AU2005330517A2 - Antiinfective lipopeptides - Google Patents
Antiinfective lipopeptides Download PDFInfo
- Publication number
- AU2005330517A2 AU2005330517A2 AU2005330517A AU2005330517A AU2005330517A2 AU 2005330517 A2 AU2005330517 A2 AU 2005330517A2 AU 2005330517 A AU2005330517 A AU 2005330517A AU 2005330517 A AU2005330517 A AU 2005330517A AU 2005330517 A2 AU2005330517 A2 AU 2005330517A2
- Authority
- AU
- Australia
- Prior art keywords
- compound
- amino
- asp
- resin
- methylpyrolidine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
- C07D403/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings
- C07D403/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D403/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00
- C07D403/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, not provided for by group C07D401/00 containing three or more hetero rings
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Oncology (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Communicable Diseases (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Description
WO 2006/110185 PCT/US2005/040919 ANTIINFECTIVE LIPOPEPTIDES CROSS-REFERENCE TO RELATED APPLICATIONS [0001] The present application claims the benefit of United States Provisional Application Numbers. 60/710,705, filed August 23, 2005 and 60/627, 056, filed November 12, 2004, which are hereby incorporated by reference in their entirety.
GOVERNMENT SUPPORT [0002] Portions of the work described herein were made with government support under Small Business Innovation Research (SBIR) Grant No. 5R44GM068173-03 and Grant No.lR43A156858-1. The government may have certain rights to such work.
FIELD OF THE INVENTION [0003] The present invention relates to novel depsipeptides compounds. The invention also relates to pharmaceutical compositions of these compounds and methods of using these compounds as antibacterial agents.
BACKGROUND OF THE INVENTION [0004] The rapid increase in the incidence of gram-positive infections -including those caused by resistant bacteria has sparked renewed interest in the development of novel classes of antibiotics. A class of compounds that has shown potential as useful antibiotic agents is the cyclic depsipeptides. A notable member of the cyclic depsipeptides is the A21978C lipopeptides described in, for example, United States Patents RE 32,333; RE 32,455; RE 32,311; RE 32,310; 4,482,487; 4,537,717; 5,912,226; 6,911,525; and 6,794,490 and International Patent Applications WO01/44272; WO01/44274; and WO01/44271. Additionally, the A54145 class of compounds described in United States Patents 4,994,270; 5,039,789; and 5,028,590 have also been shown to possess antibiotic activity.
[0005] Daptomycin, also known as LY146032, is comprised of an n-decanoyl side chain linked to the N-terminal tryptophan of a three-amino acid chain linked to a cyclic 10-amino acid peptide. Daptomycin has potent bactericidal activity in vitro and in vivo against clinically relevant gram-positive bacteria that cause serious and life-threatening diseases. These bacteria WO 2006/110185 PCT/US2005/040919 include resistant pathogens, such as vancomycin-resistant enterococci (VRE), methicillinresistant Staphylococcus aureus (MRSA), glycopeptide intermediate susceptible Staphylococcus aureus (GISA), vancomycin-resistant Staphylococcus aureus (VRSA), coagulase-negative staphylococci (CNS), and penicillin-resistant Streptococcus pneumoniae (PRSP), for which there are few therapeutic alternatives. See, Tally et al., 1999, Exp. Opin. Invest. Drugs 8:1223- 1238.
[0006] Despite the promise that existing antibacterial agents have shown, the need for novel antibiotics continues. Many pathogens have been repeatedly exposed to commonly used antibiotics. This exposure has led to the selection of variant antibacterial strains resistant to a broad spectrum of antibiotics. The loss of potency and effectiveness of an antibiotic caused by resistant mechanisms renders the antibiotic ineffective and consequently can lead to some lifethreatening infections that are virtually untreatable. As new antibiotics come to market, pathogens may develop resistance or intermediate resistance to these new drugs, effectively creating a need for a stream of new antibacterial agents to combat these emerging strains. In addition compounds that exhibit bactericidal activity offer advantages over present bacteriostatic compounds. Thus, novel antibacterial agents would be expected to be useful to treat not only "natural" pathogens, but also intermediate drug resistant and drug resistant pathogens because the pathogen has never been exposed to the novel antibacterial agent. New antibacterial agents may exhibit differential effectiveness against different types of pathogens.
SUMMARY OF THE INVENTION [0007] The present invention provides novel compounds that have antibacterial activity against a broad spectrum of bacteria, including drug-resistant bacteria, and processes for making these compounds.
WO 2006/110185 PCT/US2005/040919 [0008] The present invention provides, in one aspect, compounds of Formula I: and salts thereof; wherein: a) R 2 is an amino acid side chain, OH 0 O or NH 2 b) R 2 is H or alternatively R 2 together with R 2 forms a five or six-member heterocyclic ring;
NH
2 iO yOH"
NH
2 _1 X c) R is OH O or a non-proteinogenic amino a chain; d) R 5 is H or methyl; e) R 5 is H or an amino acid side chain derived from an N-methylamino acid.
Alternatively R 5 together with R 5 forms a five or six-member heterocyclic ring; f) R 6 is methyl or icid side 6
NH
2 g) R 8 is an amino acid side chain, methyl, O -OH or WO 2006/110185 WO 206/10185PCT/US2005!040919 h) R8* is H or, alternatively, R 8 together with R8* forms a five or six-member heterocyclic ring; OMe OH i) R 9 is 0 2 0HG Hor an amino acid side chain substituted with at least one carboxylic acid; j) R' 1 is an amino acid side chain, methyl, 0 ~~Hor H 2 k) RII is H or, alternatively, R" together with R 1 forms a five or six-member heterocyclic ring; 1) R 12is Hor CH 3 mn) R 13 is CH(CH 3 2
CH(CH
2
CH
3
)CH
3 -0
NH
2 N vv H or ;and n) each of R 6 and R 8 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonammno.
WO 2006/110185 WO 206/10185PCT/US2005!040919 100091 In another aspect, the invention provides a compound of the Formula Fl: (F 1) and salts thereof; wherein:
NH
2 a) R 8 is hydrogen, 0 or OH.
0 b) R" is methyl, L' OH, orH 2 c) R 12 is H orCH 3 d) R' 3 is CH(CH,) 2
CH(CH
2
CH
3
)CH
3 0 NH 2 H or N1 and e) each of R' and R 6 is independently amino, monosubstituted. amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbarnoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino; WO 2006/110185 WO 206/10185PCT/US2005!040919 100101 The present invention provides, in another aspect, compounds of Formula F2: H02C
R
12
R
1 3 HN NH 0CONH 2 HI 0 0 00 0 H
H
3 C N N N R NH 0 H 0 H 0 NH CO 2
H/
0) N HN 0 H 0 HN R3 0 H0 2 C HN N N
R
6 Y H 0 0
HO
2 C (172) and salts thereof; wherein:
NH
2 a) R 8 is hydrogen, methyl, ,~'0,or b) R 12 is II or CH 3 c) R 13 is CH-(CH1 3 2
CH(CH
2
CH
3
)CH
3 ri or ;and d) each of R 6 and RS** is independently amino, monosubstititted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamnino, thioureido, iminoamino, or phosphonamino; WO 2006/110185 WO 206/10185PCT/US2005!040919 [0011] In another aspect, the invention provides compounds of Formula F3: HU2L;(F3) and salts thereof; wherein:
NH
2 a) R 8 is hydrogen, 01'1 OH ,Ro b) R1 1 is methyl, L H or NH 2 c) R 1 2 iSfOr Cf 3 and d) each of R 1 R 6 *and R8** is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamnino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0012] The present invention provides, in another aspect, compounds of Formula F4:
R
1 2
\.NH
H0 2
C
HN NH 0 0 0H 00 0 H
R
1 1- N N R NH 0 H 0 H 0= NH C0 2
H/
N
HN 0 H 0 HN
R
8 0 CIII
H
H0 2 C HN N T N 0 H0 2 C (F4) and salts thereof, wherein:
NH
2 a) R 8 is hydrogen, m-ethyl, 0,~0 or 0 b) R" 1 is methyl, or N 2 c0 R 12is H or CH 3 and d) each of R 1 R 6 *and Rg* is independently amino, monosubstituted amino, disubstituted.
amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamnino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 10013] In another aspect, the invention provides compounds of Formula
(FS)
and salts thereof, wherein:
NH
2 a) R 8 is hydrogen, methyl, ,Ro 0 b) R" 1 is methyl, 0, or ~N 2 and c) each of R1, R Vand R 8 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0014] The present invention provides, in another aspect, compounds of Formula F6: (F6) and salts thereof;, wherein:
NH
2 a) R' is/ or OH OMe OH b) R, is C0. G 2
H
c) R 11 is, methyl, or IO 2 0 P N H 2 R 1 2 is Hor CH 3 and R1 is amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [00151 In another aspect, the invention provides compounds of Formnula F7: -2 (F7) and salts thereof, wherein:
NH
2 a) R 8 is methyl, 0, OOH or R* OMe OH b) R is~ J -CO 2 H CO2H' "or0H c) R 12 is IorCH 3 and d) each of R 1 and R 8 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [00161 The present invention provides, in another aspect, compounds of Formula F8: H0 2 C NGO C 2
H
HNH
HN 0 00 0 H N R
R
1 1 N N NH0 H 0 H NH NCH 3
R
3
CONH
2
N
HN =0 H HO 0
HN
H
0 HN N N H0 0 H0 2 C (178) and salts thereof, wherein: a) R 3 is hydroxyl or hydrogen
N
2 b) R 8 is methyl, 0, 'OH orR c) R' 1 is an amino acid side chain, methyl, 0 OH~o -1 NH 2 d) R1 2 is Hor CH 3 and e) each of R1 and R8** is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [00171 In another aspect, the invention provides compounds of Formula F9:
(CH
2 4
R
8 (F9) and salts thereof; wherein: a) R 12 is Hor CH 3 ;and b) each of and R8* is independently amino, mlonosubstituted amino, disubstituted.
amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamnoyl, sulfonamnino, thioacylamnino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0018] The present invention provides, in another aspect, compounds of Formiul a F R 13 HOCH
CO
9
H
H 0 2 C N H HN 0 HO, 00 0H N N
R
NH 0 Ho 0 NH CONH 2
N
HN 0H O HN HO H 0 HN, N 6 YH 0 6 0 H0 2 C (F and salts thereof; wherein: a) R 1 3 is Hor CH 3 ;and b) each of RI, and R 6 is independently amino, monosubstituted amnino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, irninoamino, or phosphonamnino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [00191 In another aspect, the invention provides compounds of Formula F 11:
NH
0)
HN
0 H0 2 C HN...
Flu2%1(P11) and salts thereof; wherein: a) Rl1 3 1 is H or OH 3 and b) each of R 1 and R 6 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[00201 The present invention provides, in another aspect, compounds of Formula F 12: H02C Me
R
13 HNN NH 0CONH 2 HN0 0 00 0 H N R HN
N
H
2 NOG NH 0 H 0 H 0 NH C0 2
H/
HN 0 H 0 HN H02C1-t
OH
3 0 H HOC HN N 11- N R 6 0 H0 2 C (1712) WO 2006/110185 WO 206/10185PCT/US2005!040919 and salts thereof, wherein: 0 NH 2 AAI~x a) R" 3 is CH(CHCH 3 )CH, or and b) each of R' and R 6 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamnino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[00211 In another aspect, the invention provides compounds of Formula F 13: rlU 2 L' (Fl 3) and salts thereof; wherein each of R1, R 6*and R8** is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [00221 The present invention provides, in another aspect, compounds of Fonnul a F14: R 12 H0 2
C
HN NH 0CONH 2 00 0 H N N1
H
2 NOC NH 0 IH0 H 0) NH C0 2
H/
N
HN 0 H Meo 0 HN 0 H C>
H
0 2 C HN N N R 6 1 H0 0 H0 2 C (F 14) and salts thereof, wherein: a) R 1 2 is Hor CH 3 ;and b) each of R1 and R 6 is independently amino, mono substituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonainino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0023] In another aspect, the invention provides compounds of Formula F and salts thereof; wherein: a) R' 2 is Hor CH 3 and b) each of R' and R8** is independently amino, monosubstituted amino, disuabstituted amino, NH-amino protecting group, acylanino, urcido, guanidino, carbamnoyl, sulfonamino, thioacylamino, thioureido, imino amino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 100241 The present invention provides, in another aspect, compounds of Formul a Fl 16: H0 2 C R2C0 2
H
N H 7HN R1 0" 00 0 H N
R
N N
H
2 NOC NH 0 HH 0) NCH.
3 HO OH K N HN )0 H 0 (GH 2 4
R
8
HN
0
H
HO4 HN
N-
I H 'I 0 H0 2 C (F16) and salts thereof; wherein: a) R1 2 is Hor CH 3 ,and b) each of R' and is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [00251 In another aspect, the invention provides compounds of Formula F17:
-CONH
2
HO
Z-(Fl 7) and salts thereof, wherein: a) R 1 2 is HorC11 3 and b) R 1 is amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamnoyl, sulfonamino, thioacylamino, thioureido, imino am-ino, or phosphonamino.
WO 2006/110185 PCT/US2005/040919 [0026] The present invention provides, in another aspect, compounds of Formula F 18:
'CONH
2 rlu2% (F18) and salts thereof; wherein each of R and R 8 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[0027] In another aspect, the invention provides compounds of Formula F19: (F19) and salts thereof; wherein: WO 2006/110185 WO 206/10185PCT/US2005!040919 0 a) R' is /N) 1
"-NH
2 or 0 R6* b) R6 is methyl or c) R' is methyl or R n d) each of R R 6 and is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamnino, thioacylamino, thioureido, iminoamino, or phosphoniamino.
[0028] The present invention provides, in another aspect, compounds of Formula H0 2 CR1 HN NH 0CONH 2 H0 0 00 D H N N H H
H
2 NOC NH 0 0 0O NCH 3 HO CONH 2
N
HN 0 H MeD 0 (CH 2 4
HN
HO 0 HN -I N O 1 N 0 H0 2 C and salts thereof; wherein: a) R12is Hor CH 3 and b) each of R' and R8* is amino, monosubstituted amino, disulbstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylainino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 100291 In another aspect, the invention provides compounds of Formula F21 (1721) and salts thereof; wherein: a) R' is 0 N (CH 2 8
CH
3
H
H H LNy (CH 2 6
CH(CH
3 2
(CH
2 )sCH(CH 3
)CH
2
CH
3 0 -0
,,-N(CHA)
8
H(CHS)CH
2
CH,
0 My (CH 2 )aCH(CH 3 2 0 b) R 1 2 is Hor CH 3 and c) R is amino, mono substituted amino, disujbstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, imino amino, or phosphonamino.
WO 2006/110185 PCT/US2005/040919 [0030] In another aspect, the invention provides compounds of Formula F22 (F22) and salts thereof; wherein:
R
6 *is amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[0031] In another aspect, the present invention also provides pharmaceutical compositions including compounds of Formula I and compounds of Formula F1-F22, and methods of use thereof.
[0032] In yet another aspect, the present invention also provides antibacterial compositions including compounds of Formula I and compounds of Formula F1-F22, and methods of use thereof.
[0033] In a further aspect the present invention provides a process for preparing the compounds of Formula I and compounds of Formula F1 -F22.
BRIEF DESCRIPTION OF THE DRAWINGS [0034] Figure 1 shows a depiction of the biosynthetic genes cluster for daptomycin, A54145, and CDA. The numbers in parenthesis denote the amino acid number. The following abbreviations are used: Trp: tryptophan; Asn: asparagine; Asp: aspartic acid; Thr: threonine; Gly: 24 WO 2006/110185 PCT/US2005/040919 glycine; Om: ornithine; Ala: alanine; Ser: serine; MeGlu: 3-methylglutamic acid; Kyn: kynurenine; Glu: glutamic acid; hAsn: 3-hydroxyasparagine; Sar: sarcosine; Lys: lysine; OMeAsp: 3-methoxyaspartic acid; Ile: isoleucine; Val: valine; D-HPG:D-hydroxyphenyl glycine.
[0035] Figure 2 depicts the deletion of dptA-Hin S. roseosporus whereby a dptA-H deletion was constructed in S. roseosporus, by exchanging the tsr (thiostrepton resistance) and cat (chloramphenicol) for the dptA-H locus to construct the deletion in the chromosome of S.
roseosporus.
[0036] Figure 3 depicts the general method for "Red-mediated" gene replacement in the daptomycin NRPS pathway. The bacteriophage X-induced "hyper-recombination" state (the "Red" system or Red-mediated recombination) was used to construct both deletions within dptBC and to clone the replacement modules via a technique called "gap-repair". Abbreviations: condensation domain; "Asr", adenylation domain for serine; thiolation domain; epimerase domain.
[0037] Figure 4 depicts constructs from S. roseosporus combinatorial library.
[0038] Figure 5 depicts the module organization in dptBC (internal module for a D- amino acid in dptBC) and the terminal amino acid module (kynurenine) in dptD associated with the thioesterase. C:is a condensation domain. Circles containing amino acid 3 letter codes are adenylation domains specific to the amino acid: Asn: asparagines; Ala: alanine; Asp: aspartic acid; 3MGlu: 3-methylglutamic acid; and Kyn: kynurenine. T is a thiolation domain. E is an epimerization domain. TE is a thioesterase domain.
DETAILED DESCRIPTION OF THE INVENTION Definitions [0039] The term "acyl" denotes a carbonyl radical attached to an alkyl, alkenyl, alkynyl, cycloalkyl, heterocycyl, aryl or heteroaryl group, examples including, without limitation, such radicals as 8-methyldecanoyl, 10-methylundecanoyl, 10-methyldodecanoyl, n-decanoyl, 8methylnonanoyl, dodecanoyl, undecanoyl, acetyl and benzoyl. In one embodiment of the invention, the acyl group is an "alkanoyl" group which is defined as a carbonyl radical attached to an alkyl group. In another embodiment of the invention, the alkanoyl group is a "CI-C2oalkanoyl" group which is defined as an alkanoyl group containing a total of 1 to 20 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or WO 2006/110185 PCT/US2005/040919 branched chain. In another embodiment of the invention, the alkanoyl group is a "C 1
-C
1 5 alkanoyl" group which is defined as an alkanoyl group containing a total of 1 to 15 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoyl group is a "C-C 13 alkanoyl" group which is defined as an alkanoyl group containing a total of 1 to 13 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoyl group is a "C5-C20alkanoyl" group which is defined as an alkanoyl group containing a total of 5 to 20 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoyl group is a "Clo-C 2 0 alkanoyl" group which is defined as an alkanoyl group containing a total of 10 to 20 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoyl group is a "CIO-C13alkanoyl" group which is defined as an alkanoyl group containing a total of 1 to 13 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoyl group is 0
(CH
2 6
CH(CH
3 2 1 (CH2) 6
CH(CH
3
)CH
2 CH3 X (CH 2 8
CH
3 O i J (CH 2
)BCH(CH
3 )CH2C H 3
(CH
2 8
CH(CH
3 2 0 or o In another embodiment of the invention, the subsets of the term acyl are "unsubstituted alkanoyl" which is defined as carbonyl radical attached to an unsubstituted alkyl group and (2) "unsubstituted alkenoyl" which is defined as carbonyl radical attached to an unsubsituted alkenyl group.
[0040] The term "acylamino" is defined as a nitrogen radical adjacent to an acyl group. In one embodiment of the invention, the acylamino group is an "alkanoylamino" group which is defined as a nitrogen radical attached to an alkanoyl group. In another embodiment of the invention, the alkanoylamino group is a "C 1
-C
20 -alkanoylamino" group which is defined as a alkanoylamino group containing a total of 1 to 20 carbon atoms, including the carbonyl carbon.
WO 2006/110185 PCT/US2005/040919 The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoylamino group is a "C 1 -Cis- alkanoylamino" group which is defined as an alkanoylamino group containing a total of 1 to 15 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoylamino group is a "C 1
-C
13 alkanoylamino" group which is defined as an alkanoylamino group containing a total of 1 to 13 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoylamino group is a "C5-C 20 -alkanoylamino" group which is defined as a alkanoylamino group containing a total of 5 to 20 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoylamino group is a "Clo-C 20 alkanoylamino" group which is defined as an alkanoylamino group containing a total of 10 to carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoylamino group is a "Clo-C 1 3 alkanoylamino" group which is defined as an alkanoylamino group containing a total of 1 to 13 carbon atoms, including the carbonyl carbon. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkanoylamino group is O H H N (CH 2 )CH(CH3)2 N (CH 2 6
CH(CH
3
)CH
2
CH
3 N (CH2) 8
CH
3 H O 0 H H
(CH
2 8 CH(CHCHC N-!N (CHZ)gCH(CH 32 o ,or o [0041] The term "acyloxy" denotes an oxygen radical adjacent to an acyl group.
[0042] The term "alkenyl" is defined as linear or branched radicals having two to about twenty carbon atoms, preferably three to about ten carbon atoms, and containing at least one carbon-carbon double bond. One or more hydrogen atoms can also be replaced by a substituent group selected from acyl, acylamino, acyloxy, alkenyl, alkoxy, alkyl, alkynyl, amino, aryl, aryloxy, carbamoyl, carboalkoxy, carboxy, carboxyamido, carboxyamino, cyano, disubstituted WO 2006/110185 PCT/US2005/040919 amino, formyl, guanidino, halo, heteroaryl, heterocyclyl, hydroxy, iminoamino, monosubstituted amino, nitro, oxo, phosphonamino, sulfinyl, sulfonamino, sulfonyl, thio, thioacylamino, thioureido, or ureido. The double bond portion(s) of the unsaturated hydrocarbon chain may be either in the cis or trans configuration. Examples of alkenyl groups include, without limitation, ethylenyl or phenyl ethylenyl. A subset of term alkenyl is "unsubstituted alkenyl" which is defined as an alkenyl group that bears no substituent groups.
[0043] The term "alkoxy" denotes oxygen radical substituted with an alkyl, cycloalkyl or heterocyclyl group. Examples include, without limitation, methoxy, tert-butoxy, benzyloxy and cyclohexyloxy.
[0044] The term "alkyl" is defined as a linear or branched, saturated radical having one to about twenty carbon atoms unless otherwise specified. The term "lower alkyl" is defined as an alkyl group containing 1-4 carbon atoms. One or more hydrogen atoms can also be replaced by a substitutent group selected from acyl, acylamino, acyloxy, alkenyl, alkoxy, alkyl, alkynyl, amino, aryl, aryloxy, carbamoyl, carboalkoxy, carboxy, carboxyamido, carboxyamino, cyano, disubstituted amino, formyl, guanidino, halo, heteroaryl, heterocyclyl, hydroxy, iminoamino, monosubstituted amino, nitro, oxo, phosphonamino, sulfinyl, sulfonamino, sulfonyl, thio, thioacylamino, thioureido, or ureido. Examples of alkyl groups include, without limitation, methyl, butyl, tert-butyl, isopropyl, trifluoromethyl, nonyl, undecyl, octyl, dodecyl, methoxymethyl, 2-(2'-aminophenacyl), 3-indolylmethyl, benzyl, and carboxymethyl. Subsets of the term alkyl are "unsubstituted alkyl" which is defined as an alkyl group that bears no substituent groups and "substituted alkyl" which denotes an alkyl radical in which one or more hydrogen atoms is replaced by a substitutent group selected from acyl, acylamino, acyloxy, alkenyl, alkoxy, alkyl, alkynyl, amino, aryl, aryloxy, carbamoyl, carboalkoxy, carboxy, carboxyamido, carboxyamino, cyano, disubstituted amino, formyl, guanidino, halo, heteroaryl, heterocyclyl, hydroxy, iminoamino, monosubstituted amino, nitro, oxo, phosphonamino, sulfinyl, sulfonamino, sulfonyl, thio, thioacylamino, thioureido, or ureido. In another embodiment of the invention, the alkyl group is a "Ci-C2o-alkyl" group which is defined as a alkyl group containing a total of 1 to 20 carbon atoms. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkyl group is a
"CI-C
1 5 alkyl" group which is defined as a alkyl group containing a total of 1 to 15 carbon atoms. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkyl group is a "Ci-C 13 alkyl" group which is defined as an WO 2006/110185 PCT/US2005/040919 alkyl group containing a total of 1 to 13 carbon atoms. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkyl group is a "Cs-C 20 -alkanoyl" group which is defined as a alkyl group containing a total of 5 to 20 carbon atoms. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkyl group is a "Clo-C 20 alkyl" group which is defined as a alkyl group containing a total of 10 to 20 carbon atoms. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkyl group is a
"C
10
-C
13 alkyl" group which is defined as a alkyl group containing a total of 10 to 13 carbon atoms. In another embodiment of the invention, the alkyl group is a "C 9
-C
1 2 alkyl" group which is defined as a alkyl group containing a total of 9 to 12 carbon atoms. The carbon atoms can be arranged in a straight chain or branched chain. In another embodiment of the invention, the alkyl group is nonyl, 7-methyloctyl, 7-methylnonyl, n-decyl, 9-methylundecyl, 9-methyldecyl, nundecyl.
[0045] The term "alkylidenyl" is defined as a carbon radical of the formula Rx
RI
wherein Rx and Rxl are independently selected from hydrido or C 7
-C
17 unsubstituted alkyl, wherein the total number of carbons from R" and RX 1 does not exceed 17.
[0046] The term "alkynyl" denotes linear or branched radicals having from two to about ten carbon atoms, and containing at least one carbon-carbon triple bond. One or more hydrogen atoms can also be replaced by a substituent group selected from acyl, acylamino, acyloxy, alkenyl, alkoxy, alkyl, alkynyl, amino, aryl, aryloxy, carbamoyl, carboalkoxy, carboxy, carboxyamido, carboxyamino, cyano, disubstituted amino, formyl, guanidino, halo, heteroaryl, heterocyclyl, hydroxy, iminoamino, monosubstituted amino, nitro, oxo, phosphonamino, sulfinyl, sulfonamino, sulfonyl, thio, thioacylamino, thioureido, or ureido. An example of alkynyl group includes, without limitation, propynyl.
[0047] The term "amino" is defined as an NH 2 radical.
[0048] The term "amino acid" denotes a compound of the formula WO 2006/110185 PCT/US2005/040919 wherein Raa is an amino acid side chain. A "naturally occurring amino acid" is an amino acid that is found in nature. An "essential amino acid" is one of the twenty common amino acids: alanine, arginine, asparagine, aspartic acid, cysteine, glutamine, glutamic acid, glycine, histidine, isoleucine, leucine, lysine, methionine, phenyalanine, proline, serine, threonine, tryptophan, tyrosine and valine. A "non-proteinogenic amino acid" is any amino acid other than an essential amino acid. In this specification, the following abbreviations are used to describe specific amino acids: Abbreviation(s) Amino acid (MeO)Asp or (m)Asp or mAsp 3-methoxy-aspartic acid or moAsp or mo(Asp) (OH)Asn or h(Asn) or hAsn or 3-hydroxy-asparagine h-Asn (OH)Asp or h(Asp) or hAspor 3-hydroxy-aspartic acid h-Asp 3-MG 3-methylglutamic acid D-HPG D-hydroxyphenyl glycine Ala Alanine Asn Asparagines Asp Aspartic acid Glu Glutamic acid Gly Glycine Ile Isoleucine Kyn Kynurinine Lys Lysine Orn Ornithine Sar Sarcosine Ser Serine WO 2006/110185 PCT/US2005/040919 Abbreviation(s) Amino acid Thr Threonine Trp Tryptophan Val Valine In one aspect of the invention amino acids are 3-methoxy-aspartic acid, 3-hydroxy-asparagine,3hydroxy-aspartic acid, 3-methylglutamic acid, Alanine, Asparagine, Aspartic acid, Glutamic acid, Glycine, Isoleucine, Kynurinine, Lysine, Omithine, Sarcosine, Serine, Threonine, Tryptophan, and Valine.
[0049] It will be understood by those of skill in the art, that peptidcs are described by the joining of the three letter codes above. For example, Asp-Asn-Trp refers to the compound Alternatively, the compound above could also be described as Asp-Asn-Trp-NH 2 It will also be understood by one of skill in the art that the peptides of the invention may contain protecting groups (vide infra). When an amino acid contains a protecting group, the three letter code will be adapted to indicate the protecting group. For example, Thr-Asp(OtBu)-Asn(NHTrt)-Trp-NH 2 refers to the following compound: [0050] Common protecting groups for the amino acids of this invention include tert-butoxy (tBu), trityl (Trt) and tert-butoxy carbonyl (BOC) protecting groups.
[0051] It will also be understood by one of skill in the art that cyclic peptides may also be described by three letter codes. For example, the three letter structure WO 2006/110185 PCT/US2005/040919 R (Trp)-Asn-h-Asn-Thr-Sar-Ala-Asp-Lys-omAsp-Gly-Asn-Glu-Ile is identical with the structure:
:ONH
2
H
2
NOC
[0052] It will also be understood by one of skill in the art that amino acids can exist in either the L or D configuration. When it is desirable to indicate the configuration of the amino acid, the D or L designation is placed before the three letter code.
[0053] The term "amino acid residue" denotes a compound of the formula 0 -7 NH 2 wherein Raa is an amino acid side chain. In one aspect of the invention, the amino acid residue is derived from a natural amino acid. In another aspect of the invention, the amino acid residue is derived from the amino acids 3-methoxy-aspartic acid, 3-hydroxy-asparagine,3-hydroxy-aspartic acid, 3-methylglutamic acid, Alanine, Asparagine, Aspartic acid, Glutamic acid, Glycine, Isoleucine, Kynurinine, Lysine, Ornithine, Sarcosine, Serine, Threonine, Tryptophan, and Valine.
[0054] The term "amino acid side chain" denotes any side chain (R group) from a naturallyoccurring or synthetic amino acid. For example, 3-indolylmethyl could also be called a tryptophan side chain. Examples of amino acid side chains include, without limitation, WO 2006/110185 WO 206/10185PCT/US2005!040919
N
N
N
INl
F
NJ
OH
F
Hr Me N4 C0 2
H
OH
F
OH
OCH
3
N
OH
N4-.
'D
2
H
OMe N4-l C0 2
H
OH
OH
HOVOH
OH
OH
0 NH 2 HOn
OH
ul*OH
H
2
N
HO
NH
2
OH
OMe
COC
2
H
H0 2
C-
WO 2006/110185 WO 206/10185PCT/US2005!040919 0 N! iN~N. H 2
NH
2
HN
0 1kNH 2 0
A)OH
NH
z~~NN,'KL
NH
2
H
C
C1
OH
)H OH
H
NH
N
H
N
hydrido and methyl, wherein each of R 1l and R 2 is independently amino, monosubstituted amino, disubstituted.
amino, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino. A"non-proteinogenic amino acid side chain" is an amino acid side chain derived from a non-proteinogenic amino acid (vide Supra). Examples of a nonproteinogenic amino acid side chains include, without limitation,
OH
OH
HOv OH HO
HOY
OH
OH
OH
A1 I
OH
H
2 N)
HO
NH
2 0'O
OH
0 NH 2 C2H andH02 WO 2006/110185 PCT/US2005/040919 In one aspect of the invention, the amino acid side chain is derived from a natural amino acid. In another aspect of the invention, the amino acid side chain is derived from the amino acids 3methoxy-aspartic acid, 3-hydroxy-asparagine,3-hydroxy-aspartic acid, 3-methylglutamic acid, Alanine, Asparagine, Aspartic acid, Glutamic acid, Glycine, Isoleucine, Kynurinine, Lysine, Omithine, Sarcosine, Serine, Threonine, Tryptophan, and Valine.
[0055] The term "2-(2'-aminophenacyl)" refers to a radical of the formula
NH
2 0 [0056] The term "aryl" or "aryl ring" is defined as an aromatic radical in a single or fused carbocyclic ring system, having from five to fourteen ring members. In a preferred embodiment, the ring system has from six to ten ring members. One or more hydrogen atoms may also be replaced by a substituent group selected from acyl, acylamino, acyloxy, alkenyl, alkoxy, alkyl, alkynyl, amino, aryl, aryloxy, azido, carbamoyl, carboalkoxy, carboxy, carboxyamido, carboxyamino, cyano, disubstituted amino, formyl, guanidino, halo, heteroaryl, heterocyclyl, hydroxy, iminoamino, monosubstituted amino, nitro, oxo, phosphonamino, sulfinyl, sulfonamino, sulfonyl, thio, thioacylamino, thioureido, or ureido. Examples of aryl groups include, without limitation, phenyl, naphthyl, biphenyl, terphenyl.
[0057] The term "aryloxy" denotes oxy-containing radicals substituted with an aryl or heteroaryl group. Examples include, without limitation, phenoxy.
[0058] The term "carbamoyl" denotes a nitrogen radical of the formula o rN ORx 3 Rx2 wherein Rx 2 is selected from hydrido, alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl and Rx 3 is selected from alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl.
[0059] The term "carboalkoxy" is defined as a carbonyl radical adjacent to an alkoxy or aryloxy group.
[0060] The term "carboxy" denotes a COOH radical.
WO 2006/110185 PCT/US2005/040919 [0061] The term "carboxyamino" denotes a CONH 2 radical.
[0062] The term "carboxyamido" is defined as a carbonyl radical adjacent to a monosubstituted amino or disubstituted amino group.
[0063] The term "a-carboxy amino acid side chain" is defined as a carbon radical of the formula
RX
4
OH
0 wherein Rx 4 is defined as an amino acid side chain.
[0064] The term "carboxymethyl" denotes a CH 2
CO
2 H radical.
[0065] The term "cycloalkyl" or "cycloalkyl ring" denotes a saturated or partially unsaturated carbocyclic ring in a single or fused carbocyclic ring system having from three to twelve ring members. In a preferred embodiment, a cycloalkyl is a ring system having three to seven ring members. One or more hydrogen atoms may also be replaced by a substituent group selected from acyl, acylamino, acyloxy, alkenyl, alkoxy, alkyl, alkynyl, amino, aryl, aryloxy, carbamoyl, carboalkoxy, carboxy, carboxyamido, carboxyamino, cyano, disubstituted amino, formyl, guanidino, halo, heteroaryl, heterocyclyl, hydroxy, iminoamino, monosubstituted amino, nitro, oxo, phosphonamino, sulfmyl, sulfonamino, sulfonyl, thio, thioacylamino, thioureido, or ureido.
Examples of a cycloalkyl group include, without limitation, cyclopropyl, cyclobutyl, cyclohexyl, and cycloheptyl.
[0066] The term "disubstituted amino" is defined as a nitrogen radical containing two substituent groups independently selected from, alkyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl. Preferred disubstituted amino radicals are "lower disubstituted amino" radicals, whereby the substituent groups are lower alkyl. Also preferred disubstituted amino radicals are amino radicals wherein one substituent is a lower alkyl group and the other substituent is an acarboxy amino acid side chain.
[0067] The group "Fmoc" is a 9-fluorenylmethoxycarbonyl group.
[0068] The term "guanidino" is defined as a nitrogen radical of the formula WO 2006/110185 PCT/US2005/040919 Rx7
N
\Rx6 wherein each of R 5
R
x7 and Rxs is independently selected from hydrido, alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl group; and Rx 6 is selected from alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl group.
[0069] The term "halo" denotes a bromo, chloro, fluoro or iodo radical.
[0070] "Heteroaryl" or "heteroaryl ring" is defined as an aromatic radical which contain one to four hetero atoms or hetero groups selected from 0, N, S, or SO in a single or fused heterocyclic ring system, having from five to fifteen ring members. In a preferred embodiment, the heteroaryl ring system has from six to ten ring members. One or more hydrogen atoms may also be replaced by a substituent group selected from acyl, acylamino, acyloxy, alkenyl, alkoxy, alkyl, alkynyl, amino, aryl, aryloxy, carbamoyl, carboalkoxy, carboxy, carboxyamido, carboxyamino, cyano, disubstituted amino, formyl, guanidino, halo, heteroaryl, heterocyclyl, hydroxy, iminoamino, monosubstituted amino, nitro, oxo, phosphonamino, sulfinyl, sulfonamino, sulfonyl, thio, thioacylamino, thioureido, or ureido. Examples of heteroaryl groups include, without limitation, pyridinyl, thiazolyl, thiadiazoyl, isoquinolinyl, pyrazolyl, oxazolyl, oxadiazoyl, triazolyl, and pyrrolyl groups.
[00711 The term "heterocyclyl," "heterocyclic" or "heterocyclyl ring" denotes a saturated or partially unsaturated ring containing one to four hetero atoms or hetero groups selected from 0, N, NH, N(lower alkyl), S, SO or SO2, in a single or fused heterocyclic ring system having from three to twelve ring members. In a preferred embodiment, a heterocyclyl is a ring system having three to seven ring members. One or more hydrogen atoms may also be replaced by a substituent group selected from acyl, acylamino, acyloxy, alkenyl, alkoxy, alkyl, alkynyl, amino, aryl, aryloxy, carbamoyl, carboalkoxy, carboxy, carboxyamido, carboxyamino, cyano, disubstituted amino, formyl, guanidino, halo, heteroaryl, heterocyclyl, hydroxy, iminoamino, monosubstituted amino, nitro, oxo, phosphonamino, sulfinyl, sulfonamino, sulfonyl, thio, thioacylamino, thioureido, or ureido. Examples of a heterocyclyl group include, without limitation, morpholinyl, piperidinyl, and pyrrolidinyl.
[0072] The term "hydrido" is defined as a single hydrogen atom [0073] The term "iminoamino" denotes a nitrogen radical of the formula: WO 2006/110185 PCT/US2005/040919 Rx9 RX9 Rx" 1 wherein each of Rx 9 and RxI is independently selected from a hydrido, alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group; and RxlO is selected from an alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group.
[0074] The term "N-methyl amino acid" denotes a compound of the formula 0 HO NHMe
HO
Raa wherein Raa is an amino acid side chain. Examples of amino acid side chains of an N-methyl amino acid include WO 2006/110185 PCT/US2005/040919
CH(CH
3 2
-CH
2
CH(CH
3 2 2- (CH) 2
CO
2 H -CH 2 0H
CH
2 SCH 3 CH(CH 3 )Et -CH(CH 3 )OH -(CH) 4
CH
3 OH OH H N
NHN
OH
OH
and C H, [0075] The term "monosubstituted amino" denotes a nitrogen radical containing a hydrido group and a substituent group selected from alkyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl.
Preferred monosubstituted amino radicals are "lower monosubstituted amino" radicals, whereby the substituent group is a lower alkyl group. More preferred monosubstituted amino radicals are amino radicals containing an ac-carboxy amino acid side chain.
[0076] The term "phosphonamino" is defined as a nitrogen radical of the formula: 0 I1 R13 AN -RX14
RX
12 wherein Rx 12 iS selected from hydrido, alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl; wherein each of Rx 13 and Rx14 is independently selected from alkyl, alkoxy, aryl, aryloxy, cycloalkyl, heteroaryl and heterocyclyl.
[0077] The term "protecting group" refers to any chemical compound that may be used to prevent a group on a molecule from undergoing a chemical reaction while chemical change WO 2006/110185 PCT/US2005/040919 occurs elsewhere in the molecule. Groups that may need protecting include hydroxyl, amino, carboxylic acids and carboxyamino groups. Numerous protecting groups are known to those skilled in the art and examples can be found in "Protective Groups in Organic Synthesis" by Theodora W. Greene and Peter G. M. Wuts, John Wiley and Sons, New York, 3 rd Edition 1999, hereafter Greene.
[0078] The term "amino protecting group" refers to any chemical compound that may be used to prevent an amino group on a molecule from undergoing a chemical reaction while chemical change occurs elsewhere in the molecule. Numerous amino protecting groups are known to those skilled in the art and examples can be found in Greene. Examples of "amino protecting groups" include phthalimido, trichloroacetyl, STA-base, benzyloxycarbonyl, tbutoxycarbonyl, t-amyloxycarbonyl, isobornyloxycarbonyl, adamantyloxycarbonyl, chlorobenzyloxycarbonyl, nitrobenzyloxycarbonyl or the like. Preferred amino protecting groups are "carbamate amino protecting groups" which are defined as an amino protecting group that when bound to an amino group forms a carbamate, or the azido group. Preferred amino carbamate protecting groups are allyloxycarbonyl (alloc), carbobenzyloxy (CBZ), 9fluorenylmethoxycarbonyl (Fmoc) and tert-butoxycarbonyl protecting groups.
[0079] The term "hydroxyl protecting group" refers to any chemical compound that may be used to prevent a hydroxyl group on a molecule from undergoing a chemical reaction while chemical change occurs elsewhere in the molecule. Numerous hydroxyl protecting groups are known to those skilled in the art and examples can be found in Greene (vide supra) Examples of hydroxyl protecting groups include esters such as, but not limited to formate, acetate, substituted acetate, crotonate, benzoate, substituted benzoates, methyl carbonate, ethyl carbonate, alkyl and aryl carbonates, borates, and sulphonates. Examples of hydroxyl protecting groups also include ethers such as, but not limited to methyl, benzyloxylmethyl, siloxymethyl, tetrahydropyranyl, substituted tetrahydropyranyl, ethyl, substituted ethyl, allyl, tert-butyl, propargyl, phenyl, substituted phenyl, benzyl, substituted benzyl, alkyl silyl and silyl ethers or the like. Preferred hydroxyl protecting groups are "acid labile ethers" which are defined as an ether protecting group that may be removed by treatment with acid. Preferred hydroxyl ether protecting groups are trityl (Trt), tert-butyl (tBu), benzyl (Bzl) and tert-butyldimethylsilyl (TBDMS) protecting groups.
[0080] The term "carboxylic acid protecting group" refers to any chemical compound that may be used to prevent a carboxylic acid on a molecule from undergoing a chemical reaction WO 2006/110185 PCT/US2005/040919 while chemical change occurs elsewhere in the molecule. Numerous carboxylic acid protecting groups are known to those skilled in the art and examples can be found in Greene (vide supra).
Examples of carboxylic acid protecting groups include, but are not limited to ,amides, hydrazides, and esters such as, methyl esters, substituted methyl, phenacyl, tetrahydropyranyl, tetrahydrofuranyl, cyanomethyl, triisopropylsilylmethyl, desyl, ethyl 2-substituted ethyl, phenyl, 2,6 dialkyl phenyl, benzyl, substituted benzyl, silyl, and stannyl, or the like. Preferred carboxylic acid ester protecting groups are allyl (All), tert-butyl (tBu), benzyl (Bzl), 1-(4,4-dimethyl- 2,6-dioxocyclohexylidinene)-3-methylbutyl]-amino}benzyl (ODmab), 1-adamantyl (1Ada) and 2-phenylisopropyl (2-PhiPr) protecting groups.
[0081] The term "sulfinyl" denotes a tetravalent sulfur radical substituted with an oxo substituent and a second substituent selected from the group consisting of alkyl, cycloalkyl, heterocyclyl, aryl, or heteroaryl group.
[0082] The term sulfonamino is defined as an amino radical of the formula: 1
R"
16
S/\
wherein Rx 15 is selected from a hydrido, alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group; and R x16 is selected from alkyl, cycloalkyl, aryl, heteroaryl or heterocyclyl group.
[0083] The term "sulfonyl" denotes a hexavalent sulfur radical substituted with two oxo substituents and a third substituent selected from alkyl, cycloalkyl, heterocyclyl aryl, or heteroaryl.
[0084] The term "thio" is defined as a radical containing a substituent group independently selected from hydrido, alkyl, cycloalkyl, heterocyclyl, aryl and heteroaryl, attached to a divalent sulfur atom, such as, methylthio and phenylthio.
[0085] The term "thioacylamino" denotes an amino radical of the formula RX17 Rx 18
S
wherein Rx 17 is selected from a hydrido, alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl group; and wherein Rxl 8 is selected from an alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl group.
[0086] The term "thioureido" is defined as a sulfur radical of the formula WO 2006/110185 PCT/US2005/040919 R19 I _Ny Rx21
S
wherein each ofRXl9and Rx 20 is independently selected from hydrido, alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl group; and Rx 21 is selected from an alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl group.
[0087] The group trityl is a triphenylmethyl group.
[0088] The term "ureido" is defined as a nitrogen radical of the formula
R
x21 Rx22
RX
23 0 wherein each ofR 2 land Rx 22 is independently selected from hydrido, alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl group; and Rx 23 is selected from an alkyl, aryl, cycloalkyl, heteroaryl or heterocyclyl group.
[0089] The terms "lptA", "lptB" "lptC" and "lptD" refer to nucleic acid molecules that encode subunits of the A54145 NRPS. In a preferred embodiment, the nucleic acid molecule is derived from Streptomyces, more preferably the nucleic acid molecule is derived from S. fradiae.
The IptA nucleic acid encodes for amino acids 1-5. The IptB nucleic acid encodes for amino acids 6 and 7. The IptC nucleic acid encodes for amino acids 8-11. The IptD nucleic acid encodes for amino acids 12 and 13 (Figurel). The terms "lptA", "lptB, "lptC' and "lptD" also refer to allelic variants of these genes, which may be obtained from other species of Streptonyces or from other S. fradiae strains.
[0090] The terms "dptA", "dptBC' and "dptD" refer to nucleic acid molecules that encode subunits of the daptomycin NRPS. In a preferred embodiment, the nucleic acid molecule is derived from Streptomyces, more preferably the nucleic acid molecule is derived from S.
roseosporus. The dptA nucleic acid encodes amino acids 1-5. The dptBC nucleic acid encodes amino acids 6-11. The dptD nucleic acid encodes amino acids 12-13 (Figure The terms WO 2006/110185 PCT/US2005/040919 "dptA", "dptBC" and "dptD" also refer to allelic variants of these genes, which may be obtained from other species of Streptomyces or from other S. roseosporus strains.
[0091] The salts of the compounds of the invention include acid addition salts and base addition salts. In a preferred embodiment, the salt is a pharmaceutically acceptable salt of the compound of Formula I or the compound of any of Formula F1-F22. The term "pharmaceutically acceptable salts" embraces salts commonly used to form alkali metal salts and to form addition salts of free acids or free bases. The nature of the salt is not critical, provided that it is pharmaceutically-acceptable. Suitable pharmaceutically acceptable acid addition salts of the compounds of the invention may be prepared from an inorganic acid or an organic acid.
Examples of such inorganic acids include, without limitation, hydrochloric, hydrobromic, hydroiodic, nitric, carbonic, sulfuric and phosphoric acid. Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, arylaliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include, without limitation, formic, acetic, propionic, succinic, glycolic, gluconic, maleic, embonic (pamoic), methanesulfonic, ethanesulfonic, 2-hydroxyethanesulfonic, pantothenic, benzenesulfonic, toluenesulfonic, sulfanilic, mesylic, cyclohexylaminosulfonic, stearic, algenic, B-hydroxybutyric, malonic, galactic, and galacturonic acid. Suitable pharmaceutically-acceptable base addition salts of compounds of the invention include, but are not limited to, metallic salts made from aluminum, calcium, lithium, magnesium, potassium, sodium and zinc or organic salts made from N,N'dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, Nmethylglucamine, lysine and procaine. All of these salts may be prepared by conventional means from the corresponding compound of the invention by treating, for example, the compound of the invention with the appropriate acid or base.
[0092] The compounds of the invention can possess one or more asymmetric carbon atoms and are thus capable of existing in the form of optical isomers as well as in the form ofracemic or non-racemic mixtures thereof. The compounds of the invention can be utilized in the present invention as a single isomer or as a mixture of stereochemical isomeric forms. Diastereoisomers, nonsuperimposable stereochemical isomers, can be separated by conventional means such as chromatography, distillation, crystallization or sublimation. The optical isomers can be obtained by resolution of the racemic mixtures according to conventional processes, for example by formation of diastereoisomeric salts by treatment with an optically active acid or base. Examples of appropriate acids include, without limitation, tartaric, diacetyltartaric, dibenzoyltartaric, WO 2006/110185 PCT/US2005/040919 ditoluoyltartaric and camphorsulfonic acid. The mixture of diastereomers can be separated by crystallization followed by liberation of the optically active bases from the optically active salts.
An alternative process for separation of optical isomers includes the use of a chiral chromatography column optimally chosen to maximize the separation of the enantiomers. Still another method involves synthesis of covalent diastereoisomeric molecules by reacting compounds of the invention with an optically pure acid in an activated form or an optically pure isocyanate. The synthesized diastereoisomers can be separated by conventional means such as chromatography, distillation, crystallization or sublimation, and then hydrolyzed to obtain the enantiomerically pure compound. The optically active compounds of the invention can likewise be obtained by utilizing optically active starting materials. These isomers may be in the form of a free acid, a free base, an ester or a salt.
[0093] The invention also embraces isolated compounds, preferably compounds of Formula I or compounds of any of Formulas F1-F22. An isolated compound refers to a compound, preferably a compound of Formula I or a compound of any of Formulas F1-F22, which represents at least about preferably at least aboutl0%, more preferably at least about even more preferably at least about 50%, yet more preferably at least about 80%, yet even more preferably at least about 90% and most preferably at least about 99% of the compound present in the mixture. In one embodiment of the invention the compound, preferably a compound of Formula I or a compound of any of Formulas F1-F22,, is present in at least about 80% to about of the composition. In another embodiment the compound, preferably a compound of Formula I or a compound of any of Formulas F1-F22, is present in at least 90% of the composition. In another embodiment the compound, preferably a compound of Formula I or compound of any of Formulas F1-F22, is is present in greater than 90% of the composition.
[0094] The percentation of the compound, preferably a compound of Formula I or a compound of any of Formulas F1-F22, may be measured by any means including nuclear magnetic resonance (NMR), gas chromatography/mass spectroscopy (GC/MS), liquid chromatography/mass spectroscopy (LC/MS) or microbiological assays. A preferred means for measuring the purity of the compound is by analytical high pressure liquid chromatography (HPLC) or LC/MS.
[0095] In one embodiment of the invention, the compound, a pharmaceutically acceptable salt thereof or a pharmaceutical composition comprising the compound exhibits a detectable (i.e.
WO 2006/110185 PCT/US2005/040919 statistically significant) antimicrobial activity when tested in conventional biological assays such as those described herein.
Depsipeptide Compounds [0096] In one aspect, the invention provides compounds of Formula I and salts thereof.
[0097] The group R 2 of Formula I is an amino acid side chain, OH 0 O or In one embodiment of the invention the amino acid side OH 0 chain is or NH 2 In another embodiment of the invention, the amino acid side chain is derived from a D- amino acid. In another embodiment of the invention, the amino acid side chain is WO 2006/110185 WO 206/10185PCT/US2005!040919 0
OH'
OHNH 0 H NH 2 Raa2,
NH
OH
NH.
0 4'JNH 2 0 9'O H'
OH
0 N 1
NH
2
H
C1
OH
aI
H
N=
NH
N
H
HNb or wherein each of Raal and Ra2 is independently amino, monosubstituted amino, disubstituted amino, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[0098] Substituent R 2 is H. Alternatively, R 2 and R 2 together with the atomns to which they are attached, form a five or six-member heterocyclic ring. In one embodiment of Formnula 1, R? and R 2 together with the atoms to which they are attached, form a pyrrolidine ring.
NH2
NH
[0099] The group R 3 of Formnula I is OH 0 0 11 uo a nonproteinogenic amino acid side chain. In one embodiment of the invention the group R 3 of
NH
2 'rlo OH
NH
2 Formula I s OH 0 ,or In another embodiment of the invention, the non-proteinogenic amino acid is WO 2006/110185 WO 206/10185PCT/US2005!040919
H
OH
HOV OH HO
HO
OH
OH
OH
O'J>*OH or
H
2
N
HO
[01001 Substituent R5 of Formula I is H or methyl and substiuent R" of Formula I is H or an amino acid side chain derived from an N-methylamino acid. In one embodiment of the invention, R5* is methyl, -4CH(CH 3 2 '--CHCH CH 3 2 I 4(CH2)2CO 2 H ,--CH 2 0H 4CHSCH, 4CH(CH,)Et -CH(CH 3
)OH
OH
OH
OH
OH
CH-
or
H,
(CH)
4
CH
3
F
HN
N
Alternatively, R 5 and RS* together with the atoms to which they are attached, form a five or sixmember heterocyclic ring. In one embodiment of Formula 1, R 5 and R 5* together with the atoms to which they are attached, form a piperidine or a pyrrolidine ring.
WO 2006/110185 PCT/US2005/040919 [0101] Group R 6 of Formula I is methyl or R6* [0102] Substituent R 8 of Formula I is an amino acid side chain, hydrogen, methyl,
NH
2 O eOH 0orR. In one embodiment of the invention, substituent R 8
NH
2 of Formula I is hydrogen, methyl, OH or In another embodiment of the invention, the amino acid side chain is derived from a D- amino acid. In another embodiment of the invention substituent R 8 is the amino acid side chain derived from glycine, D-alanine, D-asparagine, D-serine or D-lysine. In another embodiment of the invention, the amino acid side chain is 0 )~Raa1, OH
O,
NH
OH
Haa2 S 0, NH2 0
NH
2 OH
NH
OH OH 0 'JN NH 2
H
C1
H
OH
N
I' N ci H N or wherein each of Raal and R2 is independently amino, monosubstituted amino, disubstituted amino, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 PCT/US2005/040919 [0103] Substituent R 8 of Formula I is H. Alternatively, R 8 and R 8 together with the atoms to which they are attached, form a five or six-member heterocyclic ring. In one embodiment of Formula I, R 8 and R* together with the atoms to which they are attached, form a pyrrolidine ring.
OMe OH [0104] Group R 9 of Formula I is c o H 2 H,
C
2 H, or an amino acid side chain substituted with at least one carboxylic acid. In one embodiment of the invention OMe OH group R 9 of Formula I is co 2 H,
C
2 H, or CO 2 H. In another embodiment of the invention, the amino acid side chain is OMe Me OH C O 2 H K CO 2 H COH CO 2
H
SCOzH COH 'Z COH Me OMe OH [0105] Substituent R" of Formula I is an amino acid side chain, methyl, 0 OH or NH 2 In one embodiment of the invention substituent R" of Formula I is 0 methyl, 'OH, or NH 2 one embodiment of the invention, the amino acid side chain is derived from a D- amino acid. In another embodiment of the invention R 1 of Formula I is an amino acid side chain derived from D-alanine, D-serine, or D-asparagine. In another embodiment of the invention, the amino acid side chain is WO 2006/110185 WO 206/10185PCT/US2005!040919 0 _R I)1_ OH 'VO Y HNH 0 OH ~~N'~NH 2 7 H- NH 2
NH
0
_/)NH
2 0
KOH,
W-\
N
H,
OH OH N 'KNH 2
H
C1 H 0 N
OH
C1 H Yf' N or -Jwherein each of R"'I and R"2 is independently amino, monosubstituted amino, disubstituted amino, acylamino, ureido, guanidino, carbamioyl, sulfonamnino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[01061 Substituient R"l* is H. Alternatively, R" and R"l* together with the atoms to which they are attached, form a five or six-member heterocyclic ring. In one embodiment of Formula I,
R
1 1 and R' 1* together with the atoms to which they are attached, form a pynrolidine ring.
