowed to stir at reflux for about 15 hours. More Na 2 SO 3 (10 g, 79 mmol) was added and the solution was allowed to stir at reflux for another 24 hours. After cooling, the solid was filtered and washed with EtOAc three times. The filtrate was concentrated in vacuo and the obtained residue was dissolved in a mixture of EtOAc (300 ml) and water (200 ml). The organic layer was separated and washed with brine, dried over anhydrous Na 2 SO 4, filtered and concentrated in vacuo. The obtained residue was purified by flash column chromatography on silica gel (240g, 0% to 33% EtOAc in hexane) to give the compound InMOf (5.12 g, 53.3%).

EXAMPLE 11 Preparation of intermediate compound I nt- 11c Step A - Preparation of compound lnt-11b lnt-11a lnt-11b The lnt-11a aldehyde was prepared from commercially available alcohol using the method described in Example 10.

A flask was charged with lnt-1a aldehyde (82g, 0.35 mol) and a 2.33N ammonia / MeOH solution was added with good agitation (600 ml, 4.0 eq., Prepared from 200 ml of ammonia / 7N MeOH diluted with 400 my of MeOH). The reaction was then heated to 35 ° C and allowed to stir at this temperature for two hours, after which time a solution of 40% by weight of glyoxal in water (80 ml, 2.0 eq.) Was added dropwise over 15 minutes. After stirring for a further 2 hours, a 7N ammonia / MeOH solution (100 ml, 2.0 eq) was added and the reaction was allowed to stir at 35 ° C for 1 hour, additional glyoxal (40 ml, 1.0 eq) was then added. added dropwise about 5 minutes and the resulting reaction was allowed to stir at 35 ° C. for 1 hour.The reaction mixture was allowed to cool to room temperature and stirred for about 15 hours, then 7N ammonia / MeOH (50N) was added. mi, 1.0 eq) and the reaction was reheated to 35 ° C and allowed to stir at this temperature for 1 hour.An additional amount of glyoxal (20 ml, 0.5 eq.) was then added and the resulting reaction was allowed to stir at 35 ° C. ° C for 1 hour, then the mixture of The reaction was cooled to room temperature and filtered. The filtrate was concentrated in vacuo and the residue obtained was diluted with dichloromethane and water (2 L, 1: 1). The organic layer was separated, washed with 11 of water, then brine and dried (MgSO-t), filtered and concentrated in vacuo. The obtained brown foam residue was further purified using a passage through a short silica gel column to provide the compound lnt-11b (60g, 62%).

Step B - Preparation of the compound lnt- 1c lnt-11 c was prepared from lnt-11b using the method described in example 10.

Intermediates lnt-11d, lnt-11e, and lnt-11f can be prepared using the methods described in example 10 and example 11. lnt-11d lnt-11e lnt-11f EXAMPLE 12 Preparation of intermediate compound lnt-12i Step A - Preparation of the compound lnt-12b lnt-12a lnt-12b To a solution of the compound lnt-12a (60 g, 0.24 mol) in dry THF (1 L) was allowed to stir at -78 ° C, lithium hexamethyldisilazide (82 g, 0.49 mol, 1 M in THF) was added. After the reaction mixture was allowed to stir at -78 ° C for 1 hour, the iodomethane (66 g, 0.46 mol) dissolved in dry THF (100 mL) was added at -78 ° C and the mixture was allowed to stir for 15 minutes at this temperature and 2 hours at 25 ° C. The reaction mixture was warmed with saturated ammonium chloride solution and extracted with dichloromethane (3 x 300 mL). The combined organic phases were dried over MgSO 4, filtered and concentrated in vacuo. The products were purified by flash column chromatography on silica gel to provide the compound lnt-12b (18.3 g, 27% yield). 1 H NMR d: 4.38-4.34 (m, 1 H), 4.08-4.05 (m, 2 H), 2.09-2.03 (m, 1 H), 1.77-1.73 (m, 1 H), 1.35 (s, 9 H), 1.12 (t, J = 8 Hz, 3 H), 1.06 (s, 6 H).

Step B - Preparation of the compound Int-12c lnt-12b lnt-12c To a solution of the compound lnt-12b (18.3 g, 60 mmol) in dichloromethane (150 ml) was added TFA (15 ml) and the mixture was allowed to stir at room temperature for 30 minutes. The solvent was removed to provide the compound lnt-12c (11.2 g, 100% yield).

Step C - Preparation of the compound lnt-12d lnt-12c lnt-12d A suspension of UAIH4 (16.2 g, 0.44 mol) and the compound Int-12c (1.2 g, 54.8 mmol) in THF (200 ml) was allowed to stir under reflux for 8 hours. After the successive addition of 17 ml of water, 17 ml of 10% aqueous NaOH and 51 ml of water and filtering, the filtrate was concentrated in vacuo to provide the compound lnt-12d (6.7 g, 94% yield) .

Step D - Preparation of the compound lnt-12e lnt-12d lnt-12e Compound lnt-12d was dissolved in THF and Et3N, (Boc) 20 was added. The mixture was allowed to stir at room temperature for 2 hours and concentrated in vacuo. The residue obtained was purified using chromatography to provide the compound lnt-12e (14 g, 100% yield).

Step E - Preparation of the compound lnt-12f lnt-12e lnt-12f To a solution of the compound lnt-12e (14g, 65.4 mmol) in dichloromethane was added the Dess Martin reagent (41.6 g, 98.1 mol). After stirring at room temperature for about 15 hours, the solvent was removed and the residue obtained was purified using flash column chromatography on silica gel to provide the compound lnt-12f (7g, 47% yield). 1 H NMR d: 9.40 (s, 1 H), 4.05-4.03 (m, 1 H), 3.14-3.11 (m, 2 H), 1.83-1.79 (m, 1 H), 1.66-1.63 (m, 1 H ), 1.36 (s, 9 H), 1.02 (s, 6 H).

Step F - Preparation of the lnt-12q compound lnt-12f lnt-12g Glyoxal (1.75 ml of 40% in water) was added dropwise about 11 minutes to a solution of NH4OH (26 ml) and the compound Int-12f (6.1 g, 28.8 mmol) in methanol and allowed to stir at room temperature for 19 hours. The volatile component was removed in vacuo and the residue obtained was purified using flash chromatography on silica gel to provide the compound lnt-12g MS (ESI) m / z (M + H) +: 266.

Step G - Preparation of compound lnt-12h A mixture of the compound lnt-12g (2.2 g, 8.3 mmol), N-bromosuccinimide (2.66 g, 14.9 mmol) in anhydrous THF (80 ml) was heated to reflux for about 15 hours. After cooling to room temperature, the solids were removed by filtration and the filtrate was concentrated in vacuo and the residue obtained was purified using chromatography to provide the lnt-12h compound (2.0 g, 57% yield). 1 H NMR (J000120117 H 10170-003-1 CDCI3 vary 400 MHz) d: 11.03 (s, 1 H), 4.79 (t, J = 8 Hz, 1 H), 3.25 (t, J = 12 Hz, 1 H), 2.96 (t , J = 12 Hz, 1 H), 2.58-2.53 (m, 1 H), 2.95-1.90 (m, 1 H), 1.34 (s, 9 H), 1.05 (s, 3 H), 0.99 (s, 3 H). MS (ESI) m / z (M + H) +: 422.

Step H - Preparation of the lnt-12i compound To a solution of the compound lnt-12h (1.9 g, 4.5 mmol) in H20 / EtOH (40 ml / 20 ml) was added Na2SO3 (5.6 g, 4.5 mmol) and the mixture was allowed to stir at room temperature for about 15 hours. The reaction mixture was concentrated in vacuo and the residue obtained was dissolved in ethyl acetate, washed with brine, dried over MgSO4, filtered and concentrated in vacuo. The obtained residue was purified using silica gel chromatography to provide the ln-12i 1 H NMR compound d: 6.92 (s, 1 H), 4.71-4.67 (m, 1 H), 3.26-3.21 (m, 2 H), 2.01-1.96 (m, 1 H), 1.78-1.72 (m, 1 H), 1.13 (s, 9 H), 1.00 (s, 3 H).

EXAMPLE 12A Preparation of intermediate compound lnt-12o lnt-12j lnt-12k lnt-121 lnt-12m Step A The lnt-12j acid (22.7 g, 100 mmol) was dissolved in dry THF (400 ml) in a 1000 ml flask, and cooled with an ice water bath. Borane tetrahydrofuran complex (1.0 M in THF, 200 ml, 200 mmol) was added via an additional funnel dropwise over a period of 80 minutes. After 1 hour at 0 ° C, the reaction was allowed to warm to room temperature and stirred for about 15 hours. Methanol was then added dropwise via an additional funnel (~100 mL) and then the reaction was concentrated in vacuo. The residue was purified on a 300 g ISCO silica column / Rf Combi-Flash system using a gradient of 0-70% ethyl acetate in hexanes to provide ln-12k alcohol as a colorless oil (18.2 g, 85%) .

Step B Oxalyl chloride (14.08 g, 111 mmol) was dissolved in methylene chloride (340 ml) in a 1000 ml flask and cooled to -78 ° C under nitrogen atmosphere. DMSO (9.33 g, 119 mmol) was added slowly via syringe over a period of 10 minutes. The resulting solution was allowed to stir at -78 ° C for 45 minutes before the slow addition of the lnt-12k alcohol (15.2 g., 85 mmol) in methylene chloride (50 ml) and stirred at -78 ° C under nitrogen for 45 minutes before the addition of triethylamine (34.5 g, 341 mmol). After 40 minutes at -78 ° C, then the reaction was warmed to 0 ° C and stirred at 0 ° C for an additional 1 hour. After the addition of 500 ml of methylene chloride, the organic solution was washed with water, 1N HCl solution (300 ml) and water. The organic layer was dried over sodium sulfate, concentrated in vacuo to provide lnt-121 aldehyde as a colorless oil (18.14 g, ~ 100%). This crude product was used for the next reaction without purification.

Step C The lnt-121 aldehyde (18.14 g, 86 mmol) was dissolved in methanol (37 ml) and the resulting solution was cooled with a water bath of RT. A solution of 7N ammonia in methanol (31.9 ml, 223 mmol) was then added dropwise via an additional funnel over a period of 15 minutes. The reaction mixture was allowed to stir at room temperature for 20 minutes before a 40% aqueous glyoxal solution (16.2 g, 112 mmol) was added. he added. The reaction mixture was allowed to stir at room temperature for about 15 hours and concentrated in vacuo. The residue was purified using a column Rf / Combi-Flash system of 220 g of ISCO silica (0-7% methanol in the eluent of dichloromethane) to give the compound lnt-12m as a light yellow solid (10.8 g, 51.5%).

Step D The intermediate lnt-12m (10.81 g, 43.4 mmol) was dissolved in THF (200 ml) in a 250 ml flask and NBS (15.43 g, 87 mmol) was added slowly at room temperature. The resulting solution was allowed to stir at room temperature for 4.5 hours and concentrated to semi-solid. The residue was dissolved in ethyl acetate (300 mL), washed with brine (3 X 100 mL), dried over sodium sulfate and concentrated in vacuo. The crude material was purified by crystallization from dichloromethane to provide the lnt-12n compound as a white solid (7.68 g, 43.5%). The master liquid mixture was purified using a 220 g ISCO column / Combi-Flash Rf system using 0-70% ethyl acetate in hexanes as the eluent to provide a second batch of ln-12n as a clear solid (7.73 g. , 43.8).

Step E The intermediate lnt-12n (14.4 g, 35.4 mmol) was dissolved in methanol (45 ml) and water (16 ml) and placed in a water bath. EDTA (10.34 g, 35.3 mmol) followed by 7N ammonia in methanol (20.21 mL, 141 mmol) was then added. Zinc powder (2.314 g, 45.4 mmol) was then added and the resulting solution allowed to stir at room temperature. After 6 hours the reaction was then concentrated and the residue was redissolved with ethyl acetate (100 ml), washed with water (2 x 50 ml), dried over sodium sulfate and concentrated in vacuo. The crude product was purified on an 80 g silica column with a Rf Combi-Flash system using a gradient of 0-70% ethyl acetate in hexanes to provide lnt-12o as a white solid (7.56 g, 65% ).

EXAMPLE 13 Preparation of intermediate compounds lnt-13d and lnt-13e lnt-13b lnt-13c lnt-13c lnt-13d Step A - preparation of Int-13c compounds A 5-necked 3-necked round bottom flask, equipped with a mechanical stirrer, temperature probe, addition funnel and N2 inlet, was charged with the auxiliary chiral Schollkopf (lnt-13a, 200 g, 1.09 mol, 1.0 eq. ), bis (chloromethyl) dimethylsilane (lnt-13b, 256 g, 1.63 mol, 1.5 eq) and THF (2 I, Aldrich anhydrous). The flask was cooled in a dry ice / 2-propanol bath until the internal temperature reached -75 ° C. N-Butyllithium (Aldrich 2.5 M in hexanes, 478 ml, 1.19 mol, 1.09 eq) was added via a dropping funnel for 1 hour while maintaining the internal reaction temperature between -67 ° C and -76 ° C. The resulting orange-red solution was allowed to warm gradually to room temperature for about 15 hours. The reaction mixture was re-cooled to 0 ° C and warmed with 500 ml of water. Diethyl ether (2 I) was added and the layers separated. The aqueous layer was extracted with 1 l of diethyl ether. The combined organic extracts were washed with water and brine, dried with MgSO 4, filtered and concentrated in vacuo to give 480 g of orange oil. This material was left in vacuum for about 15 hours to provide 420 g of oil. The crude product was divided into two batches and purified by silica gel chromatography in a 1.6 kg flash column. The column was eluted with a gradient of 0-4% Et.sub.20 in hexanes. The product fractions were concentrated in vacuo at a bath temperature at or below 40 ° C giving 190 grams of lnt-13c- (60% yield).

Step B - preparation of the compound lnt-13d A 5-necked 3-necked round bottom flask, equipped with a mechanical stirrer, temperature probe addition funnel, external water bath and N2 inlet, was charged with the lnt-3C compound (196 g, 0.643 mol, 1.0 eq) and methanol (1.5 L). Aqueous HCl was added (500 mL of 10% in volume) at room temperature for 30 minutes, with a mean exotherm observed. The temperature increased to 37 ° C and then dropped again. The reaction mixture was allowed to stir at room temperature for 3 hours and was monitored by TLC and LC / MS. The reaction mixture was then concentrated in vacuo to an oil. Additional methanol (3 x 200 mL) was added and the reaction mixture was concentrated in vacuo again. The resulting crude product was dried under internal vacuum for about 15 hours. The crude product was then dissolved in CH2Cl2 (750 mL) and Et20 (1250 mL) and sodium iodide (96.4 g, 0.643 mol, 1.0 eq) was added. Iisopropylethylamine (336 mL, 1929 mol, 3.0 eq) was added slowly over 25 minutes with stirring, causing the temperature to rise to 35 ° C and then decrease again at room temperature. The reaction mixture was allowed to stir at room temperature for 2 hours, after which the MS of an aliquot indicated the consumption of the starting material. The reaction mixture was allowed to stir for a further 2 hours and then Boc-anhydride (281 g, 1286 mol, 2.0 eq) was added. The reaction mixture was then allowed to stir at room temperature. After two days, the reaction mixture was diluted with EtOAc (2 L) and water (1 L), and the layers were separated. The aqueous phase was extracted with 500 mL of EtOAc. The combined organic extracts were washed with water (500 mL) and brine (500 mL), dried with MgSO_i, filtered and concentrated in vacuo to give a yellow oil (380 g). The crude product was divided into two 180 g portions for convenience and each portion was purified by silica gel chromatography snapshot. The column conditions for a 180g portion of raw product are as follows. The 180 gram sample of crude product was loaded onto an S1O2 cartridge of 191 g and purified on a 1.5 kg SiO2 column. The column was eluted with a gradient of 0% -20% EtOAc / hexanes as the mobile phase to provide 52 grams of pure lnt-13d and additional lnt-13d fractions containing a small amount of a Boc-valine impurity. The impure fractions of the two columns were recombined and re-purified. After chromatography, the Int-13d compound was obtained as an oil that solidified to a white solid at rest (128 g, 65% yield in three steps).

Step C - preparation of the compound lnt-13e lnt-13d lnt-13e A solution of lnt-13d (8.5 g, 31.1 mmol) in methanol (100 mL) and 1.0 aqueous KOH solution (48 mL, 48 mmol) was allowed to stir at room temperature for approximately 15 hours. The reaction was then neutralized with 48 mL of 1.0 M aqueous hydrochloric acid solution at pH ~ 5 and partially concentrated in vacuo. The aqueous layer was then extracted twice with dichloromethane (2 x 100 mL). The combined organic solutions were concentrated in vacuo to provide the lnt-13e compound as a gel (7.74 g, 96%).

Note: Previous reactions were monitored by TLC using Hanessian staining. To prepare the visualization spot, 450 mL of H20, 25 g of ammonium molybdate, 5 g of cerium sulfate and 50 mL of concentrated hydrochloric acid or concentrated H2SO4 were combined.

EXAMPLE 14 Preparation of intermediate compound lnt-14d Step A - Preparation of the lnt-14a compound To a mixture of lnt-13e carboxylic acid (20 g, 77 mmol) in THF (400 mL) at 0 ° C was added 1M BH3 in THF (0.17 L) via the addition funnel at 0 ° C. The mixture was allowed to warm to room temperature and stir for about 15 hours. The reaction was cautiously quenched by the addition of MeOH (-75 mL) until it stopped bubbling. The reaction mixture was concentrated in vacuo, whereupon the residue obtained was partitioned between EtOAc and H20. The layers were separated and the aqueous layer was extracted with EtOAc (2x). The organic layers were combined, washed with brine, dried (Na2SO4) and concentrated in vacuo to provide the lnt-14D compound (18 g, 99%) as a clear oil, which was used without further purification. MS (ESI) m / e (M + H + Na) +: 268.

Step B - Preparation of the compound lnt-14b Oxalyl chloride (8.2 ml_, 96 mmol) and CH2CI2 (280 ml_) were added to a dry 2-necked flask equipped with a stir bar. The solution was cooled to -78 ° C, whereupon a solution of DMSO (7.4 mL, 0.10 mol) in CH2Cl2 (22 mL) was added and the mixture was allowed to stir for 30 minutes at -78 ° C. A solution of ln-14a alcohol (18 g, 74 mmol) from step A in CH2Cl2 (60 mL) was added dropwise via an addition funnel for 30 minutes. The resulting solution was allowed to stir for 30 minutes at -78 ° C whereupon EI3N (42 mL, 0.30 mol) was added dropwise. The mixture was allowed to stir for 30 minutes at -78 ° C, heat to 0 ° C and allowed to stir for 1.5 hours. The mixture was diluted with CH2Cl2 (400 mL) and transferred to a filter flask. The organic layer was washed with saturated aqueous NH 4 Cl (2 x 100 mL) and brine (2 x 100 mL). The organic layer was dried (Na2SO4), filtered and concentrated in vacuo to provide the compound lnt-14b, 18 g (99%) as a clear oil, which was used without further purification.

Step C - Preparation of the lnt-14c compound To a round bottom flask loaded with lnt-14b aldehyde (18 g, 74 mmol) from step B was added 7N NH3 in MeOH solution (28 mL, 0.19 mol) in MeOH (37 mL) at room temperature. The mixture was allowed to stir for 30 minutes at room temperature, whereby a solution of glyoxal (14 g, 96 mmol) was added over 5 minutes. The resulting solution was allowed to stir for 12 hours at room temperature and concentrated in vacuo. The residue obtained was purified by column chromatography using a gradient of 100% CH2Cl2 at 97.5% CH2Cl2 / 2.5% MeOH to provide the compound lnt-14c, 9.9 g (48%) as a yellow oil. MS (ESI) m / e (M + H) +: 282.

Step D - Preparation of the compound lnt-14d To a solution of imidazole lnt-14C (1.0 g, 3.6 mmol) from step C in CH 2 Cl 2 (5 mL) at 0 ° C, NBS (0.44 g, 2.5 mmol) in CH 2 Cl 2 (10 mL) was added dropwise through a addition funnel. The resulting mixture was allowed to stir for 90 minutes at 0 ° C, whereupon the mixture was concentrated in vacuo. The crude residue obtained was partitioned between CHCl3 (10 mL) and water (3 mL) and the layers were separated. The organic layer was washed with water (3 x 3 mL), dried (Na2SO4), filtered and concentrated in vacuo. The residue obtained was purified by column chromatography (80g) using a gradient of 100% hexanes at 65% hexanes / 35% EtOAc to give the compound lnt-14D, (0.35 g, 27%) as a white solid. MS (ESI) m / e (M + H) +: 360/362.

EXAMPLE 15 Preparation of intermediate compound lnt-15c paration of the compound lnt-15a lnt-15a To a solution of dichlorozirconocene (Cp2ZrCl2) (4.2 g, 14.2 mmol) in 40 mL of THF at -78 ° C was added n-BuLi (1.6 M in hexane, 18 mL, 28.4 mmol). The resulting reaction was allowed to stir for 1 hour, then diphenyldiallylsilane (2 g, 14.2 mmol) in 17 mL of THF was added at -78 ° C. The reaction was allowed to stir for 1 hour at -78 ° C and for 18 hours at 25 ° C. Iodine (9 g, 35.5 mmol) in 20 mL of THF was then added at -78 ° C and the mixture was allowed to stir for 1 hour. The reaction was quenched with 10% aqueous H2SO4 and the organic phase was extracted with ether. The organic solution was washed with saturated aqueous solution of aHC03, brine solution and dried with (Na2S04). After filtration, the filtrate was concentrated in vacuo and the obtained residue was purified by an ISCO column of 120 g (hexane) to provide the lnt-15a compound 2.75 g (49%). 1 H NMR (CDCl 3) d 3.44 (dd, J = 2.2, 10.0 Hz, 2H), 3.33 (dd, J = 4.7, 10.0 Hz, 2H), 1.20 (m, 2H), 0.93 (dd, J = 5.9, 14.7 Hz, 2H), 0.63 (dd, J = 11.1, 14.2 Hz, 2H), 0.19 (s, 6H).

Step B - Preparation of the compound lnt-15b lnt-15b To a solution of (2R) - (-) - 2,5-dihydro-3,6-dimethoxy-2-isopropylpyrazine (0.61 g, 4.36 mmol) in THF (8 ml_) was added n-BuLi (2.5 M in hexane 1.8 ml_, 4.58 mmol) at -78 ° C. After stirring for 0.3 hours, the Int 15a compound (2.75 g, 6.98 mmol) in 2 ml_ of THF was added and the mixture was allowed to stir at the temperature for 4 hours. The reaction was quenched by saturated aqueous NH 4 Cl solution and the organic layers were extracted with EtOAc. The combined organic solution was washed with brine solution, dried (Na2SO4) and concentrated in vacuo. The obtained residue was purified by a 40 g ISCO column (gradient from 0% to 2.5% ether in hexane) to provide the compound lnt-15b, 783 mg (44%). 1 H NMR (CDCl 3) d 4.05 (m, 1 H), 3.96 (t, J = 3.4 Hz, 1 H), 3.72 (s, 3 H), 3.71 (s, 3 H), 3.49 (dd, J = 2.8, 0.4 Hz, 1H), 3.26 (dd, J = 6, 9.4 Hz, 1 H), 2.30 (m, 1 H), 1.96 (m, 1 H), 1.60 (m, 2H), 1.37-1.17 (m, 3H), 1.08 (d, J = 6.9 Hz, 3H), 0.99-0.86 (m, 2H), 0.72 (d, J = 6.6 Hz, 3H), 0.49 (dd, J = 11.0, 14.4 Hz, 1 H), 0.35 (dd, J = 11.0, 14.2 Hz, 1 H), 0.16 (s, 6H).

Step C - Preparation of the lnt-15c compound To a solution of the compound lnt-15b (780 mg, 1.92 mmol) in MeOH (9 ml_) was added 10% aqueous HCl (3 ml_) at 0 ° C and the mixture was allowed to stir at 25 ° C for 18 hours. The mixture was concentrated in vacuo and the residue obtained was reconcentrated in vacuo with MeOH twice. The resulting white foam was dissolved in ether (6 mL) and CH2Cl2 (9 mL), and diisopropylethylamine (1 mL, 5.7 mmol) was added. After stirring at 25 ° C for 18 hours, di-t-butyl dicarbonate (922 mg, 4.22 mmol) was added and the resulting mixture was allowed to stir at 25 ° C for 2 days. The mixture was added to the cold water and the organic layers were extracted with EtOAc. The combined organic solution was washed with brine solution, dried (Na 2 SO 4) and concentrated in vacuo. Then, the residue obtained was dissolved in MeOH (8 mL) and treated with 1 M aqueous KOH solution (3.3 mL, 3.3 mmol). After stirring at 0 ° C to 25 ° C, the reaction mixture was acidified with 10% aqueous HCl and the organic layers were extracted with CH 2 Cl 2. The combined organic solution was washed with brine solution, dried with (Na 2 SO 4) and concentrated in vacuo to provide the lnt-15C compound, which was used without further purification.

EXAMPLE 16 Preparation of intermediate compound lnt-16e lnt-16a lnt-16b lnt-1 lnt-16d lnt-16e Step A - Preparation of compound lnt-16b To a flask dried with a 1000 mL flame was added 1,1-dichlorosilolane (nt-16a, 28.09 g, 181.1 mmol), bromochloromethane (23.5 mL, 362.2 mmol) and anhydrous THF (400 mL). The solution was cooled to -70 ° C, then n-BuLi (2.5M in hexane, 145 mL, 362 mmol) was added slowly over a period of 1 hour. The resulting reaction was allowed to stir at -70 to -60 ° C for 20 minutes, then was warmed to room temperature for 1 hour. The saturated solution of NH4CI (200 mL) and Et20 (200 mL) was then added and the organic layer was separated and the aqueous layer was extracted with Et20 (100 mL) twice. The organic layers were combined, washed with brine, dried over Na 2 SO 4, filtered and concentrated in vacuo. The residue obtained was purified by Si02 chromatography (240 g, eluted with hexane) to provide the compound lnt-16b (17.2 g, 51.9%).

Step B - Preparation of the compound lnt-16c To a flask dried with a flame was added (R) -2-isopropyl-3,6-dimethoxy-2,5-dihydropyrazine (10.0 g, 54.3 mmol) and anhydrous THF (200 mL). The solution was cooled to -78 ° C. N-Buu (2.5M in hexane, 24.0 mL, 59.7 mmol) was added dropwise. After the solution was stirred at -78 ° C for 30 minutes, the lnt-16b compound (in 5 mL of anhydrous THF) was added dropwise. After the solution was allowed to stir at -78 ° C for 1 hour, it was allowed to warm to room temperature in two hours. Water (100 mL) and Et20 (150 mL) were added. The organic layer was separated and the aqueous layer was extracted with Et 2 O (100 mL) twice. The organic layers were combined, washed with brine, dried over Na 2 SO 4, filtered and concentrated in vacuo. The residue obtained was purified by S102 chromatography (40 g, eluted with Et20 in hexane: 0% to 3%) to provide the compound lnt-16c (10.43 g, 58.0%).

Step C - Preparation of the compound Int 16d To a 500 mL flask was added the compound Int-16c (11.5 g, 34.8 mmol) and MeOH (80 mL). 10% HCl (20 mL) was added. The solution was allowed to stir at room temperature for 5 hours and concentrated in vacuo. The residue obtained was dissolved in 20 mL MeOH and concentrated again to remove water and hydrochloric acid. This procedure was repeated three times. He The residue obtained was dissolved in dichloromethane (50 mL) and Et20 (70 mL). DIPEA (15.4 mL, 86.9 mmol) and Nal (5.2 g, 34.75 mmol) were added. The solution was allowed to stir at room temperature for about 15 hours. Di- tert -butyl dicarbonate (18.9 g, 86.9 mmol) was added. The solution was allowed to stir at room temperature for 4 hours. Water (100 mL) and EtOAc (100 mL) were added. The organic layer was separated and the aqueous layer was extracted with EtOAc (100 mL) twice. The organic layers were combined and washed with brine, dried over anhydrous Na 2 SO 4, filtered and concentrated in vacuo. The obtained residue was purified by Si02 chromatography (220g, hexane / EtOAC: 0% to 20%) to provide the compound lnt-16d (7.9 g, 75.9%).

Step D - Preparation of compound lnt-16e The lnt-16d compound (7.9 g, 26.4 mmol) was dissolved in MeOH (100 mL) and cooled to 0 ° C. KOH was added (to 1 M water, 39.6 mL, 39.6 mmol). The solution was allowed to stir at 0 ° C for 2 hours and then at room temperature for 3 hours. Hydrochloric acid (2 N, 20 mL) was added and then additional HCl was added slowly to adjust the solution to pH 4. The acidified solution was concentrated in vacuo and water (150 mL) and EtOAc (200 mL) were added to the obtained residue. . The organic layer was separated and the aqueous layer was extracted with EtOAc (2 x 100 mL). The combined organic extracts were washed with brine, dried over anhydrous Na 2 SO 4, filtered and concentrated in vacuo. The obtained residue was dried in vacuum for 48 hours to provide the compound lnt-16e (7.45 g, 99%), which was used without further purification.

