AU2006312996A1 - DNA marker for meat tenderness in cattle - Google Patents

DNA marker for meat tenderness in cattle Download PDF

Info

Publication number
AU2006312996A1
AU2006312996A1 AU2006312996A AU2006312996A AU2006312996A1 AU 2006312996 A1 AU2006312996 A1 AU 2006312996A1 AU 2006312996 A AU2006312996 A AU 2006312996A AU 2006312996 A AU2006312996 A AU 2006312996A AU 2006312996 A1 AU2006312996 A1 AU 2006312996A1
Authority
AU
Australia
Prior art keywords
capn3
genetic marker
meat
tenderness
animal
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Abandoned
Application number
AU2006312996A
Inventor
William Barendse
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commonwealth Scientific and Industrial Research Organization CSIRO
University of New England
Department of Primary Industries (State of New South Wales)
Queensland Department of Primary Industries and Fisheries
Meat and Livestock Autralia Ltd
Original Assignee
Commonwealth Scientific and Industrial Research Organization CSIRO
University of New England
Department of Primary Industries (State of New South Wales)
Queensland Department of Primary Industries and Fisheries
Meat and Livestock Autralia Ltd
Australian Meat and Live Stock Research and Development Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2005906261A external-priority patent/AU2005906261A0/en
Application filed by Commonwealth Scientific and Industrial Research Organization CSIRO, University of New England, Department of Primary Industries (State of New South Wales), Queensland Department of Primary Industries and Fisheries, Meat and Livestock Autralia Ltd, Australian Meat and Live Stock Research and Development Corp filed Critical Commonwealth Scientific and Industrial Research Organization CSIRO
Priority to AU2006312996A priority Critical patent/AU2006312996A1/en
Priority claimed from PCT/AU2006/001667 external-priority patent/WO2007053891A1/en
Publication of AU2006312996A1 publication Critical patent/AU2006312996A1/en
Abandoned legal-status Critical Current