[0107] Group R 12of Formula I is H or CH 3 [0108] Substituent R 13 of Formula I is CH(CH 3 2
CH(CH
2 CH1 3
)CH
3
NH
2 0 NH 2 In one embodiment of the invention, R 1 3 is CH(CH 2
CH
3
)CH
3 or WO 2006/110185 PCT/US2005/040919 [0109] Each of R 1
R
6 and R 8 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino. In one embodiment of the invention R I is amino, NH-amino protecting group, or acylamino. In another embodiment of the invention R' is amino. In another embodiment of the invention, R' is NH-amino protecting group. In another embodiment of the invention R' is acylamino. In another embodiment of the invention R 1 is alkanoylamino. In yet another embodiment of the invention R' is CI 0
-C
13 alkanoylamino. In still another embodiment of the invention, R 1 is O H H S' (CH 2 6
CH(CH
3 2 L (CH 2 6
CH(CH
3
)CH
2
CH
3 LN (CHC)gCH3 H 0 H H K (CH)QCH(CH 3
)CH
2
CH
3
(CH
2 8
H(CH
3 2 o ,or o [0110] In another embodiment of the invention each of R 6 and R 8 is independently amino, or NH-amino protecting group. In another embodiment of the invention each of R 6 and R 8 is independently amino. In yet another embodiment of the invention each of R6 and R 8 is independently NH-amino protecting group.
[01111 Table I provides exemplary compounds of Formula I.
Table I Compounds ofFormula I Compound WO 2006/110185 WO 206/10185PCT/US2005!040919
H
,N-CO(CH
2 8 CH(0H 3 )0H 2
CH
3
H
N-CO(CH-
2 6
CH(CH
3 )CH2CH 3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound H0 2
C
HN N CONH 2 HO 00 0 H H 0 N N N N-CO(CH- 2
)SCH(CH
3 2 NH0) H 0 H
Z
C8NH C0 2 H I N HN
H
H0 2 C 0 HN H
NH
2 HN N N LH 0 0 HoC
HOC
HN N- 0 0 0H HO 00 0 H H 0N NN
N-C(CH
2 8
CH(CH
3
)CH
2 CH3 H H C9 NH C02Hi
N
HN 0= H H0 2 C 0 HN H
NH
2 HN
N
Y H 0 0 Ho 2
CT
0 NH 2 H0 2
C
NH C0NH 2 HN 00 HO 00 0 HH 0N N, l NC(CH)iCH(CH)CHCHt H H NH 0 0 CIO 0=Z< /NH COZH WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound
H
N-CO(CH
2 6
CH(CH
3 )0HCH, WO 2006/110185 PCT/US2005!040919 Compound WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound AVcO(cH)CH(CH)CHCH,
H
N-CO(CH
2
)GCH(CH
3
)CH
2
CH
3 WO 2006/110185 PCT/US2005!040919
-CO(CH
2 8
CH(CH
3 2 WO 2006/110185 PCT/US2005!040919 Compound WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
.N-CO(CH
2 6
CH(CH
3
)CH
2
CH
3 WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound
H
N-GO(CH
2 8
CH(CH
3
)CH
2
CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 Compound WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound
H
N-CO(CH
2 8
CH(CH,),
.CO(cH 2
),CH(CH
3
)CHCH,
WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound
H
-N-CO(CH
2 8
CH(CH
3
)CH
2
CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 Compound WO 2006/110185 PCT/US2005!040919 Compound WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound
-GO(CH
2 8
CH(CH
3 )cH- 2
CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
N-CO(CH)
6
CH(CH
3
)CH
2
CH
3
H
N-O(CH
2 )rH(CH 3
)CH
2
CH
3 WO 2006/110185 PCT/US2005!040919 Compound
H
.N-CO(CH)
6
CH(CH
3
)OH
2
CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
.N-CO(CH,),CH(CH,)CH,
H
N-CO(CH
2
)GCH(CH
3
)GH
2
CH
3 WO 2006/110185 WO 206/10185PCT/US2005!040919
-CO(CH
2 6
CH(CH
3
)CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
N-CO(CH
2 6 CH(0H 3
)CH
2
CH
3 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
N-CO(CH
2 6
CH(CH
3
)CH
3 WO 2006/110185 PCT/US2005!040919
H
N-CO(CH
2 6
CH
2
CH
2
CH
3 WO 2006/110185 WO 206/10185PCT/US2005!040919
H-
.N-CO(CH
2 6
CH
2
CH
2
CH
3
-CO(CH
2 )r 6
CH(CH
3
)CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 Compound
CH
3 HO, N NCy H0 2
C
HNH
HNOC, 0 0) N N)
N'
H H NH 0 0 C139 0 NH, NCH 3
CONH,
HN0 HO, C 0 HN 0
H
HNH
H 0 0
HO
2 C O H02C H, 10 2
C
NH'
HN 0 0
H
2 NOC 00 0
H
N
NN
H H NH 0 0 C140 0 NH, NCH 3
CONH,
HMN
H0 2 C 0 HN 0
H
HN N 1-1 0 0 H0 2
C
HO, CH, H0 2
C
CHN 0 0
H
2 NOC\- 00 0 H NH 0 0 C NH 2 NCH, CONH 2 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919
H
N-C(CH
2
)FCH
2
CH
2
CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound
H
.N-CO(cH 2 8 CH(cH)CHGH, WO 2006/110185 WO 206/10185PCT/US2005!040919
H
.N-CO(CH
2
)BCH(CH
3 2
H
,N-CO(CH
2 6
CH(CH
3
)CH
2
CH
3 WO 2006/110185 PCT/US2005!040919 Compound
H
.N-CO(CH
2 8
CH(CH
3 2 WO 2006/110185 PCT/US2005!040919
-CO(CH
2
)BCH(CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
N-CO(H
2 )E3CH(0H 3
)CH
2
CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
.N-CO(CH)
8
CH(CH
3 2 WO 2006/110185 WO 206/10185PCT/US2005!040919 0
HN
H NH 2 0 'H 3
)CH
2
CH
3 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 Compound WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
.N-CO(CH
2 6
CH(CH
3
)CH
2
CH
3 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
,N-CO(CH
2
),CH(CH,)CHCH,
H
N-CO(CH
2 )&CH(CHa)CH 2 CHs WO 2006/110185 WO 206/10185PCT/US2005!040919
H
N-CO(CH
2 6 cH(CH 3
)CH
2
CH
3 WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound
H
N-CO(CH
2
)CH(CH
3
)CH
2
CH
3 Hi
N-CO(H
2 )lcH(CH 3
)CH
2
CH
3 WO 2006/110185 WO 206/10185PCT/US2005!040919
H
N-CO(CF
211
CH
3
H
N-O(CH
2 6 cH(CH 3
)CHCH,
WO 2006/110185 WO 206/10185PCT/US2005!040919 Compound
H
N-CO(H
2 )rGH(CH 3
)CH
2
GH
3
H
.N-CO(H
2 6
H(CH
3
)CH
2
CH
3 WO 2006/110185 WO 206/10185PCT/US2005!040919 [01121 In one embodiment of the invention, each of R R and R" 2 is H R' is OMe
CO
2 H I C02H and R" 3 is CH(CH 2
CH
3
)CH
3 This embodiment provides a compound of Formula 11.
wherein R 9 is H or OMe and R 2 RW, R 5 and R' 1 are as previously defined.
101131 Table 11 provides exemplary compounds of Formnula 11.
WO 2006/110185 WO 206/10185PCT/US2005!040919 Table H1 Compounds of Formula Ii T~l ~-NH -+(CH 2 3
NH
2 Gil 3 TIL2 H Gil0 0 T113 0NH 2 H kJ-CH2)NH2 CH' H OH -1 1
KNH
2
OH
TI14 0 }OH CI- 3 CHl 3 H O T115 0 '0 H H Gil 3 Gi 3
H
b/,ANH 2 0~ 1 O T116 2 H NH 2 H (CH 2 3 NH, CH 3
H
OH
WO 2006/110185 WO 206/10185PCT/US2005!040919 T1l17 NH0 CI4 3 2 3
NH
2 C HH3O
NH
2
OH
TIIS 0 OH GII 3 Gil 3 Gi 3 H O T119 >&~C02H y(~O Gil 3
CH
2 )3NH C 3 0 T1110 \>OH H Gil 3 Gil 3 H "O 0 T111 0 NH 2 H CH 3
CH
3 H 'O b'-ANH 2 0E
OH
T1112 NH 2 H CH 3
CH
3
H
OH
T11 OH Gil 3 Gl 3 Gil 3 H LLCOH 0 T1114 ~'X'OH NH 2
GH
3 2 3
NH
2
GH
3 H IO
OH
T1115 0 NH 3
CH
3 GIl1 3 Gil 3
H
OH
T1I16 NH 2 Gil 3 Gil 3 Gi 3 H O
OH
T1I17 0&~NH -IcyOH H k1-CH)NH2 Gil 3 H1 N0 T118CO 2 H N OH H -+-GH 2 3
NH
2 GilI 3 H 0H TII18 1/1" -A H WO 2006/110185 WO 206/10185PCT/US2005!040919 R2 R6 Re R" T1119 0 NH, H1 -1-(CH 2 3
NH
2
GCH
3 H0 I NH 2 0 NH 2
OH
TI120 0KNH 7 OH CH 3
-+(CH
2 3
NH
2 Gil 3 H0 T1121 0'H H H- CH 3 Gil 3 H0 T1122 $XCO H NH 2 H -1-CCH 2 3
NH
2 Gil 3 H0 2 4)NH 2
OH
T1123 0 NH 2
CH
3 -1--(CH 2 3
NH
2 Gil 3 H0 H 0 -1 NH 2
OH
T1124 0 OH GB 3 Gil 3 Gi 3 H0
&'IKNH
2 0 1--NH 2 T1125 >>-N.OOH )(N.OH GB 3 kJ-CH)NH2 Gi 3 H 0H T1126 1/,)(N02H OH H GH 3 Gil 3 H 0NH T1127 0 NH 2 H Gil 3 Gil 3 H0 bK-)NH 2 /Ir~ 0 -kNH 2
OH
T1128 C02 NH 2 H Gil 3 Gil 3 H0 /Ir~ 0
,NH
2
OH
T1129 'C2 X 7 yOH GB 3
GB
3 Gil 3 H0 0 AH T1130 s~~C 2
NH
2 GlI 3 +(CH)NH Gil 0 Ts-/-C 2 0)N~
NH
OH
WO 2006/110185 WO 206/10185PCT/US2005!040919
R
2 RlkP 6
I
8
R
9 R7i T113 1 0NH, CH 3
CH
3 C11 3 H N0 -411N, rz~ ,)N0
OH
T1132 O NH, CH 3
CH
3
CH
3 H0 -1-1CO H
NH
2
OH
1133 0 Nj~OH H kc 2 3 H C 2 4 H H" 11134 'r (CH 2 3
NH
2 -1-(CH2)NH 2
H
0 T1135 0 NH 2 H -+(CH 2 3
NH
2
+(CH
2 4
NH
2 H "$OH b"),NH 2 0~
OH
T1136 0 '0"y H CH 3
-+(CH
2 3
NH
2 -+-(CHA)NH 2 H 113 -4 1 lNH 2 0(~HH C 3
C
2 4
H
T1137 0~~O OH-I H -CH 3 NH (CH 2 4
NH
2 H "'OH OH2 T1139 802 NH 2 H +(CH 2 3
NH
2
-+(CHA)NH
2 H "C-OH
OH
11349 0 NH 2 C"yH i 3 CHANH -J-(CH 2 4
NH
2 H '%C"OH T1141 2 H C1l 3 _1-(CH 2 3
NH
2
-J-(CH
2 4
NH
2 H OH 0 1142 ~-CO 2 H O H CH 3
+CCH
2 4
NH
2 H "CO 0 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919 7 R 2 TI155 TI156 0
NH
2 0 b'k)NH 2 I I
NH
2
OH
+(CH
2 3 N H 2
CH
3 OMe V I 4 4 0H 0
CU
3 a Cl' 3 OMe ""C0 2 H H ~(CH 2
):NH
2
CH
3 Oe 0 TII58 c H CH 3
CH
3 OMe 'z%0H 0 T1159 0 NH, H CU 3
CH
3 OMe O b4NH, Y/ 0
OH
T1160 &NO NH 2 H CH 3
CH
3 O tt e
OH
T1161 4&CH~ 7 >OH Gil 3
CH
3
CH
3 OMe '%O 0 T1162 $~OH NH, CU 3 +C23HCH 3 OMe O
OH
T1163 0 NH, Gil 3
CU
3
CU
3 OMe Y 0
OH
T1164 NH, Cl' 3 Cl 3
CH
3 O 'e OH
OH
T1165 0 OH H -1-(CH 2 3
NH
2 -1-(CH 2 4
NH
2 H 0 b ANH 2 0 o NH 2 TI166 -N OH H -+(CHA)NH 2
+(CH
2 4
NH
2 U0 %H A I1 WO 2006/110185 WO 206/10185PCT/US2005!040919 R 2 3
R
5
R
6 l* R T1167 0NH, H -J-(CH 2 3
NH
2 -1-(CH 2 4
NH
2 H IN
OH
T1168 0 G O H 3
-+(CH
2 3
NH
2
-+(CH
2 4
NH
2 H 0H
NH-
2 0 NH T1169 0 Oz-.(H H Gl 3 C;H)NH2 Ho T1170 C 2 H NH 2 H -+(CH 2 3
NH
2 2 4
NH
2 H NH
OH
T1171 0 NH 2 Gil 3
-+(CHA)NH
2
-J--(CH
2 4
NIH
2 H0
OH
T1172 0 H GIl1 3 Gil 3
-+(CH
2 4
NH
2 H 0 1173 ~C 2 H H CG- 3 2 3
NH
2 -1--(CH 2 4
NH
2 H NH 0 1174 -CO 2 H O~ H H CH 3 -+(CH 2 0 H 2 HI N H 02 TI175 0 NH 2 H1 C11 3
-+(CH
2 4
NH
2 H0 0
NH
2 /4l~ 011U-H
OH
TI176 C 2 H NH 2 H Gil 3
+(-CH
2 4
NH
2 H0 0
ANH
2
OH
TI177 OS>CH ~H Gil 3 Gi 3 +(CH2NH 2H 0 H 1178 ~C 2 H NH 2 Gil 3
-+-(CHA)NH
2 +kCH 2 4
NH
2 H NH
OH
WO 2006/110185 WO 206/10185PCT/US2005!040919 11 3 R- 6 8 T1179 0 NH, Gil 3 Gil 3
+(CH)
4 NH2 H0 O--KH NH 2
OH
T1180 ->&Is,-cO2H NH, GIR 3 Gl 3 4-(C;H)NH2 H0 -Ar--I~o -K NH 2
OH
T1181 0 rO H +(CH2)NH2 Gil OMe 0 -K NH2 0 l',NH 2 TII82 C0OH )yfH H kCH 2 3
NH
2 Gil 3 OMe 0H T1183 0NH 2 H -1-(CH 2 3
NH
2
CH,
3 OMe 0 b')N H, o NH 2
OH
T1184 0 C\ OH CH 3 +kCH)NH2 CH 3 OMe 0 -1&-,NH 2 0 -/INH 2 T1185 0 -OH H Gi 3 Gil 3 .OMe NH -N H 2 H /KH T1186 ~XC 2 H NH 2 H -+(CHA)NH 2 Gil 3 OMe 0 0Ak -4 NH 2
OH
T1187 0NH 2 CI1 3 +(CH)NH Gil 3 OMe 0
-KN
2 /Ak
H
OH
TI188 0 OH Gil 3 Gil 3 Gi 3 OMe 0 o4 H 0VkNH 2 T1189 N OH Gi1 3
+CHA)NH
2 Gil 3 OMe 0H T1190 "'Yco )NOH H Gil 3 Gil 3 OMe 0H WO 2006/110185 WO 206/10185PCT/US2005!040919 #t R 3 2R 5 R 6 Rt 8 l* -k T1191 0 NH, H Gil 3
CH
3 OMe 0 b1-"1NH, N H 2
OH
T1192 C02 NH, H Gil 3
CIT
3 OMe 0 0N NH 2
OH
T1193 O&~oH H CIT 3 Gil 3 Gi 3 OMe 0 T1194 C02 NH 2
CIT
3 CH)NH2 CIT 3 OMe 0H
OH
T1195 0 NH 2
CH
3 Gil 3 Gil 3 OMe 0 /41 0 H, 4 NH 2
OH
T1196 C2 NH 2
CH,
3 il 3
CIT
3 OMe NH
OH
T1197 0 O 7 ~H H C12)1)Hi 4 -CH)NH2 OMe %-H T1198 'rC 2 H -2(N OH H -+(CH 2 3
NH
2
+(CH
2 4
NH
2 OMe "-O 0 TI199 0 NH 2 H -1-(CH 2 3
NH
2 -1-(CH 2 4
NH
2 OMe 'O
-/INH
2 o
OH
TIll 00 G O C 3
-+(CH
2 3
NH
2
-+(CH
2 4
NH
2 OMe OH Till 01 0 \Y OH H Gil 3 41-CH 2 4
NH
2 O1'4 "'COH T~l 2 2 H NH+H(CH2)NH2 -1-(CH 2 4
NH
2 OMe
OH
WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919 11R2 3 R5 R118 R TIll 15 0 NH 2 H -1-(CH 2 3
NH
2
-+(CH
2 4
NH
2 OMe 0 V-tNI,-i 2 0-
H
OH
THI116 0 OH Gil 3
-J-(CH
2 3
NH
2
-J-(CH
2 4
NH
2 OMe 0 VbNH, T111 17 0 0 H Gil 3 OMe +(CH2)NH 2 T1l1 18 NH 2 H 2 3
NH
2
-+(CH
2 4
NH
2 OMeNH
OH
T1l1 19 0 NH 2
CH
3
-+(CH
2 3
NH
2
-+(CH
2 4
NH
2 OMe 0 H
&KANH
2 -ANH
OH
TI11 20 0 "yOH CH 3
CH
3 +(rH 2 4
NH
2 OMe Q4 H N H 2 T11121 H Gil 3
-(C
2 3
NH
2
-~CH)N
2 OMe NH T11122 XCOH~>OH H CH 3 -o(C 2 )NH 0~ 0 4kNH 2 T111 23 0 NH 2 IH CH 3
-+(CH
2 4
NH
2 OMe NH ~N H,
-IKH
OH
T11124 ~C 2 H NH 2 H 3
C~N
2 OMe NH
OH
T11125 2 H 1- OH CIH 3
CH
3
-+(CH
2 4
NH
2 OM' NH T11126H H C 3
-(CH)
3
NH
2 -1--(CH 2 4
NH
2 OMe 0 H 1A H
OH
WO 2006/110185 WO 206/10185PCT/US2005!040919 0
OH
Ris 0
R
9 is
C,
R* ,R,R ,R*,and R11 are each H; and R 6 is R6* This embodiment gives a compound of Formula III.
wherein R6*, R' R, ,R 12and R 13are as previously defined.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0115] Table III provides exemplary compounds of Formula 111.
Table III Compounds of Formula XI 11 J/ 00 0
NH
HN
H0 2 C 0
R
8 0 H N J, R R 11 R12~ R 13 TI11 CH1 3 LL0H CH 3 0 NH, T1112 CH 3 H CH 3
H
TII13 CH 3 OH CH 3 TI114 CH 3 >z OH CH 3 T1I15 CH 3 HH 0 NH 2 T1116 GET 3 0 H H
H
WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919 T11120 -CH 2 4 NH
CH
3 T111214H 3OHH K0NH T11121 -+(CH 2 4
NH
2 H~0 H H T11122 1-HN2 L OH H T11124 +(H)N2 L"OH H T11125 0 "O H H
CH
3 0 NH 2 T11126 0 H CH 3 -1 J NH 2
NH
CHH
T11127 0 CH0H -A1
NH
2 TII128 0
CH
3 T11129 0 H& H1 0 NH 2 T11130 0
H
41 NH2 T1113 1 0 zL-0H H -4 NH2 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185
R
8
R
1
RU
2 PCT/US2005!040919 R 1 3
H
TI1178 H NH 2
OH
T11179 0 0 ~H H
HNH
2 T11180 0 OH H H NH 2 TII18 1 Gil 3 0 NH 2
\/OH
C
TIII82 Cl O 'OH CH 3 4 OH N Cl T111183 Cl 1 OH OH CH 3 Cl T11184 1CO 'OH CH 3 Cl Cl OH H 0 NH 2 Cl TIII86 Cl "HH N
OHH
Cl TII187 Cl OHO H 4 /O WO 2006/110185 WO 206/10185PCT/US2005!040919 Rt R 2 1 T11188 cI 'Z OH H TIII89 CIT 3 0113 CIT 3 0 NH 2 T11190 CIT 3
CH
3
CH
3 1 N
H
TI1191 CIT 3
CH
3
CIT
3 T11192 CH 3
CIT
3
CH
3 T11193 CIT 3
CIT
3 H 0 NH 2 T11194 CH 3
OH
3
H
H
T11195 CIT 3
CIT
3
H
TII196 CIT 3
CIT
3
H
T11197 CIT 3
+(CH
2 3
NH
2 013 0 NH 2 T11198 CIT 3
-+(CH
2 3 2
CIT
3
H
T1I199 CIT 3
-+(CH
2 3
NH
2 013 WO 2006/110185 WO 206/10185PCT/US2005!040919 R wiR 12 R'1 3 TIIII00 CH 3
-+(CH
2 3
N
2
CH
3 T111101 CH 3
-+(CH
2 3
NH
2 H 0 NH 2 THE1102 CIT 3
-(CH
2 3 N H 2 H THE 03 CIT 3
-+(CH
2 3 2
H
T111104 CH 3 -1-(GH 2 3
NH
2
H
T111105 CH 3
+(CH
2 4
NH
2 C3 0 NH 2 TIII106 CIT 3
-+(CH
2 4
NH
2
CIT
3 N I N
H
TIIII07 CH 3 -1-(CH 2 4
NH
2
CH
3 T111108 CH 3
+(CH
2 4
NH
2
CH
3 T111109 CH 3
-+(CH
2 4
NH
2 H 0 NH 2 TI1110 CH 3
-+(CH
2 4
NH
2 H N
H
TI11 11 CH 3
+(CH
2 4
NH
2
H
TIM 12 CH 3 -1-(CH 2 4
NH
2
H
WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919
#R
8 R 12 R 13 T1I1125 CH 3 O H 0 NH 2 T111126 CH 3 OH H 1 N
H
T11I127 GH 3
OHH
TIII128 CH 3
OHH
TIII129 CH 3 NH CH 3 0 NH 2 N
NH
HH
TI11130 CH 3 NH Gil 3
H
HH
T11I131 CH 3 HN0 NH 2
H
T111132 CH 3 NH H H
NH
HH
TIII133 GH 3 NH H0 H N lkNANH2
H
WO 2006/110185 PCT/US2005!040919 WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005!040919 S R8 R 12
R'
3 TII1158 CH 3 0 H H Nil 2
N
H
T111159 CH 3 0 H H NH2 TI1I160 CH 3 0 H _H HNH2 T111161 CH 3 01 C 3 0 NH 2
OHH
TIII162 CH3Cl
H
T111163 CH 3 Cl -0 /OH Cl
CH
3 TI11164 I CH 3
CH
3 T111165 CH 3 T111166 CH 3
H
TIII167 CH3 WO 2006/110185 PCT/US2005!040919 R" RR2 1 T111168 CH 3 cl H
CI
WO 2006/110185 WO 206/10185PCT/US2005!040919 101161 In another embodiment of the invention each of R 2
R
8 and R"I*is This embodiment gives a compound of Formula IV.
H2C R 12
R
13
HONH
NH
HN -0 0 R 2 0 00 0 H RN lN N R H H N H 0 R 3 0 0= NR
-N
HN 0 H 09 R H N HN N
N
Y -H 0IV 0 H0 2
C
101171 Table TV provides exemplary compounds of Formula IV- Table IV Compounds of Formula IV R 12
R
13
HO
2
C
NH
'HN' 0 R 2 0 00 0 H RN)N N R N H N0 R 3 0 H 0 NRN H N 0
H
0 H N
H
HN N
N
00 H IVl 00 0 H0 2
C
R w ii w w w R" R1 2 R1 Tii- (H22H O H H C3--(CH) 4
NH
2 OMe NH 2 H -+CH(CH,)Et C0 2
H
TIV2 I CH,)CO2H HOV 0C 3 H 3--C)H OMe NH 2 H HC 3
E
3CH3 (H)N2+HCE C, 0 2 H 4 4-t OMe I2 C 2
H
TIViC -(CH),COH CH 3 H CH 3 0 Me NH 2 H 'CH(CH,)Et HO CO 2 2 )C02H TJVil CH)C 2
NH
2
CH
3
-CC(C
3 2 13 -4(H) 4 H NH 2 H -CH(CH,)Et OH C2 TIV12 -ICH) 2 COH NH 2
CH
3 CHCH(CHA) CH 3 (CH),NHI! 'Me NH 2 H -CH(CH 3 )Et 0 COH TIV13 -jCH 2 2
CO
2 H NH 2
CH
3 C11 CH 3 4(H)N2 ome NH 2 H -CH(CH,)Et OH C0 2
H
TIV14 5 H)C, NH 2
CH
3
-(CH
2 2
CO
2 H CH 3
(H)NH
2 OMe NH 2 H -CH(CH 2 )Et OH C 2
(CH
2 2 COH NH 2 CH3 CH 2 OH CH3-(CH 2 4
NH
2 OMe NH 2
-CH(CH
3 )Et OH
CO
2
H
TIV16 2
CO
2 H H NH 2 CH, OH113 4(H)N2 ome NH 2 -CH(CH3)Et TIV17 (CH 2 2 COH NH 2
CH
3
-CH
2
SCH
2 C0113 (CH) 4
NH
2 'Me NH 2 H -CH(CH,)Et OH
CO
2
H
'R
3 R 5
R
5 6R1 2 W3 TJV18 -(CH,),COH N2 C3 -CH(CH')Et C3 (HO2 Ole N 2 H -CH(CH 3 )Et OH .1 -COH TIV19 -jCH02COH NH 2
CH
3 CHCO CH 3 O M6 NH 2 H -CH(CH,'Et ~-A22
CH(CH
3 )O F-(C01N OH C0 2
H
-'CH0,COH NH 2
CH
3 OH CH 3 O (C2)eH NH 2 H -OH(CH,)Et ~2 22OH CO,0H TJV21 2 CO0 2 H NH, CH, -CH04CH 3 Cl- 3
(CH
2
)NH
2 WOe NH 2 H -CH(CH,)Et OH C0 2
H
TTV22 -CH),COH NH 2
CH
3 CH3I.(H H Ole NH 2 H CH(CH,)Et OH CO 2
H
T1V23 (HOC2 NH 2
CH
3 Cls (CH 2 0H 2 Oe NH 2 H H(CH)Et OH N CO 2
H
T1V4 4 (CH)ICOH N 2
C
3 CIL O (C2)eH NH 2 H -CHCCH 3 )Et OH C0 2 H 4
N
NH
2 H 3 OeN 2 H HC 2
E
2 H ri (H)NH l H HCE OH N> S C 2 H o' 4 RY R5 R 5 R'~R R 2 WZ W TIV26 C H)C, NH 2
CH
3 HNC3 O -(CHNH 2 U -CH(CH,)Et -C-j OH
CO
2
H
T1V2' jCH,)COH NH, CH, CH 3
(CH.),NH
2
NH
2 H -CH(CH,)Et OH 0 C 2 H TIV21 H)C, NH 2
CH
3 xCIT 3 -4-(CH 2 4
NH
2 OMe NH 2 H -+CH(CH)Et OH C0 2
H
TIV29 O(H22OH NH 2
GH
3 F CH 3 (H)N2 OMe NH 2 H -OH(CH 3 )Et 0 N OH ~C 2 TIV 3 0 H C 2 NH 2 CH 3 ON FC 34 CH N 2OM o NH H H (C H )Et OH N '7 00 2 H)COH NH 2 GCl 3 F CU 3 NH I TIV31 CH2'NH Oe H H -CH(CH,)Et r HN 4-i4 N C0 2
H
OH
8 R1ww W wR R 2 R 3 T1V32 H)COHNH 2 CHl CH Ile-o 2
)N
2 M NH, -CH(CH,)Et OH -~C0 2
H
TIV33 -(cH 2 2 COH NH 2 GCl 3 OH CR 3 0MGH,)NH! NH 2 H -CH(CH,)Et OH
CO
2
H
TIV34 -JCH 2 2 C0 2 H NH, CH3 CH 3
(CH)
4
NH
2 OMe NH 2 H -C-H(CH 3 )Et
OHN
T1V35 H,2 2HN2 C 3 HCH 3 (CHOhNH, eNH 2
-CH(CH
2 )Et TV6OH
CO
2
H
TV6- (CH 2
)CO
2 H NH 2 Gil 3 H CH 3 (CH2)NH2 M NH 2 H -CH(CH,)Et C0 2 H T1V37 -CH,)CO2H NH 2 Gil 3 H Gi 3
(CH
2
)NH
2
NH
2 H -OH(CH,)Et 0 C, C0 2
H
OH
T1V38 NH 2 Gil 3 H C HT -I(H) 4 H H NH2 HI -CH(CHORE -jC;H) 2
CO
2 H 3 I(H2,H OH R 2 R' Rs* R' w WZ W 13 TIV39 NH 2 H H OH 3 OH GEL 3 4 HC0H-(CH 2
)NH
2
HOI
C020
NH
2
H
2 0HH H -C(H) 2 H H 3 OH >i~H H 0 TIV41 NH 2 4 CH 2
CO
2 H H H (CH 2
)NH
2
OH
3 OH C~ H 3 -CH(CH3)Et ;oC0 2
H
TIV42 NH 2 C,0HH H OH 3 OH H +~CH(CH,)Et
COH+
T1V44 NH 2 H H OH 3 OH H O 3
COH.
3 -R WRR 5 R R 2 R13
NI-
2 H H 53OMe O 3 4CCH-(C 2
)NH
2
CO
2 H OHHC C02H
CO
2 H NH, 0-0 T1V46 NH 2
CHCO
2 H H H -(CH 2 3
NH
2
CH
3 OMe OH 1 H~C(C 2
E
C0 2 H
H
TJV47 NH 2 4 CHC0H H H (CH 2 3
NH
2 C3 OMe 2NOH H -CH(CH3)Et C0 2
H
TIV48 NH 2 4C,0HH H CIT 3 OMe 110H113 C(H3E c C0 2
H
TIV49 NH 2 4CH 2 COH H H (CH 2
)NH
2
CIT
3 OMe CQ~H H3 -CH(CH 3 2 CH2COCO
H
3 R 5
R
6
R
11
R
12 13 TIV51 NH 2 H H Gil 3 (C)Home NH 2 Gil 3 4 CH,0,H -(CH)4NHN'I, C0 2
H
TIV52 NH 2
CHCO
2 H H H Gil 3
-(CH)
4
NH
2 OMe NH 2
H
COH o
NH,
TIV53 NH 2 C22H H H Gil 3
(CH
2 4 NH2 OMe NH 2 Gil 3 -CH(CH,)Et C02H T1V54 NH 2
CH
2
CO
2 H H fl GH 3 0MGH2H Il NH 2 H -CH(CH,)Et -~C02H
NH
2 C,0H H H Gil 3 (H)NOMe
NH
2 Gil 3
-_-H(CHA)
TIV56 NH, HC2 H H CIT 3
(CH
2 4
NH
2 OeNH 2 H -CH(CH) 2 7, C0 2 H TIV57 NH 2 CHC2 H H Gil 3 OH NH 2 Gil 3 C02H NH, oJ TIV58 NH 2
CH
2 C0 2 H H H CH 3 H NH 2
H
C0 2 H NH, TIV59 NH 2 4CH 2 C0 2 H H H OH 3
C
2 4 H OHNH 2 0113 CH(CH 3 )Et I C02H 1-k NHi 2 -4-CHC0H H H CH 3 OH NH 2 H -CH(CH,)Et TIV61 NH2 CC0H H H 0113 -(ChNa OH NH 2
CH
3 -CH(CH3)
CO
2
H
TIV62 NH 2 4C22H H H 0113 (CH 2
)NH
2 O' NHZ H G(H2 -mo1 002H TIV63 NH 2 C22H H Hl OkHNH H 3
NH
2
H
cO 2 N]H2 0H
OH
2
R
3
R
5
R
5
R"
TIV64 NH 2 H H CH 3
NH
2
CH
3 0 NH2
OH
NH
2 C22H H H O(H)3H -Ce) H NH 2
H
C, 0 NH2 -~C0 2 H OH TIV67 NH 2 H H OHe NH 2
CH
00 4 CH2CO2H
-(CH)
2
NH
2
(CH
2 4
NH
2 r oI
NH
-L CO 2 H OH H TIV68 NH 2
CH
2
CO
2 H H H -(CH 2 )3NH 2 -4-CH 24
NH
2 OH NH 2
H
C0 2 H OH 0 II CO 2
-O
TIV69 NH 2 H H 5ome N 2
H
CHC0,- -(CH2 2
)NHH
CH
2 COH -((OHD3NH 2 NH, C0 2
H
R
2 IR R'
R
6 11 W 9 2 W3
NH
2
CH
2
CO
2 H H H
-(CH)
4
NH
2 OMe NH 2
CH
3
N
0 (C 2 )3NH 2 k(C 2
)NH
C0 2
H
TIV71 NH 2 H
HNS
OHC, (H3N2 C24H NH H 3
N
TI72 NH CH 2 C0 2 H H H -(CH) 2
NH
2
(H)
4
NH
2 O H H CC 0 2 ~D TV73 fC 2
COHNH
2 H H 2 2 C k 2)NH 2
GH
3 31 H C1 TIV 4 H,)COH N 2 H H3H 3
N
NH HkHM H1 02 H
CH
2 2 C0 2 HH HH,
CHCH
2 2 NH >.-(H04H2OH CO 0 2 H NH, -u
NH
2
O
2 00 2
CH
3 H CH WO 2006/110185 PCT/US2005!040919 WO 2006/110185 WO 206/10185PCT/US2005010919 [01181 In another embodiment, the invention provides a compound of the Formula Fl:
R
8 0 (F 1) and salts thereof, wherein:
NH
2 a) R8 is hydrogen, /11JO 0 or 0H b) is methyl, 'LLOH~o N H 2 c) R 12 isH orC14 3 d) R" i CH(CH 2
CH
3
)CH
3 0 NH 2 H or-an e) each of R' and R 6 is independently amino, monosubstituted amino, disubstituLted amino, NH-amnino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[0119] In one embodiment of the invention, substituent R 13 of Formula F1 is 0 NH 2 N I
CH(CH
2
CH
3
)CH
3 H or WO 2006/110185 WO 206/10185PCT/US2005!040919 [01201 In another embodiment of the invention, a compound of Formula Fl is selected from R'LTp--s--s--h-l--mLAp--e--s-iyDSrL3~uLi.Iy
R
1 (L-Trp)-D-Asn-L-Asp-L-Tbr-Gly-L-Oni-L-Asp-Gly-L-Asp-Gly-D-Ser-L-3mGlu-L-Kyn
R
1 (L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Orn-L-Asp-D-Asn-L-Asp-Gly-D-Ser-L-3mGLu-L-Kyn RI(L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Orn-L-Asp-D--Asn-L-Asp-Gly-D-Ser-L-3mGlu-L-Ile
R
1 (L-Trp)-D-Asn-L-Asp-L-Tbr-Gly-L-Oi-L-Asp-D-Asn-L-Asp-Gly-D-Ser-L-3mlu-L-Va R'(L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Orn-L-Asp-D-Ser-L-Asp-Gly-D-Ser-L-Glu-L-ITrp, and R' (L-Trp)-D-Asn-L-Asp-L-IThr-Gly-L-Om-L-Asp-D-Ser-L-Asp-Gly-D-Ser-L-Glu-L-Trp 101211 In one embodiment of the invention, substituent R' of Formula FlI is not CIO-alkanoyl when substitutent R8** is hydrogen or 'OH.
[01221 Exemplary compounds Formula Fl include, without limitation, compounds C22, C189, C201, C210, C37 and C39 (videsupra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [01231 In another embodiment, the invention provides a compound of the Formula F2: H02C
R
12
R
13 HN NH -0CONK 2 00 0 H N R
H
3 C N N H H NH 0 0 0= NH CO 2
H
N
HN 0
H
0 HN
R
8 0 H0 2 C HN N T N
RG*
YIH 0 0 H0 2 C (172) and salts thereof; wherein:
NH
2 a) R 8 is hydrogen, methyl, /1 0, O or b) R 12is HorCH 3 c) R 13 is CH(CH 3 2
CH(CH
2
CH
3
)CH
3 H or;an d) each of R 6 *and Rs** is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamnino, thioacylamino, thioureido, iminoamnino, or phosphonamino.
[01241 In another embodiment of the invention, a compound of Formula F2 is selected from R'LTp--s-LA ILTrGy--r--s--laLApGyIAl--ml--y R'(L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Orn-L-Asp-D-Ala-L-Asp-Gly-D-Ala-L-3mGlu-L-Tr nd
R
1 (L-Trp)-D-Asn-L-Asp-L-IThr-Gly-L-Om-L-Asp-D-Ala-L-Asp-Gly-D-Ala-L-3Glu-LTrp, n WO 2006/110185 WO 206/10185PCT/US2005!040919 [01251 Exemplary compounds Formula F2 include, without limitation, compounds C46, C49, and C61 (vide supra).
[01261 In another embodiment, the invention provides a compound of the Formula F3: 12 NH H0 2
C
HN NH 0CONH 2 HN00 00 0 H R1-N N N R NH 0 H 0 H 0 NH C0
N
HN 0z H 0 HN H0 2 C HN N N R 6 0 H0 2 C P3 and salts thereof; wherein:
NH
2 a) R 8 is hydrogen, ,orY 8* b) R" is methyl, LL-'H, ,or~'~N 2 c) R 12 is Hor CH 3 ;and d) each of R 6 *and R is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamnoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonam-ino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 101271 The present invention provides, in another aspect, compounds of Formula F4: R12 NH H0 2
C
HN NH 0CONH 2 HN r 0 0 00 0 H N R R1-N N NH H NH0 NH C0 2
H/
N
HN =0
H
0 HN
R
8 0 H0 2 C HN N) N R 6 NrI- 0 0 H0 2 C (F4) and salts thereof; wherein;
NH
2 a) R 8 is hydrogen, methyl, O or 0 b) R" is methyl, or N 2 0) R 12 isH or Cf 3 and d) each of R 6 and R is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 101281 In another embodiment, the invention provides a compound of the Formula H0 2
C
HN NH 0CONH 2 0=O0 0 H
R
1 I N N
R
<H H N H 0 0 0= N H C0 2
H
N
HN 0
H
0 HN
R
8 0 H02C
H
HOC HN N N B 0 0 H0 2 C (175) and -salts thereof; wherein:
NH
2 a) R 8 is hydrogen, methyl, ,or b) R" 1 is methyl, LL0H /11"NH 2 and c) each of R and is independently amino, monosubstituted amino, disubstittited amino, Nfl-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, imino amino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [01291 In another embodiment, the invention provides a compound of the Formula F6: H0 2 C C0 2
H
NH
HN 0 0 0 00
VH
N R R"N N IH 1H NH0 0 0 NCH 3 HO CONH 2 HN 0H O0
HN
R
9
R
8 0 H HN N
N
H0 0 H0 2 C (F6) and salts thereof; wherein:
NH
2 a) R' is _11k or OH; OMe OH COH C0 2
H
b) R' is or c) R 11 is, methyl,
CO
2
H.
0 or d) R 1 is HorC11 3 and e) R1 is amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, imino am-ino, or phosphonamino.
[01301 In another embodiment of the invention, a compound of Formula F6 is selected from R'(L-Trp)-D-Glu-L-h-Asn-L-ITbr-Sar-L-Ala-L-Asp-D-Ser-L-omAsp-Gly-D-Asn-L-Glu-L -Ile WO 2006/110185 WO 206/10185PCT/US2005!040919 R'(L-Trp)-D-Glu-L-h-Asn-L-Thr-Sar-L-Ala-L-Asp-D-Sn-L-omAsp-Gly-D-Asn-L-3GU--L-Ilean
R
1 (L-Trp)-D-Glu-L-h-Asn-L-Thr-Sar-L-Ala-L-Asp-D-Asn-L--omAsp-Gly-D-Asn-L-Glu-L-Ile n [01311 Exemplary compounds Foninula F6 include, without limitation, compounds C292, C289, C307 and C304 (vide supra).
[0132] In another embodiment, the invention provides a compound of the Formula F7: H0 2 C C0 2
H
NHV
HN 0" 00 0 H N
R
H
3 C N N NH 0 H 0 H 0z NCH 3 HO CONH 2
N
HN o0 H
R
9 0R 8 0
H
H
H N- ,N N
H
0 H0 2 C (F7) and salts thereof; wherein:
NH
2 a) R 8 is methyl, k OHor OMe OH b) R is> CH,0Hor C zH c) R1 2 is Hor CH 3 ;and d) each of R 1 and R 8 is independently amino, monosubstituted amino, disubstituted amino, NH--amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonainino, thioacylamino, thioureido, iminoamino, or phosphonamino.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0133] In another embodiment of the invention, a compound of Formula F7 is selected from
R
1 (L-Trp)-D-Glu-L-h-Asn-L-Thr-Sar-L-Ala-L-Asp-D-Lys-L-omAsp-Gly-D-Ala-L-Glu-L -le and R' (L-Trp)-D-Glu-L-h-Asn-L-Thr-Sar-L-Ala-L-Asp-D-Lys-L-omAsp-Gly-D-Ala-L-3mGlu-L-Ile [01341 Exemplary compounds Formula F7 include, without limitation, compounds C337, and C329 (vide supra).
[01351 In another embodiment, the invention provides a compound of the Formula F8: H0 2 C C0 2
H
NHV
HN 0 00 00 0 H
R
1 1 N N R NH 0 H oy 0 NCH 3
R
3
CONH
2 HN 0H HO 0 HN HO
R
8 0 HN~r)H HN
N
H0 0 H0 2 C (F8) and salts thereof, wherein: a) R 3 hydroxyl. or hydrogen
NH
2 b) R 8 is methyl, or c) R" 1 is an amino acid side chain, methyl, 0 or N 2 d) R1 2 is Hor CH 3 and e) each of R1 and R 8 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
209 WO 2006/110185 WO 206/10185PCT/US2005!040919 101361 In one embodiment of the invention group R 3 of Formula F8 is hydroxyl. This gives a compound of Formula F8A: H0 2 C C0 2
H
NH
HN 0 0 0 0 0 0H
H
R11-N N N
R
1 NH 0 0 0) NCH 3 HO CONH 2 N HN =0H HO 0HN HO R 8 0 0 HN N 0 H0 2 C (F8A) wherein RI,RS, R 8
R
11 and R 12 are as described for Formula F8.
[0137] In another embodiment of the invention, a compound of Formnula 178A is selected from, R'(L-Trp)-D-Gu-L-h-Asn-L -Thr-Sar-L-Ala-L-Asp-D-LyS-L-hAsp-Gy-D-An-L-Gu-L-IIlean
R
1 (L-Trp)-D-Glu-L-h-Asn-L -Thr-Sar-L-Ala-L-Asp-D-Lys-L-Asp-Gy-D-ASfl-L-3mGlU-LIIlc [01381 Exemplary compounds Formula F8A include, without limitation, compounds C87 and Cli11 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 101391 In another embodiment of the invention group R 3 of Formula F8 is hydrogen. This gives a compound of Formula F8B:
HO
2 C C0 2
H
NH
HN VH 0 00 0H
HNN
R
1 1 N N R H H HN 0 H HO 0HN HO
R
8 0
H
0 H N N
H
0 H02C (F8B) wherein R',R 8 RH, and R 12 are as described for Formula F8.
[0140] In another embodiment of the invention, a compound of Formula F813 is selected from R1(L-Trp)-D-Glu-L-Asn-L Thr-Sar-L-Ala-L-Asp-D-Lys-L-hAsp-Gly-D-Asn-L-Glu-L-Ilean
R
1 (L-Trp)-D-Glu-L-Asn-L-Thr-Sar-L-Ala-L-Asp-D-Lys-L-iAsp-Gly-D-AsW-L-3mGlu-L-Ile [0141] Exemplary compounds Formula F813 include, without limitation, compounds C102, and C99 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [01421 In another embodiment, the invention provides a compound of the Formula F9: H0 2 C R 12 C0 2
H
NH
HN 00 0 H00 0
H
H
2 N0C N RI H H 0 H NCH 3
CONH
2 K N HN (CH 2 4 /0
H
0 HN
H
HN N 0 N H0 0 H0 2 C (F9) and salts thereof, wherein: a) R1 2 is Hor CH 3 and b) each of R 1 and R8** is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphon amino.
[0143] In one embodiment of the invention, substituent group R1 2 of Formula F9 is methyl.
101441 In another embodiment of the invention, a compound of Formula F9 is selected from R"(L-Trp)-D-Glu-L-Asn-L-Thr-Sar-L-Ala-L-Asp-D-Lys-L-Asp-Gly-D-Asn-L-Glu-L -Ile and
R
1 (L-Trp)-D-Glu-L-Asn.-L Thr-Sar-L-Ala-L-Asp-D-Lys-L-Asp-Gly-D-Asn-L-3mGlu-L -Ile [0145] Exemplary compounds Formula F2 include, without limitation, compounds C105, and C 10 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005010919 [01461 In another embodiment, the invention provides a compound of the Formula Fl. 0: H0 2 C H C0 2
H
NH
H N 0 01N N N
R
H H NHCONH0 0NH OH HN 0t
H
0 HN HO<0 H HN N N H a H 0 0 H0 2 C (FlO) and salts thereof; wherein: a) R 13 is H or CH 3 and b) each of R 1 and R 6 is independently amnino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamnino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, inminoaniino, or phosphonamino.
[0147] In another embodiment of the invention, a compound of Formnula Fl 10 is selected from
R
1 (L-Trp)-D-Glu-L-Asn-L-Thr-Gly-L-.Om-L-Asp-D-Ala-L-Asp-Gly-D-Ser-L-3mGlu-L Ile and
R
1 (L-Trp)-D-Glu-L-Asn-L-Thr-Gly-L-Orn-L-Asp-D-Ala-L-Asp-Gly-D-Ser-L-3mGlu-L-Va [01481 Exemplary compounds Formula F10 include, without limitation, compounds C259, and C262 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0149] In another embodiment, the invention provides a compound of the Formula Fl 1: H0 2 C
CH
3 R 3 HN NH 0CONH 2 H 0' 0 0 00 0
H
N R 1 N N HO-t0 H 0 H O=NH C0 2
H/
N
HN 0
H
0 HN O H 3 0 Cx
H
H0 2 C HN N N RG' H 0 0 H0 2 C (Fl11) and salts thereof; wherein: a) R 13 is Hor CH 3 and b) each of R 1 and R 6 is independently amino, mono substituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoammno, or phosphonamino.
101501 In another embodiment of the invention, a compound of Fortnula. Fl 1 is selected from R'L D A n L- s -hrG y L O m L A p D -l sp G y D Se -mIu L Ie an
R
1 (L-'rrp)-D-Asn-L-Asp-L-IThr-Gly-L-Om-L-Asp-D-Ala-L-Asp-Gly-D-Ser-L-3mGlu-Ll Vand 10151] Exemplary compounds Formula F 11 include, without limitation, compounds C4, and C8 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0152] In another embodiment, the invention provides a compound of the Formula F 12: H02C Me R 1 3 HN NH -0CON
H
2 HN0 0 0 0N 0
H
N N
H
2 NOC NH0 H 0 H 0H N H C 2
H/
N
HN 0
H
0 HN 1-t
CH
3 0 H0 2 C HN Nr N R 6 H0 0 H0 2 C (F12) and salts thereof; wherein: 0 NH 2 a) R" 3 is CHi(CHCH,)CH, or ;and b) each of R 1 and R 6 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
101531 In another embodiment of the invention, a compound of Formula F12 is selected from R'(L.-Trp)-D-Asn-L-Asp-L Thr-Gly-L-Om-L-Asp-D-Ala-L-Asp-Gly-D-Asn-L-3m:u--Kn and R'(L-Trp)-D-Asn-L-Asp-L Thir-Gly-L-Om-L-Asp-D-Ala-L-Asp-Gly-D-Asn-L-3mGlu-L-Ike 101541 Exemplary compounds Formula F12 include, without limitation, compounds C233, and C221 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0155] In another embodiment, the invention provides a compound of the Formula Fl 3: 0 NH 2 H0 2 C MeI HN NH 0CONH 2 00 0 00 0RH N 1 N
H
2 NOCZ NH 0 H 0 H 0) NH CO 2 H/ I
N
HN 0 (CH 2 4 RBa- H 0 H H0 2 C HN N N R 6 H 'f 0 HOC (1713) and salts thereof; wherein each of R 1 R 6 and R8** is independently amino, monosubstituted amnino, disubstituted amino, INH-amino protecting group, acylamino, -ureido, guanidino, carbamoyl, sulfonanaino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[01561 In another embodiment of the invention, a compound of Fonmula F 13 is selected from
R
1 (L-Trp)-D-Asn-L.-Asp-L-Thr-Gly-L-Om-L-Asp-D-Lys-L-Asp-Gly-D-Asn-L-3mGlu-L- IKyn RI(L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Om-L-Asp-D-Lys-L-Asp-Gly-D-Asn-L-3mGlu-L-Kynan
R
1 (L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Orn-L-Asp-D..Lys-L-Asp-Gly-D-Asn-L-3mGlu-L-Kyn [0157] Exemplary compounds Fonnula F13 include, without limitation, compounds C236, C23 7, and C23 8 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005010919 [0158] In another embodiment, the invention provides a compound of the Formula F 14: H0 2
C
HN NH 0CON
H
2 HN0 0 00 0H N R N N
H
2 NOC NH0 H 0 H 0 H NH C0 2
H/
N
HN 0 H MeO 0 HN
H
H0 2 C HN NR 6 11H 0 0 H0 2 C (F 14) and salts thereof; wherein: a) R 12is Hor CH 3 ;,and b) each of R 1 and R 6 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamnoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
10159] In another embodiment of the invention, a compound of Formula F 14 is selected from I I R'(L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Om-L-Asp-D-Ala-L-omAsp-Gly-D-Asn-L-Glu-L-Ile and
R
1 (L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Om-L-Asp-D-Ala-L-omAsp-Gly-D-Asn-L-3mGlu-L-Ile [0160] Exemplary compounds Formula F14 include, without limitation, compounds C283, and C277 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [01611 In another embodiment, the invention provides a compound of the Formula Fl H0 2 C R2C0 2
H
NH
HN 0 0 0 00 0 H R' N N HO"t NH 0 y 0':NCH 3 HO CONH 2
N
HN 0
H
MeO 0 (CH 2 4
R
8
HN
7 ~0H HO HN N 0
HO
2 C (F715) and salts thereof, wherein: a) R 12is Hor CH 3 ;and b) each of R' and RS** is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonam-ino, thioacylamino, th-ioureido, iminoamino, or phosphonamino.
[01621 In one embodiment of the invention, substituent group R 1 2 of Formula F 15 is methyl.
101631 In another embodiment of the invention, a compound of Formula Fl 5 is selected from
R
1 LTp-JGu---s--h-SrLAaLApDIy--ms-lyDS LGuLIlan
R
1 (L-Trp)-D-Glu-L-h-Asn-L-TIbr-Sar-L-Ala-L-Asp-D-Lys-L-oniAsp-Gly-D-Ser-L-3Glu-L-lean [01641 Exemplary compounds Formula F15 include, without limitation, compounds C325, and C 153 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [01651 In another embodiment, the invention provides a compound of the Formula Fl 6:
HO
2 C R 2C0 2
H
NHV
HN 0 0 0 00 0
H
N R N N
H
2 NOCII NH 0 H0
H
O) NCH 3 HO CONH 2
N
HN oH O (CH 2 4
HN
0
H
HO 0HN 'f
N-
O N 0
HO
2 C (Fl 6) and salts thereof; wherein: a) R1 2 is Hor CH 3 ,and b) each of R' and RR** is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[01661 In one embodiment of the invention, substituent group R 12 of For-mula F 16 is methyl.
101671 In another embodiment of the invention, a compound of Fonmula Fl 16 is selected from I
I
R'(L-Trp)-D-Glu-L-h-Asn-L Thr-Sar-L-Ala-L-Asp-D-Lys-L-Asp-Gly-D-Asn-L-3mGlu-L-lle 101681 Exemplary compounds Formula F16 include, without limitation, compounds and C 114 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [01691 In another embodiment, the invention provides a compound of the Formula Fl 17: H0 2 C R 2C0 2
H
NHV
HN 0 0 00 0 H N N
R
H
2 NOC NH 0 H0 H O) NCH 3 HO CONH 2
N
HN oH MeO 0HN 7 ~0H r H 0 H0 2 C (F 17) and salts thereof; wherein: a) R1 2 is Hor CH 3 ;and b) R' is amino; monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, tbioacylamino, tlhioureido, iminoamino, or phosphonamino.
[0 1701 In another embodiment of the invention, a compound of Formula F 17 is selected from
R
1 (L-Trp)-D-Glu-L-h-Asn-L-Thr-Sar-L-Ala-L-Asp-D-Ala-L-omnAsp-Gly-D-Asn-L-Glu-LIIlean R'(L-Trp)-D-Glu-L-h-Asn-L-Tbr-Sar-L-Ala-L-Asp-D-Ala-L-omAsp-Gly-D-Asn-L-3mGlu-L-Ilc [0171] Exemplary compounds Formula Fl17 include, without limitation, compounds C3 16, and C3 19 (vide supra).
220 WO 2006/110185 WO 206/10185PCT/US2005!040919 [01721 In another embodiment, the invention provides a compound of the Formiula. Fl 8: H0 2 C Me C0 2
H
NH
HN 0' VH0 00 DH N R 1 N N
H
2 NOC NH 0 0 NH HO CONH 2
N
HN 0H Meo 0 (CH 2 4
HN
0
H
I H 0 H0 2 C (F 18) and salts thereof; wherein each of R' and R8** is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamnino, thioureido, iminoamino, or phosphonamino.
101731 In another embodiment of the invention, a compound of Formnula Fl 18 is
R
1 (L-Trp)-D-Glu-L--h-Asn-L Tbr-Gly-L-Ala -L-Asp-D-Lys-L-omAsp-Gly-D-Asn-L-3mGlu-L-Ile [0174] An exemplary compound of Formiula Fl 8 is, without limitation, compound C180 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0175] In another embodiment, the invention provides a compound of the Formula F19: H0 2
C
NH
HN 0 0R? 0 H 00 0H
H
N N HO NH H0 C)NC 3
CONH
2
N
HN 0
H
0 HN HO4 HN No N H 0, 0
HO
2 C (1l19) and salts thereof; wherein: 0 a) W is~ -1 NH2 or 0 R6* b) R 6 is methyl or c) R 8 is methyloy- R 8- 8 and d) each of R 6 and R8** is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, tbioacylamino, thioureido, imino amino, or phosphonamino.
1761 In another embodiment of the invention, a compound of Formula F 19 is selected from R' (L-Trp)-D-Asn-L-ASP-1 Lr-",)r-L-Ala-L-Asp-D-Ala-L-Asp-Gly-D-Ser-L-Gu-L- ile and 101771 Exemplary compounds Formnula F 19 include, without limitation, compounds C86, C359, and C356 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [01781 In another embodiment, the invention provides a compound of the Formnula.
"U
2 L, (1720) and salts thereof; wherein: a) R 1 2 is Hor CH 3 ;and b) each of R' and RS** is amino, mono substituted amino, disubstituted amino, NH--amino protecting group, acylamino, ureido, guanidino, carbarnoyl, sulfoniaiino, th-iioacylamino, thioureido, iminoamino, or phosphonamino.