EXAMPLE 17 Preparation of intermediate compounds lnt-17c v Int-17d Step A - Preparation of compound lnt-17b lnt-17a lnt-17b To a 500 mL flask was added lnt-17a (25.0 g, 130 mmol), dry dichloromethane (250 mL) and DIPEA (25.37 g, 195 mmol). The solution was cooled to 0 ° C and acetyl chloride (13.27 g, 169 mmol, in 30 mL of dry dichloromethane) was added dropwise. The resulting reaction was allowed to stir at 0 ° C for one hour and then at room temperature for about 15 hours. The solution was diluted with EtOAc and washed with water.

The organic phase was dried over anhydrous Na 2 SO 4, filtered and concentrated in vacuo.

The obtained residue was purified by flash column chromatography on silica gel (330 g, 0% to 50% EtOAc in hexane) to provide the compound lnt-17b (22.58 g, 74.5%).

Step B - Preparation of the compound lnt-17c lnt-17b lnt-17c To a 500 mL flask was added lnt-17b (21.45 g, 92.05 mmol) and dry dichloromethane (200 mL). It was cooled to 0 ° C and aluminum trichloride (AICI3, 36.82 g, 276.2 mmol) was added in portions. After the solution was allowed to stir at 0 ° C for 30 minutes, and concentrated in vacuo. The semisolid residue obtained was heated at 140 ° C for three hours. After it was cooled to 80 ° C, water (10 mL) was added dropwise. Then it was cooled to 0 ° C and EtOAc (300 mL) and water (200 mL) were added. The suspension was allowed to stir at 0 ° C until the complete solid dissolved. More EtOAc was added and the organic layer was separated. The organic layer was washed with water, dried over anhydrous Na2SO4, filtered and concentrated in vacuo. The obtained residue was purified by flash column chromatography on silica gel (330g, 0% to 10% EtOAc in hexane) to provide compound Int-17c (18.76 g, 87%).

Step C - Preparation of compound lnt-17d The lnt-17D compound was prepared using the method described previously for the synthesis of the compound lnt-17C and substituting 2-bromophenol for the compound lnt-17a in step A.

EXAMPLE 18 Preparation of intermediate compound lnt-18c lnt-18c Step A - Preparation of the compound lnt-18b lnt-18a lnt-18b To a stirred solution of (3-methyloxetan-3-yl) methanol (lnt-18a, 10. 0 g, 97.9 mmol) in methylene chloride (400 mL) at 0 ° C, under inert atmosphere, silica gel (20 g) was added. PCC (29.5 g, 137 mmol) was then added in portions over a period of 2 minutes. The solution was allowed to slowly warm to room temperature and stir for 6.5 hours. The reaction mixture was then filtered through a mixture of Celite: silica gel (1.1, 400 g total) and Celite.gel silica was washed with methylene chloride (4 L). The filtrate and washing were combined and concentrated in vacuo to provide 4.98 g (51%) of lnt-18b as a clear solution (48.5% in weight) of methylene chloride. 1 H NMR (CDCl 3 500 MHz): d D 9.94 (s, 1 H), 4.89-4.83 (m, 2 H), 4.52 ^ .46 (m, 2 H), 1.48 (s, 3 H).

Step B - Preparation of the compound lnt-18c lnt-18b lnt-18c To a stirred solution of triphenylphosphite (5.10 mL, 19.5 mmol) of methylene chloride (9 mL) at 0 ° C, in an inert atmosphere, bromine (1.00 mL, 19.5 mmol) was added dropwise at 0 ° C. Then a solution of compound lnt-18b (1.00 g, 9.99 mmol) in methylene chloride (1 mL) was added and the resulting reaction was stirred for 40 minutes at 0 ° C. The reaction mixture was diluted with hexanes (10 mL) and the solution was passed through a plug of silica gel (4 g). The solids were washed with MTBE (20 mL). The filtrate and washing was combined and concentrated in vacuo to ~10 mL and purified by flash column chromatography on silica gel (methylene chloride / pentane) to provide 1.06 g (44%) of compound Int-18C as a colorless oil. . 1 H NMR (CDCl 3,500 MHz): d 5.98 (s, 1 H), 3.76 (d, J = 10.5 Hz, 2H), 3.65 (d, J = 10.5 Hz, 2H), 1.44 (s, 3H).

EXAMPLE 19 Preparation of intermediate compound lnt-19e lnt-19e Step A - Preparation of the compound lnt-19a lnt-17d lnt-19a A mixture of lnt-17D (4.2 g, 20 mmol) and hydrazine hydrochloride 4-bromophenyl (4.4 g, 20 mmol) in AcOH and EtOH (1: 10, 100 mL) was heated to reflux and allowed to stir at this temperature for 6 hours. The reaction mixture was cooled to room temperature and concentrated in vacuo to provide the lnt-19a compound as a solid, which was used without further purification (9.2 g). MS (ESI) m / e (M + H +): 383.

Step B - Preparation of the compound lnt-19b lnt-19a lnt-19b A mixture of lnt-19a (9.2 g) in PPA was heated to 80 ° C and allowed to stir at this temperature for 2 hours. After cooling to room temperature, the reaction mixture was poured into ice water. The resulting solution was extracted with dichloromethane and the organic extract was washed with brine, dried over a2SO4, filtered and concentrated in vacuo. The obtained residue was purified by column chromatography to provide the compound lnt-19b (4.8 g). MS (ESI) m / e (M + H +): 368.

Step C - Preparation of compound lnt-19c lnt-19b lnt-19c To a solution of lnt-19b (6 g, 16.3 mmol) in DMSO / CH3CN (1: 1, 24 mL) was added Select-F (5.8 g, 16.3 mmol) in portions. The reaction was allowed to stir for 1 hour at room temperature, then the reaction mixture was concentrated in vacuo and the residue obtained was purified by HPLC to give the compound lnt-19c as a solid (1.0 g). MS (ESI) m / e (M + H +): 386.

Step D - Preparation of compound lnt-19d lnt-17c lnt-19d A suspension of lnt-17c (51.6 g, 221 mmol, 1.0 eq) in 910 ml of absolute ethanol and 100 ml of glacial acetic acid was heated at 40 ° C and 4-chlorophenyl hydrochloride hydrazine (41.66 g / 232 mmol / 1.05 g). eq) was added in portions, with stirring, followed by molecular sieves of 3 Angstroms (23 g) and additional acetic acid (350 mL). The reaction mixture was placed under an atmosphere of N2, it was heated to 70 ° C and allowed to stir at this temperature for 4 hours. The reaction mixture was allowed to cool to room temperature and was allowed to stand for about 15 hours, without stirring, under 2. The reaction mixture was filtered, the filtrate was concentrated in vacuo and the obtained residue was obtained in toluene (230 mL) and absolute ethanol (100 mL). The resulting solution was then concentrated in vacuo. The obtained residue was diluted with absolute ethanol (400 mL) and the resulting solution was allowed to stand in a water bath at 54 ° C for 45 minutes, then it was allowed to cool to room temperature while stirring. The resulting precipitate was filtered and the collected solid was washed with 30 mL of absolute ethanol and 75 mL of hexanes, then dried in vacuo to provide the compound lnt-19d as an off-white solid (50.2 grams (63%)). This material was used without further purification. MS (ESI) m l e (M + H +): 357.0, 359.0.

Step E - Preparation of the compound lnt-19e lnt-19d lnt-19e Polyphosphoric acid (111.8 g) and xylenes (260 ml_) were added to a 1-liter 3-necked flask. The flask was placed in an oil bath of 100 ° C, connected to an inlet of N2 and equipped with a mechanical stirrer. The mixture of PPA / xylenes was allowed to stir for 30 minutes to bring the internal temperature to 100 ° C. The lnt-19D compound was then added in portions for 10 minutes. The reaction was placed under N2 atmosphere, plugged, stirred for 30 minutes at 100 ° C and then stirred for 2.5 hours at 110 ° C. The flask was left out of the oil bath and allowed to cool for 15 minutes. Ice (750 mL) was added in portions to the reaction mixture with stirring. After 15 minutes, the reaction mixture was filtered through glass fiber filter paper in a Buchner funnel and an orange solid was collected. The collected solid was dissolved in EtOAc and the resulting purple solution was washed with water and brine, then dried over MgSO4, filtered and concentrated in vacuo. The obtained residue was purified by flash chromatography on a 345 g S1O2 column by gradient of 5% -25% EtOAc / hexanes to provide the compound lnt-19e (11.22 g) as a yellow solid (47%).

The following 2-aryl indole intermediates can be made using the method described above and the substitution of the appropriate reagents: i92 EXAMPLE 19a Preparation of intermediate compound lnt-19i Step A - Preparation of compound lnt-19f To a solution of lnt-17d (14.0 g, 65.1 mmol), (4-chlorophenyl) hydrazine (37.5 g, 130 mmol) in EtOH (400 mL) was added glacial acetic acid (40 mL). The reaction was heated to 90 ° C and allowed to stir at this temperature for about 15 hours. The reaction mixture was cooled to room temperature, filtered, and the filtrate was concentrated in vacuo and dried in vacuo for 15 minutes. The resulting residue was diluted with dichloromethane (600 mL) and the resulting suspension was stirred at room temperature for 30 minutes. The solid was removed by filtration and washed with dichloromethane five times. The filtrate was concentrated in vacuo and MeOH (100 mL) was added. The suspension was allowed to stir, stirring at room temperature for 15 minutes and filtered. The solid was dried in vacuum for two hours to provide the compound lnt-19f (17.9 g, 81.0%).

Step B - Preparation of the compound lnt-19q To a 250 mL three-necked flask with a mechanical stirrer was added polyphosphoric acid (PPA, 100g). PPA was heated to 1 10 ° C and lnt-19f (10.3 g, 30.3 mmol) was added in small portions. The reaction mixture gradually turned dark green. The reaction mixture was allowed to stir at 110 ° C for two hours. After cooling, crushed ice was added slowly with stirring until the dark green color disappeared. Water was added and the suspension was transferred into a 1000 mL beaker. The suspension was allowed to stir for 10 minutes and filtered. The solid was washed with water (100 mL) three times and dried under vacuum at 60 ° C for about 15 hours to provide the compound lnt-19g (9.72 g, 99.4%).

Step C - Preparation of compound lnt-19h To a 100 ml round bottom flask were added 19g-lnt (2.62 g, 8.12 mmol), DMSO (15 mL) and MeCN (15 mL). The solution was cooled to 0 ° C and Selecct-F (2.3 g, 6.5 mmol) was added in three portions. The reaction was allowed to stir at 0 ° C for 1.5 hours then gradually warmed to room temperature in one hour. The reaction mixture was diluted with 20 mL MeOH and filtered. The filtrate was concentrated in vacuo to about 20 mL and purified by C18 chromatography (150g, 50% to 100% MeCN in water, with 0.05% TFA) to provide the compound lnt-19h (964 mg, 35%).

Step D - Preparation of compound lnt-19i A solution of lnt-19h (2.05 g, 6.02 mmol), DMF (120 mL), Cs2C03 (10.0 g, 31.0 mmol) and dibromoethane (5.2 mL, 60.2 mmol) was heated to 100 ° C and allowed to stir at this temperature for about 15 hours. Additional dibromoethane (4.0 ml, 46 mmol) and CS2CO3 (3.0 g, 9.2 mmol) were added and the reaction was stirred at 100 ° C for 8 hours. The reaction mixture was cooled to room temperature and water (200 mL) and EtOAc (250 mL) were added. The organic layer was separated and the aqueous layer was extracted with EtOAc (100 mL). The organic layers were combined, washed with water (2 x 100 mL) and brine, dried over anhydrous Na 2 SO 4, filtered and concentrated in vacuo. The resulting residue was purified by flash column chromatography on silica gel (0% to 50% EtOAc in hexane) to provide the compound lnt-19i (1.24 g, 56.2%).

EXAMPLE 20 Preparation of compound 37 lnt-20c Compound 37 Step A - Preparation of the lnt-20a compound To a 40 mL vial was added lnt-19i (329 mg, 0.898 mmol), bis (pinacolato) diboro (228 mg, 0.898 mmol), Pd (dppf) 2 Cl2 * dichloromethane (146 mg, 0.18 mmol) and KOAc (264 mg). mg, 2.7 mmol). The vial was degassed, filled with N2 and capped. Dioxane was added via syringe and the solution was stirred at 90 ° C for 2 hours. (2S, 4R) -terc-butyl-2- (5-bromo-1 H-imidazol-2-yl) -4-fluoropyrrolidine-1-carboxylate praline (300 mg, 0.90 mmol), Pd (dppf) 2Cl2 * dichloromethane (83 mg, 0.1 mmol) and K2CO3 (1M, 3.3 mL, 3.3 mmol) were added and the reaction was allowed to stir at 90 ° C for 2 hours. The reaction mixture was cooled to room temperature, diluted with 5 mL of EtOAc, and the aqueous layer was separated and extracted with 3 mL of EtOAc. The combined organic extracts were dried over anhydrous Na2SO4, filtered and concentrated in vacuo. The residue obtained was purified by flash column chromatography on silica gel (24 g, 15% to 70% EtOAc in hexane) to provide the compound lnt-20a (387 mg, 79.7%).

Step B - Preparation of the compound lnt-20b To a 40 mL vial added lnt-20a (182 mg, 0.336 mmol), bis (pinacolato) diboro (89.7 mg, 0.353 mmol), Pd2 (dba) 3 »CHCl3 (35 mg, 0.034 mmol), X- phos (32 mg, 0.067 mmol) and KOAc (mg 98, 1.0 mmol). The vial was degassed, filled with N2 and capped. Dioxane was added via syringe and the solution was stirred at 120 ° C for 2 hours. (S) -terc-butyl-2- (5-bromo-1 H-imidazol-2-yl) pyrrolidine-1-carboxylate (116.9 mg, 0.37 mmol), Pd (dppf) 2 Cl2'-dichloromethane (28 mg, 0.034 mmol ) and K2CO3 (1 M, 1.0 mL, 1.0 mmol) were added. The reaction was stirred at 80 ° C for about 15 hours, then cooled to room temperature. The aqueous layer was separated and extracted with 5 mL of EtOAc. The organic extracts were combined and dried over Na 2 SO, filtered and concentrated in vacuo. The obtained residue was purified by flash column chromatography on silica gel (43 g, A: dichloromethane; B: 10% MeOH in EtOAc: A / B: 0-80%) to provide the compound lnt-20b (191 mg, 89.9%).

Step C - Preparation of the compound lnt-20c To a 40 mL vial, lnt-20a (190 mg, 0.256 mmol), MeOH (2 mL) and hydrochloric acid (4M in dioxane, 6 mL, 24 mmol) were added. The solution was allowed to stir at room temperature for two hours, then concentrated in vacuo and the residue obtained was dried under vacuum for 30 minutes to provide the compound lnt-20c, which was used without further purification.

Step D - Preparation of compound 37 To a 40 mL vial was added lnt-20c (-0.256 mmol), (S) -2- (methoxycarbonylamino) -3-methylbutanoic acid (90.0 mg, 0.512 mmol), HATU (214 mg, 0.56 mmol) and DMF ( 3 mL). The resulting solution was cooled to 0 ° C and DIPEA (0.32 mL, 1.79 mmol) was added. The reaction was allowed to stir at 0 ° C for 2 hours, then diluted with water (0.2 mL) and the resulting solution was purified by a C18 column (43g, 10% to 60%, of CH3CN in water with 0.05% TFA) to provide compound 37 (46 mg, 21.4% of ln-20b). EM 874.4 [M + H] + The following compounds of the present invention were made with the method described in Example 20.

EXAMPLE 21 Preparation of intermediate compound lnt-21a lnt-19h lnt-21a To a 20 ml microwave vial was added 19h-lnt (1.16 g, 3.41 mmol), anhydrous toluene (15 ml_), cyclopropane-carboxaldehyde (1.28 ml, 17.1 mmol) and p-toluenesulfonyl chloride (65 mg, 0.34 mmol ). The vial was capped and sealed, then placed in a microwave reactor and heated at 170 ° C for three hours. The reaction mixture was cooled to room temperature and concentrated in vacuo. The residue obtained was dissolved in dichloromethane (40 mL) and filtered through a short pad of Celite. The filtrate was concentrated in vacuo and purified using flash column chromatography on silica gel (80 g, hexane) to provide the lnt-21a compound (778 mg, 58.1%).

EXAMPLE 22 Preparation of intermediate lnt-22c lnt-22c Step A - Preparation of compound lnt-22a lnt-19b (5.82 g, 0.016 mmol) was dissolved in dichloromethane (50 ml_) and THF (50 ml_) and the mixture was stirred at room temperature until all the solids were dissolved. The resulting solution was cooled in an ice water bath for 30 minutes, after which NCS (2.13 g, 0.016 mmol) was added to the stirred reaction mixture in portions over -10 minutes. The reaction mixture was stirred at 0 ° C for 30 minutes and then at room temperature for 2 hours. The reaction mixture was concentrated in vacuo to give a brown semi-solid, which was dissolved in dichloromethane (~ 300 mL). The organic solution was washed sequentially with water (1 x ~ 200 mL), 10% aqueous sodium thiosulfate (w / v) and brine (1 x ~ 200 mL), then dried over anhydrous magnesium sulfate, filtered and concentrated in vacuum. The resulting solid residue was purified by column chromatography (Teledyne Isco RediSep® 330 g silica column, 0-30% EtOAc / hexanes in 12 column volumes in 200 mlJmin) to provide 2.97 g of lnt-22a (47% strength). yield) as a brown solid. MS (ESI) m / e (M + H +): 400.

Step B - preparation of lnt-22b compounds In a 20 mL microwave tube, ln-22a (1075 g, 2.68 mmol) was dissolved in dry toluene (13 mL). Cyclopropanecarboxaldehyde (1.0 mL, 0.94 g, 13.4 mmol), p-toluenesulfonyl chloride (51 mg, 0.27 mmol) and a magnetic stir bar were added. The tube was sealed and the reaction mixture was heated to 170 ° C (microwave) with stirring for 3 hours. The reaction mixture was cooled to room temperature, the tube opened, and in addition aliquots of each of cyclopropanecarboxaldehyde (1.0 mL, 0.94 g, 13.4 mmol) and p-toluenesulfonyl chloride (51 mg, 0.27 mmol) were added. The tube was closed again and the reaction was again subjected to microwave heating at 170 ° C for 4 hours, then cooled to room temperature and concentrated in vacuo to provide a brown solid residue. The brown solid residue was adsorbed on silica gel (19 g) using EtOAc (-100 mL), followed by evaporation of the solvent and then loaded in a 100 g Biotage® KP-Sil SNAP cartridge. Elution with 100% hexanes over 13 column volumes at 85 mL / minute gave 600 mg of lnt-22b (50% yield) as a light brown solid. MS (ESI) m / e (M + H +): 452.

EXAMPLE 23 Preparation of compound 23A Step A - Preparation of the lnt-23a compound lnt-19b lnt-23a A mixture of the compound lnt-19b (1.1 g, 3 mmol), (dibromomethyl) benzene (2.25 g, 9 mmol) and K2C03 (1.2 g, 9 mmol) in 15 mL of DMF was heated to 100 ° C and allowed to stir at this temperature for 3 hours.

The reaction mixture was cooled to room temperature, concentrated in vacuo and the obtained residue was dissolved with dichloromethane and water. The aqueous phase was extracted with dichloromethane. The combined organic extracts were washed with brine, dried over Na 2 SO 4, filtered and concentrated in vacuo. The resulting residue was purified by flash column chromatography on silica gel to provide the lnt-23a compound (380 mg, 28%) as a white solid. 1 H NMR (CDCl 3): d 7.72 (bs, 1 H), 7.44 - 7.46 (d, J = 8.4 Hz, 1 H), 7.21 - 7.28 (m, 3 H), 7.09 - 7.12 (m, 3 H). 7.04 (s, 1 H), 6.99 - 7.01 (bs, J = 6.8 Hz, 2 H), 6.78 (s, 1 H), 6.63 - 6.65 (d, J = 8.4 Hz, 1 H). MS (ESI) m / e (M + H +): 456.

Step B - Preparation of the compound lnt-23b lnt-23a lnt-23b To a solution of ln-23a (456 mg, 1.0 mmol) in 1,4-dioxane was added pinacol bis bovine (2.2 mmol), Pd (dppf) CI2 (0.04 mmol) and KOAc (4 mmol). The reaction mixture was subjected to N2, heated to 110 ° C and allowed to stir at this temperature for 3 hours. The reaction mixture was cooled to room temperature, concentrated in vacuo, and the obtained residue was purified using silica gel column chromatography to provide the compound lnt-23b (590 mg, 87% yield). 1 H NMR (CDCl 3): d 8.13 (s, 1 H), 7.60 (d, J = 7.6 Hz, 1 H), 7.52 (d, J = 8.0 Hz, 1H). 7.36-7.39 (m, 1 H), 7.14-7.19 (m, 4 H), 6.93-6.95 (m, 3 H), 6.90 (s, 1 H), 1.26-1.29 (s, 24 H). MS (ESI) m / e (M + H +): 550.

Step C - Preparation of the compound Int-23c lnt-23b lnt-23c A suspension of lnt-23b (550 mg, 1.0 mmol), tere-butyl 2- (2-bromo-1 H-imidazol-5-yl) pyrrolidine-1-carboxylate (2.4 mmol), Pd (dppf) CI2 (200 mg), Na 2 CO 3 (3 mmol) and in THF / H 2 O (10: 1, 33 mL) was allowed to stir at reflux for about 15 hours under N 2. The reaction mixture was cooled to room temperature and filtered, and the filtrate was washed with water (50 mL) and extracted with EtOAc (100 mL). The organic extract was washed with brine, dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting residue was purified by column chromatography on silica gel to provide the compound lnt-23C (160 mg). MS (ESI) m / e (M + H +): 768.

Step D - Preparation of the compound lnt-23d lnt-23c (0.10 g, 0.13 mmol) was added HCI / CH3OH (5 mL_, 3M) and the resulting reaction was allowed to stir at room temperature for about 3 hours. The reaction mixture was then concentrated in vacuo to provide the compound lnt-23d, which was used without further purification MS (ESI) m / e (M + H +): 568.

Step E - Preparation of compound 23A To a solution of lnt-23d (56.8 mg, 0.10 mmol), (S) -2- (methoxycarbonylamino) -3-methylbutanoic acid (35.0 mg, 0.20 mmol) and DIPEA (0.8 mmol) in CH3CN (1 mL) was added BOP (98 mg, 0.22 mmol). The resulting reaction was allowed to stir at room temperature and monitored using LC / MS. After LC / MS it showed that the starting material was consumed, the reaction mixture was filtered, and the filtrate was purified using HPLC to give compound A as a white solid. 1 H NMR (MeOD): d 7.94 (S, 1 H), 7.85 (d, J = 8.0 Hz, 1 H), 7.74 (s, 1 H), 7.63 (s, 1 H), 7.48 (s, 1 H), 7.35 - 7.37 (m, 2 H), 7.31 (s, 1 H), 7.17 - 7.18 (m, 4 H), 7.1 1 (s, 1 H), 6.96 -6.98 (d, J = 7.6 Hz, 2 H), 5.09 - 5.17 ( m, 2 H), 4.13 (t, J = 8.0 Hz, 2 H), 3.99 (bs, 2 H), 3.78 (bs, 2 H), 3.56 (s, 6 H), 2.44 - 2.47 (m, 2 H), 1.92-2.19 (m, 8 H), 0.77-0.85 (m, 12 H). MS (ESI) m / e (M + H +): 882.

The diastereomers were separated on a chiral column SFC: Isomer A: 1 H NMR (MeOD): d 8.08 (s, 1 H), 7.91 - 7.93 (m, 1 H), 7.72 (s, 1 H), 7.56 (s, 1 H), 7.24 - 7.43 (m, 7 H), 7.19 (s, 1 H), 7.03 - 7.05 (m, 2 H), 5.16 - 5.24 (m, 2 H), 3.81 - 4.21 (m, 6 H) ), 3.62 (s, 6 H), 2.52 - 2.54 (m, 2 H), 2.00 - 2.25 (m, 8 H), 0.84 - 0.91 (m, 12 H). MS (ESI) m / z (M + Hf: 882.

Isomer B: 1 H NMR (MeOD): d 7.90 (s, 1 H), 7.81 - 7.83 (m, 1 H), 7.72 (s, 1 H), 7.62 (s, 1 H), 7.45 (s, 1 H) ), 7.14 - 7.33 (m, 6 H), 7.09 (s, 1 H), 6.93 - 6.95 (m, 2 H), 5.06 - 5.14 (m, 2 H), 3.71 - 4.1 1 (m, 6 H) , 3.52 (s, 6 H), 2.41 - 2.44 (m, 2 H), 1.90 - 2.15 (m, 8 H), 0.74 - 0.86 (m, 12 H). MS (ESI) m / z (M + H) +: 882.

The compounds of the present invention depicted in the table below are made using the method described in example 23 and substituting the appropriate dibromotoluene derivative in step A.

EXAMPLE 24 Preparation of the compound Step A - Preparation of the compound lnt-24b lnt-24a lnt-24b To a solution of the compound lnt-24a (1.48 g, 3.76 mmol) in 11 ml of THF at -78 ° C was added n-Buü (2.5 M in hexane, 1.66 ml, 4.14 mmol). The reaction was allowed to stir at -78 ° C for 30 minutes, then 2-chloro-N-methoxy-N-methylacetamide (1.1 g, 7.52 mmol) in 2 mL of THF was added at -78 ° C. The reaction was allowed to stir for 1 hour at -78 ° C, then quenched with saturated aqueous NH 4 Cl. The resulting solution was extracted with EtOAc and the organic extract was washed with brine solution, dried (Na2SO-j), filtered and concentrated in vacuo. The resulting residue was purified using a column of 80 g ISCO (hexane at 50% EtOAc-hexane, gradient) to provide the compound lnt-24b, 503 mg (35%). LREM: (M + H) + Step B - Preparation of compound lnt-24d To a solution of the compound lnt-24b (97 mg, 0.25 mmol) and Int-6f (91 mg, 0.38 mmol) in DMF (2 mL) was added Cs2CO3 (163 mg, 0.50 mmol). The resulting reaction was heated to 40 ° C, allowed to stir at this temperature for 1 hour and then cooled to 25 ° C. The reaction mixture was poured into ice water and the organic phase was extracted with EtOAc. The organic extract was washed with brine, dried (NazSO-i), filtered and concentrated in vacuo. The obtained residue was purified by a 24 g ISCO column (gradient of 40% hexane EtOAc in hexane) to provide compound lht-24c, 135 mg (91%).

Step C - Preparation of the compound lnt-24d lnt-24c lnt-24d To a solution of the compound lnt-24c (135 mg, 0.23 mmol) in o-xylene (2 mL) was added ammonium acetate (107 mg, 1.38 mmol) and the resulting reaction was allowed to stir at 140 ° C for 3 hours. After cooling to 25 ° C, the reaction mixture was added to the aqueous solution of NaHCO 3 and the organic layer was extracted with EtOAc. The combined organic solutions were washed with brine, dried (Na2SO4), filtered and concentrated in vacuo. The obtained residue was purified by a 24 g ISCO column (gradient of 50% hexane EtOAc in hexane) to provide the compound lnt-24d, 84 mg (64%). LREM: (M + H) + = 575 Step D - Preparation of compound lnt-24g Int-7d Int- 24g To a solution of compound lnt-24d (81 mg, 0.14 mmol), bis-pinacolatodiborane (53 mg, 0.21 mmol), PdCI2 complex (dppf) 2 CH2Cl2 (11.5 mg, 0.014 mmol) in 1,4-dioxane (2 ml) ) potassium acetate (41 mg, 0.42 mmol) was added. The reaction was degassed and allowed to stir at 100 ° C for 2 hours. After being cooled to 25 ° C, the reaction mixture was diluted with EtOAc and filtered through a pad of Celite. The filtrate was concentrated in vacuo to provide the lnt-24f compound, which was combined with lnt-7d (66 mg, 0.21 mmol) and PdCI2 complex (dppf) 2 CH2Cl2 (11.5 mg, 0.014 mmol) and dissolved in 1,4-dioxane (2 mL). The resulting solution was treated with aqueous 2M Na 2 CO 3 solution (0.21 ml, 0.42 mmol) and the reaction mixture was degassed and allowed to stir at 100 ° C for 2 hours. After being cooled to 25 ° C, the reaction mixture was diluted with EtOAc and filtered through a pad of Celite. The filtrate was concentrated in vacuo and the residue obtained was purified using an ISCO 24 g column (gradient from 0% to 100% EtOAc in hexane) to provide the compound lnt-24g (40 mg, 39%). LREM: (M + H) + = 732.