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Description

WO 2007/053891 PCT/AU2006/001667 DNA Marker For Meat Tenderness in Cattle Technical Field The present invention is concerned with genetic markers for meat tenderness in animals, and with methods 5 and oligonucleotide probes for assessing meat tenderness in said animals, and a kit for this purpose. The invention is useful for the selection of animals which show desirable traits in meat tenderness either for breeding or to select animals destined to be slaughtered 10 for food. Background Art Meat tenderness is an important issue for consumers, and one which can influence demand sufficiently 15 for an especially tender meat to command a premium price in the marketplace. The physiological change in muscle structure during the post-mortem period is complex but clearly seems to be at least one factor in meat tenderness. It has been theorised that an endogenous, 20 calcium-dependent proteinase, calpain, initiates in vivo muscle protein degradation. In particular, calpain is believed to be responsible for the breakdown of myofibril protein, which is closely related to meat tenderness. Two isoforms of calpain have been isolated, and these are 25 referred to as p-calpain and m-calpain. Each of these consists of an 80 kDa catalytic sub-unit, which are products of separate genes, and a 30 kDa regulatory sub unit, which is identical in both enzymes. Both p-calpain and m-calpain have been shown to degrade most of the 30 fibrular protein, excluding, however, actin and myosin. Accordingly these classical calpains and the molecule which regulates their activity, calpastatin, play a key role in the tenderisation process that occurs during post mortem storage of meat under refrigeration. 35 In addition to the classical calpains, cloning and sequencing DNA has led to identification of a number of calpain-like genes in different organisms or in WO 2007/053891 PCT/AU2006/001667 -2 specific tissues. With few exceptions the proteins encoded by the expressed mRNAs have not been isolated from tissues, so very little is known about the catalytic or other properties of the proteins encoded by these genes. 5 At least twelve different mRNAs or genes encoding polypeptides with sequence homology to the calpains have been identified in vertebrates, and several are expressed principally in skeletal or smooth muscle cells. In particular, calpain 3 (CAPN3) is expressed principally in 10 skeletal muscle and has recently been shown (Ilian et al., 2004) to play a role in post-mortem tenderisation of meat via the proteolysis of specific muscle structural proteins such as nebulin. 15 Summary of the Invention The present inventors have now shown an association between genetic variation at CAPN3 and meat tenderness. Accordingly, in a first aspect of the present 20 invention there is provided a method for assessing the tenderness of meat from an animal, comprising the step of testing the animal for a genetic marker in the calpain3 (CAPN3) gene associated with Warner-Bratzler peak force variation or for a genetic marker located other than in 25 CAPN3 which shows allelic association therewith. It will be appreciated that the test may be a positive test for the presence of the polymorphism associated with low Warner-Bratzler peak-force or a 30 negative test confirming the absence of the polymorphism. Either test allows the tester to reach the same conclusion concerning the meat tenderness characteristics of a beast. Thus a beast identified as having the potential for more tender beef could be used for breeding to improve the 35 herd. Alternatively this test could simply mark the beast as more suitable for slaughter if higher quality, more tender beef is desired.
WO 2007/053891 PCT/AU2006/001667 -3 In an embodiment, the polymorphism is a single nucleotide polymorphism (SNP) identified in Table 8 or 11. It was not previously known that variation between the DNA of individuals at CAPN3 affected meat 5 tenderness. However, given the identification of a DNA variance at CAPN3 associated with increased meat tenderness it follows that other polymorphisms in and around the calpain 3 gene could be used as tools to select for meat tenderness. Where there has been a relatively 10 recent reduction in population size for a species, particular haplotypes of individuals will be relatively over-represented. If insufficient time has elapsed to cause allelic association to decay, there will be linkage disequilibrium even for alleles which are far apart. 15 Livestock species such as cattle have been domesticated from a relatively small pool of wild ancestors in recent times and therefore in these species allelic association is found between alleles that may be remote physically (Farnir et al. 2000; McRae et al. 2002; Tenesa et al. 20 2003; Nsengimana et al. 2004). Thus it follows that regions of genetic variation that are outside of CAPN3 will also show allelic association with the polymorphisms in that gene, and therefore will be suitable genetic markers for the characteristic of peak-force variation. 25 Hence, these polymorphisms may also be used to assess meat tenderness. In effect, these polymorphisms serve as markers for the same causative genetic difference. Further polymorphisms, either known or unknown, may be assayed using techniques such as TAQMAN assay, primer 30 extension and oligonucleotide ligation assays. Furthermore, the design of specific primers to amplify a particular DNA fragment is well within the capability of the person skilled in the art; therefore any region of interest of CAPN3 may be amplified with appropriate 35 primers. Equally, primers other than those specifically disclosed above may be used to amplify the polymorphisms identified in Table 8 or 11.
WO 2007/053891 PCT/AU2006/001667 -4 It will be appreciated that the association of an allele or genotype with increased value will often apply across breeds and families within breeds. However, a particular allele or genotype may not always be .associated 5 with increased values across breeds; in one breed the allele or genotype might be associated with an increased value but in another breed it might be associated with decreased value or not be associated with difference in value. The person skilled in the art will be able to 10 establish the direction of the association following the teachings herein. In an embodiment haplotypes consisting of the CAPN3:C.53 T>G-T, CAPN3JK-G and CAPN3:C.2443-103G>C-C allele as set forth in Table 1 are associated with 15 improved meat tenderness in Brahman cattle. In an embodiment haplotypes consisting of the CAPN3:C.53 T>G-G, CAPN3JK-G and CAPN3:C.2443-103G>C-G allele are associated with improved meat tenderness in Belmont Red Cattle. 20 In an embodiment the polymorphism and flanking sequence of comprises the nucleotide sequence set forth in any one of SEQ ID Nos: I to 3 and 5 to 15. According to yet another aspect of the present invention there is provided a method for selecting an 25 animal likely to yield meat of improved tenderness, comprising the steps of: (1) testing the animal for the presence of a genetic marker in CAPN3 associated with low peak-force or for a genetic marker located other than in 30 CAPN3 which shows allelic association therewith; and (2) selecting animals in said genetic marker is present. Advantageously, in order to assess the tenderness 35 of meat from an animal and/or to select an animal likely to yield meat with improved tenderness, testing may comprise the steps of: WO 2007/053891 PCT/AU2006/001667 -5 1) obtaining a biological sample from the animal; 2) extracting DNA from the sample; 3) amplifying DNA from CAPN3 and/or from 5 regions surrounding CAPN3 in order to amplify instances of genetic variation which show allelic association to polymorphisms at CAPN3; and 4) identifying the allele present in the amplified DNA. 10 In a still further aspect the invention provides an oligonucleotide probe for amplification of a genetic marker associated with low Warner-Bratzler peak-force, said genetic marker being either a polymorphism in the calpain3 (CAPN3) gene associated with Warner-Bratzler peak 15 force variation or for a genetic marker located other than in CAPN3 which shows allelic association therewith. In a still further aspect the present invention provides a kit for use in assessing the tenderness of meat from an animal and/or selecting an animal likely to yield 20 meat of improved tenderness, comprising oligonucleotide probes for amplification of at least one genetic marker for meat tenderness as described above. This specification contains nucleotide and amino acid sequence information prepared using PatentIn Version 25 3.3. Each nucleotide sequence is identified in the sequence listing by the numeric indicator <210> followed by the sequence identifier (e.g. <210>1, <210>2, <210>3, etc). The length and type of sequence (DNA, protein (PRT), etc), and source organism for each nucleotide 30 sequence, are indicated by information provided in the numeric indicator fields <211>, <212> and <213>, respectively. Nucleotide sequences referred to in the specification are defined by the term "SEQ ID NO:", followed by the sequence identifier (e.g., SEQ ID NO: 1 35 refers to the sequence in the sequence listing designated as <210>1 and the sequence information immediately follows the identifier <400>1). In the sequences the symbols Y, WO 2007/053891 PCT/AU2006/001667 -6 R, M, K, S and W have been used to indicate the polymorphism. Thus the symbol "M" represents an A/T polymorphism, and so on. The sequence flanking the polymorphism is derived from publicly available sequence 5 information. The present invention is not restricted to detection of the entire nucleotide sequence or in any way restricted to use of the entire nucleotide sequence. This information is presented to assist in the design of oligonucleotide premiers and probes, but the person 10 skilled in the art will recognise that such sequence may contain errors and will adjust their design accordingly. The designation of nucleotide residues referred to herein are those recommended by the IUPAC-IUB Biochemical Nomenclature Commission, wherein A represents 15 Adenine, C represents Cytosine, G represents Guanine, T represents Thymine, Y represents a pyrimidine residue, R presents a purine residue, M represents Adenine or Cytosine, K represents Guanine or Thymine, S represents Guanine or Cytosine, W represents Adenine or Thymine, H 20 represents a nucleotide other than Guanine, B represents a nucleotide other than Adenine, V represents a nucleotide other than Thymine, D represents a nucleotide other than Cytosine and N represents any nucleotide residue. Throughout this specification, unless 25 specifically states otherwise or the context requires otherwise, reference to a single step, composition of matter, group of steps or group of compositions of matter shall be taken to encompass one and a plurality (i.e. one or more) of those steps, compositions of matter, groups of 30 steps or group of compositions of matter. As used herein any range of numerals includes all within the range and the term "at least one" means one, two, three, four, etc. up to the possible maximum. Therefore a reference to one or more SNPs includes one SNP 35 or any number of SNPs from two to the total number of SNPs set forth herein. The SNPs set forth herein can be used alone or in any combination, therefore the invention WO 2007/053891 PCT/AU2006/001667 -7 envisages detection of any of the possible combinations of SNPs set forth herein. As used herein the term "cow' is used to refer to an individual animal without an intention to limit by 5 gender and should not be taken to do so unless it is necessary from the context to infer that a female animal is referred to. The term should also be taken to encompass a young animal of either gender. The present invention is not be limited in scope 10 by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein. 15 The present invention may be performed following the description herein without undue experimentation using, unless otherwise indicated, conventional techniques of molecular biology. Such procedures are described in various publications referred to throughout 20 the specification, and the content of each such publication is incorporated herein by reference. Throughout this specification and the claims, the words "comprise", "comprises" and "comprising" are used in a non-exclusive sense, except where the context 25 requires otherwise. It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any of these documents forms part of the common general 30 knowledge in the art, in Australia or in any other country. Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically 35 described. It is to be understood that the invention includes all such variations and compounds referred to or indicated in this specification, individually or WO 2007/053891 PCT/AU2006/001667 -8 collectively, and any and all combinations or any two or more of said steps or features. Detailed Description of the Invention 5 The methods of the invention allow for the management of bovine animals including selection of animals for breeding or cloning. The methods allow the identification of animals with favourable LDPF characteristics. 