[0179] In another embodiment of the invention, a compound of Formula F20 is selected from
R
1 (L-Trp)-D-Asn-L-h-Asn-L-Tbr-Sar-L-Ala-L-Asp-D-Lys-L-omlAsp-Gly-D-Asn-L-Glu-L-Ile and
R
1 (L-Trp)-D-Asn-L-h-Asn-LI-.Thr-Sar-L-Ala-L-Asp-D-Lys-L-omiAsp-Gly-D-Asn-L-3mGlu-L-Ile [01801 Exemplary compounds Formula F20 include, without limitation, compounds C343, and C340 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 10181] In another embodiment, the invention provides a compound of the Formula F2 1 (F2 1) and salts thereof; wherein: a) R' is 0 N (CH 2 8
CH
3
H
H H (CH2)6CH(CH 3 )2 K (CH2)CH(CH 3
)CH
2
CH
3 0 0 N1(CH 2
),CH(CH,)CHCH,
0 Li KNy (CH 2 8
CH(CH
3 2 0 b) R1 2 is Hor CH 3 ,and c) R8* is amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamnino, thioacylamino, thioureido, imino amino, or phosphonamino.
[0182] In another embodiment of the invention, a compound of Formula F21 is selected from R' -(L-Trp)-D-Asn-L-Asp-L-Thr-Sar-.L-Ala-L-Asp-D-Lys-L-omAsp-Gly-D-Asn-L-3mGlu-L-Ile and R'-(L-Trp)-D-Asn-L-Asp-L-Thr-Sar-L-Ala-L-Asp-D-Lys-L-omAsp-Gly-D-Asn-L-Glu-L Ile.
[01831 Exemplary compounds Formula F21 include, without limitation, compounds C265, and C271 (vide supra).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [01841 In another embodiment, the invention provides a compound of the Formula F22 H0 2 C
CH
3
"NNH
NH
CONH
2 HN 0 0 N NH 00 H0
A(CH
2 8
CH(CH
3
)CH
2
CH
3 N NH HO 0 H H NH NH C0 2
H/
HN 0 H 0 HN
CH
3 0 HO/C HN N N R 6 0 H0 2
C
(F22) and salts thereof; wherein: R6*.saio monosubstituted amino, disubstituted amnNil-amino prtciggroup, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamnino, thioureido, iminoamino, or phosphonamino.
[01851 In another embodiment of the invention, a compound of Formula F22 is (LTrp)-D-Asn-L-Asp-L-Thr-Gly-L-Om-L-Asp-D-AlaLAspGlyDSerL-3mGlwL-rp
NH(CO)(CH
2 8
CH(CH
3
)CH
2
CH:
3 [01861 An exemplary compound Formula F22 includes, without limitation, compound C3 (vide supra).
[0187] In one embodiment of the invention, substituent R' of any of the compounds of Formula 131-1720 is amino, acylamino, NH-amino protecting group or carbamoyl. In another embodiment of the invention, substituent R1 of any of the compounds of Formula F I -F20 is a Clo-C 1 3 alkanoylamino. In yet another embodiment of the invention, substituent R1 of any of the compounds of Formula Fl1 -1720 is WO 2006/110185 PCT/US2005/040919 0 H H o _N (CH 2 6
CH(CH
3 2 2(CH 2 )6CH(CH 3
)CH
2 CH3 N (CH2)8CH3 H 0 0 H H
S(CH
2
)CGH(H
3 )CH (CH 2 8 H()CH23 CH 3 2 o ,or o In yet another embodiment of the invention, substituent R 1 of any of the compounds of Formula F1-F20is
H
,N y (CH 2 )6CH(CH3)CH2CH 3 0 [0188] In one embodiment of the invention, substituent R 6 of any of the compounds of Formula F1-F5, F10-F14, F19 and F22 is amino, NH-amino protecting group or carbamoyl. In another embodiment of the invention, substituent R 6 of any of the compounds of Formula of Fl- F10-F14, F19 and F22 is amino.
[0189] In one embodiment of the invention, substituent R 8 of any of the compounds of Formula F2-F5, F7-F9, F13, F15, F16, F18 and F20-F21 is amino, NH-amino protecting group or carbamoyl. In another embodiment of the invention, substituent R 8 of any of the compounds of Formula F2-F5, F7-F9, F13, F15, F16, F18 and F20-F21 is amino.
101901 It will be understood by one of skill in the art that the compounds of the invention, particularly compounds of Formula I and Formula Fl-F22, are useful as intermediates for the preparation of other compounds of Formula I and Formula F1-F22. Particularly useful compounds that are also intermediates are compounds of Formula I, F2-F5, F13 and F19 wherein at least one of R 1
R
6 or R 8 is amino, NH-amino protecting group or carbamoyl; compounds of Formula Fl or F10-F14 wherein at least one of R or R 6 is amino, NH-amino protecting group or carbamoyl; compounds of Formula F7-9, F15-16, F18 and F20 wherein at least one of R or
R
8 is amino, NH-amino protecting group or carbamoyl; compounds of Formula F22 wherein
R
6 is amino, NH-amino protecting group or carbamoyl; compounds of Formula F21 wherein
R
8 is amino, NH-amino protecting group or carbamoyl;and compounds of Formula F6 and F17 wherein R' is amino, NH-amino protecting group or carbamoyl.
Pharmaceutical Compositions and Methods of Use Thereof WO 2006/110185 PCT/US2005/040919 [0191] The instant invention provides pharmaceutical compositions or formulations comprising, in one embodiment, compounds of Formula I or compounds of any of Formula Fl- F22, or salts thereof [0192] Compounds of the present invention, preferably compounds Formula I or compounds of any of Formula F1-F22, or pharmaceutically acceptable salts thereof, can be formulated for oral, intravenous, intramuscular, subcutaneous or parenteral administration for the therapeutic or prophylactic treatment of diseases, particularly bacterial infections. For oral or parenteral administration, compounds of the present invention can be mixed with conventional pharmaceutical carriers and excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, wafers and the like. The compositions comprising a compound of this invention will contain from about 0.1 to about 99% by weight of the active compound, and more generally from about 10 to about [0193] The pharmaceutical preparations disclosed herein are prepared in accordance with standard procedures and are administered at dosages that are selected to reduce, prevent or eliminate the infection (See, e. "Remington's Pharmaceutical Sciences", Mack Publishing Company, Easton, PA and "Goodman and Gilman's The Pharmaceutical Basis of Therapeutics", Pergamon Press, New York, NY, the contents of which are incorporated herein by reference, for a general description of the methods for administering various antimicrobial agents for human therapy). The compositions of the present invention, preferably compositions of Formulas I or compositions of any of Formulas F1-F22, can be delivered using controlled capsules) or sustained release delivery systems bioerodable matrices). Exemplary delayed release delivery systems for drug delivery that are suitable for administration of the compositions of the invention, preferably compositions of Formula I or any of Formulas F1-F22, are described in U.S. Patent Nos. 4,452,775 (issued to Kent), 5,239,660 (issued to Leonard), and 3,854,480 (issued to Zaffaroni).
[0194] The pharmaceutically-acceptable compositions of the present invention comprise one or more compounds of the invention, preferably compounds of Formula I or compounds of any of Formulas F1-F22, in association with one or more nontoxic, pharmaceutically-acceptable carriers and/or diluents and/or adjuvants and/or excipients, collectively referred to herein as "carrier" materials, and if desired other active ingredients. The compositions may contain common carriers and excipients, such as corn starch or gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid. The WO 2006/110185 PCT/US2005/040919 compositions may contain croscarmellose sodium, microcrystalline cellulose, corn starch, sodium starch glycolate and alginic acid.
[0195] Tablet binders that can be included are acacia, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone (Povidone), hydroxypropyl methylcellulose, sucrose, starch and ethylcellulose.
[0196] Lubricants that can be used include magnesium stearate or other metallic stearates, stearic acid, silicone fluid, talc, waxes, oils and colloidal silica.
[0197] Flavoring agents such as peppermint, oil ofwintergreen, cherry flavoring or the like can also be used. It may also be desirable to add a coloring agent to make the dosage form more aesthetic in appearance or to help identify the product.
[0198] For oral use, solid formulations such as tablets and capsules are particularly useful.
Sustained release or enterically coated preparations may also be devised. For pediatric and geriatric applications, suspensions, syrups and chewable tablets are especially suitable. For oral administration, the pharmaceutical compositions are in the form of, for example, a tablet, capsule, suspension or liquid. The pharmaceutical composition is preferably made in the form of a dosage unit containing a therapeutically-effective amount of the active ingredient. Examples of such dosage units are tablets and capsules. For therapeutic purposes, the tablets and capsules which can contain, in addition to the active ingredient, conventional carriers such as binding agents, for example, acacia gum, gelatin, polyvinylpyrrolidone, sorbitol, or tragacanth; fillers, for example, calcium phosphate, glycine, lactose, maize-starch, sorbitol, or sucrose; lubricants, for example, magnesium stearate, polyethylene glycol, silica, or talc; disintegrants, for example, potato starch, flavoring or coloring agents, or acceptable wetting agents. Oral liquid preparations generally are in the form of aqueous or oily solutions, suspensions, emulsions, syrups or elixirs may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous agents, preservatives, coloring agents and flavoring agents. Examples of additives for liquid preparations include acacia, almond oil, ethyl alcohol, fractionated coconut oil, gelatin, glucose syrup, glycerin, hydrogenated edible fats, lecithin, methyl cellulose, methyl or propyl parahydroxybenzoate, propylene glycol, sorbitol, or sorbic acid.
[0199] For intravenous (IV) use, a compound of the present invention can be dissolved or suspended in any of the commonly used intravenous fluids and administered by infusion.
Intravenous fluids include, without limitation, physiological saline or Ringer's solution.
WO 2006/110185 PCT/US2005/040919 Intravenous administration may be accomplished by using, without limitation, syringe, minipump or intravenous line.
[02001 Formulations for parenteral administration can be in the form of aqueous or nonaqueous isotonic sterile injection solutions or suspensions. These solutions or suspensions can be prepared from sterile powders or granules having one or more of the carriers mentioned for use in the formulations for oral administration. The compounds can be dissolved in polyethylene glycol, propylene glycol, ethanol, corn oil, benzyl alcohol, sodium chloride, and/or various buffers.
[0201] For intramuscular preparations, a sterile formulation of a compound of the present invention, or a suitable soluble salt form of the compound, for example the hydrochloride salt, can be dissolved and administered in a pharmaceutical diluent such as Water-for-Injection (WFI), physiological saline or 5% glucose. A suitable insoluble form of the compound may be prepared and administered as a suspension in an aqueous base or a pharmaceutically acceptable oil base, an ester of a long chain fatty acid such as ethyl oleate.
[0202] A dose of an intravenous, intramuscular or parental formulation of a compound of the present invention may be adminstered as a bolus or by slow infusion. A bolus is a dose that is administered in less than 30 minutes. In a preferred embodiment, a bolus is administered in less than 15 or less than 10 minutes. In a more preferred embodiment, a bolus is administered in less than 5 minutes. In an even more preferred embodiment, a bolus is administered in one minute or less. An infusion is a dose that is administered at a rate of 30 minutes or greater. In a preferred embodiment, the infusion is one hour or greater. In another embodiment, the infusion is substantially constant.
[02031 For topical use the compounds of the present invention, preferably compounds of Formula I or compounds of any of Formula F1-F22, can also be prepared in suitable forms to be applied to the skin, or mucus membranes of the nose and throat, and can take the form of creams, ointments, liquid sprays or inhalants, lozenges, or throat paints. Such topical formulations further can include chemical compounds such as dimethylsulfoxide (DMSO) to facilitate surface penetration of the active ingredient.
[0204] For application to the eyes or ears, the compounds of the present invention, preferably compounds Formula I or compounds of any of Formula F1-F22, can be presented in liquid or semi-liquid form formulated in hydrophobic or hydrophilic bases as ointments, creams, lotions, paints or powders.
WO 2006/110185 PCT/US2005/040919 [0205] For rectal administration the compounds of the present invention, preferably compounds Formula I or compounds of any of Formula F 1-F22, can be administered in the form of suppositories admixed with conventional carriers such as cocoa butter, wax or other glyceride.
[0206] Alternatively, the compounds of the present invention, in one embodiment, compounds of Formula I or compounds of any of Formulas F1-F22, can be in powder form for reconstitution in the appropriate pharmaceutically acceptable carrier at the time of delivery. In another embodiment, the unit dosage form of the compound can be a solution of the compound or preferably a salt thereof in a suitable diluent in sterile, hermetically sealed ampoules or sterile syringes. The concentration of the compound in the unit dosage may vary, e.g. from about 1 percent to about 50 percent, depending on the compound used and its solubility and the dose desired by the physician. If the compositions contain dosage units, each dosage unit preferably contains from 1-500 mg of the active material. For adult human treatment, the dosage employed preferably ranges from 5 mg to 10 g, per day, depending on the route and frequency of administration.
10207] In another aspect, the invention provides a method for inhibiting the growth of microorganisms, preferably bacteria, comprising contacting said organisms with a compound of the present invention under conditions which permit contact of the compound with said organism and with said microorganism. Such conditions are known to one skilled in the art and are exemplified in the Examples. This method involves contacting a microbial cell with a therapeutically-effective amount of compound(s) of the invention, preferably compound(s) of s Formula I or compound(s) of any of Formula F1-F22 in vivo or in vitro.
[0208] According to this aspect of the invention, the novel compositions disclosed herein are placed in a pharmaceutically acceptable carrier and are delivered to a recipient subject (preferably a human) in accordance with known methods of drug delivery. In general, the methods of the invention for delivering the compositions of the invention in vivo utilize artrecognized protocols for delivering the agent with the only substantial procedural modification being the substitution of the compounds of the present invention, preferably compounds of Formula I or compounds of any of Formula F1-F22, for the drugs in the art-recognized protocols.
Likewise, the methods for using the claimed composition for treating cells in culture, for example, to eliminate or reduce the level of bacterial contamination of a cell culture, utilize artrecognized protocols for treating cell cultures with antibacterial agent(s) with the only substantial procedural modification being the substitution of the compounds of the invention, preferably 230 WO 2006/110185 PCT/US2005/040919 compounds of Formula I or compounds of any of Formula F1 -F22, for the agents used in the artrecognized protocols.
[0209] In one embodiment, the invention provides a method for treating an infection, especially those caused by gramin-positive bacteria, in a subject with a therapeutically-effective amount of a compound of the invention. Exemplary procedures for delivering an antibacterial agent are described in U.S. Patent Number 5,041,567, and PCT patent application number EP94/02552 (publication number WO 95/05384), the entire contents of which documents are incorporated in their entirety herein by reference. As used herein, the phrase "therapeuticallyeffective amount" means an amount of a compound of the present invention that prevents the onset, alleviates the symptoms, or stops the progression of a bacterial infection. The term "treating" is defined as administering, to a subject, a therapeutically-effective amount of a compound of the invention both to prevent the occurrence of an infection and to control or eliminate an infection. The term "subject," as described herein, is defined as a mammal, a plant or a cell culture. In a preferred embodiment, a subject is a human or other animal patient in need of antibacterial treatment.
[0210] The method comprises administering to the subject an effective dose of a compound of the present invention. An effective dose is generally between about 0.1 and about 100 mg/kg of a compound of the invention or a pharmaceutically acceptable salt thereof. A preferred dose is from about 0.1 to about 50 mg/kg of a compound of the invention or a pharmaceutically acceptable salt thereof. A more preferred dose is from about 1 to 25 mg/kg of a compound of the invention or a pharmaceutically acceptable salt thereof. An effective dose for cell culture is usually between 0.1 and 1000 tg/mL, more preferably between 0.1 and 200 gg/mL.
[0211] Compositions containing the compounds of the invention can be administered as a single daily dose or in multiple doses per day. The treatment regime may require administration over extended periods of time, for several days or for from two to four weeks. The amount per administered dose or the total amount administered will depend on such factors as the nature and severity of the infection, the age and general health of the patient, the tolerance of the patient to the compound and the microorganism or microorganisms involved in the infection. A method of administration to a patient of daptomycin, another member of the depsipeptide compound class, is disclosed in United States Patent Numbers 6,468,967 and 6,852,689, the contents of which are herein incorporated by reference.
WO 2006/110185 PCT/US2005/040919 [0212] A compound of the present invention may also be administered in the diet or feed of a patient or animal. If administered as part of a total dietary intake, the amount of compound employed can be less than 1% by weight of the diet and preferably no more than 0.5% by weight.
The diet for animals can be normal foodstuffs to which the compound can be added or it can be added to a premix.
[0213] The present invention also provides methods of administering a compound of the invention, preferably a compound of Formula I or a compound of any of Formulas F1-F22, or a pharmaceutical composition thereof to a subject in need thereof in an amount that is efficacious in reducing, ameliorating or eliminating the bacterial infection. The compound may be administered orally, parenterally, by inhalation, topically, rectally, nasally, buccally, vaginally, or by an implanted reservoir, external pump or catheter. The compound may be prepared for opthalmic or aerosolized uses. The compounds of the present invention can be administered as an aerosol. A preferred aerosol delivery vehicle is an anhydrous or dry powder inhaler.
Compounds of Formula I or compounds of any of Formula F1-F22, or a pharmaceutical composition thereof may also be directly injected or administered into an abscess, ventricle or joint. Parenteral administration includes subcutaneous, intravenous, intramuscular, intraarticular, intra-synovial, cistemal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion. In a preferred embodiment, the compounds of the present invention are administered intravenously, subcutaneously or orally. In a preferred embodiment for administering a compound according to Formula I or a compound of any of Formula F1-F22 to a cell culture, the compound may be administered in a nutrient medium.
[0214] The method of the instant invention may be used to treat a subject having a bacterial infection in which the infection is caused or exacerbated by any type of bacteria, particularly gram-positive bacteria. In one embodiment, a compound of the present invention or a pharmaceutical composition thereof is administered to a patient according to the methods of this invention. In a preferred embodiment, the bacterial infection may be caused or exacerbated by gram-positive bacteria. These gram-positive bacteria include, but are not limited to, methicillinsusceptible and methicillin-resistant staphylococci (including Staphylococcus aureus, S.
epidermidis, S. haemolyticus, S. hominis, S. saprophyticus, and coagulase-negative staphylococci), glycopeptide intermediary- susceptible S. aureus (GISA), vancomycin-resistant Staphylococcus aureus (VRSA), penicillin-susceptible and penicillin-resistant streptococci (including Streptococcus pneumoniae, S. pyogenes, S. agalactiae, S. avium, S. bovis, S. lactis, S.
WO 2006/110185 PCT/US2005/040919 sangius and Streptococci Group C, Streptococci Group G and viridans streptococci), enterococci (including vancomycin-susceptible and vancomycin-resistant strains such as Enterococcus faecalis and E. faecium), Clostridium difficile, C. clostridiiforme, C. innocuum, C. perfringens, C. ramosum, Haemophilus influenzae, Listeria monocytogenes, Corynebacteriumjeikeium, Bifidobacterium spp., Eubacterium aerofaciens, E. lentum, Lactobacillus acidophilus, L. casei, L. plantarum, Lactococcus spp., Leuconostoc spp., Pediococcus, Peptostreptococcus anaerobius, P. asaccarolyticus, P. magnus, P. micros, P. prevotii, P. productus, Propionibacterium acnes, Actinomyces spp., Moraxella spp. (including M. catarrhalis) and Escherichia spp. (including E.
coli).
[0215] In a preferred embodiment, the antibacterial activity of compounds of Formula I or compounds of any of Formula F1-F22 against classically "resistant" strains is comparable to that against classically "susceptible" strains in in vitro experiments. In another preferred embodiment, the minimum inhibitory concentration (MIC) value for compounds according to this invention, against susceptible strains, is typically the same or lower than that ofvancomycin or daptomycin. Thus, in a preferred embodiment, a compound of this invention or a pharmaceutical composition thereof is administered according to the methods of this invention to a patient who exhibits a bacterial infection that is resistant to other compounds, including vancomycin or daptomycin. In addition, unlike glycopeptide antibiotics, depsipcptidc compounds such as those disclosed in the present invention, exhibit rapid, concentrationdependent bactericidal activity against gram-positive organisms. Thus, in a preferred embodiment, a compound according to this invention or a pharmaceutical composition thereof is administered according to the methods of this invention to a patient in need of rapidly acting antibiotic therapy.
[0216] The method of the instant invention may be used for any bacterial infection of any organ or tissue in the body. In a preferred embodiment, the bacterial infection is caused by gram-positive bacteria. These organs or tissue include, without limitation, skeletal muscle, skin, bloodstream, kidneys, heart, lung and bone. The method of the invention may be used to treat, without limitation, skin and soft tissue infections, bacteremia and urinary tract infections. The method of the invention also may be used to treat mixed infections that comprise different types of gram-positive bacteria, or which comprise both gram-positive and gram-negative bacteria.
These types of infections include intra-abdominal infections and obstetrical/gynecological infections. The method of the invention also may be used to treat an infection including, without WO 2006/110185 PCT/US2005/040919 limitation, endocarditis, nephritis, septic arthritis, intra-abdominal sepsis, bone and joint infections, and osteomyelitis. In a preferred embodiment, any of the above-described diseases may be treated using compounds according to this invention or pharmaceutical compositions thereof.
[02171 The method of the present invention may also be practiced while concurrently administering one or more other antimicrobial agents, such as antibacterial agents (antibiotics) or antifungal agents. In one aspect, the method may be practiced by administering more than one compound according to this invention. In another embodiment, the method may be practiced by administering a compound according to this invention with a lipopeptide compound, such as daptomycin or the lipopeptide compounds described, for example in United States Patents 6,911,525; and 6,794,490 and in International Patent Applications WOO 1/44272; WOO 1/44274; WO01/44271 and WOO3/014147.
[0218] Antibacterial agents and classes thereof that may be co-administered with a compound according to the invention include, without limitation, penicillins and related drugs, carbapenems, cephalosporins and related drugs, aminoglycosides, bacitracin, gramicidin, mupirocin, chloramphenicol, thiamphenicol, fusidate sodium, lincomycin, clindamycin, macrolides, novobiocin, polymyxins, rifamycins, spectinomycin, tetracyclines, vancomycin, teicoplanin, streptogramins, anti-folate agents including sulfonamides, trimothoprim and its combinations and pyrimethamine, synthetic antibacterials including nitrofurans, methenamine mandelate and methenamine hippurate, nitroimidazoles, quinolones, fluoroquinolones, isoniazid, ethambutol, pyrazinamide, para-aminosalicylic acid (PAS), cycloserine, capreomycin, ethionamide, prothionamide, thiacetazone, viomycin, evemrninomycin, glycopeptide, glycylcylcline, ketolides, oxazolidinone; imipenen, amikacin, netilmicin, fosfomycin, gentamicin, cefiriaxone, ZIRACIN®, LY 333328, CL 331002, HMR 3647, ZYVOXO, SYNERCID aztreonam metronidazole, epiroprim, OCA-983, GV-143253, sanfetrinem sodium, CS-834, biapenem, A-99058.1, A-165600, A-179796, KA 159, dynemicin A, DX8739, DU 6681; cefluprenam, ER 35786, cefoselis, sanfetrinem celexetil, HGP-31, cefpirome, HMR-3647, RU-59863, mersacidin, KP 736, rifalazil; AM 1732, MEN 10700, lenapenem, BO 2502A, NE- 1530, PR 39, K130, OPC 20000, OPC 2045, veneprim, PD 138312, PD 140248, CP 111905, sulopenem, ritipenam acoxyl, RO-65-5788, cyclothialidine, Sch-40832, SEP-132613, micacocidin A, SB-275833, SR-15402, SUN A0026, TOC 39, carumonam, cefozopran, cefetamet pivoxil, and T 3811.
WO 2006/110185 PCT/US2005/040919 [0219] Antifungal agents that may be co-administered with a compound according to the invention include, without limitation, caspofungen, voriconazole, sertaconazole, IB-367, FK- 463, LY-303366, Sch-56592, sitafloxacin, DB-289 polyenes, such as amphotericin, nystatin, primaricin; azoles, such as fluconazole, itraconazole, and ketoconazole; allylamines, such as naftifine and terbinafine; and anti-metabolites such as flucytosine. Other antifungal agents include without limitation, those disclosed in Fostel, et al., 2000, Drug Discovery Today 5: 32, herein incorporated by reference. Fostel et al. discloses antifungal compounds including corynecandin, Mer-WF3010, fusacandins, artrichitin/LL 15G256, sordarins, cispentacin, azoxybacillin, aureobasidin and khafrefungin.
[0220] A compound according to this invention may be administered according to this method until the bacterial infection is eradicated or reduced. In one embodiment, a compound of Formula I or a compound of any of Formulas F1-F22 is administered for a period of time from 2 days to 6 months. In a preferred embodiment, a compound of Formula I or a compound of any of Formulas F1-F22 is administered for 7 to 56 days. In a more preferred embodiment a compound of Formula I or a compound of any of Formulas F1-F22 is administered for 7 to 28 days. In an even more preferred embodiment, a compound of Formula I or a compound of any of Formulas F1-F22 is administered for 7 to 14 days. A compound of Formula I or or a compound of any of Formulas F1-F22 may be administered for a longer or shorter time period if it is so desired.
[0221] The instant invention provides antibacterial compositions or formulations comprising, in one embodiment, compounds of Formula I or compounds of any of Formula F1-F22, or salts thereof. In one embodiment the antibacterial compositions may be contained in an aqueous solution. In another embodiment the aqueous solution may be buffered. In another embodiment the buffer may hav an acidic, neutral, or basic pH.
Preparation of Novel Depsipeptides 1. Synthetic Processes [0222] In one embodiment of the invention, the compounds of Formula I or Formula Fl -F22 may be prepared using solid support chemistry. Three preferred methods, Methods A-C, produce resin bound linear precursor nn3, nn3 a or nn3b.
WO 2006/110185 PCT/US2005/040919 [0223] As outlined in Scheme I, Method A utilizes a resin-bound 7 amino acid -derived polypeptide fragment, nnl, and a six amino acid-derived polypeptide fragment, nn2. This method is referred to as a "7 6 fragment synthesis".
WO 2006/110185 WO 206/10185PCT/US2005!040919 Scheme I Method A "7 6" fragment synthesis R1 3
A
P,
8
HN
0 0 WA 0 0
H
N J !_RiA N' N H 0 RSA 0 W SANR6A R~
N
0=
H
HO
>-WRA
0 nniIl (nn2) (nrn3) 10 1 R8A n~ (nn4) WO 2006/110185 PCT/US2005/040919 [0224] Alternatively, as described in Scheme II, Method B utilizes a resin-bound 6 amino acid -derived polypeptide fragment, nnla, and a seven amino acid-derived polypeptide fragment, nn2a. This method is referred to as a "6 7 fragment synthesis".
WO 2006/110185 PCT/US2005!040919 Scheme 11 Method B. "6 7"1 fragment synthesis R 12 R1 3
A
Resln0 2 C jH HN oP 8 -N 0 a R 2 A 0 00 0 rH RIA NA N N 0R 3 A 0 R 2 Rs*
N
HN 0
H
R 9 A 0R8A 0 H R 6
A
NN NHP 2 0 0
OR!
P
8 0 2 C (na (nn2a) ResirIOzCR13 HN
OP
RI 00 P,,HN 0 0o RIIA 0 H 3 NN NN H
NH
0
HHN
HN0 0RA00
N"YH
00 0 l 0 WO 2006/110185 PCT/US2005/040919 [0225] Another method, Method C, utilizes a 6 amino acid derived polypeptide, a resin bound-amino acid, and a second 6 amino acid derived polypepetide. This method is referred to as a "1 6 6 fragment synthesis".
WO 2006/110185 WO 206/10185PCT/US2005!040919 Scheme III Method C. "1 6+ 6" fragment synthesis.
ResinO 2
C
HN O"ResinO 2 C 2 R1A 00 N O2 0 0= (n23)
HN
0=
P
28
HN
Rm 9 A R SA 0 RG HN ,j HN 0 Ra0
P
8 0 2 C (nnlb) (n26) IN. I Solid Support Synthesis of Depsipeptide Compounds Method A: 7 6 Fragment Synthesis WO 2006/110185 PCT/US2005!040919 102261 The depsipeptide compounds of Formula I may be synthesized on a solid support as outlined in Scheme IV, Scheme V and Scheme VI as follows.
WO 2006/110185 PCT/US2005/040919 Scheme IV S,0R12 Resin02C R1 S R 1 2 ResinO 2 C R12 0 0 Resin 2 C HN OP R NR
P
2 HN 1OP R 0 I 0Q 0 R IA NR" P 3
HN
0 P 7
HN
R9A R8A O H _R6A (nn6) HN N N
P
8 0 2 C (nnl) [0227] In the first step, a protected glutamic acid-derivative such as commercially available N-a-Fmoc-L-glutamic acid a-allyl ester or N-Fmoc-L-3-methyl glutamic acid a-allyl ester (See Examples 1-68 and 1-69, vide infra) is coupled to a resin to give Compound nn5, wherein R' 2 is as defined previously. A resin or solid support, such as, but not limited to, Wang, HMPA, Safety Catch, Rink Acid, 2-chlorotrityl-chloride resin, trityl-chloride resin, 4-methyltrityl-chloride resin, 4-methoxytrityl-chloride resin or PAM resin may be used in this reaction. Protecting groups P 1 and P 2 are chosen so that they may be removed independently of one another and without effecting cleavage of the peptide from the resin. Examples of protecting groups can be found in "Protecting Groups in Organic Synthesis" by Theodora W. Greene, (vide supra), hereafter "Greene", incorporated herein by reference. A protecting group combination, such as, but not limited to Pi is allyl ester and P 2 is Fmoc is suitable for this reaction.
[0228] Deprotection of the amine of Compound nn5, followed by coupling of the free amino with an amino acid or a protected amino acid affords Compound nn6, wherein P 3 is a protecting group that can be removed independently of P 1 and without effecting cleavage of the peptide from the resin; R 11A is an amino acid side chain, a protected amino acid side chain, methyl, CH2-
OP
4 or CH 2
-CONHP
5 each of P 4 and P 5 sis independently a suitable protecting group and each of P 1 and R 11 is as defined previously. This peptide coupling process, deprotection of the alpha-amino group, followed by coupling to a protected amino acid, is repeated until the desired number of amino acids has been coupled to the resin. In Scheme IV, a total of seven amino acids have been coupled to give compound nnl wherein, WO 2006/110185 PCT/US2005/040919 R 6*A
R
6A is methyl or 6A; R 6 A is a protected amino, monosubstituted amino, disubstituted amino, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino, provided that R 6 A is compatible with the conditions required to remove the resin from the peptide;
R
8A is an amino acid side chain, a protected amino acid side chain, methyl, CH 2
-OP
6
CH
2
CONHP
5 or R8*A; wherein each of Ps 5 and P 6 is independently a suitable protecting group; wherein R 8 is a protected amino, monosubstituted amino, disubstituted amino, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino, provided that R 8 is compatible with the conditions required to remove the resin from the peptide; OMe
OP
9
-OP
9 wherein R 9 A is or an amino acid side chain substituted with at least op one carboxylic acid group of the formula, o P 7 is a protecting group that can be removed independently of P 1 without effecting cleavage of the peptide from the resin; each of P 8 and P 9 is independently a suitable protecting group such that Pi and P 7 may be removed independently of each of Ps and P 9 and that each of Ps and P 9 is cleaved upon cleavage from the resin; and P 1
R
8 R9A, R 11
R
11 A and R 12 are as defined previously.
[0229] A second peptide is coupled to a resin in a similar fashion, as outlined in Scheme V.
WO 2006/110185 PCT/US2005!040919 Scheme V step 1 R5'A NRAl) step 2 o NP1 stepI NH0P12 Resin-OH 0b- NR' 0NNR 5 sepRS Resin-0 R5*A =0 o= Resin-0 Resin-0 (nn7) (nn8) (nn9) step 4 OZ RA HO 0 R2A 0 H Ny
R
N N N RI, N N 6A R 3 A o 0 A R 3 A 0 R-
NR
5 A ~step_5 N 5 RS'AA N l 0= 0=
H
Resin-0 (ni 0) Resin-0 (nil1) step 6 R1 3 A R1 3
A
1 1HN 0 R2A 0 0H 0 R2A 0 1 0 NYH sep 0 N N H OI RI 0 H I 0 R 3 A o RSA R
N,*
N 0 H Resin-0 (012) HO(nn2) [02301 In step 1, an N-protected-glycine, such as commercially available Fmoc-N-glycine, is coupled to a resin to give Compound mn7 wherein RA and R*A are independently hydrido and
P
10 is a protecting group chosen so that it may be removed without effecting cleavage of the peptide from the resin. The choice of resin used in step 1 is dependent upon the nature of the amino acid that is coupled in steps 2-6. If the amino acid side chains contain protecting groups, a resin must be chosen such that the protecting groups remain intact when the resin is removed from the peptide in step 7. Resins that can be cleaved while preserving the protecting groups of peptides include, but are not limited to, Safety Catch, Rink Acid, 2-chiorotrityl-chloride resin, trityl-chioricle resin, 4-miethyltrityl-chioride resin, 4-methoxytrityl-chloride resin or PAM resin.
[02311 Deprotection of the protected amnino of Compound nn7, followed by coupling of the free amino with n 14 WO 2006/110185 PCT/US2005/040919 (n14) affords Compound nn8, wherein P 1 1 is a protecting group chosen so that it may be removed without effecting cleavage of the peptide from the resin. This peptide coupling process, i.e., deprotection of the alpha-amino group, followed by coupling to a protected amino acid, is repeated until the desired number of amino acids has been coupled to the resin. In Scheme V, five amino acids have been coupled to give Compound nl 1 wherein R 1 A is a protected amino, monosubstituted amino, disubstituted amino, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino, provided that R 1 A is compatible with the conditions required to remove the resin from the peptide; R 2 A is an amino acid side chain, a protected amino acid side chain, CH 2
-CH
2
-CO
2
P
1 4 or CH 2 -CONHP1i; R 3 A is
CH
2 -C0 2
P
16
CH(OP
1 7 )CONH2, CH 2
CONH
2 a non-protienogenic amino acid side chain, or a protected non-proteinogenic amino acid side chain; each of P 12 and P 1 3 is a protecting group chosen so that it may be removed without effecting cleavage of the peptide from the resin; each
P
14
P
1 5, P 1 6 and P 1 7 is independently a suitable protecting group; and R 2
R
5 A and R 5 A is as previously defined.
[0232] Compound nl 1 is coupled with
NHP
1 8 H Ri 3
A
0 to give Compound n12, wherein Pig is a suitable protecting group and R' 3 A is CH(CH 3 2
CH(CH
2
CH
3
)CH
3 S 0 NHP 19 0 N 3 N I H or [0233] The peptide n12 is then removed from the resin to give compound nn2 wherein P9g is a suitable protecting group.
246 WO 2006/110185 WO 206/10185PCT/US2005!040919 [02341 Coupling of the peptide fragments nnl and nn2 is outlined in Scheme VI.
Scheme VI (nn2) (nn3) Am
I
[02351 The peptide fragments nnl and nn2 are coupled to yield the resin bound peptide nn3 wherein, RIA, R 2 WZA, R 3 A, RSIA, R 5
R
6 A R8*, R8A, R 9 A, R1IA R 11 R 12 R 1 3 A, pi, p8, and P 18 WO 2006/110185 PCT/US2005/040919 are as previously defined. Deprotection of the Pi and P 1 5 protecting groups, followed by cyclization affords a resin-bound depsipeptide nn4 wherein, RA, R 2
R
2 A, R 3 A, R 5 A, R 5
R
6A
R
8 RA, R9A, RA, R 1 R1, R13A, and P 8 are as previously defined. Cleavage of the depsipeptide from the resin and deprotection of any remaining protecting groups yields compounds of Formula I.
Solid Support Synthesis of Depsipeptide Compounds Method B 6 7 Fragment Synthesis [0236] The depsipeptide compounds of Formula I may be synthesized on a solid support as described in Schemes VII, VIII and IX.
Scheme VII
R
1 2 ResinO z C R1 SHN OP1 ResnO R2 ResinO 2 C 12 RA ResinO 2 C OP OP NR 11 P, OP 1 10 0 0 0 R11A
NR
1
P
3
HN
-0
R
9 A R 8 A o NP2 C NHP 2 0 (nn6) HN P Oz2C (nnla) 10237] Compound nn6 is prepared as described in Method A. The peptide coupling process (vide supra), deprotection of the alpha-amino group, followed by coupling to a protected amino acid, is repeated until the desired number of amino acids has been coupled to the resin. In Scheme VII, a total of six amino acids have been coupled to give compound nnla wherein, R 8 R8A, R 9 A R R 1 A, R 1 2
P
1 and Ps are as defined previously and P 20 is a protecting group that can be removed independently of Pi and without effecting cleavage of the peptide from the resin, such as Pi is allyl and P 20 is Fmoc.
[0238] A second peptide is coupled to a resin in a similar fashion, as outlined in Scheme
VIII.
WO 2006/110185 PCT/US2005/040919 Scheme VIII
NR
6
P
22 Resin-OH Ste 21 HN -R Ste
S
HN
Resin 0 Resin 0
R
(n16) (n17) (n18) (n19) Step HO 0 R 2
A
N N NR 2
*P
24 O I R 3 A 0
NR
5 RsA /Resi Resin 0 N- H 'Np H
O
(n21) Step 7 Step 8 (n22) (nn2a) [0239] In step 1, a N-protected-amino acid is coupled to a resin to give Compound nl 6 wherein P 21 is a protecting group that can be removed without effecting cleavage of the peptide from the resin and R 6 A is as defined previously. The choice of resin used in step 1 is dependent upon the nature of the amino acid that is coupled in steps 2-6. If the amino acid side chains contain protecting groups, a resin must be chosen such that the protecting groups remain intact when the resin is removed from the peptide in step 8. Resins that can be cleaved while WO 2006/110185 PCT/US2005/040919 preserving the protecting groups ofpeptides include, but are not limited to, Safety Catch, Rink Acid, 2-chlorotrityl-chloride resin, trityl-chloride resin, 4-methyltrityl-chloride resin, 4methoxytrityl-chloride resin or PAM resin.
[0240] Deprotection of the protected amino of Compound nl6, followed by coupling of the free amino with a second protected amino acid affords Compound n17 wherein P 22 is a protecting group that can be removed without effecting cleavage of the peptide from the resin; and R 5
R
5 and R 6 are as defined previously.
[0241] Deprotection of the protected amino of Compound n17, followed by coupling of the free amino with n14 (vide supra) affords Compound nl 8, wherein, R 5
R
5
R
6A and P9 are as described previously. The peptide coupling process, deprotection of the alpha-amino group, followed by coupling to a protected amino acid, is repeated until the desired number of amino acids has been coupled to the resin. In Scheme VIII, six amino acids have been coupled to give Compound n21, wherein each of P 23 and P 2 4 is a protecting group that can be removed without effecting cleavage of the peptide from the resin; R
A
R
2A
R
2
R
3A
R
5
R
5 and R6A are as described previously.
[0242] Compound n21 is coupled with nl 5 (vide supra) to give Compound n22, wherein
R
1A
R
2 A, R 2
R
3 A, R, R 6 A R 13 A and P 1 are as described previously.
[0243] The peptide n22 is then removed from the resin to give compound nn2a, wherein R
A
R
2A
R
2
R
3A
R
5
R
6A
R
13A and Pis are as described previously.
[0244] Coupling of the peptide fragments nnla and nn2a is outlined in Scheme IX.
WO 2006/110185 WO 206/10185PCT/US2005!040919 Scheme IX Resin0 2 C R1 HN
OP
00 R11A
HN
RA R8A c R13A
P
18
HN
0 0 RWA 0j
H
O=N RA0 R
HI
NR
5 RAC R R6*
=N
0 H
HN
-R6A
.NHP
20 0o_ (nnla) (nn2a) (nn3a) 1
P
8 0 2 c (nn4a) [0245] The peptide fragments nnl a and nn2a are coupled to yield the resin bound peptide nn3 awhereinR"A, RA,R W,RW ,RA R' R 8A,R 9A, R' ,R1 I,R 12, R' ,PI, P8,PIand P18 are as described previously.
WO 2006/110185 PCT/US2005/040919 [02461 Deprotection of the Pi and P 18 protecting groups, followed by cyclization affords a resin-bound depsipeptide nn4a, wherein RA, R 2 A, R 2
R
3 A, R 5
R
5
R
6 A, R 8
R
8 A, R 9 A, R 11 R
A
R
12
R
13 and Ps are as described previously.
[0247] Cleavage of the depsipeptide from the resin and deprotection of any remaining protecting groups yields compounds of Formula I.
Solid Support Synthesis of Depsipeptide Compounds Method C 1 6 6 Fragment Synthesis.
[0248] In an alternative embodiment of the invention, the depsipeptide compounds of Formula I may be synthesized as described in Schemes X-XII.
Scheme X 0 Step 1 Resin Resin-O
R
1 2A
P
26
HN
(n23) [0249] In step 1, a protected-p-methyl glutamic acid derivative such as commercially available N-a-Fmoc-L-glutamic acid a-allyl ester or N-Fmoc-L-3-methyl glutamic acid a-allyl ester (See Examples 1-68 and 1-69, vide infra) is coupled to a resin to give Compound n23 wherein R 1 2 A is methyl. A resin or solid support, such as, but not limited to, Wang, HMPA, Safety Catch, Rink Acid, 2-chlorotrityl-chloride resin, trityl-chloride resin, 4-methyltritylchloride resin, 4-methoxytrityl-chloride resin or PAM resin may be used in this reaction.
Protecting groups P 25 and P 2 6 are chosen so that they can be removed independently of one another and without effecting cleavage of the peptides from the resin. A protecting group combination, such as, but not limited to P 2 5 is allyl ester and P 26 is Fmoc is suitable for this reaction.
[0250] A second peptide is coupled to a resin in a similar fashion, as outlined in Scheme XI.
Scheme XI WO 2006/110185 PCT/US2005/040919 Resin-OH Resin-.
0
HO
R
i l A R
RIIA-
Resin- O N-Ri 1
N-R
11
R
11 A 0), NR P 27 HN
HN
O0 P 28 HN 0 P 8
HN
RSA RA^ O R 6 A R 9 A R 8 A O R 6
A
HN N HN N ON (n24) N 0 0 O Ra 0 R PO2C P 8 0 2
C
(n26) [0251] In step 1, a protected amino acid is coupled to a resin to give Compound n24, wherein
P
27 is a protecting group that can be removed without effecting cleavage of the peptide from the resin; R"l* and R'1A are as previously defined. The choice of resin used in the first step is dependent upon the nature of the amino acid that is coupled in the proceeding steps. If the amino acid side chains contain protecting groups, a resin must be chosen such that these protecting groups remain intact when the peptide is removed from the resin. Resins that can be cleaved while preserving the protecting groups ofpeptides include, but are not limited to, Safety Catch, Rink Acid, 2-chlorotrityl-chloride resin, trityl-chloride resin, 4-methyltrityl-chloride resin, 4methoxytrityl-chloride resin or PAM resin.
[0252] This peptide coupling process, deprotection of the alpha-amino group, followed by coupling to a protected amino acid, is repeated until the desired number of amino acids has been coupled to the resin. In Scheme XI, a total of six amino acids have been coupled to give compound n25 wherein, P 28 is a protecting group that can be removed without effecting cleavage of the peptide from the resin; R 6A
R
8 RA, R 9 A, R 11 RIA, and P 8 are as previously defined.
[0253] Cleavage of the peptide from the resin affords compound n26. Coupling of the 3 peptide fragments is outlined in Scheme XII.
WO 2006/110185 PCT/US2005!040919 Scheme XII ReSinO 2 C 0 (n23)
P
28
HN
HN
0 (nnlb)
CH
0 R11A
HN
0 P 28
HN
R
9 At RBA o RG A HI Nj)
N
I0 o R 8
P
8 0 2 C (n26) -RVA- NKt HN
H
o HN R9A R 8 A C _R6A HN N N4 )fI 0 o R 8 (nn4b) [02541 The resin bound 3-methyiglutamate n23, where Rl1 2 A is as described previously is deprotected to give the free amnine, then coupled to fragment n26 to give resin bound fragment nnlb, wherein R'IA RI*, RA, R A R 8
R
6 A, p 8
P
25 and P 28 are as previously described. This is then coupled to the previously described fragment nn2, to give nn3b wherein RIA, R 2 A, R 2 WO 2006/110185 PCT/US2005/040919
R
3
R
5 A
R
5 A
R
6A R, R
A
R
9
R
1 R1
A
R
1
R
13A P, Ps, and P18 are as described previously. Deprotection and cyclization as described in Methods A affords a resin-bound depsipeptide nn4b wherein R
A
R
2A
R
2
R
3
R
5 A
R
5 A
R
6A
R
8
R
8A
R
9A
R
11 RIIA, R 12
A
R
1 3 A, and Ps are as described previously. Cleavage of the depsipeptide from the resin followed by deprotection of any remaining protecting groups yields compounds of Formula I.
[0255] Following the synthetic schemes above (Schemes IV-XII), it is understood that both the amino acid amino group and the amino acid side chain functional groups must be orthogonally protected prior to attaching them to the growing peptide chain. Suitable protecting groups can be any protecting group useful in peptide synthesis. Such pairings of protecting groups are well known. See, "Synthesis Notes" in the Novabiochem Catalog and Peptide Synthesis Handbook, 1999, pages S1-S93 and references cited therein.
[0256] It will also be understood by those skilled in the art that the choice of protecting group on the amino acid side chain functional groups will either result or not result in the protecting group being cleaved concomitantly with the peptide's final cleavage from the resin, which will give the natural amino acid functionality or a protected derivative thereof, respectively. When the protecting groups are not concomitantly cleaved when the depsipeptide is cleaved from the resin, additional deprotection may be necessary.
[0257] It would be clear to one of skill in the art that the linear precursor nn3 nn3 a or nn3b and hence intermediate nn4 nn4a and nn4b and final product I can be obtained not only by Methods A-C as described above, but also, by combining any two fragment pairs. These fragment pairs can be envisioned by fragmenting the compound of Formula I between any two amino acids in the sequence, i.e. 1+12, 2+11, 3+10, etc.
WO 2006/110185 PCT/US2005/040919 [0258] Alternatively, the compounds can be formed by linear assembly prior to ester formation by the methods described in United States Patent Numbers 6,911,525 and 6,794,490, and International Patent Application Numbers W001/44272, WO01/44274, WO01/44271 and W003/014147. Alternatively, the compounds can be formed by assembly of multiple fragments.
[0259] Although the methods described above employ resin chemistry, the methods would also be suitable for solution-phase peptide chemistry.
[0260] Alternatively, the compounds of the present invention can be formed by the methods described in International Patent Application Number W02005/012541.
2. Biosynthetic Process Non-Ribosomal Peptide Synthetases Pathways [0261] Bacteria, including actinomycetes, and fungi synthesize a diverse array of low molecular weight peptide and polyketide compounds (approx. 2-48 residues in length). The biosynthesis of these compounds is catalyzed by non-ribosomal peptide synthetases (NRPSs) and by polyketide synthetases (PKSs). The NRPS process, which does not involve ribosomemediated RNA translation according to the genetic code, is capable of producing peptides that exhibit enormous structural diversity, compared to peptides translated from RNA templates by ribosomes. These include the incorporation ofD- and L-amino acids and hydroxy acids; variations within the peptide backbone which form linear, cyclic or branched cyclic structures; and additional structural modifications, including oxidation, acylation, glycosylation, Nmethylation and heterocyclic ring formation. Many non-ribosomally synthesized peptides have been found which have useful pharmacological antibiotic, antiviral, antifungal, antiparasitic, siderophore, cytostatic, immunosuppressive, anti-cholesterolemic and anticancer), agrochemical or physicochemical biosurfactant) properties.
[0262] Non-ribosomally synthesized peptides are assembled by large about 200-2000 kDa), multifunctional NRPS enzyme complexes comprising one or more subunits. Examples include daptomycin, A54145, vancomycin, echinocandin and cyclosporin. Likewise, polyketides are assembled by large multifunctional PKS enzyme complexes comprising one or more subunits. Examples include erythromycin, tylosin, monensin and avermectin. In some cases, complex molecules can be synthesized by mixed PKS/NRPS systems. Examples include rapamycin, bleomycin and epothilone.
WO 2006/110185 PCT/US2005/040919 [0263] An NRPS usually consists of one or more open reading frames that make up an NRPS complex. The NRPS complex acts as a protein template, comprising a series of protein biosynthetic units configured to bind and activate specific building block substrates and to catalyze peptide chain formation and elongation. (See, Konz and Marahiel, 1999, Chem.
Biol. 6: 39-48 and references cited therein; von D6hren et al., 1999, Chem. Biol. 6: 273-279, and references cited therein; and Cane and Walsh, 1999, Chem. Biol. 6: 319-325, and references cited therein each hereby incorporated by reference in its entirety). Each NRPS or NRPS subunit comprises one or more modules. A "module" is defined as the catalytic unit that incorporates a single building block an amino acid) into the growing peptide chain. The order and specificity of the biosynthetic modules that form the NRPS protein template dictates the sequence and structure of the ultimate peptide products.
[0264] Each module of an NRPS acts as a semi-autonomous active site containing discrete, folded protein domains responsible for catalyzing specific reactions required for peptide chain elongation. A minimal module (in a single module complex) consists of at least two core domains: 1) an adenylation domain responsible for activating an amino acid (or, occasionally, a hydroxy acid); and 2) a thiolation or acyl carrier domain responsible for transferring activated intermediates to an enzyme-bound pantetheine cofactor. Most modules also contain 3) a condensation domain responsible for catalyzing peptide bond formation between activated intermediates. Supplementing these three core domains are a variable number of additional domains which can mediate, N-methylation (M or methylation domain) and L- to Dconversion (E or epimerization domain) of a bound amino acid intermediate, and heterocyclic ring formation (Cy or cyclization domain). The domains are usually characterized by specific amino acid motifs or features. It is the combination of such auxiliary domains acting locally on tethered intermediates within nearby modules that contributes to the enormous structural and functional diversity of the mature peptide products assembled by NRPS and mixed NRPS/PKS enzyme complexes.
[0265] The adenylation domain of each minimal module catalyzes the specific recognition and activation of a cognate amino acid. In this early step of non-ribosomal peptide biosynthesis, the cognate amino acid of each NRPS module is bound to the adenylation domain and activated as an unstable acyl adenylate (with concomitant ATP-hydrolysis). See, Stachelhaus et al., 1999, Chem. Biol. 6: 493-505 and Challis et al., 2000, Chem. Biol. 7: 211-224, each incorporated herein by reference in its entirety. In most NRPS modules, the acyl adenylate WO 2006/110185 PCT/US2005/040919 intermediate is next transferred to the T (thiolation) domain (also referred to as a peptidyl carrier protein or PCP domain) of the module where it is converted to a thioester intermediate and tethered via a transthiolation reaction to a covalently bound enzyme cofactor phosphopantetheinyl intermediate). Modules responsible for incorporating D-configured or N-methylated amino acids may have extra modifying domains which, in several NRPSs studied, are located between the A and T domains.
[0266] The enzyme-bound intermediates in each module are then assembled into the peptide product by stepwise condensation reactions involving transfer of the thioester-activated carboxyl group of one residue in one module to, the adjacent amino group of the next amino acid in the next module while the intermediates remain linked covalently to the NRPS. Each condensation reaction is catalyzed by a condensation domain which is usually positioned between two minimal modules. The number of condensation domains in a NRPS generally corresponds to the number of peptide bonds present in the final (linear) peptide. An extra C domain has been found in several NRPSs at the amino terminus of cyclosporin synthetase and the carboxyl terminus ofrapamycin; see, Konz and Marahiel, supra) that has been proposed to be involved in peptide chain termination and cyclization reactions. Many other NRPS complexes, however, release the full length chain in a reaction catalyzed by a C-terminal thioesterase (Te) domain (of approximately 28K-35K relative molecular weight).
[0267] Thioesterase domains of most NRPS complexes use a catalytic triad (similar to that of the well-known chymotrypsin mechanism) which includes a conserved serine (less often a cysteine or aspartate) residue in a conserved three-dimensional configuration relative to a histidine and an acidic residue. See, e.g. V. De Crecy-Lagard in "Comprehensive Natural Products Chemistry", Volume 4, ed.by J.W. Kelly, Elsevier, New York, 1999, pp. 221-238, each incorporated herein by reference in its entirety. Thioester cleavage is a two step process. In the first (acylation) step, the full length peptide chain is transferred from the thiol tethered enzyme intermediate in the thiolation domain (see above) to the conserved serine residue in the Te domain, forming an acyl-O-Te ester intermediate. In the second (deacylation) step, the Te domain serine ester intermediate is either hydrolyzed (thereby releasing a linear, full length product) or undergoes cyclization, depending on whether the ester intermediate is attacked by water (hydrolysis) or by an activated intramolecular nucleophile (cyclization).
[0268] Sequence comparisons of C-terminal thioesterase domains from diverse members of the NRPS superfamily have revealed a conserved motif comprising the serine catalytic residue WO 2006/110185 PCT/US2005/040919 (GXSXG motif), often followed by an aspartic acid residue about 25 amino acids downstream from the conserved serine residue. A second type of thioesterase, a free thioesterase enzyme, is known to participate in the biosynthesis of some peptide and polyketide secondary metabolites.
See Schneider and Marahiel, 1998, Arch. Microbiol. 169: 404-410, and Butler et al., 1999, Chem. Biol. 6: 87-292, each incorporated herein by reference in its entirety. These thioesterases are often required for efficient natural product synthesis (See United States Patent Application Number 20020192773). Butler et al. have postulated that the free thioesterase found in the polyketide tylosin gene cluster which is required for efficient tylosin production may be involved in editing and proofreading functions.
[0269] The modular organization of the NRPS multienzyme complex is mirrored at the level of the genomic DNA encoding the modules. The organization and DNA sequences of the genes encoding several different NRPSs have been studied. (See, Marahiel, 1997, Chem. Biol. 4: 561-567, incorporated herein by reference in its entirety). Conserved sequences characterizing particular NRPS functional domains have been identified by comparing NRPS sequences derived from many diverse organisms and those conserved sequence motifs have been used to design probes useful for identifying and isolating new NRPS genes and modules.
[0270] The modular structures of PKS and NRPS enzyme complexes can be exploited to engineer novel enzymes having new specificities by changing the numbers and positions of the modules at the DNA level by genetic engineering and recombination in vivo. Functional hybrid NRPSs have been constructed, for example, based on whole-module fusions. See, Gokhale et al., 1999, Science 284: 482-485; Mootz et al., 2000, Proc. Natl. Acad. Sci. U.S.A. 97: 5848- 5853, incorporated herein by reference in their entirety. Recombinant techniques may be used to successfully swap domains originating from a heterologous PKS or NRPS complex. See, e.g., Schneider et al., 1998, Mol. Gen. Genet. 257: 308-318; McDaniel et al., 1999, Proc. Natl. Acad.
Sci. U.S.A. 96: 1846-1851; United States Patent Nos. 5,652,116 and 5,795,738; and International Patent Number WO 00/56896; incorporated herein by reference in their entirety.
[0271] Engineering a new substrate specificity within a module, by altering residues which form the substrate binding pocket of the adenylation domain, has also been described. See, e.g., Cane and Walsh, 1999, Chem. Biol. 6: 319-325; Stachelhaus et al., 1999, Chem. Biol. 6: 493- 505; and International Patent Application NumberWO 00/52152; each incorporated herein by reference in its entirety. By comparing the sequence of the B. subtilis peptide synthetase GrsA adenylation domain (PheA, whose structure is known) with sequences of 160 other adenylation WO 2006/110185 PCT/US2005/040919 domains from pro- and eukaryotic NRPSs, for example, Stachelhaus et al. (supra) and Challis et al., 2000, Chem. Biol. 7: 211-224 defined adenylation domain signature sequences (analogous to codons of the genetic code) for a variety of amino acid substrates. From the collection of those signature sequences, a putative NRPS selectivity-conferring code (with degeneracies like the genetic code) was formulated.
