AU2005240681A1 - Polynucleotides for the detection of Escherichia coli - Google Patents

Description

WO 2005/108578 PCT/CA2005/000694 POLYNUCLEOTIDES FOR THE DETECTION OF ESCHERICHIA COLI FIELD OF THE INVENTION The present invention pertains to the field of detection of microbial contaminants and, 5 in particular, the invention relates to the detection of contamination by Escherichia coli. BACKGROUND OF THE INVENTION Escherichia coli strains are widely distributed within the intestinal tracts of humans and warm-blooded animals. Most E. coli strains are considered harmless members of 10 the microflora of the intestinal tract, however, four particular groups of E. coli strains, referred to as the enterovirulent Escherichia coli group, are pathogenic and cause gastrointestinal illnesses. This bacterium is commonly associated with contamination of food and water arising from fecal contaminations and E. coli is commonly used as an indicator of fecal contamination for diagnostic purposes. [Conway, PL (1995) 15 Microbial ecology of the human large intestine. In: Human colonic bacteria: role in nutrition, physiology, and pathology, GR Gibson and GT Macfarlane, eds. pp.1-24. CRC Press, Boca Raton, FL.; Edberg, SC (2000) Escherichia coli: the best biological drinking water indicator for public health protection. Society for applied microbiology symposium series 29: 106S-116S; Neill, MA et al. (1994) Escherichia 20 coli. In: Foodborne Disease Handbook, YH Hui, JR Gorham, KD Murell, and DO Cliver, eds. Marcel Decker, Inc. New York. pp. 169-213]. In order to prevent E. coli infections, methods of detection can be utilized that identify the presence of the bacteria in food, prior to consumer availability and consumption. However, due to relatively quick rates of food spoilage, many detection techniques, which require long 25 time periods, are not time and cost effective. For example, a number of detection technologies require the culturing of bacterial samples for time periods of up to eight days. However, in that time, the product being tested must be placed in circulation for -1- WO 2005/108578 PCT/CA2005/000694 purchase and consumption. Therefore, a system that can rapidly identify the presence of E. coli in food samples is desirable. A variety of methods are described in the prior art for the detection of bacterial contaminants. One of these methods is the amplification of specific nucleotide 5 sequences using specific primers in a PCR assay. Upon completion of the amplification of a target sequence, the presence of an amplicon is detected using agarose gel electrophoresis. This method of detection, while being more rapid than traditional methods requiring culturing bacterial samples, is still relatively time consuming and subject to post-PCR contamination during the running of the agarose 10 gel. An additional technology utilized for detection of bacterial contamination, is nucleic acid hybridization. In such detection methodologies, the target sequence of interest is typically amplified and then hybridized to an oligonucleotide probe which possesses a complementary nucleic acid sequence to that of the target molecule. The probe can 15 be modified so that detection of the hybridization product may occur, for examples, the probe can be labelled with a radioisotope or fluorescent moiety. The general use of E. coli nucleic acid sequences for detection of this bacterium has been described. Many of the described detection methods, however, are specific for certain strains of E. coli, such as 0157, or are not specific forE. coli. For example, 20 U.S. Patent No. 5,654,417 describes DNA fragments useful for detecting E. coli 0157:H7 strains and U.S. Patent No. 6,365,723 describes genomic sequences, which can be used as diagnostic probes. These sequences are present in E.coli 0157:H7 but absent from E. coli K1 2. Similarly, Desmarchelier et al. (J. Clin. Microbiol. (1998) 36:1801-1804) describe a PCR-based method for detecting E. coli 0157 that involves 25 amplification of a region of the O-antigen synthesis genes followed by gel electrophoresis and Southern blot analysis to confirm the identify of the amplified fragment. The method was capable of identifying two serotypes of E. coli 0157; the 0157:H7 and 0157:H- serotypes. Another PCR-based protocol based on the amplification of the rfbB region of the O-antigen synthesis genes is described by 30 Maurer et al. (Appl. Environ. Microbiol. (1999) 65:2954-2960). More general -2- WO 2005/108578 PCT/CA2005/000694 methods are.provided in U.S. Patent 5,693,469 and 6,551,776, which describe hybridization assay probes complementary to E. coli rRNA sequences. In addition to hybridizing to E. coli sequences, however, these probes hybridize to other genus members and Shigella species. 5 A particularly useful modification of the above technology provides for the concurrent amplification and detection of the target sequence (i.e. in "real time") through the use of specially adapted oligonucleotide probes. Examples of such probes include molecular beacon probes (Tyagi et al., (1996) Nature Biotechnol. 14:303 308), TaqMan® probes (U.S. Patent Nos. 5,691,146 and 5,876,930) and Scorpion 10 probes (Whitcombe et al., (1999) Nature Biotechnol. 17:804-807). The use of TaqMan® probes to detect Escherichia coli in water samples is described by Frahm and Obst inJ. Microbiol. Methods (2003) 52:123-131. Molecular beacons represent a powerful tool for the rapid detection of specific nucleotide sequences and are capable of detecting the presence of a complementary 15 nucleotide sequence even in homogenous solutions. Molecular beacons can be described as hairpin stem-and-loop oligonucleotide sequences, in which the loop portion of the molecule represents a probe sequence, which is complementary to a predetermined sequence in a target nucleotide. One arm of the beacon sequence is attached to a fluorescent moiety, while the other arm of the beacon is attached to a 20 non-fluorescent quencher. The stem portion of the stem-and-loop sequence holds the two arms of the beacon in close proximity. Under these circumstances, the fluorescent moiety is quenched. When the beacon encounters a nucleic acid sequence complementary to its probe sequence, the probe hybridizes to the nucleic acid sequence, forming a stable complex and, as a result, the arms of the probe are 25 separated and the fluorophore emits light. Thus, the emission of light is indicative of the presence of the specific nucleic acid sequence. Individual molecular beacons are highly specific for the DNA sequences they are complementary to. A molecular beacon probe designed to specifically detect the E. coli 0157:H7 serotype has been described (Fortin et al., (2001) Analytical Biochem. 289:281-288). 30 The probe was designed to hybridise to an amplified target sequence from the rfbE 0 -3- WO 2005/108578 PCT/CA2005/000694 antigen synthesis gene of E.coli 0157:H7 that is either 496 base pair (bp) or 146 bp in length, depending on the primers used. The probe was also able to detect E. coli 0157:NM and 0157:H- serotypes, but was not intended to detect other strains of E. coli. 5 The prpR gene from several bacteria, including E. coli and Salmonella typhimurium has been characterized. The sequence of the prpR gene has extensive homology with numerous members of the sigma-54-dependent family of transcriptional activators. The PrpR protein is believed to be a transcriptional activator for the prp operon, which encodes enzymes involved in propionate catabolism [Blattner, FR, et al., 10 (1997) Science 277:1453-1474; Horswill, AR, and Escalante-Semerena, JC (1997) Journal ofBacteriology. 179:928-940; Shingler, V (1996) Molecular Microbiology. 19:409-416]. The function of the ykgM gene ofE. coli, on the other hand, has not been characterized. However, the amino acid sequence encoded by the ykgM gene has 15 similarities to the sequence of a 50S ribosomal protein. It is well known that the genomes of E. coli and Shigella spp. are very similar, which can make separate detection of these pathogens difficult. U.S. Patent Application No. 20030113731 describes primers with sequences designed to hybridise to a region of the E. coli genome that encodes three hypothetical proteins with unknown functions. 20 The primers are reported to amplify sequences from 64 subtypes and serotypes of E. coli and to discriminate an E. coli template from a Shigella template. This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of 25 the preceding information constitutes prior art against the present invention. SUMMARY OF THE INVENTION An object of the present invention is to provide polynucleotides for the detection of Escherichia coli. In accordance with one aspect of the present invention, there is -4- WO 2005/108578 PCT/CA2005/000694 provided a combination of polynucleotides for amplification and detection of E. coli nucleic acid sequences, said combination selected from the group of: (a) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-11; 5 a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-11 and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof; (b) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence 10 as set forth in any one of SEQ ID NOs:26-35; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35 and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof, and (c) a combination comprising a first polynucleotide primer 15 comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-1 i; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2 11, a third polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35; a fourth polynucleotide 20 primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35, a first polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:12, or the complement thereof, and a second polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the 25 complement thereof. In accordance with another aspect of the present invention, there is provided a method of detecting E. coli in a sample, said method comprising the steps of: (i) contacting a sample suspected of containing, or known to contain, E.coli with a first pair of polynucleotide primers capable of amplifying a first E. coli target sequence within the 30 prpR gene, or a second pair of polynucleotide primers capable of amplifying a second E. coli target sequence within the ykgM gene, or both said first and second pair of polynucleotide primers, under conditions that permit amplification of said target -5- WO 2005/108578 PCT/CA2005/000694 nucleotide sequence(s), and (ii) detecting any amplified target sequence(s), wherein detection of an amplified target sequence indicates the presence ofE. coli in the sample. In accordance with another aspect of the present invention, there is provided a method 5 of detecting E. coli in a sample, said method comprising the steps of: (i) contacting a sample suspected of containing, or known to contain, one or more