10 The principal commercial bovine animals are cattle, and there are many breeds of cattle. In an embodiment the cow is a breed (or cross) selected not exclusively from the group consisting of Angus, Ankole Watusi, Ayrshire, Bazadaise, Beefalo, Beefmaster, Belgian 15 Blue, Belmont Red, Blonde d'Aquitaine, Bonsmara, Braford, Brahman, Brahmousin, Brangus, Braunvieh, British White, American Brown Swiss, BueLingo, Charolais, Chianina, Corriente, American Devon, Dexters, Droughtmaster, Galloway, Gelbvieh, Guernsey, Hereford, Highland, 20 Holstein, Jersey, Limousin, Lowline, Maine-Anjou, Marchigiana, Milking Shorthorn, Montebeliarde, Murray Grey, Normande, Parthenaise, Piedmontese, Pinzgauer, Romagnola, Salers, Salorn, Santa Gertrudis, Shetland, Shorthorn, Simmental, South Devon, Tarentaise, Texas 25 Longhorn and Wagyu, most particularly Angus, Shorthorn, Hereford, Murray Grey, Brahman, Belmont Red and Santa Gertrudis. Single nucleotide polymorphisms are allelic variants that occur in a population where a single 30 nucleotide difference is present at a locus. The method of the invention can involve detection of one single nucleotide polymorphism or more than one single nucleotide polymorphism, and can involve detection of single nucleotide polymorphisms which form or are a part of a 35 haplotype which, as used herein, refers to groupings of two or more single nucleotide polymorphisms that are physically present in the same chromosome and tend to be WO 2007/053891 PCT/AU2006/001667 -9 inherited together except when recombination occurs. Methods for identifying haplotype alleles in nucleic acid samples are known to the person skilled in the art. This is from methods for haplotyping are described in WO 5 2005/040400, the contents of which are incorporated herein by reference. A preferred sample for performing the method of the invention is a readily accessible sample that comprises genomic DNA. For example, genetic testing of 10 cattle is often performed using a hair follicle, for example, isolated from the tail of an animal to be tested. Other examples of readily accessible samples include, for example, bodily fluids or an extract thereof or a fraction thereof. For example, a readily accessible 15 bodily fluid includes, for example, whole blood, saliva, semen or urine. In another embodiment, a biological sample comprises a cell or cell extract or mixture thereof derived from a tissue such as, for example, skin. 20 Preferably, a biological sample has been isolated or derived previously from a subject by, for example, surgery, or using a syringe or swab. Cell preparations or nucleic acid preparation derived from such tissues or cells are not to be excluded. 25 The sample can be prepared on a solid matrix for histological analyses, or alternatively, in a suitable solution such as, for example, an extraction buffer or suspension buffer, and the present invention clearly extends to the testing of biological solutions thus 30 prepared. Analysis of the sample may be carried out by a number of methods. The present invention has identified a number of SNPs associated with traits in bovine animals, and subsequently detecting the presence or absence of the 35 favourable allelic form of each SNP, or a plurality of these SNPs can be done using methods known in the art. Such methods may employ one or more oligonucleotide probes WO 2007/053891 PCT/AU2006/001667 - 10 or primers including, for example, an amplification primer pair that selectively hybridize to a target polynucleotide which comprises a part or all of the sequence set forth in any one of SEQ ID Nos:1 to 15. Oligonucleotide probes 5 useful in an embodiment of the invention comprise an oligonucleotide which is complementary to and spans a portion of the polynucleotide including the SNP in question. Therefore, the presence of a specific nucleotide at the position (i.e. one of the allelic forms 10 of the SNP) is detected by the ability or otherwise for the probe to hybridize. Such a method can further include contacting the target polynucleotide and hybridized oligonucleotide with an endonuclease and detecting the presence or absence of a cleavage product of the probe. 15 An oligonucleotide ligation assay also can be used to identify a nucleotide occurrence at a polymorphic position, wherein a pair of probes that selectively hybridize upstream and adjacent to and downstream and adjacent to the site of the SNP are prepared, and wherein 20 one of the probes includes a terminal nucleotide complementary to a nucleotide' occurrence of the SNP. Where the terminal nucleotide of the probe is complementary to the nucleotide occurrence, selective hybridization includes the terminal nucleotide such that, 25 in the presence of a ligase, the upstream and downstream oligonucleotides are ligated. As such, the presence or absence of a ligation product is indicative of the nucleotide occurrence at the SNP site. An oligonucleotide also can be useful as a 30 primer, for example, for a primer extension reaction, wherein the product (or absence of a product) of the extension reaction is indicative of the nucleotide occurrence. In addition, a primer pair useful for amplifying a portion of the target polynucleotide 35 including the SNP site can be useful, wherein the amplification product is examined to determine the nucleotide occurrence at the SNP site. Particularly WO 2007/053891 PCT/AU2006/001667 - 11 useful methods include those that are readily adaptable to a high throughput format, to a multiplex format, or to both. The primer extension or amplification product can be detected directly or indirectly and/or can be sequenced 5 using various methods known in the art. Amplification products which span a SNP loci can be sequenced using traditional sequence methodologies (e.g., the "dideoxy mediated chain termination method," also known as the "Sanger Method" (Sanger, F., et al. J. Molec. Biol. 94:441 10 (1975); Prober et al. Science 238:336-340 (1987)) and the "chemical degradation method," "also known as the "Maxam Gilbert method" (Maxam, A.M., et al. Proc. Natl, Acad. Si (U.S.A.) 74:560 (1977)), the contents of which are herein incorporated by reference to determine the 15 nucleotide occurrence at the SNP loci. As will be apparent to the person skilled in the art, the specific probe or primer used in an assay of the present invention will depend upon the assay format used. Methods of designing probes and/or primers for example, 20 PCR or hybridization are known in the art and described, for example, in Dieffenbach and Dveksler (Eds) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995) and more recently in P. -Y. Kwok (Ed) (In: Methods in Molecular Biology Vol 212 Human 25 Press, Totowa New Jersey, 2003). The various categories of polymorphism have been systematized and the various methods used to detect them have been thoroughly overviewed (Barendse and Fries 1999). In short, there are only two kinds of polymorphism, those due to changes of 30 DNA bases and those due to insertion and deletion of bases. Furthermore, the detection of these polymorphisms uses essentially the same technology and it is a rare technique that can be used for only one or the other of these kinds of polymorphism. Polymorphisms can also be 35 divided into those that are in or near a sequence that is transcribed into RNA (type I polymorphisms) and those that are in DNA that is never translated into RNA (type II WO 2007/053891 PCT/AU2006/001667 - 12 polymorphisms) . However, all of these polymorphisms can be detected using the same kinds of methods. The methods for detecting DNA polymorphisms revolve around 3 major aspects, not all of which are used in every detection 5 method, and some methods use techniques that are not one of these 3 major kinds. The point is that there are a large and ever increasing range of methods for detecting polymorphisms so it is not possible to be prescriptive about how the polymorphism should be detected, rather, it 10 is the DNA sequence which lends itself to one or the other method of detection. Most of these methods are highly dependent upon the polymerase chain reaction (PCR), although it is possible to detect sequence differences easily without using the PCR. The three technologies are 15 1) separation of DNA by size or by composition, 2) oligonucleotide hybridisation to recognise specific DNA sequences, and 3) DNA visualisation. The DNA separation may be performed on solid matrices but may be performed in liquid matrices. The recognition of DNA sequence is 20 usually performed by oligonucleotides of predefined sequence but may be performed enzymatically since some enzymes recognise specific DNA sequence motifs. DNA visualisation can be performed directly on the DNA which binds to some elements such as silver when it is visible 25 in ordinary light, it may fluoresce under ultra violet light when it is bound to some molecules such as ethidium bromide, or it may be visualised through autoradiography when radioactive nucleotides are incorporated into the sequence. More usually, the DNA is visualised when it is 30 bound to a DNA oligonucleotide which has a previously attached reporter molecule which may then be detected after laser excitation. Many methods depend on reporting the result of a specific reaction on the DNA, and may not even detect the DNA itself but remnants of the successful 35 detection. These descriptions are merely to indicate the wide range and the many possible permutations of DNA detection, and do not exclude methods that have not been WO 2007/053891 PCT/AU2006/001667 - 13 specifically referred to. Some of the methods that might be used to detect the polymorphisms are described below, but they are not the only possible methods. While the specific 5 hybridization of the probe or primer or other method for detecting variability to any nucleic acid can be predicted using well known rules, the probe or primer may not be unique if it is designed to bind to repetitive DNA sequence or to sequence common to members of a gene 10 family, and so precautionary screening of probes and primers should be performed using, for example, BLAST against the cow and other genomes. In many cases this will not be sufficient and the adequacy of probes or primers may need to be confirmed empirically using methods known 15 in the art. This same proviso will apply to all methods of detecting DNA that uses short probes and primers as would be appreciated by anyone skilled in the art. The following is a list of some of the more useful current high throughput methods of detecting 20 polymorphisms in cattle, but these should not be taken as an exhaustive list or be used to exclude new methods yet to be developed where they are essentially being used to identify the underlying DNA sequence. In that regard, if the DNA sequence has been transcribed to RNA and the RNA 25 is tested for variation, or if the RNA has been translated to protein and the protein is tested for variation, these RNA and protein detection methods will also be methods of detecting the underlying DNA sequence. As indicated above, sometimes the detection method reports the result of a 30 successful reaction without directly detecting the DNA molecule, and obviously this would apply for RNA and protein as well. Some of the useful DNA based methods of detecting polymorphisms are the Taqman assay (LIvAK 2003), which uses 35 competitive hybridisation of probes specific for the alternative DNA sequences and where a successful reaction is detected through the liberation of a reporter dye, the WO 2007/053891 PCT/AU2006/001667 - 14 SNPlex assay (Applied Biosystems Incorporated, Foster City, CA) which uses the oligonucleotide ligation assay and where a successful reaction is reported via Zipchute probes that are separated on a capillary DNA sequencer, 5 high throughput molecular inversion probes associated with generic microarray technologies (HARDENBOL et al. 2003; HARDENBOL et al. 2005), the MASSextend (STORM et al. 2002) or generic primer extension technologies (CHEN et al. 1997) which use mass spectrometry or laser fluorescence of the 10 probe modified by an enzyme reaction respectively. The present invention also relates to kits which can be used in the above described methods. Such kits typically contain an oligonucleotide probe, primer, or primer pair, or combinations thereof, depending upon the 15 method to be employed. Such oligonucleotides are useful, for example, to identify a SNP as set forth herein. In addition, the kit may contain a control comprising oligonucleotides corresponding to the nucleotide sequence of the non-desired allelic form. In addition, the kit may 20 contain reagents for performing a method of the invention such as buffers, detectable labels, one or more polymerases, which can be useful for a method that includes a primer extension or amplification procedure, and are nucleases for digesting hybridization products or 25 a ligase which can be useful for performing an oligonucleotide ligation assay. The primers or probes can be included in the kit in labelled form. The kit may also include instructions for use. As well as management of the individual animal, 30 the present invention allows for selection of animals for breeding programs. Thus a herd may be developed with desirable LDPF characteristics so as to have enhanced longissimus dorsi peak force. The method involves selecting animals with desirable characteristics and using 35 them in a breeding program. The progeny of the mating of selected parents are likely to exhibit the trait, thus creating a line of animals with specific characteristics.
WO 2007/053891 PCT/AU2006/001667 - 15 The progeny can then be used to breed and so on in order to continue the line, which may be monitored for purity using the original SNP markers. Furthermore, the method of the invention allows 5 for in vitro methods of producing animals. In general terms the method involves identification of one or more SNPs as set forth in SEQ ID Nos: 1 to 15 in a bovine animal, isolating a progenitor cell from the animal and generating an animal from the progenitor cell. Methods of 10 cloning bovine animals are well known to the person skilled in the art. For methods involved in cloning of cattle known methods may be used directly. As set forth, for example, in S.M. Willadsen "Cloning of sheep and cow embryos" Genome 31:956 (1989), the contents of which are 15 incorporated herein by reference. In an embodiment, following development of an embryo, one or more cells is/are isolated therefrom and screened as described above. An embryo having or likely to have possess the desired trait is then selected and 20 implanted into a suitable recipient. In this manner, animals having or likely to have improved meat tenderness are produced. In an embodiment the selected animals are used to produce offspring using in vitro fertilization. In this 25 process, ova are harvested from a cow comprising one or more SNP of the invention by, for example, transvaginal ovum pick-up (OPU) or by laparoscopic aspiration. The recovered ovum is then matured prior to fertilization. Zygotes are then cultured for a time and under conditions 30 suitable for embryo development. For example, zygotes are cultured in a ligated oviduct of a temporary recipient (sheep or rabbit). Alternatively, zygotes are co-cultured in vitro with somatic cells (e.g., oviduct epithelial cells, granulosa cells, etc) in a defined medium. 35 Alternatively, zygotes are cultured in vitro in a simple medium such as synthetic oviductal fluid without any somatic cell support.