[0272] The ability to engineer NRPSs having new modular template structures and new substrate specificities by adding, deleting or exchanging modules (or by adding, deleting or exchanging domains within one or more modules) will enable the production of novel peptides having altered and potentially advantageous properties. A combinatorial library comprising over novel polyketides, for example, was prepared by systematically modifying the PKS that synthesizes an erythromycin precursor (DEBS) by substituting counterpart sequences from the rapamycin PKS (which encodes alternative substrate specificities). See, International Patent Application NumberWO 00/63361 and McDaniel et al., 1999, supra, each incorporated herein by reference in its entirety.
[0273] Daptomycin is an example of a non-ribosomally synthesized peptide made by a NRPS (Figure Modification of the genes encoding the proteins involved in the daptomycin biosynthetic pathway, including the daptomycin NRPS, provide a first step in producing modified Streptomyces roseosporus (NRRL 11379) as well as other host strains which can produce an improved antibiotic (for example, having greater potency); which can produce natural or new antibiotics in increased quantities; or which can produce other peptide products having useful biological properties. Compositions and methods relating to the Streptomyces roseosporus daptomycin biosynthetic gene cluster, including isolated nucleic acids and isolated proteins, are described in International Patent Application Number W003/014297; hereby incorporated by reference.
[0274] A54145 is another example of a non-ribosomally synthesized peptide made by a NRPS. A54145 is a cyclic lipopeptide antibiotic that is produced by the fermentation of Streptomycesfradiae (NRRL 18158). A54145 comprises a fatty acid chain linked via a threeamino acid chain to the N-terminal tryptophan of a cyclic 10-amino acid peptide (Figure The compound has similar in vitro anti-bactericidal activity to A21978C/daptomycin factors against various strains of S. aureus, S. epidermidis, Streptococcuspyogenes, and enterococci.
Compositions and methods relating to the Streptomycesfradiae A54145 biosynthetic gene WO 2006/110185 PCT/US2005/040919 cluster, including isolated nucleic acids and isolated proteins, are described in International Patent Application Number W003/060127; hereby incorporated by reference.
[0275] The genes encoding the proteins involved in the A54145 biosynthetic pathway, including the A54145 NRPS, provide a first step in producing modified Streptomycesfradiae as well as other host strains which can produce an improved antibiotic (for example, having greater potency); which can produce natural or new antibiotics in increased quantities; or which can produce other peptide products having useful biological properties.
Methods of Altering Gene Clusters for Production of Novel Compounds by NRPS Alteration of NRPS Polypeptide Modules and Domains [0276] In one aspect, the invention provides a method of altering the number or position of the modules in an NRPS to obtain the compounds of Formula I or compounds of any of Formula F1-F22. In one embodiment, one or more domains maybe deleted from the NRPS. In this case, the product produced by the NRPS will have a chemical change relative to the peptide produced in the absence of the deletion, if an epimerization and/or methylation domain is deleted.
[0277] In another embodiment, one or more domains may be added to the NRPS. In this case, the peptide synthesized by the NRPS will have an additional chemical change. For instance, if an epimerization domain or a methylation domain is added, the resultant peptide will contain an extra D-amino acid or will contain a methylated amino acid, respectively. In a yet further embodiment, one or more modules may be mutated, an adenylation domain may be mutated such that it has a different amino acid specificity than the naturally-occurring adenylation domain. With the amino acid code in hand, one of skill in the art can perform mutagenesis, by a variety of well known techniques, to exchange the code in one module for another code, thus altering the ultimate amino acid composition and/or sequence of the resulting peptide synthesized by the altered NRPS. In another embodiment, one or more subunits may be added or deleted to the NRPS.
[0278] In a still further embodiment, one or more domains, modules or subunits may be substituted with another domain, module or subunit in order to produce novel peptides by complementation (See International Patent Application Number WO 01/30985, providing, inter alia, methods for substituting modules). In this case, the peptide produced by the altered NRPS will have, one or more different amino acids compared to the naturally-occurring peptide.
WO 2006/110185 PCT/US2005/040919 In addition, different combinations of insertions, deletions, substitutions and mutations of domains, modules or subunits may be used to produce a peptide of interest. For instance, one may substitute a modified module, domain or subunit for a naturally-occurring one, or may substitute a naturally-occurring module, domain or subunit from the NRPS from one organism for a module, domain or subunit of an NRPS from another organism. Modifications of the modules, domains and subunits may be performed by site-directed mutagenesis, domain exchange (for module or subunit modification), deletion, insertion or substitution of a domain in a module or subunit, or deletion, insertion or substitution of a module in a subunit. Further, a domain, module or subunit may be disrupted such that it does not function using any method known in the art. These disruptions include, such techniques as a single crossover disruptant or replacement through homologous recombination by another gene a gene that permits selection or screening).
[0279] The products produced by the modified NRPS complexes will have different incorporated amino acids, different chemical alterations of the amino acids methylation and epimerization). The domains, modules or subunits may be derived from any number of NRPS desired, including two, three or four NRPS. Further, the invention contemplates these altered NRPS complexes with and without an integral thioesterase domain.
[0280] The source of the modules, domains and/or subunits may be derived from the daptomycin biosynthetic gene cluster NRPS, the A54145 biosynthetic gene cluster NRPS, or may be derived from any NRPS that encodes another lipopeptide or other peptide source. These peptide sources include glycopeptide gene clusters, mixed pathway gene clusters and siderophore gene clusters. Artificial NRPSs and methods for making them, have been desribed in International Patent Application Number WO01/30985, herein incorporated by reference.
Further, the source of the modules, domains and/or subunits may be obtained from any appropriate source, including both streptomycete and non-streptomycete sources. Nonstreptomycete sources include actinomycetes, Amycolatopsis; prokaryotic nonactinomycetes, Bacillus and cyanobacteria; and non-bacterial sources, fungi.
[0281] An NRPS or portion thereof may be heterologous to a host cell of interest or may be endogenous to the host cell. In one embodiment, the NRPS or a portion thereof a domain, module or subunit thereof) is introduced into the host cell on any vector known to one having ordinary skill in the art, a plasmid, a cosmid, bacteriophage or BAC. The host cell into which the NRPS or portion thereof is introduced may contain an endogenous NRPS or portion WO 2006/110185 PCT/US2005/040919 thereof a domain, module or subunit thereof). Alternatively, a heterologous NRPS or portion thereof may be introduced into the host cell containing the heterologous NRPS or portion thereof. The first NRPS, or another NRPS, or domain, module or subunit of an NRPS may have either a naturally-occurring sequence or a modified sequence. In another embodiment, the NRPS or portion thereof is endogenous to the host cell, the host cell is S. fradiae in the case of A54145 or is S. roseosporus in the case ofdaptomycin. A naturally-occuring or modified NRPS, or a domain, module or subunit thereof may be introduced into the host cell comprising the endogenous NRPS or portion thereof. The heterologous domains, modules, subunits or NRPS may comprise a constitutive or regulatable promoter, which are known to those having ordinary skill in the art. The promoter can be either homologous or heterologous to the nucleic acid molecule being introduced into the cell. In certain embodiments, the promoter may be from the A54145 biosynthetic gene cluster or the daptomycin biosynthetic gene cluster, as described above.
[0282] The nucleic acid molecule comprising the NRPS or portion thereof a domain, module or subunit) may be maintained episomally or integrated into the genome. The nucleic acid molecule may be introduced into the genome at, phage integration sites. Further, the nucleic acid molecule may be introduced into the genome at the site of an endogenous or heterologous NRPS or portion thereof or elsewhere in the genome. The nucleic acid molecule may be introduced in such a way to disrupt all or part of the function of a domain, module or subunit of an NRPS already present in the genome, or may be introduced in a manner that does not disturb the function of the NRPS or portion thereof.
[0283] The peptides produced by these NRPSs may be useful as new compounds or may be useful in producing new compounds. In a preferred embodiment, the new compounds are useful as or may be used to produce antibiotic compounds. In another preferred embodiment, the new compounds are useful as or may be used to produce other peptides having useful activities, including but not limited to antibiotic, antifungal, antiviral, antiparasitic, antimitotic, cytostatic, antitumor, immuno-modulatory, anti-cholesterolemic, siderophore, agrochemical insecticidal) or physicochemical surfactant) properties.
[02841 Further diversity ofnon-ribosomally synthesized peptides and polyketides may also be achieved by expressing one or more NRPS and PKS genes (encoding natural, hybrid or otherwise altered modules or domains) in heterologous host cells, in host cells other than those from which the NRPS and PKS genes or modules originated.
WO 2006/110185 PCT/US2005/040919 3. Post Peptide Modification [0285] The compounds of the present invention may be obtained by first assembling the core of the molecule by any of the methods described above followed by synthetic manipulation of all or some of the remaining primary amino groups as described in United States Patent Numbers 6,911,525; and 6,794,490 and in International Patent Application NumbersWO01/44272; WOO 1/44274; and WO01/44271.
[0286] Treatment of the primary amino group(s) with reagents such as isocyanates, isothiocyanates, activated esters, acid chlorides, sulfonylchlorides or activated sulfonamides, heterocycles bearing readily displaceable groups, imidates, lactones or reductively with aldehydes affords compounds in which one or more of substituents Raal, R aa
R
6 *,and is independently monosubstituted amino, disubstituted amino, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
[0287] In order to achieve these modifications, it may be necessary to protect certain functionalities in the molecule. Protecting these functionalities should be within the expertise of one skilled in the art following the disclosure of this invention. See, Greene, supra.
Cells and Methods for Making Cells that Can Express Recombinant NRPS [0288] The present invention includes cells and methods for making cells that can express recombinant NRPS gene clusters that are capable of expressing the recombinant NRPS and capable of producing the various compounds of the invention. In certain specific embodiments, the cells are gram positive cells, including Streptomyces lividans, Streptomyces coelicolor, or Streptomyces roseosporus.. In other specific embodiments of the invention, a recombinant NRPS is assembled from modules from a daptomycin or A54145 NRPS gene cluster. These genes may be "swapped" using recombination techniques known in the art or exemplified herein.
In other embodiments, certain genes in the recombinant NRPS are deactivated or "knocked out" to avoid the expression product and its activity in the cell. [JILL, SHOULD WE MENTION 3MG HERE AND lptl?] [0289] In a preferred embodiment, bacterial host cells are used to express the nucleic acid molecules of the instant invention. Useful expression vectors for bacterial hosts include bacterial plasmids, such as those from E. coli or Streptomyces, including pBluescript, pGEX-2T, pUC vectors, col El, pCR1, pBR322, pMB9 and their derivatives, wider host range plasmids, such as WO 2006/110185 PCT/US2005/040919 RP4, phage DNAs, the numerous derivatives of phage lambda, NM989, ?GT10 and ?GT11, and other phages, M13 and filamentous single stranded phage DNA. A preferred vector is a bacterial artificial chromosome (BAC). A more preferred vector is pStreptoBAC, as described in Example 2 of International Patent Application Number 03/014297.
[0290] In other embodiments, eukaryotic host cells, such as yeast, insect or mammalian cells, may be used. Yeast vectors include Yeast Integrating plasmids YIp5) and Yeast Replicating plasmids (the YRp and YEp series plasmids), Yeast centromere plasmids (the YCp series plasmids), pGPD-2, 2p plasmids and derivatives thereof, and improved shuttle vectors such as those described in Gietz and Sugino, Gene, 74, pp. 527-34 (1988) (YIplac, YEplac and YCplac). Expression in mammalian cells can be achieved using a variety of plasmids, including pSV2, pBC12BI, and p91023, as well as lytic virus vectors vaccinia virus, adeno virus, and baculovirus), episomal virus vectors bovine papillomavirus), and retroviral vectors murine retroviruses). Useful vectors for insect cells include baculoviral vectors and pVL 941.
[0291] Other aspects of the invention provide compounds and methods for making the compounds from recombinant cells described herein. The compounds can be produced by culturing the cells using techniques and conditions that are known in the art or described herein.
The conditions for culturing the cells may include fermenting the cells with a lipopeptide tail precursor that promotes the production of a particular compound of the invention. This precursor may be taken up by the cell during fermentation and increase the production of a particular compound in the cell. A precursor provided to the cell during fermentation is sometimes called a fermentation feed and the resulting compound a feed product. The compounds of the invention produced by culturing or fermenting the cells of the invention may be further isolated from the fermentation product and/or purified.
Preparation of Novel Depsipeptides 1. Synthetic Processes [0292] In order that this invention may be more fully understood, the following examples are set forth. These examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention in any way.
[0293] Examplel-1: Synthesis ofPeptide Resin Compound 1: Resin-Gly-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-NH 2 (1) WO 2006/110185 PCT/US2005/040919 [0294] Reaction 1: Preparation of Resin-Gly-Thr-NHFmoc (2) [0295] A solution of commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-threonine (2 mL of a 0.5 molar solution in N-methylpyrolidine), 1,3-diisopropylcarbodiimide (2 mL of a molar solution in N-methylpyrolidine), and 1-hydroxy-benzotriazole (2 mL of a 0.5 molar solution in N-methylpyrolidine) was added to commercially available glycine 2-chlorotrityl resin (334 mg). The mixture was shaken for one hour, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (see E. Kaiser, et al., 1970, Anal. Biochem. 34: 595; and "Advanced Chemtech Handbook of Combinatorial, Organic and Peptide Chemistry" 2003-2004, page 208). The Kaiser test gave a blue color indicating that the reaction was incomplete therefore the coupling conditions above was repeated. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 2.
[0296] Reaction 2: Preparation of Resin-Gly-Thr-NH z (3) [0297] Compound 2 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 3.
[0298] Reaction 3: Preparation of Resin-Glv-Thr-Asp(OtBu)-NHFmoc (4) [0299] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-aspartic acid 3-tertbutyl ester (2 mL of a 0.5 molar solution in N-methylpyrolidine), 1,3-diisopropylcarbodiimide (2 mL of a 0.5 molar solution in N-methylpyrolidine), and 1-hydroxy-benzotriazole (2 mL of a molar solution in N-methylpyrolidine) were added to compound 3. The mixture was shaken for one hour, filtered through a glass sinter funnel and the coupling was repeated. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 6 mL), methanol (3 x 6 mL and again with N-methylpyrolidine (3 x 6 mL) to give compound 4.
[0300] Reaction 4: Preparation ofResin-Glv-Thr-Asp(OtBu)-NH z [0301] Compound 4 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine WO 2006/110185 PCT/US2005/040919 in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound [0302] Reaction 5: Preparation of Resin-Gly-Thr-Asp(OtBu)-DAsn(NHTrt)-NHFmoc (6) [0303] A solution of commercially available Na-(9-Fluorenylmethoxycarbonyl)-Dasparagine 6-N-trityl (2 mL of a 0.5 molar solution in N-methylpyrolidine), 1,3diisopropylcarbodiimide (2 mL of a 0.5 molar solution in N-methylpyrolidine), and 1-hydroxybenzotriazole (2 mL of a 0.5 molar solution in N-methylpyrolidine) was added to resin 5. The reaction mixture was shaken for one hour, filtered through a glass sinter funnel and the coupling was repeated. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with Nmethylpyrolidine (3 x 6 mL) to give compound 6.
[0304] Reaction 6: Preparation of Resin-Glv-Thr-Asp(OtBu)-DAsn(NHTrt)-NH 7 (7) [0305] Compound 6 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 7.
[0306] Reaction 7: Preparation of Resin-Glv-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-NHFmoc (8) [0307] Commercially available Nc-(9-Fluorenylmethoxycarbonyl)-L-tryptophan (2 mL of a molar solution in N-methylpyrolidine), 1,3-diisopropylcarbodiimide (2 mL of a 0.5 molar solution in N-methylpyrolidine), and 1-hydroxy-benzotriazole (2 mL of a 0.5 molar solution in N-methylpyrolidine) were added to resin 7. The reaction mixture was shaken for one hour, then filtered through a glass sinter funnel and the coupling was repeated. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 8.
[0308] Reaction 8: Preparation of Resin-Glv-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-NHz (1) [0309] Compound 8 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), WO 2006/110185 PCT/US2005/040919 methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give resin peptide compound 1.
[0310] Example 1-2: Synthesis ofPeptide Resin Compound 9: Resin-Glu(aOAllyl)-DSer(OtBu)-Gly-Asp(OtBu)-DAla-Asp-Orn(NHBo)-NH (9) [0311] Reaction 1: Preparation of Resin-Glu(aOAllyl1-NHFmoc [0312] To a suspension of commercially available 4-hydroxymethylphenoxy resin (Wang resin, 5 g, 0.4 mmol/g) in dichloromethane (60 mL) was added 1,3-diisopropylcarbodiimide (0.940 mL), 4-dimethylaminopyridine (24 mg in N-methylpyrolidine (1 and commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-glutamic acid a-allyl ester (2.46 g in Nmethylpyrolidine (9 The reaction mixture was stirred for 16 hours, filtered through a glass sinter funnel, and the solid was washed with N-methylpyrolidine and dichloromethane and dried under reduced pressure to give compound [03131 Reaction 2: Preparation of Resin-Glu(aOAllyl-NH 2 (11) [0314]] Compound 10 (526 mg) was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for 30 minutes. The resin was filtered through a glass sinter funnel and re-suspended in piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 11.
[0315] Reaction 3: Preparation of Resin-Glu(aOAllv1-DSer(OtBu)-NHFmoc(12) [0316] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-D-serine-tert-buty ether (2 mL of a 0.5 molar solution in N-methylpyrolidine), 1,3-diisopropylcarbodiimide (2 mL of a molar solution in N-methylpyrolidine), and 1-hydroxy-benzotriazole (2 mL of a 0.5 molar solution in N-methylpyrolidine) were added to resin 11. The reaction mixture was shaken for one hour, then filtered through a glass sinter funnel and the coupling was repeated. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 12.
WO 2006/110185 PCT/US2005/040919 [0317] Reaction 4: Preparation ofResin-Glu(aOAllvl)-DSer(OtBu)-NH 2 (13) [0318] Compound 12 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 13.
[0319] Reaction 5: Preparation of Resin-Glu(aOAllyl)-DSer(OtBu)-Gly-NHFmoc (14) [0320] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-glycine (2 mL of a molar solution in N-methylpyrolidine), 1,3-diisopropylcarbodiimide (2 mL of a 0.5 molar solution in N-methylpyrolidine), and 1-hydroxy-benzotriazole (2 mL of a 0.5 molar solution in N-methylpyrolidine) were added to resin 13. The reaction mixture was shaken for one hour, then filtered through a glass sinter funnel and the coupling was repeated. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 14.
[0321] Reaction 6: Preparation of Resin-Glu(aOAllvl)-DSer(OtBu)-Gly-NH [0322] Compound 14 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 269 WO 2006/110185 PCT/US2005/040919 [0323] Reaction 7: Preparation of Resin-Glu(aOAllvl)-DSer(OtBu-Gl-Asp(OtBu)- NHFmoc (16) [0324] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-aspartic acid 3-tertbutyl ester (2 mL of a 0.5 molar solution in N-methylpyrolidine), 1,3-diisopropylcarbodiimide (2 mL of a 0.5 molar solution in N-methylpyrolidine), and I-hydroxy-benzotriazole (2 mL of a molar solution in N-methylpyrolidine) were added to resin 15. The reaction mixture was shaken for one hour, through a glass sinter funnel and the coupling was repeated. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 16.
[0325] Reaction 8: Preparation of Resin-Glu(aOAllvyl)-DSer(OtBu)-Gl-Asp(OtBu)-NH (17) [0326] Compound 16 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 17.
[0327] Reaction 9: Preparation of Resin-Glu(aOAllvyl)-DSer(OtBu)-Gl-Asp(OtBu)-DAla- NHFmoc (18) [0328] A solution of commercially available Nc-(9-Fluorenylmethoxycarbonyl)-D-alanine mL of a 0.5 molar solution in N-methylpyrolidine), 1,3-diisopropylcarbodiimide (2 mL of a molar solution in N-methylpyrolidine), and 1 -hydroxy-benzotriazole (2 mL of a 0.5 molar solution in N-methylpyrolidine) was added to resin 17. The reaction mixture was shaken for one hour, filtered through a glass sinter funnel and the coupling was repeated. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 18.
[0329] Reaction 10: Preparation of Resin-Glu(aOAlll)-DSer(OtBu)-Gly-Asp(OtBu)-DAIa- NH2 (19) [0330] Compound 18 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered WO 2006/110185 PCT/US2005/040919 through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 19.
[0331] Reaction 11: Preparation of Glu(qOAllvl)-DSer(OtBu)-Gly-Asp(OtBu)-DAla- Asp(OtBu)-NHFmoc [0332] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-aspartic acid 1tertbutyl ester mL of a 0.5 molar solution in N-methylpyrolidine), 1,3diisopropylcarbodiimide (2 mL of a 0.5 molar solution in N-methylpyrolidine), and 1-hydroxybenzotriazole (2 mL of a 0.5 molar solution in N-methylpyrolidine) was added to resin 19. The reaction mixture was shaken for one hour, filtered through a glass sinter funnel and the coupling was repeated. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with Nmethylpyrolidine (3 x 6 mL) to give compound [0333] Reaction 12: Preparation ofResin-Glu(OAll11)-DSer(OtBu)-Gly-Asp(OtBu)-DAla- Asp(OtBu)-NH9 (21) [0334] Compound 20 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 21.[0335] Reaction 13: Preparation of Resin-Glu(aOAllyl)-DSer(OtBu)-Gly-Asp(OtBu)- DAla-Asp(OtBu)-Orn-NHFmoc (22) [0336] A solution of commercially available Nac-(9-Fluorenylmethoxycarbonyl)-N3- (tertbutoxycarbonyl)-L-omithine (2 mL of a 0.5 molar solution in N-methylpyrolidine), 1,3diisopropylcarbodiimide (2 mL of a 0.5 molar solution in N-methylpyrolidine), and 1-hydroxybenzotriazole (2 mL of a 0.5 molar solution in N-methylpyrolidine) was added to resin 21. The reaction mixture was shaken for one hour, then filtered through a glass sinter funnel and the coupling was repeated. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with Nmethylpyrolidine (3 x 6 mL) to give compound 22.
WO 2006/110185 PCT/US2005/040919 [0337] Reaction 14: Preparation of Resin-Glu(aOAllvl)-DSer(OtBu)-Glv-Asp(OtBu)-DAla- Asp(OtBu)-Om(NHBoc)-NH z (9) [0338] Compound 22 was agitated in 20% piperidine in N-methylpyrolidine (6 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (6 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give compound 9.
[03391 Example 1-3: Synthesis ofPeptide Resin Compound 23: Ph I-Ph HN Ph HO CH 3
O
O H O H N N O N-(CH 2 )8CH 3
HN
So' tBU Resin- O- 0
N
H
(23) [0340] Reaction 1: Preparation of Compound 24 F OH F OY (CH 2 8
CH
F F F F 0 24 [0341] Pentafluorophenol (3.68 g) was dissolved in dichloromethane (40 mL) and cooled to 0 °C in an ice/NaC1 bath. Decanoylchloride (4.15 mL) was added dropwise such that the temperature remained below 2 oC. Once addition was complete, the reaction was stirred for an additional 2.5 hours at 0 OC. The cooling bath was then removed and the reaction warmed to ambient temperature and stirred for 17 hours. The volatiles were removed under reduced pressure to give the crude product pentafluorophenyl ester 24, which could be used subsequently without further purification.
WO 2006/110185 PCT/US2005/040919 [0342] Reaction 2 Preparation of Compound 23 Ph s-Ph HN Ph F F HO CHs o N NH 2
(CH)CH
3 SO-tBu 24 Resin--O 0 N
H
1 Ph HN 'Ph HO. .CH O' HO HN N N (CH 2 )a 8
CH
3 N N H 0 0H 0 HN 0 tBu Resin-O O 'tB N
H
23 [0343] Resin peptide compound 1 (2 g) was added to a solution of the pentafluorophenyl ester ofdecanoic acid, 24, (440 mg) in dichloromethane. The mixture was shaken for 17 hours, filtered through a glass sinter funnel, and the reaction was judged to be incomplete using the Kaiser Test (vide supra). Decanoic acid (517 mg), 1-hydroxy-benzotriazole (446 mg), and 1,3diisopropylcarbodiimide (438 tL) were dissolved in N-methylpyrolidine (8 mL) and stirred for one hour. The resin was then added to the decanoic acid mixture then stirred for 8 hours, filtered through a glass sinter funnel and washed with N-methylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL). The reaction was found to be complete using the Kaiser Test, yielding the resin bound lipopeptide 23.
[0344] Example 1-4: Synthesis of Compound C352: (C352) WO 2006/110185 PCT/US2005/040919 [0345] Reaction 1: Preparation of Compound
NH
2
N
3
H
2 N O H O N OH 0 H 0 [0346] Commercially available Kynurenine (3 g) was suspended in acetonitrile (100 mL) and water (30 mL). Diisopropylethylamine (DIPEA, 5.01mL) was added dropwise to the solution and stirring was continued until the solution was homogeneous. The solution was then cooled to 0 °C in an ice/sodium chloride bath and a solution of allyloxycarbonyl oxysuccinimide (AllocOSu, 4.3 g) in acetonitrile (30 mL) was added. The reaction mixture was stirred for 3 hours then concentrated to remove acetonitrile, basified with 5% K 2 C0 3 solution (220 mL) and washed with ethyl acetate (5 x 90 mL) and dichloromethane (1 x 90 mL). The aqueous portion was then acidified to pH 1 and extracted with ethyl acetate (4 x 90 mL). Combined acidic organic washes were dried with anhydrous MgSO 4 and evaporated to give crude product (4.85 Purification by column chromatography on silica gel, eluting with dichloromethane methanol 19:1, gave the desired intermediate, L- 2 -N-(allyloxycarbonyl)-4-(2-aminophenyl)-4oxobutanoic acid, after evaporation of the solvent as a yellow solid 2.92 g. This solid (2.9 g) was dissolved in 4N HC1 (100 mL) and cooled to 0 OC in an ice/sodium chloride bath. A solution of NaNO 2 (0.76 g) in water (10 mL) was added dropwise such that the temperature remained below 3 oC, and the resultant solution was stirred for 2.5 hours at 0 A solution of NaN 3 (1.95 g) in water (10 mL) was added dropwise such that the temperature remained below 3 °C and the resultant solution was warmed to ambient temperature and stirred over 19 hours. The reaction mixture was poured into water (250 mL) and extracted with dichloromethane (4 x 100ml). The combined organic washes were dried with anhydrous MgSO 4 and evaporated to the desired product compound 25 (2.86 g).
WO 2006/110185 PCT/US2005/040919 [0347] Reaction 2: Preparation of Compound (26) Ph jPh HN Ph HO CHz O 0 O 0 3 0 0 0 N 3 N N N' N y-(CH2)BCH3 O O ON H O H O N OH Resin-OO O P
H
23 Na Ph 0 fO HN Ph 0 N O CH3 O 0 0 N
N
A
r
N
-N(
CH
2)8
CH
3 0 o H H HN t HO 0 O-tBu
H
26 [0348] L- 2 -N-(allyloxycarbonyl)-4-(2-azidophenyl)-4-oxobutanoic acid 25 (636 mg), 4dimethylaminopyridine (25 mg), and N-methyl-2-chloropyridinium iodide (511 mg) were flushed well with argon, then suspended in dichloromethane (10 mL). Triethylamine (560 pL) was added and the reaction mixture was stirred to give a homogeneous solution. Resin lipopeptide 23 (667 mg) was added to the solution and the flask was flushed again with argon and shaken for 17 hours. A 20 mg sample of the resin was removed to test the reaction for completion (20 mg of resin in dichloromethane (0.6 mL) was treated with 2,2,2-trifluoroethanol, (0.2 mL) and acetic acid (0.2 mL) and stirred for 3 hours. The reaction mixture was filtered through a glass sinter funnel, and the solvent was evaporated to give a residue. Liquid Chromatography/Mass Spectral analysis of the residue indicated the reaction was incomplete).
Coupling was judged to be incomplete so the resin was dried under reduced pressure for 5 days, and the above coupling was repeated over another 17 hours. The reaction mixture was filtered through a glass sinter funnel and the solid was washed well with dichloromethane. The solid was then suspended in dichloromethane (6 mL), 2,2,2-trifluoroethanol (2 mL), acetic acid (2 mL), and shaken for 5 hours. The reaction mixture was filtered through a glass sinter funnel and evaporation of the filtrate gave the crude desired peptide 26 (44 mg). The crude product was purified by reverse phase HPLC (C18 10 tM Jupiter column 250 x 21.2mm) eluting with a WO 2006/110185 WO 206/10185PCT/US2005!040919 gradient from 20% acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to acetonitrile 0.5% formic acid: 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were freeze-dried to give the pure product 26 (10.6 mg).
[03491 Reaction 3: Preparation of Compound (27) Resin-O
H
0 tBu-O< 0 oHS tBu
OAI
tBu0Bo But-0- Hi HNN N 1"N -tH28H tBu 0H 0 0~ 0 tu 0 Bu NH OHN 0 0N H 0 H 27 103591 Hydroxy-benzotriazole (5 mg), l,3-diisopropylcarbodiimide (6 jiL), and peptide resin compound 9 (12.3 mg) were added to a solution of compound 26 (10.6 mg) in Nmethylpyrolidine (0.7 mL) then shaken for 22 hours. The resin was filtered through a glass sinter fuannel and the coupling was judged to be complete using the Kaiser Test (vide supra), yielding resin bound lipopeptide 27.
WO 2006/110185 PCT/US2005/040919 [0351]1 Reaction 4- Prenaration of Comnound (28) 28 [0352] The dried resin 27 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (19 mg) in dichloromethane (1.47 mL), acetic acid (74 pL), and N-methylmorpholine (37 pL). The mixture was shaken for 4 hours at ambient temperature, filtered-through a glass sinter funnel, and the solid was washed with two times with N-methyhnorpholine, two times with methanol, and again two times with N-methylmorpholine.
l-Hydroxy-benzotriazole (0.5 mL of a 0.5 molar solution in N-methylmorpholine) and 1,3diisopropylcarbodiimide (0.5 mL of a 0.5 molar solution in N-methylmorpholine) were added to the resin. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give the resin bound cyclized depsipeptide 28.
WO 2006/110185 PCT/US2005/040919 [0353] Reaction 5: Prenaration of Compound (C352) 28 N OH HN rTQ HO NH H (0 HN O N SH NH 2 C352 [0354] The dried resin 28 was suspended in dichloromethane, (4 mL) trifluoroacetic acid, (6 mL) ethanedithiol (250 and triisopropylsilane (250 pl), and the reaction mixture was stirred for 3 hours at ambient temperature. The resin was filtered through a glass sinter funnel and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (6 mL), and water (3 mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 [tM Jupiter column 250 x 21.2mm) eluting with a gradient from 20% acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile 0.5% formic acid 20 water 0.5% formic acid over minutes. The product bearing fractions were combined and freeze-dried to give the pure product C352(1.0 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0355] Examiple 1-5: Synthesis of Conipound C369: I Y 2)80113 0 (C369) [03561 Reaction 1: Preparation of Compound 41 N- N--I(CHA)CH 3 3u 0 N0
H
23 Fmoc, Fmoc,,
OH
H 0 Compound 30 is obtained from compound 23 using either Method D or Method E (vide inifra).
Method D [03571 To the resin bound lipopeptide, 23 (1 g) was added a solution of commercially available Nac-(9-Fluorenylmethoxycarbonyl)-L-isoleucine (618 mg), bromo-trispyrrolidinophosphonium hexafluorophosphate (PyBrOP, 815 mg), and Di-isopropylethylamine WO 2006/110185 PCT/US2005/040919 (914 pLL), in dichloromethane (5 mL). Dimethylaminopyridine (5 mg) was added and the mixture was shaken for 2 hours. After 2 h, the mixture was filtered through a glass sinter funnel and washed with dichloromethane (3 x 10 mL) and the coupling procedure was repeated. The resulting resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x mL) and methanol (3 x 10 mL), and dried under diminished pressure over potassium hydroxide pellets. This dried resin was suspended in dichloromethane (3 mL), 2,2,2-trifluoroethanol (1 mL), and acetic acid (1 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 30 (400 mg) as a white solid.
Method E [0358] Commercially available No-(9-Fluorenylmethoxycarbonyl)-L-isoleucine (95 mg), 4dimethylaminopyridine (6 mg), and N-methyl-2-chloropyridinium iodide (69 mg) were flushed well with argon then suspended in dichloromethane (2.7 mL). Triethylamine (76 pL) was added and the reaction mixture was stirred to give a homogeneous solution. Resin lipopeptide 23 (200 mg) was added to the solution, the flask was flushed again with argon and then the reaction mixture was shaken for 14 hours. The resulting resin was then filtered through a glass sinter funnel and washed well with dichloromethane. The solid was suspended in dichloromethane (6 mL), 2,2,2-trifluoroethanol (2 mL), and acetic acid (2 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide (54 mg) as a white solid.
280 WO 2006/110185 PCT/US2005/040919 [0359] Reaction 2: Preparation of Compound (31) Resin-O OOH0 tBu-0 tBU 0 0 NH
I
I N 0_ _IIT C) H N'L~ BO
""H
Ph SPh Ph HN -T HOO
O
0 tBu HO 0 31 [0360] 1 -Hydroxy-benzotriazole (26 mg), 1,3-diisopropylcarbodiimide (30 gL), and peptide resin compound 9 (64 mg) were added to a solution of the depsipeptide 30 (54 mg) in Nmethylmorpholine (3.8 mL), and the resulting mixture was shaken for 22 hours. The resin was filtered through a glass sinter funnel, and the coupling was judged to be complete using the Kaiser Test (vide supra), yielding the resin bound depsipeptide 31.
WO 2006/110185 PCT/US2005/040919 [0361] Reaction 3: Preparation of Compound (32) Ph Resin-O FmocHN O H O HNPhN S0 0 H 0 tBu 0 K tBuN NL lr NyN (CH)CH3 tBo IJ Hlu o H 0 32 [0362] The dried resin 31 was placed under an argon atmosphere, and treated with a solution oftetrakis-(triphenylphosphine)palladium(0) (48 mg in dichloromethane (7.63 acetic acid (0.38 mL), and N-methylmorpholine (0.19 mL). The mixture was shaken for 4 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed two times with Nmethylmorpholine, two times with methanol, and again two times with N-methylmorpholine.
The solid resin was suspended in 20% piperidine in N-methylmorpholine (7 mL) for 105 minutes, filtered through a glass sinter funnel and the solid was washed well with Nmethylmorpholine. 1-Hydroxy-benzotriazole (0.3 mL of a 0.5 molar solution in Nmethylmorpholine) and 1,3-diisopropylcarbodiimide (0.3 mL of a 0.5 molar solution in Nmethylmorpholine) were added to the resin. The reaction mixture was shaken for 17 hours, filtered through a glass sinter funnel, and the precipitate was washed well with Nmethylmorpholine to give the resin bound cyclized depsipeptide 32.
WO 2006/110185 PCT/US2005/040919 [0363] Reaction 4: Preparation of Compound C369 Ph Resin-O HN ,-Ph 0H Ph O H O H H P. N O C369 [0364] The dried resin 32 was suspended in dichloromethane (4 mL), trifluoroacetic acid (6 mL), ethanedithiol (250 pL), and triisopropylsilane (250 pL), and stirred for 3 hours at ambient temperature. The reaction mixture was filtered through a glass sinter funnel and washed with dichloromethane (2 x 2 mL) and the combined filtrates were evaporated under reduced pressure.
Crude product was then partitioned between diethyl ether (6 mL) and water (3 mL). The aqueous layer was separated and freeze dried to give the crude product 33 (21.5 mgs). The crude product was then purified by reverse phase HPLC (C18 10 pM Jupiter column 250 x 21.2mm) eluting with a gradient from 20% acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to acetonitrile 0.5% formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give the pure product C369 (1.8 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [03651 Examnple 1-6: Synthesis of Peptide Resin Comipound 34: Resin-Glu(ctOAllyl)-DSer(OtBu)-Gly-Asp(OtBui)-DLys(NHBoc)-Ap(OtBu)NHI- (34) [03661 Reaction 1: Preparation of Resin-Glu(aOAllyl)-DSer(OtBu)-Gly-ASP(OtBu}- DLys(INHBoc)-N-HFmoc [03671 Commercially available Na-(9-Fluorenyhnethoxycarbonyl)- :NE-(t-butyloxycarbonyl D-lysine (1.48 1,3-diisopropylcarbodiimide (0.49 mL), 1-hydroxy-benzotriazole (425 mg) and 4-dimethylaminopyridine (37 mg) as a solution in N-methylpyrolidine (20 mL) was added to resin 1 7(vide supra). The reaction mixture was shaken for three hours, filtered through a glass sinter funnel and the coupling was rcpeatcd for 15 hours. The reaction mixture was filtered, through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mE), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mTL) to give compound 103681 Reaction 2: Prearation of Resin-Glu(aCOAllyl)-DSer(OtBu)-Gly-Asp(OtBu)- DLys(NHBoc)-NH 9 (36) [03691 Compound 35 was agitated in 20% piperidine in N-methylpyrolidine (25 mL) for one hour. The reaction mixture was filtered through a glass sinter funel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 miL) to give compound 36.
[0370] Reaction 3: Preparation of Resin-Glu(ctOAllyl)-DSer(OtBu)-Gly-Asp(OtBu)- DLvys(NHBoc)-Asp(OtBu)-NHFmoc (37) [0371] Commercially available Nc-(9-Fluorenylmethoxycarbonyl)-L-aspartic acid 1-tertbutyl ester (2.16 1,3 -diisopropylcarbodiimide (822 tp1), and I1-hydroxy-benzotriazole ('710 mg) as a solution in N-methylpyrolidine (20 mL) was added to resin 36. The reaction mixture was shaken for four hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with Nmethylpyrolidine (3 x 15 mL) to give compound 37.
[03721 Reaction 4: Preparation of Resin-Glu(aOAllyl)-DSer(OtBu)-Gly-Asp(OtBu,)- DLys(NHBoc)-Asp(OtBu)-N1 9 (34) 10373] Compound 37 was agitated in 20% piperidine in N-methylpyrolidine (25 mL) for one hour. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-niethylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound 34.
WO 2006/110185 WO 206/10185PCT/US2005!040919 103741 Example 1- 7: Synthesis of Peptide Resin Compound 38: Resin-Glu(aOAllyl)-DSer(OtBu)-Gly-Asp(OtBu)-DA~a-Asp(OtBu)-Ala-NH 2 (38) [03751 Reaction 1: Preparation of Resin-Glu(aOAlll)-DSer(OtBu)-Gly-Ap(OtBu)-DAla- Asp(OtBu)-Ala-N-HFmoc (39) [03761 Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-alanine (1.62 1,3dilsopropylcarbodlimide (825 jiL), and 1 -bydroxy-benzotriazole (715 mg) as a solution in Nmethylpyrolidine 20 mL) was added to resin 21 (vide supra). The reaction mixture was shaken for 17 hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mE), methanol (3 x 15 mL), and again with Nmethylpyrolidine (3 x 15 mL) to give compound 39.
[03771 Reaction 2: Preparation. of Resin-Glu(atOAlll)-DSer(Ot~u)-Glv- Asp(OtBu)-DAla- Asip(OtBu)-Ala--H 2 (38) [0378] Compound 39 (227mg) was agitated in 20% piperidine in N-methylpyrolidine (1 mL) for 0.5 hour. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 5 mL), methanol (3 x 5 mL), and again with Nmethylpyrolidine (3 x 5 mL) to give 3 8 [0379] Example 1-8: Synthesis of Peptide Resin Compound Resin-Glu~cxOAliyl)-DAsn(NHTrt)-Gly-Asp(OtBu)-D~a-Asp(OtBu)-N1 2 [03801 Reaction 1: Prearation of Resin-Glu(aOAllyl)-DAsn(NH~rt)-NHFmoc (41) [0381] A solution of commercially available Ncx-(9-Fluorenylmethoxycarbonyl)-Dasparagine (NELTrtjO}I (3.1 2-(1H-Benzotriazol-yl)-1 1,3,3-tetramethyluronium-i tetrafluroborate (TBTU, 1.67 Hydroxy-benzotriazole (0.56g) and diisopropylethylamine (DIPEA, 2.7 mL) as a solution in N-methylpyrrolidone (NMP, 40 mL) was added to Resin-Glu-
NH
2 (1 1,vide supra, 4 The mixture was shaken for 30 minutes, filtered through a glass sinter funinel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with Nmethylpyrolidine (3 x 40 mL), methanol (3 x 40 mL), and again with N-methylpyrolidine (3 x iniL) to give compound 4 1.
WO 2006/110185 PCT/US2005/040919 [0382] Reaction 2: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-NH (42) [0383] Compound 41 was agitated in 20% piperidine in N-methylpyrolidine (30 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel and was re-suspended in piperidine in N-methylpyrolidine (30 mL) and was agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 30 mL), methanol (3 x 30 mL), and again with N-methylpyrolidine (3 x mL) to give compound 42.
[0384] Reaction 3: Preparation of Resin-Glu(aOAllyl)-DAsn(NHTrt)-Glv-NHFmoc (43) [0385] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-glycine (1.55 2-(1H- Benzotriazol-yl)-l,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 1.67 Hydroxybenzotriazole (HOBt, 0.56g) and diisopropylethylamine (DIPEA, 2.7 mL) as a solution in Nmethylpyrrolidone (NMP, 40 mL) was added to compound 42 (4 The mixture was shaken for minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 40 mL), methanol (3 x 40 mL), and again with N-methylpyrolidine (3 x 40 mL) to give compound 43.
[0386] Reaction 4: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Glv-NH z (44) [0387] Compound 43 was agitated in 20% piperidine in N-methylpyrolidine (30 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel and was re-suspended in piperidine in N-methylpyrolidine (30 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 30 mL), methanol (3 x 30 mL), and again with N-methylpyrolidine (3 x 30 mL) to give compound 44.
[0388] Reaction 5: Preparation of Resin-Glu(aOAllyl)-DAsn(NHTrt)-Glv-Asp(OtBu)- NHFmoc [0389] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-aspartic acid 13tertbutyl ester (2.14 2-(1H-Benzotriazol-yl)-1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 1.67 HOBt (0.56g) and diisopropylethylamine (DIPEA, 2.7 mL) as a solution in Nmethylpyrrolidone (NMP, 40 mL) was added to compound 44 (4 The mixture was shaken for minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so WO 2006/110185 PCT/US2005/040919 the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 40 mL), methanol (3 x 40 mL), and again with N-methylpyrolidine (3 x 40 mL) to give compound [0390] Reaction 6: Preparation of Resin-Glu(aOAllyl)-DAsn(NHTrt)-Gly-Asp(OtBu)-NH? (46) [0391] Compound 45 was agitated in 20% piperidine in N-methylpyrolidine (30 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel and was re-suspended in piperidine in N-methylpyrolidine (30 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 30 mL), methanol (3 x 30 mL), and again with N-methylpyrolidine (3 x 30 mL) to give compound 46.
[0392] Reaction 7: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Glv-Asp(OtBu)-DAla- NHFmoc (47) [0393] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-D-alanine (0.81 2- (1H-Benzotriazol-yl)-l,l,3,3-tetramethyluronium tetrafluroborate (TBTU, 0.84 HOBt (0.28g) and diisopropylethylamine (DIPEA, 1.4 mL) as a solution in N-methylpyrrolidone (NMP, mL) was added to compound 46 (2 The mixture was shaken for 30 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 20 mL), methanol (3 x 20 mL), and again with Nmethylpyrolidine (3 x 20 mL) to give compound 47.
[0394] Reaction 8: Preparation of Glu(aOAllvl)-DAsn(NHTrt)-Glv-Asp(OtBu)-DAla-NH.
(48) [0395] Compound 47 was agitated in 20% piperidine in N-methylpyrolidine (15 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel and was re-suspended in piperidine in N-methylpyrolidine (15 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 10 mL), methanol (3 x 10 mL), and again with N-methylpyrolidine (3 x mL) to give compound 48.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0396] Reaction 9: Preparation of Resin-Gl1u(CtOAllyl)-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla- Asp(OtBu)-NHFmoc (49) [0397] Commercially available Nc'c-(9-Fluorenylmethoxycarbonyl)-L-aspartic acidf3 tertbutyl ester (1.07 2-(l H-Benzotriazol-yl)-1, 1,3,3-tetramethyluronium tetrafluroborate (TBTU, 0.84 HOBt (0.28g) and diisopropylethylamine (DIPEA, 1.4 mL) as a solution in Nmethylpyrrolidone (NMP, 20 mL) was added to compound 48 (2 The mixture was shaken for minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 20 mL), methanol (3 x. 20 mL), and again with N-methylpyrolidine (3 x 20 mL) to give compound 49 [03981 Reaction 10: Preparation of Glu(aOAllvl)-DAsnCNHTrt)-Glv-:Asp(OtBu)-DAla- Asp(OtBu)-N-H, [03991 Compound 49 was agitated in 20% piperidine in N-methylpyrolidine (15 mL) for 3 0 minutes. The reaction mixture was filtered through a glass sinter funnel and was re-suspended in piperidine in N-methylpyrolidine (15 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 10 mL), methanol (3 x 10 mL), and again with N-methylpyrolidine (3 x mL) to give compound [0400] Example 1-9: Synthesis of Peptide Resin Compound SO: Resin-Glu(caOAl)-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla-Asp(Ot~u)-Orn(NHEBoc)-NH 2 [04011 Reaction 1: Preparation of Resin-Glu(aOAlll)-DAsn(NHTrt)-Glv-Asp(OtBu)-DAla- Asp(OtBu)-Omn(NHBoc)-NHjFmoc (51) [04021 Commercially available Nci-(9-Fluorenylmethoxycarbonyl)-L-omithine (Boc)-O1I (1.17 2-(1 H-Benzotriazol-yl)- 1, 1,3,3-tetramethyluronium tetrafiuroborate (TBTU, 0.83 g), HOBt (0.3 1lg) and diisopropylethylamine (DIPEA, 1.4 mL) as a solution in N-methylpyrrolidone (NMP, 20 mL) was added to compound 40 (2.8 The mixture was shaken for 30 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtrationthrough a glass sinter funnel the product bearing resin 288 WO 2006/110185 WO 206/10185PCT/US2005!040919 was washed with N-methylpyrolidine (3 x 20 mL), methanol (3 x 20 mL), and again with Nmethylpyrolidine: (3 x 20 mL to give compound 5 1.
[9403] Reaction 2 Preparation of Resin-GLu~cLOAllyl)-DAsn(NfTrt)-Gy-:Asp(OtBu)-DAla- Asp(OtBu)-Om(NHBoc)-'NH2 10404] Compound 51 was agitated in 20% piperidine in N-methylpyrolidine (15 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (15 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 10 mL), and again with N-methylpyrolidine (3 x 10 mL) to give compound [0405] Example 1-10: Synthesis of Peptide Resin Compound 52: Resin-Glu(aOAliyl)-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Ala-NH 2 (52) [0406] Reaction 1 :Prparation of Resin-Gl-u(aiOAllyl)-DAsn(NHIrt-Gly-Asp)(OtBu)-DAla- Asp(OtBu)-Ala-NHFmoc (53) [04071 Commercially available Nc-(9-Fluorenylnmethoxycarbonyl)-L-alanine (63 mg), 2- (1 H-B enzotriazol-yl)-l ,1,3 ,3-tetramnethyluronium tetrafluroborate (I'BTU, 64 mg), HOBt (27 mg) and diisopropylethylamine (DIPEA, 70 [tL) as a solution in N-methylpyrrolidone (NMP, I mL) was added to compound 40 (340 mg). The mixture was shaken for 30 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 2 mL), methanol (3 x 2 ml), and again with Nmethylpyrolidine (3 x 2 mL) to give compound 53.
104081 Reaction 2: Prearation of Resin-Glu(ctOAllyl)-DAsn(NHjrt -Glv-Asp(OtBua)-DAla- Asp(OtBu)-Ala-NH, (52) 104091 Compound 53 was agitated in 20% piperidine in N-methylpyrolidine (1.5 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (1.5 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 1 mL), methanol (3 x 1 mL), and again with N-methylpyrolidine (3 x 1 mL) to give compound 52.
WO 2006/110185 WO 206/10185PCT/US2005!040919 [04101 Example 1-11: Synthesis of Peptide Resin Compound 54: Rei-l~O~l-~rO~)Gy-s(tu-~sN~e-s(tu-r(Ho)
NH
2 (54) [04111 Reaction 1: Preparation of Resin-Glu(ctOAllyl)-DSer(OtBu)-Gly-Asp(OtBu)- DLys(NHBoc)jAsp(OtBu [04 121 Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-omithine (Boc)-OH (0.44 2-(l H-Benzotriazol-yl)-1 ,1 ,3,3 -tetramethyluronium tetrafiuroborate (TBTU, 0.31 g), HOBt 13 g) and diisopropylethylamninc (DIPEA, 0.3 mL) as a solution in Nmethylpyrrolidone (NMP, 20 mL) was added to compound 34 (vide supra, 0.8 The mixture was shaken for 30 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 20 mL), methanol (3 x mL), and again with N-methylpyrolidine (3 x 20 mL) to give compound 104131 Reaction 2: Preparation of Resin-Glu(oaOAllyl)-DSer(OtBu)-Gly-As (OtBu)- DLys(NqHBoc)-Asp(OtBu)-Om(NHBoc)-NH (4) [04141 Compound 55 was agitated in 20% piperidine in N-methylpyrolidine (8 nI) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-rnethylpyrolidine (8 mL) and agitated for 30 mninutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 8 mL), methanol (3 x 8 mL), and again with N-m ethylpyroli dine (3 X 8 mL) to give compound 54.
[04151 Example 1-12: Synthesis of Peptide Resin Compound 56 Resin-Glu~xOAlyl)-DAsn(NHTrt)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-NH 2 (56) [04161 Reaction 1: Preparation of Resin-Glu(aOAllyl)-DAsn(NHTrt)-GI)y-Asp(OtBu)- DLys(NHBoc)-NHI~hoc (57) [04171 Commercially available Nc-(9-Fluorenylmethoxyearbonyl)-D- Nci-(9- Fluorenylmethoxycarbonyl)- N&-(t-butyloxycarbonyl L-lysine (1.28 2-(1H-lBenzotriazol-yl)- 1,1,3,3-tetramethyluronium tetrafiuroborate (TBTU, 0.84 HOBt (0.28 g) and diisopropylethylamine (DIPEA, 1.4 mLT) as a solution in N-methylpyrrolidone (NMP, 20 mL) was added to compound 46 (2 The mixture was shaken for 3 0 minutes, filtered through a WO 2006/110185 PCT/US2005/040919 glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 20 mL), methanol (3 x 20 mL), and again with Nmethylpyrolidine (3 x 20 mL) to give compound 57.
[0418] Reaction 2: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Gly-Asp(OtBu)- DLys(NHBoc)-NH 2 (58) [0419] Compound 57 was agitated in 20% piperidine in N-methylpyrolidine (15 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (15 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 10 mL), and again with N-methylpyrolidine (3 x 10 mL) to give compound 58.
[0420] Reaction 3: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Glv-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-NHFmoc (59) [0421] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-aspartic acid 3tertbutyl ester (1.07 2-(1H-Benzotriazol-yl)-1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 0.84 HOBt (0.28 g) and diisopropylethylamine (DIPEA, 1.4 mL) as a solution in Nmethylpyrrolidone (NMP, 20 mL) was added to compound 58 (2 The mixture was shaken for minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 20 mL), methanol (3 x 20 mL), and again with N-methylpyrolidine (3 x 20 mL) to give compound 59 [0422] Reaction 4: Preparation of Resin-Glu(aOAllyl)-DAsn(NHTrt)-Glv-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-NH z (56) [0423] Compound 59 was agitated in 20% piperidine in N-methylpyrolidine (15 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (15 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 10 mL), and again with N-methylpyrolidine (3 x 10 mL) to give compound 56.
WO 2006/110185 WO 206/10185PCT/US2005!040919 10424] Example 1-13: Synthesis of Peptide Resin Compound Resin-Glu(aOAl)-DAsn(NHTrt)-Gly-Asp(QtBu)-DLys(NHBoc)-Asp(OtBu).
Orn(NllBoc)-NH [04251 Reaction 1: Prqparation of Resin-Glu aOAlly1 -DAsn NHTrt)-Gi -As OtBu DLyvs(N\HBoc')-Asp(OtBu)-Om(NHBoc)-NHFmoc(61) [04261 Commercially available Na-(9-Fluorenymethoxycarbonyl)-L-orithine (Boc)-OH (0.54 2-(1H-Benzotriazol-yl)- 1,1,3,3 -tetrarnethyluronium tetrafluroborate (TBTU, 0.38 g), HOBt 12 g) and diisopropylethylamine (DIPEA, 0. 63 mL) as a solution in Nmethylpyrrolidone (NMP, 12 mL) was added to compound 56 (1.2 The mixture was shaken for 30 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x. 20 mL), methanol (3 x 20 mL), and again with N-methylpyrolidine (3 x 20 mL) to give compound 61.
[0427] Reaction 2: Prenaration of Resin-Glu(QcOAllv1')-DAsn(NHTrt)-Gly-As-p(OtBu)- DLvs(NHBoc)-Asp(OtBu)-Om(NHBoc')-NI 2 [0428] Compound 6l1was agitated in 20% piperidine in N-methylpyrolidine (12 mL) for 3 0 minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (12 mL) and agitated for 30minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 10 mL), and again with N-methylpyrolidine (3 x 10 mL) to give compound [0429] Example 1-14: Synthesis of Peptide Resin Compound 62: Resin-Glu(aOAllyl)-DAsn(NHTrt)-Gy-Asp(OtBu)-DLys(NLBo)-Asp(OtBu)AaNH 2 (62) [0430] Reaction 1: Preparation of Resin-Glu(aOAllyl)-DAsn(NHTrt)-Gly-Ap(OtBu)- DLvs(NHBoc)-Asp(OtBu)-Ala-NHFmoc(63) [0431] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-alanine (0.78 2- (1H-Benzotriazol-yl)-l ,l,3,3-tetramethyluronium tetrafiuroborate (TBTU, 0.80 11O1t (0.27 g) and diisopropylethylamine (DII'EA, 0.81 mL) as a solution in N-methylpyrrolidone (NMP, mL) was added to compound 56 (2 The mixture was shaken for 3 0 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the WO 2006/110185 PCT/US2005/040919 standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 20 mL), methanol (3 x 20 mL), and again with Nmethylpyrolidine (3 x 20 mL) to give compound.63.
[0432] Reaction 2: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Glv-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-Ala-NH (62) [0433] Compound 63 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (20 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 20 mL), and again with N-methylpyrolidine (3 x 20 mL) to give compound 62.
[0434] Example 1-15: Synthesis ofPeptide Resin Compound 64: Resin-Ala-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-NH 2 (64) [0435] Reaction 1: Preparation of Resin-Ala-Sar-NMeFmoc [0436] A solution of commercially available Na-(9-Fluorenylmethoxycarbonyl)- sarcosirie (1.56 2-(1H-Benzotriazol-yl)-1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 1.61 g), and diisopropylethylamine (DIPEA, 871 pl) as a solution in N-methylpyrrolidone (NMP, 25 mL) was added to commercially available alanine 2-chlorotrityl resin (66, 2.5 The mixture was shaken for 30 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound [0437] Reaction 2: Preparation of Resin-Ala-Sar-NMeH (67) [0438] Compound 65 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for 1 hour. The reaction mixture was filtered through a glass sinter funnel then the solid washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give compound 67.
