AU2006281976B2 - Modification of endophyte infection - Google Patents

Abstract

The present invention relates to nucleic acids encoding apyrase enzymes in plants and the use thereof for modifying plant/endophyte symbioses.

Description

WO 2007/019616 PCT/AU2006/001161 1 Modification of endophyte infection The present invention relates to nucleic acid fragments encoding amino acid sequences for apyrase enzymes in plants. The present invention also relates to the use of such nucleic acid fragments in the modification of plant/endophyte symbioses in plants, 5 particularly in temperate grasses. The Epichlos and Neotyphodium species (phylum Ascomycota, order Hypocreales, family Clavicipitaceae) form agronomically important symbiotic relationships with the major subfamily of temperate grasses, the Po6ideae (Schardl et al., 2004). These symbioses have a reasonably high degree of host-strain specificity and can be 10 mutualistic, antagonistic or both; in some cases the fungal endophyte is seed transmissible. The mechanisms by which this symbiosis is established and maintained are very poorly understood and this is reflected by our comparatively limited ability to manipulate them. The identification of specific symbiosis genes in either the host or endophyte would generate exploitable properties including the potential to create new 15 symbioses. The two best understood plant/microbial symbioses are those involving mycorrhizae and rhizobia. Fossil evidence shows the plant/mycorrhizal symbiotic relationship formed approximately 460 million years ago (Kistner and Parniske, 2002) and the legume/rhizobium symbiosis is thought to have developed between 90-120 million years 20 ago (Kistner and Parniske, 2002). It is generally thought that the latter symbiosis utilises a number of the plant genes that were already involved in plant/mycorrhizal symbiosis (Gualtieri and Bisseling, 2000). Evidence supporting this comes from the myriad of Nod plant mutants that are also Myc7. The grass/endophyte symbiosis is thought to have begun approximately 40 million years ago; hence this symbiosis is 25 younger than either the plant/mycorrhizal or legume/rhizobium symbioses. It is possible that the grass/endophyte symbiosis may utilise some plant genes common in the plant/mycorrhizal and legume/rhizobium symbioses, such as the gene encoding Lectin Nucleotide Phosphohydrolases (LNPs). LNPs and their cDNAs were originally isolated from a variety of legume species. These WO 2007/019616 PCT/AU2006/001161 2 were characterised as peripherally bound membrane proteins belonging to the apyrase category of enzymes (Etzler et al., 1999; Roberts et al., 1999). Apyrases appear to be present in all eukaryotic organisms; and are involved in a wide variety of functions, it was recently demonstrated that LNP from the legume Lotus japonicus is essential for 5 both the rhizobial- and mycorrhizal-legume symbioses (Etzler and Murphy, 2002; Etzler and Roberts, 2001; 2005). Phylogenetic analyses indicates that the LNPs appear to constitute a specialized category of apyrases unique to the legumes (Roberts et al., 1999; Cohn et al., 2001). However, since the ability to undergo symbiosis with mycorrhizal fungi is not confined to leguminous plants, Etzler and Roberts (2001; 2005) 10 suggested that non leguminous Myc* plants possess a related apyrase that performs a similar function to LNP in this symbiosis. Although the mechanisms determining host/strain specificity are unknown there is a high degree of specificity for compatible interactions (Schardl et al., 2004). The ability to manipulate host/strain specificity may provide a mechanism to alter, for example, 15 abiotic stress tolerance, alkaloid production, and pathogenic resistance. Many epichlos have positive effects of host plant growth including, increased tiller number, seed production, root growth and total biomass. Epichlos invaded plants frequently exhibit improved recovery after water stress in comparison to endophyte free plants (Schardl et al., 2004). The biochemical basis for the improved physiological 20 responses are poorly understood; however, the ability to create and or manipulate the plant/epichlos symbioses may provide a mechanism to generate plants with desirable abiotic stress tolerant profiles. Many epichlos produce alkaloids with biological activity conferring resistance to grazing and insect predation. The alkaloids belong to several distinct classes; the lolines and 25 peramines are involved in preventing invertebrate predation; the indolediterpene and ergot alkaloids posses both anti-insect and anti-vertebrate activities. While the latter is particularly problematic in the pastoral environment it can be useful in other grassed areas such as in turfed areas of golf courses and airports where the anti-vertebrate properties act as a deterrent to unwanted grazing birds. The type and amount of 30 alkaloid produced is determined by the strain of epichlos (Schardl et al., 2004). The WO 2007/019616 PCT/AU2006/001161 3 ability to create and or manipulate the plant/epichlos symbioses may provide a mechanism to produce the desired alkaloid profile. Some epichlos confer resistance to attack by pathogenic nematodes and pathogenic fungi. The mechanisms by which resistance is developed is not fully elucidated. The 5 type and efficacy of resistance to pathogenic attack is determined by the strain of epichlos (Schardl et al., 2004). The ability to create and or manipulate the plant/epichlos symbioses may provide a mechanism that produced the desired resistance to pathogenic attack. In one aspect, the present invention provides a substantially purified, recombinant, 10 synthetic or isolated nucleic acid encoding an amino acid sequence of an apyrase enzyme or complementary or antisense to a nucleic acid sequence encoding an amino acid sequence of an apyrase enzyme; and functionally active fragments and variants of the nucleic acid. The apyrase may have the enzyme nomenclature 3.6.1.5 (International Union of 15 Biochemistry and Molecular Biology). The nucleic acid may be obtained from ryegrass (Lolium) or fescue (Festuca) species. These species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow fescue and red fescue. Preferably the species is a ryegrass, more preferably perennial ryegrass (L. perenne). 20 The nucleic acid may be obtained from clover (Trifolium) species. Preferably the species is white clover (T. repens). Nucleic acids according to the invention may be full-length genes or part thereof, and are also referred to as "nucleic acid fragments" and "nucleotide sequences" in this specification. The nucleic acid may also be part of a DNA sequence including 25 regulatory sequences such as a promoter and a terminator. The nucleic acid may be of any suitable type and includes DNA (such as cDNA or WO 2007/019616 PCT/AU2006/001161 4 genomic DNA) and RNA (such as mRNA) or interfering RNA (RNAi) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases, and combinations thereof. The term "isolated" means that the material is removed from its original environment 5 (eg. the natural environment if it is naturally occurring). For example, a naturally occurring nucleic acid or polypeptide present in a living plant is not isolated, but the same nucleic acid or polypeptide separated from some or all of the coexisting materials in the natural system, is isolated. Such an isolated nucleic acid could be part of a vector and/or such nucleic acid could be part of a composition, and still be isolated in that such 10 a vector or composition is not part of its natural environment. Similarly, the term "substantially purified" refers to a material which is removed from its original environment and which is substantially free of any compound normally associated with the material in its natural state. For example, the material may be homogeneous by one or more purity or homogeneity characteristics used by those of 15 skill in the art. The term, however, is not meant to exclude artificial or synthetic mixtures of the material with other compounds. The term is also not meant to exclude the presence of minor impurities which do not interfere with the biological activity of the material and which may be present, for example, due to incomplete purification. Preferably, the substantially purified material is at least approximately 80% pure, more 20 preferably at least approximately 90% pure, most preferably at least approximately 95% pure. By "functionally active" in respect of a nucleotide sequence is meant that the fragment or variant (such as an analogue, derivative or mutant) is capable of phosphohydrolase activity in a plant. Such variants include naturally occurring allelic variants and non 25 naturally occurring variants. Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant. Preferably the functionally active fragment or variant has at least approximately 80% identity to the relevant part of the above mentioned sequence, more preferably at least approximately 90% identity, most 30 preferably at least approximately 95% identity. Such functionally active variants and WO 2007/019616 PCT/AU2006/001161 5 fragments include, for example, those having nucleic acid changes which result in conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 30 nucleotides, more preferably at least 45 nucleotides, most preferably at least 60 nucleotides. 5 By "functionally active" in the context of a polypeptide is meant that the fragment or variant has one or more of the biological properties of the enzyme apyrase. Additions, deletions, substitutions and derivatizations of one or more of the amino acids are contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant. Preferably the functionally active fragment or variant has at 10 least approximately 60% identity to the relevant part of the above mentioned sequence, more preferably at least approximately 80% identity, most preferably at least approximately 90% identity. Such functionally active variants and fragments include, for example, those having conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 15 10 amino acids, more preferably at least 15 amino acids, most preferably at least 20 amino acids. By "operably linked" is meant that a regulatory element is capable of causing expression of a nucleic acid in a plant cell with which it is operably linked and a terminator is capable of terminating expression of a nucleic acid in a plant cell. Preferably, the 20 regulatory element is upstream of the nucleic acid and the terminator is downstream of said nucleic acid. By "an effective amount" is meant an amount sufficient to result in an identifiable phenotypic trait in said plant, or a plant, plant seed or other plant part derived there from. Such amounts can be readily determined by an appropriately skilled person, 25 taking into account the type of plant, the route of administration and other relevant factors. Such a person will readily be able to determine a suitable amount and method of administration. See, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, the entire disclosure of which is incorporated herein by reference.