WO 2007/053891 PCT/AU2006/001667 - 16 The method is amenable to screening embryos produced using any assisted breeding technology and/or for screening embryos produced using an ovum and/or sperm from an animal that has not been screened using the method of 5 the invention. Modes for Performing the Invention A gene for beef tenderness was located to bovine chromosome 10 in the CBX experiment in the period 1996 10 1999. One sire, CBX 7, shows suggestive evidence for a QTL affecting LD compression (lod = 2.27), the peak located between the DNA markers CSRM60 and DIK20 (Hetzel and Davis, 1999). This region of bovine chromosome 10 is now known to include genes from Human chromosome 15. An 15 examination of human chromosome 15 revealed the presence of the CAPN3 gene, which has also been mapped to bovine chromosome 10 (Nonneman and Koohmaraie 1999). Since this gene has become implicated in meat tenderness in studies in sheep (Ilian et al., 2001, 2004), it was selected as 20 the primary positional candidate for the effect. SNP were sought in the gene and were tested for effects on meat tenderness on a diverse range of cattle. A statistically significant effect of genetic substitution at the CAPN3 gene was found on peak force measurements of the LD 25 (longissimus dorsi) muscle. Cattle were chosen from the CRC DNA Bank to have as diverse a genetic and phenotypic background as possible. Information stored in the CRC Database was used to select animals. Animals of extremes of peak-force were 30 selected, although animals with peak-force measures above 12 were excluded since they might have confounded peak force measurements. In essence, the procedure was to select cattle in each cohort which were of phenotypic extreme measures, to ensure that no sire was represented 35 by a cluster of offspring, that all markets and finishing regimes were included in each extreme, so that extremes were not biased by being representative of a particular WO 2007/053891 PCT/AU2006/001667 - 17 market or finishing regime. A total of 246 samples were obtained, and were the combined samples used in the CAST experiments (Barendse, 2001 W002064820, PCT/AUO2/00122) (Tables 1 and 2 combined). 5 Example 1 These DNA samples were genotyped for the CAPN3X3 G266C (Calpain 3 intron 24 and 3'UTR G->C base 266 ) DNA fragment. This polymorphism was obtained by sequencing a 10 panel of 12 animals including 2 of zebu ancestry for a PCR fragment including intron 24 and the 3'UTR (untranslated region) using the following primers: CAPN3X3U1 GGACGGTATCATCAAACTCAATG (SEQ ID NO:14) 15 CAPN3X3D1 AGACTCCAAGCAAAGCTCTCACT (SEQ ID NO:15) A SNP was discovered in this fragment at base 266 as per the following DNA sequence: >CAPN3X3|BtajContig1 good seq 17-678 snp 1 zebu opp hom g266c 20 TTTTTGGGAAAAACATCAAACTCAATGTTCTCGAGGTAAAGCCTAACAGT ACACTCCCCCCGCACTTTAAAATTTGAGGTGGAGGGATGGGATTGGATGG GATGGGAAAGGAACATAAAGGGAAGCTCAGAGCTCAGCAGGATGTGGTCA TGGGGAACGCATAGTGGGGGAAGGCTCTAAGGAAGCCTCAGTTATGGCTT TATGCTGGAAAATCTGTACTTTCTAGGGGAGATCTGTGGGAAGGATGCTT 25 CTCAGGAAATCTTCCgTGTCTGGCATGCTGGGACTGGCCTTTTCTTCTAC GTTTTAGATATGTAGGGCTTGGCTCTTTTGTCTCATTGTGCATTCTGATC TTGGGACTTCCTCTTGCAGTGGCTGCAGCTCACCATGTATGCCTGAACCA AGCTGGCCACATCGAAGGCATGGAGGATCACTCAGGATTTCAATTTCACC CAACAGAGCTAGTCACTTACCTCAAAGGACACAGTTGCTGCACCCCCAGG 30 AAGCCTCCAGGCACCTCATCAGTCTAGTTCCTCCTCTACTCACTTCCCTC CCAGCCTTAGGGCATCTGTCCATTTGTCAGGCCCAGCCTGACCCTTCAGT TAAGGAATGGGGAAGGGAGAGCTGTGTTGTCCCTGTGCCACATGGAGCCA AGTGCCTCTGTCTGCTTCCGCTAGCCACGACTACATTTA (SEQ ID NO:1) This SNP was assayed using the following pair of 35 Taqman probes: CAPN3X3 -266G 6FAM-CTTCCGTGTCTGGC (SEQ ID NO:16) WO 2007/053891 PCT/AU2006/001667 - 18 CAPN3X3-266C VIC-TCTTCCCTGTCTGGC (SEQ ID NO:17) PCR primers to amplify the region around the SNP consist of combinations of the following up and down 5 primers: CAPN3X3G266CU2 AGCCTCAGTTATGGCTTTATGC (SEQ ID NO:18) CAPN3X3G266CD1 AGATCAGAATGCACAATGAGACA (SEQ ID NO:19) 10 The PCR occurred in 10 pL, contained 50 ng DNA, 0. 2 pM per probe and 0. 9 pM per primer, in ABI Taqman Universal PCR Mastermix, for 40 cycles, annealing/extension at 60 C for 60 seconds, using an ABI 7900HT. 15 The genotypes were analysed using generalised linear models (GLM) following the equation peakforce = 1 + fixed + random effects + genotypes + error implemented via the S-PLUS software. Fixed effects that were considered were breed, market (Domestic, Korea, Japan), cohort, 20 finish (pasture v grain, north v south) and the random effect of sire. Some models did not include sire, since the samples were chosen to have as few animals per sire as possible. The size of the effects associated with genotype was estimated by the comparison of the sum of squares of 25 Analysis of Variance models with and without the marker genotypes. Plots of raw peakforce values against Calpain 3 genotypes were constructed. The full data set shows a statistically significant association between genotype and LD peak force 30 when sire is included in the model. Neither sire nor breed of origin was statistically significant consistent with the scheme of sampling across a wide range of breeds and sires and using animals of extreme phenotype as can be seen the following table. 35 WO 2007/053891 PCT/AU2006/001667 - 19 Table 1 Analysis of Deviance Table (CAPN3 for all breeds including sire as a random variable) Gaussian model 5 Response: ldpf Terms added sequentially (first to last) Df Deviance Resid. Df Resid. Dev F Value Pr(F) NULL 241 1135.673 10 market 2 114.7534 239 1020.919 21.92078 0.0000000 cohort 26 353.6020 213 667.317 5.19591 0.0000000 finish 3 67.5197 210 599.798 8.59863 0.0000659 breed 4 9.2969 206 590.501 0.88797 0.4760605 sireid 137 396.8467 69 193.654 1.10668 0.3254380 15 genotype 2 18.2843 67 175.370 3.49276 0.0360653 A similar association was found when the effect of sire was excluded from the analysis as can be seen in the following table. 20 WO 2007/053891 PCT/AU2006/001667 - 20 Table 2 Analysis of Deviance Table Gaussian model Response: ldpf 5 Terms added sequentially (first to last) Df Deviance Resid. Df Resid. Dev F Value Pr(F) NULL 241 1135.673 market 2 114.7534 239 1020..919 20.63407 0.0000000 cohort 26 353.6020 213 667.317 4.89092 0.0000000 10 finish 3 67.5197 210 599.798 8.09391 0.0000404 breed 4 9.2969 206 590.501 0.83584 0.5038044 genotype 2 23.2422 204 567.258 4.17924 0.0166409 The average deviation for the cc genotype is +0.96 kg PF, for the cg genotype is +0.024 kg PF and for 15 the gg genotype is -0.98 kg PF. However, the frequency of the c allele is extremely low in the taurine breeds and so the analysis was redone using only the Brahman, Belmont Red and Santa Gertrudis animals. Allele frequencies are shown below.
WO 2007/053891 PCT/AU2006/001667 - 21 Table 3 Breed cc cg gg p(c) Angus 0 1 43 0.01 Brahman 1 9 33 0.13 5 Belmont Red 1 10 26 0.16 Hereford 0 0 39 0.00 Santa Gertrudis 0 7 30 0.10 Shorthorn 0 0 42 0.00 10 Again, there is a statistically significant association between genotype and meat tenderness.
WO 2007/053891 PCT/AU2006/001667 - 22 Table 4 Analysis of Deviance Table Gaussian model Response: ldpf 5 Terms added sequentially (first to last) Df Deviance Resid. Df Resid. Dev F Value Pr(F) NULL 116 503.4443 market 2 34.6401 114 468.8042 6.828450 0.0017177 cohort 16 180.6520 98 288.1522 4.451392 0.0000020 10 finish 2 27.7125 96 260.4398 5.462838 0.0057299 breed 2 7.6218 94 252.8180 1.502455 0.2279932 genotype 2 19.4642 92 233.3537 3.836900 0.0250907 The average deviation for the cc genotype is +0.84 kg PF, for the cg genotype is +0.062 kg PF and for 15 the gg genotype is -0.90 kg PF. A similar result is found when sire is included in the model as seen below but then the size of effect expands to a massive average deviation for the cc genotype of +2.84 kg PF, for the cg genotype of -0.91 kg PF and for the gg genotype of -1.93 kg PF. These 20 values are probably too large and are probably not accurately estimated.
WO 2007/053891 PCT/AU2006/001667 - 23 Table 5 Analysis of Deviance Table Gaussian model Response: ldpf 5 Terms added sequentially (first to last) Df Deviance Resid. Df Resid. Dev F Value Pr(F) NULL 116 503.4443 market 2 34.6401 114 468.8042 8.418921 0.0013715 cohort 16 180.6520 98 288.1522 5.488204 0.0000456 10 finish 2 27.7125 96 260.4398 6.735234 0.0040914 breed 2 7.6218 94 252.8180 1.852404 0.1755742 sireid 64 178.7883 30 74.0296 1.357896 0.1874672 genotype 2 16.4259 28 57.6037 3.992150 0.0298284 WO 2007/053891 PCT/AU2006/001667 - 24 Table 6. Characteristics of the first Cattle Sample Total: 169 83 high peak force 5 86 low peak force Breeds: 29 Santa Gertrudis 25 Hereford 26 Angus 27 Belmont Red 10 31 Brahman 31 Shorthorn Regions: 38 Pasture South 28 Pasture North 57 Grain South 15 41 Grain North Markets: 72 Korean 67 Domestic 25 Japanese Cohorts: 27 Cohorts 20 Median: 5 steers per cohort bottom quartile: 2 steers per cohort top quartile: 9 steers per cohort Sires: 112 sires Median: 1 steer per sire 25 bottom quartile: 1 steer per sire top quartile: 2 steers per sire WO 2007/053891 PCT/AU2006/001667 - 25 Table 7. Characteristics of the second sample of 77 animals Total: 77 5 39 high peak force 38 low peak force Breeds: 11 Belmont Red 11 Hereford 13 Brahman 10 13 Shorthorn 14 Santa Gertrudis 15 Angus Regions: 24 Pasture South 12 Pasture North 15 21 Grain South 20 Grain North Markets: 35 Korean 25 Domestic 17 Japanese 20 Cohorts: 22 Cohorts Median: 3 steers per cohort bottom quartile: 2 steers per cohort top quartile: 5 steers per cohort Sires: 64 sires 25 Median: 1 animal per sire bottom quartile: 1 animal per sire top quartile: animal per sire WO 2007/053891 PCT/AU2006/001667 - 26 Example 2 The initial associations between CAPN3X3 to meat tenderness were found using a sample of animals of extremes of tenderness. To explore the association 5 further, to measure the effect of allele substitution at the gene, and to determine the breed differences that might be found, additional polymorphisms in the gene were identified, including one affecting the amino acid sequence, and genotyped on more than 2,000 animals of 10 Brahman, Belmont Red and Santa Gertrudis ancestry from the Beef CRC 1 progeny tests DNA bank and database. Animals of pure Taurine ancestry were not examined further since the allele frequencies of all of the SNP are extremely low in purebred Taurine animals. 15 Two additional SNP were identified and genotyped in addition to CAPN3X3. These are CAPN3E6, a mutation in exon 6, and CAPN3JK, a SNP detected in a fragment containing the 10t and 1lt introns. The DNA sequences associated with these SNP are contained in Table 8. These 20 sequences were used to generate Tagman assays and the primers and probes for these are contained in Table 9. The method of determining whether a measured allele or genotype has an increased value compared to others at that locus or more broadly within the gene or genetic region 25 would be familiar to practitioners of the art but will be described briefly. In essence we partition the variance associated with the trait into that due to the Mendelian component associated with the locus under discussion as well as a polygenic component due to shared family. 30 Before this is done, the trait values must be adjusted for fixed environmental and genetic effects, for covariates, and for random genetic effects such as the sire or dam. This is usually performed using a General Linear Mixed Model. Then the genotypes can be compared using a t test 35 or a one-way analysis of variance, and the statistical significance can be assessed using permutation tests, particularly where the trait distribution is non-normal.