E. coli target nucleotide sequences with a combination of polynucleotides of the invention under conditions that permit amplification of said target sequence(s), and (ii) detecting any amplified target sequence(s), wherein detection of an amplified target sequence 10 indicates the presence of E.coli species in the sample. In accordance with another aspect of the present invention, there is provided a kit for the detection of E. coli, said kit comprising a combination of polynucleotides selected from the group of: (a) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one 15 of SEQ ID NOs:2-11; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2 11 and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:12, or the complement thereof; (b) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides 20 of the sequence as set forth in any one of SEQ ID NOs:26-35; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35 and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof, and (c) a combination comprising a first 25 polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-11; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-11, a third polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35; 30 a fourth polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35, a first polynucleotide -6- WO 2005/108578 PCT/CA2005/000694 probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:12, or the complement thereof, and a second polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof. 5 In accordance with another aspect of the present invention, there is provided a pair of polynucleotide primers for amplification of a portion of an E. coli prpR gene, said pair ofpolynucleotide primers comprising: (a) a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-11; and (b) a second polynucleotide primer comprising at least 7 consecutive 10 nucleotides of a sequence complementary to any one of SEQ ID NOs:2-11. In accordance with another aspect of the present invention, there is provided a pair of polynucleotide primers for amplification of a portion of an E. coli genome comprising the 3' region of the ykgM gene, said pair dfpolynucleotide primers comprising: (a) a first polynucleotide primer comprising at least 7 consecutive nucleotides of the 15 sequence as set forth in any one of SEQ ID NOs:26-35; and (b) a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35. In accordance with another aspect of the present invention, there is provided an isolated E. coli specific polynucleotide consisting essentially of: (a) the sequence as 20 set forth in SEQ ID NO: 12 or SEQ ID NO:36, or a fragment of said sequence, or (b) a sequence that is the complement of (a). In accordance with another aspect of the present invention, there is provided a polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of an E. coli prpR gene, said polynucleotide primer 25 comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:12, or the complement thereof. In accordance with another aspect of the present invention, there is provided a polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of an E. coli genome comprising the 3' region of the ykgM -7- WO 2005/108578 PCT/CA2005/000694 gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof. In accordance with another aspect of the present invention, there is provided a polynucleotide probe of between 7 and 100 nucleotides in length for detection of E. 5 coli, said polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:12 or 36, or the complement thereof. BRIEF DESCRIPTION OF THE DRAWINGS These and other features of the invention will become more apparent in the following detailed description in which reference is made to the appended drawings wherein: 10 Figure 1 presents a multiple sequence alignment showing conserved regions of a portion of the prpR gene from various E. coli strains [SEQ ID NOs:2-11]. The sequences depicted represent the non-coding strand of the gene. Shaded blocks highlight the following regions: bases 469 to 490: forward primer SEQ ID NO:14; bases 519 to 541: binding site for a molecular beacon probe [SEQ ID NO:16]; bases 15 571 to 588: binding site for reverse primer [SEQ ID NO:15]; Figure 2 presents the arrangement of PCR primers and a molecular beacon probe on the prpR gene sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs:14 & 15; 20 Figure 3 presents the secondary structure of a molecular beacon probe in accordance with one embodiment of the invention [SEQ ID NO:16]; Figure 4 presents a multiple sequence alignment of a portion of the ykgM gene and the region of the genome adjacent to the 3' end of the ykgM gene from several isolates of E. coli [SEQ ID NOs:26-35]. The sequences depicted represent the non-coding strand. 25 Shaded blocks highlight the following regions: bases 212 to 232 : forward primer SEQ ID NO:38; bases 249 to 276: binding site for a molecular beacon probe [SEQ ID NO:40]; bases 336 to 355: binding site for reverse primer SEQ ID NO:39; -8- WO 2005/108578 PCT/CA2005/000694 Figure 5 presents the arrangement of PCR primers and a molecular beacon probe on the ykgM consensus sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs:38 & 39; 5 Figure 6 presents the secondary structure of a molecular beacon probe in accordance with one embodiment of the invention [SEQ ID NO:40]; Figure 7 presents (A) the sequence of a portion of an E. coliprpR gene [SEQ ID NO: 1] comprising the prpR consensus sequence identified in one embodiment of the invention, (B) the sequence oftheprpR conserved region (consensus sequence) [SEQ 10 ID NO: 12]. The following abbreviations are used to represent multiple bases: Y = T or C, R= A or G, S = G or C, M = A or C, and W = T or A, and (C) the sequence of a highly conserved region [SEQ ID NO:13] identified within the consensus sequence, and Figure 8 presents (A) the sequence (non-coding strand) of an E. coli ykgM gene [SEQ 15 ID NO:25] and (B) the sequence of the E. coli ykgM consensus sequence [SEQ ID NO:36], (C) the sequence of a highly conserved region [SEQ ID NO:37] identified within the consensus sequence. The following abbreviations are used to represent multiple bases: Y = T or C and R = A or G. DETAILED DESCRIPTION OF THE INVENTION 20 The present invention is based on the identification of highly conserved regions (consensus sequences) within the E. coli genome that are common to known E. coli strains, but absent from other bacterial species including Shigella species. The consensus sequences constitute suitable target sequences for the design of primers and probes capable of specifically amplifying and detecting nucleic acids sequences from 25 one or more E. coli strains in a test sample. The present invention thus provides for primer and probe sequences capable of amplifying and/or detecting all or part of an E. coli consensus sequence that are suitable for use in detecting the presence of various E. coli strains in a sample, such as -9- WO 2005/108578 PCT/CA2005/000694 a clinical sample, microbiological pure culture, or a sample related to food, environmental or pharmaceutical quality control processes. The present invention contemplates methods of detecting E. coli strains in a sample using primers and/or probes targeting a single consensus sequence, as well as methods using combinations 5 of primer and/or probe sets, wherein each set targets the same or different consensus sequences. In one embodiment, the use of such combinations increases the specificity of detection. In one embodiment, the invention provides diagnostic assays that can be carried out in real time and addresses the need for rapid detection of E. coli in a variety of biological samples. 10 In one embodiment, the primers and probes provided by the present invention are capable of distinguishing E. coli target sequences from Shigella sequences, i.e. specifically amplify and/or detect E. coli-sequences but not Shigella sequences. In addition, the primers and probes of the invention demonstrate a specificity for E. coli nucleic acid sequences of at least 95%, as defined herein. In one embodiment, the 15 primers and probes of the invention demonstrate a specificity for E. coli nucleic acid sequences of at least 97%. In another embodiment, the primers and probes of the invention demonstrate a specificity for E. coli nucleic acid sequences of at least 98%. In further embodiments, the primers and probes of the invention demonstrate a specificity for E. coli nucleic acid sequences of at least 99%, and at least 99.5%. 20 As indicated above, combinations of primer and probe sets that target the same or different E. coli consensus sequences are also contemplated for the detection of E. coli. Such combinations can demonstrate greater specificity than one, or both, of the sets of primers/probes alone. In accordance with one embodiment of the invention, therefore, there is provided a combination of primer and/or probe sets that target 25 different consensus sequences and which demonstrate a specificity for E. coli of at least 98%. In another embodiment, there is provided a combination of primer and/or probe sets that target different consensus sequences and which demonstrate a specificity for E. coli of at least 99%. In a further embodiment, there is provided a combination of primer and/or probe sets that target different consensus sequences and 30 which demonstrate a specificity for E. coli of at least 99.5%. -10- WO 2005/108578 PCT/CA2005/000694 In contrast to previously described primers and probes, which are often specific for a certain strain of E. coli, the sensitivity of the primers and probes of the present invention make them suitable for detecting a wide variety of E. coli strains, thus the primers/probes are broadly applicable in a range of settings. In accordance with one 5 embodiment of the invention, the primers and probes demonstrate a sensitivity in detecting E. coli strains of at least 90%. In another embodiment, the primers and probes demonstrate a sensitivity of at least 91%. In further embodiments, the primers and probes demonstrate a sensitivity of at least 92%. As discussed above with respect to specificity, combinations of primers/probes that 10 target the same or different E. coli consensus sequences can be employed in detection assays in order to increase the sensitivity of detection, if desired. Thus, in one embodiment, the present invention provides for a combination of primer and probe sets that target different consensus sequences and which demonstrate a sensitivity of at least 95%. In another embodiment, there is provided a combination of primer and 15 probe sets that target different consensus sequences and which demonstrate a sensitivity of at least 96%. In further embodiments, there are provided combinations of primer and probe sets that target different consensus sequences and which demonstrate a sensitivity of at least 97%, and at least 98%. Definitions 20 Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms "oligonucleotide" and "polynucleotide" as used interchangeably in the present application refer to a polymer of greater than one nucleotide in length of 25 ribonucleic acid (RNA), deoxyribonucleic acid (DNA), hybrid RNA/DNA, modified RNA or DNA, or RNA or DNA mimetics. The polynucleotides may be single- or double-stranded. The terms include polynucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as polynucleotides having non-naturally-occurring portions which function similarly. -11- WO 2005/108578 PCT/CA2005/000694 Such modified or substituted polynucleotides are well-known in the art and for the purposes of the present invention, are referred to as "analogues." The terms "primer" and "polynucleotide primer," as used herein, refer to a short, single-stranded polynucleotide capable of hybridizing to a complementary sequence 5 in a nucleic acid sample. A primer serves as an initiation point for template dependent nucleic acid synthesis. Nucleotides are added to a primer by a nucleic acid polymerase in' accordance with the sequence of the template nucleic acid strand. A "primer pair" or "primer set" refers to a set of primers including a 5'upstream primer that hybridizes with the 5' end of the sequence to be amplified and a 3' downstream 10 primer that hybridizes with the complementary 3' end of the sequence to be amplified. The term "forward primer" as used herein, refers to a primer which anneals to the 5' end of the sequence to be amplified. The term "reverse primer", as used herein, refers to a primer which anneals to the complementary 3' end of the sequence to be amplified. 