WO 2006/110185 PCT/US2005/040919 [0439] Reaction 3: Preparation of Resin-Ala-Sar-Thr-NHFmoc (68) [0440] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-threonine (853 mg), bromo-tris-pyrrolidinophosphonium hexafluorophosphate (PyBrOP, 1.165 and DIPEA (1.31 mL) as a solution in dichloromethane (25 inL) was added to compound 67 (334 mg). The mixture was shaken for one hour. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL and again with N-methylpyrolidine (3 x 15 mL) to give compound 68.
[0441] Reaction 4: Preparation of Resin-Ala-Sar-Thr-NH2 (69) [0442] Compound 38 (vide supra) was agitated in 20% piperidine in N-methylpyrolidine mL) for 1 hour. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with Nmethylpyrolidine (3 x 15 mL) to give compound 69.
[0443] Reaction 5: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-NHFmoc [0444] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-aspartic acid 3-tertbutyl ester (2.06 TBTU (1.61 and DIPEA (871 gL) as a solution in NMP (25 mL) were added to compound 69. The mixture was shaken for three hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-niethylpyrolidine (3 x mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound [0445] Reaction 6: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-NH 7 (71) [0446] Compound 70 was agitated in 20% piperidine in N-methylpyrolidine (25 mL) for one hour. The reaction mixture was filtered through a glass sinter funnel then washed with Nmethylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give compound 71.
[0447] Reaction 7: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)-NHFmoc (72) [0448] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-D-asparagine 6-N-trityl (1.49 TBTU (1.61 and DIPEA (871 gL) as a solution in NMP (25 mL) was added to compound 71. The reaction mixture was shaken for seventeen hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound 72.
WO 2006/110185 PCT/US2005/040919 [0449] Reaction 8: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)-NH? (73) [0450] Compound 72 was agitated in 20% piperidine in N-methylpyrolidine (25 mL) for 2 hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound 73.
[0451] Reaction 9: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp- NHFmoc (74) [0452] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-tryptophan (1.07 g), TBTU (802 mg), and DIPEA (435 iL) as a solution in NMP (10 mL) was added to resin 73.
The reaction mixture was shaken for forty three hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound 74.
[0453] Reaction 10: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-NH2 (64) [0454] Compound 74 was agitated in 20% piperidine in N-methylpyrolidine (25 mL) for one hour. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give resin peptide compound 64.
[0455] Example 1-16: Synthesis ofPeptide Resin Compound Resin-Ala-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-Undecanoic amide. [0456] Commercially available undecanoic acid (930 mg), 1,3-diisopropylcarbodiimide (0.78 mL), and 1-hydroxy-benzotriazole (676 mg) as a solution in N-methylpyrolidine (20 mL) was added to compound 64. The mixture was shaken for 23 hours, filtered through a glass sinter funnel, and the reaction was judged to be incomplete using the Kaiser Test (vide supra). The resin was then filtered through a glass sinter funnel and washed with N-methylpyrolidine (3 x mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL). The reaction was found to be complete using the Kaiser Test, yielding the resin bound compound 295 WO 2006/110185 PCT/US2005/040919 [0457] Example 1-17: Synthesis ofPeptide Resin Compound (76) Resin-Gly-Thr-Asp(OtBu)-DAsn(NHITrt)-Trp-8-Methyldecanoic amide (76) 104581 Commercially available 8-methyldecanoic acid (1.55 2-(1H-Benzotriazol-yl)- 1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 2.67 diisopropylethylamine (DIPEA, 2.9 mL), and 1-hydroxy-benzotriazole (1.12 g) as a solution in N-methylpyrolidine (80 mL) was added to compound 1 (7.6 The mixture was shaken for 18 hours, filtered through a glass sinter funnel, and the reaction was judged to be complete using the Kaiser Test (vide supra), yielding the resin bound compound 76.
[0459] Example 1-18: Synthesis ofPeptide Resin Compound (77) Resin-Gly-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-tridecanoic amide (77) 10460] Commercially available tridecanoic acid (2.39 2-(1H-Benzotriazol-yl)-1,1,3,3tetramethyluronium tetrafluroborate (TBTU, 3.47 diisopropylethylamine (DIPEA, 3.75 mL), and 1-hydroxy-benzotriazole (1.46 g) as a solution in N-methylpyrolidine (80 mL) was added to compound 1 (10 The mixture was shaken for 17 hours, filtered through a glass sinter funnel, and the reaction was judged to be complete using the Kaiser Test (vide supra), yielding the resin bound compound 77.
[0461] Example 1-19: Synthesis ofPeptide Resin Compound (78) Resin-Gly-Thr-Asp(OtBu)-DGlu(OtBu)-Trp-8-Methyldecanoic amide (78) [0462] Reaction 1: Preparation of Resin-Glv-Thr-Asp(OtBu)-DGlu(OtBu)-NHFmoc (79) [04631 Commercially available Nc-(9-Fluorenylmethoxycarbonyl)-D-glutamic acid y-t-butyl ester (1.14 TBTU (0.87 HOBt (0.37 g) and DIPEA (940 as a solution inNMP mL) was added to compound 5. The reaction mixture was shaken for one hour. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL). The reaction was judged to be complete using the Kaiser Test (vide supra), yielding the resin bound compound 79.
[0464] Reaction 2: Preparation of Resin-Gly-Thr-Asp(OtBu)-DGlu(OtBu)-NH2 [0465] Compound 79 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for minutes. The resin was filtered through a glass sinter funnel and re-suspended in 20% piperidine in N-methylpyrolidine (20 mL) and agitated for 15 minutes. The reaction mixture was filtered WO 2006/110185 PCT/US2005/040919 through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give resin bound compound [0466] Reaction 3: Preparation of Resin-Glv-Thr-Asp(OtBu)-DGlu(OtBu)-Trp-NHFmoc (81) [0467] Commercially available Na-(9-Fluorenylmethoxycarbonyl)- L-tryptophan (1.15 g), TBTU (0.87 HOBt (0.37 g) and DIPEA (940 pL) as a solution in NMP (20 mL) was added to the compound 80. The reaction mixture was shaken for one hour. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL). The reaction was judged to be complete using the Kaiser Test (vide supra), yielding the resin bound 81.
[0468] Reaction 4: Preparation ofResin-Glv-Thr-Asp(OtBu)-DGlu(OtBu)-Tr-NH, (82) [0469] Resin bound compound 81 was agitated in 20% piperidine in N-methylpyrolidine mL) for 15 minutes. The resin was filtered through a glass sinter funnel and re-suspended in piperidine in N-methylpyrolidine (20 mL) and agitated for 15 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give resin bound compound 82.
[0470] Reaction 5: Preparation of Resin-Glv-Thr-Asp(OtBu)-DGlu(OtBu)-Trp-8- Methyldecanoic amide (78) [0471] Commercially available 8-methyldecanoic acid (0.71 2-(1H-Benzotriazol-yl)- 1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 1.21 diisopropylethylamine (DIPEA, mL), and 1-hydroxy-benzotriazole (0.508 g) as a solution in N-methylpyrolidine (80 mL) was added to compound 82 (4.0 The mixture was shaken for 18 hours, filtered through a glass sinter funnel), and the reaction was judged to be complete using the Kaiser Test (vide supra).
The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 6 mL), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give resin bound compound 78.
WO 2006/110185 WO 206/10185PCT/US2005!040919 104721 Example 1-20: Synthesis of Peptide Resin Compound (83) Resin-Ala-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-8-Methyldecanoic amide (83) 104731 Commercially available 8-methyldecanoic acid (0.71 2-(lH-Benzotriazol-yl)- 1,1 ,3,3-tetramethyluronium tetrafi-uroborate (TBTU, 0.60 dilsopropylethylamine (DIPEA, 0.64 mL), and 1 -hydroxy-benzotriazole (0.25 g) as a solution in N-methylpyrolidine (20 mL) was added to compound 34 (1.8 The mixture was shaken for 18 hours, filtered through a glass sinter funnel, and the reaction was judged to be complete using the Kaiser Test (vide supra). Tfhe reaction mixture was filtered through a glass sinter funnel then the solid was washed with IN-methylpyrolidine (3 x 6 mE), methanol (3 x 6 mL), and again with N-methylpyrolidine (3 x 6 mL) to give resin bound compound 83.
104741 Example 1-21: Synthesis of Peptide Resin Compound (84) Resin-Mla-S ar-Thr-Asp(OtBu)-DGlu(OtBu)-Trp-8-Methyldecanoic amide (84) [04751 Reaction 1: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-DGlu(OtBu)-NHFmoc [04761 Commercially available Nc-(9-Fluorenylmetlhoxycarbonyl)-D-glutamic acid 'y-t-butyl ester (0.98 TBTU HOBt (0.31 g) and DIPEA (810 ItL) as a solution in NMP mE) was added to compound 71 (1.8 The reaction mixture was shaken for seventeen hours.
The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give compound [0477] Reaction 2: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-DGlu(OtBu)-NH?. (86 [0478] Compound 85 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel re-suspended in piperidine in N-methylpyrolidine (20 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mE), methanol (3 x 20 mL), and again with N-methylpyrolidine (3 x 20 mL) to give compound 86.
[0479] Reaction 3: Prearation of Resin-Ala-Sar-Thr-As-p(OtBu)-DGlu(OtBu)-Trp-NHFmoc (87) [04801 Commercially available INa-(9-Fluorenylmethoxycarbonyl)-L-tryptophan (0.98 g), TBTU (0.74 HOBt (0.31 g) and DIPEA (810 jiL) as a solution in NMP (25 mL) was added to compound 86 (2.2 The reaction mixture was shaken for seventeen hours. The reaction WO 2006/110185 PCT/US2005/040919 mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 25 mL), methanol (3 x 25 mL), and again with N-methylpyrolidine (3 x mL) to give compound 87.
[0481] Reaction 4: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-DGlu(OtBu)-Trp-NH2 (88) [0482] Compound 87 was agitated in 20% piperidine in N-methylpyrolidine (25 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel re-suspended in piperidine in N-methylpyrolidine (25 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 30 mL), and again with N-methylpyrolidine (3 x 30 ml,) to give compound 88.
[0483] Reaction 5: Preparation of Resin-Ala-Sar-Thr-Asp(OtBu)-DGlu(OtBu)-Trp-8- Methyldecanoic amide (84) [0484] Commercially available 8-methyldecanoic acid (0.34 2-(1H-Benzotriazol-yl)- 1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 0.60 diisopropylethylamine (DIPEA, 0.64 mL), and 1-hydroxy-benzotriazole (0.25 g) as a solution in N-methylpyrolidine (20 mL) was added to compound 88 (2.0 The mixture was shaken for 18 hours, filtered through a glass sinter funnel, and the reaction was judged to be complete using the Kaiser Test (vide supra). The solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 16 mL), and again with N-methylpyrolidine (3 xl6 mL) to give resin bound compound 84.
[0485] Example 1-22: Synthesis ofPeptide Resin Compound 89 Resin-Ala-Gly-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-Undecanoic amide (89) [0486] Reaction 1: Preparation of Resin-Ala-Glv-NHFmoc [0487] A solution of commercially available Na-(9-Fluorenylmethoxycarbonyl)-glycine (1.49 TBTU (1.61 and DIPEA (871 pL) as a solution in NMP (25 mL) were added to the commercially available Alanine-2-cholrotrityl-resin (66, 2.5 The mixture was shaken for three hours, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound WO 2006/110185 PCT/US2005/040919 [0488] Reaction 2: Preparation of Resin-Ala-Gly-NH 2 (91) [0489] Compound 90 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for 1 hour. The reaction mixture was filtered through a glass sinter funnel then the solid washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give compound 91.
[0490] Reaction 3: Preparation of Resin-Ala-Gly-Thr-NHFmoc (92) [0491] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-threonine (853 mg), bromo-tris-pyrrolidinophosphonium hexafluorophosphate (PyBrOP, 1.165 and DIPEA (1.31 mL) as a solution in dichloromethane (25 mL) was added to compound 91 (334 mg). The mixture was shaken for one hour. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound 92.
[0492] Reaction 4: Preparation of Resin-Ala-Gly-Thr-NH 2 (93) [0493] Compound 92 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for hours. The reaction mixture was filtered through a glass sinter funnel then the solid washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give resin bound compound 93.
[04941 Reaction 5: Preparation of Resin-Ala-Gly-Thr-Asp(OtBu)-NHFmoc (94) [0495] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-aspartic acid p-tertbutyl ester (2.06g), TBTU (1.61 and DIPEA (871 jL) as a solution in NMP (25 mL) was added to compound 93. The mixture was shaken for three hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound 94.
[0496] Reaction 6: Preparation ofResin-Ala-Gly-Thr-Asp(OtBu)-NH z [04971 Compound 94 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for 1 hour. The reaction mixture was filtered through a glass sinter funnel then the solid washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give compound 94.
WO 2006/110185 PCT/US2005/040919 [0498] Reaction 7: Preparation of Resin-Ala-Gly-Thr-Asp(OtBu)-DAsn(NHTrt)-NHFmoc (96) [0499] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-D-asparagine -N-trityl (1.49 TBTU (0.80 and DIPEA (435 pL) as a solution in DMF (10 mL) were added to compound 95. The mixture was shaken seventeen hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound 96.
[05001 Reaction 8: Preparation of Resin-Ala-Gly-Thr-Asp(OtBu)-DAsn(NHTrt)-NH2 (97) [0501] Compound 96 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for 2 hours. The reaction mixture was filtered through a glass sinter funnel then the solid washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give compound 97.
[0502] Reaction 9: Preparation of Resin-Ala-Gly-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp- NHFmoc (98) [0503] Commercially available Nc-(9-Fluorenylmethoxycarbonyl)-L-tryptophan (1.07 g), TBTU (0.80 and DIPEA (435 as a solution in NMP (25 mL) was added to compound 97.
The mixture was shaken for forty three hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound 98.
[0504] Reaction 10: Preparation of Resin-Ala-Gly-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-NH, (99) [0505] Compound 98 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for 1 hour. The reaction mixture was filtered through a glass sinter funnel then the solid washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give compound 99.
[0506] Reaction 11: Preparation of Resin-Ala-Gl-Thr-Asp(OtBu)-DAsn(NHTrt)-Tr- Undecanoic amide (89) [0507] Commercially available undecanoic acid (930 mg), 1,3-diisopropylcarbodiimide (0.78 mL), and 1-hydroxy-benzotriazole (676 mg) as a solution in N-methylpyrolidine (20 mL) was added to compound 99. The mixture was shaken for 23 hours, filtered through a glass sinter funnel, and the reaction was judged to be incomplete using the Kaiser Test (vide supra). The resin was then filtered through a glass sinter funnel and washed with N-methylpyrolidine (3 x WO 2006/110185 WO 206/10185PCT/US2005!040919 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL). The reaction was found to be complete using the Kaiser Test, yielding compound 89.
[0508] Example 1-23: Synthesis of Peptide Resin Compound 100 Resin-Ala-Gly-Thr-Asp(OtBu)-DGlu(OtBu)-Trp-Undecanoic anilde (100) [05091 Reaction 1: Preparation of Resin-Ala-GIy-Tbr-Asp(OtBu)-DGlu(OtBu)-NHFmoc.
(101) [05101 Commercially available Nca-(9-Fluorenylmethoxycarbonyl)-D-glutamic acid y-t-butyl ester (1.06 TBTU (0.80 and DIPEA (43 5 jiL) as a solution in DMF (10 mL) were added to compound 95. The mixture was shaken seventeen hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give compound compound 101.
[05111 Reaction 2: Preparation of Resin-Ala-Gly-Thr-Asp(OtBu)-DGlu(OtBu)-NH2 (102) [05121 Compound 10 1 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for 1 hour. The reaction mixture was filtered through a glass sinter funnel then the solid washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give compound 102.
[05131 Reaction 3: Preparation of Resin-Ala-Gly-Tbr-Asp(OtBu)-DGlu(OtBu)-Trp-NHFmoc (103) [0514] Commnercially available Ncx-(9-Fluorenylmethoxycarbonyl)-L-tytophan (1.07 g), TBTU (0.80 and DIIPEA (435 p1L) as a solution in NMP (25 mL) was added to compound 102. The mixture was shaken for forty three hours. The reaction mixture was filtered through a glass sinter *funnel then the solid was washed with N-methylpyrolidine (3 x 15 mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL) to give 103.
[0515] Reaction 4: Preparation of Resin-Ala-Gly-Thr-As-p(OtBu)-DGlu(OtBu)-Trp-N~H- (104) [0516] Compound 103 was agitated in 20% piperidine in N-methylpyrolidine (20 mL) for 1 hour. The reaction mixture was filtered through a glass sinter funnel then the solid washed with N-methylpyrolidine (3 x 15 miL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x mL) to give compound 104.
WO 2006/110185 PCT/US2005/040919 [0517] Reaction 5: Preparation of Resin-Ala-Gly-Thr-Asp(OtBu)-DGlu(OtBu)-Trp- Undecanoic amide. (100) [0518] Commercially available undecanoic acid (930 mg), 1,3-diisopropylcarbodiimide (0.78 mL), and l-hydroxy-benzotriazole (676 mg) as a solution in N-methylpyrolidine (20 mL) was added to compound 104. The mixture was shaken for 23 hours, filtered through a glass sinter funnel, and the reaction was judged to be incomplete using the Kaiser Test (vide supra). The resin was then filtered through a glass sinter funnel and washed with N-methylpyrolidine (3 x mL), methanol (3 x 15 mL), and again with N-methylpyrolidine (3 x 15 mL). The reaction was found to be complete using the Kaiser Test, yielding the compound 100.
[0519] Example 1-24: Synthesis ofPeptide Resin 105 Resin-Orn(NHBoc)-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)-Trp-8-Methyldecanoic amide (105) [0520] Reaction 1: Preparation of Resin-Orn(NHBoc)-NHFmoc (106) [0521] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-N-S-tertbutoxycarbonyl- L-ornithine (8.73 g) as a solution in dichloromethane (100 mL) and diisopropylethylamine (DIPEA, 13.4 mL), were added to a pre-swollen commercially available 2-chlorotrityl resin 107 (10.0 The mixture was shaken for 1 hour, filtered through a glass sinter funnel, and the reaction was judged to be complete using the Kaiser Test (vide supra). The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 100 mL), methanol (3 x 100 mL), and again with N-methylpyrolidine (3 x 100 mL) to give compound 106.
[0522] Reaction 2: Preparation of Resin-Om(NHBoc)-NH, (108) [0523] Compound 106 was agitated in 20% piperidine in N-methylpyrolidine (100 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (100 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 130 mL), methanol (3 x 130 mL), and again with N-methylpyrolidine (3 x 130 mL) to give compound 108.
[0524] Reaction 3: Preparation of Resin-Orn(NHBoc)-Sar-NMeFmoc (109) [0525] A solution of commercially available Na-(9-Fluorenylmethoxycarbonyl)- sarcosine (2.6 2-(1H-Benzotriazol-yl)-l,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 2.7 g), HOBt (1.13 g) and diisopropylethylamine (DIPEA, 2.9 mL) as a solution in N- WO 2006/110185 PCT/US2005/040919 methylpyrrolidone (100 mL) was added to compound 108 (10 The mixture was shaken for minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 115 mL), methanol (3 x 115 mL), and again with N-methylpyrolidine (3 x 115 mL) to give compound 109.
[0526] Reaction 4: Preparation of Resin-Om(NHBoc)-Sar-NMeH (110) [0527] Compound 109 was agitated in 20% piperidine in N-methylpyrolidine (100 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (100 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 130 mL), methanol (3 x 130 mL), and again with N-methylpyrolidine (3 x 130 mL) to give compound 110.
[0528] Reaction 5: Preparation ofResin-Orn(NHBoc)-Sar-Thr-NHFmoc (111) [0529] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-threonine (2.9 2- (1H-Benzotriazol-yl)-1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 2.7 HOBt (1.13 g) and diisopropylethylamine (DIPEA, 2.9 mL) as a solution in N-methylpyrrolidone (100 mL) was added to compound 110 (11 The mixture was shaken for 60 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 115 mL), methanol (3 x 115 mL), and again with Nmethylpyrolidine (3 x 115 mL) to give compound 111.
[0530] Reaction 6: Preparation of Resin-Orn(NHBoc)-Sar-Thr-NH 2 (112) [0531] Compound 111 was agitated in 20% piperidine in N-methylpyrolidine (110 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (110 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 110 mL), methanol (3 x 110 mL), and again with N-methylpyrolidine (3 x 110 mL) to give compound 112.
WO 2006/110185 PCT/US2005/040919 [0532] Reaction 7 Preparation of Resin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-NHFmoc (113) [0533] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-aspartic acid P-tertbutyl ester, TBTU (2.7 HOBt (1.13 g) as a solution in N-methylpyrrolidone (100 mL) was added to compound 112 (11 g) followed by addition of diisopropylethylamine (DIPEA, 2.9 mL).
The mixture was shaken for 60 minutes, filtered (through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration v the product bearing resin was washed with N-methylpyrolidine (3 x 115 mL), methanol (3 x 115 mL), and again with N-methylpyrolidine (3 x 115 mL) to give 113.
[0534] Reaction 8: Preparation of Resin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-NH (114) [0535] Compound 113.was agitated in 20% piperidine in N-methylpyrolidine (115 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (115 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 120 mL), methanol (3 x 120 mL), and again with N-methylpyrolidine (3 x 120 mL) to give compound 114.
[0536] Reaction 9: Preparation of Resin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)- NHFmoc (115) [0537] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-D-asparagine (5.0 2- (1H-Benzotriazol-yl)-1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 2.7 HOBt (1.13 g) and diisopropylethylamine (DIPEA, 2.9 mL) as a solution in NMP (120 mL) was added to compound 114 (12 The mixture was shaken for 60 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with Nmethylpyrolidine (3 x 125 mL), methanol (3 x 125 mL), and again with N-methylpyrolidine (3 x 125 mL) to give compound 115.
[0538] Reaction 10: Preparation ofResin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)- NH, (116) [0539] Compound 115 was agitated in 20% piperidine in N-methylpyrolidine (130 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (130 mL) and agitated for 30 minutes. The reaction mixture WO 2006/110185 PCT/US2005/040919 was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 130 mL), methanol (3 x 130 mL), and again with N-methylpyrolidine (3 x 130 mL) to give compound 116.
[0540] Reaction 11: Preparation of Resin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)- Trp-NHFmoc (117) [0541] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-tryptophan (3.57 2- (1H-Benzotriazol-yl)-1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 2.7 HOBt (1.13 g) and diisopropylethylamine (DIPEA, 2.9 mL) as a solution in N-methylpyrrolidone (130 mL) was added to compound 116 (13 The mixture was shaken for 60 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 135 mL), methanol (3 x 135 mL), and again with Nmethylpyrolidine (3 x 135 mL to give compound 117.
[0542] Reaction 12: Preparation ofResin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-DAsn(NHTrt)- Trp-NH2 (118) [0543] Compound 117 was agitated in 20% piperidine in N-methylpyrolidine (130 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (130 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 130 mL), methanol (3 x 130 mL), and again with N-methylpyrolidine (3 x 130 mL) to give compound 118.
[0544] Reaction 13: Preparation of Resin-Orn(NHBoc)-Sar-Thr-Asp(OtBu)-DAsn(NHTrt- Trp-8-Methyldecanoic amide (105) [0545] Commercially available 8-methyldecanoic acid (1.56 2-(1H-Benzotriazol-yl)- 1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 2.7 diisopropylethylamine (DIPEA, 2.9 mL), and 1-hydroxy-benzotriazole (1.25 g) as a solution in N-methylpyrolidine (120 mL) was added to compound 118 (13.8 The mixture was shaken for 18 hours, filtered through a glass sinter funnel, and the reaction was judged to be complete using the Kaiser Test (vide supra). The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 120 mL), methanol (3 x 120 mL), and again with N-methylpyrolidine (3 x 120 mL) to give compound 105.
WO 2006/110185 PCT/US2005/040919 [0546] Example 1-25: Synthesis ofPeptide Resin Compound 119 Resin-Orn(NHBoc)-Sar-Thr-Asp(OtBu)-DGlu(OtBu)-Trp-8-Methyldecanoic amide (119) [0547] Reaction 1: Preparation of Resin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-DGlu(OtBu)- NHFmoc. (120) [0548] Commercially available NaT-(9-Fluorenylmethoxycarbonyl)-D-glutamic acid y-t-butyl ester (2.29 TBTU (1.73 HOBt (0.73 g) and DIPEA (1.9 mL) as a solution in NMP mL) were added to compound 114 (3.3 The mixture was shaken for three hours. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with Nmethylpyrolidine (3 x 25 mL), methanol (3 x 25 mL), and again with N-methylpyrolidine (3 x mL) to give compound 120.
[0549] Reaction 2: Preparation of Resin-Om(NHBoc)-Sar-Thr-Asp(OtBu-DGlu(OtBu)-NH, (121) [0550] Compound 120 was agitated in 20% piperidine in N-methylpyrolidine (25 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (25 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 30 mL), and again with N-methylpyrolidine (3 x 30 mL) to give compound 121.
[0551] Reaction 3: Preparation of Resin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-DGlu(OtBu)-Trp- NHFmoc (122) [0552] Commercially available Nc-(9-Fluorenylmethoxycarbonyl)-L-tryptophan (2.30 2- (1H-Benzotriazol-yl)-1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 1.7 HOBt (0.73 g) and diisopropylethylamine (DIPEA, 1.9 mL) as a solution in N-methylpyrrolidone (25 mL) was added to compound 121 (3.5 The mixture was shaken for 60 minutes, filtered through a glass sinter funnel and a few beads were tested for the presence of a free amine using the standard Kaiser test (vide supra). The Kaiser test gave a yellow color so the coupling was deemed complete. After filtration through a glass sinter funnel the product bearing resin was washed with N-methylpyrolidine (3 x 25 mL), methanol (3 x 25 mL), and again with N-methylpyrolidine (3 x 25 mL) to give compound 122.
WO 2006/110185 PCT/US2005/040919 [0553] Reaction 4: Preparation of Resin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-DGlu(OtBu)-Trp-
NH
2 (123) [0554] Compound 122 was agitated in 20% piperidine in N-methylpyrolidine (25 mL) for minutes. The reaction mixture was filtered through a glass sinter funnel, re-suspended in piperidine in N-methylpyrolidine (25 mL) and agitated for 30 minutes. The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x mL), methanol (3 x 30 mL), and again with N-methylpyrolidine (3 x 30 mL) to give compound 123.
[0555] Reaction 5: Preparation of Resin-Om(NHBoc)-Sar-Thr-Asp(OtBu)-DGlu(OtBu)-Trp- 8-Methyldecanoic amide (119) [0556] Commercially available 8-methyldecanoic acid (0.50 2-(1H-Benzotriazol-yl)- 1,1,3,3-tetramethyluronium tetrafluroborate (TBTU, 0.86 diisopropylethylamine (DIPEA, 0.94 mL), and 1-hydroxy-benzotriazole (0.35 g) as a solution in N-methylpyrolidine (30 mL) was added to compound 123 (3.8 The mixture was shaken for 18 hours, filtered through a glass sinter funnel, and the reaction was judged to be complete using the Kaiser Test (vide supra). The reaction mixture was filtered through a glass sinter funnel then the solid was washed with N-methylpyrolidine (3 x 36 mL), methanol (3 x 36 mL), and again with N-methylpyrolidine (3 x 36 mL) to give compound 119.
[0557] Example 1-26: Esterification and Cleavage ofPeptide Resin Compound 76 Gly-Thr(OIleNHFmoc)-Asp(OtBu)-DAsn(NHTrt)-Trp-8-Methyldecanoic amide (126) [0558] Commercially available Nct-(9-Fluorenylmethoxycarbonyl)-L-isoleucine (1.7 4dimethylaminopyridine (117 mg), and N-methyl-2-chloropyridinium iodide (1.23 g) were flushed well with argon then suspended in dichloromethane (20 mL). Triethylamine (76 pL) was added and the reaction mixture was stirred to give a homogeneous solution. Compound 76 g) was added to the solution. The flask was flushed again with argon and then shaken for 14 hours. The resulting resin was then filtered through a glass sinter funnel and washed well with dichloromethane. The solid was suspended in dichloromethane (21 mL), 2,2,2-trifluoroethanol (7 mL), and acetic acid (7 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 126 (285 mg) as a white solid.
WO 2006/110185 PCT/US2005/040919 [0559] Example 1-27: Esterification and Cleavage ofPeptide Resin Compound 77 Preparation of Gly-Thr(OIleNHFmoc)-Asp(OtBu)-DAsn(NHTrt)-Trp-tridecanoic amide (127) [0560] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-isoleucine (1.48 4dimethylaminopyridine (102 mg), and N-methyl-2-chloropyridinium iodide (1.07 g) were flushed well with argon then suspended in dichloromethane (20 mL). Triethylamine (1.17 mL) was added and the reaction mixture was stirred to give a homogeneous solution. Compound 77 (1.75 g) was added to the solution. The flask was flushed again with argon and then shaken for 14 hours. The resulting resin was then filtered through a glass sinter funnel and washed well with dichloromethane. The solid was suspended in dichloromethane (15 mL), 2,2,2trifluoroethanol (5 mL), and acetic acid (5 mL), and shaken for 4 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 127 (490 mg) as a white solid.
[0561] Example 1-28: Esterification and Cleavage ofPeptide Resin Compound 78 Preparation of Gly-Thr(OIleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8-Methyldecanoie amide (128) [0562] To compound 78 (5.9 g) was added a solution of commercially available Na-(9- Fluorenylmethoxycarbonyl)-L-isoleucine (4.9 bromo-tris-pyrrolidinophosphonium hexafluorophosphate (PyBrOP, 6.5 and di-isopropylethylamine (7.3 mL), in dichloromethane mL). Dimethylaminopyridine (25 mg) was added and the mixture was shaken for 2 hours.
After 2 h, the mixture was filtered through a glass sinter funnel and washed with dichloromethane (3 x 60 mL) and the coupling procedure was repeated. The resulting resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 60 mL) and methanol (3 x 60 mL), and dried under diminished pressure over potassium hydroxide pellets. This dried resin was suspended in dichloromethane (27 mL), 2,2,2-trifluoroethanol (9 mL), and acetic acid (9 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 128 (2.1 g) as a white solid.
WO 2006/110185 PCT/US2005/040919 [0563] Example 1-29: Esterification and Cleavage ofPeptide Resin Compound 83 Preparation of Ala-Sar-Thr(OlleNHFmoc)-Asp(OtBu)-DAsn(ONHTrt)-Trp-8- Methyldecanoic amide (129) [0564] To compound 83 (3.3 g) was added a solution of commercially available Na-(9- Fluorenylmethoxycarbonyl)-L-isoleucine (3.2 bromo-tris-pyrrolidinophosphonium hexafluorophosphate (PyBrOP, 4.2 and Di-isopropylethylamine (4.7 mL), in dichloromethane mL). Dimethylaminopyridine (23 mg), was added and the mixture was shaken for 2 hours.
After 2 h, the mixture was filtered through a glass sinter funnel and washed with dichloromethane (3 x 30 mL) and the coupling procedure was repeated. The resulting resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 30 mL) and methanol (3 x 30 mL), and dried under diminished pressure over potassium hydroxide pellets. This dried resin was suspended in dichloromethane (24 mL), 2,2,2-trifluoroethanol (6 mL), and acetic acid (6 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 129 (2.9 g) as a white solid.
[0565] Example 1-30: Esterification and Cleavage ofPeptide Resin Compound Preparation of Ala-Sar-Thr(OlleNHAlloc)-Asp(OtBu)-DAsn(NHTrt)-Trp-Undecanoic amide (130) [0566] Nca-(Allyloxycarbonyl)-L-isoleucine 124 (1.34 g, vide infra), 4dimethylaminopyridine (15 mg), and N-methyl-2-chloropyridinium iodide (1.59 g) were flushed well with argon then suspended in dichloromethane (30 mL). Triethylamine (1.74 mL) was added and the reaction mixture was stirred to give a homogeneous solution. Compound 75 (1.25 g) was added to the solution. The flask was flushed again with argon and then shaken for 14 hours. The resulting resin was then filtered through a glass sinter funnel and washed well with dichloromethane. The solid was suspended in dichloromethane (12 mL), 2,2,2-trifluoroethanol (4 mL), and acetic acid (4 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 130 (154 mg) as a white solid.
WO 2006/110185 PCT/US2005/040919 [0567] Example 1-31: Esterification and Cleavage ofPeptide Resin Compound 84 Preparation of Ala-Sar-Thr(OIleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8-Methyldecanoic amide (131) [0568] To compound 84 (4.8 g) was added a solution of commercially available Na-(9fluorenylmethoxycarbonyl)-L-isoleucine (3.2 bromo-tris-pyrrolidinophosphonium hexafluorophosphate (PyBrOP, 4.2 and Di-isopropylethylamine (4.7 mL), in dichloromethane mL). Dimethylaminopyridine (23 mg) was added and the mixture was shaken for 2 hours.
After 2 h, the mixture was filtered through a glass sinter funnel and washed with dichloromethane (3 x 30 mL) and the coupling procedure was repeated. The resulting resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 30 mL) and methanol (3 x 30 mL), and dried under diminished pressure over potassium hydroxide pellets. This dried resin was suspended in dichloromethane (24 mL), 2,2,2-trifluoroethanol (6 mL), and acetic acid (6 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 131 (2.92 g) as a white solid.
[0569] Example 1-32: Esterification and Cleavage ofPeptide Resin Compound 89 Preparation of Ala-Gly-Thr(OleNHAlloc)-Asp(OtBu)-DAsn(NHTrt)-Trp-Undecanoic amide (132) [0570] Na-(Allyloxycarbonyl)-L-isoleucine 124 (1.34 g, vide infra), 4dimethylaminopyridine (15 mg), and N-methyl-2-chloropyridinium iodide (1.59 g) were flushed well with argon then suspended in dichloromethane (30 mL). Triethylamine (1.74 mL) was added and the reaction mixture was stirred to give a homogeneous solution. Compound 89 (1.25 g) was added to the solution. The flask was flushed again with argon and then shaken for 14 hours. The resulting resin was then filtered through a glass sinter funnel and washed well with dichloromethane. The solid was suspended in dichloromethane (12 mL), 2,2,2-trifluoroethanol (4 mL), and acetic acid (4 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 132 (147 mg) as a white solid.
WO 2006/110185 PCT/US2005/040919 [0571] Example 1-33: Esterification and Cleavage ofPeptide Resin Compound 100 Preparation of Ala-Gly-Thr(OIleNHAlloc)-Asp(OtBu)-DGlu(OtBu)-Trp-Undecanoic amide (133) [0572] Na-(Allyloxycarbonyl)-L-isoleucine 124 (1.34 g, vide infra), 4dimethylaminopyridine (15 mg), and N-methyl-2-chloropyridinium iodide (1.59 g) were flushed well with argon then suspended in dichloromethane (30 mL). Triethylamine (1.74 mL) was added and the reaction mixture was stirred to give a homogeneous solution. Compound 100 (1.25 g) was added to the solution. The flask was flushed again with argon and then shaken for 14 hours. The resulting resin was then filtered through a glass sinter funnel and washed well with dichloromethane. The solid was suspended in dichloromethane (12 mL), 2,2,2trifluoroethanol (4 mL), and acetic acid (4 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 133 (95 mg) as a white solid.
[0573] Example 1-34: Esterification and Cleavage ofPeptide Resin Compound 105 Preparation of Orn(NHBoc)-Sar-Thr(OIleNHFmoc)-Asp(OtBu)-DAsn(NHTrt)-Trp-8- Methyldecanoic amide (134) [0574] Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-isoleucine (2.0 4dimethylaminopyridine (140 mg), and N-methyl-2-chloropyridinium iodide (1.46 g) were flushed well with argon then suspended in dichloromethane (20 mL). Triethylamine (1.6 mL) was added and the reaction mixture was stirred to give a homogeneous solution. Compound 105 g) was added to the solution. The flask was flushed again with argon and then shaken for 14 hours. The resulting resin was then filtered through a glass sinter funnel and washed well with dichloromethane. The solid was suspended in dichloromethane (21 mL), 2,2,2-trifluoroethanol (7 mL), and acetic acid (7 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 134 (890 mg) as a white solid.
WO 2006/110185 WO 206/10185PCT/US2005!040919 105751 Example 1-35: Esterification and Cleavage of Peptide Resin Compound 119 Preparation of Orn(NHBoc)-Sar-Thr(OIeNlJFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8- Methyldecanoic aniide (135) 105761 Commercially available Na-(9-Fluorenylmethoxycarbonyl)-L-isoleucine (2.0 4dimethylaminopyridine (140 mg), and X-methyl-2-chloropyridinium iodide (1.46 g) were flushed well with argon then suspended in dichioromethane (20 mL). Triethylamine (1.6 mL) was added and the reaction mixture was stirred to give a homogeneous solution. Compound 119 (1.75 g) was added to the solution. The flask was flushed again with argon and then shaken for 14 hours. The resulting resin was then filtered through a glass sinter funnel and washed well with dichloromethane. The solid was suspended in dichioromethane (21 mL), 2,2,2trifluoroethanol (7 mL), and acetic acid (7 mL), and shaken for 3 hours. The resin was filtered through a glass sinter funnel and evaporation of the filtrate gave the desired peptide 135 (761 mg) as a white solid.
[05771 Example 1-36: Preparation of Compound C16 I leI Glu-DSer-Gly-Asp-DAla-Asp-Orn-Gly-Thr-Asp-DAsn-Trp-8-Methyldecanoic amide (C 16) [05781 Reaction 1: Preparation of Resin-Glu(QxOAIlvl)-DSer(OtBu)-Glv-Asp2(OtBu)-DAla- Asp(OtBu)-Om(NHBoc)-Gly-Thr(OleNHFmoc)-Asp(OtBu)-DAsn(NHTrt)-Trp-8- Methyldecanoic amide (137) 105791 Ilydroxy-benzotriazole (17 mg), benzotriazole-1 -yl-oxy-tris-(dimethylamino)phosphoniumnhexafluaorophosphonate (BOP, 55 mg), and diisopropylethylamine (22 jiL), were added to a solution of compound 126 (174 mg) in dimethylformaiuide (3 mL), then compound 9 (3 00 mg) was added and the mixture then shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 3 mL) and dried under reduced pressure, yielding resin bound compound 137.
WO 2006/110185 PCT/US2005/040919 [0580] Reaction 2: Preparation of I Ile
I
Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Om(NHBoc)-Gly-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DAsn(NHTrt) (138) [0581] Compound 137 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) and dried under reduced pressure.
The resin was washed with DMF:piperidine 4:1 (10 mL) for 4 hrs then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL), and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 uL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 138.
[0582] Reaction 3: Preparation of compound (C16) [0583] Dried compound 138 was suspended in dichloromethane, (2.5 mL) trifluoroacetic acid, (2.5 mL) ethanedithiol (125 uL), and triisopropylsilane(125 lL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 tM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give the pure product C16 (3.7 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [0584] Example 1-3 7: Preparation of Conmpound C76 I le- I Glu-DSer-Gly -Asp-DAla-Asp-Orn-Gly -Thr-Asp-Dglu-Trp-8-Methyldecanoc amide (C76) [0585] Reaction 1: Preparation of Resin-Glu(caOAlv)-DSer(OtBu)-Gl-ASP(OtBu)-DAla- Asp(OtBu)-Om(NHBoc)-Gly-Thr(OlleNHFmoc)-Asn)(OtBu -DGlu(OtBua)-Trp-8- Methydecanoic amide (140) 105861 Hydroxy-benzotriazole (20 mg), benzotriazole-l -yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamnine (26 RL), were added to a solution of compound 128 (174 mg) in dimethylformamide (3 mL). Compound 9 (300 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide Supra). The resin was filtered through a glass sinter funnel, washed with dichioromethane (3 x 3 mL) and dried under reduced pressure, yielding resin bound compound 140.
[0587] Reaction 2: Prearation of I Ile Resin-Glu-DSer(OtB-u)-Gly-Asp(OtBu)-DAla-Asp(OtB-u)-Om(NHBoe)-Gly-Thr-Asp(OtBu) 8-Methyldecanoic amide-TIrp-DGlu(OtBu) (141) [05881 Compound 140 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylfonrinamide (10 mL), 0.5% di-isopropylethylamine in climethylformamide (10 mL), and dichioromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF:piperidine 4:1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylfonrnamide (10 mL), and dichloromethane mL) then dried under reduced pressure. The resin was suspended in IN-methylmorpholine (3 mL) then l-hydroxy-benzotriazole (135 mg) and 1 ,3-diisopropylcarbodiimide (157 piL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 14 1.
WO 2006/110185 PCT/US2005/040919 [0589] Reaction 3: Preparation of compound (C76) [0590] Dried compound 141 was suspended in dichloromethane, (2.5 mL) trifluoroacetic acid, (2.5 mL) ethanedithiol (125 piL), and triisopropylsilane(125 tL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 ItM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give the pure product C76 (9.0 mg).
[0591] Example 1-38: Preparation of Compound I Ile Ie Glu-DSer-Gly-Asp-DAla-Asp-Orn-Sar-Thr-Asp-DAsn-Trp-8-Methyldecanoic amide [0592] Reaction 1: Preparation of Resin-Glu(aOAllyl)-DSer(OtBu)-Glv-Asp(OtBu)-DAla- Asp(OtBu)-Om(NHBoc)-Sar-Thr(OIleNHFmoc)-Asp(OtBu)-DAsn(NHTrt)-Tip-8- Methyldecanoic amide (143) [0593] Hydroxy-benzotriazole (20 mg), benzotriazole-l-yl-oxy-tris-(dimethylamino)phosphoniumnhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 tL), were added to a solution of compound 134 (243 mg) in dimethylformamide (3 mL). Compound 21 (322 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 143.
WO 2006/110185 PCT/US2005/040919 [0594] Reaction 2: Preparation of [I Ile Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Orn(NHBo)-Sar-Thr-Asp(OtBu)- 8-Methyldecanoic amide-Trp-DAsn(NHTrt) (144) [0595] Compound 143 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF:piperidine 4:1 (10 mL) for 4 hrs then filtered through a glass sinter funnel). The solid was washed with dimethylformamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 gL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 144.
[0596] Reaction 3: Preparation of compound [0597] Dried compound 144 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 gL), and triisopropylsilane(125 p and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered through a glass sinter funnel, washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 RM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C75 (8.1 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [05981 Example 1-39 Preparation of Compound C74 I ~lie Glu-DSerGyAspDAaAspAa Gy y..Thr..AsAsn-nr8M ehldn amide (C74) [05991 Reaction 1: Preparation of Resin-Glu(aOAlly1}.pSer(OtBu)..Gly..ASP(OtBu)-DAla- As(tu-l-l-h(~N~mc-s(tu-~nHr) -Mehdcam ide (146) 10600] Jlydroxy-benzotriazole (27 mng), benzotriazole-1-y1-oxytris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 88.5 mg), and diisopropylethylamine (100 were added to a solution of compound 126 (278 mg) in dimethylfonnanaide (3 mL). Compound 38 (227 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-beuzotriazole (20 mg), benzotriazole-1 -yl-oxy-tris- (dimethylamino)-phosphoniunmhexafluorophosphonate (BOP, 60 mg), and diisopropylethylamine (30 ttL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichioromethane (3 x 5 mL) and dried under reduced presure, yielding compound 146.
[0601] Reaction 2: Prparation of compound (147) 8-Methyldecanoic amide-Trp-DAsn(NHTrt) (147) [0602] Compound 146 was placed under an argon atmosphere, and treated with a solution of tctrakis-(triphenylphosphine)palladium~(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylfonnamide (10 mL), 0.5% di-isopropylethylamine in dimethylfonnamide (10 mL), and dichioromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF~piperidine 4:1 (10 mL) for 4 hrs then filtered through a glass sinter funnel. The solid was washed with dimethylformarnide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 WO 2006/110185 PCT/US2005/040919 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 pL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 147.
[0603] Reaction 3 Preparation of compound (C74) [0604] Dried compound 147 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 jM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C74 (3.9 mg).
[0605] Example 1-40: Preparation of I Ile I Glu-DSer-Gly-Asp-DAla-Asp-Ala-Sar-Thr-Asp-DAsn-Trp-8-Methyldecanoic amide (C86) [0606] Reaction 1: Preparation of Resin-Glu(aOAllvl)-DSer(OtBu)-Glv-Asp(OtBu)-DAla- Asp(OtBu)-Ala-Sar-Thr(OIleNHFmoc)-Asp(OtBu)-DAsn(NHTrt)-Trp-8-Methyldecanoic amide (149) [0607] Hydroxy-benzotriazole (20 mg), benzotriazole-l-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 pL), were added to a solution of compound 129 (228 mg) in dimethylformamide (3 mL). Compound 21 (280 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test(vide supra). The resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 149.
WO 2006/110185 PCT/US2005/040919 [0608] Reaction 2: Preparation of I Ile- Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Ala-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DAsn(NHTrt) (150) [0609] Compound 149 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF:piperidine 4:1 (10 mL) for 4 hrs then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL), dichloromethane mL) and dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 jL) were added.
The reaction was shaken for 7 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 150.
[0610] Reaction 3: Preparation of (C86) [0611] Dried compound 150 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 utL), and triisopropylsilane(125 and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 pM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C86 (2.8 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [06121 Example 1-41: Preparation of Compound C79 I IeI Glu-DSer-Gly-Asp-DAla-Asp-Orn-Sar-Thr-Asp-DGlu-Trp-8-Methyldecanoic aide (C79) [06131 Reaction 1: Preparation of Resin-Glu(aOAllyl-De(tu-l-s(tu-A Asp(OtBu)-Om(NHBoc)-Sar-Thr(OIeNHFmoc)-Asp(O~u -DGlu(OtBu)-Trp-8- Methyldecanoic amide (152) [06141 Hydroxy-beuzotriazole (20 mg), benzotriazole-1 -yl-oxy-tris-(dimethylamino)phosphoniumliexafluorophosphonate (B OP, 66 mg), and dilsopropylethylamine (52 were added to a solution of compound 135 (217 mg) in dimethylformainide (3 mL). Compound 21 (278 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichioromethane (3 x 3 mL) and dried under reduced pressure, yielding resin bound compound 152.
[06151 Reaction 2: Pre paration of I Ile Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Om(NT{Boc)-Sar-Tlir-Asp(OtBu) 8-Methyldecanoic am-ide-Trp-DGlu(OtBu) (153) [06161 Compound 151 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(O) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylfonnamide (10 mL), and dichloromethane (10 mL) then dried -under reduced pressure.
The resin was washed with DMF:piperidine 4:1 (10 mL) for 4 hrs then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL) then 1 -hydroxy-benzotriazole (13 5 mg) and 1 ,3-diisopropylcarbodiimide (157 IiL) were added. The reaction was shaken for 7 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 153.
[06171 Reaction 3: Preparation of compound (C79) 106181 Dried compound 153 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 jgiL, and triisopropylsilane(1 25 p1L), and the reaction mixture 321 WO 2006/110185 PCT/US2005/040919 was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C 18 10 tM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C79 (1.5 mg).
[0619] Example 1-42: Preparation of Compound C81 I Ile 1 Glu-DSer-Gly-Asp-DAla-Asp-Ala-Gly-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C81) [0620] Reaction 1: Preparation of Resin-Glu(aOAllyl)-DSer(OtBu)-Glv-Asp(OtBu)-DAla- As(OtBu)-Ala-Gly-Thr(OlleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8-Methyldecanoic amide (155) [0621] Hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 pL), were added to a solution of compound 128 (183 mg) in dimethylformamide (3 mL). Compound 38 (227 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 3 mL) and dried reduced pressure, yielding compound 155.
[0622] Reaction 2: Preparation of I Ile
I
Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Ala-Gly-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (156) [0623] Compound 155 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium WO 2006/110185 PCT/US2005/040919 thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hrs then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 pL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 156.
[0624] Reaction 3: Preparation of(C81) [0625] Dried compound 156 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 gL), and triisopropylsilane(125 tL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C 18 10 gM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C81 (2.3 mg).
[0626] Example 1-43: Preparation of Compound I Ile I Glu-DSer-Gly-Asp-DAla-Asp-Ala-Sar-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide [0627] Reaction 1: Preparation of Resin-Glu(aOAllvl)-DSer(OtBu)-Gly-Asp(OtBu)-DAla- Asp(OtBu)-Ala-Sar-Thr(OIleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8-Methldecanoic amide (158) [0628] Hydroxy-benzotriazole (20 mg), benzotriazole-l-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 pL), were added to a solution of compound 131 (196 mg) in dimethylformamide (3 mL). Compound 21 (278 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra) The WO 2006/110185 PCT/US2005/040919 resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 158.
[06291 Reaction 2: Preparation of Ile I Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Ala-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (159) [0630] The resin 158 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hrs then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 gL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 159.
[0631] Reaction 3: Preparation of compound [0632] Dried compound 159 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 pM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C80 (6.2 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [06331 Example 1-44: Preparation of Compound C72 I le Glu-DAsn-Gly-Asp-DAla-Asp-Orn-Gly-Thr-Asp-DAsn-Trp-8-Methyldecanoic amide (C72) [06341 Reaction 1: Pre paration of Resin-Glu(cuOAllyl)-DAsn-Glv-Asp(OtBu)-DAla- Asp(OtBu)-Om(NHBoc)-Gly-Thr(OIeNBFmoc)-Asy(OtBu)-DAsn(NHIrt)-Trp-8- Methyldecanoic amide (161) [0635] Hydroxy-benzotriazole (20 mg), benzotriazole- 1 -yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mng), and diisopropylethylamine (26 giL), were added to a solution of compound 126 (274 mg) in dimethylformamide (3 mL). Compound (303 mg) was added and the mixture then shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichioromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 16 1.
[06361 Reaction 2: Preparation of Ii Resin-Glu-DAsn(NIHTrt)-Gly-Asp(OtBu)-DAla-Asp(OtBua)-Om(NHBoc)-Gly-Thr-A sp(OtBu) 8-Methyldecanoic amide-Trp-DAsn(N}{Trt) (162) [06371 Compound 161 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylfornmide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 brs then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL), dichloromethane mL) and dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL) and l-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 pL) were added.
The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylniorpholine to give compound 162.
WO 2006/110185 PCT/US2005/040919 [0638] Reaction 3: Preparation of (C72) [0639] Dried compound 162 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 tiL), and triisopropylsilane(125 tL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (Cl 8 10 tM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C72 (2.9 mg).
[0640] Example 1-45: Preparation ofC352 I Ile
I
Glu-DAsn-Gly-Asp-DAla-Asp-Orn-Gly-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C352) [0641] Reaction 1: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Glv-Asp(OtBu)-DAla- Asp(OtBu)-Om(NHBoc)-Gly-Thr(OIleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8- Methyldecanoic amide (164) [0642] Hydroxy-benzotriazole (20 mg), benzotriazole-1 -yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 gL), were added to a solution of compound 127 (183 mg) in dimethylformamide (2 mL). Compound (265 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 gL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 164.
WO 2006/110185 PCT/US2005/040919 [0643] Reaction 2: Preparation of I Ile I Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Orn(NHBoc)-Gly-Thr-Ap(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (165) [0644] Compound 164 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hrs then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 p.L) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 165.
[0645] Reaction Preparation of compound (C352) [0646] Dried compound 165 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 gL), and triisopropylsilane(125 gL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 jiM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C352 (4.7 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [06471 Example 1-46: Preparation of Compound I leI Glu-DAsn-Gly-Asp-DAla-Asp-Orn-Sar-Thr-Asp-DAsn-Trp-8-Methydecanoic amide [06481 Reaction 1: Preparation of Resin-Glu(oQOAlly1)-DAsn(NHirt)-Glv-Asp(Ot -a -DAla- Asp(Ot~u -Om(Boc)-Sar-Thr(OIeNHFmoc)-Asp(OtBu)-DAsn(NHTrt)Tr-8-M thIdecanoic amide (167) [06491 Hydroxy-benzotriazole (20 mg), benzotriazole-1I -yl-oxy-tris-(dimethylamino)phosphoniumihexafiuorophosphonate (BOP, 66 mg), and diisopropylethylamine (30 pLf), were added to a solution of compound 134 (248 mg) in dimethylformainide (3 mL). Compound (238 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test(vide supra). The resin was filtered through a glass sinter funnel, washed with dichioromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 167.
[06501 Reaction 2: Preparation of I le 7 Re-sin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Orn(NHBoc)-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DAsn(NHTrt) (168) [06511 Compound 167 was placed under an argon atmosphere, and treated with a solution of tetrakis-Qtriphenylphosphine)palladium(0),(340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in diinethylformamide (10 mL), 0.5% di-isopropylethylamidne in dimethylformnai-nide (10 mL), and dichioromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 his then filtered through a glass sinter funnel. The solid was washed with dimethylfonnamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylnorpholine (3 mL) then 1 -hydroxy-benzotriazole (13 5 mg) and 1 ,3-diisopropylearbodiimide (157 ptL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 168.
WO 2006/110185 PCT/US2005/040919 [0652] Reaction 3: Preparation of compound [0653] Dried compound 168 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 gL), and triisopropylsilane(125 ptL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 IpM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C85 (3.7 mg).
[0654] Example 1-47: Preparation of Compound C353 I Ile I Glu-DAsn-Gly-Asp-DAla-Asp-Ala-Gly-Thr-Asp-DAsn-Trp-8-Methyldecanoic amide (C353) [0655] Reaction 1: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla- Asp(OtBu)-Ala-Gly-Thr(OleNHFmoc)-Asp(OtBu)-DAsn(NHTrt)-Trp-8-Methldecanoic amide (170) [0656] Hydroxy-benzotriazole (20 mg), benzotriazole-1 -yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (52 pL), were added to a solution of compound 126 (209 mg) in dimethylformamide (2 mL). Compound 52 (340 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 pL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 170.
WO 2006/110185 PCT/US2005/040919 [0657] Reaction 2: Preparation of I Ile Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Ala-Gly-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DAsn(NHTrt) (171) [0658] The resin 170 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel. The solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL) then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 pL) were added.
The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 171.
[0659] Reaction 3: Preparation of compound (C353) [0660] Dried compound 171 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 tL), and triisopropylsilane(125 utL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 gM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C353 (6.8 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [06611 Example 1-48: Preparation of Compound C82 I leI Glu-D)Asn-Gly -Asp-DAla-Asp-Ala-Sar-Thr-Asp-DAsn-Trp-8-Methydecanoic amide (C82) [06621 Reaction 1: Pre paration of Resin-Glu(aOAlll)-DAsnCNHTrt)-Glv-Asp(OtBu)-DAla- Asp(OtB-u)-Ala-Sar-Thr(OlleNHFmoc)-Asp(OtBu)-DAsn(NHTrt)-Trp-8-Methyldecanoic amide (173) [06631 Hydroxy-benzotriazole (20 mg), benzotriazole- 1-yl-oxy-tris-(dimethylamino)phosphoniumhexafiuorophosphonate (BOP, 66 mg), and dilsopropylethylamine (26 g1), were added to a solution of compound 129 (221 mg) in dimethylformamide (3 mL). Compound (238 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 3 mL) then dried under reduced pressure, yielding compound 173.