Step E - Preparation of compound lnt-24h lnt-24g lnt-24h To a solution at 0 ° C of the compound lnt-24g (40 mg, 0.054 mmol) in dichloromethane (2 mL) was added TFA (0.4 mL). The reaction was allowed to stir 0 ° C for 0.5 hours and then warmed to 25 ° C and allowed to stir for an additional 2 hours. The reaction mixture was concentrated in vacuo and the obtained residue was dissolved in MeOH (2 mL) followed by the addition of 4N HCl in dioxane (0.3 mL). The solution was concentrated in vacuo to provide the lnt-24h compound as its HCI salt (40 mg), which was used without further purification. LREM: (M + H) + = 532.

Step F - Preparation of compound 16 To a solution of -30 ° C of the compound lnt-24h (41 mg, 0.068 mmol), the compound lnt-1a (36 mg, 0.20 mmol) and düsopropylethylamine (83 μ ?, 0.48 mmol) in DMF (1.5 ml) were added. added HATU (103 mg, 0.27 mmol). The mixture was allowed to stir at -30 ° C at 0 ° C for 1 hour and for an additional 2 hours at 0 ° C. The reaction was then quenched by the addition of cold water and the resulting mixture was purified using Gilson HPLC (CH3CN-H20, 0.1% TFA) to provide compound 16. Compound 16 was dissolved in MeOH (10 mL) and treated with HCl 4N in dioxane (0.3 ml) followed by concentration in vacuo to provide the HCl salt of compound 16 as a ~ 1: 1 mixture of diastereomers, 16 mg (28%).

The diastereomers were separated by chiral HPLC using chiral Semi-prep OD column (Lux cellulose-1) (20% EtOH-hexane, 0.1% DEA) to provide compound 16A (retention time: 44 minutes), 6 mg and compound 37B (retention time: 66 minutes), 3 mg.

EXAMPLE 25 Preparation of compound 17 17 Step A - Preparation of the lnt-25a compound The lnt-25a compound was prepared from the lnt-24b compound using the method described in Example 24, step B (100%).

Step B - Preparation of compound lnt-25b The lnt-25b compound was prepared from the lnt-25a compound using the method described in example 24, step C yield (45%). LREM (M + H) + = 589.

Step C - Preparation of the compound lnt-25d Compound lnt-25d was prepared from compound int-25b using the method described in Example 24, yield from step D (44%). LRE: (M + H) + = 746.

Step D - Preparation of the compound lnt-25e Compound lnt-25e was prepared from compound lnt-25d using the method described in Example 24, step E yield (100%).

Step E - Preparation of compound 17 Compound 17 (HCl salt) was prepared from the lnt-25e compound using the method described in Example 24, step F yield (50%).

The diastereomers were separated by chiral HPLC using chiral Lux C-2 Semi-prep column (50% EtOH-hexane, 0.1% DEA) to provide compound 17A (retention time: 45 minutes) and compound 17B (time Retention: 59 minutes).

EXAMPLE 26 Preparation of compound 23 Step A - Preparation of the compound lnt-26a lnt-24b lnt-26a The lnt-26a compound was prepared from the lnt-24b compound using the method described in Example 24, step B (87%).

Step B - Preparation of compound lnt-26b The lnt-26b compound was prepared from the lnt-26a compound using the method described in Example 24, step C (72%). LREM (M + H) + = 585.

Step C - Preparation of the compound lnt-26d To a solution of the compound lnt-26b (243 mg, 0.42 mmol), bis-pinacolato diborate (127 mg, 0.50 mmol), PdCl2 complex (dppf) 2 CH2Cl2 (34 mg, 0.042 mmol) in 1,4-dioxane ( 3 ml) was added potassium acetate (83 mg, 0.84 mmol). The mixture was degassed and allowed to stir at 100 ° C for 2 hours. After being cooled to 25 ° C, lnt-7d (265 mg, 0.84 mmol), PdCI2 complex (dppf) 2 CH2CI2 (34 mg, 0.042 mmol) and K2C03 (1N aqueous solution, 1.2 ml, 1.2 mmol) were added. The mixture was degassed and allowed to stir at 90 ° C for 18 hours. After being cooled to 25 ° C, the mixture was diluted with EtOAc and filtered through a pad of Celite. The filtrate was concentrated in vacuo and the obtained residue was purified using Prep TLC (5% MeOH in CH 2 Cl 2) to give lnt-26d, 146 mg (47%). LREM: (M + H) + = 742.

Step D - Preparation of compound lnt-26e The lnt-26e compound was prepared from lnt-26d using the method described in Example 24, step E (100%). LREM: (M + H) + = 542.6.

Step E - Preparation of compound 23 Compound 23 (HCl salt) was prepared from the lnt-26e compound using the method described in Example 24, step F (53%).

The diastereomers were separated by chiral HPLC using chiral Lux C-2 Semi-prep column (50% EtOH-hexane, 0.1% DEA) to provide compound 23A (retention time: 16 minutes) and compound 23B (time of Retention: 27 minutes).

EXAMPLE 27 Preparation of compound 26 26 Step A - Preparation of compound lnt-27a lnt-24b lnt-13e lnt-27a The lnt-27a compound was prepared from the lnt-24b compound using the method described in Example 24, step B (85%).

Step B - Preparation of compound lnt-27b The lnt-27b compound was prepared from the lnt-27a compound using the method described in Example 24, step C (75%). LREM (M + H) + = 593.

Step C - Preparation of the compound Int 27d The lnt-27d compound was prepared from the compound lnt-27b using the method described in Example 24, step D (40%). LREM (M + H) + = 750.

Step D - Preparation of compound lnt-27e The lnt-27e compound was prepared from the lnt-27d compound using the method described in Example 24, step E (100%). LREM: (M + H) + = 550.

Step E - Preparation of compound 26 Compound 26 (HCl salt) was prepared from compound lnt-27e using the method described in Example 24, step F (50%).

The diastereomers were separated by chiral HPLC using a chiral Lux C-2 Semi-prep column (35% EtOH-hexane, 0.1% DEA) to provide compound 26A (retention time: 38 minutes) and compound 26B (time Retention: 50 minutes).

EXAMPLE 28 Preparation of compound 240 Step A - Preparation of compound lnt-28c lnt-28a lnt-28b lnt-28c A solution of ln-28a (13.2 g, 46mM), lnt-28b (9.0 g, 38 mm), Pd (PPh3) 4 (4.4 g, 3.8 mm), K2C03 (13.1 g, 95 mmol) in 28 ml of H20 and 140 ml of DME was purged with nitrogen. The reaction was allowed to stir while heating under reflux for 3 hours. Another portion of boric acid (0.5 equiv.), Pd (PPh3) 4 (0.01 eq) was added and the reaction was allowed to stir at reflux for an additional 4 hours. The reaction mixture was diluted with EtOAc and filtered through a small Celite plug. The filtrate was concentrated in vacuo and the residue obtained was purified with instantaneous LC (0-10% EtOAc / hexane) to provide compound lnt-28c (14.5 g). MS (ESI) m / e (M + Na +): 425.

Step B - Preparation of compound lnt-28d To a suspension of the compound lnt-28c (2 g, 5 mM) in CH 2 Cl 2 (8 mL), TFA (4 mL) was added dropwise and the reaction allowed to stir at room temperature for 14 hours. The reaction mixture was concentrated in vacuo and the resulting residue was suspended in a solvent mixture of THF (25 ml), ethanol (6 ml) and water (2.5 ml). Zn powder (3.25 g, 50 mmol) and NH 4 Cl (1.3 g, 25 mmol) were added and the reaction was allowed to stir at reflux for 1 hour. The reaction mixture was diluted with EtOAc and filtered through a small Celite plug. The filtrate was washed with water and brine, dried over MgSO4, filtered and concentrated in vacuo to provide the compound lnt-28d (1.9 g). MS (ESI) m / e (M + H +): 273.

Step C - Preparation of compound lnt-28e lnt-28d lnt-28e To a suspension of lnt-28d (1 g, 3.6 mm) in DMSO (5 ml) / acetonitrile (5 ml) was added Select-F (1.53 g, 4.3 mmol). The reaction was allowed to stir for 30 minutes, then diluted with EtOAc and washed with water and brine, and the organic phase was dried over MgSO 4, filtered and concentrated in vacuo. The residue obtained was suspended in acetic anhydride (4 ml) and allowed to stir at room temperature for 2 hours. The reaction mixture was then diluted with EtOAc and washed with water and NaHCO 3 solution. The organic phase was dried over MgSO 4, filtered and concentrated in vacuo and the residue obtained was suspended in EtOAc (10 mL). To the resulting suspension was added 4M HCl in dioxane (4 mL) and the reaction was allowed to stir room temperature for 2 hours. The reaction mixture was filtered and the collected solid was washed with hexane, then recrystallized from ethanol to provide the lnt-28e compound (200 mg). MS (ESI) ml (M + H +): 315.

Step D - Preparation of compound lnt-28f lnt-28e lnt-28f To a suspension at 0 ° C of lnt-28e (200 mg, 0.63 mm) in CH 2 Cl 2 (5 mL) was added the 1 M solution of BBr 3 in CH 2 Cl 2 (5 mL) at 0 ° C. The reaction was allowed to stir at 0 ° C for 1.5 hours, then an additional 5 ml of the 1 M solution of BBr 3 in CH 2 Cl 2 was added and the reaction was heated to 40 ° C and allowed to stir at this temperature for 5 hours. The reaction mixture was then diluted with EtOAc (200 mL) and the resulting solution was washed with NaOH solution and NaHCO3 solution. The organic layer was then washed with water and brine, dried over MgSO4, filtered and concentrated in vacuo to provide a residue which was subsequently suspended in CH2Cl2 (5 mL) was cooled to 0 ° C. To this solution was added E.3N (0.6 ml) and Tf20 (0.5 ml) and the resulting reaction was allowed to stir at 0 ° C for 1.5 hours. The reaction was then diluted with dichloromethane and warmed with 10% citric acid. The organic layer was washed with water and brine, dried over MgSO4, filtered and concentrated in vacuo. The residue obtained was suspended in dioxane (8 ml) and to the resulting solution was added bis-pinacolatodiborane (265 mg), PdCfc complex (dppf) 2 CH2CI2 (26 mg) and potassium acetate (206 mg). The mixture was degassed, purged with nitrogen and allowed to stir at 100 ° C for 1.6 hours. The reaction mixture it was cooled to 25 ° C, diluted with EtOAc and filtered through a pad of Celite. The filtrate was concentrated in vacuo and the obtained residue was purified using flash LC (0-100% EtOAc-Hex) to provide the compound lnt-28f (100 mg).

Step E - Preparation of compound 240 Compound 240 was prepared from compound lnt-28f using the method described in Example 20.

\ EXAMPLE 29 Preparation of intermediate compound lnt-29a To a suspension of compound lnt-28d (0.51 g, 1.87 mmol) in CH 2 Cl 2 (3 mL) was added cyclopropyl anhydride (2 mL). The resulting reaction was allowed to stir at room temperature for 2 hours, then a solution of HCl 4 in dioxane (3 mL) was added and the reaction was allowed to stir at room temperature for 2 hours. The reaction mixture was then filtered and the collected solid was washed with hexane and dried in vacuo to provide the int-29a compound (590 mg). MS (ESI) m / e (M + H +): 323.

EXAMPLE 30 Step A lnt-30a phenol commercially available (125 g, 73.3 mmol), Int-30b hydrazine (13.1 g, 73.3 mmol) and methanol (200 mg) were charged to a 500 ml flask. To the suspension of potassium acetate (14.5 g, 148 mmol) was added and the resulting reaction mixture was allowed to stir at reflux. After 3 hours, the reaction was cooled, and the solid was collected by filtration, washed with methanol (50 ml) and water (2 x 50 ml) and dried in vacuo to provide hydrazone Int-30C as a light orange solid. (18.5 g, 50%).

Step B Int-30c (18.5 g, 62.7 mmol) and polyphosphoric acid (50 g) were added to a 250 ml flask equipped with a mechanical stirrer. The mixture is allowed to stir at 120 ° C for 30 minutes and cooled to room temperature. Ice and water were added to the mixture. The solid was collected by filtration, washed with water (2 x 100 mL) and then dissolved in ethyl acetate (200 mL) and washed with water (2 x 200 mL) again. The solution was then dried over sodium sulfate and concentrated in vacuo to provide indole lnt-30d as a solid (17 g, 98%).

Step C Indol Int-30d (18.3 g, 65.8 mmol), cesium carbonate powder (356.6 g, 117 mmol) and DMSO (100 mL) were charged into a 500 mL flask. To the resulting suspension was added diiodomethane (134.4 g, 36 mmol) by syringe. The reaction mixture was allowed to stir at room temperature for about 15 hours, treated with water (300 ml) and filtered. The solid was purified by a 120 g silicon column / Combi-Flash Rf system using a gradient of 0-20% ethyl acetate in hexanes to provide lnt-30e as a white solid (8.5 g, 45%) .

Step D Int-30e (2.4g, 8.27 mmol), NBS (1.47 g, 8.27 mmol) and THF (50 mL) was added to a 100 mL flask and stirred at room temperature.

After 5 hours the reaction was concentrated in vacuo to a semi-solid and the residue treated with water (100 ml), stirred at room temperature for about 15 hours and filtered. The filter cake was washed with water (3 X 20 ml) and dried to provide indole lnt-30f as a pale solid (2.7 g, 88%).

EXAMPLE 31 Preparation of compound 1525 and compound 1541 Compound 1541 Step A To a 35 ml microwave reaction tube was added lnt-30f (500 mg, 1.36 mmol), bis (triphenylphosphine) palladium (II) dichloride (95 mg, 0.135 mmol), copper iodide (258 mg, 1355 mmol) ) and DMF (10 ml). The resulting suspension was degassed and heated to 100 ° C, and then lnt-31a was added in portions by syringe. The resulting mixture was allowed to stir at 100 ° C for 6 hours under additional nitrogen. After cooling, the solution was diluted with 10 ml of ethyl acetate, filtered and concentrated in vacuo. The residue was purified using a 40 g silica column / Rf Combi-Flash system (0-15% ethyl acetate, eluent of hexanes) to provide lnt-31 b as a wax (370 mg, 65%).

Step B lnt-31 b (120 mg, 0.286 mmol), bis (pinacolato) diboro (152 mg, 0.6 mmol), potassium acetate (280 mg, 2.86 mmol), Pd2 (dba) 3-CHCl3 (59.1 mg, 0.057 mmol) , X-PHOS (54.4 mg, 0.114 mmol) and dioxane (4 ml) were added to a 35 ml microwave reacttube. The sealed mixture was degassed and stirred at 110 ° C under nitrogen atmosphere for 8 hours then cooled to room temperature. To this mixture was added lnt-7h bromide (246 mg, 0.658 mmol), PdCI2 (dppf) -CH2Cl2 (46.7 mg, 0.0057 mmol), 1.5 M aqueous solutof sodium carbonate (1.9 mL, 2.9 mmol). The resulting mixture was degassed and stirred at 95 ° C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated, purified using Gilson reverse phase chromatography (10-80% acetonitrile in water with 0.1% TFA eluent) to provide compound 1525 as a wax (68 mg, 20%). LC / MS analysis calculated for: C52H53 9O8 935.4; found: 937.1 (M + H) +.

Step C Compound 1525 (16 mg, 0.014 mmol) and 10% palladium on activated charcoal (5 mg, 4.7 μ?) Were added with 8 ml of methanol in a 250 ml pressure vessel and the reactwas stirred at room temperature under atmosphere of 35 psi hydrogen using the PARR hydrogenatapparatus for 6 hours. The reactmixture was filtered through celite, concentrated in vacuo to provide compound 1541 as a solid (15 mg, 93%).

LC / MS analysis calculated for: C52H61 N9O8 939.4; found: 939.7 (M + H) +.

EXAMPLE 32 Preparatof compound 752 A round bottom flask was charged with lnt-32a (89 mg, 0.14 mmol), (R) -2- (diethylamino) -2-phenylacetic acid hydrochloride (66 mg, 0.32 mmol), HATU (58 mg, 0.153 mmol ) and 2 ml of DMF provide 50 mg (34%) of the title compound 752 using the top method as step D of compound 752. LC-MS (M + H) = 946.8.

EXAMPLE 33 Preparatof compound 1359 lnt-33f Compound 1359 Step A Cs2C03 (48.5 g, 150 mmol) and dibromoethane (28 g, 150 mmol) was added to a stirred solutof lnt-19 g (9.6 g, 30 mmol) in DMSO (100 ml) and the mixture was allowed to stir at 90 ° C for approximately 15 hours. The mixture was cooled, diluted with water (-200 ml) and extracted with EtOAc (3 x 100 ml). The combined organic extracts and an EtOAc wash were washed with brine (1 x 80 mL), dried over Na2SO4. The dried layer was evaporated, the solid residue was triturated with methylene chloride, filtered to provide the first crop of l-33a as a white solid (4.33 g). The filtrate was purified by column chromatography on silica gel 330g, eluting with Hex / EtOAc (0 to 10% then 20%) to provide the second crop of lnt-33a as a white solid (2.5 g) yield of 62.3 %.

Step B lnt-33a (6.4 g) was resolved in SFC (chiral AD, 30% MeOH / AcCN (2: 1) in C02, to provide lnt-33a '(~ 3 g) and lnt-33a "(~ 2.8g) .

Step C lnt-33a "(0.51 g, 1463 mmol), bis (pinacolato) diboro 0.446 g, 1755 mmol), KOAc (0.431 g, 4.40 mmol) and PdCI2 (dppf) 2 (0.107 g, 0.146 mmol) was added in a tube After the vial was rinsed with N2, dioxane (5 ml) was added. The mixture was allowed to stir at 95 ° C for 4 hours. The crude lnt-33b was used in the next step without purificat Step D lnt-7d (0.51 g, 1.61 mmol), PdCI2 (dppf) 2 (0.107 g, 0.146 mmol) and K2CO3 (1 N ac, 5 mL) was added to the aforementd reactmixture lnt-33b. The tube was sealed and degassed and heated at 100 ° C for about 15 hours. After cooling, EtOAc (30ml) was added and extracted with brine (30ml). The organic layer was separated and dried and concentrated in vacuo. The crude material was purified on an ISCO column (40 g) and eluted with Hex: EtOAc from 0% to 70% to provide Int-33c (350 mg, 45%).

Step E lnt-33c (160mg, 0.317 mmol), Pd2 (dba) 3, (44mg, 0.048 mmol), X-Phos (45.3 mg, 0.095 mmol), KOAc (93 mg, 0.950 mmol), bis (pinacolato) diborium (88 mg, 0.349 mmol) and dioxin (3 ml) are added in a sealed tube of 25 ml. The tube was then degassed in vacuo followed by rinsing with N2 three times. The mixture was allowed to stir at 120 ° C for about 15 hours. LC-MS indicates that the reactwas complete, the crude product lnt-33d was used in the next step without further purificat Step F lnt-33d (131 mg, 0.392mmol), PdCI2 (dppf) 2 > (26 mg, 0.036 mmol) and 1 M K2CO3 (~ 3 mL) was added to the aforementioned Int-7e mixture. The mixture was allowed to stir at 90 ° C for 4 hours. After cooling, the aqueous layer was separated and extracted with 10 ml of EtOAc. The organic layers were combined and dried over anhydrous Na2SO4. The solution was filtered and concentrated in vacuo. The product was purified using SiO2 chromatography (24 g, solvent A: DCM, solvent B. 0-50%) to provide lnt-33e as the desired product (95 mg, 37%).

Step G Int-33e (95 mg) was allowed to stir in dioxane (10 mL). HCl (4N in dioxane, 3 mL) was added and allowed to stir at room temperature for 1.5 hours. The solvent was removed and the lnt-33f was isolated without further purification (95 mg, 100%).

Step H lnt-33f (50 mg, 0.075 mmol) was dissolved in DMF (1.5 ml) and cooled to 0 ° C. HATU (68.2 mg, 0.179 mmol) compound 10A (34.1 mg, 0.157 mmol was added followed by the addition of Hunig's base (0.062 mL, 0.45 mmol) The reaction was allowed to stir at 0 C for 45 minutes. to quench the reaction The mixture was purified using RP_HPLC (AcCN / H20, 0-80%) to give the title compound 1359-115 mg (52.4%).

EXAMPLE 34 Preparation of compound 851 Compound 851 Step A A mixture of lnt-34a (0.3g, 0.773 mmol), cesium carbonate (0.755 g, 2.318mmol) and acid (1 R, 3S, 5R) -2- (tert-butoxycarbonyl) -2- azabicyclo [3.1.0] hexane-3-carboxylic acid (0.386 g, 1.7mmol) in DMF (10ml ) were combined in a microwave tube and heated to 40 ° C. After 4 hours. TLC indicates that the reaction was complete. The reaction was diluted with EtOAc (30ml) washed with water (3x20ml), brine (1x20ml), dried (Na2SO4), filtered and concentrated under reduced pressure to provide lnt-34b as a red oil. Int-34b was used in the next step without further purification.

Step B lnt-34b (0.59 g, 0.766 mmol), ammonium acetate (1182 g, 15.33 mmol) and xylenes (15 mL) were charged into a microwave tube and heated to 120 ° C (oil bath) for 4 hours. (Note: this reaction must be carried out in an extraction hood with shield protection). The reaction was cooled and then diluted with EtOAc (25ml) and water (25ml). The organic layer was washed with water (2x20ml), brine (1x20ml), dried (Na2SO4), filtered and concentrated to provide crude lnt-34c which was purified in an ISCO chromatography system using 5% MeOH / Ch ^ Ck. The corresponding fraction was collected and concentrated to provide lnt-34c as an orange solid, Step C The standard capping procedure was used as for compound 851 of lnt-34c as above (41%).

EXAMPLE 35 Preparation of intermediate lnt-35e lnt-19g lnt-35a Step A The indole phenol lnt-19-g (10.0 g, 31.0 mmol), cesium carbonate (40 g, 123 mmol) and DMSO (77 ml) was added to a 500 ml round bottom flask equipped with a stir bar . 1,1-Dichloropropane (10.09 g, 89 mmol) was added to the reaction mixture, N2 was blown over the reaction mixture, and the bottle was capped. The flask was placed in a 90 ° C oil bath, which was then heated to 110 ° C. After ~16 hours at 110 ° C, the reaction mixture was allowed to cool to room temperature. 1.1-Additional dichloropropane was added (4 g, 35 mmol), the reaction mixture was covered with N2 and re-heated to 110 ° C. After 4.5 hours, the reaction was cooled to room temperature, and poured into 300 ml of water. EtOAc was added (500 ml) and the layers separated. The aqueous layer was extracted with additional EtOAc. The combined organic layer was washed with water and brine, filtered by gravity and dried over MgSO4. The mixture was filtered and the solvent was concentrated under reduced pressure to provide 11.62 g of a tan solid. The crude product lnt-35a was dissolved in CH2Cl2, silica gel (62 g) was added and the mixture was concentrated in vacuo. The silica gel containing the crude product was charged dry on a column of silica gel (262 g) which had been packed with hexanes. The column was eluted with a gradient of EtOAc / hexanes (0% - 1.5%). The first main peak was collected as a product to provide lnt-35a as a white solid (3.11 g). LC / MS. Observed. M + H = 361.8.

Step B lnt-35a (1.59 g, 4.38 mmol), PdCI2 (dppf) (0.493 g, 0.674 mmol), Bis (pinacolato) diboro (1.08 g, 4.26 mmol) and potassium acetate (1.49 g, 15.18 mmol) were added to a 20 ml microwave vial equipped with a stir bar. The vial was a cycle between vacuum and nitrogen five times. Dioxane (16 ml) was added via the syringe and the vial was a cycle between vacuum and nitrogen three times more. The vial was placed in a preheated reaction block and the reaction mixture was allowed to stir at 85 ° C. After 2.5 hours, the reaction mixture was allowed to cool to room temperature. The reaction mixture was diluted with water and ethyl acetate and the layers were separated. The organic layer was washed with water and brine, filtered through a pad of Celite, dried with MgSO4 and filtered again. The solvent was evaporated under reduced pressure to provide lnt-35b as a yellow oil. The crude product was further purified via silica gel column chromatography on a 80 g Gold Isco S1O2 cartridge, using a gradient of MeOH / CH2Cl2 (0% -5%) as the mobile phase to provide lnt-35b (1.29 g). ) like a white foam. LC / MS. Observed M + H = 410.1 1.

Step C lnt-35b (0.66 g, 1611 mmol), lnt-10f (0.658 g, 1682 mmol) and PdCI2 (dppf) (0.120 g, 0.164 mmol) were added to a round bottom flask equipped with a stir bar. The bottle was covered with a septum, connected to a vacuum line by needle and pipe and cycled between vacuum and nitrogen five times. Dioxane (8 ml) was added through the syringe and the vial was a cycle between vacuum and nitrogen three times more. Aqueous 2.0 M potassium carbonate (2.8 ml, 5.60 mmol) was added and the vial was a cycle between vacuum and nitrogen five times and the flask was heated to 85 ° C in a heating block. After 16.5 hours, the reaction mixture was allowed to cool to room temperature, diluted with ethyl acetate and water and the layers separated. The organic layer was washed with water and brine, filtered by gravity, dried with gSO and filtered again. The solvent evaporated under reduced pressure to provide lnt-35c (1.16 g) as a brown foam. The crude product was purified by flash silica gel column chromatography on an ISCO 80 g S1O2 Gold cartridge, using a gradient of MeOH / CH2Cl2 (0% -5%) as the mobile phase. The main peak was isolated as a product to provide lnt-35c (0.41 g) as a tan foam.

LC / MS- Observed M + H = 594.2.

Step D X-Phos (0.116 g, 0.243 mmol), adduct Pd2 (dba) 3 chloroform (0.110 g, 0.106 mmol), Bis- (pinacolato) diboro (0.175 g, 0.689 mmol) and potassium acetate (0.254 g, 2.59 mmol) they were added to a 5 ml microwave tube equipped with a stir bar. The tube was capped and connected to a vacuum line by needle and tubing. The tube was a cycle between vacuum and nitrogen five times. Dioxane (0.3 ml) was added via the syringe and the tube was a cycle between vacuum and nitrogen five times. After five minutes, a solution of lnt-35c (0.44 g, 0.741 mmol) in 2.2 ml of dioxane was added by syringe. The tube was cycled between vacuum and nitrogen five more times and the tube was placed in a heating block at 120 ° C. After 4 hours the reaction mixture was allowed to cool to room temperature environment and was used in the next step without further purification.

Step E PdCI2 (dppf) (81 mg, 0.111 mmol) and lnt-7d (246 mg, 0.777 mmol) were added to a 5 ml microwave tube equipped with a stir bar. The tube was capped and connected to a vacuum line by needle and tubing. The tube is cycled between vacuum and nitrogen five times. The crude lnt-35c was added via the syringe to the tubing containing the Suzuki reaction. The tube was cycled between vacuum and nitrogen three times. Aqueous 2.0M potassium carbonate (1480 mL, 2.96 mmol) was added via syringe. The tube was cycled between vacuum and nitrogen three times more. The tube was placed in a heating block of 85 ° C and allowed to stir for approximately 15 hours. After -16 hours, the reaction was cooled and the aqueous layer was removed through the pipette. The remaining organic layer was diluted with 1.5 ml of DMF and 0.3 ml of water. The resulting material was passed through a micron syringe filter while injected directly into an ISCO C-18 Gold cartridge. The cartridge has been conditioned with 15% acetonitrile in water. TFA (0.1%) is added to each component of the mobile phase. The column was eluted with a gradient of acetonitrile / water (15% -90% with 45% acetonitrile maintenance while the main peak eluted) Int-35d was obtained as a white solid (262 mg). MS Observed M + H = 795.3.

Step F lnt-35d (257 mg, 0.323 mmol) and methanol (15 ml) were added to a round bottom flask equipped with a stir bar. HCl in dioxane (4.0) (5 mL, 20.00 mmol) was added, and the reaction mixture was stirred at room temperature. After ~ 45 minutes the reaction mixture was concentrated in vacuo. Int-35e was obtained as a colorful solid (int-5060 LC / MS, observed M + H = 695.3) The product was used in the subsequent reactions without further purification.

EXAMPLE 36 Preparation of compound 814, 1450 and 1451 Amino acid lnt-4f (44.6 mg, 0.205 mmol) and a solution containing lnt-35e (57 mg, 0.082 mmol), acetonitrile (410 μl), THF (410 μl), and DIPEA (71.6 μl, 0.410 mmol) ) a 1 vial of dram equipped with a stir bar was added. Propylphosphonic anhydride (aka T3P) (164 μ ?, 0.246 mmol) was added, and the reaction mixture was allowed to stir at room temperature. After 4 hours, the reaction mixture was diluted with EtOAc and water and the layers separated. The organic layer was washed with water and brine, dried with MgSO 4, filtered and concentrated to a brown oil. The aqueous layer was then basified with 2.0M potassium carbonate and extracted with EtOAc and CH2Cl2. The combined organic layer was filtered, dried with MgSO 4, filtered again and concentrated to dryness. The crude product was purified by silica gel column chromatography on a 4 g ISCO SiO2 cartridge, using a gradient MeOH / CH2Cl2 as mobile phase to provide a white solid compound 814 Observed. M + H = 894.3.