WO 2007/019616 PCT/AU2006/001161 6 It will also be understood that the term "comprises" (or its grammatical variants) as used in this specification is equivalent to the term "includes" and should not be taken as excluding the presence of other elements or features. It will be understood that the invention disclosed and defined in this specification 5 extends to all alternative combinations of two or more of the individual features mentioned or evident from the text or figures. All of these different combinations constitute various alternative aspects of the invention. In a preferred embodiment of this aspect of the invention, the substantially purified, recombinant, synthetic or isolated nucleic acid encoding an apyrase protein or 10 complementary or antisense to a sequence encoding an apyrase protein includes a nucleotide sequence selected from the group consisting of (a) the sequence shown in Figure 2 hereto (SEQ ID NO: 1); (b) the complement of the sequence recited in (a); (c) a sequence antisense to the sequences recited in (a) and (b); (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c); and (e) interfering 15 RNA (RNAi) derived from the sequences recited in (a) and (b). In a further embodiment of this aspect of the invention, the substantially purified, recombinant, synthetic or isolated nucleic acid fragment encoding an apyrase protein or complementary or antisense to a sequence encoding an apyrase protein includes a nucleotide sequence selected from the group consisting of (a) the sequence shown in 20 Figure 3 hereto (SEQ ID NO: 3); (b) the complement of the sequence recited in (a); (c) a sequence antisense to the sequences recited in (a) and (b); (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c); and (e) interfering RNA (RNAi) derived from the sequences recited in (a) and (b). In a further embodiment of this aspect of the invention, the substantially purified, 25 recombinant, synthetic or isolated nucleic acid fragment encoding an apyrase protein or complementary or antisense to a sequence encoding an apyrase protein includes a nucleotide sequence selected from the group consisting of (a) the sequence shown in Figure 4 hereto (SEQ ID NO: 5); (b) the complement of the sequence recited in (a); (c) a sequence antisense to the sequences recited in (a) and (b); (d) functionally active -7 fragments and variants of the sequences recited in (a), (b) and (c); and (e) interfering RNA (RNAi) derived from the sequences recited in (a) and (b). In a particularly preferred embodiment, the present invention provides a substantially purified, recombinant, synthetic or isolated nucleic acid encoding an apyrase 5 polypeptide, or complementary or antisense to a nucleic acid sequence encoding an apyrase polypeptide, wherein said nucleic acid includes a nucleotide sequence selected from the group consisting of (a) the sequence shown in SEQ ID NO:1; (b) the complement of the sequence recited in (a); (c) a sequence antisense to the sequences recited in (a) and (b); (d) functionally active fragments and variants of the sequences o recited in (a), (b) and (c) having at least approximately 95% identity to the relevant part of the sequence recited in (a), (b) or (c) and having a size of at least 60 nucleotides; and (e) interfering RNA (RNAi) derived from the sequences recited in (a) and (b). Specific oligonucleotide probes based upon the nucleic acid sequences of the present invention may be designed and synthesized by methods known in the art. Moreover, 5 the entire sequences may be used directly to synthesize DNA probes by methods known to the skilled artisan such as random primer DNA labelling, nick translation, or end-labelling techniques, or RNA probes using available in vitro transcription systems. In addition, specific primers may be designed and used to amplify a part or all of the sequences of the present invention. The resulting amplification products may be 20 labelled directly during amplification reactions or labelled after amplification reactions, and used as probes to isolate full length cDNA or genomic fragments under conditions of appropriate stringency. In addition, short segments of the nucleic acid fragments of the present invention may be used in polymerase chain reaction protocols to amplify longer nucleic acid 5 fragments encoding homologous genes from DNA or RNA. The polymerase chain reaction may also be performed on a library of cloned nucleic acid fragments wherein the sequence of one primer is derived from the nucleic acid fragments of the present invention, and the sequence of the other primer takes advantage of the presence of the polyadenylic acid tracts to the 3' end of the mRNA precursor encoding plant genes. o Alternatively, the second primer sequence may be based upon sequences derived -8 from the cloning vector. For example, those skilled in the art can follow the RACE protocol (Frohman et al. (1988) Proc. Natl. Acad Sci. USA 85:8998, the entire disclosure of which is incorporated herein by reference) to generate cDNAs by using PCR to amplify copies of the region between a single point in the transcript and the 3' 5 or 5' end. Using commercially available 3' RACE and 5' RACE systems (BRL), specific 3' or 5' cDNA fragments can be isolated (Ohara et al. (1989) Proc. Nat. Acad Sci USA 86:5673; Loh et al. (1989) Science 243:217). Products generated by the 3' and 5' RACE procedures may be combined to generate full-length cDNAs. In a further aspect of the present invention there is provided a substantially purified, o recombinant, synthetic or isolated polypeptide from a ryegrass (Lolium), fescue (Festuca) or clover (Trifolium) species, selected from the group consisting of apyrase enzymes and functionally active fragments and variants thereof. The ryegrass (Lolium) or fescue (Festuca) species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow fescue 5 and red fescue. In one embodiment the species is perennial ryegrass (L. perenne). The clover (Trifolium) species may be of any suitable type. In one embodiment the species is white clover (T. repens). In a preferred embodiment of this aspect of the invention, there is provided a substantially purified, recombinant, synthetic or isolated apyrase polypeptide including o an amino acid sequence selected from the amino acid sequence shown in Figure 2 hereto (SEQ ID NO: 2), and functionally active fragments and variants thereof. In a further embodiment of this aspect of the invention, there is provided a substantially purified recombinant, synthetic or isolated apyrase polypeptide including an amino acid sequence selected from the amino acid sequence shown in Figure 3 5 hereto (SEQ ID NO: 4), and functionally active fragments and variants thereof. In a further embodiment of this aspect of the invention, there is provided a substantially purified recombinant, synthetic or isolated apyrase polypeptide including - 8a an amino acid sequence selected from the amino acid sequence shown in Figure 4 hereto (SEQ ID NO: 6), and functionally active fragments and variants thereof. In a particularly preferred embodiment, the present invention provides a substantially purified, recombinant, synthetic or isolated apyrase polypeptide from a Lolium species, 5 wherein said polypeptide includes an amino acid sequence selected from the amino acid sequence shown in SEQ ID NO: 2 and functionally active fragments and variants thereof having at least approximately 80% identity to the relevant part of SEQ ID NO: 2 and having a size of at least 20 amino acids. In a further embodiment of this aspect of the invention, there is provided a polypeptide o recombinantly produced from a nucleic acid according to the present invention. Techniques for recombinantly producing polypeptides are known to those skilled in the art. Availability of the nucleotide sequences of the present invention and deduced amino acid sequences facilitates immunological screening of cDNA expression libraries. Synthetic peptides representing portions of the instant amino acid sequences may be WO 2007/019616 PCT/AU2006/001161 9 synthesized. These peptides can be used to immunise animals to produce polyclonal or monoclonal antibodies with specificity for peptides and/or proteins comprising the amino acid sequences. These antibodies can be then used to screen cDNA expression libraries to isolate full-length cDNA clones of interest. 5 A genotype is the genetic constitution of an individual or group. Variations in genotype are essential in commercial breeding programs, in determining parentage, in diagnostics and fingerprinting, and the like. Genotypes can be readily described in terms of genetic markers. A genetic marker identifies a specific region or locus in the genome. The more genetic markers, the finer defined is the genotype. A genetic marker 10 becomes particularly useful when it is allelic between organisms because it then may serve to unambiguously identify an individual. Furthermore, a genetic marker becomes particularly useful when it is based on nucleic acid sequence information that can unambiguously establish a genotype of an individual and when the function encoded by such nucleic acid is known and is associated with a specific trait. Such nucleic acids 15 and/or nucleotide sequence information including single nucleotide polymorphisms (SNPs), variations in single nucleotides between allelic forms of such nucleotide sequence, can be used as perfect markers or candidate genes for the given trait. In a further aspect of the present invention, there is provided use of nucleic acids of the present invention including SNP's, and/or nucleotide sequence information thereof, as 20 molecular genetic markers. In a further aspect of the present invention there is provided a method of isolating a nucleic acid of the present invention including a single nucleotide polymorphism (SNP). Nucleic acids and fragments thereof from a nucleic acid library may desirably be sequenced. The nucleic acid library may be of any suitable type and is preferably a 25 cDNA library. The nucleic acid fragments may be isolated from recombinant plasmids or may be amplified, for example using polymerase chain reaction. The sequencing may be performed by techniques known to those skilled in the art. In a further aspect of the present invention there is provided use of a nucleic acid according to the present invention, and/or nucleotide sequence information thereof, as a 30 molecular genetic marker. More particularly, nucleic acids according to the present WO 2007/019616 PCT/AU2006/001161 10 invention and/or nucleotide sequence information thereof may be used as a molecular genetic marker for quantitative trait loci (QTL) tagging, QTL mapping, DNA fingerprinting and in marker assisted selection, particularly in ryegrasses and fescues. Even more particularly, nucleic acids according to the present invention and/or nucleotide sequence 5 information thereof may be used as molecular genetic markers in forage and turf grass improvement, e.g. tagging QTLs for herbage quality traits, dry matter digestibility, mechanical stress tolerance, disease resistance, insect pest resistance, plant stature, leaf and stem colour. Even more particularly, sequence information revealing SNPs in allelic variants of the nucleic acids of the present invention and/or nucleotide sequence 10 information thereof may be used as molecular genetic markers for QTL tagging and mapping and in marker assisted selection, particularly in ryegrasses and fescues. In a still further aspect of the present invention there is provided a construct including a nucleic acid according to the present invention. The construct may be a vector. In a preferred embodiment of this aspect of the invention, the vector may include at least 15 one regulatory element, such as a promoter, a nucleic acid according to the present invention and a terminator; said regulatory element, nucleic acid and terminator being operably linked. The vector may be of any suitable type and may be viral or non-viral. The vector may be an expression vector. Such vectors include chromosomal, non-chromosomal and 20 synthetic nucleic acid sequences, eg. derivatives of plant viruses; bacterial plasmids; derivatives of the Ti plasmid from Agrobacterium tumefaciens, derivatives of the Ri plasmid from Agrobacterium rhizogenes; phage DNA; yeast artificial chromosomes; bacterial artificial chromosomes; binary bacterial artificial chromosomes; vectors derived from combinations of plasmids and phage DNA. However, any other vector may be 25 used as long as it is replicable, or integrative or viable in the plant cell. The regulatory element and terminator may be of any suitable type and may be endogenous to the target plant cell or may be exogenous, provided that they are functional in the target plant cell. In another embodiment, the vector may include more than one nucleic acid. The nucleic WO 2007/019616 PCT/AU2006/001161 11 acids within the same vector may have identical or differing sequences. In one preferred embodiment, the vector has at least two nucleic acids encoding functionally similar enzymes. Preferably one of the regulatory elements is a promoter. A variety of promoters which 5 may be employed in the vectors of the present invention are well known to those skilled in the art. Factors influencing the choice of promoter include the desired tissue specificity of the vector, and whether constitutive or inducible expression is desired and the nature of the plant cell to be transformed (eg. monocotyledon or dicotyledon). Particularly suitable constitutive promoters include the Cauliflower Mosaic Virus 35S 10 (CaMV 35S) promoter, the maize Ubiquitin promoter, and the rice Actin promoter. A variety of terminators which may be employed in the vectors of the present invention are also well known to those skilled in the art. It may be from the same gene as the promoter sequence or a different gene. Particularly suitable terminators are polyadenylation signals, such as the CaMV 35S polyA and other terminators from the 15 nopaline synthase (nos) and the octopine synthase (ocs) genes. The vector, in addition to the regulatory element, the nucleic acid of the present invention and the terminator, may include further elements necessary for expression of the nucleic acid, in different combinations, for example vector backbone, origin of replication (ori), multiple cloning sites, spacer sequences, enhancers, introns (such as 20 the maize Ubiquitin Ubi intron), antibiotic resistance genes and other selectable marker genes (such as the neomycin phosphotransferase (npt2) gene, the hygromycin phosphotransferase (hph) gene, the phosphinothricin acetyltransferase (bar or pat) gene), and reporter genes (such as green fluorescence protein (GFP), beta glucuronidase (GUS) gene (gusA)). The vector may also contain a ribosome binding 25 site for translation initiation. The vector may also include appropriate sequences for amplifying expression. As an alternative to use of a selectable marker gene to provide a phenotypic trait for selection of transformed host cells, the presence of the vector in transformed cells may be determined by other techniques well known in the art, such as PCR (polymerase WO 2007/019616 PCT/AU2006/001161 12 chain reaction), Southern blot hybridisation analysis, histochemical GUS assays, northern and Western blot hybridisation analyses. Those skilled in the art will appreciate that the various components of the vector are operably linked, so as to result in expression of said nucleic acid. Techniques for 5 operably linking the components of the vector of the present invention are well known to those skilled in the art. Such techniques include the use of linkers, such as synthetic linkers, for example including one or more restriction enzyme sites. The vectors of the present invention may be incorporated into a variety of plants, including monocotyledons (such as grasses from the genera Lolium, Festuca, 10 Paspalum, Pennisetum, Panicum and other forage and turfgrasses, corn, rice, sugarcane, oat, wheat and barley) dicotyledons (such as arabidopsis, tobacco, soybean, canola, cotton, potato, chickpea, medics, white clover, red clover, subterranean clover, alfalfa, eucalyptus, poplar, hybrid aspen, and gymnosperms (pine tree)). In a preferred embodiment, the vectors are used to transform monocotyledons, 15 preferably grass species such as ryegrasses (Lolium species) and fescues (Festuca species), even more preferably a ryegrass, most preferably perennial ryegrass, including forage- and turf-type cultivars. Techniques for incorporating the vectors of the present invention into plant cells (for example by transduction, transfection or transformation) are well known to those skilled 20 in the art. Such techniques include Agrobacterium mediated introduction, electroporation to tissues, cells and protoplasts, protoplast fusion, injection into reproductive organs, injection into immature embryos and high velocity projectile introduction to cells, tissues, calli, immature and mature embryos. The choice of technique will depend largely on the type of plant to be transformed. 25 Cells incorporating the vectors of the present invention may be selected, as described above, and then cultured in an appropriate medium to regenerate transformed plants, using techniques well known in the art. The culture conditions, such as temperature, pH and the like, will be apparent to the person skilled in the art. The resulting plants may be reproduced, either sexually or asexually, using methods well known in the art, to WO 2007/019616 PCT/AU2006/001161 13 produce successive generations of transformed plants. In a further aspect of the present invention there is provided a plant cell, plant, plant seed or other plant part, including, e.g. transformed with, a vector of the present invention. 5 The plant cell, plant, plant seed or other plant part may be from any suitable species, including monocotyledons, dicotyledons and gymnosperms. In a preferred embodiment the plant cell, plant, plant seed or other plant part is from a monocotyledon, preferably a grass species, more preferably a ryegrass (Lolium species) or fescue (Festuca species), even more preferably a ryegrass, most preferably perennial ryegrass, 10 including both forage- and turf-type cultivars. The present invention also provides a plant, plant seed or other plant part derived from a plant cell of the present invention. The present invention also provides a plant, plant seed or other plant part derived from a plant of the present invention. In a further aspect of the present invention there is provided a method of modifying 15 apyrase activity in a plant, including introducing into said plant an effective amount of a nucleic acid, construct and/or vector according to the present invention. Preferably the plant is a temperate grass, such as a ryegrass or fescue. In a further aspect of the present invention there is provided a method of modifying plant/endophyte symbioses in a plant, said method including introducing into said plant 20 an effective amount of a nucleic acid, construct and/or vector according to the present invention. Preferably the plant is a temperate grass, such as a ryegrass or fescue. Preferably the endophyte is an Epichlos or Neotypodium species. Using the methods and materials of the present invention the apyrase content of a plant, for example L. perenne may be modified by over expressing the transcribed 25 region of an apyrase sequence according to the present invention or by silencing the homologous gene sequence in the plant. Varying the apyrase content of a plant enables the manipulation of plant/epichlos symbioses.