15 The terms "probe" and "polynucleotide probe," as used herein, refer to a polynucleotide used for detecting the presence of a specific nucleotide sequence in a sample. Probes specifically hybridize to a target nucleotide sequence, or the complementary sequence thereof, and can be single- or double-stranded. The term "specifically hybridize," as used herein, refers to the ability of a 20 polynucleotide to bind detectably and specifically to a target nucleotide sequence. Polynucleotides specifically hybridize to target nucleotide sequences under hybridization and wash conditions that minimize appreciable amounts of detectable binding to non-specific nucleic acids. High stringency conditions can be used to achieve specific hybridization conditions as is known in the art. Typically, 25 hybridization and washing are performed at high stringency according to conventional hybridization procedures and employing one or more washing step in a solution comprising 1-3 x SSC, 0.1-1% SDS at 50-70 0 C for 5-30 minutes. The term "specificity," as used herein, refers to the ability of a primer or primer pair to amplify, or a probe to detect, nucleic acid sequences from E. coli but not other 30 bacterial species. "% specificity" is defined by a negative validation test as described -12- WO 2005/108578 PCT/CA2005/000694 herein whereby the primers and/or probe are tested against a panel of at least 100 bacterial species other than E. coli. Thus, for example, a pair of primers that does not amplify any nucleic acid sequences from the panel of bacterial species would be defined as demonstrating 100% specificity and a pair of primers that amplified a 5 nucleic acid sequence from one bacterial species in a panel of 100 species would be defined as demonstrating 99% specificity. The term "sensitivity," as used herein, refers to the ability of a primer or primer pair to amplify, or a probe to detect, nucleic acid sequences from a range of E.coli strains. "% sensitivity" is defined by a positive validation test as described herein whereby the 10 primers and/or probe are tested against a panel of at least 100 E. coli strains. Thus, for example, a pair of primers that amplifies nucleic acid sequences from all E. coli strains in the panel would be defined as demonstrating 100% sensitivity and a pair of primers that amplified nucleic acid sequences from ninety E. coli strains in a panel of 100 strains would be defined as demonstrating 90% sensitivity. 15 The term "corresponding to" refers to a polynucleotide sequence that is identical to all or a portion of a reference polynucleotide sequence. In contradistinction, the term "complementary to" is used herein to indicate that the a polynucleotide sequence is identical to all or a portion of the complementary strand of a reference polynucleotide sequence. For illustration, the nucleotide sequence "TATAC" corresponds to a 20 reference sequence "TATAC" and is complementary to a reference sequence "GTATA." The terms "hairpin" or "hairpin loop" refer to a single strand of DNA or RNA, the ends of which comprise complementary sequences, whereby the ends anneal together to form a "stem" and the region between the ends is not annealed and forms a "loop." 25 Some probes, such as molecular beacons, have such "hairpin" structure when not hybridized to a target sequence. The loop is a single-stranded structure containing sequences complementary to the target sequence, whereas the stem self-hybridises to form a double-stranded region and is typically unrelated to the target sequence, however, nucleotides that are both complementary to the target sequence and that can 30 self-hybridise can also be included in the stem region. -13- WO 2005/108578 PCT/CA2005/000694 The terms "target sequence" or "target nucleotide sequence," as used herein, refer to a particular nucleic acid sequence in a test sample to which a primer and/or probe is intended to specifically hybridize. A "target sequence" is typically longer than the primer or probe sequence and thus can contain multiple "primer target sequences" and 5 "probe target sequences." A target sequence may be single- or double-stranded. The term "primer target sequence" as used herein refers to a nucleic acid sequence in a test sample to which a primer is intended to specifically hybridize. The term "probe target sequence" refers to a nucleic acid sequence in a test sample to which a probe is intended to specifically hybridize. 10 As used herein, the term "about" refers to a +/-10% variation from the nominal value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to. Target Sequences In order to identify potential target sequences in the E. coli genome, a comparative 15 analysis of the two genomes of E. coli K12 and the genome of Shigellaflexneri was conducted to identify regions that are unique to E. coli. These sequences were then searched against the E. coli 0157:H7 genome to ensure that they are shared by E. coli K12 and E. coli 0157:H7. Two regions of the genome corresponding to the genes, prpR and ykgM, were identified as sources of target sequences for the specific 20 detection of E. coli. Multiple sequence alignments conducted using portions of the prpR or ykgM gene sequences from a range of E. coli strains identified highly conserved regions associated with each gene that can serve as E. coli specific target sequences. Multiple sequence alignment analysis of a portion of E. coliprpR gene sequences 25 identified a 120 nucleotide region oftheprpR gene sequence, having a sequence corresponding to SEQ ID NO:12 (shown below and in Figure 7), as being generally conserved in the various E. coli strains. 5'-GCTAATGACCCGYACATCYACCGGAACAGGCTGATGCCCGCCGACGC -14- WO 2005/108578 PCT/CA2005/000694 GGGTGACCTCTTTTTCTTCCAGCACCCGYARCAGSCGRGTCTGCAAMGGY AGCGGCATTTCGCCWATCTCRTC-3' [SEQ ID NO:12] wherein: Y = T or C, R =A or G, S =G or C, M = A or C, and W =T or A. This sequence is referred to herein as theprpR consensus sequence. An exemplary 5 multiple sequence alignment of portions of the non-coding strand of the prpR gene is shown in Figure 1. One skilled in the art will appreciate that similar alignments can be conducted using shorter sequences and/or the coding strand of the gene, such as the region shown in Figure 7A [SEQ ID NO: 1]. Similarly, multiple sequence alignment analysis of a region of the E. coli genome 10 encompassing the 3' end of the ykgM gene (non-coding strand, as shown in Figure 4, SEQ ID NOs:26-35) identified a 144 nucleotide region having a sequence corresponding to SEQ ID NO:36 (shown below and in Figure 8), as being generally conserved in the various E. coli strains. This sequence is referred to herein as the ykgM consensus sequence. 15 5'-CTTCACAATCTGACAGTCTGGATGGCGTTCTTTTGCGGTACGCAGAGA GTTAAGRACTTTCATCAYGCCCCCTTTTTCGTGCTAACAAAACGACCAAAA I CGTTGGGTGAAYCGTGCAACATTTCCTTCTGATGCCACTGTTCTC-3' [SEQ ID NO:36] wherein: Y = T or C and R = A or G. 20 Accordingly in one embodiment, the present invention provides isolated E. coli specific polynucleotides consisting of the consensus sequence as set forth in SEQ ID NO:12 (shown in Figure 7), or in SEQ ID NO:36 (shown in Figure 8), or the complement of these sequences, that can be used as target sequences for the design of primers and/or probes for the specific detection of E. coli. 25 It will be recognised by those skilled in the art that all, or a portion, of the consensus sequences set forth in SEQ ID NO:12 and SEQ ID NO:36 can be used as target sequences for the specific detection of E. coli. Thus, in one embodiment of the invention, target sequences suitable for the specific detection of E. coli are provided that comprise at least 60% of the sequence set forth in SEQ ID NO:12 or 36, or the - 15- WO 2005/108578 PCT/CA2005/000694 complement thereof. In another embodiment, the target sequences comprise at least 75% of the sequence set forth in SEQ ID NO:12 or 36, or the complement thereof. In a further embodiment, the target sequences comprise at least 80% of the sequence set forth in SEQ ID NO: 12 or 36, or the complement thereof. Target sequences 5 comprising at least 85%, 90%, 95% and 98% of the sequence set forth in SEQ ID NO:12 or 36, or the complement thereof, are also contemplated. Alternatively, such portions of the consensus sequences can be expressed in terms of consecutive nucleotides of the sequence set forth in SEQ ID NO: 12 or 36. Accordingly, target sequences comprising portions of the consensus sequences that 10 include at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100 and at least 105 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12 or 36, or the complement thereof, are contemplated. By "at least 65 consecutive nucleotides" it is meant that the target sequence may comprise any number of consecutive nucleotides between 65 and the full length of the sequence set 15 forth in SEQ ID NO:12 or 36 (i.e. 120 or 144 nucleotides, respectively), thus this range includes portions of the consensus sequence that comprise at least 66, at least 67, at least 68, at least 69, etc, consecutive nucleotides of the sequence set forth in SEQ ID NO:12 or 36. Within the identified consensus sequences, additional highly conserved regions were 20 identified. The highly conserved region of the prpR consensus sequence thus identified is 23 nucleotides in length and has a sequence corresponding to SEQ ID NO: 13 (as shown below and in Figure 7C). 