106641 Reaction 2: Preparation of I Ile Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Ala-S;ar-Tbr-Asp(OtBu) 8-Methyldecanoic aniide-Trp-DAsn(NHTrt) (174) 106651 Compound 173 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichioromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 firs then filtered through a glass sinter funnel. The solid was washed with dimethylfonnarnide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 p1L) were added. The reaction was shaken for 17 hours, filtered, through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 174.
WO 2006/110185 PCT/US2005/040919 [0666] Reaction 3: Preparation (C82) [0667] Dried compound 174 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 IM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C82 (3.8 mg).
[0668] Example 1-49: Preparation of Compound C83 I -Ile I Glu-DAsn-Gly-Asp-DAla-Asp-Orn-Sar-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C83) [0669] Reaction 1: Preparation of Resin-Glu(aOAllyl)-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla- Asp(OtBu)-Om(NHBoc)-Sar-Thr(OIleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8- Methyldecanoic amide (176) [0670] Hydroxy-benzotriazole (20 mg), benzotriazole-l-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 IL), were added to a solution of compound 135 (221 mg) in dimethylformamide (3 mL). Compound (238 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test(vide supra. The resin was filtered, through a glass sinter funnel, washed with dichloromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 176.
WO 2006/110185 PCT/US2005/040919 [0671] Reaction 2: Preparation of IIle Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Om(NHBoc)-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (177) [0672] Compound 176 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 ml) for 4 hrs then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 gL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 177.
[0673] Reaction 3: Preparation of Compound (C83) [0674] Dried compound 177 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 gL), and triisopropylsilane(125 IL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 gM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C83 (4.3 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [06751 Example 1-50: Preparation of Compound C84 I H~le--I Glu-DAsn-Gly-Asp-DAla-Asp-Ala-Gly-Thr-Asp-DGlu-Trp-8-Methyldecanoic amiide (C84) [06761 Reaction 1: Preparation of Resin-Glu(cOAll)-DAsn(lNlTrt) -Gly-Asp(OtBu)- DAla-Asp(OtBu)-Ala-Gly-Thr(OlIeNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8-Methldecanoic amide (179) [06771 Hydroxy-benzotriazole (20 mg), benzotriazole- 1 -yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mng), and diisopropylethylamine (26 p1L), were added to a solution of compound 128 (183 mg) in dimethylformnamide (3 mL). Compound 52 (212 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichioromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 179.
[06781 Reaction 2: Preparation of I le Resin-Glu-DAsn(NHlTrt)-Gly-Asp(OtBu)-DAka-Asp(OtBu)-Ala-Gly-Thr-A sp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (180) [06791 Compound 179 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(O) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylfon-nanfide (10 mL), 0. 5% di-isopropylethylarnine in diinethylformamide (10 mL), and dichioromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4 :1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylfonnamide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure. The resin was suspended in Nmethylmorpholine (3 ruL), then I -hydroxy -benzotriazole (135 mg) and 1,3dilsopropylcarbodilmide (157 [t1) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-n-ethylmorpholine to give compound 180.
[0680] Reaction 3: Preparation. of compound (C 84) [06811 Dried compound 180 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 1 iL), and triisopropylsilane(125 and the reaction mixture 334 WO 2006/110185 PCT/US2005/040919 was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 jiM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C84 (6.6 mg).
[0682] Example 1-51: Preparation of Compound C354 I Ile I Glu-DAsn-Gly-Asp-DAla-Asp-Ala-Sar-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C354) [0683] Reaction 1: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla- Asp(OtBu)-Ala-Sar-Thr(OlleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8-Methyldecanoic amide (182) [0684] Hydroxy-benzotriazole (20 mg), benzotriazole-l-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 pL), were added to a solution of compound 131 (196 mg) in dimethylformamide (2 mL). Compound (238mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 tL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 182.
WO 2006/110185 PCT/US2005/040919 [0685] Reaction 2: Preparation of I Ile
I
Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DAla-Asp(OtBu)-Ala-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (183) [0686] Compound 182 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hrs then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL) then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 pL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 183.
[0687] Reaction 3: Preparation of compound (C354) [0688] Dried compound 183 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 uL), and triisopropylsilane(125 tL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 jIM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C354 (4.7 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [06891 Example 1-52: Preparation of Compound C73 I le Glu-DSer-Gly-Asp-DLys-Asp-Orn-Gly-Thr-Asp-DAsn-Trp-8-Methydecanoic amide (C73) [06901 Reaction 1: Preparation of Resin-Glu(coOAllyl)-DSer(OtBu)-Glv-Asp(OtBu- DLys(NTIBoc)-Asp(OtBu)-Om(NHBoc)YGlv-Thr(OIeNHFmoc)-Asp(OtBu)-DAsn(NT1Trt)-Trp- 8-Meth-yldecanoic amnide (185) [06911 Hydroxy-benzotriazole (20 mg), benzotriazole-1 -yl-oxy-tris-(dimethylamino)phosphoniumhexafiuorophosphonate (B OP, 66 mg), and dilsopropylethylamine (26 giL), were added to a solution of compound 126 (298 mg) in dimethylformnamide (3 mL). Compound 54 (312 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichioromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 185.
[06921 Reaction 2: Prenaration of IIle Resin-Glu-.DSer(OtB-a)-Gly-Asp(Otlu)-DLys(NIIBoc)-Asp(OtBu)-Orn(NHBoc)-Gly-Thr-Asp(Otlu) 8-Methyldecanoic amide-Trp-DAsn(NHiTrt) (186) [06931 Compound 185 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladi-um(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylfonnamide (10 mL), 0.5% di-isopropylethylamnine in dimethylfonnamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DME: piperidine 4:1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformnamide (10 mnL) and dichioromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then l-hydroxy-benzotriazole (135 mg) and 1 ,3-diisopropylcarbodiimide (157 [LL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 186.
WO 2006/110185 PCT/US2005/040919 [0694] Reaction 3: Preparation of compound (C73) [0695] Dried compound 186 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 ptM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C73 (24.6 mg).
[0696] Example 1-53: Preparation of Compound C355 I Ile I Glu-DSer-Gly-Asp-DLys-Asp-Orn-Gly-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C355) [0697] Reaction 1: Preparation of Resin-Glu(ctOAllvl)-DSer(OtBu)-Glv-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-Om(NHBoc)-Gly-Thr(OlleNHFmoc)-Asp(OtBu)-DGlu(OtBu)u-Trp 8-Methyldecanoic amide (188) [0698] Hydroxy-benzotriazole (20 mg), benzotriazole-1 -yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 pL), were added to a solution of compound 128 (183 mg) in dimethylformamide (2 mL). Compound 54 (322.6mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 pL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel), washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 188.
WO 2006/110185 PCT/US2005/040919 [0699] Reaction 2: Preparation of I Il I Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Om(NHBoc)-Gly-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-dGlu(OtBu) (189) [0700] Compound 188 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure. The resin was suspended in Nmethylmorpholine (3 mL), then 1 -hydroxy-benzotriazole (135 mg) and 1,3diisopropylcarbodiimide (157 pL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 189.
[0701] Reaction 3:Preparation of(C355) [0702] Dried compound 189 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pl), and triisopropylsilane(125 jpl), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 pM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C355 (8.2 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [07031 Example 1-54: Preparation of Compound C356 I le Glu-DSer-Gly-Asp-DLys-Asp-Orn-Sar-Thr-Asp-DAsn-Trp-8 -Methyldecanoic amlide (C356) [0704] Reaction 1: Preparation of Resin-Glu(axOAllyl)-DSer(OtBu)-Glv-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-Om(NH4Boc)-Sar-Thr(OIeNHFmoc)-Asp(OtBu -DAsnNH At-Tp- 8-Meth Idecanoic amide (191) [07051 Hydroxy-benzotriazole (20 mg), benzotriazole-1I -yl-oxy-tris-(dimethylamino)phosphoniumhcxafiuorophosphonate (B OF, 66 mg), and diisopropylethylamine (26 gjL), were added to a solution of compound 134 (243 mg) in dimethylformamide (2 mL). Compound 34 (263 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole- 1-yl-oxy-tris- (dimethylamino)-phosphoniunihexafiuorophosphonate (BOP, 60mg), and diisopropylethylamine (30 jiL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 191.
[07061 Reaction 2: Preparation of I Ile Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Om(NHBoc)-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-D sn(NHTrt) (192) [07071 Compound 191 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium tliiocarbozo ate in dimethylformamide (10 mL), 0. 5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethanc (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamnide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure. T he resin was suspended in Nmethylmorpholine (3 mL), then 1 -hydroxy-benzotriazole (13 5 mg) and 1,3 WO 2006/110185 PCT/US2005/040919 diisopropylcarbodiimide (157 pL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 192.
[0708] Reaction 3: Preparation of(C356) [0709] Dried compound 192 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 1l), and triisopropylsilane(125 p1), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 gM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C356 (8.7 mg).
[0710] Example 1-55: Preparation of Compound C357 I -Ile I Glu-DSer-Gly-Asp-DLys-Asp-Ala-Gly-Thr-Asp-DAsn-Trp-undecanoic amide (C357) [0711] Reaction 1: Preparation of Resin-Glu(aOAllyl)-DSer(OtBu)-Glv-Asp(OtBu)- DLvs(NHBoc)-Asp(OtBu)-Ala-Gly-Thr(OIleNHAlloc)-Asp(OtBu)-DAsn(NHTrt)-Trpundecanoic amide (194) [0712] Hydroxy-benzotriazole (14 mg), benzotriazole-l-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 44 mg), and diisopropylethylamine (20 iL), were added to a solution of compound 132 (147 mg) in dimethylformamide (3 mL). Compound 34 (200 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 itL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 194.
WO 2006/110185 PCT/US2005/040919 [0713] Reaction 2: Preparation of I Ile I Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Ala-Gly-Thr-Asp(OtBu) Undecanoic amide-Trp-DAsn(NHTrt) (195) [0714] Compound 194 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 jL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 195.
[0715] Reaction 3: Preparation of(C357) [0716] Dried compound 195 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 and triisopropylsilane(125 pL); and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product (43 mg). The crude product was purified by reverse phase HPLC (C18 10 [M Jupiter column 250 x 21.2mm) eluting with a gradient from 20% acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to acetonitrile 0.5% formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C357 (4.5 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [07171 Example 1-56: Preparation of Compound C358 I ~lie Glu-DSer-Gly-Asp-DLys-Asp-Ala-Sar-T1 r-Asp-DAsn-Trp-undecanoic amide (C358) [07181 Reaction 1: Preparation of Resin-Glu(ctOAllyl)-DSer(OtBu)-Gly-Asp(OtBu).
DLys(NHBocV-Asp)-Aa-Sar-Thr(OleNflAlloc)Asp(OtBu)-DAsn(NHTrt)rpundecanoic amnide (197) 107191 Hydroxy-benzotriazole (14 mg), benzotriazole- 1 -yl-o xy-tris-(dimethylamnino)phosphoniumbexafluorophosphonate (BOP, 44 mg), and diisopropylethylamine (20 gQL, were added to a solution of compound 1310 (154 mg) in dimethylformamide (3 mnL). Compound 34 (200 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1 -yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 jilL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 197.
[0720] Reaction 2: Preparation of -I__le Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DLys(NBoc)Asp(OtBu)AaSarThr-Asp(Otu) Undecanoic amide-Trp-DAsn(NHTrt) (198) [0721] Compound 197 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (3 40 mg) in dichioromethane (9.25 mL), acetic acid mL), and N-methylmorpholiue (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5 di-isopropylethylamine in dimethylformamide (10 mL), and dichioromethane (10 mL) then dried under reduced pressure.
The resin was suspended in N-methyliniorpholine (3 mL), then 1 -hydroxy-benzotriazole (13 mg) and 1 ,3-diisopropylcarbodiimide (157 jiL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 198.
WO 2006/110185 PCT/US2005/040919 [0722] Reaction 3: Preparation of compound (C358) [0723] Dried compound 198 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 tL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel, washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 ItM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C 358 (2.7 mg).
[0724] Example 1-57: Preparation of Compound C359 I Ile I Glu-DSer-Gly-Asp-DLys-Asp-Orn-Sar-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C359) [0725] Reaction 1: Preparation ofResin-Glu(aOAllvl)-DSer(OtBu)-Gl-Asp(OtBu)- DLvs(NHBoc)-Asp(OtBu)-Om(NHBoc)-Sar-Thr(OIleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp- 8-Methyldecanoic amide (200).
[0726] Hydroxy-benzotriazole (20 mg), benzotriazole-l-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 were added to a solution of compound 135 (217 mg) in dimethylformamide (2 mL). Compound 34 (263 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 jpL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 200.
WO 2006/110185 PCT/US2005/040919 [0727] Reaction 2: Preparation of I Ile I Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Om(NHBoc)-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (201) [0728] Compound 200 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylfomiamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 fiL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 201.
[0729] Reaction 3: Preparation of (C359) [0730] Dried compound 201 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 tM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C359 (4.7 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [07311 Examiple 1-58: Preparation of compound C360 le Glu-DSer-Gly-Asp-DLys-Asp-Ala-Giy-Thr-Asp-DGlu-Trp-undecanoic amide (C360) [07321 Reaction 1: Preparation of Resin-GLu(YxOAllyl)-DSer(OtBu)-Gly-Asp(OtBu DLys(NHBoc)-Asp(OtBu)-Ala-Gly-Thr(OlleNHAllo)-As-p(OtBu)-DGlu(OtBu)-Trpundecanoic amide (203) 107331 Hydroxy-benzotriazole (14 mg), benzotriazole- 1-yl-oxy-tris-(dimethylamino)phosphoniumnhexafiuorophosphonate (B OP, 44 mg), and diisopropylethylamine (20 pL), were added to a solution of compound 133 (95 mg) in dimethylfonnamide (3 mL). Compound 34 (200 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete -using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1I-yl-oxy-tris- (dimethylamnino)-phosphoniun-ihexafiuorophosphonate (BOP, 6 0mg), and diisopropylethylamine (30 were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichioromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 203.
[0734] Reaction 2: Preparation of Ii Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Ala-Gly-Thr-Asp(OtBu) Undecanoic anmide-Trp-Dc~lu(OtBu) (204) [07351 Compound 203 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 rnL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was suspended in N-methylmorpholine (3 mL), then Il-hydroxy-benzotriazole (13 mg) and 1 ,3-diisopropylcarbodiimide (157 [t1) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 204.
WO 2006/110185 PCT/US2005/040919 [0736] Reaction 3: Preparation of compound (C360) [0737] Dried compound 204 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 uL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 itM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C360 (3.4 mg).
[0738] Example 1-59: Preparation of Compound C361 lie I Glu-DSer-Gly-Asp-DLys-Asp-Ala-Sar-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C361) [0739] Reaction 1: Preparation of Resin-Glu(aOAllvl)-DSer(OtBu)-Glv-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-Ala-Sar-Thr(OleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8- Methyldecanoic amide (206) [0740] Hydroxy-benzotriazole (20 mg), benzotriazole-1 -yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 AL), were added to a solution of compound 131 (196 mg) in dimethylformamide (2 mL). Compound 34 (270 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test(vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 pL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 206.
WO 2006/110185 PCT/US2005/040919 [0741] Reaction 2: Preparation of I Ile
I
Resin-Glu-DSer(OtBu)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Ala-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (207) [0742] Compound 206 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then driedunder reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure. The resin was suspended in Nmethylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3diisopropylcarbodiimide (157 pL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 207.
[0743] Reaction 3: Preparation of compound (C361) [0744] Dried compound 207 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 gJM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C361 (6.3 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 107451 Example 1-60: Preparation of Compound C77 I le Giu-DAsn-Giy-Asp-DLys-Asp-Orn-Gly-Thr-Asp-DAsn-Trp-8-Methylecanoic amide (C77) [07461 Reaction 1: Preparation of Resin-Glu(o.OAllyl)-DAsn(NHTrt)-Glv-Asp(OtBu)- DLys(NHBoc)-Ap(OtBu)-OmNBoc)-Gly-Thr(OIeN4Fmoc)-Ap(OtBu)-DAsn(NHTrt)-Trp- 8-Meth3Ldecanoic amide (209) [0747] Hydroxy-benzotriazole (20 mg), benzotriazole-l -yl-oxy-tris-(dimethylamnino)phosphoniumhexafluaorophosphonate (BOP, 66 mg), and diisopropylethylamnine (26 p1), were added to a solution of compound 126 (243 mg) in dimethylformnamide (3 mL). Compound (217 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dicliloromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 209.
[0748] Reaction 2: Preparation of I Ile Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Om(NIJBoc)-Gly-T'hr-A Isp(OtBu) 8-Methyldecanoic amide-Trp-DAsn(NHTrt) (210) [0749] Compound 209 was placed under an argon atmosphere, and treated with a solution of tetralkis-(triphenylplhosphine)palladium(O) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamnide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure. The resin was suspended in Nmethylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3diisopropylcarbodiimide (157 jtL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 210.
WO 2006/110185 PCT/US2005/040919 [0750] Reaction 3: Preparation of compound (C77) [0751] Dried compound 210 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 gM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C77 (3.8 mg).
[0752] Example 1-61: Preparation of Compound C362 I Ile I Glu-DAsn-Gly-Asp-DLys-Asp-Orn-Gly-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C362) [0753] Reaction 1: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Glv-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-Om(NHBoc)-Gly-Thr(OIleNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp- 8-Methvldecanoic amide (212) [0754] Hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 gL), were added to a solution of compound 128 (183 mg) in dimethylformamide (2 mL). Compound (217 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 uL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced presure, yielding compound 212.
WO 2006/110185 PCT/US2005/040919 [0755] Reaction 2: Preparation of I Ile
I
Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Or(NHBoc)-Gly-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (213) [0756] Compound 212 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 iL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 213.
[0757] Reaction 3: Preparation of compound (C362) [0758] Dried compound 213 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 pM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C362 (3.1 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [07591 Example 1-62: Preparation of Compound C363 I le--I Glu-DAsn-Gly-Asp-DLys-Asp-Orn-Sar-Thr-Asp-DAsn-Trp-8-Methyldecanoic amide (363) [0760] Reaction 1: Preparation of Resin-Glu(aOAllyl)-DAsn(NHTrt -Gly-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-Om(NHBoc)-Sar-Thr(OIeNB~moc)-Asp(OtBu -DAsnNI{r)- rp- 8-Methyldecanoic amide (215) [076 11 Hydroxy-benzotriazole (20 mg), beuzotriazole- 1 -yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 p1), were added to a solution of compound 134 (342 mng) in dimethylfonnamide (2 mL). Compound 56 (416 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole- 1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafiuorophosphonate (BOP, 60mg), and diisopropylethylamine (30 jgL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduaced pressure, yielding compound 215.
[07621 Reaction 2: Preparation of Ile Resin-Glu-DAsn(NI]Trt)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Om(NHBoc)-Sar-Thr-A Isp(OtBu) 8-Methyldecanoic amide-Trp-DAsn(NHTrt) (216) [0763] Compound 215 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladiumn(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformainide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichioromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4:1 (10 mL) 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichioromethane mL) then dried under reduced pressure. The resin was suspended in N-methyhnorpholine (3 mL), then 1 -hydroxy-benzotriazole (135 mg) and I ,3-diisopropylcarbodiimiide (157 1 iL) were WO 2006/110185 PCT/US2005/040919 added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 216.
[0764] Reaction 3: Preparation of compound (C363) [0765] Dried compound 216 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 tiM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C363 (6.1 mg).
[0766] Example 1-63: Preparation of Compound C364 I Ile I Glu-DAsn-Gly-Asp-DLys-Asp-Ala-Gly-Thr-Asp-DAsn-Trp-tridecanoic amide (C364) [0767] Reaction 1: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Gly-Asp(OtBu)- DLvs(NHBoc)-Asp(OtBu)-Ala-Gly-Thr(OIleNHFmoc)-Asp(OtBu)-DAsn(NHTrt)-Trp- Tridecanoic amide (218) [0768] Hydroxy-benzotriazole (20 mg), benzotriazole-l-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 pL), were added to a solution of compound 127 (146 mg) in dimethylformamide (3 mL). Compound 62 (171 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 218.
WO 2006/110185 PCT/US2005/040919 [07691 Reaction 2: Preparation of I lie Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Ala-Gly-Thr-Asp(OtBu) Tridecanoic amide-Trp-DAsn(NHTrt) (219) [0770] Compound 218 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4: 1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure. The resin was suspended in Nmethylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3diisopropylcarbodiimide (157 pL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 219.
[07711 Reaction 3: Preparation of compound (C364) [0772] Dried compound 219 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 pM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C364 (4.8 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [07731 Example 1-64: Preparation of Compound C365 I le- I GIu-DAsn-Gly-Asp-DLys-Asp-Ala-Sar-Thr-Asp-DAsn-Trp-8-Methyldecanoic amide (C36 [07741 Reaction 1: Preparation of Resin-Glu(aOAllyUl-DAsn(NHTrt)-Gly-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-Ala-Sar-Thr(OIleNFIFmoc)-Asp(OtBu)-DAsn(NHTrt)-Trp-8- Methyldecanoic amide (221) [07751 Hydroxy-benzotriazole (20 mg), benzotriazole-1 -yl-oxy-tris-(dimethylamino)phosphoniunihexafluorophosphonate (B OP, 66 mg), and diisopropylethylamnine (26 1 were added to a solution of compound 129 (195 mg) in dimnethylformamide (2 mL). Compound 56 (400 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide-supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole- 1 -yl-oxy-tris- (dimethylamnino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 g1), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 221.
107761 Reaction 2: Preparation of I Bie Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Ala-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DAsn(NHTrt) (2227) 107771 Compound 221 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mng) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4: 1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure. The resin was suspended in Nmethylmorpholine (3 m1L), then 1-hydroxy-benzotriazole (135 mg) and 1,3- WO 2006/110185 PCT/US2005/040919 diisopropylcarbodiimide (157 tL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 222.
[0778] Reaction 3: Preparation of compound (C365) [0779] Dried compound 222 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 and triisopropylsilane(125 tL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 jIM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C365 (10.2 mg).
[07801 Example 1-65: Preparation of Compound C366 I -Ile I Glu-DAsn-Gly-Asp-DLys-Asp-Orn-Sar-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C366) [0781] Reaction 1: Preparation of Resin-Glu(aOAllyl)-DAsn(NHTrt)-Gly-Asp(OtBu)- DLvs(NHBoc)-Asp(OtBu)-Om(NHBoc)-Sar-Thr(OIleNHFmoc)-Asp(OtBu)-DGlulOtBu)-Trp- 8-Methyldecanoic amide (224) [0782] Hydroxy-benzotriazole (20 mg), benzotriazole-l-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 were added to a solution of compound 135 (217 mg) in dimethylformamide (2 mL). Compound 56 (217 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 jiL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 224.
356 WO 2006/110185 PCT/US2005/040919 [0783] Reaction 2: Preparation of I Ile I Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Om(NHBoc)-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-Ddlu(OtBu) (225) [0784] Compound 224 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4 :1 (10mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL)and dichloromethane mL) then dried under reduced pressure. The resin was suspended in N-methylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3-diisopropylcarbodiimide (157 gL) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 225.
[0785] Reaction 3: Preparation of Compound (C366) [0786] Compound 225 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid mL), ethanedithiol (125 gL), and triisopropylsilane(125 gL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure.
Crude product was then partitioned between diethyl ether (10 mL), and water (2.5 mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 jM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile 0.5% formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C366 (1.1 mg).
WO 2006/110185 WO 206/10185PCT/US2005!040919 [07871 Example 1-66: Preparation of Compound C367 I le Glu-DAsn-Gly-Asp-DLys-Asp-Ala-Giy-Thr-Asp-DGIu-Trp-8-Methyldecanoic amiide (C367) [07881 Reaction 1: Preparation of Resin-Glu(cxOAlll)-DAsn(NHTrt)-Gly-Asp(OtBu)- DLys(NHBoc)-Asp(OtB-u)-Ala-Gly-Thr(OIeNHFmoc)-Asp(OtBu)-DG-u(OtBu)-Trp-8- Methyldecanoic amide (227) 10789] Hydroxy-benzotriazole (20 mg), benzotriazole- 1-yl-oxy-tris-(dimethyl amino)phosphoniumnhexafluorophosphonate (BOP, 66 mng), and diisopropylethylamine (26 gL), were added to a solution of compound 128 (183 mg) in dimethylformnamide (3 mL). Compound 62 (294 mg) was added and the mixture was shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be complete using the Kaiser Test (vide supra). The resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 3 mL) and dried under reduced pressure, yielding compound 227.
[07901 Reaction 2: Preparation of Ile Resin-Glu-DAsn(NHlTrt)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Ala-Gly-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu).
(228) [07911 Compound 227 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformnamide (10 mL), 0.5% di-isopropylethylamine in dimethylfoninamide (10 mL), and dicliloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4: 1 (10 mL) for 4 hours then filtered through a glass sinter funnel. The solid was washed with dimethylformamide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure. The resin was suspended in Nmethylmorpholine (3 mL), then l-hydroxy-benzotriazole (135 mg) and 1,3diisopropylcarbodiiniide (157 tl,) were added. The reaction was shaken for 17 hours, filtered through a glass sinter funnel, and washed well with N-methylmorpholine to give compound 228.
WO 2006/110185 PCT/US2005/040919 [0792] Reaction 3: Preparation of (C367) [0793] Dried compound 228 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 gL), and triisopropylsilane(125 iL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 gM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give product C366 (6.9 mg).
[0794] Example 1-67: Preparation of Compound C368 I Ile I Glu-DAsn-Gly-Asp-DLys-Asp-Ala-Sar-Thr-Asp-DGlu-Trp-8-Methyldecanoic amide (C368) [0795] Reaction 1: Preparation of Resin-Glu(aOAllvl)-DAsn(NHTrt)-Gly-Asp(OtBu)- DLys(NHBoc)-Asp(OtBu)-Ala-Sar-Thr(OIlcNHFmoc)-Asp(OtBu)-DGlu(OtBu)-Trp-8- Methyldecanoic amide (230) [0796] Hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris-(dimethylamino)phosphoniumhexafluorophosphonate (BOP, 66 mg), and diisopropylethylamine (26 pL), were added to a solution of compound 131(296 mg) in dimethylformamide (2 mL). Compound 56 (416 mg) was added and the mixture then shaken for 17 hours. A portion of the resin was removed and the coupling was judged to be incomplete using the Kaiser Test (vide supra). An additional portion of hydroxy-benzotriazole (20 mg), benzotriazole-1-yl-oxy-tris- (dimethylamino)-phosphoniumhexafluorophosphonate (BOP, 60mg), and diisopropylethylamine (30 gL), were added and the mixture was then shaken for 26 hours.
Coupling was judged to be complete using the Kaiser Test so the resin was filtered through a glass sinter funnel, washed with dichloromethane (3 x 5 mL) and dried under reduced pressure, yielding compound 230.
WO 2006/110185 PCT/US2005/040919 [0797] Reaction 2: Preparation of I lie I Resin-Glu-DAsn(NHTrt)-Gly-Asp(OtBu)-DLys(NHBoc)-Asp(OtBu)-Ala-Sar-Thr-Asp(OtBu) 8-Methyldecanoic amide-Trp-DGlu(OtBu) (231) [0798] Compound 230 was placed under an argon atmosphere, and treated with a solution of tetrakis-(triphenylphosphine)palladium(0) (340 mg) in dichloromethane (9.25 mL), acetic acid mL), and N-methylmorpholine (0.25 mL). The mixture was shaken for 4.5 hours at ambient temperature, filtered through a glass sinter funnel, and the solid was washed with 0.5% sodium thiocarbozoate in dimethylformamide (10 mL), 0.5% di-isopropylethylamine in dimethylformamide (10 mL), and dichloromethane (10 mL) then dried under reduced pressure.
The resin was washed with DMF: piperidine 4 :1 (10 mL) for 4 hours then filtered through a glass sinter funnel The solid was washed with dimethylformamide (10 mL) and dichloromethane (10 mL) then dried under reduced pressure The resin was suspended in Nmethylmorpholine (3 mL), then 1-hydroxy-benzotriazole (135 mg) and 1,3diisopropylcarbodiimide (157 jL) were added. The reaction was shaken for 17 hours, filtered, through a glass sinter funnel and washed well with N-methylmorpholine to give compound 231 [0799] Reaction 3: Preparation of compound (C368) [0800] Dried compound 231 was suspended in dichloromethane (2.5 mL), trifluoroacetic acid (2.5 mL), ethanedithiol (125 pL), and triisopropylsilane(125 pL), and the reaction mixture was stirred for 4.5 hours at ambient temperature. The resin was filtered, through a glass sinter funnel washed with dichloromethane, and the combined filtrates were evaporated under reduced pressure. Crude product was then partitioned between diethyl ether (10 mL), and water mL). The aqueous layer was freeze-dried to give crude product. The crude product was purified by reverse phase HPLC (C18 10 pM Jupiter column 250 x 21.2mm) eluting with a gradient from acetonitrile 0.5% formic acid: 80 water 0.5% formic acid to 80% acetonitrile formic acid 20 water 0.5% formic acid over 25 minutes. The product bearing fractions were combined and freeze-dried to give compound C368 (11.8 mg).
WO 2006/110185 PCT/US2005/040919 [0801] Example 1-68: Stereoselective synthesis of2S,3R-N-Fmoc-L-3-methyl-glutamic acid alpha allyl ester 232 o 0 0OH 232 [0802] Reaction 1 0 N L O ON N-I-I
H
o o 233 234 [0803] Tetra butyl ammonium iodide (39.4 g) was added to a solution of commercially available Garner's aldehyde 233 (98 g) in 3M potassium carbonate (K 2 C0 3 100 mL) under a nitrogen atmosphere to give a heterogeneous solution. After 15 minutes tert-butyl-diethyl phosphonoacetate (130 g) was added and the reaction mixture was stirred vigorously for 18 hours. Water (500 ml) was added and the resultant mixture was extracted with methyl tert-butyl ether (MTBE, 3 x 250 mL). The combined organic fractions were combined, washed with saturated sodium chloride (1 x 250 mL), dried over magnesium sulfate (MgSO 4 filtered, and concentrated to give the crude product as a yellow oil. Purification by column chromatography on silica gel, eluting with ethyl acetate: hexane 1: 9, gave the desired product 234 (95.3 g).
[0804] Reaction 2 S0 234 235 WO 2006/110185 PCT/US2005/040919 [0805] A solution of cuprous iodide (Cul, 137 g) in dry tetrahydrofuran (THF, 2250 mL) under a nitrogen atmosphere was cooled to -10 °C and stirred for 30 minutes. To this solution was added a 1.6 M solution of methyl lithium (MeLi) in diethyl ether (900 mL) such that the temperature remained below -10 The resultant mixture was stirred at -10 °C for 30 minutes then cooled to -78 °C and stirred for 45 minutes. Trimethyl silyl chloride TMSC1, (91 mL) was added such that the temperature remained below -78 °C then the reaction mixture was stirred for minutes. A solution of the substrate ester 234 (85.45 g) in THF (250 ml) was added dropwise over one hour. The reaction mixture was stirred at -78 OC for one hour and allowed to warm to °C before a quench solution of 90% saturated ammonium chloride (NH 4 C1): ammonium hydroxide (NH 4 0H, 1500 mL) was added slowly. The reaction mixture was stirred for 30 minutes and warmed to -30 °C before being worked up in 3 separate 1500 mL portions.
Each portion was partitioned and the aqueous layer was extracted with MTBE (500 mL). The combined organic phases were filtered through celite and washed with the 90% saturated
NH
4 C1:10% NH 4 0H solution (4 x 400 mL), dried over sodium sulfate (Na 2
SO
4 filtered, and concentrated to give the product. The volatiles were removed from the product under high vacuum to give the product 235 (85.45 Compound 235 was used without further purification.
[0806] Reaction 3 o00 0 0 HO HN I 235 236 [0807] A solution of the oxazolidine 235 (70 g) in methanol (1800 mL) was cooled to 0 °C and stirred for one hour. Boron trifluoride acetic acid complex (BF 3 .2HOAc, 450 mL) was added dropwise over two hours such that the internal temperature remained below 3 The reaction mixture was then quenched by the addition of 20% sodium bicarbonate (Na 2
CO
3 3000 mL) over two hours and the resultant solution was worked up in 5 separate 1000 mL portions.
Each 1000 mL portion was extracted with dichloromethane (3 x 300 mL), the organic extracts were combined, washed with NaHCO 3 (1 x 300 mL) saturated sodium chloride (1 x 30 OmL), dried over MgSO 4 filtered, and concentrated to give the crude product. The combined products were purified by column chromatography on silica gel, eluting with a gradient elution from WO 2006/110185 PCT/US2005/040919 ethyl acetate:80% hexane to 50% ethyl acetate:50% hexane. Combining and evaporating the product bearing fractions gave the desired product 236 (36.3 g).
[0808] Reaction 4 0 0 HO HNA- O HO HN-IO- o 0 Z: 0 0 236 237 [0809] A solution of the alcohol 236 (24 g) in acetonitrile (238 mL) and water (29.7 mL) was cooled to 0 OC, and periodic acid (52.2 g) was added in portions to maintain a temperature of 0 The reaction mixture was stirred at 0 °C for 45 minutes and chromium trioxide (CrO3, 460 mg) was added. The reaction mixture was stirred for 15minutes before being quenched by the slow addition of a 0.4 M dibasic sodium phosphate solution (Na 2
HPO
4 560 mL, pH The resultant mixture was extracted with MBTE (4 x 300 mL), and the combined organic extracts were washed with saturated sodium chloride (1 x 250 mL), NaHCO 3 (1 x 250 mL), and saturated sodium chloride (1 x 250 mL). The organic portion was then dried over MgSO 4 filtered, and concentrated to give the crude product. Purification by preparative thin layer chromatography on silica gel, eluting with 20 %ethyl acetate:80% hexane and extraction from silica gel with dichloromethane, gave the desired product 237(15.32 g).
[0810] Reaction HO HN OL- O
HN--IVO-
237 238 [0811] To a solution of the acid 237 (15.32 g) in N,N-dimethylformamide (DMF, 200 mL) was added potassium bicarbonate (KHC0 3 9.66 g) and the resultant suspension was stirred for minutes. A solution of allyl bromide (21 mL) in DMF (200 mL) was then added dropwise over 30 minutes and the reaction mixture was stirred for 19 hours. Water (500 mL) was added and the resultant mixture was extracted with ethyl acetate (5 x 200 mL), and the combined WO 2006/110185 PCT/US2005/040919 organic extracts were washed with water (2 x 200 mL), and saturated sodium chloride (1 x 200 mL). The organic portion was then dried over Na 2
SO
4 filtered, and concentrated to give the crude product as a yellow oil. Purification by column chromatography on silica gel, eluting with ethyl acetate:hexane 1: 4 gave the desired product 238(9.2 g).
[0812] Reaction 6 0 H--1 HNoLO 0
OH
238 232 [0813] Trifluoroacetic acid (TFA, 25 mL) and triisopropyl silane (TIPS, 1 mL) was added to a solution of the ester 238 (9.2 g) in dichlromethane and the reaction mixture was stirred for 1 hour. The mixture was then concentrated under vacuum and the resultant residue was dissolved in hexane (100 mL) and re-cvaporated three times. The residue was then dissolved in saturated NaHCO 3 (53 mL) and 1,4-dioxane (50 mL) and a solution of 9-Fluorenylmethoxycarbonyl-Nhydroxysuccinimide (FmocOSu, 9.52 g) in 1,4-dioxane (50 mL) was added dropwise over minutes. During this time the reaction mixture became cloudy so a further portion of 1,4dioxane (20 mL) added to give a heterogeneous solution that was stirred for a further 17 hours.
The reaction mixture was filtered, and the residue was washed with 1,4-dioxane (50 mL). The combined organic fractions were evaporated and re-dissolved in ethyl acetate (250 mL) and acidified prior to washing with potassium sulfate (KHS0 4 3 x 50 mL), and saturated sodium chloride (1 x 50 mL). The organic portion was then dried over Na 2
SO
4 filtered, and concentrated to give the crude product. The product was purified by column chromatography on silica gel, using a gradient elution from 20% ethyl acetate:80% hexane to 40% ethyl hexane. Combining and evaporating the product bearing fractions gave the desired product 232 (6.32 g).
WO 2006/110185 PCT/US2005/040919 [0814] Example 1-69: Stereoselective synthesis of2S,3S-N-Fmoc-L-3-methyl-glutamic acid alpha allyl ester 239 o\ O OH
OHN-
0 239 [0815] Reaction 1 Ph 0" Ph Ph I O=S=0SO O NH 3 0 N Ph O O 240 241 [0816] Glycine benzyl ester tosylate salt (6.75 g) was partitioned between dichloromethane (100 mL) and aqueous 10% w/v K 2 C0 3 (100 mL). The aqueous portion was extracted with dichloromethane (2 x 50 mL), and the combined organic fractions were dried over MgS04, filtered and evaporated to a glassy solid (3.29 This solid was dissolved in dry dichloromethane (80 mL) and a solution ofbenzophenone iminc (3.62 g) in dichloromethane mL) was added. The resultant mixture was stirred at ambient temperature for 17 hours. The mixture was concentrated to an oil under vacuum, re-dissolved in ether (80 mL), and washed with water (2 x 40 mL). The organic layer was dried over MgSO 4 filtered and evaporated to give the crude product as a clear oil. Purification by recrystallization from warm ether/hexane gave pure 241 (3.82 g).
[0817] Reaction 2 Ph h Ph Ph
N
Ph241 242 Ph 241 242 WO 2006/110185 PCT/US2005/040919 [0818] To a suspension ofbenzyl-N-(diphenylmethylene) glycinate 241 (5.7 g) and O-allyl- N-(9-anthracenylmethyl)cinchonidinium bromide (1.05 g) in dichloromethane (80 mL) cooled to -78 °C under a nitrogen atmosphere, was added cesium hydroxide (14.53 The mixture was stirred for 20 minutes and tert butyl crotonate (9.13 mL) was added dropwise so that the temperature remained at -78 oC. After stirring at -78 °C for 2 hours the mixture was warmed to °C for 30 minutes then the mixture was allowed to warm to ambient temperature over 2 hours. The mixture was then poured into diethyl ether (600 mL) and water (200 mL), partitioned, and the organic layer was washed with water (2 x 170 mL) and saturated sodium chloride (1 x 150 mL). The ether fraction was then dried over MgSO 4 filtered and evaporated to give the product 242 (4.46 which was used subsequently without further purification.
[0819] Reaction 3 Ph Ph O N -Ph HO HN-- L Ph o f o I 242 243 [0820] To a solution of the protected 3-methyl glutamate 64 (4.46 g) in tetrahydrofuran (250 mL) was added a solution of 10% w/v citric acid (120 mL) and the mixture was stirred for 17 hours. The solution was then concentrated under vacuum to remove the tetrahydrofuran and diethyl ether (100 mL) and 1N HC1 (250 mL) were added. After partitioning, the aqueous layer was washed with diethyl ether (2 x 100 mL), basified to pH 14 by the addition of solid K 2
CO
3 and extracted with ethyl acetate (4 x 100 mL). Acetic acid (3 mL), and 10% palladium on carbon (500 mg) were added to the combined ethyl acetate fractions and the resultant suspension was stirred under a hydrogen atmosphere for 16 hours. Methanol (300 mL) was added, and the reaction mixture was filtered through celite. The filtrate was evaporated to an oil, which was dissolved and evaporated first in ethyl acetate (300 mL) and then diethyl ether (300 mL) to give a white gel. This residue was dissolved in tetrahydrofuran (200 mL) and 10% w/v K 2 C0 3 (100 mL), and 9-fluorenylmethoxycarbonyl-N-hydroxysuccinimide (5.83g) was added. The reaction mixture was stirred for 22 hours, and concentrated under vacuum to remove the tetrahydrofuran.
To the concentrated solution, diethyl ether (170 mL) and water (300 mL) were added. After partitioning, the aqueous layer was washed with diethyl ether (3 x 130 mL), acidified to pH 2 WO 2006/110185 PCT/US2005/040919 with concentrated HC1, and extracted with ethyl acetate (3 x 200 mL). The ethyl acetate fractions were then dried over MgSO 4 filtered and evaporated to give the product 243 (3.31 g), which was used subsequently without further purification.
[0821] Reaction 4 0 0 HO HN- I O 0 HN-L- 0 0 0( 0 0 243 244 [0822] To a solution of 2S,3S-N-Fmoc-L-3-methyl-glutamic acid y tert-butyl ester 243 (3.3 g) in dichloromethane (150 mL) was added N,N'diisopropylcarbodiimide polystyrene resin (10.8 g) and 4-dimethylaminopyridine (92 mg), and the reaction mixture was stirred for 5 minutes.
Allyl alcohol (0.612 mL) was added, and the reaction mixture was stirred for a further minutes. -Filtration and evaporation of the solvent gave the desired diester 244 (2.02 g).
[0823] Reaction SHN1 O/ 0HN H N 0 o 244 239 [0824] To a solution of the diester 244 in dichloromethane (42 mL), cooled to 0 OC, was added triisopropylsilane (0.82 mL) and trifluoroacetic acid (4 mL). The reaction mixture was stirred at 0 °C for 10 minutes, warmed to ambient temperature, and stirred for 90 minutes.
Hexane (600 mL) was added and the mixture was evaporated, the residue was dissolved in diethyl ether (150 mL) and 5% w/v K 2 C0 3 (200 mL). The aqueous layer was washed with diethyl ether (2 x 80 mL), acidified to pH 2 with concentrated HC1, and extracted with ethyl WO 2006/110185 PCT/US2005/040919 acetate (3 x 100 mL). The ethyl acetate fractions were then dried over MgSO4, filtered and evaporated to give the product 239 (1.48 g).
[0825] Example 1-70: Preparation of2S-N-Fmoc-L-3-O-(tert-butyldimethysilyl)-asparagine 0 FmocHNHoH
OH
TBSO- 0
NH
2 245 [0826] Reaction 1 CIHN OH CIHN Ot-Bu 0 0
OCH
3
OCH
3 246 247 [0827] To a suspension of the commercially available aspartic acid ester 246 (2.75 g) in perchloric acid (HC10 4 3 mL) was added t-butyl acetic acid ester (100 mL). After 24 h, the solution was poured into saturated K 2 C0 3 (200 mL). The resulting biphasic mixture was extracted with diethyl ether (3 x 100 mL) and the combined organic extract was washed with saturated K 2 C0 3 (3 x 50 mL), dried over Na 2
SO
4 filtered and concentrated under diminished pressure to give a clear colorless oil. The oil was then dissolved in cold (0 diethyl ether mL) and 1 N HC1 in diethyl ether (15 mL) was added. After 20 min the solution was concentrated under diminished pressure to give 247 (2.0 g).
[0828] Reaction 2 CIHN Ot-Bu TrHN Ot-Bu 0 0
OCH
3
OCH
3 247 248 [0829] To a suspension of the diester 247 (4.78 g) in methyl tert-butyl ether (100 mL) was added saturated aqueous K 2 C0 3 (100 mL). The resulting aqueous layer was washed with methyl tert-butyl ether (3 x 100 mL). The organic extract was combined and washed with saturated
K
2 C0 3 (2 x 100 mL), dried over Na 2
SO
4 filtered and concentrated under diminished pressure.
WO 2006/110185 PCT/US2005/040919 The resulting colorless oil was mixed with trityl chloride (5.57 CH 3 CN (100 mL), and triethylamine (5.60 mL). After 16 h, the mixture was filtered and diluted with methyl tert-butyl ether (200 mL). The resulting organic extract was washed with 1N citric acid (3 x 100 mL), saturated NaHCO 3 (3 x 100 mL), saturated NaC1 (3 x 100 mL), dried over Na 2 SO4, filtered, and concentrated under diminished pressure. Chromatography on base washed flash silica gel (20 x 4 cm) using 1:11 ethyl acetate-hexanes with 1% triethylamine present gave product 248 (7.12 g).
[0830] Reaction 3 0 HO 0
OCH
3
OCH
3 248 249 [0831] To a cooled (-78 solution of 248 (2.22 g) in tetrahydrofuran (20 mL) was added 16.5 mL of 0.91 M potassium hexamethyldisilazane solution in tetrahydrofuran. After 1 h at -78 oC, oxodiperoxy(pyridine)(1,3-dimethyl-3,4,5,6-tetrahydro-2( H)-pyrimidinone)molybdenum (IV) (MoOPD, 3.68 g, obtained from STREM Chemicals, Inc; see Anderson, JC. and Smith, SC., 1990, Synlett 107-109 for the synthesis of this reagent) was added in portions. The mixture was stirred for 1 h at -78 allowed to warm up to -55 OC, and stirred for an additional hour.
The mixture was quenched with saturated aqueous Na 2
SO
3 (20 mL) and warmed to room temperature. The resulting biphasic mixture was washed with methyl tert-butyl ether (3 x 100 mL) and the organic layers were combined and washed with 1 N citric acid (3 x 50 mL), saturated aqueous NaHCO 3 (3 x 50), and saturated aqueous NaC1 (3 x 50), dried over Na 2
SO
4 filtered, and concentrated under diminished pressure. Chromatography on flash silica gel (20 x 3 cm) using 1:5 ethyl acetate-hexanes gave product 249 (1.64g).
[0832] Reaction 4 O O HN H TrHN Ot-Bu TrHN Ot-Bu HO HO 0
OCH
3
OH
249 250 [0833] To a solution of 249 (650 mg) in 1:1 dioxane-water (50 mL) was added lithium hydroxide (507 mg). After 1 h the solution was washed with methyl tert-butyl ether (3 x 50 mL) and the resulting aqueous layer was acidified to pH ~4 with IN citric acid. The resulting 369 WO 2006/110185 PCT/US2005/040919 solution was extracted with methyl tert-butyl ether (3 x 100 mL). The organic phase was washed with 1 N citric acid (3 x 100 mL), and saturated NaC1 (3 x 100 mL), dried over Na 2 S04, filtered, and concentrated under diminished pressure to give 250 (630mg).
[0834] Reaction 0
HO
TrH Ot-Bu TrHN Ot-Bu HO/ HO 0 OH NH 2 250 251 [0835] To a solution of 250 (650 mg), benzotriazol-l-yloxy-tris(dimethylamino)phosphonium hexafluorophosphate (997 mg), and NH 4 C1 (153 mg) in dimethylformamide mL) was added diisopropylethylamine (0.78 mL). After lh, ethyl acetate (150 mL) was added and the resulting solution was washed with 10% K 2 C0 3 (3 x 100 mL), water (3 x 100 mL), 1 N citric acid (3 x 100 mL), and saturated NaCI, dried over Na 2
SO
4 filtered, and concentrated under diminished pressure to yield 251 (640 mg).
[0836] Reaction 6 HO O TrHN Ot-Bu
H
2 OH CF 3
COOH
HO 0 HOCOOH
NH
2
NH
2 251 252 [0837] To a solution of 251 (1.91 g) in dichloromethane (5 mL) was added water (1 mL) followed by trifluoroacetic acid (10 mL). After 4 h, the solution was concentrated under diminished pressure and the remaining slurry was concentrated twice from toluene. The resulting solid was triturated with diethyl ether and the resulting solid was filtered and washed with diethyl ether. The resulting solid was dried under diminished pressure to give 252 (952 mg).
WO 2006/110185 PCT/US2005/040919 [0838] Reaction 7
H
0
H
0
H
2 N OH FmocHN OH
CF
3 COOH H
O
HO
HO
NH
2
NH
2 252 253 [0839] To a solution of a solution of 9-Fluorenylmethoxycarbonyl-N-hydroxysuccinimide (3.37 g) in 1-4-dioxane (50 mL). After 16 h, the resulting solution was diluted with aqueous 5
K
2 C0 3 solution (25 mL) and extracted with diethyl ether (3 x 50 mL). The resulting aqueous extract was acidified to pH ~2 with a 1 N HCI solution and diethyl ether (50 mL) was added.
The resulting solid was partitioned between the acidic solution and diethyl ether. The solid was collected and washed with IN HC1 and diethyl ether to yield 253 (1.50 g).
[0840] Reaction 8 FmocHN O FmocHNH OH FmocHN O H
H
HO- 0 TBSO" 0
NH
2
NH
2 253 245 [0841] To a solution of 253 (370 mg) in dimethylformamide (10 mL) was added tertbutyldimethylsilyl chloride (300 mg), followed by imidazole (200 mg). After 8 h, the solution was diluted with ethyl acetate and washed with 1 N HCI (3 x 100 mL) and saturated sodium chloride, dried over Na 2 S04, filtered, and concentrated under diminished pressure.
Chromatography on flash silica gel (25 x 2 cm) using 19:1:0.1 CHzCl 2 :MeOH:AcOH as eluent gave 245 (300 mg).
WO 2006/110185 PCT/US2005/040919 [0842] ester 254 Example 1-71: Preparation of2S-N-Fmoc-L-(3-methox)-13-tert-butvl aspartic acid [0843] Reaction 1
H
O
CIH
3 N OCH 3 O-Bu Ot-Bu TrHN
OCH
3 Ot-Bu 255 256 [0844] To a suspension of commercially available diester 255 (4.78 g) in methyl tert-butyl ether (100 mL) was added saturated aqueous K 2 C0 3 (100 mL). The resulting aqueous layer was washed with methyl tert-butyl ether (3 x 100 mL). The organic extract was combined and washed with saturated K 2 C0 3 (2 x 100 mL), dried over Na 2
SO
4 filtered and concentrated under diminished pressure. The resulting colorless oil was dissolved in a solution oftrityl chloride (5.57 and triethylamine (5.60 mL) in acetonitrile (100 mL). After 16 h, the mixture was filtered and diluted with methyl tert-butyl ether (200 mL). The resulting organic extract was washed with 1N citric acid (3 x 100 mL), saturated NaHCO 3 (3 x 100 mL), and saturated NaC1 (3 x 100 mL), dried over Na 2
SO
4 filtered, and concentrated under diminished pressure.
Chromatography on base washed flash silica gel (20 x 4 cm) using 1:11 ethyl acetate-hexanes with 1% triethylamine present gave 256 (7.12 g).
[0845] Reaction 2
O
TrHN OCH 3 0 Ot-Bu 256 TrHNH OCH 3
HO
Ot-Bu 257 [0846] To a cooled (-78 OC) solution of 256 (2.22 g) in tetrahydrofuran (20 mL) was added 16.5 mL of 0.91 M potassium hexamethyldisilazane solution in tetrahydrofuran. After 1 h at -78 WO 2006/110185 PCT/US2005/040919 oxodiperoxy(pyridine)(1,3-dimethyl-3,4,5,6-tetrahydro-2(1H)-pyrimidinone) molybdenum (IV) (MoOPD, obtained from STREM Chemicals, Inc; 3.68 g, see Anderson, JC. and Smith, SC., 1990, Synlett 107-109 for the synthesis of this reagent) was added in portions. The mixture was stirred for 1 h at -78 allowed to warm up to -55 OC and stirred for an additional hour.
The mixture was quenched with saturated aqueous Na2S03 (20 mL) and warmed to room temperature. The resulting biphasic mixture was washed methyl tert-butyl ether (3 x 100 mL).
The organic layers were combined and washed with 1 N citric acid (3 x 50 mL), saturated aqueous NaHCO 3 (3 x 50), and saturated aqueous NaC1 (3 x 50), dried over Na 2
SO
4 filtered, and concentrated under diminished pressure. Chromatography on flash silica gel (20 x 3 cm) using ethyl acetate-hexanes gave 257 (1.64 g).
[0847] Reaction 3 TrHN OCH 3 _CbzHN CH3 HO 0 HO 0 Ot-Bu Ot-Bu 257 258 [0848] To a solution of 257 (4.61 g) in dichloromethane (100 mL) was added trifluoroacetic acid (2 mL). After 1 h, the resulting solution was concentrated under diminished pressure, and aqueous 5 K 2 C0 3 (50 mL) was added followed by a solution ofbenzyloxycarbonyl-Nhydroxysuccinimide (2.49 g) in dioxane (50 mL). After 16 h, the resulting solution was extracted with ethyl acetate (3 x 100 mL). The organic extract was washed with 1 N citric acid (3 x 50 mL), saturated NaHCO 3 (3 x 50 mL) and NaCI (3 x 50 mL), dried over Na 2
SO
4 filtered and concentrated under diminished pressure. Chromatography on flash silica gel (25 x 3 cm) using 1:3 ethyl acetate-hexanes gave 258 (2.01 g).
[0849] Reaction 4 O O bzHN CbzHN 0 3 HO H 3 0 Ot-Bu Ot-Bu 258 259 [0850] To a cold (0 suspension of 258 (353 mg) and silver oxide (462 mg) in tetrahydrofuran (25 mL) was added iodomethane (0.62 mL). The mixture was allowed to warm WO 2006/110185 PCT/US2005/040919 up to room temperature over 4 h. After 48 h, the suspension was filtered through Celite and concentrated under diminished pressure. Chromatography on flash silica gel (25 x 2 cm) using 1:3 ethyl acetate-hexanes gave 259 (300 mg).
[0851] Reaction H 0 CzN OH CbzHN H OCH 3 CbzHN OH
H
3 CO 0 H 3 CO: 0 Ot-Bu Ot-Bu 259 260 [0852] To a cold (0 solution containing 259 (300 mg, 0.81 rmmol) in 25 mL of dioxane was added 240 mg (10 mmol) of LiOH in 25 mL of water. After 1 h, the mixture was acidified to pH 4 with 1 N citric acid, and extracted with ether (3 x 50 mL). The resulting organic extract was washed with 1 N citric acid (3 x 50 mL), and saturated NaCI (3 x 30 mL) dried over Na 2
SO
4 filtered and concentrated under diminished pressure to give 260 as a clear, colorless oil (280 mg).
[0853] Reaction 6
H
0
H
CbzHNH OH FmocHN OH
H
3 CO
H
3 CO
O
Ot-Bu Ot-Bu 260 254 [08541 Compound 260 is converted to 254 by treatment of an ethyl acetate solution of 260 with 10% palladium on carbon, under a hydrogen atmosphere as previously described for the conversion of 242 to 243 followed by an amine protection as previously described for conversion of 252 to 253.
WO 2006/110185 PCT/US2005/040919 [0855] Example 1-72: Preparation ofNa-(Allvloxvcarbonvl)-L-isoleucine 124 [0856] Reaction 1 0
H
2 N OH 0 N OH 125 124 [0857] Commercially available Isoleucine (22 g) was added to a solution of allyloxycarbonyl oxysuccinimide (AllocOSu, 51 g) in tetrahyrofuran (150 mL). Ten percent K 2 C0 3 aqueous solution (100 mL) was added to this suspension and the mixture was stirred for 17 hours before concentrating to approximately 120 ml under reduced pressure. The solution was added to
K
2 C0 3 aqueous solution (100 mL) and water (200ml) and washed with diethyl ether (4 x 150 mL). The aqueous portion was then acidified to pH 1 and extracted with dichloromethane (4 x 200 mL). Combined acidic dichloromethane washes were dried with anhydrous MgSO 4 and evaporated to crude product (38.1 Purification by column chromatography on silica gel, (eluting with dichloromethane/methanol gradient of 100% dichloromethane to dichloromethane: methanol 9:1) followed by evaporation of the solvent, gave the compound 124 as a yellow oil (36 g).
[0858] Example 2-1: Construction of an S. roseosporus-based in-trans expression system for the production of the novel biosynthetic pathways.