WO 2007/019616 PCT/AU2006/001161 14 In a further aspect of the present invention there is provided a method of modifying ryegrass/epichlos symbiosis including introducing into a plant an effective amount of a nucleic acid, construct and/or vector according to the present invention. In a further aspect of the present invention there is provided a method of modifying 5 fescue/epichlos symbiosis including introducing into a plant an effective amount of a nucleic acid, construct and/or vector according to the present invention. The temperate grass (Pobideae)/Epichlos and Neotyphodium host/endophyte symbiosis may be reduced or eliminated by the suppression of apyrase expression. Alternatively, the host/strain specificity may be manipulated by the expression of the complete open 10 reading frame of an apyrase (using either a constitutive promoter or the native promoter) from one temperate grass species in a separate temperate grass species. This may allow the transgenic grass to form symbiotic relationships with strains of EpichIod and Neotyphodium species that were previously not possible. Plants may be transformed with constructs containing either over expression cassettes 15 or silencing constructs. Apyrase expression may then be analysed, for example by Northern blot analysis, RT-PCR or by using antibodies to apyrase. The ability of apyrase null plants (e.g. ryegrass) to form symbioses may be demonstrated by performing inoculations with suitable strains of endophyte, mycorrhizae and rhizobium and comparing the level of symbiotic formation with wild type plants. Furthermore, 20 plants expressing an apyrase from a different grass species may be able to form a symbiotic relationship with strains of Epichlos and Neotyphodium species that were previously not possible. This may be demonstrated by performing inoculations with suitable strains of endophyte and comparing the level of symbiotic formation with wild type plants. 25 In a further aspect of the present invention there is provided RNAi constructs designed using the nucleic acids or nucleic acid fragments of the present invention. In one embodiment, the RNAi construct contains the apyrase sequence-derived nucleic acid fragments shown in Figure 28 (SEQ ID NO: 16), or functionally active fragments or WO 2007/019616 PCT/AU2006/001161 15 variants thereof. In a further embodiment the RNAi construct containing the apyrase sequence-derived nucleic acid fragments shown in Figure 30 (SEQ ID NO: 17) or functionally active fragments or variants thereof. 5 In a further embodiment the RNAi construct containing the apyrase sequence-derived nucleic acid fragments shown in Figure 32 (SEQ ID NO: 18), or functionally active fragments or variants thereof. In a further embodiment the RNAi construct containing the apyrase sequence-derived nucleic acid fragments shown in Figure 34 (SEQ ID NO: 19), or functionally active 10 fragments or variants thereof. In a further embodiment the RNAi construct containing the apyrase sequence-derived nucleic acid fragments shown in Figure 36 (SEQ ID NO: 20), or functionally active fragments or variants thereof. LIST OF FIGURES 15 Figure 1. Dendrogram analysis of aligned apyrase sequences. Figure 2. (A) Nucleic acid sequence of 6RG cDNA (open reading frame indicated by overhead bar) (SEQ ID NO: 1), and (B) translated sequence of 6RG open reading frame (SEQ ID NO: 2). Figure 3. (A) Nucleic acid sequence of 4WC cDNA (open reading frame indicated 20 by overhead bar) (SEQ ID NO: 3) and (B) translated sequence of 4WC open reading frame (SEQ ID NO: 4). Figure 4. (A) Nucleic acid sequence of 7WC cDNA (open reading frame indicated by overhead bar) (SEQ ID NO: 5) and (B) translated sequence of 7WC open reading frame (SEQ ID NO: 6).