5'-TGACCTCTTTTTCTTCCAGCACC-3' [SEQ ID NO:13] The highly conserved region of the ykgM consensus sequence is 28 nucleotides in 25 length and has a sequence corresponding to SEQ ID NO:37 (as shown below and in Figure 8C). 5'-GTACGCAGAGAGTTAAGRACTTTCATCA-3' [SEQ ID NO:37] wherein: R = A or G. - 16- WO 2005/108578 PCT/CA2005/000694 Accordingly, one embodiment of the present invention provides for target sequences that comprise all or a portion of a sequence corresponding to SEQ ID NO: 13 or 37, or the complement thereof. It will also be appreciated that the target sequences may include additional nucleotide 5 sequences that are found upstream and/or downstream of the consensus sequence in the E. coli genome. As the assays provided by the present invention typically include an amplification step, it may be desirable to select an overall length for the target sequence such that the assay can be conducted fairly rapidly. Thus, the target sequence typically has an overall length of less than about 500 nucleotides. In one 10 embodiment, the target sequence has an overall length of less than about 400 nucleotides. In another embodiment, the target sequence has an overall length of less than about 350 nucleotides. In other embodiments, the target sequence has an overall length of less than or equal to about 300, about 250, about 200, and about 150 nucleotides. 15 Polynucleotide Primers and Probes The present invention provides for polynucleotides for the amplification and/or detection of E. coli nucleic acids in a sample. The polynucleotide primers and probes of the invention comprise a sequence that corresponds to or is complementary to the portion of the E. coliprpR gene shown in any one of SEQ ID NOs:2-11 or the region 20 of the E. coli genome encompassing the 3' end of the ykgM gene as shown in any one of SEQ ID NOs:26-35 (referred to herein as the ykgM 3' region) that are capable of specifically hybridizing to E. coli nucleic acids. In one embodiment, the polynucleotides of the invention comprise a sequence that corresponds to or is complementary to a portion of the E. coliprpR gene sequence as set forth in SEQ ID 25 NO: 1 or the regions of the ykgM 3'region as set forth in SEQ ID NOs:26-35. The polynucleotides of the present invention are generally between about 7 and about 100 nucleotides in length. One skilled in the art will understand that the optimal length for a selected polynucleotide will vary depending on its intended application (i.e. primer, probe or combined primer/probe) and on whether any additional features, 30 such as tags, self-complementary "stems" and labels (as described below), are to be -17- WO 2005/108578 PCT/CA2005/000694 incorporated. In one embodiment of the present invention, the polynucleotides are between about 10 and about 100 nucleotides in length. In another embodiment, the polynucleotides are between about 12 and about 100 nucleotides in length. In other embodiments, the polynucleotides are between about 12 and about 50 nucleotfdes and 5 between about 12 and about 40 nucleotides in length. One skilled in the art will also understand that the entire length of the polynucleotide primer or probe does not need to correspond to or be complementary to its target sequence within the E. coli prpR gene or ykgM 3' region in order to specifically hybridize thereto. Thus, the polynucleotide primers and probes may comprise 10 nucleotides at the 5' and/or 3' ternmini that are not complementary to the target sequence. Such non-complementary nucleotides may provide additional functionality to the primer/probe, for example, they may provide a restriction enzyme recognition sequence or a "tag" that facilitates detection, isolation or purification. Alternatively, the additional nucleotides may provide a self-complementary sequence that allows the 15 primer/probe to adopt a hairpin configuration. Such configurations are necessary for certain probes, for example, molecular beacon and Scorpion probes. The present invention also contemplates that one or more position within the polynucleotide can be degenerate, i.e. can be filled by one of two or more alternate nucleotides. As is known in the art, certain positions in a gene can vary in the 20 nucleotide that is present at that position depending on the strain of bacteria that the gene originated from. By way of example, position 487 of the alignment shown in Figure 1 can contain a thymine ("T") nucleotide or a cytosine ("C") nucleotide depending on which strain of E. coli the prpR gene originates from. Thus, a "degenerate" primer or probe can be designed to target this sequence that contains 25 either a T or a C at the position corresponding to position 487 in the alignment. Degenerate primers or probes are typically prepared by synthesising a "pool" of polynucleotide primers or probes that contains approximately equal amounts of, for example, a polynucleotide containing a T at the degenerate position and a polynucleotide containing a C at the degenerate position. - 18 - WO 2005/108578 PCT/CA2005/000694 Typically, the polynucleotide primers and probes of the invention comprise a sequence of at least 7 consecutive nucleotides that correspond to or are complementary to a portion of the E. coli sequences shown in any one of SEQ ID) NOs:2-11 or 26-35. As is known in the art, the optimal length of the sequence 5 corresponding or complementary to the target E. coli sequences will be dependent on the specific application for the polynucleotide, for example, whether it is to be used as a primer or a probe and, if the latter, the type of probe. Optimal lengths can be readily determined by the skilled artisan. In one embodiment, the polynucleotides comprise at least 10 consecutive nucleotides 10 corresponding or complementary to a portion of the E. coli sequences shown in any one of SEQ ID NOs:2-11 or 26-35. In another embodiment, the polynucleotides comprise at least 12 consecutive nucleotides corresponding or complementary to a portion of the E. coli sequences shown in any one of SEQ ID NOs:2-11 or 26-35. In a further embodiment, the polynucleotides comprise at least 15 consecutive nucleotides 15 corresponding or complementary to a portion of the E. coli sequences shown in any one of SEQ ID NOs:2-11 or 26-35. Polynucleotides comprising at least 18, at least 20, at least 22, at least 24, at least 26, at least 27 and at least 28 consecutive nucleotides corresponding or complementary to a portion of the E. coli sequences shown in any one of SEQ ID NOs:2-11 or 26-35 are also contemplated. 20 Sequences of exemplary polynucleotides of the invention are set forth in Table 1. Further non-limiting examples for the polynucleotides of the invention include polynucleotides that comprise at least 7 consecutive nucleotides of any one of SEQ ID NOs:14, 15, 17, 19, 20, 22, 24, 38, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 and 63. 25 Table 1: Exemplary polynucleotides of the invention Target gene Nucleotide sequence SEQ ID NO prpR 5'-GCTAATGACCCGTACATCTACC-3' 14 prpR 5'-GATGAGATTGGCGAAATG-3' 15 prpR 5'-TGACCTCTTI1TCTTCCAGCACC-3' 17 -19- WO 2005/108578 PCT/CA2005/000694 Target gene Nucleotide sequence SEQ ID NO prpR 5'-GGTGCTGGAAGAAAAAGAGGTCA-3' 19 prpR 5'-CTACCGGAACAGGCTGATG-3' 20 prpR 5'-GTGACCTCTTTTCTTCCAGCACC-3' 22 prpR 5'-GGTGCTGGAAGAAAAAGAGGTCAC-3' 24 ykgM 5'-CTTCACAATCTGACAGTCTGG-3' 38 ykgM 5'-GAGAACAGTGGCATCAGAAG-3' 39 ykgM 5'-GTACGCAGAGAGTTAAGRIACTTTCATCA-3' 41 ykgM 5'-TGATGAAAGTY 2 CTTAACTCTCTGCGTAC-3' 43 ykgM 5 '-CATCACGCCCCCTTTTTCG-3' 45 ykgM 5'-CGAAAAAGGGGGCGTGATG-3' 47 ykgM 5 '-CATCACGCCCCCTTTTTC-3' 49 ykgM 5'-GAAAAAGGGGGCGTGATG-3' 51 ykgM 5'-CCCCTTTTTCGTGCTAACAAAACG-3' 53 ykgM 5'-CGTTITGTTAGCACGAAAAAGGGG-3' 55 ykgM 5'-CATCAYGM 3 CCCCTTITCG-3' 57 ykgM 5'-CGAAAAAGGGGK 4 CR'TGATG-3' 59 ykgM 5'-CATCAIsGICCCCTTTTTCG-3' 61 ykgM 5'-CGAAAAAGGGGICITGATG-3' 63 SR represents A or G 2 Y represents T or C 3 M represents A or C 4 K represents T or G 5 sI represents inosine Primers As indicated above, the polynucleotide primers of the present invention comprise a sequence that corresponds to or is complementary to a portion of the E. coli sequences -20 - WO 2005/108578 PCT/CA2005/000694 shown in any one of SEQ ID NOs:2-11 or 26-35. In accordance with the invention, the primers are capable of amplifying a target nucleotide sequence comprising all or a portion of the 120 nucleotide consensus sequence as shown in SEQ ID NO: 12, or comprising all or a portion of the 144 nucleotide consensus sequence as shown in 5 SEQ ID NO:36. Accordingly in one embodiment, the present invention provides for primer pairs capable of amplifying an E. coli target nucleotide sequence, wherein the target sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of SEQ ID NO:12 or 36, or the complement thereof. Thus, pairs of primers can be selected to comprise a forward primer corresponding to 10 a portion of the E. coliprpR gene sequence upstream of or within the region of the gene corresponding to SEQ ID NO:12 and a reverse primer that it is complementary to a portion of the E. coli prpR gene sequence downstream of or within the region of the gene corresponding to SEQ ID NO: 12. Similarly, pairs of primers can be selected to comprise a forward primer corresponding to a portion of the E. coli ykgM 3' region 15 upstream of or within the region corresponding to SEQ ID NO:36 and a reverse primer that it is complementary to a portion of the E. coli ykgM 3'region downstream of or within the region corresponding to SEQ ID NO:36. In accordance with the present invention, the primers comprise at least 7'consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs:2-11 or 26-35. In one 20 embodiment, the primers comprise at least 7 consecutive nucleotides of SEQ ID NO: 1. In another embodiment, the primers comprise at least 7 consecutive nucleotides of the sequence set forth in SEQ ID NO:12 or 36. Appropriate primer pairs can be readily determined by a worker skilled in the art. In general, primers are selected that specifically hybridize to the appropriate region of 25 the E. coli genome, as described above. In addition, primers are selected that contain minimal sequence repeats and that demonstrate a low potential of forming dimers, cross dimers, or hairpin structures and of cross priming. Such properties can be determined by methods known in the art, for example, using the computer modelling program OLIGO® Primer Analysis Software (distributed by National Biosciences, 30 Inc., Plymouth, MN). -21- WO 2005/108578 PCT/CA2005/000694 Non-limiting examples of suitable primer sequences include sequnces that comprise SEQ ID NO:14, 15, 20, 38 or 39 shown in Table 1, as well as primers comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs:14, 15, 17, 19, 20, 22, 24, 38, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63. 