Compound 814 (mixture of the isomer in the ethyl position) was separated on a Chiralcel OD column using 30% ethanol in hexanes as the mobile phase. Diethylamine (0.1% by volume) was added for each component of the mobile phase. Two peaks containing a molecular ion were isolated at 894.4 in the LC / MS. LC / MS. Observed. M + H = 895.0. Peak A = Compound 1450; Peak B = Compound 1451.

EXAMPLE 37 lnt-35b (113 mg, 0.276 mmol), lnt-7b (103 mg, 0.238 mmol) and PdCI2 (dppf) (26 mg, 0.036 mmol) were added to a 2 ml microwave vial equipped with a stir bar. Using the procedure of example 35, step C provided 129 mg of lnt-37a as a clear oil. LC / MS. Observed M + H = 636.1.

X-Phos (30 mg, 0.063 mmol), Pd2 (dba) 3 (31 mg, 0.034 mmol), Bis (pinacolato) -diboro (47 mg, 0.185 mmol) and potassium acetate (65 mg, 0.662 mmol) were added to a 2 ml microwave vial equipped with a stir bar. The vial was capped and connected to a vacuum line through a needle and tubing. The vial was cycled between vacuum and nitrogen five times. A solution of lnt-37a (125 mg, 0.197 mmol) in dioxane (800 μ?) Was added via the syringe, and the vial was a cycle between nitrogen and house vacuum five times. The flask was placed in a preheated reaction block and the reaction mixture was allowed to stir at 120 ° C, for 3.5 hours. The reaction mixture was allowed to cool to room temperature and was allowed to stir for about 15 hours at room temperature. The crude reaction mixture, which contains the intermediate compound lnt-37b, was used without further purification.

EXAMPLE 38 Preparation of compound 1453 The microwave vial containing the crude reaction mixture lnt-37b was loaded with lnt-7i (0.063 g, 0.145 mmol) and PdCI2 (dppf) (17 mg, 0.023 mmol). The vial was re-capped and connected to a vacuum line by the syringe needle and tubing. Using the procedure for example 35, step C, compound 1453 was provided as a brown solid (43 mg). LC / E Observed. M + H = 936.4.

EXAMPLE 39 Preparation of compound 1452 lnt-7i (0.070 g, 0.169 mmol) and PdCI2 (dppf) (0.024 g, 0.033 mmol) were added to a 2 ml microwave tube equipped with a stir bar. The vial was capped and connected to a vacuum line through a needle and tubing. The vial was cycled between vacuum and nitrogen five times. A solution of compound 1453 (0.135 g, 0.185 mmol) in dioxane (0.9 ml) was added via syringe into the reaction vial. Using the procedure for example 35, step C provided compound 1452 as a tan solid (49 mg). LC / MS. Observed. M + H = 936.4.

EXAMPLE 40 Preparation of compound 751 Step A Using the method described in example 35, step B, InMOa (0.34 g, 0.83 mmol) was converted to InMOa (0.24 g, 40% yield) as a brown solid. LC / MS Obs M + H = 720.4.

Step B Using the method described in example 35, step F, InMOa (78 mg, 0.11 mmol) was converted to lnt-40b 72 mg (99%) as a salt of dihydrochloride. LC / MS Obs M + H = 521.2.

Step C Using the method described in example 36, step A, lnt-40b (72 mg, 0.11 mmol) were treated with lnt-2b (49 mg, 0.23 mmol) to provide compound 751 (80 mg, 75% yield) as the dihydrochloride salt. LC / MS Obs M + H = 918.5.

EXAMPLE 41 Preparation of compound 1491 Step A In a 20 ml Biotage ® microwave tube, cyclopropylacetaldehyde (2.0 g, 24 mmol) was dissolved in toluene (10 ml) to provide a milky mixture. Int-22a (1.78 g, 4.43 mmol) was added and the resulting red-brown suspension was allowed to stir at room temperature for 10 minutes. P-Toluenesulfonyl chloride (85 mg, 0.443 mmol) and toluene (2 mL) were added and the tube was flushed with nitrogen. The sealed reaction was heated and stirred under microwave conditions (Biotage® initiator 8, reaction temperature = 170 ° C, total heating time = 12 hours), after the reaction mixture was allowed to cool to room temperature. The reaction mixture was concentrated under reduced pressure (bath temperature ~50-60 ° C) and then co-evaporated with EtOAc (2 x 100 mL) to give a dark brown semi-solid as crude product. The crude product was adsorbed on 6.0 g silica gel and purified using flash silica gel chromatography (ISCO® silica gel column, 200 g RediSep ® Gold, eluent of 0-30% gradient EtOAc / hexanes @ 150 ml / min) to provide lnt-41a as a light yellow-orange solid (710 mg, 34% yield).

Step B In a 125 ml round bottom flask, lnt-41a (0.707 g, 1.51 mmol), bis (pinacolato) -diboro (0.806 g, 3.18 mmol), (dppf) PdCl2 * CH2Cl2 (111 mg, 0.151 mmol) and KOAc (445 mg, 4.54 mmol) were mixed. Added one Magnetic stirring bar, the flask was sealed and alternately evacuated and refilled with nitrogen (5x). Dry dioxane (7.5 ml) was added and the flask was immersed in a preheated oil bath at 90 ° C. After 1.5 hours the reaction mixture was allowed to cool to room temperature, diluted with EtOAc (~100 mL) and washed with brine (~50 mL). The organic layer was dried over anhydrous MgSO 4, filtered and concentrated under reduced pressure (water bath temperature ~ 50-60 ° C) to give a dark brown semi-solid as crude product. The crude product was purified by flash silica gel chromatography (120 g Gold RediSep® silica gel column, ISCO®, eluent 0-70% EtOAc / hexanes @ 85 ml / min gradient) to provide lnt-41b as a beige solid (630 mg, 74% yield).

Step C In a 125 ml round bottom flask, lnt-41b (618 mg, 1.10 mmol), bromo-imidazole lnt-7d (731 mg, 2.31 mmol), (dppf) PdCl2'CH2Cl2 (81 mg, 0.110 mmol) were mixed . A magnetic stir bar was added and the flask was sealed with a rubber septum. The flask was evacuated alternately and refilled with nitrogen (5x). Dioxane (11 mL) was added and the reaction mixture was allowed to stir at room temperature for 5 minutes after the aqueous potassium carbonate solution (5.5 mL, aqueous, 1M 5.5 mmol) was added. The reaction mixture was allowed to stir at 90 ° C for 18 hours. The reaction mixture was allowed to cool to room temperature and was diluted with EtOAc (-100 mL). The resulting solution was poured into a separatory funnel containing EtOAc (~50 mL) and water (50 mL). The organic layer was washed with brine (~ 50 ml). The organic layer was dried over anhydrous MgSO 4, filtered and concentrated under reduced pressure to give an orange brown as a crude product. The crude product was purified by flash silica gel chromatography (Gold RediSep® 80 g silica gel column, ISCO®, 0-100% EtOAc-hexanes gradient @ 60 ml / min). The fractions containing the product were collected, concentrated and re-purified using reverse phase chromatography (Gilson ® Phenomenex Gemini column 150 x 21.20 mm x 5 μ ??; eluent of 10-70% MeCN / water (+ 0.1% from TFA) gradient around 20 minutes) to provide lnt-41c as a beige solid (467 mg, 54% yield).

Step D In a 50 ml round bottom flask, lnt-41c (41 1 mg, 0.527 mmol) was dissolved in methanol (5.0 ml) and hydrogen chloride solution (1.5 ml, 4M in dioxane (1.8 g, 6 mmol) was added. The reaction mixture was allowed to stir at room temperature for 24 hours.The reaction mixture was concentrated under reduced pressure to give lnt-41d as a beige (396 mg, quantitative yield).

Step E lnt-4f (85 mg, 0.392 mmol), weighed into a pre-tared vial and transferred to a 50 ml round bottom flask containing lnt-41 d (142 ml). mg, 0.196 mmol) with the aid of dry DMF (4 x 500 μ? _). Düsopropylamine (200 μ ?, 148 mg, 1.15 mmol) was added by syringe. The mixture was allowed to stir at room temperature for ~ 1 minute, during which time all solids dissolved. The flask was cooled in an ice water bath for ~ 10 minutes. Solid HATU (157 mg, 0.412 mmol) was added in one portion at 0 ° C but was gradually allowed to warm to room temperature as the cooling bath expired. After 24 hours of methanol (2 ml), water (0.2 ml) and potassium carbonate (135 mg, 0.980 mmol) were added sequentially. The reaction mixture was extracted with EtOAc (2 x 50 mL), the combined extracts were washed with brine (~50 mL) and dried over anhydrous MgSO4. After filtration, the organic layer was concentrated under reduced pressure to give a light brown solid as the crude product. Further purification by reverse phase chromatography (Gilson® column; Phenomenex® Gemini 150 x 21.20 mm x 5 pm; 10-70% MeCN / water gradient (+ 0.1% TFA) for 15 minutes) yielded compound 1491 as a beige (164 mg, 86% yield).

EXAMPLE 42 Preparation of compound 1490 Into a 50 ml round bottom flask, lnt-41d (196 mg, 0.270 mmol) and lnt-1a (95 mg, 0.540 mmol) were mixed. A magnetic stir bar was added and the solids were dissolved in dry DMF (2.7 ml). Diisopropylethylamine (283 μ? _, 209 mg, 1.62 mmol) was added, the reaction mixture was cooled to 0 ° C (ice water bath) and then stirred for 15 minutes. HATU solid (216 mg, 0.567 mmol) was added in one portion and the reaction mixture was allowed to stir at 0 ° C for 24 hours. Methanol (2 mL), water (0.2 mL) and potassium carbonate (187 mg, 1.35 mmol) were added and the reaction was allowed to stir at room temperature for 18 hours. Water (20 mL) was added and the reaction mixture was extracted with EtOAc (2 x 50 mL). The combined organic extracts were washed with brine (~50 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a light brown solid as a crude product. The crude product was purified directly by reverse phase chromatography (Gilson® column; Phenomenex® Gemini 150 x 21.20 mm x 5 pm; 10-70% MeCN / water gradient (+ 0.1% TFA) about 15 minutes to provide the compound 1490 as a beige solid (151 mg, 63% yield).

EXAMPLE 43 Preparation of compound 1499 1490 1499 In a 5 ml Biotage® microwave tube, compound 1490 (128 mg, 0.143 mmol), bis (pinacolato) diboro (73 mg, 0.286 mmol), Pd2 (dba) 3'CHCI3 (15 mg, 0.014 mmol) and X-Phos (14 mg, 0.029 mmol) were mixed. A magnetic stir bar was added and the tube was evacuated alternately and refilled with nitrogen (5 x). Dry dioxane (1.0 ml) was added and the reaction mixture was immersed in a preheated oil bath at 120 ° C. After 2 hours the reaction mixture was diluted with EtOAc (~50 mL) and washed with brine (~25 mL). The organic layer was dried over anhydrous MgSO-i, filtered and concentrated under reduced pressure to give an orange-red color as a crude product. The crude product was purified by reverse phase chromatography (Gilson ® Phenomenex® Gemini column 150 x 21.20 mm x 5 pm; gradient 10-70% MeCN / water (+ 0.1% TFA) for 15 minutes) to provide compound 1499 as a beige solid (75 mg, 61% yield).

EXAMPLE 44 Preparation of compound 1500 Using the method described in Example 43, compound 1491 was transformed to compound 1500 and the crude product was purified directly by reverse phase chromatography (Gilson ® Column; Phenomenex ® Gemini 150 x 21.20 mm x 5 pm; 10-70 gradient). % MeCN / water (+ 0.1% TFA) for 15 minutes) to provide compound 1500 as a beige solid (89 mg, 64% yield).

EXAMPLE 45 Preparation of lnt-45a and lnt-45b Chiral SFC separation (chiral AD, 30% MeOH / AcCN (2: 1) in C02) from lnt-23a that produces compounds lnt-45a and lnt-45b.

EXAMPLE 46 Preparation of compound 728 Step A To a 250 ml round bottom flask with a stirring bar under N2 was added dibromoindole lnt-45a (3 g, 6.6 mmol) followed by bis (pinacolato) diboro (3.7 g, 14.5 mmol), KOAc (1.9 g, 20 mmol). ) and PdCI2 (dppf CH2Cl2 (1.6 g, 2.0 mmol) .Dioxane (~ 45 mL) was added to the mixture which was degassed six times under vacuum filled with N2 after each evacuation.The reaction flask was fixed with a condenser. reflux and the mixture was heated to 90 ° C. After 5 hours the mixture was considered complete by LC-MS and the crude bisboronate was used as such.

To a cooled flask containing the above crude bisboronate was added bromo imidazole lnt-4f (4.6 g, 14.5 mmol), PdCl 2 dppf.CH 2 Cl 2 (1 6 g, 1.98 mmol) and 1 M K 2 CO 3 (~ 20 mL). The flask was washed with N2, capped and heated to 95 ° C. After 12 hours at 95 ° C and the mixture was cooled to room temperature and the mixture was diluted with EtOAc (100 ml) and water (20 ml). The layers were separated and the aqueous layer was extracted with EtOAc (3 x 75 mL). The organic layers were combined and washed with brine (1 x 50 mL), dried (Na2SO4), filtered and concentrated under reduced pressure. The crude material was purified using a 220 gm ISCO Gold RS column using a 100% gradient of CH2CI2 at 92/8% CH2Cl2 / eOH to provide 2.0 (39%) of lnt-46a as a brown solid.

LC-MS M + H = 769.2.

Step B To a solution of lnt-46a (0.11 g, 0.14 mmol) in CH 2 Cl 2 (1.5 ml) under N 2 was added excess TFA (1 ml) and the resulting mixture was stirred at room temperature for 2 hours. The reaction was concentrated in vacuo and then taken in ~ 2-3 mL 4.0 M HCI in dioxane and concentrated to dryness to produce lnt-46b (75 mg, 99% yield) as the HCl salt.

LC-MS M + = 568.2.

Step C To a solution of lnt-46b (75 mg, 0.13 mmol) in 1.5 ml of DMF (1.5 ml) at -15 ° C was added (S) -2- (methoxycarbonylamino) -2- (tetrahydro-2H-pyran) 4-yl) acetic lnt-4f (60 mg, 0.28 mmol) and HATU (0.105 g, 0.277 mmol). The mixture was allowed to stir for -15 minutes whereupon DIPEA (0.17 ml, 0.925 mmol) was added. The mixture was allowed to stir at -15 ° C for 90 minutes whereupon H2O (3 mL) and EtOAc (15 mL) were added. The organic layer was washed with H20 (3 X 3 mL), brine (3 x 3 mL), dried (Na2SO4), filtered and concentrated under reduced pressure. The crude material was purified by reverse phase HPLC (Gilson) using a C18 column with a gradient: 0% ACN at 90% ACN / 10% water (both with 0.1% TFA) to provide 120 mg (87% ) of the title compound 728 as a light yellow dihydrochloride salt after treatment with HCl. LC-MS (M + H) = 966.6.

EXAMPLE 47 Step A Using the procedure for the preparation of lnt-46a, Int-45b (2.5g, 5.5 mmol) was converted to 2.5 g (56%) of lnt-47a as a brown solid. LC-MS M + H 768.4.

Step B Using the procedure for the preparation of lnt-46b, Int-47a (0.10 g, 0.14 mmol) was converted to 98 mg (99%) of lnt-47b as the hydrochloride salt. LC-MS (M + H) = 568.3.

Step C Using the method described in example 46, step C, lnt-47b (98 mg, 0.14 mmol) was treated with (S) -2- (methoxycarbonylamino) -2- (tetrahydro-2H-pyran-4-yl) acetic acid lnt-4f (0.65 mg, 0.30 mmol) to provide 39 mg (26%) of compound 538 as the dihydrochloride salt after treatment with HCl. LC-MS M + H 966.4.

EXAMPLE 48 Preparation of compound 725 Step A Following the procedure for example 46, step C, the treatment of lnt-47b (75 mg, 0.13 mmol) with hydrochloride of the acid (R) -2- (diethylamino) -2-phenylacetylnt-2c (68 mg, 0.28 mmol) yielded 0.12 g (83%) of the title compound 725. LC-MS (M + H) = 946.8.

Chiral separation of CFS (chiral AD, 30% MeOH / AcCN (2: 1) in C02) from nnt-49 yielded the compounds lnt-49a and lnt-49b.

Optical rotation: lnt-49b [alpha] D 23 -362.4 ° EXAMPLE 50 Preparation of compound 758 Step A Using the procedure for the preparation of lnt-46a, Int-49a (1.0 g, 2.4 mmol) was converted to 0.73 g (49%) of lnt-50a as a brown s. LC-MS M + H 567.2.

Step B To a round bottom flask loaded with lnt-50a (0.25 g, 0.44 mmol) and a stir bar was added MeOH (1 mL) to give a yellow heterogeneous mixture. HCl 4N in dioxane (~1 mL) was added dropwise and the resulting solution was allowed to stir for 2.5 hours at room temperature. The mixture was concentrated under reduced pressure to provide an orange s. The s was triturated with Et20 (4 x 4 mL), concentrated under reduced pressure, and placed under high vacuum to provide lnt-50b (206 mg, 99%) of a light yellow s. LC-MS M + H = 467.2. This material was taken without further characterization or purification.

Step C To a solution of lnt-50b (0.24 g, 0.44 mmol) in DMF (2.5 ml) at -10 ° C (ice / acetone) was added (S) -2- (methoxycarbonylamino) -3-methylbutanoic acid lnt-2d ( 85 mg, 0.49 mmol), HATU (0.18 g, 0.49 mmol), then DIPEA (0.23 mL, 1.3 mmol) was added dropwise to give an orange homogeneous solution. The resulting solution was allowed to stir for 1 hour at -10 ° C, whereupon the reaction mixture was diluted with water (1.5 ml) and EtOAc (4 ml) and the layers were separated. The aqueous layer was extracted with EtOAc (3 x 4 mL) and the organic layers were combined. The organic layer was washed with brine (1 x 3 mL), dried (Na 2 SO 4), filtered and concentrated under reduced pressure. The resulting orange / brown semis was placed under high vacuum to provide a yellow semi-s. The crude material was taken in CH2CI2 (2 ml) and loaded onto a 40 g silica gold column. A gradient of 100% CH2Cl2 at 85% CH2Cl2 / 15% MeOH was run about 35 minutes. The important fraction was then collected and concentrated under reduced pressure to provide 0.27 g (95%) of lnt-50c as a white s. LC-MS (M + H) = 624.2.

Step D To a 20 ml pressure tube with a stir bar was added lnt-50c (0.30 g, 0.48 mmol) in dioxane (4 mL). Bis (pinacolato) diboro (0.13 g, 0.53 mmol), KOAc (0.14 g, 1.4 mmol) and Pd2 (dba) 3. CHCI3 (75 mg, 0.07 mmol) and X-Phos (69 mg, 0.14 mmol) were added to the tube to provide a heterogeneous mixture. The reaction mixture was degassed under vacuum and filled with N2 five times. The tube was capped, the reaction was heated to 120 ° C. After 4 hours LC-MS (M + H 716.2) dictates that the reaction was completed. For the cold pressure tube containing the crude boronate, bromo imidazole lnt-2a (0.18 g, 0.58 mmol), PdCI2dppf.CH2Cl2 (79 mg, 0.096 mmol) and K2C03 1M (1.4 ml) were added. The tube was washed with N2, capped and heated at 95 ° C for 12 hours. The reaction was then cooled to room temperature, diluted with EtOAc (100 mL) and water (20 mL). The layers were separated and the aqueous layer was extracted with EtOAc (3 x 75 mL). The organic layers were combined and washed with brine (1 x 50 mL), dried (Na2SO4), filtered and concentrated under reduced pressure. The crude material was purified by a 40 gm RS ISCO Gold column using a 100% CH 2 Cl 2 gradient. at 90/10% CH2Cl2 / MeOH to give 0.16 (37%) of lnt-50d as a brown s. LC-MS (M + H) = 825.4.

Step E Using the procedure for the preparation of lnt-3b, lnt-50d (71 mg, 0.086 mmol) was converted to 71 mg (99%) of the free diamine as the hydrochloride salt. LC-MS (M + H) = 726.2.

Using the procedure in Example 45, step C, the intermediate diamine lnt-50d '(71 mg, 0.086 mmol) was treated with (S) -2- (methoxycarbonylamino) -2- (tetrahydro-2H-pyran-4) acid. il) acetic lnt-4f (20 mg, 0.094 mmol) to provide 70 mg (82%) of compound 758 as the dihydrochloride salt after HCI treatment. LC-MS (M + H) = 966.4.

Preparation of compound 734 Using the methods described in the example 7 steps A-E, the lnt-49b was converted to compound 734. LC-MS (M + H) = 925.3.

EXAMPLE 51 Preparation of compound 760 Step A Using the method described in Example 50, lnt-50a (0.40 g, 0.71 mmol) was treated with lnt-7b (0.32 g, 0.85 mmol) after the initial boronate formation to provide 0.27 g (44%) of lnt- 51a as a whitish solid. LC-MS (M + H) = 825.2.

Step B Using the method described in example 5o, lnt-51a (86 mg, 0.10 mmol) was converted to 86 mg (99%) of lnt-51 b as the hydrochloride salt. LC-MS (M + H) = 725.4.

Step C Using the procedure in example 50, lnt-51 b (86 mg, 0.10 mmol) was treated with (S) -2- (methoxycarbonylamino) -2- (tetrahydro-2 H -pyran-4-yl) acetic acid-4-f. (25 mg, 0.12 mmol) to provide 65 mg (62%) of compound 760 as the dihydrochloride salt after HCI treatment. LC-MS (M + H) = 924.5.

Preparation of compound 731 In an analogous procedure, lnt-50a was converted to compound 731. LC-MS (M + H) = 924.5.

EXAMPLE 52 Preparation of compound 762 Using the method described in Example 50, lnt-51 b (86 mg, 0.10 mmol) was treated with (2S, 3R) -3-methoxy-2- (methoxycarbonylamino) butanoic acid-1e (22 mg, 0.12 mmol) to provide 70 mg (69%) of compound 762 as the dihydrochloride salt after HCI treatment. LC-MS (M + H) = 899.4.

EXAMPLE 53 Preparation of compound 732 In a procedure analogous to Example 50 using (R) -2- (diethylamino) -2-phenylacetic acid hydrochloride lnt-2c and lnt-9b was converted to compound 732. LC-MS (M + H) = 914.4.

EXAMPLE 54 Preparation of compound 1178 and compound 1179 1178 (Isomer A) 179 (Isomer B) Step A lnt-54a (prepared from lnt-19i, 800 mg, 1.87 mmol), bis (pinacolato) diboro (474 mg, 1.87 mmol), PdCI2 (dppf) 2 (273 mg, 0.37 mmol) and KOAc (549 mg, 5.6 mmol) were added to a 100 ml flask. After the flask was rinsed with N2, dry dioxane (18 ml) was added and the reaction was allowed to stir at 90 ° C for 2 hours. After cooling, int-10f (624 mg, 1.87 mmol), PdCI2 (dppf) 2 (136 mg, 0.19 mmol) and 1 M K2CO3 solution (1 M, 5.6 mL, 5.6 mmol) were added. The mixture was allowed to stir at 90 ° C for 4 hours and was allowed to cool to room temperature. The aqueous layer was separated and extracted with 10 ml of EtOAc. The organic layers were combined and dried over anhydrous Na 2 SO 4, filtered and concentrated in vacuo. The product was purified using silica gel chromatography (80 g, eluent: EtOAc in hexane: 0% to 80%) to provide lnt-54b (791 mg, 70.3%).

Step B lnt-54b (791 mg, 1.31 mmol), bis (pinacolato) diboro (333 mg, 1.31 mmol), Pd2 (dba) 3 (120 mg, 0.13 mmol), dicyclohexyl (2 ', 4', 6'-triisopropylbiphenyl- 2-yl) phosphine (125 mg, 0262) and KOAc (386 mg, 3.93 mmol) were added to a 100 ml flask. After the flask was washed with N2, dioxane (13 ml) was added. The mixture was allowed to stir at 110 ° C for 2 hours. After cooling, the compound lnt-10f (438 mg, 1.31 mmol), PdCI2 (dppf) 2 (96 mg, 0.13 mmol) and 1 M K2CO3 solution (1M, 3.9 ml, 3.9 mmol) were added. The The mixture was allowed to stir at 90 ° C for an additional 4 hours and allowed to cool to room temperature. The aqueous layer was separated and extracted three times with 10 ml of EtOAc. The combined organic extracts were dried over anhydrous Na2SC, filtered and concentrated in vacuo. The product was purified by chromatography on silica gel (40 g, eluent: EtOAC (10% MeOH) in CH 2 Cl 2: 0% to 80% to provide lnt-54c (364 mg, 33.8%).

Step C lnt-54c was loaded into a 50 ml flask, MeOH (0.5 ml) was added and the reaction was allowed to stir at room temperature for 1 minute. HCl (4M in dioxane, 6.6 ml, 26.4 mmol) was then added and the solution allowed to stir at room temperature. After 1 hour the solution was concentrated and the residue was dried under vacuum to provide lnt-54d (364 mg, 100%) which was used in the next step without further purification.

Step D lnt-54d (364 mg, 0.443 mmol), (S) -2- (methoxycarbonylamino) -3-methylbutanoic acid (155 mg, 0.886 mmol), HATU (337 mg, 0.886 mmol) and DMF (4.5 ml) were added to a 40 ml flask. The reaction mixture was cooled to 0 ° C and DI PEA (0.55 mL, 3.1 mmol) was added. After 1 hour, water (0.7 ml) and TFA (0.7 ml) were added at 0 ° C. The solution was then stirred at room temperature for an additional 30 minutes, before concentration to an oil. The solution was purified using C18 column (80 g, 10% to 70% CH3CN / water with 0.05% TFA) to provide Int-54e (312 mg, 60.5%).

Step E lnt-54e was resolved by chiral SFC (Chiracel AS-H, 20 x 250 mm, eluent: 40% MeOH (0.2% DEA) / CO 2, 50 ml / min) to provide isomer A (compound 1178, 1st peak , 110 mg, 35.2%) and B (compound 1172, 2nd peak, 108 mg, 34.6%).

The following compounds were prepared as described above.

EXAMPLE 55 Preparation of compound 1353 Step A Using the method described in example 50 step A, ln-5a (1.0 was converted to boronate and treated with lnt-7d (0.92 g, 2.9 provide 0.92 g (67%) of lnt-55a as a brown solid. LC- MS (M + H) = 566.7.

Step B Using the method described in Example 50, lnt-55a (0.70 g, 0.12 mmol) was converted to the boronate intermediate followed by treatment with lnt-7d (0.53 g, 1.5 mmol) to provide 0.25 g (25%) of lnt. -55b. LC-MS (M + H) = 811.6.

Step C Using the method described in Example 50, lnt-55b (0.25 g, 0.31 mmol) was converted to 0.23 g (99%) of lnt-55c as the hydrochloride salt. LC-E (M + H) = 611.8.

Step D preparation of compound 1353 Using the procedure of Example 50 step E, lnt-55c (23 mg, 0.31 mmol) was treated with (S) -2- (methoxycarbonylamino) -3-methylbutanoic acid lnt-1 a (0.11 g, 0.65 mmol) to provide 0.19 g (66%) of compound 1353 as the dihydrochloride salt. LC-MS (M + H) = 926.2.

EXAMPLE 56 Preparation of intermediate compound lnt-56b triphenyl phosphite (31 ml, 37 g, 120 mmol), dichloromethane (250 ml) and cooled for 15 minutes in an acetone bath on dry ice which was maintained at -50 to -60 ° C. Bromine (6.2 ml, 19 g, 120 mmol) was added dropwise over 15 minutes through an addition funnel. Triethylamine (19 ml, 13 g, 132 mmol) and 3,5-dimethoxybenzaldehyde (lnt-56a, 10.0 g, 60.2 mmol) were added sequentially. The reaction mixture was allowed to stir at -60 ° C for 1 hour. The cold bath was removed and the reaction mixture was allowed to stir an additional 18 hours as the temperature was allowed to reach room temperature. The reaction mixture was concentrated by rotary evaporation under reduced pressure (water bath temperature ~50-60 ° C) to provide a viscous, dark brown liquid as raw product. The crude product was taken up in EtOAc (~100 mL) and filtered. The filtrate was concentrated under reduced pressure (water bath temperature ~50-60 ° C) to provide a crude, dark brown Int-56b as a viscous liquid. Int-56b was loaded directly onto a 330 g Gold RediSep® silica gel column pre-equilibrated and purified using flash chromatography (ISCO®; eluent: gradient 0-5% EtOAc / hexanes, 5-70% EtOAc / hexane to give lnt-56b as a white solid (12.8 g, 68% yield).