WO 2007/019616 PCT/AU2006/001161 16 Figure 5. Vector map of C-terminal 6RG::His in pET28. Figure 6. Sequence feature map of C-terminal 6RG::His in pET28 (SEQ ID NOS: 7 [nucleotide sequence] and 8 [amino acid sequence]). Figure 7. Vector map of mature 4WC::His in pET28. 5 Figure 8. Sequence feature map of mature 4WC::His in pET28 (SEQ ID NOS: 9 [nucleotide sequence] and 10 [amino acid sequence]). Figure 9. Vector map of mature 7WC::His in pET28. Figure 10. Sequence feature map of mature 7WC::His in pET28 (SEQ ID NOS: 11 [nucleotide sequence] and 12 [amino acid sequence]). 10 Figure 11. Coomassie stained SDS-PAGE analysis of recombinant C-terminal 6RG in pET28 expressed in E. coli. Arrows indicate recombinant 6RG Lanes 0, 5: protein marker Lanes 1, 2, 3, 4, 6: pET28-7WC Lane 1 induction 0 hr 15 Lane 2 induction 3 hr Lane 3 soluble proteins Lane 4 inclusion bodies Lane 6: Nickel column eluate (major fraction) Figure 12. Coomassie stained SDS-PAGE analysis of recombinant mature 4WC in 20 pET28 expressed in E. coli. Arrows indicate recombinant 4 WC. Lane 0: protein marker Lane 1 to lane 5: pET28 without insert Lane 6 to lane 11: pET28 - 4WC Lane 1 and lane 6: induction 0 hr WO 2007/019616 PCT/AU2006/001161 17 Lane 2 and lane 7: induction 1 hr Lane 3 and lane 8: induction 3 hr Lane 4 and lane 9: soluble proteins Lane 5 and lane 10: inclusion bodies 5 Lane 11: whole gel elution(major fraction) Figure 13. Coomassie stained SDS-PAGE analysis of recombinant mature 7WC in pET28 expressed in E. coli. Arrows indicate recombinant 7WC. Lane 0: protein marker Lane 1 to lane 5: pET28 without insert 10 Lane 6 to lane 11: pET28 - 7WC Lane 1 and lane 6: induction 0 hr Lane 2 and lane 7: induction 1 hr Lane 3 and lane 8: induction 3 hr Lane 4 and lane 10: soluble proteins 15 Lane 5 and lane 9: inclusion bodies Lane 11: whole gel elution(major fraction) Figure 14. Immunoblot analysis to determine antisera titre of anti-6RG. A) Anti-6RGcc antibody screened against purified recombinant mature 6RG and C-terminal 6RG. Anti-6RGcc antibodies were shown to recognise both 6RGfn (expected size = 47kD) 20 and 6RGcc (expected size = 26kD). The relative sizes of the multiple bands detected on the Immunoblot containing 6RGcc indicated that multimers of the 6RGcc peptide were forming. B) To confirm the presence of multimers, 6RGcc was run on a urea / SDS-PAGE denaturing, reducing gel, blotted and again screened with anti-6RGcc antibodies. Only a single peptide band was detected (down to a titre of 1:25,600), 25 confirming that the numerous higher molecular weight bands seen in the 6RGcc samples run on a non-reducing SDS-PAGE gel (A) were multimers of 6RGcc. Figure 15. Immunoblot analysis to determine anti-6RG sensitivity to 6RG. Titre: 1:1000 exposure time 2 min.