WO 2007/053891 PCT/AU2006/001667 - 27 The average effect of allele substitution at the locus is derived from the allele frequency, the difference between homozygotes and the degree of dominance, where a = a[l + k(p - (1-p)] where a is half the difference between 5 homozygotes, p is the allele frequency and k is d/a where d is the difference between the heterozygote and half the distance between the homozygotes. Good starting points for further information on this process are Boerwinkle et al. 1986 Ann. Hum. Genet. 50, 181-194 and Lynch and Walsh, 10 1997 (Sinauer Associates). The residual LDPF data were obtained using ASREML using the model: ldpf - mu herd kill_group stimcode age cwt ! sireid in which sireid is a random effect, herd is the 15 herd within breed, kill_group incorporates cohort, finish and market, stimcode is a fixed effect recording the amount of electrical stimulation to the carcass, while age and carcass weight are covariates which affect tenderness. The association of an allele or genotype with 20 increased value will often apply across breeds and families within breeds. However, a particular allele or genotype may not always be associated with increased value across breeds, in one breed the allele or genotype might be associated with increased value but in another breed it 25 might be associated with decreased value or not be associated with differences in value. The results presented here show both the associations aggregated across the breeds, which represents the alleles or genotypes that will be associated with increased value for 30 most breeds, as well as the associations specifically within breeds. Since the values have been adjusted for the breeds, the associations can be pooled across breeds, and differences in allele frequency in the breeds will not cause the generation of spurious associations due to 35 Simpsons Paradox. However, mixing a breed in which one allele is associated with higher meat tenderness with another breed that has a different allele associated with WO 2007/053891 PCT/AU2006/001667 - 28 higher meat tenderness will tend to reduce the size of the effect. This should give an indication where in the gene the causal mutation is likely to be (see below). We have reported the results for both breeds 5 combined and breeds separated. Firstly, the aggregated statistics give more realistic values of the size of effect because they are based on larger numbers, and secondly, that there are many more breeds in existence than we have access to so it is important to obtain the 10 general association between the allele or the genotype and the trait, which will have applicability in most or all breeds. Clearly, the person skilled in the art will know that some breeds may have different associations between the allele or genotype and the trait due to one of several 15 real biological causes. The first and probably most common is that the measured allele or genotype is not causative, so it is in linkage disequilibrium with the causative allele or genotype. There will be cases where the allele or genotype being measured is in opposite 20 genetic phase to the causative allele or genotype, and this might be reflected in some breed differences. The second is that there may be more than one causative mutation in the gene, with different frequencies in different breeds, hence the measured allele or genotype 25 may show different predictive efficiencies in different breeds and show opposite genetic phase relationships due to complex associations between the measured allele or genotype and the different causative mutations. The third is that a causative mutation in a gene may be affected by 30 genes elsewhere in the genome. These epistatic or background effects have been known for decades, and some of these may have an impact upon the association between the measured allele or genotype and the trait value. In the associations between CAPN3 and meat 35 tenderness (Table 10), that the CAPN3JK SNP has the largest effect of allele substitution, the only one below the P < 0.05 level in the combined data, and the only one WO 2007/053891 PCT/AU2006/001667 - 29 in which those breeds that have statistically significant associations to LDPF have the same allele associated with improved tenderness. When we explore this further, we see that all SNP have statistical associations between the 5 Brahman and Belmont Red breed, but none have associations in the Santa Gertrudis breed. Moreover, the association in the CAPN3JK SNP shows the same allele having effects on increasing meat tenderness, while for the CAPN3E6 and CAPN3X3 SNP, the Brahman and Belmont Red have 10 contradictory associations for those SNP, which effectively cancels out the effect of the gene. The association in Santa Gertrudis is not statistically significant in these data so the preferred allele for meat tenderness is irrelevant. The CAPN3JK SNP appears thus to 15 show consistent associations in those breeds in which it has statistically significant associations, where the G allele is associated with improved tenderness. Further SNP near CAPN3JK would be expected to be causal and genotypes at the causal SNP could be predicted using 20 haplotypes. Since all SNP show associations to meat tenderness in Brahman and Belmont Red animals, haplotypes between these DNA markers might improve prediction since they would encompass the region of the gene that appears 25 to contain the causal mutations. Given the direction of associations in Table 8, for the Brahman for example, haplotypes consisting of the CAPN3E6-T, CAPN3JK-G and CAPN3X3-C allele should improve meat tenderness while in the Belmont Red for example, haplotypes consisting of the 30 CAPN3E6-G, CAPN3JK-G and CAPN3X3-G allele should improve meat tenderness. These data have been compared to the Calpastatin (CAST) genotypes (Barendse, W. 2001. DNA markers for meat tenderness. Patent W002064820 (Patent Application 35 PCT/AU02/00122) for these same animals. We see that the overall size of effect of the CAPN3JK genotypes is very similar to that of CAST.
WO 2007/053891 PCT/AU2006/001667 - 30 Table 8. DNA sequence information for CAPN3 SNP >CAPN3E6IBta I exon6 (2nd AA coding exon) AA 34, bp 100 gloot 5 ATGCCGACCGTCATTAGCGCCTCTGTGGCCCCACGGACAGGGG CTGAGCCCA [g/t] GTCCCCAGGGCCCATCGCCCAGGCAGCCCAGGACAAGGGC ACCGAGGCAGGGGGTGGAAACCCAAGTGGCATCTACTCAGCCATCATCAG CCGCAATTTTCCCATTATTGGGGTGAAAGAGAAGACATTCGAGCAGCTTC ACAAGAAATGTCTGGAAAAGAAGGTTCTTTTTGTGGATCCTGAGTTCCCA 10 CCGGACGAGACCTCCCTGTTTTACAGCCAGAAGTTCCCCATCCAGTTCGT CTGGAAGAGaCCTCCG (SEQ ID NO:1) >CAPN3JKlBtalContig1 good bp15-1182, snp zebu opp hom, 1 taur het bp g642t 15 TATATAAAAACGGAGAGGACGGAGCTGGGGGCTAACCTCTTCACCATCGG TTTCGCCATCTACGAGGTGTGCCGTCCCTGACGAGCTTCAGACCGCCTCT TTAGGGAAGAGGCTTTCAGGGGGCTTCCTGAGGGGTTCCCCAGTTTCCCC AACATCCAGTGCCCCCCAAAACTACTGATATCAGGCCCACTTGAGTCAGA ACCTCTTAGAAGTTTGTAACCAGTGGGGGAAGAACCCACCTAGGGGAGGT 20 GGGGGTGGGGCTGGGGCTGTCCAGGTAGGTACATGGGGCATTAGAGCCCC TCATTCGCTCTACGATTGCTAGCATGCCCTTTGGCAAGTTTCCATCCCGA TTAAGACCTGAAATCCACAAAAATCTGAGCACCTTCCTTTTCTGTTTCTC CCCAAGGTTCCCAAAGAGGTATAGAAGTGGAGCAGCCAGCAGTGTGTGCA GCGTTACCAGGGTCCTGGGTCCGCCTGGGGCACATCAGGGCACCTCCTGT 25 GGGGTTTGGGGGCAGGACTGTGATAGGAGAGGGCCTGGCCCACCTTACCT AACTCCAGAGCAGGTCCTCGGGCCATTGCATGGCCTCCTGACCCCCACCC CACAACATGCCCTTCCCCTTGCCCACCAGAGACCATTACAC [g/t] CTCACATG CTTGCTCACACTCACACACAGAATCACACAGACACATTGTGAGGCTGATC GCCTTCTTTGGGGGTGGAGGAATCACCTCCCTCAGACCCAGTCCACAACC 30 CCCACCCCTGCCTCCCTGGGGTCTTTCCCCAGTCCAGAGGTGTTCTGGAG CTGAGCAGCAGCAATTCTGGTAAGTGACCCTGAGTGGGGGATGCCAGACT TGACCTTCACTTCTGGATCACAGCAGAAAAGGAAGAGGATATGGGGTAGG GAGCTCCAGGGATGTTGAGCTATTCGAGGCCTTGGGAATTGGAAGCTGGT AGGTTGTGACTATGAAATGAGTGACCAGGGAGTTGGGAAGGAGGACCCCT 35 CTGGAGGAGGACTGTGAGCAGGACAGGGTGTCCCTCCCAAGGGGCTGAGG TACCTTGGGCTCTTCTCTCCCTTAGATGCACGGCAACAAGCAGCACCTGC AGAAGGACTTCTTCCTGTACAATGCCTCCAAGGCTAGGAGCAGCCCCTAC ATCAACATGCGGGAGGTGTCTGAGCGCTTCCGCCTGCTACACCAATATTA A (SEQ ID NO:2) 40 >CAPN3X3|BtajContig1 good seq 17-678 snp 1 zebu opp hom g266c TTTTTGGGAAAAACATCAAACTCAATGTTCTCGAGGTAAAGCCTAACAGT ACACTCCCCCCGCACTTTAAAATTTGAGGTGGAGGGATGGGATTGGATGG 45 GATGGGAAAGGAACATAAAGGGAAGCTCAGAGCTCAGCAGGATGTGGTCA TGGGGAACGCATAGTGGGGGAAGGCTCTAAGGAAGCCTCAGTTATGGCTT TATGCTGGAAAATCTGTACTTTCTAGGGGAGATCTGTGGGAAGGATGCTT CTCAGGAAATCTTCC [c /g] TGTCTGGCATGCTGGGACTGGCCTTTTCTTCTAC
GTTTTAGATATGTAGGGCTTGGCTCTTTTGTCTCATTGTGCATTCTGATC
WO 2007/053891 PCT/AU2006/001667 - 31 TTGGGACTTCCTCTTGCAGTGGCTGCAGCTCACCATGTATGCCTGAACCA AGCTGGCCACATCGAAGGCATGGAGGATCACTCAGGATTTCAATTTCACC CAACAGAGCTAGTCACTTACCTCAAAGGACACAGTTGCTGCACCCCCAGG AAGCCTCCAGGCACCTCATCAGTCTAGTTCCTCCTCTACTCACTTCCCTC 5 CCAGCCTTAGGGCATCTGTCCATTTGTCAGGCCCAGCCTGACCCTTCAGT TAAGGAATGGGGAAGGGAGAGCTGTGTTGTCCCTGTGCCACATGGAGCCA AGTGCCTCTGTCTGCTTCCGCTAGCCACGACTACATTTA (SEQ ID NO:3) WO 2007/053891 PCT/AU2006/001667 - 32 Table 9. The Tagman Probes and Primers for CAPN3 CAPN3E6 (exon6) CAPN3E6100T 6FAM-TGAGCCCATGTCC (SEQ ID NO:20) 5 CAPN3E6100G VIC-TGAGCCCAGGTCC (SEQ ID NO:21) CAPN3E6G100TU1 ATGCCGACCGTCATTAGC (SEQ ID NO:22) CAPN3E6G100TD1 GAGTAGATGCCACTTGGGTTTC (SEQ ID NO:23) CAPN3JK ( 1 0th/ 1 lth introns) 10 CAPN3JK-V2-642G VIC-TACACGCTCACATGC (SEQ ID NO:24) CAPN3JK-V2-642T 6FAM-ACACTCTCACATGCT (SEQ ID NO:25) CAPN3JKG642TU2 ATTGCATGGCCTCCTGAC (SEQ ID NO:26) CAPN3JKG642TD2 CTCCAGAACACCTCTGGACTG (SEQ ID NO:27) 15 CAPN3X3 (including the 3'UTR) CAPN3X3-266G 6FAM-CTTCCGTGTCTGGC (SEQ ID NO:16) CAPN3X3-266C VIC-TCTTCCCTGTCTGGC (SEQ ID NO:17) CAPN3X3G266CU2 AGCCTCAGTTATGGCTTTATGC (SEQ ID NO:18) 1'CAPN3X3G266CD1 AGATCAGAATGCACAATGAGACA (SEQ ID NO:19) 20 WO 2007/053891 PCT/AU2006/001667 -33 (dk 0 m :> 0 ") - rai U 0)d a)i r! 0 m ol4 43 a)L-L-L vv I ODi o 0%~ w0) m 000H 44H O0O,4 0o o 000i 000m 00 0 (D H'r0 WiH .W~ .rOh o Ir e 0 ( to 43 EU H q o cq-H0 io 1 C4 4r4H qr4 14 Cq C
)
d eHHIN HQ H%) oinn 4 o .. 0 0 - 0 .0 00 * 0~. HO0Hr ir a 0 mor 0 fn 4c m o 000 Ar 3 (d a)0 %i-I na C4 ~ or 0 0) r :>. 40 0 ,r C ; V C4 C 4 4in. C; ( ro4 0 I C w4 WDa~'- M 0 to 000 Ln u1OD r-i CD H).E 0)dW 0- in Lfl CDvH H(qH 0 0 r q0 Hl 00 15 0~r .I~' 0H HC ( 44 (d 0, '1 V' .4) 'V ~- o * E 0 H U 3 .- M ~ 004 - 0H 00 C1 0.0L mr q i v0 F4i E H -H V)E (d-l O~ 0 ; ;C;C C ; ;0; C ;51 O C;l C; C;d)0 0 00)D0) cl 43V d EU ODr 01o too' C%0 Cqo 0w %0 DHr 434 V30) 4 0 (D oo(h - H m m W ~OD H to %D' U0 ajv' 0O 00 040 00 0 m ~~C ODO a 0- I 0 00 00OD0 0 00 000 k) W m 0-0 0. rC * . 0 r- H 000t010 00 03 H II ; C;C ; C ; ; C ;C mnnf inU pnW ininO Cl qw 0 0) A 0001 0 00 000 000E C 1flo -Hto 0 00 - 00 000 0.0 000 rdM I OH ( 0 000 m -I -a 0 00 HHH OHH 4J j () . . ... .* . V 4 .) 0 eq 0 '9 C
A
4 0H 4 0 IU 000 I11 .00 0 i H 44 ~ ~ 00cqr 00 .1100 0c too o m O 000 4 0 M 0 43 10 0r~c 0ri 0 mH - 00 rI c.r- r 00)0) -IO( ( 0)i H (di i 4)- 0)4 * E.W10 C~ 0n m wr~ 0))4 ;> ~ I-le-r(i0 0 -0 -0)000) iritr aI4 rI '' m M4 14. E)P 1 P4 o ii~ Paam (Aa m( m 3b 0 Um m.10) (DVC mVC m11 001M)mm Susitt Sheet I I I I Ru 26
MRW/AU
WO 2007/053891 PCT/AU2006/001667 - 34 Example 3 We sequenced the coding sequence of the CAPN3 gene in a range of animals of divergent breeds from mRNA of taurine and zebu cattle using ABI Big-Dye terminator 5 chemistry on a 377 ABI DNA sequencer following the manufacturer's instructions (ABI, Foster City, CA). The consensus sequence is contained in Table 11. The CAPN3E6 SNP is at bp260.
WO 2007/053891 PCT/AU2006/001667 - 35 Table 11. Additional single nucleotide polymorphisms in the CAPN3 coding sequence. >CAPN3|Bta contig2 good seq bp 14-3051, start bp 209, 1st 5 stop bp 2675, coding SNP opp hom bp 260 ccca[gt]gtcc R->M, bp 510 2 het agag[ag]cctc, bp 759 opp hom caac[ct]taca, bp 2089 4 het agac[aglacac N->D, bp 2235 1 het agaa[ctlgtcc, bp 2289 opp hom tcac~ag]ctgg, bp 2313 opp hom tgat[ctlgctc, bp 2330 3 het acag[atltggc D->V, bp 2340 3 10 het ctgg[aglagac, bp 2547 1 good het actt[ctlgaca TCCAGGAAAAAATGATGGCTTCCGGACCACAGCTCAGTTTTTAAGCTGGA CGACCTTCTGATGGGTTTTAAACTTCGAATTGGATGTGGACATTTTTCTT TCTGATGACAGAATCACTGGAACTTCCCCTTTGCAGTTGCTTCCTTTCCT TAAAGGTAGCTGAATCTTGCTGTCTTTAAAAACCTTTTCTTTCCAAATTT 15 GCCTGCCATGCCGACCGTCATTAGCGCCTCTGTGGCCCCACGGACAGGGG CTGAGCCCAtGTCCCCAGGGCCCATCGCCCAGGCAGCCCAGGACAAGGGC ACCGAGGCAGGGGGTGGAAACCCAAGTGGCATCTACTCAGCCATCATCAG CCGCAATTTTCCCATTATTGGGGTGAAAGAGAAGACATTCGAGCAGCTTC ACAAGAAATGTCTGGAAAAGAAGGTTCTTTTTGTGGATCCTGAGTTCCCA 20 CCGGACGAGACCTCCCTGTTTTACAGCCAGAAGTTCCCCATCCAGTTCGT CTGGAAGAGaCCTCCGGAAATTTGTGAGAATCCCCGATTTATCGTTGGTG GAGCCAATAGAACTGACATCTGCCAAGGAGATCTAGGGGACTGCTGGTTT CTTGCAGCCATCGCTTGCCTGACCTTGAACAAGCGTCTGCTTTTCCGGGT CATACCCCATGATCAGAGTTTCACCGAAAACTACGCGGGGATTTTTCACT 25 TCCAGTTCTGGCGCTATGGAGACTGGGTGGACGTGGTTATTGATGACTGC CTGCCAACcTACAACAATCAACTGGTTTTCACCAAATCCAACCATCGCAA TGAGTTCTGGAGTGCTCTGCTGGAGAAGGCTTATGCTAAGCTCCATGGTT CGTATGAAGCCCTGAAAGGTGGGAACACTACAGAGGCCATGGAGGACTTC ACGGGAGGAGTGACAGAGTTTTTTGAAATCAAGGATGCTCCCAGAGACAT 30 GTACAAGATCATGAAGAAAGCCATCGAGAGGGGTTCCCTCATGGGCTGCT CCATTGATGATGGCACAAACATGACCTATGGAACCTCTCCTTCTGGGCTG AAAATGGGGGAGTTGATTGAGCGGATGGTGAGGAATATGGATAACTCGCG GCTCAGGGACTCAGACCTCATCCCTGAGGGATGCTCAGATGACAGACCAA CTCGGATGATTGTTCCAGTTCAGTTTGAGACAAGAATGGCCTGTGGGCTG 35 GTCAAAGGCCATGCCTACTCAGTCACTGGGCTGGAGGAGGCCCTGTACAA GGGTGAGAAAGTGAAGCTGGTGCGGCTGCGGAACCCCTGGGGCCAGGTGG AGTGGAATGGCTCCTGGAGTGACAGCTGGAAGGACTGGAGCTATGTGGAC AAGGACGAGAAGGCCCGTTTGCAGCACCAGGTCACTGAGGATGGAGAGTT CTGGATGTCCTACGATGATTTTATCTACCATTTCACAAAGCTGGAGATCT 40 GCAACCTCACAGCTGATGCCCTGGAGTCCGACAAGCTTCAGACTTGGACA GTGTCCGTGAATGAGGGCCGCTGGGTGAGGGGCTGCTCTGCCGGAGGCTG CCGCAACTTCCCAGACACTTTCTGGACCAACCCACAGTACCGTCTGAAGC TCCTAGAGGAGGACGACGACCCCGATGATTCCGAGGTGATCTGTAGTTTC CTGGTGGCTCTGATGCAGAAGAACCGGAGGAAGGACCGGAAGCTGGGGGC 45 TAACCTCTTCACCATCGGTTTCGCCATCTACGAGGTTCCCAAAGAGATGC ACGGCAACAAGCAGCACCTGCAGAAGGACTTCTTCCTGTACAATGCCTCC AAGGCTAGGAGCAGAACCTACATCAACATGCGGGAGGTGTCTGAGCGCTT
CCGCCTGCCTCCCAGCGAGTACGTCATTGTGCCCTCCACTTACGAGCCCC
WO 2007/053891 PCT/AU2006/001667 - 36 ACCAGGAGGGCGAGTTCATCCTCCGGGTCTTCTCGGAAAAGAGGAACCTC TCTGAGGAAGTTGAGAATACAATCTCTGTGGATCGGCCAGTGAAAAAGAA AAAAAACAAGCCCATCATCTTTGTTTCAGACCGAGCAAACAGCAACAAGG AGCTGGGTGTGGACCAGGAAACAGAGGAGGGAAAAGACaACACAAGCCCT 5 GATAAGCAAGCAAAATCCCCACAGCTAGAGCCTGGCAACACCGACCAGGA AAGTGAGGAACAGCGGCAATTCCGGAATATTTTCAGGCAGATAGCAGGCG ATGACATGGAGATCTGCGCAGATGAGCTCAAGAAcGTCCTTAACAGAGTT GTGAACAAACATAAGGACCTGAAGACACAAGGCTTCACgCTGGAGTCCTG CCGTAGCATGATtGCTCTCATGGACACAGaTGGCTCTGGGaGACTGAACC 10 TGCAAGAGTTTCATCACCTCTGGAAGAAGATTAAGACGTGGCAGAAAATT TTCAAACACTATGACACAGACCAATCTGGCACCATCAACAGCTACGAGAT GCGCAATGCAGTCAAAGATGCAGGCTTCCACCTCAACAACCAGCTCTACG ATATCATTACCATGCGCTATGCAGACAAGTACATGAATATTGACTTcGAC AGTTTCATCTGCTGCTTTGTCAGGCTGGAGGGCATGTTCAGAGCTTTCAA 15 TGCATTTGACAAGGATGGGGACGGTATCATCAAACTCAATGTTCTCGAGT GGCTGCAGCTCACCATGTATGCCTGAACCAAGCTGGCCACATCGAAGGCA TGGAGGATCACTCAGGATTTCAATTTCACCCAACAGAGCTAGTCACTTAC CTCAAAGGACACAGTTGCTGCACCCCCAGGAAGCCTCCAGGCACCTCATC AGTCTAGTTCCTCCTCTACTCACTTCCCTCCCAGCCTTAGGGCATCTGTC 20 CATTTGTCAGGCCCAGCCTGACCCTTCAGTTAAGGAATGGGGAAGGGAGA GCTGTGTTGTCCCTGTGCCACATGGAGCCAAGTGCCTCTGTCTGCTTCCG CTAGCCACAGGCCAGTGAGAGCTTTGCTTGGAGTCTGATGGCCTCAGCTC TGAAGACAAGTACTCTCCTTAGATGCTTGCAGCTGTTTGCAGAAGCATTT GCCAATGGCAAAAA (SEQ ID NO: 4) 25 Each polymorphism shown in SEQ ID NO: 4 is set out singly in position order from 5' to 3' with flanking sequence in SEQ ID NOs: 5 to 13 except the bp260 polymorphism which is set out in SEQ ID NO: 1 and 30 identified above as the CAPN3E6 polymorphism.