In the same manner, the following 1,1-dibromo intermediates were prepared from the corresponding aldehydes.

EXAMPLE 57 Preparation of compound 1286 Step A lnt-19g (10.0 g, 31 mmol), NCS (4.14 g, 31 mmol), dichloromethane (300 mL) and THF (300 mL) were added to a 1 L flask and the resulting mixture was allowed to stir at 0 ° C for 1 hour and then at room temperature for 2 hours. The reaction mixture was then concentrated to a semi-solid and the residue was suspended in dichloromethane (150 ml) and filtered. The solid was washed with dichloromethane (2 x 15 mL) and dried to provide Int-57a as a solid (6.4 g, 58%).

Step B lnt-57a (1.0 g, 2.8 mmol), 3-methoxybenzaldehyde (0.572 g, 0.58 mmol), p-toluenesulfonic acid (0.0053 g, 0.28 mmol) and o-xylene (10 mL) were added to a pressure vessel of 35 g. my. The resulting mixture was allowed to stir at 170 ° C for about 15 hours under the protection of a shield, cooled to room temperature and purified on a silica 80 column. g / Rf Combi-Flash system (eluent: 0-5% ethyl acetate in hexanes eluent) to provide lnt-57b as a gel (0.2 g, 15%).

Step C lnt-57b (200 mg, 0.421 mmol), bis (pinacolato) diboro (18 mg, 0. 421 mmol), potassium acetate (207 mg, 2.1 mmol), PdCI2 (dppf) -CH2Cl2 (34.4 mg, 0.042 mmol) and dioxin (5 mL) were added to a 35 mL microwave reaction tube. The sealed tube was degassed and stirred at 95 ° C under nitrogen atmosphere for 4 hours then cooled to room temperature. To this mixture was added lnt-7d bromide (160 mg, 0.505 mmol), PdCI2 (dppf) -CH2Cl2 (34.4 mg, 0.042 mmol), 1.5 M aqueous solution of sodium carbonate (1.4 mL, 2.1 mmol). The resulting mixture was degassed and stirred at 95 ° C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated, purified using a 12 g silica column in Rf Combi-Flash system (0-60% of ethyl acetate, eluent hexanes) to provide lnt-57c as a wax (14 mg, 43%).

Step D lnt-57c (65 mg, 0.103 mmol), bis (pinacolato) diboro (57.5 mg, 0.226 mmol), potassium acetate (101 mg, 1.03 mmol), Pd2 (dba) 3-CHCl3 (21.3 mg, 0.02 mmol), X-PHOS (19.6 mg, 0.04 mmol) and dioxane (3 mL) were added to a 35 mL microwave reaction tube. The sealed mixture was degassed and stirred at 10 ° C under nitrogen atmosphere for 8 hours then it was cooled to room temperature. To this mixture was added bromide 27 (85 mg, 0.258 mmol), PdCI2 (dpp-CH2CI2 (16.8 mg, 0.02 mmol), 1.5 M aqueous sodium carbonate solution (0.7 ml, 1.05 mmol) .The resulting mixture was degassed and it was stirred at 95 ° C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated, purified using a 4 g silica column / Rf Combi-Flash system (0-100% ethyl acetate in eluent of hexanes) to provide lnt-57d as a solid (39 mg, 47%).

Step E lnt-57d (39 mg, 0.048 mmol), TFA (1 mL) and dichloromethane (1 mL) were added to a 25 mL flask and stirred at room temperature for 4 hours and concentrated in vacuo. The residue was dissolved in methanol (2 mL), treated with 0.1 mL of 4.0 M HCl solution (0.4 mmol) in dioxane and concentrated again in vacuo to provide lnt-57e as a white solid. This crude product was used for the next reaction without purification.

Step F Diamine lnt-57e, valine-acid MOC lnt-1a (14.3 mg, 0.081 mmol) and DMF (1 mL) were added to a 50 mL flask and cooled to 0 ° C. To this cooled solution was added HATU (30 mg, 0.08 mmol) and the reaction was allowed to stir at 0 ° C over a period of 1 hour, warmed with water (3 drops).

The reaction mixture was purified using reverse phase chromatography (0-90% acetonitrile in water with 0.1% TFA eluent) to provide compound 1286 as a wax (13 mg, 31%). LC / MS analysis calculated for: Csil ^ NgOe 923.4; found: 924.5 (M + H) +.

EXAMPLE 58 Preparation of compound 1198 and compound 1199 1198 1199 Compound 1198 (20 mg, 0.020 mmol), trimethylboroxin (7.67 mg, 0.061 mmol), Pd2 (dba) 3 (3.73 mg, 4.07 pmol) and dicyclohexyl (2,, 4 ', 6'-triisopropylbiphenyl-2-yl) phosphine (3.88 mg, 8.14 pmol) are added to a 50 ml flask. After the flask was rinsed with N2, 1,4-dioxane (204 μ) and K2CO3 (61.1 μ ?, 0.061 mmol) was added. The mixture was allowed to stir at 110 ° C for 16 hours. After cooling, the aqueous layer was separated and extracted with 5 ml of EtOAc. The organic layers were combined and dried over anhydrous Na2SO4. The solution was filtered and concentrated in vacuo. The solution was concentrated and purified using SiO2 chromatography (24 g, MeOH (eluent: 10% concentrated ß ?? /? 3 ·? 20) in CH2Cl2, 0% to 80%) provide compound 1199 (15 mg, 77%).

The following compound was made using the method described in the previous example: EXAMPLE 59 Preparation of compound 1014 Step A In a 250 ml round bottom flask, lnt-19b (2,006 g, 5.47 mmol) was dissolved in DMSO (22 ml). Pure dibromide lnt-56c (1710 g, 6.01 mmol) was added, followed by solid cesium carbonate (5.34 g, 16.4 mmol). The reaction mixture was immersed in an oil bath preheated to 90 ° C and stirred for 18 hours, then allowed to cool to room temperature, and poured into water (~100 ml), whereupon a colored solid was precipitated cinnamon. The aqueous mixture was extracted with EtOAc (2 x 100 mL). The combined organic phases were washed with brine (~50 mL), then dried over anhydrous MgSO4, filtered and concentrated in vacuo to give a tan-brown solid as the crude product. The crude product was purified by flash silica gel chromatography (220g Gold RediSep® silica gel column, Isco®, eluent: gradient 0-30% EtOAc / hexanes to provide lnt-59a as a pale yellow solid ( 683 mg, 26% yield).

Step B Into a 20 ml Biotage® microwave tube, a stir bar was charged with lnt-59a (670 mg, 1.37 mmol), bis (pinacolato) diboro (695 mg, 2.74 mmol), (dppf) PdCI2 »CH2Cl2 (68 mg, 0.083 mmol) and potassium acetate (403 mg, 4.11 mmol). The tube was evacuated alternately and refilled with nitrogen 5 times. Dioxane (14 ml) was added and the tube was immersed in a preheated oil bath at 90 ° C. After 1.5 hours, then the reaction was allowed to cool to room temperature, diluted with EtOAc (~20 mL) and filtered through a pad of Celite ®. The pad was rinsed with EtOAc (~50 mL) and the combined filtrate was washed with brine (~25 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a light brown solid as a crude product. The crude product was purified by flash silica gel chromatography (Isco®, 40 g Gold RediSep ® silica gel column, eluent gradient of 0-50% EtOAc / hexanes) to provide lnt-59b as a beige solid ( 705 mg, 88% yield).

Step C A 20 ml Biotage® microwave tube was loaded with a stir bar, lnt-59b (700 mg, 1.20 mmol), bromoimidazole lnt-7d (834 mg, 2.64 mmol) and (dppf) PdCI2 * CH2Cl2 (49 mg, 0.060 mmol). The tube was evacuated alternately and filled with nitrogen (5x). Dioxane (8 ml) was added and the reaction mixture was allowed to stir at room temperature for 5 minutes.

Aqueous potassium carbonate solution (6 mL, 1M aqueous, 6 mmol) was then added and the reaction immersed in a preheated oil bath at 90 ° C. After 18 hours, the reaction was allowed to cool to room temperature and was diluted with EtOAc (~50 mL), filtered through a polyethylene filter frit and the filtrate was washed with brine (~25 mL). The organic layer was dried over anhydrous MgSO 4, filtered and concentrated under reduced pressure to give an orange-brown solid as a crude product. The crude product was purified using flash silica gel chromatography (Isco®, 120 g Gold RediSep® silica gel column, eluent 0-10% gradient MeOH CHzC) to provide lnt-59c as a beige solid (719 mg, 75 % of performance).

Step D A 5 ml Biotage® microwave tube was loaded with a stir bar, lnt-59c (130 mg, 0.162 mmol), (dba) 3Pd2 »CHCl3 (25 mg, 0.024 mmol) and X-Phos (23 mg, 0.049). mmol). The tube was sealed and alternately evacuated and refilled with nitrogen (5 x). 5-Methylthienyl-2-boronate (36 mg, 0.16 mmol), dissolved in dioxane (1.6 ml) and potassium carbonate (0.8 ml, 1 M aqueous, 0.8 mmol) was added by syringe. The tube was immersed in an oil bath preheated to 120 ° C and stirred for 4 hours. The reaction mixture was then cooled, diluted with EtOAc (-50 mL), filtered and washed with brine (-25 mL). The organic layer was dried over anhydrous gSO4, filtered and concentrated under reduced pressure to provide the crude product. like a golden yellow solid. Additional purification by reverse phase chromatography (Gilson ® Column; Phenomenex ® Gemini 150 x 21.20 mm x 5 pm; 10-70% MeCN / water gradient (+ 0.1% TFA) around 20 minutes) to provide lnt-59d as a beige solid (26 mg, 19% yield).

Step E In a 50 ml lnt-59d round bottom flask (20 mg, 0.03 mmol) was dissolved in methanol (500 μl) and the HCl solution (60 μl, 4 M in dioxane, 0.240 mmol) was added. . The light yellow, clear stained solution was allowed to stir at room temperature for 24 hours. The reaction mixture was concentrated in vacuo to provide lnt-59e as a beige solid (15.6 mg, 83% yield).

Step F In a 50 ml round bottom flask, lnt-59e (16 mg, 0.019 mmol) and lnt-1 a (7 mg, 0.040 mmol) was dissolved in DMF (200 μl). Diisopropylethylamine (20 μ ?, 15 mg, 01 18 mmol) was added and the reaction mixture was cooled in an ice water bath for 15 minutes. Solid HATU (15 mg, 0.039 mmol) was added slowly and the reaction allowed to warm slowly to room temperature. After 3 hours the reaction was purified directly by reverse phase chromatography (Gilson ® Column, Phenomenex ® Gemini 150 x 21.20 mm x 5 μ? T> gradient 10-70% MeCN / water (+0.1% TFA) in minutes) to provide the compound 1014 as a beige solid (12 mg, 62% yield).

EXAMPLE 60 Preparation of compound 1005 Step A A 5 ml Biotage® microwave tube equipped with a magnetic stir bar was added, lnt-59c (254 mg, 0.317 mmol), phenylboronic acid (77 mg, 0.634 mmol), Pd2 (dba) 3'CHCI3 (66 mg , 0.063 mmol) and X-Phos (61 mg, 0.127 mmol). The tube was sealed and alternately evacuated and refilled with nitrogen (5 x). Dioxane (3 mL) and potassium carbonate (0.78 mL, 1M aqueous, 0.78 mmol) was added and the reaction was immersed in a preheated oil bath of 110 ° C. After 22 hours the reaction was allowed to cool, diluted with EtOAc (-30 mL) and washed sequentially with water (-20 mL) and brine (-20 mL). The organic layer was dried over anhydrous MgSO4, it was filtered and concentrated in vacuo to give the crude product as a light brown solid. The crude product was purified using flash silica gel chromatography (Isco®, Gold RediSep® silica gel column 40 g, eluent gradient 0-10% CH2Cl2 / MeOH) to provide lnt-60a (134 mg, 50% of yield) as a pale yellow-orange solid.

Step B In a 125 ml round bottom flask, lnt-60a (100 mg, 0.118 mmol) was dissolved in methanol (1.2 ml). Hydrogen chloride solution (0.300 ml, 4 M in dioxane, 1.2 mmol) was added and the reaction mixture was allowed to stir at room temperature. After 17 hours the reaction mixture was concentrated under reduced pressure to provide a brown-gold solid, which was dried in a vacuum oven (inner vacuum, ~ 60 ° C) for 20 hours to provide lnt-60b as a brown solid. golden (99 mg, quantitative yield).

Step C To a 50 ml flask equipped with a stir bar was added lnt-60b (39 mg, 0.047 mmol) and lnt-1a (17 mg, 0.094 mmol) and dry DMF (472 μ?). Diisopropylethylamine (41 ID, 31 mg, 0.236 mmol) was added and the reaction mixture was cooled to 0 ° C in an ice water bath. After - 15 minutes, solid HATU (40 mg, 0.104 mmol) was added and the reaction mixture was stirred at 0 ° C, after 2 hours of which the reaction was tempered by the addition of water (20 ml), with which a beige solid precipitated. The solid was collected by vacuum filtration and further washed with water (~50 ml). The solid was dissolved in EtOAc (~100 mL) and the resulting solution was washed with brine (~25 mL). The organic layer was collected, dried over MgSO4, filtered and concentrated under reduced pressure to give a beige beige product. Further purification by reverse phase C18 chromatography (Gilson® Column, Phenomenex® Gemini C18 5 pm 150 x 21.20 mm, eluent: 10-70% MeCN / water + 0.1% TFA in 20 minutes @ 20 ml / min.). to produce compound 1005 as a beige solid (28.4 mg, 63% yield).

EXAMPLE 61 Preparation of compound 1166, 1171 and 1173 Step A Compound lnt-61a (150 mg, 0.179 mmol, was prepared by a similar route as in example 59), biphenyl-4-ylboronic acid (35.4 mg, 0.179 mmol), Pd2 (dba) 3 (18.5 mg, 0.018 mmol) and dicyclohexyl (2,, 4,, 6'-triisopropylbiphenyl-2-yl) phosphine (17 mg, 0.036 mmol) were added to a 40 ml flask. The flask was placed in vacuum and filled with N2. This procedure was repeated once. Dioxane (1.8 ml) and K2CO3 (1M, 0.9 ml, 0.9 mmol) were added, and the sealed flask was allowed to stir at 110 ° C. After 3 hours the reaction was cooled, the aqueous layer was separated and extracted with 3 ml of EtOAc. The organic layers were combined and dried over anhydrous Na2SO4, filtered and concentrated to provide the crude product. Further purification by silica gel chromatography (eluent: EtOAC (10% MeOH) in CH2Cl2: (0% to 80%) gives the compound lnt-61a (137 mg, 80%).

Steps B and D were carried out using the methods described in Example 50.

The following compound was made using the method described in the previous example: Preparation of compound 1528 Step A To a 250 ml flask was added lnt-19g (5.0 g, 15.5 mmol), lnt-56h dibromide (5.8 g, 80% purity, 15.5 mmol), cesium carbonate (25.3 g, 77 mmol) and acetonitrile (50 mi) and the resulting suspension was allowed to stir at 60 ° C for about 15 hours. Then ethyl acetate (200 ml) was added, and the organic layer was washed with water (2 x 150 ml), dried over sodium sulfate and concentrated in vacuo. The residue was purified on a 120 g silica column / Rf Combi-Flash system (eluent: 0-10% ethyl acetate in hexanes) to give lnt-62a as a white solid (3.7 g, 52%).

Step B Intermediate lnt-62a (500 mg, 1.09 mmol), bis (pinacolato) diboro (304 mg, 1.2 mmol), potassium acetate (535 mg, 5.45 mmol), PdCI2 (dppf) -CH2CI2 (89 mg, 0.109 mmol) and dioxane (8 ml) were added to a 35 ml microwave reaction tube. The sealed mixture was degassed and stirred at 95 ° C under nitrogen atmosphere for 4 hours and then cooled to room temperature. To this mixture was added ln-12o bromide (429 mg, 1.31 mmol), PdCI2 (dppf) -CH2Cl2 (89 mg, 0.109 mmol), 1.5 M aqueous solution of sodium carbonate (3.6 mL, 5.4 mmol). The resulting mixture was degassed and stirred at 95 ° C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated to give the crude product. Additional purification was performed on a pre-silica gel column packaged 40 g / s Rf Combi-Flash system (eluent: 0-90% ethyl acetate in hexanes) to provide lnt-62b as a wax (530 mg, 78%).

Step C lnt-62b (130 mg, 0.207 mmol), bis (pinacolato) diboro (58 mg, 0.23 mmol), potassium acetate (102 mg, 1.04 mmol), Pd2 (dba) 3-CHCl3 (21.5 mg, 0.02 mmol), X-PHOS (19.8 mg, 0.04 mmol) and dioxane (2 mL) were added to a 35 mL microwave reaction tube. The sealed mixture was degassed and stirred at 110 ° C under nitrogen atmosphere for 8 hours then cooled to room temperature. To this mixture was added lnt-7b bromide (78 mg, 0.21 mmol), PdCI2 (dppf) -CH2Cl2 (14.2 mg, 0.02 mmol), 1.5 M aqueous solution of sodium carbonate (0.6 mL, 0.9 mmol). The resulting mixture was degassed and stirred at 95 ° C under nitrogen atmosphere for 6 hours, cooled to room temperature, concentrated to provide the crude product. Additional purification on a pre packed silica gel column of 4 g / Rf Combi-Flash system (eluent: 0-100% ethyl acetate in hexanes) provides lnt-62c as a solid (105 mg, 68%).

Step D lnt-62c (98 mg, 0.11 mmol), TFA (1 mL) and dichloromethane (1 mL) were added to a 25 mL flask. The resulting solution was allowed to stir at room temperature for 4 hours and concentrated in vacuo. The residue was dissolved in methanol (2 mL), treated with 0.1 mL of 4.0 M HCl solution (0.4 mmol) in dioxane and concentrated again in vacuo to provide lnt-62d as a solid (99 mg, 100%).

Step E lnt-62d (30 mg, 0.034 mmol), lnt-1a acid (6.5 mg, 0.04 mmol) and DMF (1 ml) was added to a 25 ml flask and the resulting solution was cooled to 0 ° C. To this cooled solution was added HATU (13 mg, 0.034 mmol) and the reaction was allowed to stir at 0 ° C, after 1 h, water (3 drops) was added and the reaction was purified directly using reverse phase chromatography (10-). 80% acetonitrile in water with 0.1% TFA eluent) to provide compound 1528 as a white solid (5 mg, 13%). LC / MS analysis calculated for: CsiHseFNgOe 941.4; found: 942.5 (M + H) +.

EXAMPLE 63 Preparation of compound 1496 Step A In a 250 ml round bottom flask equipped with a stir bar, dibromoindole lnt-19b (4.41 g, 12.02 mmol), lnt-56c (4.47 g, 14.4 mmol) was added and dissolved in dry DMSO (50 ml). . Solid cesium carbonate (20 g, 61 mmol) was added. The reaction mixture was allowed to stir at 100 ° C for 14 hours. Water (~ 150 mL) was added to the reaction mixture, whereupon a beige solid precipitated. The suspension was extracted with EtOAc (3 x 250 mL). Combined extracts were washed with brine (~ 250 ml). The organic layer was dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give the crude product as a light brown-orange solid. The crude product was adsorbed on silica gel (10.0 g) and then further purified using flash silica gel chromatography (Isco® column, 330 g RediSep® Gold silica gel, eluent: gradient 0-10% EtOAc / hexanes) to provide lnt-63a as a light brown solid (2.77 g, 46% yield).

Step B A 125 ml round bottom flask equipped with a stir bar was charged with lnt-63a (1.46 g, 2.90 mmol), bis (pinacolato) diboro (1.55 g, 6.09 mmol), (dppf) PdCI2"CH2Cl2 (106 mg , 0.145 mmol) and KOAc (854 mg, 8.71 mmol). The reaction was sealed and alternately evacuated and filled with nitrogen (5 x). Dry dioxane (19 ml) was added and the flask was immersed in a preheated oil bath at 90 ° C. After 1 hour the reaction mixture was allowed to cool to room temperature, diluted with EtOAc (100 mL), filtered through a polyethylene frit and washed with brine (~50 mL). The organic layer was dried over anhydrous MgSO4, filtered and concentrated to give the crude product as a dark brown semi-solid. The crude product was purified by flash silica gel chromatography (Gold RediSep® 220 g silica gel column, Isco®, eluent: gradient 0-30% EtOAc / hexanes) to provide lnt-63b (1.09 g, 63%). % of performance).

Step C A 125 ml round bottom flask equipped with a stir bar was charged with lnt-63b (707 mg, 1184 mmol), ln-7d bromoimidazole (786 mg, 2.49 mmol), (dpp PdC ChkCb (87 mg, 0118 mmol The flask was alternately evacuated and refilled with nitrogen (5x) .Dioxane (12 mL) was added and the reaction mixture was allowed to stir at room temperature for 5 minutes Aqueous potassium carbonate solution (6 mL, 1M aqueous 6 mmol) was then added. The reaction mixture was allowed to stir at 90 ° C for 2.5 h, cooled to room temperature and diluted with EtOAc (-50 mL). The resulting solution was poured into a separatory funnel containing EtOAc (~50 mL) and water (50 mL). The organic layer was washed with brine (~ 50 ml). The organic layer was dried over anhydrous MgSO 4, filtered and concentrated under reduced pressure to give the crude product as a brown-orange solid. The crude product was further purified by flash silica gel chromatography (Column Isco®, 120 g RediSep® Gold silica gel g 120, eluent: 0-100%. {10% MeOH / EtOAc}., Gradient of hexanes) to give lnt-63c a light brown solid (644 mg, 67% yield).

Step D In a 50 ml round bottom flask, lnt-63c (633 mg, 0.776 mmol) was dissolved in methanol (8.0 ml) and hydrogen chloride solution (2.0 ml, 4M in dioxane (2.4 g, 8 mmol) was added. The reaction mixture was allowed to stir at room temperature for 24 hours.The reaction mixture was concentrated under reduced pressure to provide lnt-63d as a beige solid (572 mg, 97% yield).

Step E lnt-4f (57 mg, 0.263 mmol) was dissolved in dry DMF (1.3 ml). The resulting solution was added to a 50 ml round bottom flask that contains lnt-63d solids (100 mg, 0.131 mmol). N.N-Diisopropylethylamine (140 μ ?, 104 mg, 0.802 mmol) was added and the mixture was stirred by sonication until no more solid adhered to the walls of the flask. The reaction mixture was allowed to stir at 0 ° C (ice water bath) for -15 minutes. Solid HATU (10 mg, 0.289 mmol) was added and the reaction mixture was allowed to stir at 0 ° C. After 1.5 hours the reaction was diluted with methanol (1 ml) and water (-0.1 ml) and solid potassium carbonate (36 mg, 0.263 mmol) was added sequentially. After 24 hours the reaction mixture was partitioned between EtOAc (~100 mL) and brine (~25 mL). The aqueous layer was extracted with a second portion of EtOAc (~25 mL). The combined extracts were washed with brine (~25 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give the crude product as a light brown solid. The crude product was purified directly by reverse phase chromatography (Gilson ® Phenomenex Gemini column 150 x 21.20 mm x 5 μm, eluent: 0-70% MeCN / water (+ 0.1% TFA) gradient for 15 minutes) to provide the Compound target product 1496 as a white solid (84 mg, 63% yield).

EXAMPLE 64 Preparation of compounds 1002, 1024 and 1025 Step A A 250 ml round bottom flask was charged with lnt-19b (3 g, 8.2 mmol) and DMSO (35 ml). 1, 1-dibromide lnt-56g (2.5g, 8.1 mmol) and cesium carbonate (8.0 g, 25 mmol) were added and the mixture was heated with stirring at 90 ° C for 18 hours. The reaction mixture was poured into water (~ 300 mL) and extracted with EtOAc (3 x 250 mL). Combined extracts were washed with brine (-250 ml). The organic layer was dried over anhydrous MgSO 4, filtered and concentrated under reduced pressure to provide the crude product as brown oil. The crude product was adsorbed on silica gel 8.5 g and further purified using flash silica gel chromatography (Column Isco®, 300g RediSep® Gold silica gel, eluent: gradient 0-50% EtOAc / hexanes) to provide lnt-64a (751 mg, 18% yield).

Step B In a Biotage® microwell tube of 20 ml, lnt-64a (276 mg, 0.535 mmol), bis (pinacolato) diboro (220 mg, 0.866 mmol), (dppf) PdCI2 »CH2Cl2 (34 mg, 0.042 mmol) and KOAc (122 mg, 1.24 mmol) were added. The tube was sealed and alternately evacuated and filled with nitrogen (5 x). Dry dioxane (3.5 ml) was added and the reaction mixture was allowed to stir until homogeneity was achieved (< 1 minute). The tube was immersed in an oil bath preheated to 90 ° C and stirred for 45 minutes.

The reaction mixture was cooled, diluted with EtOAc (~10 mL) and filtered through a pad of Celite® with wash (EtOAc). The combined filtrates were washed with brine (~25 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give the crude product as an orange-brown solid. Additional purification by flash silica gel chromatography (Isco® column, 40g RediSep® Gold silica gel, eluent: gradient 0-30% EtOAc / hexanes) to provide lnt-64b as an off-white solid (127 mg, 39% of performance).

Step C In a Biotage ® microwave tube of 20 ml, lnt-64b (122 mg, 0.200 mmol), bromoimidazole lnt-7d (133 mg, 0.420 mmol), and (dppf) PdCI2 »CH2Cl2 (16 mg, 0.020 mmol) were mixed . The tube was sealed and alternately evacuated and refilled with nitrogen (5 x). Dioxane (2 ml) and potassium carbonate (0.60 ml, aqueous 1 M; 0.60 mmol) were added and the reaction was immersed in a preheated oil bath at 90 ° C. After 17 hours the reaction mixture was allowed to cool, was diluted with EtOAc (-100 mL) and washed with brine (~ 50 mL). The organic layer was dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a light brown solid. The crude product was purified by flash silica gel chromatography (Isco® column, 24 g RediSep Gold silica gel, eluent: gradient 0-60% MeOH / CH 2 Cl 2) to provide lnt-64c as a beige solid (111 mg , 67% yield).

Step D In a 50 ml round bottom flask, lnt-64d (101 mg, 0.122 mmol) was dissolved in methanol (2.0 ml) and hydrochloric acid solution (300 μl, 4 M in dioxane, 1.2 mmol) was added. The pale yellow solution was allowed to stir at room temperature for 23 hours, then concentrated under reduced pressure to provide intermediate 900D (100 mg, - 100% yield) as a light yellow powder.

Step E A 50 ml flask was charged with lnt-64d (55 mg, 0.072 mmol) and lnt-1a (25 mg, 0.143 mmol) and dissolved in dry DMF (716 μ?). Diisopropylethylamine (61μ ?, 46mg, 0.358mmol) was added and the reaction mixture was cooled to 0 ° C in an ice water bath. After ~ 15 minutes, solid HATU (57 mg, 0.150 mmol) was added. After 3 hours at 0 ° C the reaction was quenched by the addition of water (20 ml), whereupon a beige solid precipitated. The solid was collected by vacuum filtration and washed again with water (50 ml). The solid was dissolved in EtOAc (~100 mL) and the resulting solution was washed with brine (~25 mL). The organic layer was collected, dried over MgSO.j, filtered and concentrated under reduced pressure to provide the crude product. Further purification by reverse phase C18 chromatography (Gilson ® Column, Phenomenex Gemini C18 5 pM 150 x 21.20 mm, eluent: 10-70% MeCN / water + 0.1% TFA) gave compound 1002 as a beige solid ( 26 mg, 39% yield).

Step F: Separation of the isomer by HPLC.

Compound 1002 (48.8 mg) was dissolved in absolute EtOH (1.0 mL) and the solution filtered through a 13 mm Whatman Puradisc syringe filter. The sample was injected onto a Phenomenex Lux cellulose-2 semi-preparative column (5 μm, 150 x 21.20 mm); detection wavelength? = 350 nm. Elution with 50% EtOH / hexane @ 10 ml / min provided the first peak (eluted between t = 0.5 minutes and t = 35 minutes) that was collected and concentrated to provide compound 1024 (15 mg) as a white solid. The polarity of the solvent eluent was increased to 60% EtOH / hexane at t = 120 minutes while maintaining a flow rate of 10 ml. The second component (between t = 125 minutes and t = 185 minutes) was collected and concentrated to provide compound 1025 (15 mg) as an off-white solid.