WO 2007/019616 PCT/AU2006/001161 18 Figure 16. Immunoblot analysis to determine antisera titre of anti-4WC. Purified antigen (protein 4WC) was run a 10% SDS PAGE as a preparative gel then was transferred on the Sequi-Blot PVDF membrane that was cut to many stripes. Every strip was tested a different titre. Blotting was detected by chemiluminescence's method (100 5 ng antigen, 30 sec exposure). Figure 17. Immunoblot analysis to determine anti-4WC sensitivity to 4WC. A range of purified antigen (100ng, 50ng 25ng, 12.5ng and 6.25ng) was run a 10% SDS PAGE and then transferred on the membranes. Two concentrations of antibody titres (1:1000 and 1:500) were against the membranes and the blotting was detected by 10 chemiluminescence's method. Figure 18. Immunoblot analysis to determine anti 4WC specificity. Purified proteins 6rg and 7wc (250ng) were run on SDS PAGE and transferred on membrane. High titres of antibody 4wc (1:100 and 1:200) were used to against the membrane. The blot was detected by chemiluminescence's method (30 sec exposure). 15 Figure 19. Immunoblot analysis to determine antisera titre of anti-7WC. Purified antigen (protein 7wc) was run a 10% SDS PAGE as a preparative gel then was transferred on the Sequi-Blot PVDF membrane that was cut to many stripes. Every strip was tested a different titre. Blotting was detected by chemiluminescence's method (100 ng antigen, 10 min exposure). 20 Figure 20. Immunoblot analysis to determine anti-7WC sensitivity to 7WC. A range of purified antigen (100ng, 50ng 25ng, 12.5ng and 6.25ng) was run a 10% SDS PAGE and then transferred on the membranes. Two concentrations of antibody titres (1:1000 and 1:500) were against the membranes and the blotting was detected by chemiluminescence's method. 25 Figure 21. Immunoblot analysis to determine anti-7WC specificity. Determination of Anti 7WC cross reactivity to recombinant 4WC and Lotus japonics root extract by immunoblot. Antibody titre = 1:400. 80pjl root extract = 21 mg (FW) equivalents of Lotus roots.

WO 2007/019616 PCT/AU2006/001161 19 Figure 22. Region of 6RG genomic sequence used to probe ryegrass Northern blot. Probe covers part of the second last exon, as well as the last exon and 3'UTR (SEQ ID NO: 13 [nucleotide sequence], SEQ ID NO: 14 [amino acid sequence, second last exon], SEQ ID NO: 15 [amino acid sequence, last exon]). 5 Figure 23. Northern blot analysis showing spatial and temporal expression of 6RG in ryegrass. Total RNAs were extracted by Trizol method. 10 pg of Total RNA was loaded on a 1.2% of formaldehyde denature agarose gel and transferred to the membrane by 20x SSC. The membrane was hybridisated by the probe 6RG (61 Obp fragment with two exons and one intron of 3'-end) in Church Buffer at 65'C overnight following by high 10 stringency washing. Figure 24. Immunoblot analysis showing expression of 6RG in ryegrass (Nui cultivar). Total proteins were extracted from seedlings germinated in either light or dark conditions. Proteins were loaded on a 10% SDS PAGE and then transferred to the membrane. Antibody 6RG (1:1000) was against the membrane and the blot was 15 detected by chemiluminescence's method. Arrows indicated the presence of immunoreactive bands of the correct predicted size. Figure 25. Immunoblot analysis showing spatial and temporal expression of 4WC in white clover. Total proteins were extracted from white clover shoots and roots germinated for a week under the condition of 25'C, light/darkness=16/8 photoperiod, 20 seedlings germinated under the same condition except total darkness for a week, and leaves harvested from greenhouse. Two different concentrations of total proteins were loaded on a 10% SDS PAGE and then transferred to the membrane. Antibody 4WC (1:1000) was against the membrane and the blot was detected by chemiluminescence's method (2 min exposure). 25 Figure 26. Immunoblot analysis showing spatial and temporal expression of 7WC in white clover. Total proteins were extracted from white clover shoots and roots germinated for a week under the condition of 25'C, light/darkness=16/8 photoperiod, seedlings germinated under the same condition except total darkness for a week, and leaves harvested from greenhouse. Two different concentrations of total proteins were WO 2007/019616 PCT/AU2006/001161 20 loaded on a 10% SDS PAGE and then transferred to the membrane. Antibody 7WC (1:1000) was against the membrane and the blot was detected by chemiluminescence's method (2 min exposure). Figure 27. Vector map of pCHO4. Shuttle vector containing the RNAi construct of 6RG 5 coding region spanning apyrase domains 1-2, designed to specifically silence the expression of 6RG transcripts. Figure 28. Sequence feature map of pCHO4 (SEQ ID NO: 16). Shuttle vector containing the RNAi construct of 6RG coding region spanning spyrase domains 1-2, designed to specifically silence the expression of 6RG transcripts. 10 Figure 29. Vector map of pCH05. Shuttle vector containing the RNAi construct of 6RG construct of 6RG coding region between the last apyrase domain and the first hydrophobic domain, designed to specifically silence the expression of 6RG transcripts. Figure 30. Sequence feature map of pCH05 (SEQ ID NO: 17). Shuttle vector containing the RNAi construct of 6RG coding region between the last apyrase domain 15 and the first hydrophobic domain, designed to specifically silence the expression of 6RG transcripts. Figure 31. Sequence feature of map pCH05. Shuttle vector containing the RNAi construct of 6RG coding region between the last apyrase domain and the first hydrophobic domain, designed to specifically silence the expression of 6RG transcripts. 20 Figure 32. Sequence feature map of pCH17b (SEQ ID NO: 18). Plant binary vector containing the RNAi construct of 7WC coding region spanning coding region between the last apyrase domain and the first hydrophobic domain, designed to specifically silence the expression of 7WC transcripts. Figure 33. Vector map of pCH18b. Plant binary vector containing the RNAi construct 25 of 7WC coding region spanning apyrase domains 1-2, designed to specifically silence the expression of 7WC transcripts.