5 Probes In order to specifically detect E. coli, the probe polynucleotides of the invention are designed to correspond to or be complementary to a portion of the consensus sequences shown in SEQ ID NO:12 and 36. The probe polynucleotides, therefore, comprise at least 7 consecutive nucleotides of the sequence set forth in SEQ ID 10 NO:12 or 36, or the complement thereof. As indicated above, highly conserved regions were identified within the E.coli consensus sequences. In one embodiment, therefore, the present invention provides for probe polynucleotides comprising at least 7 consecutive nucleotides of the sequence set forth in SEQ ID NO: 13 or 37, or the complement thereof. 15 Non-limiting examples of suitable probe sequences include sequences that comprise SEQ ID NO:17, 19, 22, 24, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63 shown in Table 1, as well as probes comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs:14, 15, 17, 19, 20, 22, 24, 38, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63. In one embodiment, the probes comprises at least 7 consecutive nucleotides 20 of any one of SEQ ID NOs: 17, 19, 22, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63. Various types of probes known in the art are contemplated by the present invention. For example, the probe may be a hybridization probe, the binding of which to a target nucleotide sequence can be detected using a general DNA binding dye such as ethidium bromide, SYBR® Green, SYBR® Gold and the like. Alternatively, the probe 25 can incorporate one or more detectable labels. Detectable labels are molecules or moieties a property or characteristic of which can be detected directly or indirectly and are chosen such that the ability of the probe to hybridize with its target sequence is not affected. Methods of labelling nucleic acid sequences are well-known in the art (see, for example, Ausubel et al., (1997 & updates) Current Protocols in Molecular 30 Biology, Wiley & Sons, New York). - 22 - WO 2005/108578 PCT/CA2005/000694 Labels suitable for use with the probes of the present invention include those that can be directly detected, such as radioisotopes, fluorophores, chemiluminophores, enzymes, colloidal particles, fluorescent microparticles, and the like. One skilled in the art will understand that directly detectable labels may require additional 5 components, such as substrates, triggering reagents, light, and the like to enable detection of the label. The present invention also contemplates the use of labels that are detected indirectly. Indirectly detectable labels are typically specific binding members used in conjunction with a "conjugate" that is attached or coupled to a directly detectable label. Coupling chemistries for synthesising such conjugates are 10 well-known in the art and are designed such that the specific binding property of the specific binding member and the detectable property of the label remain intact. As used herein, "specific binding member" and "conjugate" refer to the two members of a binding pair, i.e. two different molecules, where the specific binding member binds specifically to the probe, and the "conjugate" specifically binds to the specific binding 15 member. Binding between the two members of the pair is typically chemical or physical in nature. Examples of such binding pairs include, but are not limited to, antigens and antibodies; avidin/streptavidin and biotin; haptens and antibodies specific for haptens; complementary nucleotide sequences; enzyme cofactors / substrates and enzymes; and the like. 20 In one embodiment of the present invention, the probe is labelled with a fluorophore. The probe may additionally incorporate a quencher for the fluorophore. Fluorescently labelled probes can be particularly useful for the real-time detection of target nucleotide sequences in a test sample. Examples of probes that are labelled with both a fluorophore and a quencher that are contemplated by the present invention include, 25 but are not limited to, molecular beacon probes and TaqMan probes. Such probes are well known in the art (see for example, U.S. Patent Nos. 6,150,097; 5,925,517 and 6,103,476; Marras et al., "Genotyping single nucleotide polymorphisms with molecular beacons." In Kwok, P.Y. (ed.), "Single nucleotide polymorphisms: methods and protocols," Vol. 212, pp. 111-128, Humana Press, Totowa, NJ.) 30 A molecular beacon probe is a hairpin shaped oligonucleotide sequence, which undergoes a conformational change when it hybridizes to a perfectly complementary - 23 - WO 2005/108578 PCT/CA2005/000694 target sequence. The secondary structure of a typical molecular beacon probe includes a loop sequence, which is capable of hybridizing to a target sequence and a pair of arm (or "stem") sequences. One arm is attached to a fluorophore, while the other arm is attached to a quencher. The arm sequences are complementary to each other so as 5 to enable the arms to hybridize together to form a molecular duplex and the beacon adopts a hairpin conformation in which the fluorophore and quencher are in close proximity and interact such that emission of fluorescence is prevented. Hybridization between the loop sequence and the target sequence forces the molecular beacon probe to undergo a conformational change in which arm sequences are forced apart and the 10 fluorophore is physically separated from the quencher. As a result, the fluorescence of the fluorophore is restored. The fluorescence generated can be monitored and related to the presence of the target nucleotide sequence. If no target sequence is present in the sample, no fluorescence will be observed. This methodology, as described further below, can also be used to quantify the amount of target nucleotide in a sample. By 15 way of example, Figures 3 and 6 depict the secondary structure of exemplary hairpin loop molecular beacons having sequences corresponding to SEQ ID NO: 16 and 40, respectively. Wavelength-shifting molecular beacon probes which incorporate two fluorophores, a "harvester fluorophore and an "emitter" fluorophore (see, Kramer, et al., (2000) 20 Nature Biotechnology, 18:1191-1196) are also contemplated. When a wavelength shifting molecular beacon binds to its target sequence and the hairpin opens, the energy absorbed by the harvester fluorophore is transferred by fluorescence resonance energy transfer (FRET) to the emitter, which then fluoresces. Wavelength-shifting molecular beacons are particularly suited to multiplex assays. 25 TaqMan ® probes are dual-labelled fluorogenic nucleic acid probes that function on the same principles as molecular beacons. TaqMan® probes are composed of a polynucleotide that is complementary to a target sequence and is labelled at the 5' terminus with a fluorophore and at the 3' terminus with a quencher. TaqMan ® probes, like molecular beacons, are typically used as real-time probes in amplification 30 reactions. In the free probe, the close proximity of the fluorophore and the quencher ensures that the fluorophore is internally quenched. During the extension phase of the - 24 - WO 2005/108578 PCT/CA2005/000694 amplification reaction, the probe is cleaved by the 5' nuclease activity of the polymerase and the fluorophore is released. The released fluorophore can then fluoresce and produce a detectable signal. Linear probes comprising a fluorophore and a high efficiency dark quencher, such as 5 the Black Hole Quenchers (BHQTM; Biosearch Technologies, Inc., Novato, CA) are also contemplated. As is known in the art, the high quenching efficiency and lack of native fluorescence of the BHQTM dyes allows "random-coil" quenching to occur in linear probes labelled at one terminus with a fluorophore and at the other with a BHQTM dye thus ensuring that the fluorophore does not fluoresce when the probe is in 10 solution. Upon binding its target sequence, the probe stretches out spatially separating the fluorophore and quencher and allowing the fluorophore to fluoresce. One skilled in the art will appreciate that the BHQTM dyes can also be used as the quencher moiety in molecular beacon or TaqMan® probes. As an alternative to including a fluorophore and a quencher in a single molecule, two 15 fluorescently labelled probes that anneal to adjacent regions of the target sequence can be used. One of these probes, a donor probe, is labelled at the 3' end with a donor fluorophore, such as fluorescein, and the other probe, the acceptor probe, is labelled at the 5' end with an acceptor fluorophore, such as LC Red 640 or LC Red 705. When the donor fluorophore is stimulated by the excitation source, energy is transferred to 20 the acceptor fluorophore by FRET resulting in the emission of a fluorescent signal. In addition to providing primers and probes as separate molecules, the present invention also contemplates polynucleotides that are capable of functioning as both primer and probe in an amplification reaction. Such combined primer/probe polynucleotides are known in the art and include, but are not limited to, Scorpion 25 probes, duplex Scorpion probes, LuxTM primers and AmplifluorTM primers. Scorpion probes consist of, from the 5' to 3' end, (i) a fluorophore, (ii) a specific probe sequence that is complementary to a portion of the target sequence and is held in a hairpin configuration by complementary stem loop sequences, (iii) a quencher, (iv) a PCR blocker (such as, hexethylene glycol) and (v) a primer sequence. After 30 extension of the primer sequence in an amplification reaction, the probe folds back on - 25 - WO 2005/108578 PCT/CA2005/000694 f itself so that the specific probe sequence can bind to its complement within the same DNA strand. This opens up the hairpin and the fluorophore can fluoresce. Duplex Scorpion probes are a modification of Scorpion probes in which the fluorophore coupled probe/primer containing the PCR blocker and the quencher-coupled sequence 5 are provided as separate complementary polynucleotides. When the two polynucleotides are hybridized as a duplex molecule, the fluorophore is quenched. Upon dissociation of the duplex when the primer/probe binds the target sequence, the fluorophore and quencher become spatially separated and the fluorophore fluoresces. The Amplifluor Universal Detection System also employs fluorophore/quencher 10 combinations and is commercially available from Chemicon International (Temecula, CA). In contrast, LuxTM primers incorporate only a fluorophore and adopt a hairpin structure in solution that allows them to self-quench. Opening of the hairpin upon binding to a.target sequence allows the fluorophore to fluoresce. 15 Suitable fluorophores and/or quenchers for use with the polynucleotides of the present invention are known in the art (see for example, Tyagi et al., Nature Biotechnol., 16:49-53 (1998); Marras et al., Genet. Anal.: Biomolec. Eng., 14:151-156 (1999)). Many fluorophores and quenchers are available commercially, for example from Molecular Probes (Eugene, OR) or Biosearch Technologies, Inc. (Novato, CA). 