EXAMPLE 65 Preparation of compound 1019 Step A In a 250 ml round bottom flask, 2- (hydroxyphenyl) indole lnt-19g (3.03 g, 9.4 mmol) and gem-dibromide lnt-56g (8.7 g, 28 mmol) was mixed and dissolved in dry DMSO (94). my). Solid cesium carbonate (21 g, 66 mmol) and a magnetic stir bar were added. The reaction mixture was allowed to stir at 100 ° C for 21 hours. Water (~ 500 ml) was added to the reaction mixture, whereupon a beige solid precipitated. The suspension was extracted with EtOAc (3 x 250 mL) and the combined extracts were washed with brine (~ 250 mL). The organic layer was dried over anhydrous MgSO 4, filtered and concentrated under reduced pressure to give the crude product as a dark brown-orange solid. The crude product was adsorbed on silica gel (10 g) and then purified using flash silica gel chromatography (Column Isco®, 120g RediSep® Gold silica gel; Eluent gradient 0-50% EtOAc / hexanes) for provide lnt-65a as a light brown solid (1.80 g, 41% yield). |o Step B In a 125 ml round bottom flask, lnt-65a (2.644 g, 6.18 mmol), b1s (pinacolato) diboron (1.57 g, 6.18 mmol), (dppf) PdCI2'CH2Cl2 (138 mg, 0.168 mmol) and KOAc (1.65 g, 16.85 mmol) was mixed. The reaction was evacuated and filled with nitrogen (5x) followed by dry dioxane (38 ml). The flask was immersed in an oil bath preheated to 90 ° C and the reaction mixture was allowed to stir at 90 ° C for 2 hours. The reaction mixture was allowed to cool to room temperature, diluted with EtOAc (~ 300 mL) and washed with brine (~ 200 mL). The organic layer was dried over anhydrous MgSO4, filtered and concentrated in vacuo to give a dark yellow solid, which was purified by flash silica gel chromatography (Isco® Column, 120g RediSep® Gold silica gel; eluent: gradient 0-50% EtOAc / hexanes) to provide lnt-65b as a yellow solid (1.99 g, 68% yield).

Step C In a 125 ml round-bottom flask, the borntin-65b (1.14 g, 2.21 mmol), bnt-7d bromoimidazole (750 mg, 2.37 mmol), (dppf) PdCI2 »CH2Cl2 (90 mg, 0.110 mmol) were mixed . The flask was evacuated alternately and refilled with nitrogen (5x) and dry dioxane (15 ml) was added. The reaction mixture was allowed to stir at room temperature for 5 minutes and then aqueous potassium carbonate solution (11 mL, 1 M aqueous, 11 mmol) was added. The flask was immersed in an oil bath preheated to 90X and stirred at 90 ° C for 3 hours. The reaction mixture was allowed to cool to room temperature, diluted with EtOAc (~100 mL) and the resulting solution was filtered and washed with brine (~50 mL). The organic layer was dried over anhydrous MgSO 4, filtered and concentrated under reduced pressure to give a brown-orange solid. The crude product was purified by flash silica gel chromatography (Gold RediSep® 220 g silica gel column, Isco®, eluent: 0-100% EtOAc / hexanes) to give lnt-65c as a golden yellow solid ( 1.06 g, 76% yield).

Step D In a 150 ml round bottom flask, substrate lnt-65c (754 mg, 1202 mmol) was dissolved in methanol (12 mL) and the HCl solution (3 mL, 4 M in dioxane, 12 mmol) was added. The pale yellow, clear solution was allowed to stir at room temperature for 18 hours. The reaction mixture was concentrated by rotary evaporation under reduced pressure to provide intermediate lnt-65d as a pale yellow solid (728 mg, quantitative yield).

Step E In a 50 ml round bottom flask, lnt-65d (719 mg, 1.20 mmol) and lnt-1a (231 mg, 1.318 mmol) was dissolved in dry DMF (12 ml). Diisopropylethylamine (1.0 mL, 774 mg, 5.99 mmol) was added and the mixture The reaction was cooled to 0 ° C (ice water bath). After 15 minutes, solid HATU (684 mg, 1.80 mmol) was added in one portion. The reaction mixture was allowed to stir at 0 ° C for 1 hour. Water (~20 mL) was added and the precipitated solid was collected by vacuum filtration. The collected solid was washed with water (~ 5 ml) and dried in air. The crude product was further purified using flash silica gel chromatography (Column Isco®, 40g RediSep® Gold silica gel, eluent: 0-10% gradient of? ß ?? / ?? 2 ?? 2). All fractions containing the product were collected, concentrated and re-purified using flash silica gel chromatography (Column Isco®, 80 g RediSep® Gold silica gel, eluent: gradient 0-3.5% MeOH / CH2CI2) to provide lnt-65e (286 mg, 35% yield).

Step F In a 50 ml round bottom flask, lnt-65e (285 mg, 0.417 mmol), bis (pinacolato) diboro (127 mg, 0.500 mmol), Pd2 (dba) 3'CHCI3 (43 mg, 0.042 mmol), X -Phos (40 mg, 0.083 mmol) and KOAc (123 mg, 1.25 mmol) were mixed. The flask was evacuated alternately and refilled with nitrogen (5x). Dioxane (3 mL) was added and the reaction was allowed to stir at 120 ° C for 1.5 hours. The reaction mixture was allowed to cool slowly to room temperature for 12 hours. The reaction mixture was diluted with EtOAc (-100 mL) and washed with brine (~ 50 mL). The organic layer was dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a solid orange as raw product. The crude product was purified by flash silica gel chromatography (Gold RediSep® 40 g silica gel column, Isco®, eluent: gradient 0-9% MeOH / CH 2 Cl 2) to provide lnt-65f as a foamy solid yellow-orange color (253 mg, yield 78%).

Step G In a Biotage® microwave tube of 5 ml, lnt-65f (123 mg, 0.159 mmol), bromoimidazole lnt-1 Of (64 mg, 0.190 mmol), (dppf) PdCI2 »CH2Cl2 (13 mg, 0.016 mmol) were mixed . The tube was then evacuated and refilled with nitrogen (5x), dry dioxane (1.5 ml) was added and the reaction mixture was stirred at room temperature for 5 minutes. Aqueous solution of potassium carbonate (0.800 ml), aqueous 1M, 0.8 mmol) was then added. The tube was immersed in an oil bath preheated to 90 ° C and the reaction was allowed to stir for 16 hours. The reaction mixture is allowed to cool to room temperature, diluted with EtOAc (-50 mL) and filtered through a polyethylene filter frit. The filtrate was washed with brine (-25 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a light brown solid. The crude product was purified by flash silica gel chromatography (Gold RediSep® Silica Gel Column 24 g; lsco (R): eluent: gradient 0-9% MeOH / CH 2 Cl 2) to give lnt-65 g as a beige solid (92 mg, 64% yield).

Step H In a 50 ml round bottom flask, the lnt-65g (73 mg, 0.081 mmol) was dissolved in methanol (0.8 ml) and hydrogen chloride solution (200 pl, 4 M in dioxane) (240 mg, 0.800 mmol). ) was added. The reaction mixture was allowed to stir at room temperature for 18 hours. The reaction mixture was concentrated under reduced pressure to provide lnt-65h as a beige solid (77 mg, quantitative yield).

Step I Into a 50 ml round bottom flask, lnt-65h (73 mg, 0.080 mmol) and lnt-1a (17 mg, 0.096 mmol) were mixed and dry DMF (1 ml) was added. Diisopropylethylamine (70 μL, 53 mg, 0.412 mmol) was added and the reaction was cooled to 0 ° C (ice water bath). After 15 minutes. Solid HATU (46 mg, 0.120 mmol) was added in one portion. The reaction mixture was allowed to stir at 0 ° C for 1 hour. Water (~20 mL) was added and the precipitated solid was collected by vacuum filtration. The collected solid was washed with water (~ 5 ml), dried briefly, dissolved in DMF (~1 ml) and purified by reverse phase C18 chromatography (Gilson® Column, Phenomenex® Gemini C18 5 pm 150 x 21.20 mm , eluent: 10-70% MeCN / water + 0.1% TFA) to provide compound 1019 (21 mg, 28% yield) as a beige solid.

EXAMPLE 66 Preparation of compound 1033 Step A In a 200 ml pear-shaped flask was charged with lnt-19c (1.64 g, 4.26 mmol), lnt-56g (2.64 g, 8.52 mmol), DMSO (17 ml) and stirred until homogeneous. Solid cesium carbonate (10 g, 66 mmol) was added, the flask fitted with a condenser and then immersed in an oil bath preheated to 100 ° C. After 18 hours the reaction mixture was poured into the water (-400 ml) and extracted with EtOAc (2 x 150 ml, 1 x 300 ml). The aqueous layer was diluted with brine (~ 200 mL) and extracted with EtOAc (~ 150 mL). The combined organic phases were washed with brine (~100 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a red-orange semisolid. The crude product was adsorbed on silica gel (10.0 g) and purified using flash silica gel chromatography (Isco® Column, 220 g RediSep® Gold silica gel, eluent: gradient 0-40% EtOAc / hexanes) to provide lnt-66a (1.09 g, 48% yield) as a beige solid.

Step B In a 125 ml round bottom flask, lnt-66a (1.03 mg, 1. 93 mmol), bis (pinacolato) diboro (1.08 g, 4.25 mmol), (dppf) PdCl2 * CH2Cl2 (158 mg, 0.193 mmol) and KOAc (569 mg, 5.80 mmol) were mixed. The tube was sealed and alternately evacuated and filled with nitrogen (5x) and dry dioxane (13 ml) was added. The flask was immersed in an oil bath preheated to 90 ° C and the reaction mixture was allowed to stir for 1 hour. The reaction mixture was allowed to cool to room temperature, diluted with EtOAc (100 mL), filtered and washed with brine (~50 mL). The organic layer was dried over anhydrous MgSO4, filtered and concentrated to give a light brown solid. The crude product was purified by flash silica gel chromatography (120 g Gold RediSep® silica gel column, Isco®, eluent: gradient 0-40% EtOAc / hexanes) to provide lnt-66b as a dark beige ( 1.00 g, 83% yield).

Step C A 125 ml round bottom flask was charged with intermediate lnt-66b (992 mg, 1.58 mmol), bromoimidazole lnt-7d (1100 mg, 3.48 mmol) and (dppf) PdCI2 * CH2Cl2 (129 mg, 0.158 mmol). The flask was sealed and alternately evacuated and filled with nitrogen (5 x). Dioxane (11 mL) was added and the reaction mixture was allowed to stir at room temperature for 5 minutes. Aqueous potassium carbonate solution (5 ml, 1M aqueous, 5 mmol) was added and the flask was immersed in an oil bath preheated to 90 ° C. After 22 hours the reaction was allowed to cool to room temperature, diluted with EtOAc (~100 mL) and the resulting solution was washed with brine (~ 50 mL). The organic layer was dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a light brown solid. The crude product was purified by flash silica gel chromatography (80 g Gold RediSep® silica gel column, Isco®, eluent: 0-6% MeOH / CH 2 Cl 2 gradient) to provide lnt-66c as a solid color yellow-orange (867 mg, 65% yield).

Step D In a 100 ml round bottom flask, lnt-66c (690 mg, 0.816 mmol) was dissolved in methanol (8 ml) and hydrogen chloride solution (2 ml, 4 M in dioxane (2.4 g, 8 mmol) was added. The reaction mixture was allowed to stir at room temperature for 12 hours.The reaction mixture was concentrated under reduced pressure to provide lnt-66d as a beige solid (648 mg, quantitative yield).

Step E Into a 50 ml round bottom flask was charged lnt-66d (200 mg, 0.253 mmol) and lnt-1a (97 mg, 0.556 mmol) and dry DMF (2.5 ml). Diisopropylethylamine (265 μ ?, 196 mg, 1.5 mmol) was added and the reaction was cooled to 0 ° C (ice water bath). After 15 minutes. Solid HATU (240 mg, 0.632 mmol) was added in one portion. The reaction mixture was allowed to stir at 0 ° C for 10 hours. Water (20 ml) was added to quench the reaction. The cream suspension was extracted with EtOAc (2 x 50 mL) and the combined extracts were washed with brine (~25 mL). The organic layer was dried over anhydrous MgSO 4, filtered and concentrated under reduced pressure to give a light yellow-brown solid. The crude product was purified using reverse phase chromatography (Gilson ® Column; Phenomenex ® Gemini 150 x 21.20 mm x 5 μm; eluent: gradient 10-70% MeCN / water (+ 0.1% TFA)) to provide the compound 1033 as a beige solid (79 mg, 33% yield).

EXAMPLE 67 Preparation of compound 1038 Step A In a 250 ml round bottom flask was charged with lnt-65f (1.51 g, 1.95 mmol), bromoimidazole lnt-7d (739 mg, 2.34 mmol), (dppf) PdCl2'CH2CI2 (143 mg, 0.195 mmol). The flask was evacuated alternately and refilled with nitrogen (5x) and dry dioxane (19 ml) was added. After 5 minutes, aqueous potassium carbonate solution (10 ml, 1 M aqueous, 10 mmol) was added and the reaction was immersed in a preheated oil bath at 90 ° C. After 10 hours, the reaction was allowed to cool at room temperature and diluted with EtOAc (~100 mL) and water (50 mL). The organic layer was washed with brine (~50 mL), dried over anhydrous MgSO4, filtered and concentrated by rotary evaporation under reduced pressure to give a brown-orange solid. The crude product was purified by flash silica gel chromatography (Gold RediSep® 220 g silica gel column, Isco®, eluent: gradient 0-100% EtOAc / hexanes) to provide lnt-67a as a golden yellow solid. (1.23 g, 71% yield).

Step B In a 50 ml round bottom flask, lnt-67a (1222 g, 1.381 mmol) was dissolved in methanol (14 ml) and hydrogen chloride solution (3.5 ml, 4 M in dioxane (4.20 g, 14 mmol) was added. The reaction mixture was allowed to stir at room temperature for 9 hours, and then concentrated under reduced pressure to provide lnt-67b as a beige solid (1222 g, 99% yield).

Step C A 50 ml round bottom flask was charged with lnt-67b (155 mg, 0.73 mmol), lnt-4f (45 mg, 0.208 mmol) and the solids were dissolved in a solution of diisopropylethylamine (151 μl, 112 mg, 0.867 mmol) in dry DMF (1.7 ml). The reaction mixture was cooled to 0 ° C (ice water bath) and stirred for 15 minutes. Solid HATU (99 mg, 0.260 mmol) was added in a portion. The reaction mixture was allowed to stir at 0 ° C for 2 hours. Methanol (10 ml) and TFA (56 pl) were added sequentially at room temperature and the reaction mixture was allowed to stir at room temperature for an additional 2 hours. Aqueous solution of sodium bicarbonate (~10 mL) and water (20 mL) were added, and the aqueous phase was extracted with EtOAc (2 x 50 mL). The combined organic phase was washed with brine (~25 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a light brown solid. The crude product was purified directly by reverse phase chromatography (Gilson ® Column, Phenomenex Gemini 150 x 21.20 mm x 5 pM, Run 1: Eluent: 10-70% MeCN / water gradient (+ 0.1% TFA); Run 2 : 10-60% MeCN / water gradient (+ 0.1% TFA)) to provide compound 1038 as a beige solid (80 mg, 47% yield).

EXAMPLE 68 Preparation of compound 1048 A 50 ml round bottom flask was charged with lnt-64d (167 mg, 0.216 mmol), lnt-4f (103 mg, 0.475 mmol) and the solids were dissolved in DMF dry (2 ml). Diisopropylethylamine (226 μ? (167 mg, 1.30 mmol) was then added to the reaction at 0 ° C (ice water bath) and stirred for 15 minutes.HATU solid (204 mg, 0.537 mmol) was then added in one portion and the reaction was allowed to stir at 0 ° C for 1 hour, methanol (1 ml) and trifluoroacetic acid (200 μ) were added and the reaction was allowed to stir at room temperature for 30 minutes. The reaction mixture was extracted with EtOAc (2 x 50 mL), the combined organic phase was washed with brine (50 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a solid. light yellow-orange color The crude product was purified directly by reversed-phase chromatography (Gilson® Column; Phenomenex Gemini 150 x 21.20 mm x 5 μp; eluent: 10-60% MeCN / water (+ 0.1% TFA) )) to provide compound 1048 as a beige solid (135 mg, 61% yield) ento).

EXAMPLE 69 Preparation of compound 1488 Step A One 20 ml Biotage® microwave vial was loaded with lnt-64b (392 mg, 0.643 mmol), bromoimidazole InMOf (451 mg, 1.35 mmol) and (dppf) PdCl2, CH2Cl2 (47 mg, 0.064 mmol). The flask was alternately evacuated and refilled with nitrogen (5x) and dry dioxane (6.5 ml) was added and vigorously stirred. After 5 minutes the aqueous potassium carbonate solution (3 mL, 1M aqueous, 3 mmol) was added and the reaction was immersed in an oil bath preheated to 90 ° C. After 18 hours the reaction was allowed to cool to room temperature and was diluted with EtOAc (-100 ml) and water was added. The reaction was extracted three times with EtOAc (~ 50 mL), and the combined organic was washed with brine (~ 50 ml). The organic phase was dried over anhydrous MgSO 4, filtered and concentrated under reduced pressure to give a brown-orange solid. The crude product was purified by flash silica gel chromatography (Gold RediSep® 40 g silica gel column, Isco®, eluent: gradient 0-100% EtOAc / hexanes) to provide lnt-69a as a golden yellow solid. (409 mg, 74% yield). ' Step B In a 50 ml round bottom flask, lnt-69a (375 mg, 0.434 mmol) was dissolved in methanol (4.5 ml) and a solution of hydrogen chloride (1.0 ml, 4 M in dioxane (1.2 g, 4 mmol) The reaction mixture was allowed to stir at room temperature for 24 hours.The reaction mixture was concentrated under reduced pressure to provide lnt-69b as a beige solid (344 mg, 98% yield).

Step C lnt-4F (99 mg, 0.454 mmol) was weighed into a pre-set vial and transferred using the DMF solvent (4 x 500 μ?) to a 50 ml round bottom flask containing lnt-69b (167 mg, 0.206 mmol)). Diisopropylethylamine (220 μm, 163 mg, 1.26 mmol) was added per syringe. The mixture was allowed to stir at room temperature for ~ 1 minute, during which time all solids dissolved. The flask was cooled in a bath of ice water for ~ 15 minutes and solid HATU (196 mg, 0.516 mmol) was added in one portion. After 1.5 hours at 0 ° C, methanol (1 ml) and TFA (190 μ) were added sequentially and the reaction mixture was allowed to stir for a further 2 hours. Water (~20 mL) was added and the reaction mixture was extracted with EtOAc (2 x 50 mL). The combined organic phases were washed with brine (~50 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to provide a light orange solid. The crude product was purified directly by reverse phase chromatography (Gilson ® column, Phenomenex Gemini 150 x 21.20 mm x 5 μm, eluent: gradient 0-60% MeCN / water (+ 0.1% TFA) for 15 minutes. which were eluted are compounds 1488 and a TFA adduct thereof The total production of the final product was 146 mg, 67% yield.

EXAMPLE 70 Preparation of compound 1492 A 50 ml round bottom flask was charged with lnt-64d (183 mg, 0.237 mmol) and (R) -N, N-diethylphenylglycine hydrochloride (127 mg, 0.520 mmol) and the solids were dissolved in dry DMF (2.5 my). Diisopropylethylamine (400 μ ?, 296 mg, 2.29 mmol) was added, the reaction was cooled to 0 ° C (ice water bath) and stirred for 15 minutes. Solid HATU (225 mg, 0.591 mmol) was added in one portion. After 1 hour methanol (1 ml) and trifluoroacetic acid (365 μl) were added and the reaction was allowed to stir at room temperature for 30 minutes. The reaction was warmed with water (20 mL) and the product was extracted into EtOAc (2 x 50 mL). The combined organic phase was washed with brine (~50 mL), dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to provide a light yellow-orange solid. The crude product was purified directly by reversed phase chromatography (Gilson® Column; Phenomenex Gemini 150 x 21.20 mm x 5 μm; eluent: gradient 10-60% MeCN / water (+ 0.1% TFA) for 15 minutes) to provide fractions containing compound 1492 and a TFA adduct thereof. Re-treatment of the TFA-adduct fractions with methanol as above provided additional amounts of the desired compound. Total yield of compound 1492 was 201 mg, 74% yield.

EXAMPLE 71 Preparation of compound 1044 A 50 ml round bottom flask was charged with lnt-67b mg, 0.138 mmol) and (R) -N, N-diethylphenylglycine hydrochloride (40 mg, 0.165 mmol) and the solids were dissolved in a solution of diisopropylethylamine (240 μ ?, 178 mg, 1.375 mmol) in dry DMF (1.4 my). The reaction mixture was cooled to 0 ° C (ice water bath) and stirred for 15 minutes. Solid HATU (78 mg, 0.206 mmol) was added in one portion. After 1 hour the reaction mixture was concentrated under reduced pressure to give viscous, brown oil, which was purified using reverse phase chromatography (Gilson® Column; Phenomenex® Gemini 150 x 21.20 mm x 5 pm C-18; Run 1: 450 μl injection; 10-70% MeCN / water gradient (+ 0.1% TFA) for 15 minutes Run 2: 600 μ? injection; 10-60% MeCN / water gradient (+ 0.1% TFA) about 20 minutes) to provide compound 1044 as a beige solid (88 mg, 66% yield).

EXAMPLE 72 Preparation of compound 1039 A 50 ml round bottom flask was charged with Inter lnt-67b (104 mg, 0.1 16 mmol), lnt-1e (27 mg, 0.140 mmol) and a solution of diisopropylethylamine (102 μg, 75 mg, 0.581 mmol). in dry DMF (1 ml). The reaction mixture was cooled to 0 ° C (ice water bath) and stirred for 15 minutes. Solid HATU (66 mg, 0.174 mmol) was added in one portion and the reaction mixture was allowed to stir for 2 hours and allowed to warm to room temperature. Methanol (1 ml) and TFA (56 μl) were added sequentially at room temperature and the reaction was allowed to stir at room temperature for 2 hours. Water (20 ml) followed by aqueous sodium bicarbonate solution (-10 ml) were then added. The reaction was extracted with EtOAc (2 x 50 mL) and the combined extracts were washed with brine (~25 mL). The organic phase was dried over anhydrous MgSO4, filtered and concentrated under reduced pressure to give a light brown solid. The crude product was purified directly by reversed-phase chromatography (Gilson® Column; Phenomenex® Gemini 150 x 21.20 mm x 5 μ? T; Run 1: gradient 10-70% MeCN / water (+ 0.1% TFA) during 20 minutes.

Run 2: gradient 10-60% MeCN / water (+ 0.1% TFA) around 20 minutes) to provide compound 1039 as a beige solid (65 mg, 82% yield).

EXAMPLE 73 Preparation of compound 959. 950 and 951 Step A lnt-22a (1 g, 2.8 mmol), 2-methyl thiophenecarboxaldehyde (1.06 g, 8.4 mmol) and p-tosyl chloride were dissolved in toluene (10 mL) and stirred in a pressure tube at 150 ° C for 6 hours. . After cooling, the crude material was purified using an ISCO silica gel column (pre-packed, 80 g) eluted with EtOAc: Hex (0% to 5%) to produce lnt-73a (500 mg, 38%).

Step B lnt-73a (0.5 g, 1.08 mmol), bis (pinacolato) diboro (0.3 g, 1.2 mmol), KOAc (316 mg, 3.2 mmol) and PdCI2 (dppf) 2 (88 mg, 0.1 mmol) were added in a tube of microwave. After the flask was rinsed with 2, and dioxane (3 mL) was added. The mixture was allowed to stir at 110 ° C for 1 hour. The crude reaction containing lnt-73b was used without further purification.

Step C Lnt-1 Of (430 mg, 1.3 mmol), PdCI2 (dppf) 2 (88 mg, 0.11 mmol) and K2C03 (1 N ac, 3.23 ml) were added to the reaction flask loaded with lnt-73b. The tube was sealed, degassed and stirred at 90 ° C for about 15 hours. After cooling, EtOAc (100 ml) was added, the layers were separated and the organic phase was washed with brine (100 ml). The organic phase was dried and concentrated to give a semi-solid. The raw product is purified on an ISCO column (pre-packed with silica gel, 40 g) and eluted with gradient Hex: 0% EtOAc at 70% to provide the product lnt-73c 650 mg (94%).

Step D lnt-73c (640 mg, 1.0 mmol), bis (pinacolato) diboro (508 mg, 2 mmol), Pd2dba3 (155 mg, 0.15 mmol), X-Phos (143 mg, 0.3 mmol) and KOAc (491 mg, 5 mg). mmol) were added to a 20 ml microwave tube. The tube was sealed, degassed and the reaction was allowed to stir at 117 ° C for 8 hours. To this reaction mixture was added lnt-10f (259 mg, 0.78 mmol), PdCl 2 (dppf) 2 (106 mg, 0.13 mmol) and K 2 CO 3 (1 N ac, 1.9 ml). The tube was sealed and degassed and heated at 100 ° C for an additional 24 hours. After cooling, EtOAc (100ml) was added, the layers were separated, and the organic phase was washed with brine (100ml). The organic phase was dried and concentrated to provide a solid. The crude material was purified on an ISCO column (pre-packed with silica gel, 24 g) and eluted with DCM: DCM / eOH / NH3.MeOH (90: 10: 1) from 0% to 80% to provide the product lnt-73d 130 mg (24%).

Step E lnt-73d (145 mg, 0.18 mmol) was dissolved in dioxane (2 mL) and HCl (4N in dioxane, 0.9 mL) was added at room temperature. After 1.5 hours, the reaction was concentrated in vacuo under vacuum. The lnt-73e product was isolated without further purification (123 mg, 100%).

Step F lnt-73e (123 mg, 0.18 mmol) was dissolved in DMF (5 mL) and cooled to 0 ° C. HATU (154 mg, 0.41 mmol), lnt-1a (71.1 mg, 0.41 mmol) were added followed by the addition of Hunig's base (0.19 mL, 1.06 mmol). After 1.5 hours at 0 ° C, water was added to quench the reaction. The mixture was diluted with EtOAc and extracted with NaCl aq. The organic phase was dried and concentrated to yield a solid. Further purification with silica gel chromatography (pre-packed column, 23 g) eluted with DCM and EtOAC / MeOH / NH3.H20 (90: 10: 1) 0-80% to provide compound 959 103 mg (62%) .

Compounds 950 v 951 The diastereomers of compound 959 (103 mg) were separated by chiral SFC separation on an AS-H column (50% MeOH (0.2% DEA) / CO 2, 50 ml / min, 100 bar), to provide the isomer of the compound A 950 (27 mg, 35%) and the isomer of compound B 951 (28 mg).

EXAMPLE 74 Preparation of compound 1464 Step A 2-Chloro-5-dichloromethylthiophene was prepared from 2-chlorothiophene-aldehyde (5 g, 13.62 mmol) and Cs2CO3 (19.97 g, 61.3 mmol) was charged into a flask and dissolved in DMSO (50 mL). Int-19b (5.49 g, 27.2 mmol) was added and the reaction was heated to 100 ° C. After 1 hour, the reaction was filtered and the filtrate was extracted with NaCl aq. The organic phase was dried and concentrated in vacuo to a semi-solid. The crude material was purified using flash column chromatography on silica gel (220 g column) eluted with EtOAc in hex 0% to 5% to provide lnt-74a (1.35 g, 20%).

Step B lnt-74a (1.53 g, 3.09 mmol), dipynacolatoborane (1.8 g, 7.1 mmol), KOAc (1.52 g, 15.44 mmol) and PdCI2 (dppf) 2 (0.504 g, 0.62 mmol) were loaded in a microwave tube. After the flask was rinsed with N2, dioxane (20 ml) was added. The mixture was allowed to stir at 95 ° C for 4 hours. The crude reaction was diluted with EtOAc (100 mL) and extracted with NaCl aq. The organic phase was dried and concentrated in vacuo. The crude material was purified by flash column chromatography on silica gel with EtOAc in hex (0% to 20%) eluent to provide lnt-74b (990 mg, (54%).

Step C lnt-74b (990 mg, 1.68 mmol), lnt-10f (1.35 g, 4.03 mmol), PdCI2 (dppf) 2 (0.274 g, 0.342 mmol) and K2C03 (1N ac, 8.4 ml) were added to a microwave tube of 20 mi. The tube was sealed, degassed with nitrogen and stirred at 100 ° C for about 15 hours. After cooling, EtOAc (100ml) was added and the reaction was extracted with brine (100ml). The organic phase was separated, dried and concentrated in vacuo. The crude material was purified on a column of ISCO silica gel (40 g) and with the eluent EtOAc / Hex (0% to 70%) to give the product lnt-74c 500 mg (33%).

Int-74c (504 mg) was subjected to chiral CFS separation on the OD-H column (IPA (0.05% DEA) / CO2) to provide lnt-74c 'and lnt-74c "isomers (176 mg, 35%).

Step D lnt-74c "(176 mg) was dissolved in dioxane (10 mL) and HCl (4N in dioxane, 0.53 mL) was added and stirred at room temperature After 1.5 hours, the solvent was removed in vacuo. it was isolated without further purification (167 mg, 100%).