WO 2007/019616 PCT/AU2006/001161 21 Figure 34. Sequence feature map of pCH18b (SEQ ID NO: 19). Plant binary vector containing the RNAi construct of 7WC coding region spanning apyrase domains 1-2, designed to specifically silence the expression of 7WC transcripts Figure 35. Vector map of pCH19b. Plant binary vector containing the RNAi construct 5 of 4WC coding region between the last apyrase domain and the first hydrophobic domain, designed to specifically silence the expression of 4WC transcripts. Figure 36. Sequence feature map of pCH19b (SEQ ID NO: 20). Plant binary vector containing the RNAi construct of 4WC coding region between the last apyrase domain and the first hydrophobic domain, designed to specifically silence the expression of 10 4WC transcripts. Figure 37. PCR - gel analysis of transgenic ryegrass. A) genomic samples amplified using the hygromycin primers, expected band size = 375bp (arrow). B) genomic samples amplified using the ocs terminator primers, expected band size = 439bp (arrow). 15 Figure 38. Southern blot analysis of RNAi white clover plants using the BAR ORF as the probe. The invention will now be described with reference to the following non-limiting examples. It should be understood that the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention 20 described above. EXAMPLES Example 1 Cloning apyrases Clones were chosen from ryegrass and white clover EST libraries by BLAST (Altschul et 25 al., 1990) searching the EST databases using translated exon sequences from public WO 2007/019616 PCT/AU2006/001161 22 domain apyrase sequences. Sequence alignment analysis EST sequences were translated and aligned to published apyrase peptide sequences and to translated sequences from published apyrase cDNAs. Sequences were aligned 5 using the PileUp programme on the Wisconsin Package Version 10.3, Accelrys Inc., San Diego, CA. This analysis generates a single alignment output and a non statistically analysed dendogram tree based on the alignment (Figure 1). N-terminal sequence data (where available) was analysed by TargetP V1.0 (Emanuelsson et al., 2000) and SignalP V2.0 (Bendtsen et al., 2004.). The predictions 10 from these analyses were summarised and are presented in Figure 1. Three clones were selected; including: 4WC, 7WC, 6RG These full length clones were selected based on their clustering along with their predicted sub-cellular targeting and potential cleavage site of the signal sequence. The white clover clones (4WC and 7WC) were chosen since they align closely with the 15 apyrases Db-LNP and Lj-LNP (predicted secretory apyrases) that are involved in the establishment of symbiotic relations and possibly in cell-cell interaction. Two white clover clones were selected since one belonged to a clade containing sequences from only indeterminate nodule forming legume species and the other belonged to a clade that contains only legume sequences but from both determinate and indeterminate 20 nodule forming species. Both Db-LNP and Lj-LNP are from determinate nodule forming legumes and have been shown to have roles in establishing legume/rhizobium and legume/mycorhizzal symbioses (Etzler and Murphy 2002; Etzler and Roberts 2001; 2005). Furthermore, Kalsi and Etzler (2000) have shown that Db-LNP is a peripherally membrane bound protein. The white clover clones serve as controls from which to 25 compare the analysis of the ryegrass apyrase clone 6RG. 6RG was chose as it contains secretory elements and therefore has the potential to be on the cell surface and involved in cell-cell interaction.

WO 2007/019616 PCT/AU2006/001161 23 The 6RG clone contains the full length open reading frame (Figure 2). The translated sequence of 6RG clusters with a clade that contains other sequences from monocotyledons only, all of which are predicted to be secretory proteins (Figure 1).The 4WC clone contains the full length open reading frame (Figure 3). Translated sequence 5 of 4WC clusters with known LNP clones from both indeterminate and determinate nodule forming species of legume. The 7WC clone contains the full length open reading frame (Figure 4). Translated sequence of 7WC clusters with potential LNP clones containing only sequences from indeterminate nodule forming species of legume. Example 2 10 Protein expression and generation of polyclonal antisera A 711 base pair section of the C-terminal of 6RG was cloned into the pET28 expression vector (Figures 5 & 6) to express a 237 amino acid 6RG peptide with a C-terminal 6xHis tag. A culture of pCH25 in BL21 E coli cells was initiated and incubated at 37 0 C. When the 15 culture had grown to an OD 600 of 0.6-0.7, expression of C-terminal 6RG was induced by the addition of IPTG (isopropyl p-D-thiogalactopyranoside), and the culture was incubated for a further 3h at 37 0 C. The culture was harvested and inclusion bodies isolated. Samples taken during the induction period and a sample from the inclusion body prep were analysed on an SDS-PAGE gel (Figure 11). 20 Proteins from the inclusion body prep were solubilised in buffered 6M urea and passed down a Nickel Affinity Column. Selected fractions were dialysed against PBS and concentrated to 0.35pg/pL by lyophilisation. These fractions were further purified by whole gel elution from an SDS-PAGE gel (Figure 11). Sufficient quantities (3-400pg) of the truncated C-terminal 6RG protein was purified 25 using a 3 step process utilizing inclusion body preparation, affinity purification (Ni3* column for His tag) and gel elution. 300 pg of purified protein was injected into a rabbit over a period of 3 injections (4 weeks) to generate anti-apyrase polyclonal antibodies. Prior to immunisation a 'pre-bleed' blood sample was removed from the rabbit for WO 2007/019616 PCT/AU2006/001161 24 comparison of specificity between pre- and post-immunisation antibody titres. The sequences encoding the mature peptides of 4WC and 7WC were separately cloned in frame into pET28a providing C-terminal His tag fusions (Figures 7 & 8 and 9 &10 respectively) and transformed into BL21 E. coli cells for recombinant protein expression. 5 Induction, localisation and size determination studies were performed for each construct. In each case the protein was the predicted size (based on PAGE) and was targeted predominantly to the inclusion bodies (Figures 12 and 13 respectively). Sufficient quantities (3-400pg) of each of the protein products from these clones was purified using a 3 step process utilizing inclusion body preparation, affinity purification 10 (Ni 2 + column for His tag) and gel elution (Figures 12 and 13 respectively). 300 pg of each purified protein was injected into separate rabbits over a period of 3 injections (4 weeks) to generate anti-apyrase polyclonal antibodies. Prior to immunisation a 'pre-bleed' blood sample was removed from the rabbit for comparison of specificity between pre- and post-immunisation antibody titres. 15 Rabbit polyclonal antibodies generated against E. coli expressed, C-terminal 6RG were analysed by immunoblot to determine titre and specificity. The maximum titre that was still able to detect 100ng (-0.0001 OD 280 ) of purified recombinant 6RG was between 1:12,800 and 1:25,000 (Figure 14). The maximum sensitivity by immunoblot was 12.5ng using a 1:1000 dilution (Figure 15). The pre-immune antibody serum has a 20 negligible cross reactivity to recombinant 6RG. Rabbit polyclonal antibodies generated against E. coli expressed, mature 4WC were analysed by immunoblot (chemiluminesence detection of Horse Radish Peroxidase activity) to determine titre and specificity. The maximum titre that was still able to detect 1 OOng (-0.0001 OD 2 80 ) of purified recombinant 4WC was between 1:3,200 and 1:6,400 25 (Figure 16). The maximum sensitivity by immunoblot was 12.5ng using a 1:500 dilution (Figure 17). Antiserum generated against 4WC is also able to detect recombinant 7WC but not 6RG (Figure 18). Rabbit polyclonal antibodies generated against E. coli expressed, mature 7WC were analysed by immunoblot to determine titre and specificity. The maximum titre that was WO 2007/019616 PCT/AU2006/001161 25 still able to detect 100ng (-0.0001 OD 2 80 ) of purified recombinant 7WC was between 1:6,400 and 1:12,800 (Figure 19). The maximum sensitivity by immunoblot was 25ng using a 1:500 dilution (Figure 20). Antiserum generated against 7WC is not able to detect recombinant 4WC (Figure 21). 5 Example 3 Spatial and temporal expression analysis of 6RG, 4WC and 7WC For 6RG spatial and temporal analysis we performed Northern blot analysis on the following ryegrass tissues: shoots from seedlings germinated and grown for I week in 16hr day light conditions; roots from the same seedlings; whole seedlings grown for 1 10 week in the dark; leaves from plants grown in the glass house; immature inflorescence (x2); flowers; pollen (x2). From each sample I Opg of total RNA was run in a denaturing gel and transferred to nylon membrane. The blot was probed with a 610 base genomic probe consisting of the region encoding the last 2 exons and last intron and the 3' untranslated region (Figure 22). The Northern blot shows the transcript is highly 15 expressed both the shoots and roots of young seedlings and to a lesser extent in immature inflorescences (Figure 23). Immunoblot analysis of ryegrass (Nui cultivar) seedlings germinated in either light or dark conditions also showed the presence of immunoreactive bands of the predicted size, indicating that 6RG was expressed under both these conditions (Figure 24). 20 Four white clover tissue types were analysed by immunoblot using antiserum generated against recombinant 4WC or 7WC. Tissue included: shoots from seedlings germinated and grown for 1 week in 16hr day light conditions; roots from the same seedlings; whole seedlings grown for 1 week in the dark; first fully expanded leaves (3rd node below the apex) from plants grown in the glass house. 25 Anti 4WC detected 2 bands in the root and 3 or more bands in the whole seedlings (Figure 25). In the roots these bands corresponded to approximately 46 and 55kDa, in the whole seedling the bands corresponded to approximately 46, 55 and 60kDa. No immunogenic protein was detected in the shoots or leaves.