WO 2007/053891 PCT/AU2006/001667 - 37 Table 12. The lab names of the SNP used in examples, such as CAPN3E6, CAPN3JK and CAPN3X3 have standardised names (den Dunnen and Antonarakis 2000), as do the SNP in SEQ ID NO:4. These are as follows in order from 5' to 3' in the 5 gene: Lab Name Standard Name Coding sequence effect CAPN3E6 CAPN3:c.53T>G Met18Arg CAPN3- CAPN3:c.303A>G Arg no change 510 CAPN3- CAPN3:c.552C>T Thr no change 759 CAPN3JK CAPN3:c.1538+225G>T Intronic CAPN3- CAPN3:c.1882A>G Asn628Asp 2089 CAPN3- CAPN3:c.2028C>G Asn no change 2235 CAPN3- CAPN3:c.2082G>A Thr no change 2289 CAPN3- CAPN3:c.2106T>C Ile no change 2313 CAPN3- CAPN3:c.2123A>T Val708Asp 2330 CAPN3- CAPN3:c.2133A>G Gly no change 2340 CAPN3- CAPN3:c.2339C>T Phe no change 2547 CAPN3X3 CAPN3:c.2443-103G>C Intronic To determine which of the new SNP derived from 10 sequencing the CAPN3 gene are associated with meat tenderness, Taqman Assays were constructed using the Taqman methodology. The same samples were used as in Example 1, to determine which alleles had more favourable tenderness. In each case (Table 13), the rarer allele 15 always had a less tender or more tough average phenotype, even if these were not statistically significant. In Table 13 the rarer alleles are CAPN3-759 T, CAPN3-2289 A, and CAPN3-2313 C. 20 WO 2007/053891 PCT/AU2006/001667 - 38 Table 13. Associations between meat tenderness and CAPN3 SNP. Locus x0 SE x1 SE x2 SE N FreqO alpha tmax PermP capn3- 0.34 0.18 0.93 0.42 1.54 2.56 86 0.89 -0.61 1.36 0.1700 759 capn3- 0.69 1.70 1.44 0.38 0.52 0.12 233 0.06 -0.65 2.43 0.0117 2289 capn3- 0.97 0.57 0.80 0.27 0.52 0.13 236 0.15 0.19 0.97 0.3488 2313 5 Alpha, the average effect of allele substitution is measured in kg of peak force. Similarly, the CAPN3:c.1882G allele, which is the 10 rarer allele at the CAPN3:c.1882A>G SNP, and the CAPN3:c.2123T allele, which is the rarer allele at the CAPN3:c.2123A>T SNP, will cause an increase in meat toughness. Furthermore, the CAPN3:c.303G allele, which is 15 the rarer allele at the CAPN3:c.303A>G SNP, the CAPN3:c.2028G allele, which is the rarer allele at the CAPN3:c.2028C>G SNP, and the CAPN3:c.2339T allele, which is the rarer allele at the CAPN3:c.2339C>T SNP, will cause an increase in meat toughness.
WO 2007/053891 PCT/AU2006/001667 - 39 References: The contents of the following documents are incorporated herein through reference: Altschul, S. F., Gish, W., Miller, W., Myers, E. 5 W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, 403-410 (1990). Barendse, W. 2001. DNA markers for meat tenderness. Patent W002064820 (Patent Application PCT/AUO2/0 0122). 10 Barendse, W. The transition from quantitative trait loci to diagnostic test in cattle and other livestock. Aust. J. Exp. Agr. 45, 831-836 (2005). Barendse, W., 1997. Assessing lipid metabolism. Patent application PCT/AU98/00882 15 Barendse, W. and Fries, R., 1999. Genetic linkage mapping, the gene maps of cattle, and the lists of loci, pp. 329-364 in The genetics of cattle, edited by R. Fries and A. Ruvinsky, CABI Publishing, Wallingford. Barendse, W. and Harrison, B., (2001) The 20 analysis of effects on instron compression and adhesion in the semitendinosus muscle of genotypes at the candidate gene Lysyl Oxidase (LOX) in cattle of diverse breeds. CRC commercial-in-confidence report. Barendse, W., Harrison, B. and Li, Y. 2000. The 25 analysis of effects on peak-force of genotypes at the candidate gene Calpastatin in cattle of diverse breeds. Confidential Report of the Beef Quality CRC. Barendse, W., Bunch, R. J., Harrison, B. E. & Thomas, M. B. The growth hormone GH1:c.457C>G mutation is 30 associated with relative fat distribution in intra muscular and rump fat in a large sample of Australian feedlot cattle. Anim. Genet. 37, 211-214 (2006). Carlborg, 0., Jacobsson, L., Ahgren, P., Siegel, P. & Andersson, L. Epistasis and the release of genetic 35 variation during long-term selection. Nat. Genet. 38, 418 420 (2006). Casas, E. et al. Quantative trait loci affecting WO 2007/053891 PCT/AU2006/001667 - 40 growth and carcass composition of cattle segregating alternate forms of myostatin. J. Anim. Sci. 78, 560-569 (2000). Chen, X.N., B. Zehnbauer, A. Gnirke, and P.Y. 5 Kwok. 1997. Fluorescence energy transfer detection as a homogeneous DNA diagnostic method. Proc. NatI. Acad. Sci. (USA) 94: 10756-10761. Chung, H.Y., Davis, M.E. and Hines, H.C. 1999. A DNA polymorphism of the bovine calpastatin gene detected 10 by SSCP analysis. Animal Genetics 30, 80. Chung, H.Y., Davis, M.E., Hines, H.C. and Wulf, D.M. 1999. Relationship of a PCR-SSSCP at the bovine Calpastatin locus with Calpastatin activity and Meat Tenderness. Ohioline Bulletin Special Circular 170-99. 15 http://www.ag.ohio-state.edu/-ohioline/scl70/scl70_3.html Coleman, J.B., Cucca, F., Hearne, C.M., Cornall, R.J., Reed, P.W., Ronningen, K.S., Undlien, D.E., Nistico, L., Buzzetti, R., Tosi, R., Pociot, F., Nerup, J., ornelis, F., Barnett, A.H., Bain, .C., and Todd, J.A. 20 1995. Linkage disequilibrium mapping of a type 1 diabetes susceptibility gene (IDDM7) to chromosome 2q31-q33. Nature Genetics 9, 80-85. Cronlund, A.L., Smith, B.D., Kagan, H.M. 1985. Binding of lysyl oxidase to fibrils of type I Collagen. 25 Connective Tissue Research 14, 109-119. den Dunnen, J.T. and S.E. Antonarakis. 2000. Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum. Mut. 15: 7 12. 30 Drinkwater, R.D., Harrison, B., Byrne, K., Botero, F.A., Knight, M., Davis, G.P., Lenane, I., Li, Y., Kuipers, R., and Moore, S.S. 1999. Candidate genes for Meat Quality, draft report for the 1998-1999 research program. Cattle and Beef CRC Commercial-In-Confidence 35 Report. Drinkwater, R. D. et al. Detecting quantitative trait loci affecting beef tenderness on bovine chromosome WO 2007/053891 PCT/AU2006/001667 - 41 7 near calpastatin and lysyl oxidase. Aust. J. Exp. Agr. 46, 159-164 (2006). Ekholm, E.C., Ravanti, L., Kahari, V., Paavolainen, P. and Penttinen, R.P. 2000. Expression of 5 extracellular matrix genes: transforming growth factor (TGF)-betal and ras in tibial fracture healing of lathyritic rats. Bone 27, 551-557. Ewing, B., Hillier, L., Wendl, M. C. & Green, P. Base-calling of automated sequencer traces using phred. I. 10 Accuracy assessment. Genome Res. 8, 175-185 (1998). Farnir, F., W. Coppieters, J.J. Arranz, P. Berzi, N. Cambisano, B. Grisart, L. Karim, F. Marcq, L. Moreau, M. Mni, C. Nezer, P. Simon, P. Vanmanshoven, D. Wagenaar, and M. Georges. 2000. Extensive genome-wide linkage 15 disequilibrium in cattle. Genome Res. 10: 220-227. Fisher, R. A. The correlation between relatives on the supposition of Mendelian inheritance. Trans. Roy. Soc. Edin. 52, 399-433 (1918). Garcia, M. D. et al. Significant association of 20 the calpastatin gene with fertility and longevity in dairy cattle. Anim. Genet. 37, 304-305 (2006). Geesink, G.H. and Koohmaraie, M. 1999. Postmortem proteolysis and calpain/calpastatin activity in callipyge and normal lamb biceps femoris during extended 25 postmortem storage. J. Anim. Sci. 77, 1490-1501. Giampuzzi, M., Botti, G., Cilli, M., Gusmano, R., Borel, A., Sommer, P., Di Donato, A. 2001. Down regulation of lysyl oxidase induced tumorigenic transformation in NRK-49F cells characterized by 30 constitutive activation of Ras proto-oncogene. Journal of Biological Chemistry [epub ahead of print]. Gilmour, A. R., Thompson, R. & Cullis, B. R. Average information REML: An efficient algorithm for variance parameter estimation in linear mixed models. 35 Biometrics 51, 1440-1450 (1995). Goll, D. E., Thompson, V. F., Li, H. Q., Wei, W. & Cong, J. Y. The calpain system. Physiological Reviews WO 2007/053891 PCT/AU2006/001667 - 42 83, 731-801 (2003). Gordon, D., Abajian, C. & Green, P. Consed: a graphical tool for sequence finishing. Genome Res. 8, 195 202 (1998). 5 Hardenbol, P., J. Baner, M. Jain, M. Nilsson, E.A. Namsaraev, G.A. Karlin-Neumann, H. Fakhrai-Rad, M. Ronaghi, T.D. Willis, U. Landegren, and R.W. Davis. 2003. Multiplexed genotyping with sequence-tagged molecular inversion probes. Nature Biotech. 21: 673-678. 10 Hardenbol, P., F.L. Yu, J. Belmont, J. MacKenzie, C. Bruckner, T. Brundage, A. Boudreau, S. Chow, J. Eberle, A. Erbilgin, M. Falkowski, R. Fitzgerald, S. Ghose, 0. Iartchouk, M. Jain, G. Karlin-Neumann, X.H. Lu, X. Miao, B. Moore, M. Moorhead, E. Namsaraev, S. Pasternak, E. 15 Prakash, K. Tran, Z.Y. Wang, H.B. Jones, R.W. Davis, T.D. Willis, and R.A. Gibbs. 2005. Highly multiplexed molecular inversion probe genotyping: over 10,000 targeted SNPs genotyped in a single tube assay. Genome Res. 15: 269-275. Hetzel., D.J.S and Davis, G.P. 1999. Gene 20 markers for carcass, meat quality and live animal traits. Final report CSIRO Tropical Agriculture and CRC for Meat Quality. Report finalised by Y.Li. Ilian, M.A., Bekhit, A.E-D., Bickerstaffe, R. 2004. The relationship between meat tenderization, 25 myofibril fragmentation and autolysis of calpain 3 during post-mortem aging. Meat Science 66, 387--397. Ilian, M.A., Morton, J.D., Bekhit, A. E.-D., Roberts, N., Palmer, B., Sorimachi, H. and Bickerstaffe, R. Journal of Agricultural and Food Chemistry 49, 1990- 30 1998. James, T., Matzelle, D., Bartus, R., Hogan, E. L. & Banik, N. L. New inhibitors of calpain prevent degradation of cytoskeletal and myelin proteins in spinal cord in vitro. J. Neurosci. Res. 51, 218-222 (1998). 35 J.Henshall and M. Goddard (1999) Multiple-trait mapping of quantitative trait loci after selective genotyping using logistic regression. Genetics 151:885- WO 2007/053891 PCT/AU2006/001667 - 43 894. Livak, K.J. 2003. SNP genotyping by the 5' nuclease reaction. In Meth. Mol. Biol. (ed. P.-Y. Kwok),. pp. 129-147. Humana Press, Totowa New Jersey. 5 Y. Li (2000) CRC Molecular Genetics Program Annual Report. CRC commercial-in-confidence report. Lonergan, S.M., Ernst, C.W., Bishop, M.D., Calkins, C.R., and Koohmaraie, M. 1995. Relationship of restriction fragment length polymorphisms (RFLP) at the 10 bovine calpastatin locus to calpastatin activity and meat tenderness. J.Anim. Sci 73, 3608-3612. Luo, L. J. et al. Overdominant epistatic loci are the primary genetic basis of inbreeding depression and heterosis in rice. II. Grain yield components. Genetics 15 158, 1755-1771 (2001). Lynch, M. & Walsh, J. B. Genetics and Analysis of Quantitative Traits (Sinauer Associates, Inc., Sunderland, MA, 1998). Koohmaraie, M. Biochemical factors regulating the 20 toughening and tenderization processes of meat. Meat Sci. 43, 193-201 (1996). Koohmaraie, M. 1994. Muscle proteinases and meat aging meat Sci. 36:93. McRae, A.F., J.C. McEwan, K.G. Dodds, T. Wilson, 25 A.M. Crawford, and J. Slate. 2002. Linkage disequilibrium in domestic sheep. Genetics 160: 1113-1122. Nellaiappan, K., Risitano, A., Liu, G., Nicklas, G. and Kagan, K.M. 2000. Fully processed lysyl oxidase catalyst translocates from the extracellular space into 30 nuclei of aortic smooth-muscle cells. Journal of Cell Biochemistry 79, 576-582. Nickerson, D. A., Tobe, V. 0. & Taylor, S. L. PolyPhred: Automating the detection and genotyping of single nucleotide substitutions using fluorescence-based 35 resequencing. Nucl. Acids Res. 25, 2745-2751 (1997). Nonneman, D. and M. Koohmaraie. 1999. Molecular cloning and mapping of the bovine and ovine skeletal WO 2007/053891 PCT/AU2006/001667 - 44 muscle-specific calpains. Anim. Genet. 30: 456-458. Nsengimana, J., P. Baret, C.S. Haley, and P.M. Visscher. 2004. Linkage disequilibrium in the domesticated pig. Genetics 166: 1395-1404. 5 Nonneman, D., Kappes, S.M. and Koohmaraie, M. 1999. Rapid communication: a polymorphic microsatellite in the promotor region of the bovine calpastatin gene. J. Anim. Sci 77, 3114-3115. Olson, T. A. in The genetics of cattle (eds. 10 Fries, R. & Ruvinsky, A.) 33-53 (CAB International, Wallingford, 1999). Page, B. T. et al. Evaluation of single nucleotide polymorphisms in CAPN1 for association with meat tenderness in cattle. J. Anim. Sci. 80, 3077-3085 15 (2002). Perry, D., Shorthose, W. R., Ferguson, D. M. & Thompson, J. M. Methods used in the CRC program for the determination of carcass yield and beef quality. Aust. J. Exp. Agr. 41, 953-957 (2001). 20 Robinson, D. L., Ferguson, D. M., Oddy, V. H., Perry, D. & Thompson, J. Genetic and environmental influences on beef tenderness. Aust. J. Exp. Agr. 41, 997 1003 (2001). Slee, R.B., Hillier, S.G., Largue, P., Harlow, 25 C.R., Miele, G. and Clinton, M. 2001. Differentiation dependent expression of connective tissue growth factor and lysyl oxidase messenger ribonucleic acids in rat granulosa cells. Endocrinology 142, 1082-1089. Storm, N., B. Darnhofer-Demar, D. van den Boom, 30 and C.P. Rodi. 2002. MALDI-TOF mass spectrometry-based SNP genotyping. . Meth. Mol. Biol. 212: 214-262. Tenesa, A., S.A. Knott, D. Ward, D. Smith, J.L. Williams, and P.M. Visscher. 2003. Estimation of linkage disequilibrium in a sample of the United Kingdom dairy 35 cattle population using unphased genotypes. J. Anim. Sci. 81: 617-623. Terwilliger, J.D. 1995. A powerful likelihood WO 2007/053891 PCT/AU2006/001667 - 45 method for the analysis of linkage disequilibrium between trait loci and one or more polymorphic marker loci. American Journal of Human Genetics 56, 777 -- 787. Upton, W., Burrow, H. M., Dundon, A., Robinson, 5 D. L. & Farrell, E. B. CRC breeding program design, measurements and database: methods that underpin CRC research results. Aust. J. Exp. Agr. 41, 943-952 (2001). Wang, D. L., Zhu, J., Li, Z. K. & Paterson, A. H. Mapping QTLs with epistatic effects and QTLxenvironment 10 interactions by mixed linear model approaches. Theor. Appl. Genet. 99, 1255-1264 (1999). Whipple, G., Koohmaraie, M., Dikeman, M.E., Crouse, J.D., Hunt, M.C., Klemm, R.D. 1990. Evaluation of attributes that affect longissimus muscle tenderness in 15 Bos taurus and Bos indicus cattle. J.Anim. Sci. 68, 2716 2728. White, S. N. et al. A new single nucleotide polymorphisms in CAPN1 extends the current tenderness marker test to include cattle of Bos indicus, Bos taurus, 20 and crossbred descent. J. Anim. Sci. 83, 2001-2008 (2005). Woodward, B.W., DeNise, S.K., and Marchello, J.A. 2000. Evaluation of calpastatin activity measures in ante-and postmortem muscle from half-sib bulls and steers. J.Anim. Sci. 78, 804-809. 25