Step E lnt-74d (Diastereoisomer B, 167 mg, 0.21 mmol) was dissolved in DMF (3 mL) and cooled to 0 ° C. HATU (169 mg, 0.44 mmol), lnt-10f (74.1 mg, 0.423 mmol) were added followed by the addition of Hunig's base (0.22 mL, 1.27 mmol) and the reaction was allowed to stir at 0 ° C. After 1.5 hours, water was added and the reaction was diluted with EtOAc and extracted with NaCl aq. The organic phase was dried and concentrated in vacuo to provide a solid. Purification by chromatography on silica gel (23 g) with DCM and eluent EtOAC / MeOH / NH 3 (90: 10: 1-0% to 100%) provided the title compound 970 (140 mg, 69.1%).

Compound 1464 (Diastereoisomer B).

Compound 970 (60 mg, 0.063 mmol), cyclopropylboronic acid (81 mg, 0.94 mmol), Pd2dba3 (6.5 mg, 6.26 prnol), X-Phos (5.97 mg, 0.013 mmol) and K2C03 (1 N ac, 188 μ?) they were added to a 20 ml microwave tube. The tube was sealed and degassed with nitrogen. The reaction was allowed to stir at 110 ° C for 5 hours. The crude material was purified on silica gel with DCM to eluent EtOAc / MeOH / NH3.H20 (100: 10: 1-0% to 90%) to give compound 1464 (40 mg, (62%).

EXAMPLE 75 Preparation of compound 1459 Step A To a solution of 4-methyl-2-thiazole-2-carboxaldehyde (2.0 g, 5.73 mmol) in CH2Cl2 (40 mL) at -20 ° C, pyridine (0.254 mL, 3. 15mmol), followed by the addition of PCI5 (6.55 g, 31.5mmol). The mixture was allowed to stir at -20 ° C for 30 minutes. NaHCO 3 (13.2 g, 10eq.) Was added as a solid to the reaction mixture. After stirring for an additional 30 minutes the reaction was filtered through celite and washed with 2 x 25 ml of CH2Cl2. The filtrate was concentrated under reduced pressure to provide the crude. It was redissolved in CH2CI2 and filtered through a pad of silica gel. The filtrate in concentration and drying provides lnt-75a as brown oil .. (32%) Step B Dibromo indole (lnt-19b, 0.5 g, 1362mmol), 2- (dichloromethyl) -4-methylthiazole (lnt-75a, 0.496 g, 2.72 mmol) and cesium carbonate (0.976 g, 3.00mmol) were combined in acetonitrile (10 ml) of a 50 ml round bottom flask equipped with a condenser and heated at 55 ° C for 15 hours. The analysis of the TLC showed the consumption of starting material. The reaction was diluted with EtOAc, washed with water (3 x 20 mL), brine (1 x 20 mL), dried (Na2SO4), filtered and concentrated under reduced pressure to give a crude brown semisolid. The mixture was allowed to stir with ether and filtered to give lnt-75b as a yellow solid. The filtrate was concentrated and purified using an ISCO silica gel column. The combined yield of 4 was 0.32 g (49%).

Step C Intermediate lnt-75b (0.095 g, 0.2mmol), bis (pinacolato) diboro (0.106 g, 0.419 mmol), potassium acetate (0117 g, 1197 mmol) and PdCI2 (dppf) CH2CI2 (0.065 g, 0.08 mmol) and dioxane (2.0 ml) were combined in a microwave tube and sealed and purged with nitrogen (3x). The reaction was heated at 90 ° C for 2 hours. TLC showed complete reaction. The reaction mixture containing lnt-75c was used without further treatment.

Step D To the above reaction mixture (intermediate lnt-75c (0.114 g, 0.2mmol) in the microwave tube, N-Bocprolina imidazole bromide (lnt-7d, 0.139 g, 0.44mmol), PdCI2 (dppf) .CH2Cl2 was added. (0.033 g, 0.04 mmol) and potassium carbonate (1199 ml of 1M aqueous solution, 1199 mmol) was sealed and purged with nitrogen (3x) .The reaction was heated at 90 ° C for 4 hours. dilute with EtOAc (25ml) and water (20ml) The resulting mixture was stirred vigorously for 10 minutes and then filtered through Celite The filtrate was partitioned The organics were washed with water (3x15ml) and brine (1x15ml), dried (Na2SO4), filtered and concentrated in vacuo The resulting crude was purified using preparative silica gel column chromatography, using 5% MeOH / CH2Cl2 to provide the desired product lnt-75d (79%).

Step E Trifluoroacetic acid (0.25 ml, 3.24 mmol) was added to the intermediate lnt-75d at ° C. The mixture was allowed to warm to room temperature and was stirred for an additional 1 hour. The solvent was removed under reduced pressure. The product was treated with 0.36 ml of 4MHCl in dioxane (1.44 mmol). After 10 minutes of stirring, the excess acid and solvent was removed and the lnt-75e product was dried for about 15 hours.

Preparation of compound 1459 To a solution of intermediate lnt-75e (0.035 g, 0.045mmol) in DMF (1.4 mL) was added (S) -2- (methoxycarbonylamino) -2- (tetrahydro-2H-pyran-4-l) acetic acid (0.022 g, 0.1 mmol), HATU (0.038 g, 0.1 mmol). The reaction was cooled to -15 ° C and Hunig's base (0.051 ml, 0.363 mmol) was added dropwise. The resulting mixture was allowed to stir for 1.5 hours at -15 ° C. The reaction was warmed with water (20ml). The product was extracted with EtOAC (3x20ml). The organics were washed with water (3x20ml), brine (1x20ml), dried (Na2SO4), filtered and concentrated under reduced pressure to provide the crude which was purified using Gilson reverse phase chromatography using the elution gradient of 0% at 90% CH3CN with 0.1% TFA and water with 0.1% TFA. The desired fractions were collected and concentrated under reduced pressure and then treated with 0.3 ml of 2MHCl in ether. The solvent was removed and the sample was dried for about 15 hours to give compound 1 59 as an orange-brown solid. (32%).

EXAMPLE 76 Preparation of intermediate compound lnt-76d Step A - Preparation of lnt-76a To a cooled mixture of thionyl chloride (20 mL, 274 mmol) and DMF (0.7 mL) at 0 ° C, benzothiophene 2-carboxaldehyde (4.7 g, 29.0 mmol) was added in 3 portions and stirred at 0 ° C for 30 minutes. minutes and then allowed to warm up for about 15 hours. The mixture was poured into the ice and aqueous 1N sodium hydrogen carbonate and then extracted with EtOAc. The combined organic solution was washed with brine and dried (Na2SO4) and concentrated in vacuo to provide lnt-76a (6.1 g, 28.1 mmol, 97% yield).

Step B - Preparation of compound lnt-76b lnt-19g (4.5 g, 13.95 mmol), lnt-76a (6.06 g, 27.9 mmol) and cesium carbonate (18.18 g, 55.8 mmol) in DMSO (22 mL) was allowed to stir at 80 ° C for 2 hours. The mixture was then added to the cold water and the resulting solid was filtered and washed with water to provide 1.55 g of a solid. The filtrate was concentrated and the residue was allowed to stir with 1: 1 MeOH-MC to give crude solid material which was further purified using silica gel chromatography (prepacked Biotage column, loading 80g solids, eluent: 1000% hex at 15% EtOAc / Hex) to provide the desired product lnt-76b (650 mg, 33.8% yield).

Step C - Preparation of lnt-76c A mixture of lnt-76b (0.418 g, 0.90 mmol), bis (pinacolato) diboro (0.25 g, 0.99 mmol), KOAc (0.176 g, 1.80 mmol) and Pd (dppf) Cl2 (0.066 g, 0.09 mmol) in 1 , 4-dioxane (3 ml) was degassed (by discharge of N2) and heated to 100 ° C. After 4 h, the reaction was cooled to room temperature and lnt-10f (329 mg0.99 mmol), Pd (dppf) CI2 (66 mg, 0.09 mmol) and 1N K2CO3 (1.8 mL, 1.8 mmol) were added. The mixture was degassed and heated at 100 ° C for 2 hours. The mixture was cooled to room temperature, diluted in EtOAc and filtered through the pad of celite. The filtrate was concentrated in vacuo and the residue was purified on an ISCO gold 80 g gold column (eluent: CH2Cl2-5% MeOH / CH2Cl2) to give lnt-76c (503 mg, 0.785 mmol, 88% yield) as a yellow solid pale.

LC / MS (M + H) = 641.2.

Step D - Preparation of lnt-76d A mixture of lnt-76c (0.292 g, 0.455 mmol), bis (pinacolato) diboro (0.127 g, 0.50 mmol), KOAc (0.089 g, 0.91 mmol), X-Phos (0.043 g, 0.091 mmol) and Pd2dba3 (0.047) g, 0.046 mmol) in 1,4-dioxane (3.5 ml) was degassed (by N2 discharge) and heated to 100 ° C. After 18 hours, the reaction was cooled to room temperature, the crude mixture was treated with lnt-7d (160 mg, 0.51 mmol), Pd (dppf) CI2 (34 mg, 0.046 mmol) and K2C03 1 N (0.92 ml, 0.92 mmol). The mixture was degassed and stirred at 100 ° C for 6 hours, cooled to room temperature, diluted in EtOAc and filtered through the celite pad. The filtrate was concentrated in vacuo and the residue was purified on an ISCO Gold 40 g gold column (eluent: Hex-EtOAc gradient 100: 1 at 85:15) to provide lnt-76d (225 mg, 58% yield) as a solid pale yellow color. LC / MS (M + H) = 842.3.

EXAMPLE 77 Preparation of compound 792, 422 and 423 Step A Trifluoroacetic acid (1 mL, 12.98 mmol) was added to a stirred solution, cooled to 0 ° C of lnt-76d (0.171 g, 0.203 mmol) in CH 2 Cl 2 (3 mL). After 5 minutes, the reaction was allowed to warm to room temperature and mix an additional 90 minutes. The mixture was concentrated in vacuo and the residue was dissolved in MeOH followed by treatment with 2N HCl in ether. The methanol solution was then concentrated to dryness affording lnt-77a (0.145 g, 0.203 mmol, 100% yield) which was used without further purification.

LC / MS (M + H) = 642.3.

Step B A round flask was charged with lnt-77a (145 mg, 0.203 mmol), DMF (1.5 ml) and lnt-4a (88 mg, 0.406 mmol) and cooled to -15 ° C. To the reaction mixture was added?,? -dusopropylethylamine (0.248 ml, 1.42 mmol) and HATU (154 mg, 0.406 mmol). After 10 minutes the reaction was allowed to warm to 0 ° C. After 3 hours, the reaction was warmed by 0.5 ml of water and the mixture was filtered and purified on Gilson HPLC (eluent: acetonitrile / water + 0.1% TFA) to give compound 792 (106 mg, 41% yield) as a diastereomeric mixture (~ 1: 1).

The diastereomers of compound 792 were separated by SFC to provide the pure diastereomers of compound 422 and compound 423.

LC / MS (M + H) = 104 .4. SFC separation condition: Instrument: Thar 80 SFC; Column: Chiral Cel OJ, 20 m, Daicel Chemical Industries, Ltd 250x30mml.D. Mobile phase: A: Supercritical C02, B: ETOH (containing 0.2% DEA), A: B = 45: 55 to 80ml / min; Column temperature: 38 ° EXAMPLE 78 Preparation of intermediate compound lnt-78a lnt-78a (248 mg, 0.288 mmol, 62% yield) was prepared from lnt-76c (343 mg, 0.47 mmol) using the method described in the example LC / MS (M + H) = 860.3.

EXAMPLE 79 Preparation of compounds 791, 703 and 704 Step A Compound lnt-79a (211 mg, 0.29 mmol, 100% crude yield) was prepared from lnt-78a (248 mg, 0.29 mmol) following the method described in example 77 step A LC / MS (M + H) = 660.3 Step B Compound 791 (112 mg, 0.087 mmol, 44% yield) was prepared from lnt-79a (147 mg, 0.20 mmol) using the method described in example 77, step B the SFC separation provided the diastereomers of compound 703 and compound 704 LC / MS (M + H) = 1058.2 SFC separation condition: (Thar 80 SFC, Chiral Pak AS, 20 m, Daicel Chemical Industries, Ltd 250x30mml.D.

Mobile phase: A: Supercritical C02, B: ETOH (containing 0.2% DEA), A: B = 60: 40 to 80ml / min EXAMPLE 80 Compound 789 (106 mg, 0.084 mmol, 41% yield) was prepared from lnt-77a (145 mg, 0.203 mmol) using lnt-1a using the method described in example 77, step B LC / MS (M + H) = 1041.4.

EXAMPLE 81 Step A n-BuLi (5.79 ml, 14.47 mmol) was added to a stirred solution, cooled to -78 ° C of 7-bromo-4-methyl-3,4-dihydro-2H-1,4-benzoxazine (nnt-81a, 3 g, 13.15 mmol) in THF (24 mL). After stirring 1 h at -78 ° C for 1 hour, DMF (2.037 ml, 26.3 mmol) was added dropwise and the mixture was allowed to warm slowly for 2 hours at room temperature. The reaction was warmed with aqueous ammonium chloride and the product was extracted into ethyl acetate. The organic phase was washed with brine, dried (Na2SO4), filtered under reduced pressure to give lnt-81b (2.32 g, 13.09 mmol, 100% yield) as a green solid.

Step B A 0.2-0.5 ml microwave tube was charged with lnt-22a (1g, 2491 mmol), lnt-81b (1.12 g, 6.32 mmol), p-TsCl (0.142 g, 0.747 mmol) and toluene (8 ml). The reaction was heated in the microwave reactor at 170 ° C for 6 hours. The mixture was cooled, concentrated in vacuo and the residue was purified on a gold ISCO 24 g column (eluent: 100% Hex gradient). at 50% EA / Hex) to provide lnt-81c (190 mg, 0.339 mmol, 13.61% yield).

Step C A mixture of lnt-81c (350 mg, 0.624 mmol), bis (pinacolato) diboro (349 mg, 1373 mmol), KOAc (245 mg, 2.497 mmol) and Pd (dppf) Cl2 (45.7 mg, 0.062 mmol) in 1 , 4-dioxane (5 ml) was degassed (by N2 discharge) and at 100 ° C. After 18 hours, the reaction was cooled to the temperature, the mixture was treated with lnt-1 Of (438 mg, 1310 mmol), K2CO3 1N (2.5 ml, 2.5 mmol) and Pd (dppf) CI2 (45.7 mg, 0.062 mmol). The mixture was degassed and heated at 100 ° C for 18 hours. The mixture was cooled, diluted in EtOAc and filtered through the pad of celite, and the filtrate was concentrated in vacuo to provide a solid. The crude product was purified using flash column chromatography on silica gel in (gold ISCO 40g, eluent: Hex-EtOAc 100: 0 to 85:15) to provide lnt-81d (233 mg, 0.256 mmol, 41.1% yield) as a pale yellow solid. LC / MS (M + H) = 909.4.

EXAMPLE 82 Preparation of compound 793 Step A Compound lnt-82a was prepared from lnt-81 d (100 mg, 0.11 mmol) using the method described in example 77, step A (86 mg, 0.11 mmol, 100% yield). LC / MS (M + H) = 709.3.

Step B Compound 793 was prepared from lnt-82a (86 mg, 0.11 mmol) using the method described in example 77, step B (63 mg, 0.050 mmol, 46% yield). LC / MS (M + H) = 1024.4.

EXAMPLE 83 Preparation of compound 794 A mixture of X-Phos (4.27 mg, 8.95 μ? T), compound 793 (56 mg, 0.045 mmol), Pd2dba3 (4.63 mg, 4.47 pmol), KOAc (10.98 mg, 0.1 12 mmol) and bis ( pinacolato) diboro (17.04 mg, 0.067 mmol) in 1,4-dioxane (1 mL) was degassed and heated at 100 ° C for about 15 hours. The mixture was then cooled to room temperature, filtered and the crude reaction mixture was purified on Gilson HPLC (eluent: acetonitrile / water + 0.1% TFA) to provide compound 794 (30.5 mg, 0.025 mmol, 56% yield). ). LC / E (M + H) = 989.5.

EXAMPLE 84 Preparation of compounds 1051, 1061 v 1062 Step A A 20 ml microwave tube was loaded with lnt-22a (1.0 g, 2.5 mmol), 3-phenylpropanal (3.3 ml, 3.3 g, 25 mmol) and p-toluenesulfonyl chloride (48 mg, 0.25 mmol) and toluene ( 8 mi). The reaction mixture was heated and stirred at 170 ° C in a microwave for 12 hours. The reaction mixture was concentrated in vacuo under vacuum, and the residue was adsorbed on silica gel. Purification by chromatography on silica gel (eluent: 0-15% of EtOAc / hexanes) provides lnt-84a as a yellow oil (901 mg, 70% yield).

Step B A 20 ml microwave tube was loaded with lnt-84a (901 mg, 1. 74 mmol), bis (pinacolato) diboro (1.1 g, 4.4 mmol), (dppf) PdCl2"CH2Cl2 (142 mg, 0.17 mmol) and KOAc (512 mg, 5.22 mmol). Dioxane (10 ml) was added, and the sealed reaction was degassed with dry nitrogen. The reaction was allowed to stir at 90 ° C for 2 hours, then allowed to cool to room temperature, and diluted with EtOAc (100 mL). The organic phase was washed sequentially with water (10 ml) and brine (10 ml). The organic phase was dried over MgSO, filtered and concentrated in vacuo to provide a solid. The crude product was purified using flash column chromatography on silica gel (eluent: 0-20% EtOAc / hexanes) to provide lnt-84b (1.3 g).

Step C A 20 ml microwave tube was loaded with lnt-84b (572 mg, 0.93 mmol), lnt-10f (687 mg, 2.05 mmol) and (dppf) PdCI2"CH2Cl2 (38 mg, 0.047 mmol). The tube was sealed, dioxane (8 ml) was added, degassed with nitrogen and aqueous potassium carbonate (6 ml, 1 M, 6 mmol) was added. The reaction mixture was heated at 90 ° C for 16 hours, cooled to room temperature and diluted with EtOAc (100 mL). The aqueous layer was extracted with EtOAc (2 x 20 mL), and the combined organic extracts were washed with brine (20 ml), dried over MgSO, filtered and concentrated in vacuo. The crude product was purified using flash column chromatography on silica gel (eluent: EtOAc (containing 10% MeOH): hexanes from 10:90 to 90:10) to provide lnt-84c (580 mg, 72% yield ).

Step D A 125 ml round bottom flask was charged with lnt-84c (411 mg, 0.47 mmol) and methanol (9 ml). HCl (9.4 ml, 2 M in diethyl ether, 19 mmol) was added and the reaction mixture was allowed to stir for about 15 hours at room temperature. The reaction mixture was concentrated in vacuo to provide lnt-84d (384 mg, quantitative yield).

Step E In a 125 ml round bottom flask, lnt-84d (382 mg, 0.52 mmol) and lnt-1a (228 mg, 1.3 mmol) were dissolved in DMF (7.5 ml) and diisopropylethylamine (0.63 ml, 0.47 g, 3.6 mmol). ) was added. The reaction mixture was cooled to 0 ° C and allowed to stir for 15 minutes. HATU (395 mg, 1.04 mmol) was added and the reaction mixture was allowed to stir at 0 ° C for 30 minutes, and then at room temperature for 2.5 hours. The reaction mixture was poured into water (30 ml). The precipitate was collected by filtration, then dissolved in methylene chloride (200 ml), dried over MgSO, filtered and concentrated in vacuo. The resulting crude product was purified using C18 reverse phase chromatography (Gilson, 0-90% CH3CN (+ 0.1% TFA), water (+ 0.1% TFA) for 15 minutes) to give compound 1051 as a yellow foam (199 mg, 39% performance).

Step F Compound 1051 (247 mg, 0.251 mmol) was dissolved in methanol (13 mL) and palladium (268 mg, 10% by weight on carbon, containing 50% by weight of water) was added. The reaction mixture was hydrogenated for 71 hours, at which point LC / MS analysis showed a 4: 1 mixture of the desired product and the starting mixture. The hydrogenation was continued for an additional 92 hours. The reaction mixture was filtered and the catalyst was rinsed with methanol (~100 mL). The filtrate was concentrated, adsorbed on silica gel (15 mL), then purified using flash column chromatography on silica gel (0-10% MeOH (+ 1% NH OH) / CH2Cl2) to provide lnt-85e (164 mg, 69% yield).

Step G The lnt-85e isomers were separated by HPLC. Int-85e (164 mg) was dissolved in absolute EtOH (6.0 mL) and the solution was filtered. The sample was divided into four equal parts, each of which was injected into a semi-preparative column Phenomenex Lux cellulose-2 (5 μ ??, 150 x 21.20 nm); detection wavelength = 350 nm. Initial elution with 25% EtOH / hexane @ 10 ml / min per 159 minutes gives compound 1061 (Í = 83 minutes, 62 mg). The polarity of the solvent was increased to 35% EtOH / hexane and further elution at 10 ml / min yielded compound 1062 (tR = 163 minutes, 72 mg).

EXAMPLE 85 Preparation of compounds 1049, 1054, 1059 and 1060 Step A In a 20ml microwave tube, lnt-84b (229 mg, 0.37 mmol), lnt-7d (261 mg, 0.82 mmol) and (dppf) PdCI2 * CH2Cl2 (15 mg, 0.019 mmol) were combined. The tube was sealed, evacuated and placed under a nitrogen atmosphere. Dioxane (4 mL) and aqueous potassium carbonate (3 mL, 1 M, 3 mmol) was added. The reaction mixture was allowed to stir for approximately 15 minutes. hours at 90 ° C, then allowed to cool to room temperature. The reaction mixture was diluted with EtOAc (50 mL). The aqueous layer was extracted with EtOAc (2 x 10 mL). The combined organic extracts were washed with brine (20 ml), dried over MgSO 4, filtered and concentrated in vacuo. The residue was purified using flash column chromatography on silica gel (0-100% EtOAc (containing 10% MeOH) -hexanes) to provide lnt-85a (212 mg, 69% yield).

Step B In a 125 ml round bottom flask, lnt-85a (456 mg, 0.55 mmol) was dissolved in methanol (11 ml). HCl (5.5 ml, 2 M in diethyl ether, 11 mmol) was added and the reaction mixture was allowed to stir for about 15 hours at room temperature. The reaction mixture was concentrated in vacuo to provide lnt-85b (425 mg, quantitative yield).

Step C In a 125 ml round bottom flask, lnt-85b (439 mg, 0.62 mmol) and lnt-1 a (274 mg, 1.56 mmol) were dissolved in DMF (8 ml) and diisopropylethylamine (0.76 ml, 0.56 g, 4.3 mmol) was added. The reaction mixture was cooled to 0 ° C and allowed to stir for 15 minutes. HATU (475 mg, 1.24 mmol) was added and the reaction mixture was allowed to stir at 0 ° C for 30 minutes, and then at room temperature for 2 hours. The mixture of reaction was poured into water (30 ml). The precipitate was collected by filtration, then dissolved in EtOAc (200 mL), dried over MgSO4, filtered and concentrated in vacuo. The resulting crude product was purified using C18 reverse phase C18 chromatography (Gilson, 0-90% CH3CN (+ 0.1% TFA), water (+ 0.1% TFA) for 15 minutes) to provide compound 1049 as a foam yellow (362 mg, 62% yield).

Step D Compound 1049 (362 mg, 0.383 mmol) was dissolved in methanol (20 mL) and palladium (163 mg, 10% by weight on carbon, containing 50% by weight of water) was added. The reaction mixture was hydrogenated for 71 hours, at which point the LCEM analysis showed only a trace amount of remaining starting material. The reaction mixture was filtered and the catalyst was rinsed with methanol (~100 mL). The filtrate was concentrated, adsorbed on silica gel (15 mL), then purified using flash column chromatography on silica gel (0-10% MeOH (+ 1% NH4OH) / CH2Cl2) to provide compound 1054 ( 231 mg, 66% yield).

Step E The isomers comprising compound 1054 were separated by HPLC. Compound 1054 (222 mg) was dissolved in absolute EtOH (6.0 mL) and the solution was filtered. The sample was divided into two equal parts, each of which was injected into a semi-preparative column Phenomenex Lux cellulose-2 (5 μ ??, 150? 21.20 mm); detection wavelength? = 350 nm. Elution with 45% EtOH / hexane (+ 0.1% diethylamine) @ 10 ml / min provides fraction A: compound 1059 (tR = 32 minutes, 91 mg) and fraction B: compound 1060 (tR = 97 minutes, 68 mg ).

EXAMPLE 86 Preparation of compound 1 100 Step A A 20 ml microwave tube was charged with lnt-22a (1.0 g, 2.8 mmol), 3- (3'-methoxyphenyl) propanal (2.3 g, 14 mmol), p-toluenesulfonyl chloride (53 mg, 0.280 mmol) and dissolved in toluene (9 ml). The tube was sealed and heated in a microwave with stirring at 170 ° C. After 12 hours the reaction was partially concentrated in vacuo, and the residue was adsorbed on silica gel (20 ml). The crude product was purified using flash column chromatography on silica gel (eluent: 0-10% EtOAc: hexanes) to provide lnt-86a (1.39 g, 99% yield).

Step B A 20-ml microwave tube was loaded with lnt-86a (1.39 g, 2.76 mmol), bis (pinacolato) diboro (772 mg, 3.04 mmol), (dppf) PdCI2'CH2CI2 (202 mg, 0.276 mmol) and KOAc (813 mg, 8.29 mmol). The tube was sealed, evacuated and placed under nitrogen atmosphere. Dioxane (11 mL) was added, the reaction was allowed to stir at 90 ° C for 2 hours and then allowed to cool to room temperature. EtOAc (40 mL) and water (40 mL) were added. The aqueous layer was extracted with EtOAc (2 x 40 mL). Combined organic layers were washed with brine (40 ml), dried over MgSO 4, filtered and concentrated in vacuo. The crude product was purified using flash column chromatography on silica gel (eluent 0-30% EtOAc / hexanes) to provide lnt-86b (1.07 g, 70% yield).

Step C A 20 ml microwave tube was loaded with lnt-86b (500 mg, 0.91 mmol), lnt-7h (373 mg, 0.999 mmol) and (dppf) PdCI2 * CH2Cl2 (67 mg, 0.091 mmol). The tube was sealed, evacuated and placed under a nitrogen atmosphere. Dioxane (9 ml) and aqueous potassium carbonate (2.7 ml, 1 M, 2.7 mmol) were added and the reaction was allowed to stir for about 15 hours at 80 ° C. After cooling to room temperature, EtOAc (50 ml) and water (50 ml) were added and the layers separated. The aqueous layer was extracted with EtOAc (2 x 10 mL), and the combined organic extracts were washed with brine (20 mL), dried over MgSO4, filtered and concentrated in vacuo. The crude product was purified using flash column chromatography on silica gel (eluent: 0-100% EtOAc / hexanes) to give lnt-86c (385 mg, 59% yield).

Step D In a 20 ml microwave tube, lnt-86c (380 mg, 0.530 mmol), bis (pinacolato) diboro (336 mg, 1.3 mmol), (dba Pda'CHC- (55 mg, 0.053 mmol), X-Phos (51 mg, 0.106 mmol) and KOAc (156 mg, 1.61 mmol) were combined.The tube was sealed, evacuated and placed under a nitrogen atmosphere.Dioxane (5.3 ml) was added and the reaction was allowed to stir at 120 °. C for 1 hour, then allowed to cool to room temperature The reaction mixture was diluted with EtOAc (20 mL) and washed sequentially with water (5 mL) and brine (50 mL) .The organic layer was dried over MgSO4. filtered and concentrated in vacuo The crude product was purified using flash column chromatography on silica gel (eluent: 0-100% EtOAc / hexanes) to give lnt-86d (382 mg, 93% yield).

Step E In a 20 ml microwell tube, lnt-86d (302 mg, 0.391 mmol), lnt-7d (124 mg, 0.391 mmol) and (dppf) PdCl2 * CH2Cl2 (32 mg, 0.039 mmol) were combined. The tube was sealed, evacuated and placed under a nitrogen atmosphere. Dioxane (8 mL) and aqueous potassium carbonate (1.2 mL, 1M, 1.2 mmol) was added. The reaction was allowed to stir for about 15 hours at 80 ° C, then allowed to cool to room temperature. The reaction mixture was diluted with EtOAc (200 mL). The aqueous layer was extracted with EtOAc (2 mL). The combined organic extracts were washed with brine (50 ml), dried over MgSO 4, filtered and concentrated in vacuo. He crude product was purified using flash column chromatography on silica gel (eluent: 0-100% EtOAc (containing 10% MeOH) -hexanes) to provide lnt-86e (78 mg, 22% yield).

Step F A 125 ml round bottom flask was charged with lnt-86e (81 mg, 0.092 mmol) and methanol (2 mL). HCl (0.84 mL, 2M in diethyl ether, 1.7 mmol) was added and the reaction was allowed to stir for about 15 hours at room temperature. The reaction mixture was concentrated in vacuo to provide lnt-86f (109 mg, quantitative yield).