WO 2007/019616 PCT/AU2006/001161 26 Antiserum against 7WC detected I band in the root and 1 band in the whole seedlings (Figure 26). In both the roots and the whole seedlings the band corresponded to approximately 55kDa. Like anti 4WC, anti 7WC did not detect any immunogenic protein in the shoots or leaves. 5 Example 4 RNAi construct design The N-terminal half of the apyrase coding sequence encodes for 4 apyrase domains; this region is highly conserved (Handa and Guidotti, 1996; Roberts et al., 1999; Etzler and Roberts, 2002). In comparison, the C-terminal half of the nucleotide sequence, 10 coding for the conserved cysteines, is relatively divergent. In order to generate plants with effective apyrase silencing we created a number of constructs using different regions of the cDNA clones; these are summarised in Table 1. Table 1. RNAi construct design table. Species DNA source RNAi design RNAi target RNAi construct # ryegrass Clone 6RG coding region spanning potentially all pCHO4 apyrase domains 1-2 ryegrass apyrases Figures 27-28 ryegrass Clone 6RG coding region between 6RG and alleles pCH05 the last apyrase domain Figures 29-30 and the first hydrophobic domain white Clone 7WC coding region spanning potentially all white pCH18b clover apyrase domains 1-2 clover apyrases Figures 31-32 white Clone 7WC coding region between 7WC and alleles pCH17b clover the last apyrase domain Figures 33-34 and the first hydrophobic domain white Clone 4WC coding region between 4WC and alleles pCH19b clover the last apyrase domain Figures 35-36 and the first WO 2007/019616 PCT/AU2006/001161 27 hydrophobic domain Example 5 Transformation of Lo//um perenne by microprojectile bombardment of embryogenic callus 5 Lolium perenne was transformed using an adapted protocol from Altpeter et al, 2000 and Klein et al, 1992, using co-transformation of plasmids. One plasmid (pAcH1) contained the hygromycin phosphotransferase gene conferring resistance to the antibiotic hygromycin expressed from the rice actin promoter and the second plasmid contained the genetic construct of interest for transformation. Plasmids were mixed in a 10 one to one ratio at 1 ig/tLand simultaneously coated onto the microcarriers. Genomic DNA from hygromycin resistant (transformed) ryegrass plantlets was analysed by PCR using hygromycin specific primers which give a 375bp product: HPT-1 GCTGGGGCGTCGGTTTCCACTATCCG (SEQ ID NO: 21) HPT-2 CGCATAACAGCGGTCATTGACTGGAGC (SEQ ID NO: 22) 15 Genomic DNA from hygromycin resistant ryegrass plantlets was also analysed by PCR using terminator specific primers to confirm the gene of interest (RNAi construct) had been co-integrated with the hygromycin construct, the terminator specific primers give a 439bp product: ocs3' forward GATATGCGAGACGCCTATGA (SEQ ID NO: 23) 20 reverse primer for ocs3' GAGTTCCCTTCAGTGAACGT (SEQ ID NO: 24) The results of PCR analysis are shown in Table 2.

WO 2007/019616 PCT/AU2006/001161 28 Table 2. Ryegrass transformation results using RNAi constructs pCH04 and pCH05. Plant Selection Construct DNA Hygromycin OCS Terminator Code Number PCR PCR Result Result AFT2001 hygromycin pCH04 319 + + AFT2002 hygromycin pCH04 317 + + AFT2003 hygromycin pCHO4 323 + + AFT2004 hygromycin pCH04 299 + AFT2005 hygromycin pCHO4 310 + AFT2006 hygromycin pCHO4 327 + + AFT2007 hygromycin pCHO4 306 + + AFT2008 hygromycin pCHO4 325 + AFT2009 hygromycin pCH04 303 + AFT2010 hygromycin pCH04 347 + AFT2011 hygromycin pCH04 329 + + AFT2012 hygromycin pCHO4 346 + + AFT2013 hygromycin pCHO4 344 + + AFT2014 hygromycin pCHO4 353 + AFT2015 hygromycin pCHO4 455 + N/A AFT2101 hygromycin pCH04 326 + + AFT2102 hygromycin pCHO4 328 + + AFT2103 hygromycin pCH04 341 + + AFT2104 hygromycin pCH04 315 + + AFT2105 hygromycin pCH04 316 + + AFT2106 hygromycin pCHO4 322 + + AFT2107 hygromycin pCH04 340 + AFT2108 hygromycin pCHO4 324 + + AFT2109 hygromycin pCHO4 357 + + AFT2110 hygromycin pCHO4 330 + + WO 2007/019616 PCT/AU2006/001161 29 AFT21 11 hygromycin pCHQ4 358 + AFT2112 hygromycin pCHO4 337 + + AFT2113 hygromycin pCHO4 373 + + AFT2114 hygromycin pCHO4 453 + + AFT2116 hygromycin pCHO4 374 + + AFT2117 hygromycin pCH04 367 + + AFT2118 hygromycin pCH04 454 + N/A AFT2201 hygromycin pCHO4 312 + AFT2203 hygromycin pCHO4 314 + AFT2204 hygromycin pCHO4 308 + + AFT2205 hygromycin pCHO4 334 + + AFT2206 hygromycin pCHO4 336 + + AFT2207 hygromycin pCH04 343 N/A + AFT2208 hygromycin pCHO4 354 + + AFT2209 hygromycin pCHO4 356 + + AFT2301 hygromycin pCH05 332 + + AFT2302 hygromycin pCH05 335 + + AFT2303 hygromycin pCH05 348 + + AFT2304 hygromycin pCH05 355 + + AFT2305 hygromycin pCH05 371 + + AFT2307 hygromycin pCH05 370 + + AFT3601 hygromycin pCH05 439 + N/A AFT3602 hygromycin pCH05 440 .+ N/A AFT3603 hygromycin pCH05 441 + N/A AFT3604 hygromycin pCH05 442 + N/A AFT3605 hygromycin pCH05 443 + N/A AFT3606 hygromycin pCH05 444 + N/A AFT3607 hygromycin pCH05 445 + N/A WO 2007/019616 PCT/AU2006/001161 30 AFT3608 hygromycin pCH05 446 + N/A AFT3609 hygromycin pCH05 447 + N/A AFT4001 hygromycin pCH05 452 + N/A AFT4002 hygromycin pCH05 456 + N/A PCR gel analysis of ryegrass transformants are shown in Figure 37.