[0859] For the expression of the hybrid non-ribosomal polypeptide synthetase (NRPS) pathways, a version of the S. roseosporus high daptomycin-producing strain (NRRL 11379) that lacked all of the NRPS genes was constructed. The hybrid pathways were conjugated into this strain on BAC-based vectors which integrated site-specifically in a neutral site of the S.
roseosporus genome at a (C31 attB site.
[0860] To delete all the proposed NRPS genes from S. roseosporus a deletion cassette was constructed that contained flanking DNA from upstream of dptEF and downstream of dptH (Figure 2).
[0861] Flanking regions from upstream of dptEF and downstream of dptH were cloned around a selection cassette containing tsr (thiostrepton resistance) and cat (chloramphenicol resistance). The 5' fragment was 1478 bp long and the 3' fragment was 1862 WO 2006/110185 PCT/US2005/040919 bp long. These two fragments were cloned into a copy ofpUC19 (New England Biolabs) that already contained the tsr and cat resistance cassettes to create the deletion cassette. This cassette was then transferred to a delivery plasmid called pRHB538 (Hosted, T.J. and Baltz, 1997, J Bacteriol. 179(1): 180-6), which contains a temperature sensitive origin of replication and a dominant allele ofrpsL (streptomycin sensitive). This plasmid was introduced into a S.
roseosporus strain carrying a recessive rpsL allele that confers streptomycin resistance. This recombinant strain was then incubated overnight in a broth culture before the cells were spread on plates containing streptomycin plus thiostrepton and incubated at 39 oC. Under these conditions only those strains that have exchanged the deletion cassette (containing tsr and cat) for the dptA-H locus via homologous recombination survived the selection; all other genotypes were eliminated.
[0862] PCR and Southern blots confirmed the genotype of the dptA-H deletion mutants. The PCR fragments were designed to be amplified from primers that lay outside the 5' and 3' flanking regions and inside the tsr and cat genes. In this way, the PCR products can only be formed when the cell has exchanged the deletion cassette for the dptA-H locus. The Southern blots provided further confirmation that dptA-H had been deleted and that no aberrant integrations or recombination had occurred around this locus. Once the dptA-H deletions were confirmed genetically they were then tested to see if they were true null mutants phenotypically.
This strain was then designated S. roseosporus UA431.
[0863] Example 2-2: Fermenting Streptomyces roseosporus [0864] Spores of the Streptomyces roseosporus UA431 were harvested by suspending a day old slant culture of medium A irradiated oats (Quaker), 0.7% tryptone (Difco), 0.2% soya peptone (Sigma), 0.5% sodium chloride (BDH), 0.1% trace salts solution, 1.8% agar no. 2 (Lab 0.01 apramycin (Sigma)) in 5 mL 10% aqueous glycerol One mL of this suspension, in a 1.5 mL cryovial, comprises the starting material, which was retrieved from storage at -135 A pre-culture was produced by aseptically placing 0.3 mL of the starting material onto a slant of medium A and incubating for 9 days at 28 °C.
[0865] A seed culture was generated by aseptically treating the pre-culture with 4 mL of a 0.1% Tween 80 (Sigma) solution and gently macerating the slope surface to generate a suspension of vegetative mycelium and spores. A two mL aliquot of this suspension was transferred into a 250 mL baffled flask containing 40 mL of nutrient solution S D-glucose WO 2006/110185 PCT/US2005/040919 (BDH), 1.5% glycerol (BDH), 1.5% soya peptone (Sigma), 0.3% sodium chloride (BDH), malt extract (Oxoid), 0.5% yeast extract (Lab 0.1% Junlon PW100 (Honeywell and Stein Ltd), 0.1% Tween 80 (Sigma), 4.6% MOPS (Sigma) adjusted to pH 7.0 and autoclaved)) and shaken at 240 rpm for 44 hours at 30 °C.
[0866] Production cultures were generated by aseptically transferring 5% of the seed culture to baffled 250 mL flasks containing 50 mL medium P glucose (BDH), 2% soluble starch (Sigma), 0.5% yeast extract (Difco), 0.5% casein (Sigma), 4.6% MOPS (Sigma) adjusted to pH 7 and autoclaved)) and shaken at 240 rpm for up to 7 days at 30 oC.
[0867] Example 2-3: Analysis of the A21978C Lipopeptides from fermentations of the Streptomyces roseosporus [0868] Production cultures described in Example 2-2 were sampled for analysis by aseptically removing 2 mL of the whole culture and centrifuging for 10 minutes prior to analysis.
Volumes up to 50 microlitres of the supernatant were analyzed to monitor for production of the native lipopeptides (A21978C) as produced by Streptomyces roseosporus. This analysis was performed at ambient temperature using a Waters Alliance 2690 HPLC system and a 996 PDA detector with a 4.6 x 50 mm Symmetry C8 3.5pm column and a Phenomenex Security Guard C8 cartridge. The gradient initially holds at 90% water and 10% acetonitrile for 2.5 minutes, followed by a linear gradient over 6 minutes to 100% acetonitrile. The flow rate is 1.5 mL per minute and the gradient is buffered with 0.01% trifluoroacetic acid. By day 2 of the fermentation, production of three of the native lipopeptides, A21978CI, A21978C2 and A21978C 3 with UV/visible spectra identical to that of daptomycin, was evident, as shown by HPLC peaks with retention times of 5.62, 5.77 and 5.90 minutes (?max 223.8, 261.5 and 364.5 nm) under the analytical conditions stated. The lipopeptides then remained evident in the fermentation at each sample point during the 7-day period. Total yields of lipopeptides A21978C 1 A21978C 2 and A21978C 3 ranged from 10-20 mg per liter of fermentation material.
[0869] Liquid chromatography-mass spectrometry (LC-MS) analysis was performed on a Finnigan SSQ710c LC-MS system using electrospray ionization in positive ion mode, with a scan range of 200-2000 daltons and 2 second scans. Chromatographic separation was achieved on a Waters Symmetry C8 column (2.1x 50mm, 3.5pm particle size) eluted with a linear wateracetonitrile gradient containing 0.01% formic acid, increasing from 10% to 100% acetonitrile over a period of six minutes after a initial delay of 0.5 minutes, then remaining at 100% WO 2006/110185 PCT/US2005/040919 acetonitrile for a further 3.5 minutes before re-equilibration. The flow rate was 0.35 mL/minute and the method was run at ambient temperature.
[0870] The identification of the three native lipopeptides was confirmed in the controls (S.
roseosporus wild type), as indicated by molecular ions at m/z of 1634.7, 1648.7 and 1662.7, which is in agreement with the masses reported for the major A21978C lipopeptide factors A21978C 1 A21978C 2 and A21978C 3 respectively, produced by Streptomyces roseosporus (Debono et al., 1987, J. Antibiotics 40: 761-777). The UA431 mutants failed to produce any of the A21978C lipopeptides confirming that they were true null mutants.
[0871] Example 2-4: Constructing pDA300 and complementing the S. roseosporus dptA-H deletions [0872] Unlike yeast and some naturally competent bacteria, linear DNA fragments do not readily transform Escherichia coli. This is in part due to the degradation of foreign DNA by intracellular exonucleases such as RecBCD (Lorenz, and Wackemagel, 1994, Microbiol. Rev. 58: 563). Traditionally, homologous recombination was either achieved by using mutant strains lacking RecBCD (Jasin, and Schimmel, 1984, J. Bacteriol 159: 783) or by delivering DNA with the help plasmid vectors that cannot replicate in the host under restrictive conditions (Link, A.J. et al., 1997, J. Bacteriol. 179: 6228). Recombination events remain rare and require kilobases of homology.
[0873] Recently, several laboratories have developed strains that take advantage of the bacteriophage ,-induced "hyper-recombination" state (Datsenko, and Wanner, 2000, Proc. Nat Acad Sci U.S.A. 97: 6640; United States Patent Numbers 6,355,412 and 6,509,156B; Yu, et al., 2000, Proc. Nat Acad Sci U.S.A. 97: 5978). Recombination between DNA molecules with as little as 40-50 bp of identical sequence takes place even when using linear DNA. The X Red genes (exo, bet and gam) cause the enhancement of the recombination rate.
The exonuclease and the P-protein are responsible for recombination through repair of doublestrand breaks, whereas the gam gene product binds to the host RecBCD complex and inhibits its functions (Murphy, 1998, J. Bacteriol. 180: 2063). We refer to this technique as the "Red" system or Red-mediated recombination system.
[0874] Using the "Red" system a pDA300 (a truncated version of B12:03A05 that contains only the dptA-H genes) was constructed. This plasmid was constructed from B12:03A05 (a BAC plasmid that contains all of the dpt biosynthetic gene cluster, which was isolated from a WO 2006/110185 PCT/US2005/040919 chromosomal library of S. roseosporus (Miao et al, 2005, Microbiology 151: 1507-1523), all of the genes upstream of dptA-H and all of genes downstream of dptA-H were deleted using homologous recombination via the Red-mediated recombination system. This was achieved by introducing B12:03A05 into an E. coli strain carrying the Red genes on a plasmid (pKD78, Datsenko, KA., and Wanner, BL., 2000, Proc. Nat Acad Sci U.S.A. 97: 6640). This strain was then transformed by PCR products for the tet resistance gene that were flanked by oligonucleotides with homology to either the upstream or downstream regions of the dpt cluster.
Once constructed, pDA300 was introduced into UA431 by conjugation to create strain UA493.
Plasmid pDA300 contains oriT from plasmid RK2 (Baltz, 1998, Trends in Microbiol. 6: 76-83 (1998), incorporated herein by reference in its entirety) for conjugation from E. coli to S.
roseosporus. Plasmid pDA300 is introduced into S. roseosporus by conjugation from E. coli S17.1, or a strain containing a self-replicating plasmid RK2 S. roseosporus UA493 was fermented and analyzed using the techniques described in Examples 2-2 and 2-3 respectively.
[0875] The identification of the three native lipopeptides was confirmed, as indicated by molecular ions at m/z of 1634.7, 1648.7 and 1662.7, which is in agreement with the masses reported for the major A21978C lipopeptide factors A21978C 1 A21978C 2 and A21978C 3 respectively, produced by Streptomyces roseosporus (Debono et al., 1987, J.
Antibiotics 40: 761-777). This demonstrated that the pDA300 was able to successfully complement the dptA-H deletion to restore lipopeptide production in UA493.
[0876] Example 2-5: Exchange ofa non-ribosomalpeptide synthetase (NRPS) subunit for one that catalyzes the incorporation ofdifferent amino acid(s).
[0877] The gene that encodes the third subunit of the daptomycin NRPS (see Figure 1) contains two modules that encode the specificity for incorporation of amino acids 12 (3-methylglutamic acid (3-MeGlu)) and 13 (L-kynurenine The gene that encodes the third subunit for the biosynthesis of the cyclic lipopeptide CDA (Kempter et al, 1997, Angew. Chem.
Int. Ed. Engl. 36: 498-501; Chong et al., 1998, Microbiology 144: 193-199; each of which is incorporated by reference herein in its entirety) also encodes the last two amino acids, in this case amino acids 10 (3-MeGlu) and 11 (L-tryptophan (L-Trp); Figure A derivative of daptomycin containing L-Trp instead of L-Kyn in position 13 was generated by deleting gene dptD, and by replacing it with the gene that encodes PS3 for CDA (Hojati et al., 2002, Chem Biol. 9(11):1175-87). The vector pMF23 expressed the PS3 gene from a strong promoter WO 2006/110185 PCT/US2005/040919 the ermEp* promoter; Baltz, 1998, Trends Microbiol. 6: 76-83, incorporated herein by reference in its entirety), and when introduced in to S. roseosporus via interspecies conjugation (Baltz, 1998, Trends Microbiol. 6: 76-83) before site-specifically inserting into a neutral site in the S.
roseosporus genome, allowed cdaPS3 to complement the dptD mutation and resulted in the production of the altered daptomycin with L-Trp replacing L-Kyn to give compound C1, compound C2, and compound C3. The recombinant strain was fermented and the product(s) of the recombinant strain were analyzed by LC-MS as described in Examples 2-2 and 2-3. Similar experiments were performed where the dptD deletion was complemented by the gene that encodes the third subunit for the biosynthesis of the cyclic lipopeptide A54145 (pMF30 is a derivative of pHM 1 a that contains IptD expressed from ermEp* (Motamedi et al., 1995, Gene 160: 25-31) which also encodes the last two amino acids, in this case amino acids 12 (3-MeGlu) and 13(L-isoleucine (L-Ile) or L-valine Two derivatives of daptomycin containing either L-Ile or L-Val instead of L-Kyn in position 13 were generated by disrupting gene dptD, and by replacing it with the gene that encodes IptD for A54145 (compounds C4, C5, C6, C7, C8, C9).
[0878] Similar manipulations are performed for trans-complementation for other subunits, i.e. to generate a disruption or deletion in a subunit of the daptomycin biosynthetic gene cluster or the A54145 biosynthetic gene cluster, and then complement in trans by one or more natural or modified subunits from an NRPS (the latter can include trans-complementation by modified versions of daptomycin or A54145 biosynthetic gene cluster subunits). Trans-complementation between the NRPS subunits then leads to production of a novel nonribosomal peptide which can be analyzed for as described in previous examples.
[0879] To perform a trans-complementation experiment using portions of the daptomycin or A54145 biosynthetic gene cluster and the calcium dependent antibiotic (CDA) biosynthetic gene cluster, the set of daptomycin biosynthetic genes, or the set of daptomycin biosynthetic genes and accessory genes, such as those contained on the BAC clone B12:03A05, are introduced by transformation or conjugation into other natural or engineered strains or species of actinomycetes. The recipients may be known producers of secondary metabolites or uncharacterized strains, or may be generated by recombinant techniques to carry biosynthetic pathways other than that for biosynthesis of daptomycin. The transformants or ex-conjugants are fermented in a variety of media and whole broth or extracts thereof are screened for either novel daptomycin-like compounds or biological activity against daptomycin-resistant tester organisms.
WO 2006/110185 PCT/US2005/040919 [0880] The complementation is often facilitated by inactivation of some of the subunit genes in the daptomycin or A54145 biosynthetic pathway (as is described above for the deletion of dptD and complementation by either cdaPS3 or IptD). Sequences encoding a subunit of the NRPS are deleted or replaced by a marker gene to form a modified NRPS biosynthetic pathway; this can be achieved either in the original producing strain roseosporus for daptomycin, S.
fradiae or S. refuineus for A54145, S. coelicolor for CDA) or plasmids carrying these biosynthetic pathways.
[0881] To produce the novel lipopeptide, homologous recombination across flanking DNA sequences was used to exchange the bulk of the coding region of dptD in pDA300 for a heterologous marker gene. To perform the homologous recombination, two oligonucleotides were designed to amplify the regions directly upstream fragment") and downstream fragment") of dptD. The 5' and 3' fragments were amplified from chromosomal DNA of S.
roseosporus using the following primer sets with 5'-terminal extensions in which unique restriction sites have been introduced (underlined): fragment (1122 bp): GCG AAG CTT CTG GTG GCG CAT CAC CTG G 3' (SEQ ID NO: 1) GCT CTA GAT GGA AGT ATG TCC TCC ATC GC 3' (SEQ ID NO: 2) 3' fragment (1535 bp): CGG ATC CCG CCG GCA CCT GAC CC 3' (SEQ ID NO: 3) CCG AAT TCC GCC TCC GAG TAC ATC GAG G 3' (SEQ ID NO: 4) [0882] The amplified fragments were cloned in succession into the corresponding unique sites in the multiple cloning site of pNEB 193 (New England Biolabs). The resulting construct, pSD002, was confirmed by restriction digest analysis for orientation, and by sequencing for the absence of errors in the portions generated by PCR. A Spelfragment containing the marker gene, ermE (erythromycin resistance gene; see Hopwood, supra) was inserted into pSD002 at an Xbal site and verified by restriction digest analysis. The resulting plasmid, pSD005, thus includes a cassette composed of ermE flanked by DNA stretches homologous to DNA sequences upstream and downstream of dptD. Once inserted into the daptomycin biosynthetic gene cluster pathway by homologous recombination, this cassette would essentially replace all of dptD, except for the first 31 bp and the last 12 bp, with ermE. The region comprising the replacement WO 2006/110185 PCT/US2005/040919 cassette was then subcloned into a vector (a cloning site-modified version ofpRHB538; (Hosted and Baltz, 1997, J. Bacteriol. 179: 180-186) carrying a temperature-sensitive replication origin and rpsL (a gene conferring sensitivity to streptomycin) to create pSD030, the final plasmid in the series for introduction into S. roseosporus.
[0883] The plasmid, pSD030, was introduced into S. roseosporus by interspecies conjugation (Baltz, 1998, Trends Microbiol., 6: 76-83). Each plate was then flooded with 1 mL of water containing 1.25 mg of erythromycin, resulting in a final concentration of 50 gg/ml once the liquid was absorbed into the media. Erythromycin-resistant colonies arising on the transformation plate after 7 days were inoculated into 25 mL ofTSB (Hopwood, supra) plus erythromycin and incubated at 30 oC for 48 hours. The mycelium was harvested, and 1/10th of the mycelial mass was macerated and transferred to a new aliquot of 25 mL TSB plus erythromycin. The resultant solution was then incubated at 40 oC to select against the temperature-sensitive replicon ofpSD030. After 48 hours, the mycelium was harvested by centrifugation, macerated and resuspended in a final volume of 2 mL TSB. This suspension (100 pL) was spread on SPMR plates (Babcock et al., 1988, J. Bacteriol. 170: 2802-2808) containing g/mL erythromycin and 30 gg/mL of streptomycin. Colonies that survived were screened and shown to have the correct genotype by PCR to identify strains such as S. roseosporus UA378, in which ermE had successfully replaced dptD. This mutant was then complemented intrans by initially dptD, where dptD was expressed from the expression plasmid pHMI la (Motamedi H, et al., 1995, Gene 160(1): 25-31) under the control of the constitutive promoter ernzEp*.
[08841 Starting material of UA378 was regenerated by suspending a 10 day old slope culture of medium A (see "Practical Streptomyces Genetics" by Kieser et al., John Innes Foundation, Norwich, 2000, herein "Kieser"; 2% irradiate oats (Quaker), 0.7% tryptone (Difco), 0.2% soya peptone (Sigma), 0.5% sodium chloride (BDH), 0.1% trace salts solution, 1.8% agar no. 2 (Lab 0.01% apramycin (Sigma) in 5 mL 10% aqueous glycerol A 1.5 mL cryovial containing 1 mL of starting material was retrieved from storage at -135 "C and thawed rapidly.
A pre-culture was produced by aseptically placing 0.3 mL of the starting material onto a slope of medium A and incubating for 9 days at 28 Material for inoculation of the seed culture was generated by aseptically treating the preculture with 4 mL of a 0.1% Tween 80 (Sigma) solution and gently macerating the slope surface to generate a suspension of vegetative mycelium and spores.
WO 2006/110185 PCT/US2005/040919 [0885] A seed culture was produced by aseptically placing 1 mL of the inoculation material into a 2 L baffled Erlenmeyer flask containing 250 mL of nutrient solution S (see Kieser, supra) shaken at 240 rpm for 2 days at 30 oC.
[0886] A production culture was generated by aseptically transferring the seed culture to a L fermenter containing 14 liters of nutrient solution P (see Kieser, supra). The production fermenter was stirred at 350 rpm, aerated at 0.5 wm, and temperature controlled at 30 oC. After hours incubation a 50% glucose solution was fed to the culture at 5 g/hr throughout the fermentation.
[0887] After 40 hours incubation, a 50:50 blend ofdecanoic acid:methyl oleate (Sigma and Acros Organics, respectively) was fed to the fermenter at 0.5 g/hr for the remainder of fermentation. The culture was harvested after 112 hours, and the biomass was removed from the culture supematant by batch processing through a bowl centrifuge.
[0888] The biomass from the 20 L fermentation was discarded and the clarified liquor was applied to an open glass column, packed with Mitsubushi HP20 resin (60 x 300 mm) and conditioned with methanol and water. Prior to elution, the column was washed with 2 L of water followed by 2 L of methanol/water The column was then eluted with 2 L of methanol/water followed by 1 L methanol, and collected as two separate fractions.
[0889] Liquid chromatography-mass spectroscopy (LC-MS) electrospray ionization (ESI) analysis indicated that both fractions contained the A21978C/CDA hybrid molecules, and the less complex methanol/water fraction was processed further. This was evaporated under vacuum to an aqueous residue and then made up to 500 mL with water. It was then back extracted with 3 x 500 mL of ethyl acetate in a 2 L separating funnel, to give an aqueous and organic fraction. LC-MS (ESI) indicated that the hybrid molecules were absent from the organic phase and it was discarded. The aqueous fraction was lyophilized overnight.
[0890] The hybrid molecules were purified by preparative high performance liquid chromatography (HPLC) using a Waters Prep LC system and a Waters 40 x 200mm Nova-Pak C18 60A 6pm radially-compressed double cartridge with 40 x 10mm guard. The freeze-dried material was dissolved in water and purified using a gradient method. This method held at water and 10% acetonitrile for 2 minutes and was followed by a linear gradient over 13 minutes to 25% water and 75% acetonitrile. The flow was 55 mL/min and the whole gradient was buffered with 0.04% trifluoroacetic acid. Fractions were collected and analyzed by LC-MS on a Finnigan SSQ710c LC-MS system using electrospray ionisation (ESI) in positive ion mode, with WO 2006/110185 PCT/US2005/040919 a scan range of 200-2000 daltons and 2 second scans. Chromatographic separation for this LC-MS analysis was achieved on a Waters Symmetry C8 column (4.6x 50mm, 3.5pm particle size) eluted with a linear water-acetonitrile gradient containing 0.01% formic acid, increasing from 10% to 100% acetonitrile over a period of six minutes after an initial delay of 0.5 minutes, then remaining at 100% acetonitrile for a further 3.5 minutes before re-equilibration. The flow rate was 1.5 mL/minute and the method was run at ambient temperature.
[0891] The analysis identified compound C1 and compound C2. Both fractions required further purification prior to NMR studies. Compound C1 was further purified using an isocratic method with 60% water and 40% acetonitrile buffered with 0.04% trifluoroacetic acid.
Approximately 1.8 mg of material was isolated. Final purification of compound C2 used an isocratic method with 58% water and 42% acetonitrile buffered with 0.04% trifluoroacetic acid.
Approximately 1.5 mg of material was isolated. The UV maxima and ESI-MS molecular ion information (doubly-charged ions observed in negative ion mode) for compound Cl and compound C2 are presented below: Compound C1 Compound C2 ESI -MS 814 (M-2H) 2 821 (M-2H) 2 UV-vis ?max /nm 221,280, 221,280 108921 Example 2-6: Module exchanges constructed at positions 8 and 11 in dptBC [0893] A plasmid carrying dptBC pKN24 was constructed by truncation of B12:03A05 that carries daptomycin biosynthetic (dpt) gene cluster. The Red-mediated recombination system was employed to introduce linear PCR products of antibiotic resistance genes flanked by 45 bp sequences with homology to either upstream or downstream regions of the interested dpt genes (as described in Example The upstream region of dptBC (pKN24-26) or dptD (pKN27) was deleted by the spec-ermEp* cassette that contains a spectinomycin resistant gene (spec) and strong, constitutively expressed ermEp*. This fragment was amplified using the primers Sp6Del-1-2 and dptBC-ermEp. The downstream region of dptBC (pKN24) was deleted by a beta-lactamase gene (amp, from pBR322). this fragment was amplified using primers GTC del2 and DptD-3'::amp.
[0894] The selection cassette for the deletion of the CAT module was amplified with PCR primers that carry 50 bp of homology to the linker region of the module under investigation (see WO 2006/110185 PCT/US2005/040919 Figure 5 for positions of linkers; International Patent Application Number WO 01/30985). When these PCR fragments were introduced into electro-competent cells that contained pKN24 (a truncated version ofpDA300 that contains only dptBC, which is expressed from the constitutive promoter ermEp*, Bibb, MJ. et al., 1985, Gene 38(1-3): 215-26) and induced Red-system, the resistance cassette was integrated site specifically at the target site in pDA300 by homologous recombination (Figure 3).
deletion, 3' deletion Sp6Del-l-2 CTGGAGCTGCTTC-3', (SEQ ID NO: GTC del2 TCCTCCTTA-3' (SEQ ID NO: 6) dptBC-ermEp
TCC
GCCTCCTTTGGTCAC-3', (SEQ ID NO: 7) DptD-3'::amp GAGCTGCTTC-3' (SEQ ID NO: 8) [0895] These cells were then selected for the presence of the tet resistance marker, and the resulting colonies were analyzed genetically to validate the construction of the appropriate deletion or disruption. Part of the primer design involves placing a restriction site within the linker region of interest (Figure Once the deletion BAC was verified, the selection cassette was excised using the unique restriction sites incorporated into the linker regions (Figure 3 AvrII and Pmel).
[0896] The replacement modules (Serine; Alanine) were subcloned into pBR322 (Yanisch- Perron et al., 1985, Gene 33(1): 103-19; flanked by appropriate sites) again using the Redmediated recombination. This technique is referred to as gap-filling, where the primers include the 50 bp overlap with the regions inside the linkers of the desired module (Lee, EC. et al., 2001, Genomics 73: 56). The primers were used to amplify a part ofpBR322, including the origin of replication and ampr to generate a linear fragment flanked by the regions ofhomology inside the WO 2006/110185 PCT/US2005/040919 desired module (Serine; Alanine). These PCR fragments were introduced into DH10B electrocompetent E. coli cells containing pKN24 (see above) and pKD78 (Datsenko, KA., and Wanner, BL., 2000, Proc. Nat Acad Sci U.S.A. 97: 6640). Once recombination has occurred through both regions of homology the module will have been transferred from the original vector to pBR322, converting the linear PCR fragment into a circular version that can replicate and be selected for (Figure It is preferred if the original vector that the module is cloned from has an F-plasmid origin of replication (as opposed to an origin of replication with a higher copy number).
[0897] The cloned modules are excised from pBR322 and ligated into the deleted versions of pKN24 using the compatible restriction sites introduced around the deletion. This produced 2 plasmids: 1) pDR2155 where the D-serine-11 of daptomycin had been replaced by D-alanine by module exchanges and 2) pDR2160 where D-alanine-8 of daptomycin had been replaced by Dserine. Both pDR2155 and pDR2160 were confirmed via PCR and sequencing.
[0898] A suitable expression host was then constructed in S. roseosporus for these plasmids.
A dptB-D mutant KN100 which contains a chromosomal deletion that removes dptBC, D was constructed using the techniques described in Example 2-1. Both pKN24 and pRB04 (a plasmid constructed in the vector pHM1 la which expresses the dptD subunit under the control of ermE* constitutive promoter) were added by interspecies conjugation to KN100 strains to create KN101. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce the native lipopeptides A21978C 1 A21978C 2 andA21978C 3 Once the S. roseosporus KN100 strain had been validated, then a second derivative was created, KN156 (KN100 carrying pRB04). This strain was then used as the host for all module exchanges performed in dptBC. PB103 was constructed by adding pDR2155 to KN156. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C46, C47 and C48 Figure 4).
[0899] Strain PB118 was constructed by adding pDR2160 to KN156. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C22, C23 and C24 (Figure 4).
[0900] The recombinant strain described above, were fermented and analyzed under the conditions described in Example 2-2 and then analyzed using the techniques described in Example 2-3 (The data is summarized in Table VI).
[0901] Derivatives having Asn at the position 8 or 11 were prepared by module exchange using fusion sites TC and TE (CAT). The Red-mediated recombination system was used to WO 2006/110185 PCT/US2005/040919 replace module 8 or 11 on pKN24 by gentamycin resistance gene (ahp2) (Chow JW, Kak V, You I, Kao SJ, Petrin J, Clewell DB, Lerer SA, Miller GH, Shaw KJ. 2001, Antimicrob. Agents Chemother. 45, 2691-2694) flanked by engineered AvrII and PmeI restriction sites. Since the DNA sequences of the module 8 and 11 are highly homologous, the same primer pair was used for deletion of the two modules at the linkers B and CAT.
[0902] A DNA fragment coding for an Asn module (B-CAT), the 11 th module from A54145 NRPS was cloned by the gap-repair method. Gap-repair primers were used for PCR amplification of a portion of pBR322 including amp resistance gene and origin of replication to generate a linear fragment flanked by incorporated NheI and Hpal restriction sites and 45 bp with homology inside the desired module fragments. The linear PCR fragment was transformed into electro-competent E. coli carrying SF1:10D08 (a BAC clone of >100 kb DNA encoding parts of the A54145 biosynthetic gene cluster.(This clone was derived from a genomic BACbased library of S. fradiae that was constructed using the protocols described in Miao et al., 2005, Microbiology 151: 1507-1523. Clone BAC-P13 was isolated from the library using the protocols in Miao et al., 2005, Microbiology 151: 1507-1523) and tetR- pKD119 (Datsenko, KA., and Wanner, BL., 2000, Proc. Nat Acad Sci U.S.A. 97: 6640) coding for the Red recombination system.) Once the Red-induced recombination occurs at both homologous regions; the Asn module was transferred from BAC-P13 to the linear pBR322 to generate a circular and replicated plasmid. Module fragments with correct sequences (as verified by sequencing) were excised by NheI and HpaI digestion and used for ligation with appropriate deleted pKN24 versions to generate hybrid plasmids.
[0903] Primers for deletion of module 8 pKN24-Mod8::Gen. B-CAT 8B
TTGTTCGAGGCGCCGACGGTGAGCCGTTTGGAGCGGTTGCTGCGGGAGCGCCTAGG
ACGTTGACACCATCGAATGG. (SEQ ID NO: 9) 8 CAT-Pnme
ACAATCTCAGCACCCCCCACCACACCAACCGCCCCAGCGTCCGAACCACGTTTAAAC
CCTCATTCATCGGGCGAAAG (SEQ ID NO: [0904] Primers for deletion of module 11 WO 2006/110185 WO 206/10185PCT/US2005010919 pKN24-Modll :Gen. B-CAT 8-B
TTGTTCGAGGCGCCGACGGTGAGCCGTTTGGAGCGGTTGCTGCGGGAGCGCCTAGG
ACGTTGACACCATCGAATGG (SEQ ID NO: 11) 8_CAT-Pine
ACAATCTCAGCACCCCCCACCACACCAACCGCCCCAGCGTCCGAACCACGTTTAAAC
CCTCATTCATCGGGCGAAAG (SEQ ID NO: 12) [0905] 'Primers for gap-repair of IptAsnll.
Lpt-N11-B-P13
TCGGGGCGCGGGTCGGCGGGGCGCAGCCGGGGTCCGGCCTCGCCC
GCTAG3CTTCTTAGACGTCAGGTGGCAC (SEQ ID NO: 13) Lpt-NI1-CAT-P14
CGCGACATCTTCGAACAGCGCACGCCCGCCGCCCTCGCCGGCCGC
GTTAACCGATACGCGAGCGAACGTGA (SEQ ID NO: 14) [09061 Plasmids were screened by PCR and restriction digests, plasmids with the correct genotype were then designated as pKN45 (D-Asn module inserted at position 8) and pKN47 (D- Asn module inserted at position 11). These two plasmids were then conjugated into the expression host KNI 56 (AdptBCD pRBO4). Exconjugants were selected on ASI plates containing apramycin (50 jig/mL) and recombinant strains selected from these plates were then fermented and analyzed using the protocols described in Example 2-2 and 2-3. Novel lipopeptides Cl 89, C190 and C191 with molecular weights consistent with the insertion of Asn at position 8 in A21978C 1 2 3 were detected by LC-MS from the feinnentation broth of KN3 92 (see table VI). Novel lipopeptides C233, C234 and C235 with molecular weights consistent with the insertion of Asn at position 11 in A21978C, 2 3 were detected by LC-MS from the fermentation broth of KN404 (see table VI).
WO 2006/110185 PCT/US2005/040919 Table VI Data from module exchanges at position 8, 11 Dpt Replacement amino 5' 3' amino Results acid (source pathway) linker linker acid Lipopeptide with molecular mass of 1650 (compound D-Ala-8 D-Ser (dpt) T-C T-E C22), 1664 (compound C23) and 1678 (compound C24) detected.
Lipopeptide with molecular mass of 1677.72 (compound D-Asn-8 D-Ser (dpt) T-C# T-E# C189), 1691.75 (compound C190) and 1705.78 (compound C191) detected.
Lipopeptide with molecular mass of 1618 (compound D-Ser-ll Ala (dpt) T-C# T-E# C46), 1632 (compound C47) and 1646 (compound C48) detected.
Lipopeptide with molecular mass of 1661.72 (compound D-Asn-11 Ala(dpt) T-C# T-E# C243), 1675.75 (compound C244) and 1689.78 (compound C245) detected.
See Figure 5 for positions of T-C and T-E) [0907] Once the presence of the expected mass ions was confirmed PB103, PB1 18, KN392 and KN404 were fermented at large scale and compounds C22, C46, C189, C233 were purified using the techniques described in Example WO 2006/110185 PCT/US2005/040919 Example 2-7: Module exchanges at position 13 in dptD [0908] Module exchanges were constructed at position 13 in the dpt cluster to replace kynurenine. These constructs were made in the subunit expression plasmid pRB04 (a plasmid constructed in the vector pHM11 a which expresses the dptD subunit under the control of ermE* constitutive promoter described in Example A unique AvrII site was introduced inside the T-C linker. A second unique Pmel was introduced just downstream of the coding region of dptD. This allowed the terminal module for Kyn to be removed from dptD along with the thioesterase. Two replacement modules containing the domain arrangement CATTe were prepared as fragments flanked byAvrII and Pmel sites. The isoleucine and tryptophan modules were responsible for the incorporation of the terminal amino acids in the A54145 (Ile) and CDA (Trp) pathways. After cloning the replacement modules into the deleted pRB04 the hybrid constructs were introduced into a dptD deleted S. roseosporus, and fermentation and analysis were completed using the techniques described in Example 2-1. This data is summarized in Table VII.
Table VII Data from module exchanges at position 13 Replacement Dpt amino acid 5' 3' amino Results (source linker linker acid# pathway) Lipopeptide with molecular mass S3' of of 1630 (compound C1), 1644 Trp (CDA) Kyn-13 T-C dptD (compound C2) and 1658 (compound C3) detected.
Lipopeptide with molecular mass 3' of of 1557 (compound C4), 1571 Ile (A54145) Kyn-13 T-C dptD (compound C5) and 1585 (compound C6) detected.
#Linkers are defined in Figure WO 2006/110185 PCT/US2005/040919 [0909] Example 2-8: Deleting the dptl gene from Daptomycin NRPS Gene Cluster results in the production of lipopeptides with glutamate at position 12 [0910] Sequence comparisons between the dpt, Iptl and ginT genes suggested that dptI may play a role in the methylation of the glutamate in position 12 (the glmT gene product is believed to methylate the glutamate in a similar position in the related lipopeptide CDA; the lptI gene product is believed to methylate glutamate in the synthesis ofA54145). To test this theory a deletion was created in the dptl gene in S. roseosporus UA431 containing pDA300. A deletion plasmid was constructed that contained 2xlkb fragments that flanked dptlupstream and downstream. These fragments were ligated in such a way that they would create an in-frame deletion of dpt. This cassette was cloned into pRHB538 (see Example 2-1) and introduced in S.
roseosporus UA431/pDA300. Under the appropriate selection conditions (see Example 2-1) the deletion cassette was exchanged for the dptl gene on the chromosome, thus constructing an inframe deletion of dptl. The genotype of this mutant was confirmed by PCR and Southern blots.
This mutant was fermented and analyzed using the techniques described in Example 2-1. The results of this analysis were that these strains were only able to produce lipopeptides with masses of 1620, 1634 and 1648, which corresponded to the predicted masses for lipopeptides that contain glutamate at position 12 instead of 3-methyl-glutamate: compound C10, compound C11 and compound C12 respectively. From this data it was concluded that dptl plays a role in the methylation of glutamate during the synthesis of daptomycin.
[0911] Example 2-9: Construction of a combinatorial library of novel lipopeptides from recombinant Streptomyces roseosporus [0912] Successful module exchanges produced from Example 2-5 were further enhanced by combining pDR2155 and pDR2160 with subunits exchanges for dptD that could include lptD (the terminal subunit from the S. fradiae A54145 biosynthetic pathway that encodes for 3MeGlu and Ile/Val cloned in an expression plasmid, supra) and cdaPS3 (the terminal subunit from the S.
coelicolor calcium dependent antibiotic, CDA, biosynthetic pathway that encodes for 3MeGlu and Trp cloned in an expression plasmid, supra). These combinations were further enhanced by being expressed in hosts that contain a dpti (a putative methyl-transferase involved in the methylation of glutamate at position 12 ofdaptomycin) deletion which will lead to the inclusion of glutamate at position 12 instead of 3-methyl-glutamate.
One or more of the methods described above: WO 2006/110185 PCT/US2005/040919 1. module exchanges to effect alterations at positions 8 and 11, 2. dptI deletion to effect alterations at position 12, and 3. subunit complementation to effect alterations at position 13 were combined to construct combinatorial libraries that contained 48 novel lipopeptides.
[0913] In addition to the construction of KN100 described in Example 2-5 a second S.
roseosporus mutant was constructed, designated KN125 (using the techniques described in Example 2-1) that contained a chromosomal deletion that removes dptBC, D, G, H, I, J. After KN125 was confirmed as a null mutant it was used to construct KN159 by adding pKN24 and pRB04 to KN125. When fermented and analyzed under the conditions described in Examples 2- 2 and 2-3, this strain was shown to produce compounds C10, C11 and C12 which all lack the methyl group on glutamate 12 seen in A21978C.
[0914] Strain KN107 was constructed by adding pKN24 and pMF23 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C1, C2 and C3.
[0915] Strain KN110 was constructed by adding pKN24 and pMF30 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C4, C5, C6, C7, C8, and C9.
[0916] Strain KN160 was constructed by adding pKN24 and pMF23 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C13, C14 and [0917] Strain KN161 was constructed by adding pKN24 and pMF30 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C16, C17, C18, C19, C20, and C21.
[0918] The combinatorial approach described above, was then enhanced by the addition of the modified dptBC constructs in pDR2155 and pDR2160. Strain PB105 was constructed by adding pDR2155 and pMF23 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds G49, C50 and C51.
[0919] Strain PB108 was constructed by adding pDR2155 and pMF30 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C52, C53, C54, C55, C56, and C57.
WO 2006/110185 PCT/US2005/040919 [0920] Strain PB110 was constructed by adding pDR2155 and pRB04 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C58, C59 and [0921] Strain PB113 was constructed by adding pDR2155 and pMF23 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C61, C62 and C63.
[0922] Strain PB116 was constructed by adding pDR2155 and pMF30 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C64, C65, C66, C67, C68, and C69.
[0923] Strain PB120 was constructed by adding pDR2160 and pMF23 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C25, C26 and C27.
[0924] Strain PB123 was constructed by adding pDR2160 and pMF30 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C28, C29, C30, C31, C32, and C33.
[0925] Strain PB128 was constructed by adding pDR2160 and pRB04 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C34, C35 and C36.
[0926] Strain PB130 was constructed by adding pDR2160 and pMF23 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C37, C38 and C39.
[0927] Strain PB131 was constructed by adding pDR2160 and pMF30 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C40, C41, C42, C43, C44, and [0928] Strain KN393 was constructed by adding pKN45 and pMF23 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C198, C199 and C200.
[0929] Strain KN394 was constructed by adding pKN45 and pMF30 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C201, C202, C203, C210, C211, and C212.
WO 2006/110185 PCT/US2005/040919 [0930] Strain KN395 was constructed by adding pKN45 and pRB04 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C192 C193 and C194.
[0931] Strain KN396 was constructed by adding pKN45 and pMF23 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C195, C196 and C197.
[0932] Strain KN397 was constructed by adding pKN45 and pMF30 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C204, C205, C206, C207, C208, and C209.
[0933] Strain KN405 was constructed by adding pKN47 and pMF23 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C224, C225 and C226.
[0934] Strain KN406 was constructed by adding pKN47 and pMF30 to KN100. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C221, C222, C223, C213, C214, and C215.
[0935] Strain KN407 was constructed by adding pKN47 and pRB04 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C230, C231 and C232.
[0936] Strain KN408 was constructed by adding pKN47 and pMF23 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C227, C228 and C229.
[0937] Strain KN409 was constructed by adding pKN47 and pMF30 to KN125. When fermented and analyzed under the conditions described in Examples 2-2 and 2-3, this strain was shown to produce compounds C72, C219, C220, C216, C217, and C218 [0938] Example 2-10 Module exchanges constructed atpositions 2 through 4 in daptomycin [0939] Multiple module exchanges were performed in either dptA, dptBC or a combination of dptA and BC in order to complete these exchanges a new expression plasmid was needed as pKN24 only contained dptBC. The new vector, pKN18, was a truncated product ofB12:03A05 (a BAC clone that contains entire daptomycin biosynthetic pathway, see Example 2-1) that was able to express both dptA and dptBC. Plasmid pKN18 was constructed by truncating WO 2006/110185 PCT/US2005/040919 B12:03A05using the Red-mediated recombination (see Example 2-5) system through two sequential deletions of B12: 03A05. The two deletions deleted all of genes upstream of dptR and all of the genes downstream of dptBC (pKN18 carries the locus dptR-drrAB-dptEFABC).
Firstly, the upstream region of the locus (insert coordinate 0.552 kb- 45,576 kb on B12:03A05, see table VI for primers) was deleted by spectinomycin resistance gene. The region downstream of dptBC (insert coordinate 91,093 kb -127,392 kb, see table V for primers) was deleted by amp gene.
[0940] In order to combine module exchanges in dptA,BC with subunit swaps for dptD (see Example 2-6) and peptide tailoring methyl transferase dpti (see Example 2-8) it was necessary to construct a new expression plasmid that could express the dptlJ genes in the dpt deletion host UA431 (see Example 2-1) with the modified pKN18 plasmids. In order to express a glutamate methyltransferase in UA431 (AdptE-J), pKN54, a plasmid that carries strong promoter permEp* and functions for integration on chromosome from phi-BT1 phage was constructed based on kanRpRT802 (Gregory, Till, Smith, M.C.;.2003. J Bacteriol.185: 5320-5323.). The 1.8 kb BglII/SmaI fragment from pHMl la which carries ermEp* and a transcriptional terminator (.Integrative vectors for heterologous gene expression in Streptomyces spp. Motamedi, H; Shafiee, A; Cai, SJ; 1995, Gene.,160: 25-31) was cloned at BamHI/EcoRV sites ofpRT802 (Gregory, Till, Smith, M.C.;.2003. J Bacteriol. 185: 5320-5323), which encodes for phi-BT1 integration system. The plasmid was multiplied in selective medium with kanamycin pg/mL).
[0941] A DNA fragment coding for both dptl and dptJwas PCR amplified using B12:03A05 as the template. Two primers (with engineered restriction sites underlined) dptJ-C-HindIII: GGCGGAAGCTTACGGCACGGCAAGGCCGTTTC-3' (SEQ ID NO: 15) and dptI-N-NdeI: 5'-GGCGGCATATGACCGTGCACGACTACCAC-3' (SEQ ID NO: 16) were used for the PCR amplification. The PCR fragment was cloned on pKN54 at NdeI and HindIII sites to generate [0942] Finally, a series of expression hosts were created that would be used for the multimodular exchanges described in this Example. KN576 was constructed by introducing pRB04 (expresses dptD from minicircle integration sites, see Example 2-6) into UA431 (AdptE-J).
KN580 was constructed by introducing pRB04 (see Example 2-6) and pKN55 (dptlJ expressed from phi-BT1 integration sites) into UA431 (AdptE-J). KN577 was constructed by introducing (expresses IptD from minicircle integration sites, see Example 2-6) into UA431 (AdptE- WO 2006/110185 PCT/US2005/040919 KN587 was constructed by introducing pMF30 (see Example 2-6) and pKN55 into UA431 (AdptE-J).
Sp6 del3 GCTGCTTC (SEQ ID NO: 17) Sp6 del4 ATCCTCCTTA-3' (SEQ ID NO: 18) DptD-3'::amp GAGCTGCTTC-3' (SEQ ID NO: 19) GTC del2 TCCTCCTTA-3' (SEQ ID NO: [0943] Multi module exchanges were completed on pKN18 using the Red-mediated recombination system to change several amino acid residues on the daptomycin core simultaneously. First, the genR (Wohlleben, W. et al., 1989, Mol. Gen. Genet. 217: 202-208) gene was introduced into pKN18 to replace the DNA fragment coding for modules 2-3-4 between the linker regions B and CAT (exchanges The genR gene was then removed by AvrII/PmeI digest.
[0944] DNA fragments coding for modules 2-4, from the A54145 pathway were cloned onto pBR322 by the gap-repair method as described for single module exchange in Example This fragment was excised by NheI and Hpal digests and ligated to the deleted pKN18 to generate pKN51 (carries D-Glu at position 2 and Asn at position 3 in daptomycin). This plasmid, pKN51, was introduced into expression hosts: KN576 to produce KN630, KN580 to produce KN631, KN577 to produce KN632 and KN587 to produce KN633 via recombination.
These recombinant strains were fermented and analyzed using the techniques described in Example 2-2 and 2-3. The fermentation broth of KN633 was the only strain to contain mass ions WO 2006/110185 WO 206/10185PCT/US2005010919 consistent with the production of C259, C260, C261, C262, C263 and C264. LC/MS analysis of the fermentation broths from the other strains KN630, KN63 1 and KN632 did not reveal the presence of any novel lipopeptides.
[09451 Primers for deletion of dpt2-4.
dpt-Asn2-Del-B: GTTCGCC7FTCCCCACCGTCGCCGGCCTTCTCCCOjCTCCTGGCACGACA
A
CCTAGGTGTGTAGGCTGGAGCTGCTTCG (SEQ ID NO: 21) dpt-Thr4-Del-CAT:
TCAGGGCGCCGGTCGATCCTGGTCACAGGTGGCAGGGCGGTGCCGG
GTITAAACCATATGAATATCCTCCTTA (SEQ ID NO: 22) 109461 Primers for gap repair cloning lpt2-4 LptGlu2-Pickup-B: TCC GGG CGG GGC CGG ACG GGA CGG ACG TGG TCG TCC GGC ACG CC GCTAGCTTCTTAGiACGTCAGGTGGCAC 3' (SEQ ID NO: 23) lpt-Thr4-pickup-CAT: TTC GAG GCG CCC ACG CCC GCC GCG CTG TCC CGG CGC CTC GACACC GTTAAC CGATACGCGAGCGAACGTGA 3' (SEQ ID NO: 24) 109471 Example 2-11 Module exchanges cons tructed at positions 8 through 11 in daptomycin 1094 81 A daptomycin derivative containing 2 changes at positions 8 and I11 was generated using the Red-mediated recombination system as described in Example 2-5. Briefly, a DNA fragment coding for 4 modules (D-Ala-Asp9-Glyl 0-D-Serl 1) was deleted from pKN2I by a gentamycin resistance gene franked by AvrII and PmeI restriction sites. The genR gene was then removed by AvrIlfPmeI digest.
[09491 The corresponding DNA fragment coding for module 8-9-10-11 (D-Lys-Asp-Gly-D- Asn) from A54 145 BAG-P 13 that was subeloned on pBR322 by the gap-repair method (Example WO 2006/110185 PCT/US2005/040919 was used for ligation with the deleted pKN24 to generate pKN50. pKN50 was introduced into KN156 (see Example 2-9, S. roseosporus AdptBC,D pRBO4 [a plasmid constructed in the vector pHM 11 a which expresses the dptD subunit under the control of ermE* constitutive promote, see Example to create KN410. KN410 was fermented and analyzed using the protocols described in Examples 2-2 and 2-3. Analysis of the LC/MS data showed the presence of mass ions that were consistent with the insertion of lysine at position 8 and asparagines at position 11 ofA21978C 12 3 These compounds were designated C236, C237, C238.
[0950] Primers for deletion of module 8-11 8B
TTGTTCGAGGCGCCGACGGTGAGCCGTTTGGAGCGGTTGCTGCGGGAGCGCCTAGG
ACGTTGACACCATCGAATGG (SEQ ID NO: 1 iSUE (deletion ended at the 3' terminus of dptBC)
CAGCTCGCTGATGATATGCTGACGCTCAATGCCGTTTGGCCTCCGACTAAGTTTAAA
CCCTCATTCATCGGGCGAAAG(SEQ ID NO: 26) [0951] Primers for gap repair of module 8-11 lptK8-B-P 13
GTCCTCCGACCGCGACATCCGTCGCAACGCGGGGCGGGTGTCAGGGCGG
GCTAGCTTCTTAGACGTCAGGTGGCAC (SEQ ID NO: 27) Ipt-NI1-SUE-P14 (clonedfragment extended to the 3' terminus of IptBC)
CACCGAACTCGACCAGCTCGAAGCAGAGTGGAAGGCCGGCTGATG
GTTAACCGATACGCGAGCGAACGTGA (SEQ ID NO: 28) [0952] Example 2-12: Construction of an S. fradiae-based in-trans expression system for the production ofnovel lipopeptides.
[0953] For the expression of the hybrid non-ribosomal polypeptide synthetase (NRPS) pathways, a version of the S. fradiae high A54145 factor-producing strain that lacked all of the NRPS and potential amino acid modification genes was constructed. Engineered modified pathways were conjugated into this strain on BAC-based vectors which integrated sitespecifically in a neutral site of the S. fradiae genome at a C31 attB site.
WO 2006/110185 PCT/US2005/040919 [0954] To delete all the proposed NRPS genes from S. fradiae a deletion cassette was constructed that contained flanking DNA from upstream of lptEF and downstream of lptI.
[0955] Flanking regions from upstream of lptEF and downstream of lptl were cloned around a selection cassette containing tsr and cat. The 5' fragment was 3665 bp long and the 3' fragment was 2004 bp long. These two fragments were cloned together with the tsr and cat resistance cassettes into a copy of the delivery plasmid called pRHB538 (Hosted, TJ. and Baltz, RH., 1997, J Bacteriol. 179(1): 180-6), which contains a temperature sensitive origin of replication and a dominant allele ofrpsL (streptomycin sensitive). This plasmid was introduced into a S. fiadiae strain carrying a recessive rpsL allele that confers streptomycin resistance. This recombinant strain was then incubated overnight in a broth culture at 39 oC before the cells were spread on plates containing streptomycin plus thiostrepton and incubated at 39 Under these conditions only those strains that have exchanged the deletion cassette (containing tsr and cat) for the lptE-Ilocus via homologous recombination survived the selection; all other genotypes were eliminated. This strain was then designated S. fradiae DA1187.
10956] Example 2-13: Fermenting S. fradiae strains [0957] Mycelial glycerol stocks of the S. fradiae DA 187 stored at -80 °C were plated onto agar plates of medium R [10.3% sucrose (Sigma), 0.025% potassium sulfate (Sigma), 1.01% magnesium chloride hexahydrate (Sigma), 1% glucose (Sigma), 0.01% casamino acids (Difco), yeast extract (Difco), 0.57% TES buffer (Sigma), 2.2% agar (MBI), 0.005% potassium phosphate (Sigma), 0.29% calcium chloride dihydrate (Sigma) and 0.07% sodium hydroxide (Sigma)] (see Kieser) and grown for 3-5 days at 30 °C.
[0958] A starter culture was generated by gently macerating material from the agar plate surface to generate a suspension of vegetative mycelium and spores which was added to 8 ml of C medium 3% trypticase soy broth (Difco), 0.3% yeast extract (Difco), 0.2% magnesium sulfate (Sigma), 0.5% glucose and 0.4% maltose (Sigma), Hosted, TJ., and Baltz, RH., 1996, Microbiology 142: 2803-2813] in a 50 ml culture tube with appropriate antibiotics. Starter cultures were shaken at 240 rpm for 24 to 36 hours at 30 oC.
[0959] A one mL aliquot of this culture was transferred into a 125 mL baffled flask containing 25 mL of nutrient solution S D-glucose (BDH), 1.5% glycerol (BDH), 1.5% soya peptone (Sigma), 0.3% sodium chloride (BDH), 0.5% malt extract (Oxoid), 0.5% yeast extract WO 2006/110185 PCT/US2005/040919 (Lab 0.1% Junlon PW100 (Honeywell and Stein Ltd), 0.1% Tween 80 (Sigma), 4.6% MOPS (Sigma) adjusted to pH 7.0 and autoclaved)) and shaken at 200 rpm for 24 to 36 hours at 30 °C.
[0960] Production cultures were generated by aseptically transferring 5% of the seed culture to baffled 250 mL flasks containing 50 mL medium D glucose (Sigma), 2.5% soybean flour (Arkady), 0.5% blackstrap molasses (DSM Bakeries), 0.06% ferric ammonium sulfate (Sigma), 0.79% L-isoleucine (Sigma) and 6% calcium carbonate (Sigma) adjusted to pH 7 and autoclaved, (Boeck et al., 1990, J. Antibiotics 43: 607-615.) and shaken at 200 rpm for up to 7 days at 30 oC.
The addition of L-isoleucine to medium D had been shown to increase the proportion of factors with isoleucine at position 13 (Ilel3) and decrease the proportion of factors with valine at position 13 (Vall3) (Boeck et al., 1990, J. Antibiotics 43: 607-615.). On occasion, fermentations were done in medium D without isoleucine and these fermentation broths had a mix of both Ilel 3 and Val 3 factors.
[0961] Example 2-14: Analysis of the A54145 Lipopeptides fiom fermentations of the Streptomycesfradiae [0962] Production cultures described in Example 2-2 were sampled for analysis by aseptically removing 2 mL of the whole culture and centrifuging for 10 minutes prior to analysis.
Volumes up to 50 microlitres of the supernatant were analyzed to monitor for production of the native lipopeptides (A21978C) as produced by Streptomyces roseosporus. This analysis was performed at ambient temperature using a Waters Alliance 2690 HPLC system and a 996 PDA detector with a 4.6 x 50 mm Symmetry C8 3.5trm column and a Phenomenex Security Guard C8 cartridge. The gradient initially holds at 90% water and 10% acetonitrile for 2.5 minutes, followed by a linear gradient over 6 minutes to 100% acetonitrile. The flow rate is 1.5 mL per minute and the gradient is buffered with 0.01% trifluoroacetic acid. By day 2 of the fermentation, production of three of the native lipopeptides, A21978C 1 A21978C 2 and A21978C 3 with UV/visible spectra identical to that of daptomycin, was evident, as shown by HPLC peaks with retention times of 5.62, 5.77 and 5.90 minutes (?max 223.8, 261.5 and 364.5 nm) under the analytical conditions stated. The lipopeptides then remained evident in the fermentation at each sample point during the 7-day period. Total yields of lipopeptides A21978CI, A21978C 2 and A21978C 3 ranged from 10-20 mg per liter of fermentation material.
[0963] Liquid chromatography-mass spectrometry (LC-MS) analysis was performed on a Finnigan SSQ710c LC-MS system using electrospray ionization in positive ion mode, with a WO 2006/110185 PCT/US2005/040919 scan range of 200-2000 daltons and 2 second scans. Chromatographic separation was achieved on a Waters Symmetry C8 column (2.1x 50mm, 3.5 tm particle size) eluted with a linear wateracetonitrile gradient containing 0.01% formic acid, increasing from 10% to 100% acetonitrile over a period of six minutes after a initial delay of 0.5 minutes, then remaining at 100% acetonitrile for a further 3.5 minutes before re-equilibration. The flow rate was 0.35 mL/minute and the method was run at ambient temperature.