20 Examples of.fluorophores that can be used in the, present invention include, but are not limited to, fluorescein and fluorescein derivatives, such as 6-carboxyfluoroscein (FAM), 5'-tetrachlorofluorescein phosphoroamidite (TET), tetrachloro-6 carboxyfluoroscein, VIC and JOE, 5-(2'-aminoethyl) aminonaphthalene-1-sulphonic acid (EDANS), coumarin and coumarin derivatives, Lucifer yellow, Texas red, 25 tetramethylrhodamine, 5-carboxyrhodamine, cyanine dyes (such as Cy5) and the like. Pairs of fluorophores suitable for use as FRET pairs include, but are not limited to, fluorescein/rhodamine, fluorescein/CyS, fluorescein/Cy5.5, fluorescein/LC Red 640, fluorescein/LC Red 750, and phycoerythrin/Cy7. Quenchers include, but are not limited to, 4 '-(4-dimethylaminophenylazo)benzoic acid (DABCYL), 4 - 26 - WO 2005/108578 PCT/CA2005/000694 dimethylaminophenylazophenyl-4'-maleimide (DABMI), tetramethylrhodamine, carboxytetramethylrhodamine (TAMRA), BHQTM dyes and the like. Methods of selecting appropriate sequences for and preparing the various primers and probes are known in the art. For example, the polynucleotides can be prepared using 5 conventional solid-phase synthesis using commercially available equipment, such as that available from Applied Biosystems USA Inc. (Foster City, California), DuPont, (Wilmington, Del.), or Milligen (Bedford, Mass.). Methods of coupling fluorophores and quenchers to nucleic acids are also in the art. In one embodiment of the present invention, the probe polynucleotide is a molecular 10 beacon. In general, in order to form a hairpin structure effectively, molecular beacons are at least 17 nucleotides in length. In accordance with this aspect of the invention, therefore, the molecular beacon probe is typically between about 17 and about 40 nucleotides in length. Within the probe, the loop sequence that corresponds to or is complementary to the target sequence typically is about 7 to about 32 nucleotides in 15 length, while the stem (or arm) sequences are each between about 4 and about 9 nucleotides in length. As indicated above, part of the stem sequences of a molecular beacon may also be complementary to the target sequence. In one embodiment of the present invention, the loop sequence of the molecular beacon is between about 10 and about 32 nucleotides in length. In other embodiments, the loop sequence of the 20 molecular beacon is between about 15 and about 30 nucleotides in length. In accordance with the present invention, the loop region of the molecular beacon probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:12 or 36, or the complement thereof. In another embodiment of the present invention, the loop region of the molecular beacon probe comprises at least 7 25 consecutive nucleotides of the sequence as set forth in SEQ ID NO:13 or 37, or the complement thereof. In a specific embodiment, the loop region of the molecular beacon probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:17, 19, 22, 24, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63, or the complement thereof. - 27 - WO 2005/108578 PCT/CA2005/000694 Amplification and Detection In accordance with one embodiment of the present invention, E. coli detection involves subjecting a test sample to an amplification reaction in order to obtain an amplification product, or amplicon comprising the target sequence. 5 As used herein, an "amplification reaction" refers to a process that increases the number of copies of a particular nucleic acid sequence by enzymatic means. Amplification procedures are well-known in the art and include, but are not limited to, polymerase chain reaction (PCR), TMA, rolling circle amplification, nucleic acid sequence based amplification (NASBA), strand displacement amplification (SDA) 10 and Q-beta replicase amplification. One skilled in the art will understand that for use in certain amplification techniques the primers described above may need to be modified, for example, SDA primers comprise additional nucleotides near the 5' end that constitute a recognition site for a restriction endonuclease. Similarly, NASBA primers comprise additional nucleotides near the 5' end that are not complementary,to 15 the target sequence but which constitute an RNA polymerase promoter. Polynucleotides thus modified are considered to be within the scope of the present invention. In one embodiment of the present invention, the target sequence is amplified by PCR. PCR is a method known in the art for amplifying a nucleotide sequence using a heat 20 stable polymerase and a pair of primers, one primer (the forward primer) complementary to the (+)-strand at one end of the sequence to be amplified and the other primer (the reverse primer) complementary to the (-)- strand at the other end of the sequence to be amplified. Newly synthesized DNA strands can subsequently serve as templates for the same primer sequences and successive rounds of strand 25 denaturation, primer annealing, and strand elongation, produce rapid and highly specific amplification of the target sequence. PCR can thus be used to detect the existence of a defined sequence in a DNA sample. The term "PCR" as used herein refers to the various forms of PCR known in the art including, but not limited to, quantitative PCR, reverse-transcriptase PCR, real-time PCR, hot start PCR, long PCR, 30 LAPCR, multiplex PCR, touchdown PCR, and the like. "Real-time PCR" refers to a -28 - WO 2005/108578 PCT/CA2005/000694 PCR reaction in which the amplification of a target sequence is monitored in real time by, for example, the detection of fluorescence emitted by the binding of a labelled probe to the amplified target sequence. In one embodiment, the present invention thus provides for amplification of a portion 5 of an E. coli prpR gene of less than about 500 nucleotides in length and comprising at least 65 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12 using a pair of polynucleotide primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-11, or the complement thereof. The present invention further provides for amplification of a 10 portion of an E. coli ykgM 3' region of less than about 500 nucleotides in length and comprising at least 65 consecutive nucleotides of the sequence set forth in SEQ ID NO:36 using a pair of polynucleotide primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35, or the complement thereof. 15 The product of the amplification reaction can be detected by a number of means known to individuals skilled in the art. Examples of such detection means include, for example, gel electrophoresis and/or the use of polynucleotide probes. In one embodiment of the invention, the amplification products are detected through the use of polynucleotide probes. Such polynucleotide probes are described in detail above. 20 A further embodiment of the invention, therefore, provides for amplification and detection of a portion of an E. coliprpR gene of less than about 500 nucleotides in length and comprising at least 65 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12 using a combination of polynucleotides, the combination comprising one or more polynucleotide primers comprising at least 7 nucleotides of the sequence 25 as set forth in any one of SEQ ID NOs:2-11, or the complement thereof, and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof. In another embodiment, the present invention provides for amplification and detection of a portion of an E. coli ykgM 3' region of less than about 500 nucleotides in length 30 and comprising at least 65 consecutive nucleotides of the sequence set forth in SEQ - 29 - WO 2005/108578 PCT/CA2005/000694 ID NO:36 using a combination of polynucleotides, the combination comprising one or more polynucleotide primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35, or the complement thereof, and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as 5 set forth in SEQ ID NO:36, or the complement thereof. In an alternative embodiment, the present invention provides for concurrent amplification and detection of a portion of an E. coli prpR gene and a portion of an E. coli ykgM 3' region using primers and probes as described above. It will be readily appreciated that a procedure that allows bothiamplification and 10 detection of target E. coli nucleic acid sequences to take place in a single unopened reaction vessel would be advantageous. Such a procedure would avoid the risk of "carry-over" contamination in the post-amplification processing steps, and would also facilitate high-throughput screening or assays and the adaptation of the procedure to automation. Furthermore, this type of procedure allows "real time" monitoring of the 15 amplification reaction, as discussed above, as well as more conventional "end-point" monitoring. In one embodiment, the detection is accomplished in real time in order to facilitate rapid detection. In a specific embodiment, detection is accomplished in real time through the use of molecular beacon probes. The present invention thus provides for methods to specifically amplify and detect E. 20 coli nucleic acid sequences in a test sample in a single tube format using the polynucleotide primers, and optionally one or more probes, described herein. Such methods may employ dyes, such as SYBR Green or SYBR® Gold that bind to the amplified target sequence, or an antibody that specifically detects the amplified target sequence. The dye or antibody is included in the reaction vessel and detects the 25 amplified sequences as it is formed. Alternatively, a labelled polynucleotide probe (such as a molecular beacon or TaqMan® probe) distinct from the primer sequences, which is complementary to a region of the amplified sequence, may be included in the reaction, or one of the primers may act as a combined primer/probe, such as a Scorpion probe. Such options are discussed in detail above. - 30 - WO 2005/108578 PCT/CA2005/000694 Thus, a general method of detecting E. coli in a sample is provided that comprises contacting a test sample with a combination of polynucleotides comprising at least one polynucleotide primer and at least one polynucleotide probe or primer/probe, as described above, under conditions that permit amplification of one or more target 5 sequence, and detecting any amplified target sequence(s) as an indication of the presence of E. coli in the sample. A "test sample" as used herein is a biological sample suspected of containing, or known to contain, one or more E. coli target nucleotide sequences. In one embodiment of the present invention, a method using the polynucleotide 10 primers and probes or primer/probes is provided to specifically amplify and detect an E. coli target nucleotide sequence in a test sample, the method generally comprising the steps of: (a) forming a reaction mixture comprising a test sample, amplification reagents, one or more polynucleotide