WO 2007/019616 PCT/AU2006/001161 31 Example 5 White Clover Transformation White clover was transformed according to the following procedure (modifed from Hiei et al, 1994; Voisey et al, 1994 and Larkin et al, 1996) Transform Agrobacterium tunefacians (LBA4404) with plasmid of interest Sterilise seeds I Culture in TY medium to Soaked in sH 2 0 at stationary phase 17"C for overnight I Harvest agrobacteria by centrifugation Dissect the seeds I Ir Resupend agrobacteria in MMS Infected with agrobacteria ( and keep on bench for 1 hour Blot off excess agrobacteria Transfer to co-culture medium and incubate at 25*C darkness for 3 days Wash the cotyledons with B5 plus cefemtoxin Blot off excess buffer and transfer to selection medium, incubate at 25 0 C with 16hr light 8hr dark for 3 weeks Transfer shoots onto root generation medium and culture for additional 1-2 months Transfer plantlets to 500mL pottles and culture at 25 0 C for 1 month 5 Transfer to the soil and grow in glasshouse White clover RNAi transformants were analysed by Southern blot analysis using BAR ORF as the probe. The results are shown in Figure 38.

WO 2007/019616 PCT/AU2006/001161 32 Example 6 Analysis of transformants by immunoblot and endophyte analysis inoculations. Plants transformed with constructs containing either over expression cassettes or silencing may be analysed for apyrase expression by Northern blot analysis, RT-PCR or 5 by using the antibodies developed above. Ryegrass apyrase null plants will be endophyte- and mycorrhizae-(Etzler and Roberts 2001; 2005), while white clover apyrase null plants will be nodulation- and mycorrhizee- (Etzler and Murphy 1999; Etzler and Roberts, 2002). This may be demonstrated by performing inoculations with suitable strains of endophyte, mycorrhizae and rhizobium and comparing the level of symbiotic 10 formation withwild type ryegrass and white clover. In comparison, ryegrass plants expressing an apyrase from a different grass species may be able to form a symbiotic relationship with strains of EpichIo6 and Neotyphodium species that were previously not possible. This may be demonstrated by performing inoculations with suitable strains of endophyte and comparing the level of symbiotic formation with wild type ryegrass. 15 REFERENCES Altpeter, F., XU, J., and Ahmed, S. (2000). Generation of large numbers of independently transformed fertile perennial ryegrass (Loilum perenne L.) plants of forage- and turf type cultivars. Molecular Breeding 6:519-528. Altschul, S.F., Gish, W., Miller, W., Myers, E.W. and Lipman, D.J. (1990) "Basic local 20 alignment search tool." J. Mol. Biol. 215:403-410. Bendtsen, JD. Nielsen, H., von Heijne G., and Brunak S. (2004). Improved prediction of signal peptides: SignalP 3.0. J. Mol. Biol., 340:783-795. Cohn JR, Uhm T, Ramu S, Nam YW, Kim DJ, Penmetsa RV, Wood TC, Denny RL, Young ND, Cook DR, and Stacey G.(2001). Differential regulation of a family of 25 apyrase genes from Medicago truncatula. Plant Physiol. 125(4):2104-19. Emanuelsson, 0., Nielsen, H., Brunak, S., and von Heijne, G. (2000). Predicting WO 2007/019616 PCT/AU2006/001161 33 subcellular localization of proteins based on their N-terminal amino acid sequence. J. Mol. Biol., 300:1005-1016. Etzler, M.E., Kalsi, G., Ewing, N.N., Roberts, N.J., Day, R.B., & Murphy, J.B. (1999) A Nod Factor Binding Lectin With Apyrase Activity On The Surface Of Legume Root 5 Hairs. PNAS (USA) 96, 5856-5861. Etzler, M.E. & Murphy, J.B. Nod factor binding protein from legume roots. United States Patent 6,465,716 October 15, 2002 Etzler, M.E. & Roberts, N.J. LNP, A Protein Involved in the Initiation of Mycorrhizal Infection of Plants. U.S. Patent Application No. 09/657,631. International Publication 10 Number WO 02/20725 A2. 2001 Etzler, M.E. & Roberts, N.J. LNP, a protein involved in the initiation of mycorrhizal infection in plants. United States Patent 6,849,777 February 1, 2005 Frohman MA, Dush MK, and Martin GR. (1988). Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide 15 primer. Proc Natl Acad Sci U S A. 85(23):8998-9002. Gualtieri G, and Bisseling T. (2000). The evolution of nodulation. Plant Mol Biol. 42(1):181-94. Review. Handa M, and Guidotti G. (1996). Purification and cloning of a soluble ATP diphosphohydrolase (apyrase) from potato tubers (Solanum tuberosum). Biochem 20 Biophys Res Commun. 218(3):916-23. Documents cited in this specification are for reference purposes only and their inclusion is not acknowledgment that they form part of the common general knowledge in the relevant art.

Claims (19)

1. 2. A nucleic acid or nucleic acid fragment according to claim 1, wherein said nucleic acid or nucleic acid fragment includes a nucleotide sequence shown in SEQ ID NO 1, said nucleic acid or nucleic acid fragment having a size of at least 60 nucleotides.
2. 3. A nucleic acid or nucleic acid fragment according to claim 1 or 2, wherein said nucleic acid is from a Lolium species.
3. 4. A nucleic acid or nucleic acid fragment according to claim 3, wherein said Lolium species is Lolium perenne. o 5. A substantially purified or isolated polypeptide encoded by a nucleic acid according to any one of claims 1 to 4.
4. 6. A construct including a nucleic acid according to any one of claims 1 to 4.
5. 7. A construct according to claim 6, wherein said construct is a vector.
6. 8. A vector according to claim 7, further including a promoter and a terminator, 5 said promoter, nucleic acid or nucleic acid fragment and terminator being operatively linked. - 35
7. 9. A construct according to claim 6, wherein said construct is an RNAi construct.
8. 10. A construct according to claim 9, including a nucleotide sequence shown in SEQ ID NO: 16 or 17, or a functionally active fragment or variant thereof having at least approximately 80% identity to the sequence recited in SEQ ID NO: 16 or 17, 5 respectively.
9. 11. A construct according to claim 9 or 10, wherein said functionally active fragment or variant has at least approximately 90% identity to SEQ ID NO: 16 or 17, respectively.
10. 12. A construct according to claim 9, including a nucleotide sequence shown in o SEQ ID NO: 16 or 17.
11. 13. A plant cell, plant, plant seed or other plant part, including a construct according to any one of claims 6 to 12.
12. 14. A plant, plant seed or other plant part derived from a plant cell or plant according to claim 13 and including a construct according to any one of claims 6 to 12. 5 15. A method of modifying plant/endophyte symbioses in a plant, said method including introducing into said plant an effective amount of a nucleic acid according to any one of claims 1 to 4 or a construct according to any one of claims 6 to 12.
13. 16. A method according to claim 15, wherein said plant is a ryegrass or fescue species. 0 17. A method according to claim 15 or 16, wherein said endophyte is an Epichloe or Neotypodium species.
14. 18. A substantially purified, recombinant, synthetic or isolated apyrase polypeptide from a Lolium species, wherein said polypeptide includes an amino acid sequence selected from the amino acid sequence shown in SEQ ID NO: 2 and functionally active - 36 fragments and variants thereof having at least approximately 80% identity to the relevant part of SEQ ID NO: 2 and having a size of at least 20 amino acids.
15. 19. A polypeptide according to claim 18, wherein said functionally active fragments and variants have at least approximately 90% identity with the relevant part of SEQ ID NO: 2 and have a size of at least 20 amino acids.
16. 20. A polypeptide according to claim 18, wherein said polypeptide includes an amino acid sequence shown in SEQ ID NO: 2, said polypeptide having a size of at least 20 amino acids.
17. 21. A polypeptide according to any one of claims 18 to 20, wherein said polypeptide is from Lolium perenne.
18. 22. A nucleic acid or nucleic acid fragment according to claim 1, substantially as hereinbefore described with reference to any one of the figures or examples.
19. 23. A polypeptide according to claim 18, substantially as hereinbefore described with reference to any one of the figures or examples