Step G A 25 ml round bottom flask was charged with lnt-1e (53 mg, 0.067 mmol), lnt-86f (15.5 mg, 0.081 mmol) and DMF (1 ml). Diisopropylethylamine (82 ul, 61 mg, 0.472 mmol) was added to the solution. The reaction mixture was cooled to 0 ° C, stirred for 15 minutes and HATU (395 mg, 1.04 mmol) was added. The reaction mixture was allowed to stir at 0 ° C for 30 minutes, and then at room temperature for 2 hours. Additional diisopropylethylamine (20 uL, 2 eq) was added and the reaction was allowed to proceed for an additional 1 hour. The reaction mixture was diluted with EtOAc (30 mL) and poured into water (30 mL). The aqueous layer was extracted with EtOAc (2 x 10 mL). The combined organic phase was dried over MgSO4, filtered and concentrated in vacuo. The resulting crude product was purified using C18 reverse phase chromatography (Gilson, 0-90% CH3CN (+ 0.1% TFA), water (+ 0.1% TFA) for 15 minutes) to provide compound 1100 as a yellow solid (31 mg, 48% performance).

EXAMPLE 87 Preparation of compound 1099 A 25 ml round bottom flask was charged with lnt-86f (53 mg, 0.067 mmol), lnt-4f (18 mg, 0.081 mmol), DMF (1 mL) and diisopropylethylamine (82 mL, 61 mg, 0.47 mmol). . The reaction mixture was cooled to 0 ° C and allowed to stir for 15 minutes. HATU (26 mg, 0.067 mmol) was added and the reaction mixture was allowed to stir at 0 ° C for 30 minutes and then allowed to warm to room temperature for 2 hours. Additional Int-4f (8.8 mg, 0.6 eq), HATU (5 mg, 0.2 eq) and diisopropylethylamine (20 ul, 2 eq) was added and the reaction was allowed to continue for an additional 1 hour. The reaction was diluted with EtOAc (30 mL) and water poured (30 mL). The aqueous layer was extracted with EtOAc (2 x 10 mL) and the combined organic phase was dried over MgSO4, filtered and concentrated in vacuo. The crude product was purified using C18 reverse phase chromatography (Gilson, 0-90% CH3CN (+ 0.1% of TFA), water (+ 0.1% TFA) for 15 minutes) to provide compound 1099 as a yellow solid (28 mg, 43% yield).

EXAMPLE 88 Preparation of compounds 1502 and 1505 Compound 793 (prepared as indicated above in Example 57 lnt-14d and lnt-19j) (38 mg, 0.039 mmol) and lnt-1 a (7.5 mg, 0.04 mmol) using the method described in Example 57, step E to provide the isomer of compounds 1502 and 1505 (19 mg, 46% yield).

EXAMPLE 89 Cell-based HCV replicon assay To measure the anti-HCV activity based on cells of selected compounds of the present invention, the replicon cells were seeded at 5000 cells / well in Nunc plates coated with collagen I of 96 wells in the presence of the test compound. Various concentrations of the test compound, usually in 10 2-fold serial dilutions, were added to the test mixture, with the initial concentration varying from 250 μ? at 1 μ ?. In the test medium the final concentration of DMSO was 0.5%, that of fetal bovine serum was 5%. Cells were harvested on day 3 by adding 1x cell lysis buffer (Ambion, cat # 8721). The amount of replicon RNA was measured using real-time PCR (Taqman test). The amplicon was located in 5B. PCR primers were: 5B.2F, ATGGACAGGCGCCCTGA (SEQ ID NO: 1); 5B.2R, TTGATGGGCAGCTTGGTTTC (SEQ ID NO.2); the sequence of the probe was FAM-labeled CACGCCATGCGCTGCGG (SEQ ID No. 3). GAPDH RNA was used as an endogenous control and was amplified in the same reaction as NS5B (multiplex PCR) using primers and labeled VIC probe recommended by the manufacturer (PE Applied Biosystem). The real-time RT-PCR reactions were run in an ABI PRISM 7900HT sequence detection system using the following program: 48 ° C for 30 minutes, 95 ° C for 10 minutes, 40 cycles of 95 ° C for 15 s, 60 ° C for 1 minute. The DCT values (CT5B-CTGAPDH) were plotted against the concentration of the test compound and adjusted to the sigmoid dose-response model by XLfit4 (MDL). The EC50 was defined as the concentration of inhibitor necessary to achieve ACU = 1 over the projected baseline; CE90 is the concentration necessary to achieve ACU = 3.2 over the baseline. Alternatively, to To quantify the absolute amount of replicon RNA, a standard curve was established including T7 transcripts serially diluted from the replicon RNA in the Taqman test. All Taqman reagents were from PE Applied Biosystems. This test procedure was described in detail, for example, in Malcolm et al., Antimicrobial Agents and Chemotherapy 50: 1013-1020 (2006).

HC90 replicon assay EC90 data were calculated for selected compounds of the present invention using this method and were provided in the table immediately below and in Table 2 in Example 89.

EXAMPLE 90 Additional compounds of the invention Additional illustrative compounds of the present invention are set forth below in Table 2. The replicon data provided for selected compounds depicted in Table 2 were generated using the method described in Example 89. 381 ? 86 NA = Not Available ??? 391 94 ? 95 97 400 401 402 403 404 406 408 409 413 414 415 416 417 421 426 432 437 442 449 Comp · ECM_1 EC50.1 ECÍD_1 ECS0_2 M.S. Obi. Designation | «Y93H« U1V b b [? +? G oe Isomer > 200 755 ezda da Isomer 532 0.003 Sendllo isomer 0. 003 82-89 14.2 0.003 53.1 832.0 832.9 Isomer 8endRo 89. 97 882.0 Isomer s endito 35. 7.4 AedeDo isomer Simple isomer Isomer 78. 42 22.7 0.002 > 200 905.1 sendilo ??? J66 470 ??? 481 Comptf EC50_1 ECS0_1 EC50_1 EC4O.2 .S. Oos. Designation «? 93? | L31V b M.S. Tasting b [Isomer MtHf TencMo isomer Isomer I signal Simple isomer Simple isomer OH Simple isomer J96 DeslQnadGnl *? Isomer G Simple isomer Isomer s endito Simple isomer Simple isomer Simple isomer Simple isomer J99 Comp i EC60_1 EC1_1 EC50_1 6CS0_2 U S. Otos. Designation a Y9JH • U1V b b (? +? G of Isomer Simple isomer Simple isomer Isomer mixture Isomer's change Isomer mix Mix of 861. 0 isomer or 5 10 fifteen twenty 515 531 534 535 550 554 564 5 10 fifteen twenty 5 10 twenty 601 605 The present invention is not limited by the specific embodiments described in the examples which are intended to illustrate some aspects of the invention, and any modality that is functionally equivalent is within the scope of this invention. In fact, various modifications of the invention, in addition to those shown and described herein, will be apparent to those skilled in the art and are considered to be within the scope of the appended claims.

Several references have been cited herein, the full descriptions of which are incorporated by reference.

Claims (28)

NOVELTY OF THE INVENTION CLAIMS

1. - A compound that has the formula: or a pharmaceutically acceptable salt thereof, wherein: A and A 'are each independently a 5- or 6-membered monocyclic heterocycloalkyl, wherein said 5- or 6-membered monocyclic heterocycloalkyl group may be optionally fused to an aryl group; and wherein said 5- or 6-membered monocyclic heterocycloalkyl group can be optionally and independently substituted on one or more carbon atoms of the ring with R 3, such that either of two R 3 groups on the same ring, together with the carbon atoms at which are joined, can be joined to form a cycloalkyl group of 3 to 6 fused members, with bridge or a 4 to 6 membered heterocycloalkyl group fused, bridged or spirocyclic, wherein said 5 or 6 membered monocyclic heterocycloalkyl contains 1 to 2 heteroatoms of the ring, each independently selected from N (R4), S, O and Si (R16) 2; G is selected from -C (R3) 2-C-, -C (R3) 2-N (R5) -, - C (0) -0-, -C (0) -N (R5) -, -C (0) -C (R3) 2-C (R3) 2-C (0) -, -C (= NR5 ) -N (R5) -, -C (R3) 2-S02-, -S02-C (R3) 2-, -S02N (R5) -, -C (R3) 2-C (R3) 2-, - C (R1) = C (R14) - and -C (R1) = N-; U is selected from N and C (R2) V and V each is independently selected from N and C (R15) W and W each is independently selected from N and C (R1); X and X 'each is independently selected from N and C (R10); Y and Y 'each is independently selected from N and C (R10); R1 is selected from H, CrC6 alkyl, 3 to 6 membered cycloalkyl, halo, -OH, -O- (CrC6 alkyl), C1-C6 haloalkyl and -O- (C6 haloalkyl); each occurrence of R2 is independently selected from H, C1-C6 alkyl, 3 to 6 membered cycloalkyl, -O- (Ci-C6 alkyl, C6 haloalkyl-O- (haloalkyl of C ^ Ce), halo, -OH, aryl, and heteroaryl, each occurrence of R3 is independently selected from H, C1-C6 alkyl, C1-C6 haloalkyl, - (C6 alkylene) -O- (CrC6 alkyl), - ( CrC6 alkylene) -O- (3 to 6 membered cycloalkyl), 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl, 5 or 6 membered monocyclic heteroaryl, 9 or 10 membered bicyclic heteroaryl and benzyl, wherein said aryl group, said 5- or 6-membered monocyclic heteroaryl group, said 9- or 10-membered bicyclic heteroaryl group or the phenyl radical of said benzyl group can be optionally substituted with up to 3 groups, which may be the same or different, and are selected from C ^ C6 alkyl, C6 haloalkyl, -O- (Ci-C6 alkyl), -O (Ci-C6 haloalkyl), halo, - (d6C6 alkylene) -O - (CrC6 alkyl) and -CN and wherein two R3 groups attached to the same atom of carbon, together with the common carbon atom to which they are attached, can be joined to form a carbonyl group, a 3 to 6-membered spirocyclic cycloalkyl group or a 3 to 6 membered spirocyclic heterocycloalkyl group; each occurrence of R4 is independently selected from - [C (R7) 2] qN (R6) 2, -C (0) R11, -C (0) - [C (R7) 2] qN (R6) 2, -C (0) - [C (R7) 2] p-R11, -C (O) - [C (R7) 2] qN (R6) C (0) -R11, -C (0) [C (R7) 2 ] qN (R6) S02-R11, -C (0) - [C (R7) 2] qN (R6) C (0) O-R11, -C (O) - [C (R7) 2] qC (0 ) 0-R11 and -alkylene-N (R6) - [C (R7) 2] qN (R6) -C (0) 0-R11; each occurrence of R5 is independently selected from H, Ci-C6 alkyl, - (C6-C6 alkylene) -0- (Ci-C6 alkyl), 3-6-membered cycloalkyl, 4- to 6-membered heterocycloalkyl, aryl, 5- or 6-membered monocyclic heteroaryl and benzyl, wherein said aryl group, said 5- or 6-membered monocyclic heteroaryl group or the phenyl radical of said benzyl group can optionally be substituted with up to 3 groups, which may be the same or different, and are selected from C-C-alkyl, Ci-C6l-haloalkyl- (C-C-alkyl), -0- (C-Ce haloalkyl), halo, - (C6-C-alkylene) -0- d-C6) and -CN; each occurrence of R 6 is independently selected from H, C 6 alkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl, and 5 or 6 membered monocyclic heteroaryl, wherein said 3 to 6 membered cycloalkyl group, said 4- to 6-membered heterocycloalkyl group, said aryl group and said 5- or 6-membered monocyclic heteroaryl group can be optionally and independently substituted with up to two R8 groups, and wherein two R6 groups that are bonded to the same nitrogen atom, together with the atom common nitrogen to which they are attached, can be joined to form a 4 to 6 membered heterocycloalkyl group; each occurrence of R7 is selected independently from H, C-C-alkyl, haloalkyl from CrCs; - alkylene-0- (C-C6 alkyl), 3- to 6-membered cycloalkyl, 4- to 6-membered heterocycloalkyl, aryl, and 5- or 6-membered monocyclic heteroaryl, wherein said 3-6 membered cycloalkyl group, said 4- to 6-membered heterocycloalkyl group, said aryl group and said 5- or 6-membered monocyclic heteroaryl group can be optionally substituted with a maximum of three R8 groups; each occurrence of R8 is independently selected from H, Ci-C6 alkyl, halo, -C-Ce haloalkyl, C6-C6 hydroxyalkyl, -OH, -C (O) NH- (CrC6 alkyl), -C (O) N (Ci-C6 alkyl) 2. -O- (Ci-C6 alkyl), -NH 2 1 -NH (d-C 6 alkyl), -N (Ci-C 6 alkyl) 2 and -NHC (O) - (d-C 6 alkyl); each occurrence of R9 is independently selected from H, C -? C6 alkyl, CrC6 haloalkyl, 3-6 membered cycloalkyl, 4- to 6 membered heterocycloalkyl, aryl, and 5- or 6-membered monocyclic heteroaryl; each occurrence of R10 is independently selected from H, CrC6 alkyl, C6 halo haloalkyl, -OH, -O- (CrC6 alkyl) and -CN; each occurrence of R 11 is independently selected from H, Ci-C 6 alkyl, C-C haloalkyl, C 1 -C 6 hydroxyalkyl, 3 to 6 membered cycloalkyl and 4 to 6 membered heterocycloalkyl; each occurrence of R 12 is independently selected from C 1 -C 6 alkyl, C 6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, 5 or 6 membered monocyclic aryl and heteroaryl; each occurrence of R13 is selected independently of H, halo, Ci-C6 alkyl, CrC6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, -CN, -OR9, -N (R9) 2, -C (O) R12, -C (O) OR 9, -C (0) N (R 9) 2, -NHC (O) R 12, -NHC (0) NHR 9, -NHC (0) OR 9, -OC (0) R 12, -SR 9 and - S (0) 2R12, wherein two R12 groups with the carbon atom (s) to which they are attached may optionally be combined to form a 3-6 membered cycloalkyl group or a 4-6 membered heterocycloalkyl group; each occurrence of R 4 is independently selected from H, halo, CrC6 alkyl, - (CrC6 alkylene) -O- (Ci-C6 alkyl), 3 to 6 membered cycloalkyl, C1-C6 haloalkyl, aryl, heteroaryl 5 or 6 membered monocyclic and benzyl, wherein said aryl group, said 5 or 6 membered monocyclic heteroaryl group or the phenyl radical of said benzyl group can be optionally substituted with up to 3 groups, which may be the same or different, and are selected from halo, -CN, Ci-C6 alkyl, Ci-C6 haloalkyl, -0- (Ci-C6 alkyl), - (Ci-C6 alkylene) -0- (Ci-C6 alkyl) and -0- (haloalkyl of -06), each occurrence of R15 is independently selected from H, C6 alkyl, 3- to 6-membered cycloalkyl, halo, -OH, -O- (CrC6 alkyl), CrC6 haloalkyl and -O- (haloalkyl of C C6); each occurrence of R16 is independently selected from H, halo, C-C alkyl, and 3 to 6-membered cycloalkyl, wherein two R16 groups that are attached to a common silicon atom can be joined to form a - (CH2) 4- group or a group - (CH2) 5 - and each occurrence of q is independently an integer ranging from 0 to 4 as long as the compound of formula (I) is different from: 615

2 - The compound according to claim 1, further characterized by having the formula: (the) and pharmaceutically acceptable salts thereof, wherein: A and A 'are each independently a 5-membered monocyclic heterocycloalkyl, wherein said 5-membered monocyclic heterocyclic alkyl group may be optionally and independently substituted on one or more ring carbon atoms with R 3, such that either of the two R 13 groups on the same ring, together with the carbon atoms to which they are attached, can be joined to form a fused spirocyclic cycloalkyl group, with 3 to 6 membered briddle or spirocyclic group or fused, bridged or spirocyclic 4- to 6-membered heterocycloalkyl group, wherein said 5-membered monocyclic heterocycloalkyl contains from 1 to 2 ring heteroatoms, each independently selected from N (R4) and Si (R16) 2¡G is selected of -C (R3) 2-0-, or -C (R3) 2-C (R3) 2- R1 represents a substituent of the optional ring on the phenyl ring to which R1 is attached, wherein said C sustituC alquilo alkyl substituent, Cr C6Oalkyl and halo; each occurrence of R2 is independently selected from H, haloalkyl of C C6, cycloalkyl of 3 to 6 members, heterocycloalkyl of 4 to 6 members, aryl, monocyclic heteroaryl of 5 or 6 members, benzyl, -O- (C6 alkyl) , haloalkylene of C C6-0- (haloalkyl of C ^ Ce); - (CrC6 alkylene) C (= 0) NH-alkyl, - (Ci-C6 alkylene) aryl and - (Ci-C6 alkylene) heteroaryl, wherein said aryl group, said 5- or 6-membered monocyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which may be the same or different, and are selected from halo, -CN, C6 alkyl, Ci-C6 haloalkyl, Ci -O-alkyl -C6, - (C6-C6 alkylene) -0-C6-alkyl and -0- (CrC6 haloalkyl); each occurrence of R3 is independently selected from H, Ci-C6 haloalkyl, CrC6 alkyl, 3- to 6-membered cycloalkyl, 4- to 6-membered heterocycloalkyl, aryl, 5- or 6-membered monocyclic heteroaryl, bicyclic heteroaryl of 9 or 10 members, benzyl, -0- (Cr C6 alkyl), d-C6-0- haloalkylene (C6 haloalkyl); - (C6 alkylene) C (= 0) NH-alkyl, - (C6-C6 alkylene) aryl and - (C6-C6 alkylene) heteroaryl, wherein said aryl group, said 5- or 6-membered monocyclic heteroaryl group, said 9- or 10-membered bicyclic heteroaryl group or the phenyl group of said benzyl group may be optionally substituted with up to 3 groups, which may be the same or different, and are selected from halo, -CN, CrC6 alkyl, C1-haloalkyl C6, -O-alkyl of C1-C6, - (C -C6 alkylene) -0-CrC6 alkyl and -0- (CrC6 haloalkyl); each occurrence of R 4 is independently -C (0) - [C (R 7) 2] N (R 6) C (0) 0-R 1; each occurrence of R6 is independently selected from H and C-CQ alkyl, each occurrence of R7 is independently selected from d-Ce alkyl, Ci-C6 haloalkyl, 3- to 6-membered cycloalkyl, 4- to 6-membered heterocycloalkyl, 5 or 6 membered monocyclic aryl and heteroaryl, wherein said 3 to 6 membered cycloalkyl group, said 4 to 6 membered heterocycloalkyl group, said aryl group and said 5 or 6 membered monocyclic heteroaryl group can be optionally substituted with a maximum of three R8 groups; each occurrence of R8 is independently selected from H, C ^ 6 alkyl, halo, Ci-C6 haloalkyl, Ci-C6 hydroxyalkyl, -OH, -C (O) NH- (Ci-C6 alkyl), - C (O) N (CrC6 alkyl) 2, -O- (CrC6 alkyl), -NH2, -NH (C-C6 alkyl), -N (Ci-C6 alkyl) 2 and -NHC (0) - (d-CQ alkyl); each occurrence of R10 is independently selected from H and halo; each occurrence of R1 is independently selected from C CQ alkyl, each occurrence of R13 is independently selected from H and halo, wherein two R13 groups, together with the carbon atoms to which they are attached, can optionally be brought together to form a 3 to 6 membered cycloalkyl group or 4 to 6 membered heterocycloalkyl group; each occurrence of R14 is independently selected from H, Ci-C6 haloalkyl, 3-6 membered cycloalkyl, 4- to 6-membered heterocycloalkyl, aryl, 5- or 6-membered monocyclic heteroaryl, benzyl, -O- (C-alkyl) C6), Cr C6 haloalkylene -0- (C6 haloalkyl); - (C-i-C6 alkylene) C (= 0) NH- alkyl, - (C6-C6 alkylene) aryl, and - (CrC6 alkylene) heteroaryl, wherein said aryl group, said 5- or 6-membered monocyclic heteroaryl group or the phenyl radical of said beneyl group can be optionally substituted with up to 3 groups, which may be the same or different, and are selected from halo, -CN, C6 alkyl, C6 haloalkyl, -O-C6 alkyl, - (Ci-C6 alkylene) -0-alkyl C C6 and -0- (CrC6 haloalkyl); each occurrence of R15 is independently selected from H, haloalkyl of d-C6, cycloalkyl of 3 to 6 members, heterocycloalkyl of 4 to 6 members, aryl, monocyclic heteroaryl of 5 or 6 members, beneilo, -0- (alkyl of Ci- C6), Ci-C6 haloalkylene -0- (haloalkyl of C C6); - (C C6 alkylene) C (= 0) NH-alkyl, - (Ci-C6 alkylene) aryl, and - (C-C6 alkylene) heteroaryl, wherein said aryl group, said monocyclic heteroaryl group of 5 or 6 members or the phenyl radical of said beneyl group can be optionally substituted with up to 3 groups, which may be the same or different, and are selected from halo, -CN, C ^ C6 alkyl, C6 haloalkyl, -O- C -C6 alkyl, - (C1-C6 alkylene) -O-Ci-C6 alkyl and -O- (Ci-C6 haloalkyl); and Each occurrence of R16 is independently selected from C6 alkyl.

3. - The compound according to claim 1 or 2, further characterized in that the group: has the structure:

4. - The compound according to claim 1 or 2, further characterized in that the group: has the structure:

5. - The compound according to any of claims 1 to 4, further characterized in that A and A 'are each independently selected from:

6. - The compound according to claim 5, further characterized in that A and A 'are each independently selected from:

7. - The compound according to any of claims 1 to 6, further characterized in that A and A 'are each wherein each occurrence of Z is independently -Si (R13) 2-, -C (R13) 2- or -S-, and each occurrence of R13 is independently H, Me, F or two R13 groups together with Z, may be combined to form a cycloalkyl group of 3 to 6 spirocyclic members or a heterocycloalkyl group containing spirocyclic silyl of 3 to 6 members.

8. The compound according to any of claims 1 to 6, further characterized in that each occurrence of R4 is independently -C (0) C (R7) 2NHC (0) 0-R11 or -C (O) C (R7) 2N (R6) 2.

9. The compound according to claim 8, further characterized in that each occurrence of R 4 is independently -C (0) CH (alkyl) -NHC (0) O-alkyl, C (0) CH (cycloalkyl) -NHC (0) O-alkyl, C (0) CH (heterocycloalkyl) -NHC (0) Oalkyl, C (0) CH (aryl) -NHC (0) Oalkyl or C (0) CH (aryl) -N (alkyl) 2.

10. - The compound according to claim 1, further characterized in that it has the formula: (Ib) or a pharmaceutically acceptable salt thereof, wherein: R2 is H or F; each occurrence of R 3 is independently selected from H, CrC 6 alkyl, CrC 6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl, 5- or 6 membered monocyclic heteroaryl, 9 or 10 membered bicyclic heteroaryl, -0- (C6 alkyl), Ci-C6 haloalkylene-O- (C6 haloalkyl); - (C6 alkylene) C (= 0) NH-alkyl, - (alkylene of d-C6) aryl, and - (alkylene of Ci-C6) heteroaryl, wherein said aryl group, said monocyclic heteroaryl group of 5 or 6 members, said 9- or 10-membered bicyclic heteroaryl group or the phenyl group of said benzyl group may be optionally substituted with up to 3 groups, which may be the same or different, and are selected from halo, -CN, alkyl; Ci-C6, * s haloalkyl of C C6, -O-alkyl of CrC6, - (alkylene of C C6) -0-alkyl of CrC6 and -0- (haloalkyl of C C6); each occurrence of R4 is independently selected from -C (0) 0- (CrC6 alkyl), -C (0) -CH (R7) N (R6) 2 and -C (0) -CH (R7) C (0 ) 0-R11; each occurrence of R6 is independently H or CrC6 alkyl; each occurrence of R7 is independently selected from Ci-C6 alkyl, phenyl, 4- to 6-membered heterocycloalkyl and 3-6 membered cycloalkyl; each occurrence of R 1 is independently C 1 -C 6 alkyl; each occurrence of R13a is independently H, Me or F; or two R13a groups that are attached to the same carbon atom, together with the common carbon atom to which they are attached, combine to form a 3 to 6 membered spirocyclic cycloalkyl group; each occurrence of R13b is independently H, or both groups R13b and a group R13a that are attached to the same ring, together with the ring carbon atoms to which they are attached, can be combined to form a fused cycloalkyl group of 3 to 6 members; and R 5 represents up to 2 substituents, each independently selected from H, halo, Ci-C6 alkyl, C6 haloalkyl, 3 to 6 membered cycloalkyl, 4 to 6 membered heterocycloalkyl, aryl, 5 or 6 monocyclic heteroaryl. members, benzyl, -0- (C-pCe alkyl), CrC6-0 haloalkylene (CrC6 haloalkyl); - (d-C6 sHkylene) C (= 0) NH-alkyl, - (C6-C6 alkylene) aryl and - (alkylene of d- C6) heteroaryl, wherein said aryl group, said 5- or 6-membered monocyclic heteroaryl group or the phenyl group of said benzyl group can be optionally substituted with up to 3 groups, which may be the same or different, and are selected from halo, - CN, CrC6 alkyl, Ci-C6 haloalkyl, -O-Ci-C6 alkyl, - (alkylene CrCeJ-O-C6 alkyl and -0- (C6 haloalkyl).

1. The compound according to claim 1, further characterized in that it has the formula: (Id) or a pharmaceutically acceptable salt thereof, wherein: R30 is C-i-Ce alkyl, aryl, 5- or 6-membered monocyclic heteroaryl or 9-membered bicyclic heteroaryl; Rw is H, or Rw and R, together with the ring carbon atoms to which they are attached, combine to form a fused cycloalkyl group of 3 to 6 members; Rx is H or F, or Rw and Rx, together with the ring carbon atoms to which they are bound, combine to form a fused cycloalkyl group of 3 to 6 members; Ry is H, or Ry and Rz, together with the ring carbon atoms to which they join, combine to form a fused cycloalkyl group of 3 to 6 members; Rz is H or F, or Ry and Rz, along with the carbon atoms of the ring to which they are attached, combine to form a fused cycloalkyl group of 3 to 6 members.

12. - A compound of Table 1 or Table 2 of the above specification or a stereoisomer thereof or a pharmaceutically acceptable salt thereof.

13. - A pharmaceutical composition comprising an effective amount of the compound of any of claims 1 to 12 and a pharmaceutically acceptable carrier.

14. - The pharmaceutical composition according to claim 13, further characterized in that it additionally comprises a second therapeutic agent selected from the group consisting of HCV antiviral agents, immunomodulators and anti-infective agents.

15. The pharmaceutical composition according to claim 14, further characterized in that it additionally comprises a third therapeutic agent selected from the group consisting of inhibitors of the HCV protease, inhibitors of HCV NS5A and inhibitors of the HCV NS5B polymerase.

16. - A compound of any of claims 1 to 12 for use in the inhibition of HCV replication in a patient.

17. The use of (i) the compound of any one of claims 1 to 10 or (ii) the composition of any of claims 13 to 15, for the manufacture of a medicament for treating a patient infected with HCV.

18. - The use as claimed in claim 17, wherein the medicament is further adapted to be administrable with pegylated alpha interferon and an HCV protease.

19. - The use as claimed in claim 17 or 18, wherein the medicament is further adapted to be administrable with ribavirin.

20. - The use as claimed in claim 17 or 18, wherein the medicament is further adapted to be administrable with one to three additional therapeutic agents, wherein the additional therapeutic agents are each independently selected from protease inhibitors. HCV, inhibitors of NS5A HCV and inhibitors of HCV NS5B polymerase.

21. - The use as claimed in claim 20, wherein the one to three additional therapeutic agents comprises MK-5172.

22. - The use as claimed in claim 21 or 22, wherein the one to three additional therapeutic agents comprises PSI-7977.

23. The compound according to any of claims 1 to 12 or the composition of any of claims 13 to 15 for use in the treatment of HCV infection in a patient.

24. - The compound to be used according to claim 23, or the composition for use according to claim 23, further characterized in that the compound or composition it is further adapted to be administrable with pegylated alpha interferon and an HCV protease.

25. The compound to be used according to claim 23 or 24, or the composition for use according to claim 23 or 24, further characterized in that the compound or composition is further adapted to be administrable with ribavirin.

26. The compound to be used according to claim 23 or 24, or the composition for use according to claim 23 or 24, further characterized in that the compound or composition is further adapted to be administrable with one to three additional therapeutic agents, in wherein the additional therapeutic agents are each independently selected from HCV protease inhibitors, NS5A HCV inhibitors and inhibitors of HCV NS5B polymerase.

27. The compound to be used according to claim 26, or the composition for use according to claim 26, further characterized in that the compound or composition the one to three additional therapeutic agents comprises MK-5172.

28. The compound to be used according to claim 26 or 27, or the composition for use according to claim 26 or 27, further characterized in that the compound or composition the one to three additional therapeutic agents comprises PSI-7977.