Claims (18)

1. A method for assessing the tenderness of meat from an animal, comprising the step of testing the animal for a genetic marker in the calpain3 (CAPN3) gene associated 5 with Warner-Bratzler peak force variation or for a genetic marker located other than in CAPN3 which shows allelic association therewith.
2. A method as claimed in claim 1 wherein the genetic 10 marker is located in an intron.
3. A method as claimed in claim w wherein the genetic marker is located in intron 10 or 11. 15
4. A method as claimed in claim 3 wherein the genetic marker is CAPN3:C.552C>T.
5. A method as claimed in claim 1 wherein the genetic marker is located in the 3'UTR of CAPN3. 20
6. A method as claimed in claim 5 wherein the genetic marker is CAPN3:C.2443-103G>C.
7. A method as claimed in claim 1 wherein genetic marker 25 is located in the coding sequence of the CAPN3 gene.
8. A method as claimed in claim 7 wherein the genetic marker is selected from the group consisting of CAPN3:c.303A>G, CAPN3:c.552C>T, CAPN3:c.1882A>G, , 30 CAPN3:c.2028C>G, CAPN3:c.2082G>A, CAPN3:c.2106T>C, CAPN3:c.2123A>T, CAPN3:c.2133A>G and CAPN3:c.2339C>T.
9. A method as claimed in claim 1, further comprising the step of testing for one or more additional genetic 35 markers associated with Warner-Bratzler peak force variation. WO 2007/053891 PCT/AU2006/001667 - 47
10. A method as claimed in claim 9 further comprising the step of testing for any combination of two or more of CAPN3:C.552C>T, CAPN3:C.2443-103G>C,CAPN3:c.303A>G, CAPN3:c.552C>T, CAPN3:c.1882A>G, CAPN3:c.2028C>G, 5 CAPN3:c.2082G>A, CAPN3:c.2106T>C, CAPN3:c.2123A>T, CAPN3:c.2133A>G and CAPN3:c.2339C>T.
11. A genetic marker for meat tenderness in an animal which is a polymorphism in the calpain3 gene. 10
12. A genetic marker as claimed in claim 11 which is CAPN3:C.552C>T.
13. A genetic marker as claimed in claim 11 which is 15 CAPN3:C.2443-103G>C.
14. A genetic marker as claimed in claim 11 selected from the group consisting of CAPN3:c.303A>G, CAPN3:c.552C>T, CAPN3:c.1882A>G, CAPN3:c.2028C>G, CAPN3:c.2082G>A, 20 CAPN3:c.2106T>C, CAPN3:c.2123A>T, CAPN3:c.2133A>G and CAPN3:c.2339C>T.
15. A method for selecting an animal likely to yield meat of improved tenderness, comprising the steps of: 25 (1) testing the animal for the presence of a genetic marker in CAPN3 associated with low peak-force or for a genetic marker located other than in CAPN3 which shows allelic association therewith; and 30 (2) selecting animals in said genetic marker is present.
16. A method as claimed in claim 15, further comprising using the selected animal for breeding. 35 WO 2007/053891 PCT/AU2006/001667 - 48
17. An oligonucleotide probe for amplification of a genetic marker in the calpain3 (CAPN3) gene associated with Warner-Bratzler peak force variation or for a genetic marker located other than in CAPN3 which shows allelic 5 association therewith.
18. A kit for use in assessing the tenderness of meat from an animal and/or selecting an animal likely to yield meat of improved tenderness, comprising oligonucleotide 10 probes for amplification of at least one genetic marker associated with meat tenderness in the calpain3 (CAPN3) gene associated with Warner-Bratzler peak force variation or for a genetic marker located other than in CAPN3 which shows allelic association therewith, and means for 15 amplifying DNA.
AU2006312996A 2005-11-11 2006-11-09 DNA marker for meat tenderness in cattle Abandoned AU2006312996A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2006312996A AU2006312996A1 (en) 2005-11-11 2006-11-09 DNA marker for meat tenderness in cattle