[0964] The identification of the native A54145 lipopeptides was confirmed in the controls (S.
fradiae wild type grown in medium D without isoleucine), as indicated by molecular ions atm/z of 1630.7, 1644.7, 1644.7, 1658.7, 1658.7, 1658.7, 1672.7, which is in agreement with the masses reported for the major A54145 lipopeptide factors F, A, Al, B1, B, D, E, respectively, produced by Streptomycesfradiae (Boeck et al., 1990, J. Antibiotics 43: 587- 593). The DA1187 mutants failed to produce any of the A54145 lipopeptides in medium D with or without isoleucine confirming that they were true null mutants.
[0965] Example 2-15: Constructing pDA2002 and complementing the S. fradiae IptE-I deletion [0966] Using the "Red" system the Streptomyces integrative BAC vector pDA2002 (that contains the Ipt biosynthetic gene cluster) was constructed. This plasmid was constructed from SF1:10D08 (an E. coli BAC plasmid that contains all of the Ipt biosynthetic gene cluster as well as flanking DNA, which was isolated from a chromosomal library of S.fradiae). The Streptomyces integrative cassette; containing the phiC31 integrase and attP site, the oriT from plasmid RK2, and the apramycin (apr) resistance marker, was engineered by DNA cloning to have flanking DNA regions with identity to the backbone of the BAC vector and orf21 of the S.
fradiae insert. The Streptomyces integrative cassette was inserted into the BAC vector and a region of the BAC insert was deleted using homologous recombination via the Red-mediated recombination system. This was achieved by introducing SF :1 OD08 into an E. coli strain carrying the Red genes on a plasmid (pKD119, Datsenko, KA., and Wanner, BL., 2000, Proc.
Nat Acad Sci U.S.A. 97: 6640). This strain was then transformed with a gel purified fragment containing the Streptomyces integrative cassette flanked by appropriate described regions of homology. These cells were then selected for both apr and cat resistance, and the resulting colonies were analyzed genetically to validate the insertion of the integration cassette and deletion of sequences upstream of orf21. Once constructed the plasmid pDA2002 was WO 2006/110185 PCT/US2005/040919 introduced into S. fradiae DA1187 by conjugation to create strain DA1116. Plasmid pDA2002 contains oriT from plasmid RK2 (Baltz, 1998, Trends in Microbiol. 6: 76-83 (1998), incorporated herein by reference in its entirety) for conjugation from E. coli to S. fradiae.
Plasmid pDA2002 is introduced into S. fradiae by conjugation from E. coli S 17.1, or a strain containing a self-replicating plasmid RK2 S. fradiae DA1116 was fermented and analyzed using the techniques described in Examples 2-13 and 2-14 respectively.
[0967] The identification of the native A54145 lipopeptides was confirmed, as indicated by molecular ions at m/z of 1630.7, 1644.7, 1644.7, 1658.7, 1658.7, 1658.7, 1672.7, which is in agreement with the masses reported for the major A54145 lipopeptide factors F, A, Al, B1, B, D, E, respectively, produced by Streptomycesfradiae when grown in medium D without isoleucine (Boeck et al., 1990, J. Antibiotics 43: 587-593). When grown in medium D with isoleucine the native A54145 lipopeptides with Ilel3 predominated, as indicated by molecular ions at m/z of 1644.7, 1644.7, 1658.7, 1658.7, 1658.7, 1672.7, which is in agreement with the masses reported for the major A54145 lipopeptide factors A, Al, B1, B, D, E, respectively, This demonstrated that the pDA2002 was able to successfully complement the IptE-I deletion to restore lipopeptide production in DA1116.
[0968] Example 2-16: Removal of downstream cluster genes by insertion of terminator cassette to identify putative amino acid modification genes [0969] The terminator cassette was engineered to place the to terminator from lambda phage in front of the amp resistance gene. The terminator cassette (to terminator plus amp) was amplified with PCR primers that carry 40 to 50 bp of homology to potential amino acid modification genes and the end of the BAC vector. When these PCR fragments were introduced into electro-competent cells that contained pDA2002 and an induced Red-system, the terminator was integrated site specifically in pDA2002 by homologous recombination. These cells were then selected for the presence of the amp resistance marker as well as the apr resistance marker, and the resulting colonies were analyzed genetically to validate the insertion of the terminator cassette and deletion of sequences to the end of the BAC vector.
[0970] The terminator cassette was amplified with PCR primers that would insert the terminator downstream of orf46 to create pDA2080. pDA2080 was conjugated into S. fradiae DA1187 to create the strain DA1339. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce lipopeptides with WO 2006/110185 PCT/US2005/040919 molecular ions at m/z of 1644.7, 1644.7, 1658.7, 1658.7, 1658.7, 1672.7, which is in agreement with the masses reported for the major A54145 lipopeptide factors A, Al, B1, B, D, E, respectively, produced by Streptomycesfradiae (Boeck et al., 1990, J. Antibiotics 43: 587- 593). This demonstrated that the pDA2080 was able to successfully complement the IptE-I deletion to restore lipopeptide production in DA1339 even with the terminator cassette inserted into the BAC.
[0971] The terminator cassette was amplified with PCR primers that would insert the terminator into the IptI gene (putative methyltransferase of glutamate 12, see 2-8) to create pDA2054. pDA2054 was conjugated into S. fradiae DA1187 to create the strain DA1312. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, DA1312 was shown to produce lipopeptides with molecular ions at m/z of 1644.7, 1644.7, and 1658.7. This is in agreement with the masses reported for the major A54145 lipopeptide factors A, Al, and D, respectively, produced by Streptomycesfradiae that have glutamic acid (Glul2) instead of 3-methyl-glutamic acid (mGlul2) at position 12 (Boeck et al., 1990, J. Antibiotics 43: 587-593). From this data it was concluded that IptI plays a role in the methylation of glutamic acid during the synthesis ofA54145.
[0972] The terminator cassette was amplified with PCR primers that would insert the terminator into the IptL gene (putative oxygenase ofasparagine 3) to create pDA2076. pDA2076 was conjugated into S. fradiae DA1187 to create the strain DA1336. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, DA1336 was shown to produce lipopeptides with molecular ions at m/z of 1628.7, 1628.7, and 1642.7. This is consistent with the masses of analogs of the Glul2 factors A, Al, and D, respectively, that would have asparagine (Asn3) instead of 3-hydroxy-asparagine (hAsn3) at position 3. DA1336 was shown to produce the Ile13 compounds C93, C94, and C95, although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall3 C144, C145, and C146. From this data it was concluded that IptL plays a role in the addition of a hydroxyl group to the asparagine at position 3 during the synthesis of A54145.
[0973] The terminator cassette was amplified with PCR primers that would insert the terminator into the IptK gene (putative O-methyltransferase involved in the methoxylation of aspartic acid at position 9) to create pDA2074. pDA2074 was conjugated into S. fradiae DA1187 to create the strain DA1333. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, DA1333 was shown to produce lipopeptides with WO 2006/110185 PCT/US2005/040919 molecular ions at m/z of 1614.7, 1614.7, and 1628.7. This is consistent with the masses of analogs of the Glul2 factors A, Al, and D, respectively, that would have 3-hydroxyaspartic acid (hAsp9) instead of 3-methoxy-aspartic acid (moAsp) at position 9 and Asn3 instead ofhAsn3. DA1333 was shown to produce the Ilel3 compounds C102, C103, and C104, although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall3 C132, C133, and C134. From this data it was concluded that IptK plays a role in the methoxylation of hydroxyl-aspartic acid at position 9 during the synthesis ofA54145.
[0974] The terminator cassette was amplified with PCR primers that would insert the terminator into the IptJ gene (putative syrP regulator) to create pDA2060. pDA2060 was conjugated into S. fradiae DA1187 to create the strain DA1327. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, DA1327 was shown to produce lipopeptides with molecular ions at m/z of 1598.7, 1598.7 and 1612.7. This is consistent with the masses of analogs of the Glul2 factors A, Al, and D, respectively, that would have aspartic acid (Asp9) instead of moAsp9 at and Asn3 instead of hAsn3. DA1327 was shown to produce the Ile13 compounds C105, C106, and C107, although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall3 C135, C136, and C137. From this data it was concluded that lptJis not a regulator of A54145 biosynthesis but rather plays a role in the hydroxylation of aspartic acid at position 9 during the synthesis ofA54145.
[0975] Example 2-17: Constructing (BTI-basedplasmids for complementation experiments.
[0976] Expression of the modified A54145 biosynthetic pathways in the IptE-I mutant was achieved using an apr resistant BAC-based vector which integrated site-specifically in a neutral site of the S. fradiae genome at the C31 attB site. Further complementation of these strains would require the use of a compatible integration plasmid with a different selection marker. The (BTl-based vectors (Gregory et al. J. Bacteriol 2003: 5320-5323) with neomycin (neo) or hygromycin (hyg) resistance markers can integrate site-specifically in a neutral site of the S.
fradiae genome at a pBT1 attB site. This can also be achieved in apr resistant strains already containing 4C31-based BAC vectors integrated.
[0977] A 4BT1 integrase-based Streptomyces integrative cassette, removed from MS82 (Gregory et al., 2003, J. Bacteriol: 5320-5323) and contains the (BT1 integrase and attP site, the WO 2006/110185 PCT/US2005/040919 oriT from plasmid RK2, and the hyg resistance marker, was engineered by DNA cloning to have flanking DNA regions with identity to the backbone of the BAC vector and the S. fradiae insert.
The OBT1 integrative cassette also contains the ermE* constitutive promoter which will drive expression of downstream genes. Homologous recombination between the BAC vector and the Streptomyces integrative cassette flanked by appropriate regions ofhomology was achieved by transforming the gel purified fragment into an induced E. coli strain carrying the SF1:10D08 and the Red gene containing plasmid pKD119. These cells were then selected for both hyg and cat resistance and the resulting colonies were analyzed genetically to validate the insertion of the integration cassette and deletion of upstream sequences.
[0978] Using the "Red" system the Streptomyces integrative BAC vector pJR2012 was constructed. The OBT1 integrase-based Streptomyces integrative cassette was flanked by DNA regions with identity to the backbone of the BAC vector and IptK of the S. fradiae insert.
Homologous recombination between the BAC vector and the Streptomyces integrative cassette was achieved by transforming into cells containing the SF1:1 D08 BAC and an induced Redsystem (See Example The insertion of the )BTI integrative cassette positions the ermE* constitutive promoter directly in front of lptK to ensure its expression as well as downstream genes remaining on the BAC vector.
[0979] Using the "Red" system the Streptomyces integrative BAC vector pJR2015 was constructed. The (BT1 integrase-based Streptomyces integrative cassette was flanked by DNA regions with identity to the backbone of the BAC vector and IptL of the S. fradiae insert.
Homologous recombination between the BAC vector and the Streptomyces integrative cassette was achieved by transforming into cells containing the SF1:10D08 BAC and an induced Redsystem. The insertion of the (BT1 integrative cassette positions the ermE* constitutive promoter directly in front of IptL to ensure its expression as well as downstream genes remaining on the BAC vector.
[0980] The neo resistant 4BT1 pRT802 plasmid was converted to an expression plasmid by the insertion of a cassette containing the ermE* constitutive promoter driving expression of a spectinomycin (spec) resistance marker flanked by the fd and to terminators to create pDA2113.
The PCR amplified expression cassette was inserted into the pRT802 plasmid digested with EcoRV and Notl. Complementation plasmids expressing IptI (mGlul2 methyltransferase) or IptL (hAsn3 oxygenase) together were generated by replacing the spec marker and to terminator WO 2006/110185 PCT/US2005/040919 in pDA2113 with PCR amplified biosynthetic gene and the cat terminator cassette (to terminator engineered in front of the cat resistance gene).
[0981] The neo resistant OBT1 pDA2113 was digested with NdeI and HindIII to remove the spec marker and to terminator and ligated together with the PCR amplified Iptl gene, digested with NdeI and XbaI and the cat terminator cassette, digested with XbaI and HindIII. The newly created pDA2129 has the IptI gene, that codes for Glul2 methyltransferase, under the control of the constitutive ermE* promoter.
[0982] The neo resistant (BT1 pDA2113 was digested with NdeI and HindIII to remove the spec marker and to terminator and ligated together with the PCR amplified IptL gene, digested with NdeI and XbaI and the cat terminator cassette, digested with Xbal and HindIIl. The newly created pDA2015 has the IptL gene, that codes for Asn3 oxygenase, under the control of the constitutive ermE* promoter.
[0983] Example 2-18: Complementation of an S. fradiae mutant strains containing OC31 BACs with fBTl-based plasmids for the production of novel lipopeptides.
[0984] Once constructed the plasmid pJR2012; containing IptK (hAsp9 methoxylase), IptL (Asn3 oxygenase) under the control of the constitutive ermE* promoter and IptI (Glul2 methyltransferase), was introduced into S. fradiae DA1333 by conjugation to create strain DA1449. When fermented and analyzed under the conditions described in Examples 2-13 and 2- 14, S. fradiae DA1449 was shown to produce lipopeptides with molecular ions at m/z of 1644.7, 1644.7, 1658.7, 1658.7, 1658.7, 1672.7, which is in agreement with the masses reported for the major A54145 lipopeptide factors A, Al, B1, B, D, E, respectively, produced by Streptomycesfradiae (Boeck et al., 1990, J. Antibiotics 43: 587-593). This demonstrated that the pJR2012 was able to successfully complement the DA1333 strain to restore lipopeptide production.
[0985] The plasmid pJR2012; containing IptK (hAsp9 methoxylase), IptL (Asn3 oxygenase) under the control of the constitutive ermE* promoter and IptI (Glul2 methyltransferase), was introduced into S. fradiae DA1327 by conjugation to create strain DA1553. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA1553 was shown to produce lipopeptides with molecular ions at m/z of 1628.7, 1628.7 and 1642.7. This is consistent with the masses of analogs of the mGlul2 factors Bl, B, and E, respectively, that would have Asp9 instead of moAsp9. DA1553 was shown to produce the WO 2006/110185 PCT/US2005/040919 Ilel3 compounds C114, C115, and C116, although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vail3 C117, C118, and C119. This demonstrated that the putative LptK protein requires the presence of the lptJ protein to hydroxylate Asp9 before methoxylation can occur.
[0986] Once constructed the plasmid pJR2015; containing IptL (Asn3 oxygenase) under the control of the constitutive ermE* promoter and IptI (Glul2 methyltransferase), was introduced into S.fradiae DA1336 by conjugation to create strain DA1621. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA1621 was shown to produce lipopeptides with molecular ions at m/z of 1644.7, 1644.7, 1658.7, 1658.7, 1658.7, 1672.7, which is in agreement with the masses reported for the major A54145 lipopeptide factors A, Al, B1, B, D, E, respectively, produced by Streptomycesfradiae (Boeck et al., 1990, J. Antibiotics 43: 587-593). This demonstrated that the pJR2015 was able to successfully complement the DA1336 strain to restore lipopeptide production.
[0987] The plasmid pJR2015; containing IptL (Asn3 oxygenase) under the control of the constitutive ermE* promoter and IptI (Glul2 methyltransferase), was introduced into S. fradiae DA1333 by conjugation to create strain DA1627. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA1627 was shown to produce lipopeptides with molecular ions at m/z of 1644.7, 1644.7 and 1658.7. This is consistent with the masses of analogs of the mGlul2 factors B B, and E, respectively, that would have hAsp9 instead ofmoAsp9. DA1627 was shown to produce the Ilel3 compounds C111, C112, and C113, although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Val 3 C126, C127, and C128.
[0988] Once constructed the plasmid pDA2129; containing IptI (Glul2 methyltransferase) under the control of the constitutive ermE* promoter was introduced into S. fradiae DA613 by conjugation to create strain DA1491. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA1491 was shown to produce lipopeptides with molecular ions at m/z of 1644.7, 1644.7, 1658.7, 1658.7, 1658.7, 1672.7, which is in agreement with the masses reported for the major A54145 lipopeptide factors A, Al, B 1, B, D, E, respectively, produced by Streptomycesfradiae (Boeck et al., 1990, J. Antibiotics 43: 587- 593). This demonstrated that the pDA2129 was able to successfully complement the DA613 strain to restore production of Glul2 and mGlul2 lipopeptides.
WO 2006/110185 PCT/US2005/040919 [0989] The plasmid pDA2129; containing IptI (Glul2 methyltransferase) under the control of the constitutive ermE* promoter was introduced into S. fradiae DA1327 by conjugation to create strain DA1489. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA1489 was shown to produce lipopeptides with molecular ions at m/z of 1612.7, 1612.7 and 1626.7. This is consistent with the masses of analogs of the mGlul2 factors Bl, B, and E, respectively, that would have Asp9 instead ofmoAsp9 and Asn3 instead of hAsn3. DA1489 was shown to produce the Ilel3 compounds C108, C109, and Cl although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall13 C138, C139, and C140.
[0990] The plasmid pDA2129; containing Iptl (Glul2 methyltransferase) under the control of the constitutive ermE* promoter was introduced into S. fradiae DA1327 by conjugation to create strain DA1489. Into this strain was added the plasmid pDA2076 to create DA2000 When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA2000 was shown to produce lipopeptides with molecular ions at m/z of 1642.7, 1642.7 and 1656.7. This is consistent with the masses of analogs of the mGlul2 factors BI, B, and E, respectively, that would have Asn3 instead of hAsn3. DA1489 was shown to produce the Ile13 compounds C96, C97, and C98, although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall3 C141, C142, and C143.
[0991] The plasmid pDA2129; containing IptI(Glul2 methyltransferase) under the control of the constitutive ermE* promoter was introduced into S. fradiae DA1333 by conjugation to create strain DA1459. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA1459 was shown to produce lipopeptides with molecular ions at m/z of 1628.7, 1628.7 and 1642.7. This is consistent with the masses of analogs of the mGlul2 factors B1, B, and E, respectively, that would have hAsp9 instead ofmoAsp9 and Asn3 instead of hAsn3. DA1489 was shown to produce the Ile13 compounds C99, C100, and C101, although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall3 C129, C130, and C131.
[0992] Once constructed the plasmid pDA2117; containing IptL (Asn3 oxygenase) under the control of the constitutive enrE* promoter was introduced into S. fradiae DA1336 by conjugation to create strain DA1470. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA1470 was shown to produce lipopeptides WO 2006/110185 PCT/US2005/040919 with molecular ions at m/z of 1644.7, 1644.7, and 1658.7 which is in agreement with the masses reported for the major A54145 lipopeptide factors A, Al, D, respectively, produced by Streptomycesfradiae that have Glul2 instead of mGlul2 (Boeck et al., 1990, J. Antibiotics 43: 587-593). This demonstrated that the pDA2117 was able to successfully complement the DA1336 strain to restore production of Glul2 lipopeptides.
[0993] The plasmid pDA2117; containing lptL (Asn3 oxygenase) under the control of the constitutive ermE* promoter was introduced into S. fradiae DA1327 by conjugation to create strain DA1484. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA1484 was shown to produce lipopeptides with molecular ions at m/z of 1614.7, 1614.7 and 1628.7. This is consistent with the masses of analogs of the Glul2 factors A, Al, and D, respectively, that would have Asp9 instead ofmoAsp9. DA1484 was shown to produce the Ile13 compounds C90, C91, and C92, although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall3 C120, C121, and C122.
10994] The plasmid pDA2117; containing IptL (Asn3 oxygenase) under the control of the constitutive ermE* promoter was introduced into S. fradiae DA1333 by conjugation to create strain DA1453. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, S. fradiae DA1453 was shown to produce lipopeptides with molecular ions at m/z of 1630.7, 1630.7 and 1644.7. This is consistent with the masses of analogs of the Glul2 factors A, Al, and D, respectively, that would have hAsp9 instead ofmoAsp9. DA1453 was shown to produce the Ilel3 compounds C87, C88, and C89, although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall3 C123, C124, and C125.
[0995] Example 2-20: Module exchanges constructed at positions 8 or 11 in A54145.
[0996] Module exchanges to change either position 8 or 11 of A54145 core was done on plasmid pDA2054 (see Example 2-16, plasmid that is capable of expressing IptABCD without PmeI site). This plasmid was able to restore A54145 biosynthesis in AlptE-IS.fradiae. The DNA fragment coding for module 8 or module 11 on pDA2054 was replaced by genR gene at the linker regions B and CAT, using the red-mediated recombination system described in Example 2-6 (see primers used below). Once the genR gene was inserted into pDA2054 replacing either the lysine CAT module at position 8 or the asparagines module at position 11 409 WO 2006/110185 WO 206/10185PCT/US2005010919 was removed by NheI/Pmel digest (module 8) or AvrIIIPmeI (module- 11). The modules that were used to replace either lysine or asparagmnes were cloned using the gap-repair technique described in Example 2-6 and could be removed from pBR322 using the restriction sites NheIIHpaI. These modules included DNA fragment coding for heterologous modules cloned from daptomycin dpt D-Ala 8, dpt D-Ser 11I or from A54145 ipt D-Asnl 1. All possible combinations of Ser, Ala and Asn at either positions 8 or 11 were constructed and designated as the following hybrid plasmids pKN56 (pDA2054 containing D-Ala8), pKN57 (pDA2054 containing D-Ser8), pKLN58 (pDA2054 containing -D-Asn8), pKN59 (pDA2054 containing -D- Alal 1) and pKN60 (pDA2054 containing -D-Serl 1) were introduced into S. fradiae mutants DAl 187 (AlptE-I, see Example 2-12) and DA740 (DAl 187 plus plasmid pDA2129 which expresses IptI, see Example 2-18) to generate hybrid lipopeptides with 2 changes at positions 8 or 11I and 12.
[0997] Primers for deletion lpt-D-Lys8 lpt-Del-Lys8-B-Nhe TTC GAG GCC CGA ACG GTC GCC GCG CTG GCG GCC CGG CTG CGG ACC GCGCT AGO TGTG TAG GOT GGA GCT GCT TCG-3'(SEQ ID NO: 29) lpt-Lys8-CAT-II: OGA GAG CGG GGT CCT CGT OGO OTG CCG OGT OGG TCC TGC GGG GTTTAAACCATATGAATATCCTCCTTA-3'(SEQ ID NO 109981 lpt-D-Asnl 1 lpt-Asn II-B.
-OGAGAOAOCGACOGTGGCCGGTCTOGOOGCOGCGOTCTCCGCGGCCCTAGG
TGTGTAGGCTGGAGOTGOTTCG-3'(SEQ ID NO: 3 1) lpt-Asnl 1-CAT.
'-GTCCCGCGACCGCCGAGTACCTCGGTCGCCGGACCGCCGGGGCGCG.GTTTAA
ACCATATGAATATCCTCCTTA-3'(SEQ ID NO: 32) WO 2006/110185 PCT/US2005/040919 [0999] Primers for gap-repair cloning of both dpt-Ala8 and dpt-Serll modules Ala/Ser-B-P13 GCTAGCTTCTTAGACGTCAGGTGGCAC-3' (SEQ ID NO: 33) Ser-CAT-P 14-II GTTAACCGATACGCGAGCGAACGTGA-3'(SEQ ID NO: 34) [1000] Strain KN707 was constructed by adding pKN56 to DA1187. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C313, C314, C315, C316, C317 and C318.
[1001] Strain KN681 was constructed by adding pKN56 to DA740. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C319, C320, C321, C322, C323 and C324.
[1002] Strain KN715 was constructed by adding pKN57 to DA1187. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C292, C293, C294, C295, C296 and C297.
[1003] Strain KN689 was constructed by adding pKN57 to DA740. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C289, C290, C291, C298, C299 and C300.
[1004] Strain KN723 was constructed by adding pKN58 to DA1187. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C307, C308, C309, C310, C311 and C312.
[1005] Strain KN697 was constructed by adding pKN58 to DA740. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C301, C302, C303, C304, C305 and C306.
[1006] Strain KN728 was constructed by adding pKN59 to DA1187. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C334, C335, C336, C337, C338 and C339.
WO 2006/110185 PCT/US2005/040919 [1007] Strain KN701 was constructed by adding pKN59 to DA740. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C328, C329, C330, C331, C332 and C333.
[1008] Strain KN730 was constructed by adding pKN60 to DA1187. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C147, C148, C149, C325, C326 and C327.
[1009] Strain KN705 was constructed by adding pKN60 to DA740. When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, this strain was shown to produce compounds C150, C151, C152, C153, C154 and C155.
[1010] Example 2-21: Module exchanges constructed atpositions 2 through 4 in A54145 The exchange of modules 2-4 in IptA (D-Glu-2/hAsn-3/Thr-4) was constructed on pDA2054 (this plasmid expresses IptABCD from a BAC vector, see Example 2-16 for its construction).
pDA2054 was able to restore biosynthesis of the glutamate derivative of A54145 in the mutant DA1187 (see Example 2-15). The DNA fragment coding for modules 2-4 in IptA, on pDA2054 was replaced by the genR gene between the linker regions B and CAT (module exchange 2-4) using the red-mediated recombination system described in Example 2-6. The genR gene was flanked by restriction sites for NheI/PmeI which allowed its easy removal from the BAC vector through restriction digest. The replacement fragment was cloned into pBR322 from dptA using the gap-repair system described in Example 2-6 and was flanked by restriction sites for Nhel/HpaI. This fragment from dptA encoded for modules 2-4 from daptomycin (D-Asn-2/Asp- 3/Thr-4), this fragment was ligated to the 2-4 deleted version ofpDA2054 to generate pKN61.
Plasmid pKN61 was introduced into DA1187 and XH1000 (DAI 189 carrying pKN55, see Example 2-10) to produce recombinant strains KN650 (DA1187 plus pKN651) and KN665 (XH1000 plus pKN61).
[1011] When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, strain KN650 was shown to produce compounds C271, C272, C273, C274, C275 and C276.
[1012] When fermented and analyzed under the conditions described in Examples 2-13 and.
2-14, strain KN665 was shown to produce compounds C265, C266, C267, C268, C269 and C270.
WO 2006/110185 PCT/US2005/040919 [1013] Primers for deletion Lpt2-4 lpt-Del-Glu2-B-Nhe: CCG GTC CCC GAC CGT CGC CCG CCT CGC GGA GGA ACT GGG CGA CGG GCTAGCTGTGTAGGCTGGAGCTGCTTCG (SEQ ID NO: lptGlu2-CAT: GCG GCG CGG GAC GCT CCG CGT CCG CGT CCG GTC CGG CGG ACCGTTTAAACCATATGAATATCCTCCTTA-3' (SEQ ID NO: 36) [1014] Primers for gap repair cloning Dpt2-4 dpt-Asn2-Pick-B:
AGGCGCTCCGGGCGCGGAGGCAGCGGCGGGGTGGTGTGCTGCCGTCCG
GCTAGCTTCTTAGACGTCAGGTGGCAC (SEQ ID NO: 37) dpt-Thr4-Pick-CAT:
CTCTTCGCCGCGCCCACGCCTGCCGGGCTCGCGACCGTACTGGCGGCC
GTTAACCGATACGCGAGCGAACGTGA (SEQ ID NO: 38) Example 2-22: Module exchanges constructed atpositions 2 through 8 in A54145 [1015] The exchange of modules 2-8 in lptA,B, C (D-Glu-2/hAsn-3/Thr-4/Sar-5/Ala-6/Asp- 7/D-Lys-8) was constructed on pDA2054 (this plasmid expresses lptABCD from a BAC vector, see Example 2-16 for its construction). pDA2054 was able to restore biosynthesis of the glutamate derivative of A54145 in the mutant DA1 187 (see Example 2-15). The DNA fragment coding for modules 2-8 in lptA,B, C, on pDA2054 was replaced by the genR gene between the linker regions B and CATE (module exchange 2-8) using-the red-mediated recombination system described in Example 2-6. The genR gene was flanked by restriction sites for Nhe/PmeI which allowed its easy removal from the BAC vector through restriction digest. The replacement fragment was cloned into pBR322 from dptA,BC using the gap-repair system described in WO 2006/110185 WO 206/10185PCT/US2005!040919 Example 2-6 and was flanked by restriction sites for NheIIHpaI. This fragment from dptA4,BC encoded for modules 2-8 from daptomycin (D-Asn-2/Asp-3tThr-4/Gly-5/Orn-6/Asp-7/D-Ala-8), this fragment was ligated to the 2-8 deleted version of pDA2054 to generate pKN62. Plasmid pKN62 was introduced into DAl 187 and XH1 000 (DAl 189 carrying pKN55, see Example 2-10) to produce recombinant strains KN653 (DAI 187 plus pKN62) and KN669 (XIII 000 plus pKIN62).
[10161 When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, strain KN653 was shown to produce compounds C283, C284, C285, C286, C287 and C288.
[10171 When fermented and analyzed under the conditions described in Examples 2-13 and 2-14, strain KN669 was shown to produce compounds C277, C278, C279, C280, C281 and C282.
11018] Primers for deletion Lpt2-8 lpt-Del-Glu2-B-Nhe: CCG GTC CCC GAC CGT CGC CCG CCT CGC GGA GGA ACT GGG CGA CGG GCTAGCTGTGTAGGCTGGAGCTGCYI'CG (SEQ ID NO: 39) lpt-Lys8-CATE2-II: GGGG GGC GAC CGG CAG GAT GTC CTC CAA GGC GGT GCC GGT GCG GC GTTTAAACCATATGAATATCCTCCTTA 3' (SEQ ID NO: [1019] Primers for gap repair cloning Dpt2-8 dpt-Asn2-Pick-B:
AGGCGCTCCGGGCGCGGAGGCAGCGGCGGGGTGGTGTGCTGCCGTCCG
GCTAGCTTCTTAGACGTCAGGTGGCAC (SEQ ID NO: 41) Ala-CATE2-P 14-TI WO 2006/110185 PCT/US2005/040919
CGACGTGACGCTGGTGGAAGTGAACCAGGTGGAGCTCGACCGTCTGCAGGTTAAC
CGATACGCGAGCGAACGTGA (SEQ ID NO: 42) [1020] Example 2-23: Deletion ofmethylation in sarcosine module to produce glycine at position 5 in A54145 [1021] The selection cassette for the deletion of the methylation domain within IptAS-Sar module was amplified with PCR primers that carry 50 bp of homology to the linker region of the domain under investigation (see Figure 5 for positions of linkers). When these PCR fragments were introduced into electro-competent cells that contained pDA2054 (a truncated version of the IptBAC that contains the entire Ipt pathway, see Example 2-16) and induced Red-system (see Example the resistance cassette was integrated site specifically at the target site in pDA2054 by homologous recombination (Figure 3).
[1022] These cells were then selected for the presence of the gent resistance marker, and the resulting colonies were analyzed genetically to validate the construction of the appropriate deletion or disruption. Part of the primer design involves placing a restriction site within the linker region of interest (Pmel and Swal). (Figure 3).
[1023] The BAC containing the gent deletion of the methylation domain was subsequently digested using the unique restriction sites Pmel and Swal to excise the selection marker and religated, and the resulting colonies were analyzed genetically to validate the construction of the appropriate deletion of the methylation domain. The resulting clone was named pSD409.
[1024] pSD409 was added by interspecies conjugation from E. coli to DA1187 (a lptE-I deletion of S.fradiae, see Example 2-12) to create SD409. S. fradiae SD409 was fermented and analyzed using the techniques described in Examples 2-13 and 2-14 respectively.
[1025] The identification oflipopeptides was confirmed, as indicated by molecular ions at m/z of 1616.7 (C183), 1630.7 (C182) 1630.7 (C181) and 1644.7 (C180), which is in agreement with the masses reported for the major A54145 lipopeptides Streptomycesfradiae 14m/z. Although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Val 3 C184, and C185.
[1026] Example 2-24. Module exchanges constructed atposition 2 in A54145 [1027] Module exchanges were done on plasmid plpt-J14-P to replaced D-Glu-2 module by the module for D-Asn, D-Ser or D-Ala. The plasmid pDA2054 was able to restore biosynthesis WO 2006/110185 PCT/US2005/040919 of the glutamate derivative ofA54145 in the mutant DA1187. The DNA fragment coding for module 2 on pDA2054 was first replaced by genR gene at the linker regions CAT (see Example 2-20). The genR gene was removed by NheI/PmeI digest and replaced by NheI/HpaI DNA fragment coding for Ipt D-Asnl 1, (cloned by gap-repair method as described in Example using theprimers Lpt-Nll-B-P13 and Lpt-N11-CAT-P14). This created the hybrid plasmid pXH2000 which was introduced into DA1189 andXH1000 (DA1189 carrying pKN55) to produce recombinant strains XH1001 (DA1889 plus pXH2000) and XH1002 (XH1000 plus pXH2000). XH1001 and XH1002 were fermented and analyzed using the protocols described in Example 2-13 and 2-14. S.fradiae XH1001 was shown to produce lipopeptides with molecular ions at m/z of 1629.7, 1629.7 and 1643.7. This is consistent with the masses of analogs of the Glul2 factors A, Al, and D, respectively, that would have Asn-2. XH1001 was shown to produce the Ilel3 compounds C343, C344, and C345. Although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall3 C346, C347, and C348. S. fradiae XH1002 was shown to produce lipopeptides with molecular ions at m/z of 1643.7, 1643.7 and 1657.7. This is consistent with the masses of analogs of the mGlul2 factors B, BI, and E, respectively, that would have Asn-2.
XH1002 was shown to produce the 11e13 compounds C340, C341, and C342. Although not identified under these fermentation conditions this strain would also have the potential to produce the factors with Vall3 C349, C350, and C351.
Primers for deletion of D-GIu-2 module lptGlu2-B: GTC CCC GAC CGT CGC CCG CCT CGC GGA GGA ACT GGG CGA CGG CCTAGGTGTGTAGGCTGGAGCTGCTTCG-3'(SEQ ID NO: 43) lptGlu2-CAT: GCG GCG CGG GAC GCT CCG CGT CCG CGT CCG GTC CGG CGG ACCGTTTAAACCATATGAATATCCTCCTTA-3' (SEQ ID NO: 44) Primers for gap-repair of lpt-Asn-11.
WO 2006/110185 PCT/US2005/040919 Lpt-N11-B-P3
TCGGGGCGCGGGTCGGCGGGGCGCAGCCGGGGTCCGGCCTCGCCC
GCTAGCTTCTTAGACGTCAGGTGGCAC (SEQ ID NO: Lpt-NI-CAT-P14
CGCGACATCTTCGAACAGCGCACGCCCGCCGCCCTCGCCGGCCGC
GTTAACCGATACGCGAGCGAACGTGA (SEQ ID NO: 46) [1028] Example 3-1: Biological activity [1029] Compounds according to Formula I were tested for antimicrobial activity against a panel of organisms according to standard procedures described by the National Committee for Clinical Laboratory Standards (NCCLS document M7-A6, Vol. 23, Number 2, 2003) except that all testing was performed at 37 OC and under constant agitation at 200 rpm. Compounds were dissolved in either 100% dimethyl sulfoxide or water or 50:50 mix by volume of dimethyl sulfoxide and water depending upon the solubility of the compound and were diluted to the final reaction concentration (0.1 ig/mL-100 gg/mL) in microbial growth media. In all cases the final concentration of dimethyl sulfoxide incubated with cells is less than or equal to For minimum inhibitory concentration (MIC) calculations, 2-fold dilutions of compounds were added to wells of a microtiter plate containing 5x104 bacteria cells in a final volume of 100 tL of media (Mueller-Hinton Broth supplemented with 50 mg/L Ca 2 The optical densities (OD) of the bacterial cells, which measures bacterial cell growth and proliferation, were measured using a commercial plate reader. The MIC value is defined as the lowest compound concentration inhibiting growth of the test organism. The MIC (in pg/ml) value of representative compounds of the present invention are listed in Table V.
Table V: Biological Activity of Compounds of Formula I Assay Strain SAU.42 SAU.399 SAU.278 EFM.14 EFM.384 EFS.201 EFS.312 SPN.402 C1 C2 C3 C4 C6 WO 2006/110185 WO 206/10185PCT/US2005!040919 Assay Strain SAU.42 SAU.399 SAU.278 EFM. 14 EFM.384 EFS.201 EFS.312 SPN .402 C8 C9 010 Cll C12 C16 017 +I C18 C21 C22 C23 C24 C26 C27 C37 C38 039 C46 C47 t C48 049 061 C62 070 071 072 C73 C74 C76 077 C78 4+ WO 2006/110185 WO 206/10185PCT/US2005!040919 Assay Strain SAU.42 SAU.399 SAU.278 EFM.14 EFM.384 EFS.201 EFS.312 SPN.402 080 +I 081 C82 C83 084 085 C86 C87 090 C93 C94
+I
C96 C97 098 0103 C105 C108 C146 C153 01 54 0155 01 80 0189 0190 01 91 0201 0202 ++i 0203 0204 0205 0206 021 0 0211 0212 ++i WO 2006/110185 WO 206/10185PCT/US2005!040919 ~Assay Strain ff" SAU.42 SAU.399 SAU.27 EFM.14 EFM.384 EFS.201 EFS.312 SPN.402 C233 0234 C235 C236 C237 0238 I++ 0325 C326+ C327 0352 0353 C354 C355 0356 0357 0358 0359 0360 0361 0362 0363 0364 0365 0366 0367 0368 0369 4- [1030] wherein: Strain Species ATCC# Strain description Staphylococcus NCOLS reference strain for broth microdilution MIC SAU.42 aureus 29213 assay obtained from the ATC Staphylococcus NCOLS Methicillin and Oxacillin Resistant Clinical SAU.399 aurous 43300 Isolate obtained from the ATC Staphylococcus Daptomycin resistant mutant (DIO)- liquid serial SAU.278 aureus n/a passage mutant derived from parent S.aureus 42 WO 2006/110185 PCT/US2005/040919 Strain Species Enterococcus faecium SATCC# Strain description
I
EFM.14 6569 EFM.384 Enterococcus faecium n/a Enterococcus faecalis EFS.201 49452 FDA test organism in AOAC test for germicidal activity obtained from the ATCC Daptomycin resistant mutant (14-A)-liquid serial passage mutant derived from parent E.faecium 14 Quality control strain for API products obtained from the ATCC Daptomycin resistant mutant (EFA)- liquid serial passage mutant derived from parent E.faecalis 201 Public health Report 59:449-468 (serotype 3) obtained from the ATCC EFS.312 Enterococcus faecalis SPN.402 Streptococcus pnuemoniae 6303 [1031] Wherein indicates that the compound has an MIC (ug/ml) of 1 pg/ml or less or an ED 50 of 1 mg/kg or less; [1032] indicates that the compound has an MIC (jtg/ml) or ED 50 of greater than 1 gg/ml or 1 mg/kg, respectively but less than or equal tol 0 Pg/ml or ED 50 of mg/kg, respectively; and [1033] indicates that the compound has an MIC (pg/ml) of greater than 10 pg/ml or an EDso of greater than 10 mg/kg.
[10341 Example 3-2: In vivo activity [1035] The mouse protection test is an industry standard for measuring the efficacy of a test compound in vivo (for examples of this model see Clement, JJ. et al., 1994, Antimicrobial Agents and Chemotherapy 38 1071-1078). As exemplified below, this test is used to demonstrate the in vivo efficacy of the compounds of the present invention against bacteria.
[1036] The in vivo antibacterial activity is established by infecting female CD-1 mice (Charles River Lab, MA) weighing 19-23 g intraperitoneally with Methicillin Resistant S.
aureus (MRSA) inoculum. The inoculum is prepared from Methicillin Resistant S. aureus (ATCC 43300). The MRSA inoculum is cultured in Mueller-Hinton (MH) broth at 37 °C for 18 hours. The optical density at 600 nm (OD 00 oo) is determined for a 1:10 dilution of the overnight culture. Bacteria (8 x 108 cfu) is added to 20 ml of phosphate buffered saline (Sigma P-0261) containing 5 hog gastric mucin (Sigma M-2378). All animals are injected with 0.5 ml of the inoculum, equivalent to 2 x 107 cfu/mouse, which is the dose causing -100% death of the animals without treatment.
[10371 The test compound is dissolved in 10.0 ml of saline solution to give a solution of 1 mg/ml (pH This solution is serially diluted with vehicle by 4-fold (1.5 ml to 6.0 ml) to give 0.25, 0.063 and 0.016 mg/ml solutions. All the solutions are filtered with 0.2 pan Nalgene syringe filter. One hour after the bacterial inoculation, group 1 animals are subcutaneously (sc) injected with buffer (no test compound) and groups 2 to 5 were given test compound sc at 10.0, 0.63, and 0.16 mg/kg, respectively. Group 6 animals receive test compound sc at 10 mg/kg (or the highest therapeutic dose of a given compound) only for monitoring acute toxicity. These injections are repeated once at 4 hours after the inoculation for the respective groups. The injection volume at each time is 10 ml per kilogram of body weight. The 50% protective dose is calculated on the basis of the number of mice surviving 7 days after inoculation.
[1038] All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings herein that certain changes and modifications may be made thereto without departing from the spirit or scope of the invention disclosed.
110391 The term "comprise" and variants of the term such as "comprises" or "comprising" are used herein to denote the inclusion of a stated integer or stated integers but not to exclude any other integer or any other integers, unless in the context or usage an exclusive interpretation of the term is required.
[10401 Any reference to publications cited in this specification is not an admission that the disclosures constitute common general knowledge in Australia.
Claims (32)
1. A compound of Formula F2: H02 R 12 R 1 3 NH HN 0 1 C H 3 C 0 0 NH 0:< 0 NH HN 0 0 HN R 8 0 HO 2 C HN N o HO 2 C and salts thereof; wherein: (F2) NH 2 a) R 8 is hydrogen, methyl, b) R 12 is H or CH 3 c) R 13 is CH(CH 3 2 CH(CH 2 CH 3 )CH 3 0 NH; OH or ~jR OH or -N I L. J H or and d) each of R 6 and R 8 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
2. The compound of Claim 1 wherein each of R 6 and R 8 is independently amino, NH-amino protecting group, or carbamoyl.
3. The compound of Claim 2 wherein each of R 6 and R 8 is independently amino.
4. The compound of Claim 1 wherein R' is amino, alkanoylamino, NH-amino protecting group. The compound of Claim 4 wherein R' is a CIO-C 1 3 alkanoylamino.
6. The compound of Claim 5 wherein R, is 0 H H N (HCH N (CHACH(H 3 2 Ny (CH 2 6 CH(CH 3 )H 2 H 3 H 00 XN (CH 2 8 CH(CH 3 )CH 2 CH 3 XN (CH 2 8 CH(CH 3 2 0 or 0
7. The compound of Claim I selected from R' (L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Orn-L-Asp-D-Ala-L-Asp-G ly-D-Ala-L-3 mGlu-L-Kyn R 1 (L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Om-L-Asp-D-A Ia-L-Asp-Gly-D-A Ia-L-3mGlu-L-Trp or R 1 (L-Trp)-D-Asn-L-Asp-L-Thr-Gly-L-Orn-L-Asp-D-Ala-L-Asp-G ly-D-A !a-L-Glu-L-Trp
8. The compound of Claim 1 selected from: 0 NH 2 H0 2 C HN NH 0CONH 2 YL I k NN-CO(CH 2 6 CH(CH 3 )CH 2 CH 3 HOC HN NH 0 CONH, c-I0 0 00 0 H H IN N-N N-CO(CH),CH(CH,), H H nNH 0 0 0 NH C0 2 H/ N HN 0 H HOC 0 HN H NH, HN N 0 H 0 HO 2 C or 0 NH, HOC cIHN NH 0 GONH, I 0 0 00 0 H H ,N N N N-G0(CH 2 8 GH(CH)CH 2 CH, H H NH 0 0 <)NH C0 2 HN HN 0 H H 2 C 0 H N H HN N- NH H 0 OC N O RH IN N H H NH 00 ONCH 3 CONH 2 N HN (CH 2 4 R 8 0 H 0 HN HO 0 H HN I N H0 0 H0 2 C (F9) and salts thereof; wherein: a) R I2 is H or CH 3 and b) each of and R 8 is independently amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino. The compound of Claim 9 wherein R 8 is amino, NH-amino protecting group, or carbamoyl.
11. The compound of Claim 10 wherein R 8 is amino.
12. The compound of Claim 9 wherein R' is amino, alkanoylamino, NH-amino protecting group.
13. The compound of Claim 12 wherein R' is a CIO-CI 3 alkanoylamino.
14. The compound of Claim 13 wherein R' is O H H N (CHCHCH(CH) 6 H(CH 3 )2 N (CH 2 )6CH(CH 3 )CH 2 CH 3 H O O H H N y (CH 2 )aCH(CH 3 )CH 2 CH 3 N (CH 2 B CH(H 3 2 O or o The compound of Claim 9 wherein R 12 is CH 3
16. The compound of Claim 15 wherein R' is alkanoylamino.
17. The compound of Claim 16 wherein R' is C 1 alkanoylamino. 426 H Ny (CH 2 6 CH(CH 3 )CH 2 CH 3 0
18. The compound of Claim 17 wherein R' is
19. The compound of Claim 9 selected from: R' (L-Trp)-D-GI u-L-Asn-L-Thr-Sar-L-Ala-L-Asp-D-Lys-L-Asp-G ly-D-Asn-L-Glu-L -Ile or R '(L-Trp)-D-Glu-L-Asn-L-Thr-Sar-L-Ala-L-Asp-D-Lys-L-Asp-Gly-D-Asn-L-3mGlu-L -Ile The compound of Claim 9 selected from H 0 H N-CO(CH 2 )CH(CH 3 )CH 3 N:C1 H H N-CO(CH),CH(CH)CHCH 3 NH 0) HN H0 2 C\ 0 H N-CO(H 2 6 CH 2 CH 2 CH 3 NH 0 HN HO, C\ 0 HN H 0 2 1. A compound of Formula F21 (CH 2 4 R 8 (F2 1) and salts thereof, wherein: 429 a) R' is 0 'N (0H 2 )BCH 3 H H H 1,,Ny (CH 2 6 CH(CH 3 2 \Ny (CH 2 6 CH(CH 3 )CH 2 CH 3 0 0 X Ny (0H 2 8 CH(CH 3 )CH 2 CH 3 0 H -Ny (CH 2 )BCH(CH 3 2 0 b) R 1 2 is H or CH 3 and c) R8* is amino, monosubstituted amino, disubstituted amino, NH-amino protecting group, acylamino, ureido, guanidino, carbamoyl, sulfonamino, thioacylamino, thioureido, iminoamino, or phosphonamino.
22. The compound of Claim 21 wherein R 8 is amino, NH-amino protecting group, or carbamoyl.
23. The compound of Claim 22 wherein R 8 is amino.
24. The compound of Claim 21 wherein R' is The compound of Claim 22 wherein R' is H Ny (CH 2 6 CH(CH 3 )CHCH 3 0 >,,Ny(CH 2 6 CH(CH 3 )CH 2 CH 3 0
26. Th compund ofClaim21 wheein R12 i ehl 26. The compound of Claim 21 wherein R 12is methyl.
28. The compound of Claim 21 selected from R' -(L-Trp)-D-Asn-L-Asp-L-Thr-Sar-L-Ala-L-Asp-D-Lys-L-omrAsp-G ly-D-Asn-L-3 mGlu-L-Ile or R' -(L--Trp)-D-Asn-L-Asp-L-T'hr-Sar-L-Ala-L-Asp-D-Lys-L-omAsp-G ly-D-Asn-L-Glu-Ll I le.
29. The compound of Claim 21 selected from H N -CO(CH 2 6 C H(CH 3 )C H 3 HN H 0 H N-CO(CH,),CH(CH)CHCH, HN NN OH, H0 0 HHO 2 C HN NH 0 0 0H 0 2 O 0 0 0 H0 H N N N-00~C(CH 2 6 0H0 2 H H H NH 0 0 O NH 2 NCH 3 C0 2 HN N HN 0 H H0 2 C 0 HN 0 H 0 HN N CH, H 0 0 H0 2 C or H0 2 C NH CONH 2 HN 0 0 0 HNO 0 0 0 H H 2NCNN N N-C(CH 2 6 0H(CH 3 )OH 3 H H NH 0 0 0 NH 2 NGH 3 C0 2 H/ N N HN 0 H H0 2 C 0 HN 0 H 0 HN N CH, H 0 0 H0 2 C A pharmaceutical composition comprising a compound of Claim I and a pharmaceutically acceptable carrier.
31. An antibacterial composition comprising a compound of Claim I in an aqueous buffer.
32. A method of treating a bacterial infection in a subject, comprising administering a therapeutically-effective amount of a compound according to Claim 1 to a subject in need thereof for a time and under conditions to ameliorate said bacterial infection.
33. Use of a compound according to Claim 1 for the manufacture of a medicament for treating a bacterial infection in a subject.
34. A composition comprising a compound of claim 1, wherein the compound is present in an amount of about 80% to about 90% of the composition. A composition comprising a compound of claim 1, wherein the compound is present in about 90% of the composition.
36. A composition comprising a compound of claim 1, wherein the compound is present in greater than about 90% of the composition.
37. A pharmaceutical composition comprising a compound of Claim 9 and a pharmaceutically acceptable carrier.
38. An antibacterial composition comprising a compound of Claim 9 in an aqueous buffer.
39. A method of treating a bacterial infection in a subject, comprising administering a therapeutically-effective amount of a compound according to Claim 9 to a subject in need thereof for a time and under conditions to ameliorate said bacterial infection. Use of a compound according to Claim 9 for the manufacture of a medicament for treating a bacterial infection in a subject.
41. A composition comprising a compound of claim 9, wherein the compound is present in an amount of about 80% to about 90% of the composition.
42. A composition comprising a compound of claim 9, wherein the compound is present in about 90% of the composition.
43. A composition comprising a compound of claim 9, wherein the compound is present in greater than about 90% of the composition. Date: 7 June 2007 434
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US62705604P | 2004-11-12 | 2004-11-12 | |
| US60/627,056 | 2004-11-12 | ||
| US71070505P | 2005-08-23 | 2005-08-23 | |
| US60/710,705 | 2005-08-23 | ||
| PCT/US2005/040919 WO2006110185A2 (en) | 2004-11-12 | 2005-11-11 | Antiinfective lipopeptides |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| AU2005330517A1 AU2005330517A1 (en) | 2006-10-19 |
| AU2005330517A2 true AU2005330517A2 (en) | 2006-10-19 |
Family
ID=37087468
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| AU2005330517A Abandoned AU2005330517A1 (en) | 2004-11-12 | 2005-11-11 | Antiinfective lipopeptides |
Country Status (10)
| Country | Link |
|---|---|
| EP (1) | EP1814588A2 (en) |
| JP (1) | JP2008519848A (en) |
| KR (1) | KR20070086038A (en) |
| AU (1) | AU2005330517A1 (en) |
| BR (1) | BRPI0517830A (en) |
| CA (1) | CA2587848A1 (en) |
| IL (1) | IL183109A0 (en) |
| NO (1) | NO20072634L (en) |
| RU (1) | RU2007121705A (en) |
| WO (1) | WO2006110185A2 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| PL2379580T3 (en) * | 2008-12-22 | 2014-05-30 | Merck Sharp & Dohme | Novel antibacterial agents for the treatment of gram positive infections |
| RU2013157188A (en) * | 2011-05-26 | 2015-07-10 | Кьюбист Фармасьютикалз, Инк. | COMPOSITIONS SV-183,315 AND WAYS RELATED TO THEM |
| KR101723649B1 (en) * | 2014-10-23 | 2017-04-06 | 서울대학교산학협력단 | Novel peptide compound, a preparing method thereof, and a use thereof |
| CN113061164B (en) * | 2021-03-29 | 2023-01-10 | 四川大学 | Cyclic lipopeptide compound and application thereof in anti-rheumatoid arthritis drugs |
| WO2023152229A1 (en) * | 2022-02-09 | 2023-08-17 | Teitur Trophics Aps | Novel peptides |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7408025B2 (en) * | 1999-12-15 | 2008-08-05 | Cubist Pharmaceuticals, Inc. | Lipopeptides as antibacterial agents |
| EP1240181A2 (en) * | 1999-12-15 | 2002-09-18 | Cubist Pharmaceuticals, Inc. | Daptomycin analogs as antibacterial agents |
| KR20020063230A (en) * | 1999-12-15 | 2002-08-01 | 큐비스트 파마슈티컬즈 인코포레이티드 | Novel lipopeptides as antibacterial agents |
| EP1421097A4 (en) * | 2001-08-06 | 2005-07-06 | Cubist Pharm Inc | Compositions and methods relating to the daptomycin biosynthetic gene cluster |
| NZ531493A (en) * | 2001-08-06 | 2006-03-31 | Cubist Pharm Inc | Novel depsipeptides and process for preparing same, useful in the treatment of bacterial infection |
-
2005
- 2005-11-11 CA CA002587848A patent/CA2587848A1/en not_active Abandoned
- 2005-11-11 EP EP05857738A patent/EP1814588A2/en not_active Withdrawn
- 2005-11-11 WO PCT/US2005/040919 patent/WO2006110185A2/en active Application Filing
- 2005-11-11 RU RU2007121705/04A patent/RU2007121705A/en not_active Application Discontinuation
- 2005-11-11 BR BRPI0517830-4A patent/BRPI0517830A/en not_active IP Right Cessation
- 2005-11-11 AU AU2005330517A patent/AU2005330517A1/en not_active Abandoned
- 2005-11-11 JP JP2007541346A patent/JP2008519848A/en not_active Withdrawn
- 2005-11-11 KR KR1020077013150A patent/KR20070086038A/en not_active Application Discontinuation
-
2007
- 2007-05-10 IL IL183109A patent/IL183109A0/en unknown
- 2007-05-24 NO NO20072634A patent/NO20072634L/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| RU2007121705A (en) | 2008-12-20 |
| WO2006110185A2 (en) | 2006-10-19 |
| WO2006110185A3 (en) | 2007-10-25 |
| IL183109A0 (en) | 2008-04-13 |
| JP2008519848A (en) | 2008-06-12 |
| EP1814588A2 (en) | 2007-08-08 |
| KR20070086038A (en) | 2007-08-27 |
| CA2587848A1 (en) | 2006-10-19 |
| AU2005330517A1 (en) | 2006-10-19 |
| BRPI0517830A (en) | 2008-10-21 |
| NO20072634L (en) | 2007-08-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU784942B2 (en) | Daptomycin analogs and their use as antibacterial agents | |
| AU784755B2 (en) | Daptomycin Analogs as antibacterial agents | |
| Kittilä et al. | Halogenation of glycopeptide antibiotics occurs at the amino acid level during non-ribosomal peptide synthesis | |
| US20070128694A1 (en) | Compositions and methods relating to the daptomycin biosynthetic gene cluster | |
| US20080051326A1 (en) | Antiinfective Lipopeptides | |
| WO2001044274A1 (en) | Lipopeptides as antibacterial agents | |
| HUT58820A (en) | Process for producing new polypeptides | |
| EP1809657A1 (en) | Cyclic nonapeptide amides | |
| AU2005330517A2 (en) | Antiinfective lipopeptides | |
| EP2271665B1 (en) | Highly bridged peptides from actinomadura namibiensis | |
| EP2531205A1 (en) | Actagardine derivatives, and pharmaceutical use thereof | |
| CN101189253A (en) | Antiinfective lipopeptides | |
| WO2003014297A2 (en) | Compositions and methods relating to the daptomycin biosynthetic gene cluster | |
| US6750199B2 (en) | Antimicrobial sulfonamide derivatives of lipopeptide antibiotics | |
| EP2872527B1 (en) | Novel lantipeptide | |
| EP1200460A1 (en) | Pseudomycin n-acyl side-chain analogs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| DA3 | Amendments made section 104 |
Free format text: THE NATURE OF THE AMENDMENT IS AS SHOWN IN THE STATEMENT(S) FILED 07 JUN 2007 |
|
| MK1 | Application lapsed section 142(2)(a) - no request for examination in relevant period |