probes capable of specifically hybridising to a portion of 15 an E. coli target nucleotide sequence and one or more polynucleotide primer corresponding to or complementary to a portion of an E.coliprpR gene orykgM 3'region comprising said target nucleotide sequence; (b) subjecting the mixture to amplification conditions to generate at least one copy of the target nucleotide sequence, or a nucleic acid sequence complementary to 20 the target nucleotide sequence; (c) hybridizing the probe to the target nucleotide sequence or the nucleic acid sequence complementary to the target sequence, so as to form a probe:target hybrid; and (d) detecting the probe:target hybrid as an indication of the presence of the E. coli 25 target nucleotide sequence in the test sample. In another embodiment, the method employs one or more probe capable of specifically hybridising to a portion of an E. coli prpR target nucleotide sequence and one or more polynucleotide primer capable of amplifying said portion of theprpR target nucleotide sequence, in combination with one or more probe capable of 30 specifically hybridising to a portion of an E. coli ykgM target nucleotide sequence and -31 - WO 2005/108578 PCT/CA2005/000694 one or more polynucleotide primer capable of amplifying said portion of the ykgM target nucleotide sequence. In a further embodiment, the method employs one or more labelled probes in step (a). The term "amplification reagents" includes conventional reagents employed in 5 amplification reactions and includes, but is not limited to, one or more enzymes having nucleic acid polymerase activity, enzyme cofactors (such as magnesium or nicotinamide adenine dinucleotide (NAD)), salts, buffers, nucleotides such as deoxynucleotide triphosphates (dNTPs; for example, deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and deoxythymidine 10 triphosphate) and other reagents that modulate the activity of the polymerase enzyme or the specificity of the primers. It will be readily understood by one skilled in the art that step (b) of the above method can be repeated several times prior to step (c) by thermal cycling the reaction mixture by techniques known in the art and that steps (b), (c) and (d) may take place 15 concurrently such that the detection of the amplified sequence takes place in real time. In addition, variations of the above method can be made depending on the intended application of the method, for example, the polynucleotide probe may be a combined primer/probe, or it may be a separate polynucleotide probe, in which case two different polynucleotide primers are used. Additional steps may be incorporated 20 before, between or after those listed above as necessary, for example, the test sample may undergo enrichment, extraction and/or purification steps to isolate nucleic acids therefrom prior to the amplification reaction, and/or the amplified product may be submitted to purification/isolation steps or further amplification prior to detection, and/or the results from the detection step (d) may be analysed in order to quantify the 25 amount of target present in the sample or to compare the results with those from other samples. These and other variations will be apparent to one skilled in the art and are considered to be within the scope of the present invention. In one embodiment of the present invention, the method is a real-time PCR assay utilising two polynucleotide primers and a molecular beacon probe. In a further 30 embodiment, the real-time PCR assay employs a combination of two polynucleotide -32- WO 2005/108578 PCT/CA2005/000694 primers and a molecular beacon probe for amplification and detection of aprpR target sequence with two polynucleotide primers and a molecular beacon probe for amplification and detection of a ykgM target sequence. Diagnostic Assays to Detect E. coli 5 The present invention provides for diagnostic assays using the polynucleotide primers and/or probes that can be used for highly specific and sensitive detection of one or more E. coli strains in a test sample. The diagnostic assays comprise amplification and detection of E. coli nucleic acids as described above. The diagnostic assays can be qualitative or quantitative and can involve real time monitoring of the amplification 10 reaction or conventional end-point monitoring. In one embodiment, the invention provides for diagnostic assays that do not require post-amplification manipulations and minimise the amount of time required to conduct the assay. For example, in a specific embodiment, there is provided a diagnostic assay, utilising the primers and probes described herein, that can be 15 completed using real time PCR technology in about 54 hours and generally less that 24 hours. Such diagnostic assays are particularly useful in the detection of E. coli contamination of various foodstuffs. Thus, in one embodiment, the present invention provides a rapid and sensitive diagnostic assay for the detection of E. coli contamination of a 20 food sample. Foods that can be analysed using the diagnostic assays include, but are not limited to, dairy products such as milk, including raw milk, cheese, yoghurt, ice cream and cream; raw, cooked and cured meats and meat products, such as beef, pork, lamb, mutton, poultry (including turkey, chicken), game (including rabbit, grouse, pheasant, duck), minced and ground meat (including ground beef, ground turkey, 25 ground chicken, ground pork); eggs; fruits and vegetables; nuts and nut products, such as nut butters; seafood products including fish and shellfish; and fruit or vegetable juices. The diagnostic assays may also be used to detect E. coli contamination of drinking water. -33 - WO 2005/108578 PCT/CA2005/000694 While the primary focus of E. coli detection is food products, the present invention also contemplates the use of the primers and probes in diagnostic assays for the detection of E. coli contamination of other biological samples, such as patient specimens in a clinical setting, for example, faeces, blood, saliva, throat swabs, urine, 5 mucous, and the like, as well as E. coli contamination of surfaces and instruments, such as surgical or dental instruments. The diagnostic assays are also useful in the assessment of microbiologically pure cultures, and in environmental and pharmaceutical quality control processes. The test sample can be used in the assay either directly (i.e. as obtained from the 10 source) or following one or more pre-treatment steps to modify the character of the sample. Thus, the test sample can be pre-treated prior to use, for example, by disrupting cells or tissue, extracting the microbial content from the sample (such as a swab or wipe test sample), enhancing/enriching the microbial content of the sample by culturing in a suitable medium, preparing liquids from solid materials, diluting 15 viscous fluids, filtering liquids, distilling liquids, concentrating liquids, inactivating interfering components, adding reagents, isolating nucleic acids, purifying nucleic acids, and the like. In one embodiment of the present invention, the test sample is subjected to one or more steps to isolate, or partially isolate, nucleic acids therefrom. In another embodiment of the invention, the test sample is subjected to an enrichment 20 procedure to enhance the microbial content of the sample prior to use in the assay. As indicated above, the polynucleotide primers and probes of the invention can be used in assays to quantitate the amount of an E. coli target nucleotide sequence in a test sample. Thus, the present invention provides for a method to specifically amplify, detect and quantitate a target nucleotide sequence in a test sample, the method 25 generally comprising the steps of: (a) forming a reaction mixture comprising a test sample, amplification reagents, one or more polynucleotide probes capable of specifically hybridising to a portion of an E.coli target nucleotide sequence and one or more polynucleotide primers corresponding to or complementary to a portion of an E. coli prpR gene or ykgM 30 3' region comprising said target nucleotide sequence; -34- WO 2005/108578 PCT/CA2005/000694 %0,1-MM, cUU5/0006 9 (b) subjecting the mixture to amplification conditions to generate at least one copy of the target nucleotide sequence, or a nucleic acid sequence complementary to the target nucleotide sequence; (c) hybridizing the probe to the target nucleotide sequence or the nucleic acid 5 sequence complementary to the target sequence, so as to form a probe:target hybrid; (d) detecting the probe:target hybrid; and (e) analysing the amount of probe:target hybrid present as an indication of the amount of target nucleotide sequence present in the test sample. 10 The steps of this method may also be varied and may employ combinations of primers and probes for different target sequences as described above for the amplification/detection method. In one embodiment, the method employs one or more labelled polynucleotide probes 15 in step (a) and steps (d) and (e) are as follows: (d) detecting the probe:target hybrid by detecting the signal produced by the hybridized labelled probe; and (e) analysing the amount of signal produced as an indication of the amount of target nucleotide sequence present in the test sample. 20 Step (e) can be conducted, for example, by comparing the amount of probe:target hybrid present to a standard or utilising one of a number of statistical methods known in the art that do not require a standard. Various types of standards for quantitative assays are known in the art. For example, the standard can consist of a standard curve compiled by amplification and detection 25 of known quantities of the E. coli target nucleotide sequence under the assay conditions. Alternatively, relative quantitation can be performed without the need for a standard curve (see, for example, Pfaffl, MW. (2001) Nucleic Acids Research 29(9):2002-2007). In this method, a reference gene is selected against which the expression of the target gene can be compared and an additional pair of primers and -35- WO 2005/108578 PCT/CA2005/000694 an appropriate probe are included in the reaction in order to amplify and detect a portion of the selected reference gene. The reference gene is usually a gene that is expressed constitutively, for example, a house-keeping gene. Another similar method of quantification is based on the inclusion of an internal 5 standard in the reaction. Such internal standards generally comprise a control target nucleotide sequence and a control polynucleotide probe. The internal standard can further include an additional pair of primers that specifically amplify the control target nucleotide sequence and are unrelated to the polynucleotides of the present invention. Alternatively, the control target sequence can contain primer target sequences that 10 allow specific binding of the assay primers but a different probe target