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
AU2005906261 2005-11-11
AU2005906261A AU2005906261A0 (en) 2005-11-11 DNA marker for meat tenderness in cattle
PCT/AU2006/001667 WO2007053891A1 (en) 2005-11-11 2006-11-09 Dna marker for meat tenderness in cattle
AU2006312996A AU2006312996A1 (en) 2005-11-11 2006-11-09 DNA marker for meat tenderness in cattle

Publications (1)

Publication Number Publication Date
AU2006312996A1 true AU2006312996A1 (en) 2007-05-18

Family

ID=39522889

Family Applications (1)

Application Number Title Priority Date Filing Date
AU2006312996A Abandoned AU2006312996A1 (en) 2005-11-11 2006-11-09 DNA marker for meat tenderness in cattle

Country Status (1)

Country Link
AU (1) AU2006312996A1 (en)

Similar Documents

Publication Publication Date Title
Schuetz et al. Implication of complex vertebral malformation and bovine leukocyte adhesion deficiency DNA-based testing on disease frequency in the Holstein population
Samollow et al. First-generation linkage map of the gray, short-tailed opossum, Monodelphis domestica, reveals genome-wide reduction in female recombination rates
US20060172329A1 (en) DNA markers for cattle growth
JP2011193825A (en) Vertnin gene which governs the number of vertebras of swine and use thereof
JPH1099085A (en) Polymorphism of human mitochondrial dna
Moller et al. High-resolution comparative mapping of pig Chromosome 4, emphasizing the FAT1 region
US20040048267A1 (en) Novel calpastatin (CAST) alleles
US20030170674A1 (en) Nitric oxide synthase gene diagnostic polymorphisms
US20090148844A1 (en) Dna marker for meat tenderness in cattle
US20100009374A1 (en) Sire early selection for male fertility using single nucleotide polymorphisms (snps) of the dazl gene
AU754923B2 (en) Method to determine predisposition to hypertension
WO2008014550A1 (en) Markers for pigmentation
JP5424519B2 (en) Parkin gene mutations, compositions, methods and uses
JP2004519219A (en) Genetic tests to identify complex spinal malformation carriers in cattle
JP5897704B2 (en) Detection of Brachyspina mutation
AU2006312996A1 (en) DNA marker for meat tenderness in cattle
EP1660675B1 (en) Polymorphism of the igf2 gene and improving production characteristics of cattle
EP0857219B1 (en) Microsatellite sequences for canine genotyping
US20040126795A1 (en) Genetic markers associated with scrotal hernias in pigs
WO2002066639A1 (en) Brain aneurysm-sensitive gene
KR101444414B1 (en) Composition for predicting of meat quality in Hanwoo
WO2008034186A1 (en) Dna markers for meat tenderness
AU2007281024B2 (en) Markers for pigmentation
US20090191549A1 (en) Single nucleotide polymorphisms (snp) and their association with tick resistance in bovine animals
Othman et al. GENETIC POLYMORPHISM OF BUFFALO ยต-CALPAIN GENE USING PCR-RFLP

Legal Events

Date Code Title Description
MK4 Application lapsed section 142(2)(d) - no continuation fee paid for the application