sequence. This allows both the E. coli target sequence(s) and the control sequence to be amplified with the same primers, but the amplicons are detected with separate probe polynucleotides. Typically, when a reference gene or an internal standard is employed, the reference/control probe incorporates a detectable label that is distinct 15 from the label incorporated into the E.coli target sequence specific probe(s). The signals generated by these labels when they bind their respective target sequences can thus be distinguished. In the context of the present invention, a control target nucleotide sequence is a nucleic acid sequence that (i) can be amplified either by the E.coli target sequence 20 specific primers or by control primers, (ii) specifically hybridizes to the control probe under the assay conditions and (iii) does not exhibit significant hybridization to the E. coli target sequence specific probe(s) under the same conditions. One skilled in the art will recognise that the actual nucleic acid sequences of the control target nucleotide and the control probe are not important provided that they both meet the 25 criteria outlined above. The diagnostic assays can be readily adapted for high-throughput. High-throughput assays provide the advantage of processing many samples simultaneously and significantly decrease the time required to screen a large number of samples. The present invention, therefore, contemplates the use of the polynucleotides of the -36- WO 2005/108578 PCT/CA2005/000694 present invention in high-throughput screening or assays to detect and/or quantitate E. coli target nucleotide sequences in a plurality of test samples. For high-throughput assays, reaction components are usually housed in a multi container carrier or platform, such as a multi-well microtitre plate, which allows a 5 plurality of assays each containing a different test sample to be monitored simultaneously. Control samples can also be included in the plates to provide internal controls for each plate. Many automated systems are now available commercially for high-throughput assays, as are automation capabilities for procedures such as sample and reagent pipetting, liquid dispensing, timed incubations, formatting samples into 10 microarrays, microplate thennocycling and microplate readings in an appropriate detector, resulting in much faster throughput times. Kits and Packages for the Detection of E. coli The present invention further provides for kits for detecting E. coli in a variety of samples. In general, the kits comprise one or more pairs of primers and one or more 15 probe capable of amplifying and detecting E. coli target sequence(s) as described above. If desired, one of the primers and the probe may be provided in the form of a single polynucleotide, such as a Scorpion probe, as described above. The probe provided in the kit can be unlabelled, or can incorporate a detectable label, such as a fluorophore or a fluorophore and a quencher, or the kit may include reagents for 20 labelling the probe. The primers/probes can be provided in separate containers or in an array format, for example, pre-dispensed into microtitre plates. One embodiment of the present invention provides for kits comprising a combination of primer and probe sets, each of the sets being capable of amplifying and detecting an E. coli target sequence associated with a different gene. 25 The kits can optionally include amplification reagents, such as buffers, salts, enzymes, enzyme co-factors, nucleotides and the like. Other components, such as buffers and solutions for the enrichment, isolation and/or lysis of bacteria in a test sample, extraction of nucleic acids, purification of nucleic acids and the like may also be included in the kit. One or more of the components of the kit may be lyophilised and - 37 - WO 2005/108578 PCT/CA2005/000694 the kit may further comprise reagents suitable for the reconstitution of the lyophilised components. The various components of the kit are provided in suitable containers. As indicated above, one or more of the containers may be a microtitre plate. Where appropriate, the 5 kit may also optionally contain reaction vessels, mixing vessels and other components that facilitate the preparation of reagents or nucleic acids from the test sample: The kit may additionally include one or more controls. For example, control polynucleotides (primers, probes, target sequences or a combination thereof) may be provided that allow for quality control of the amplification reaction and/or sample 10 preparation, or that allow for the quantitation of E. coli target nucleotide sequences. The kit can additionally contain instructions for use, which may be provided in paper form or in computer-readable form, such as a disc, CD, DVD or the like. The present invention further contemplates that the kits described above may be provided as part of a package that includes computer software to analyse data 15 generated from the use of the kit. The invention will now be described with reference to specific examples. It will be understood that the following examples are intended to describe preferred embodiments of the invention and are not intended to limit the invention in any way. EXAMPLES 20 Example 1: Determination of a Unique, Conserved DNA Region in E. coliprpR Gene Sequences The prpR gene coding regions from 10 different E. coli isolates were sequenced and aligned using the multiple alignment program Clustal WTM. The resulting alignment was used to identify short DNA regions that were conserved within the E. coli group, 25 yet which are excluded from other bacteria. Figure 1 depicts a sample of such an alignment in which a portion of the prpR gene of 10 different E. coli strains have been aligned. -38- WO 2005/108578 PCT/CA2005/000694 A 120 nucleotide conserved sequence (consensus sequence) was identified as described above (SEQ ID NO:12). GCTAATGACCCGYACATCYACCGGAACAGGCTGATGCCCGCCGACGCGGG TGACCTCTTTTTCTTCCAGCACCCGYARCAGSCGRGTCTGCAAMGGYAGC 5 GGCATTTCGCCWATCTCRTC [SEQ ID NO:12] wherein: Y = T or C, R = A or G, S = G or C, M = A or C, and W = T or A. This unique and conserved element of E. coli prpR-gene sequences was used to design highly specific primers for the PCR amplification of the conserved region of the prpR gene. 10 Example 2: Generation of PCR Primers for Amplication of the prpR Consensus Sequence Within the conserved 120 nucleotide sequence identified as described in Example 1, regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. 15 The primer sequences are shown below: Forward primer #1: 5'- GCTAATGACCCGTACATCTACC -3' [SEQ ID NO:14] Reverse primer #1: 5'- GATGAGATTGGCGAAATG -3' [SEQ ID NO:15] Forward primer #2: 5'-CTACCGGAACAGGCTGATG-3' [SEQ ID NO:20] In the alignment presented in Figure 1, the positions of forward primer #1 and the 20 reverse primer #1 are represented by shaded boxes. Forward primer #1 starts at position 469 and ends at position 490 of the alignment. Reverse primer #1 represents the reverse complement of the region starting at position 571 and ending at position 588. Example 3: Generation of Molecular Beacon Probes Specific for the E. coliprpR 25 Consensus Sequence -39- WO 2005/108578 PCT/CA2005/000694 In order to design molecular beacon probes specific for E. coli, a region within the consensus sequence described above was identified which not only was highly conserved in all E. coli isolates but was also exclusive to E. coli isolates. This sequence consisted of a 23 nucleotide region that would be suitable for use as a 5 molecular beacon target sequence. The sequence is provided below: 5'- TGACCTCTTTTTCTTCCAGCACC -3' [SEQ ID NO: 13] The complement of this sequence [SEQ ID NO:19, see Table 1] is also suitable for use as a molecular beacon target sequence. A molecular beacon probe having the sequence shown below was synthesized by 10 Integrated DNA Technologies Inc. prpR molecular beacon probe #1: 5'- cgtgcgTGACCTCTTTTTCTTCCAGCACCcgcacg -3' [SEQ ID NO:16] The complement of this sequence (SEQ ID NO: 18, shown below) can also be used as a molecular beacon probe for detecting E.coli. 15 5 -cgtgcgGGTGCTGGAAGAAAAAGAGGTCAcgcacg- 3 ' [SEQ ID NO:18] The starting material for the synthesis of the molecular beacons was an oligonucleotide that contains a sulfhydryl group at its 5' end and a primary amino group at its 3' end. DABCYL was coupled to the primary amino group utilizing an amine-reactive derivative of DABCYL. The oligonucleotides that were coupled to 20 DABCYL were then purified. The protective trityl moiety was then removed from the 5'-sulfhydryl group and a fluorophore was introduced in its place using an iodoacetamide derivative. An individual skilled in the art would recognize that a variety of methodologies could be used for synthesis of the molecular beacons. For example, a controlled-pore glass 25 column that introduces a DABCYL moiety at the 3' end of an oligonucleotide has recently become available, which enables the synthesis of a molecular beacon completely on a DNA synthesizer. - 40 - WO 2005/108578 PCT/CA2005/000694 Table 2 provides a general overview of the characteristics of molecular beacon probe #1. The beacon sequence shown in Table 2 indicates the stem region in lower case and the loop region in upper case. Table 2. Description of prpR molecular beacon probe #1 Beacon Sequence (5' -> 3'): cgtgcgTGACCTCTTTTTCTTCCAGCACCcgcacg Fluorophore (5'): FAM Quencher (3'): DABCYL 5 Table 3 provides an overview of the thermodynamics of the folding of molecular beacon probe #1. Calculations were made using MFOLDTM software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site. Figure 2 shows the arrangement of PCR primers and the molecular beacon probe in theprpR consensus sequence. Numbers in parentheses indicate the positions of the 10 first and last nucleotides of each feature on the PCR product generated with the forward primer #1 and reverse primer #1. Table 3. Thermodynamics of molecular beacon probe #1. Tm loop (thermodynamics algorithm) 58.9 0 C Tm stem (mFOLD calculation) 63.7 0 C

AG

37 (mFOLD calculation) -4.02 kCal/mol All (nmFOLD calculation) -50.4 kCal/mol A furtherprpR specific molecular beacon suitable for the detection of E. coli was also prepared as described above. The sequence is shown below (nucleotides in lower case 15 represent the nucleotides that make up the stem of the beacon): prpR molecular beacon probe #2: 5 '-cgtgcGTGACCTCTTTTTCTTCCAGCACCgcacg-3'[SEQ ID NO:21] The complement of this sequence (SEQ ID NO:23, see below) can also be used as a molecular beacon probe for the detection ofE. coli. -41- WO 2005/108578 PCT/CA2005/000694 5'-cgtgcGGTGCTGGAAGAAAAAGAGGTCACgacg-3' [SEQ ID NO:23] Example 4: Isolation of DNA from Test Samples The following protocol was utilized in order to isolate DNA from test samples. Material needed for DNA extraction: 5 -Tungsten carbide beads: Qiagen -Reagent DX: Qiagen -DNeasy Plant Mini Kit: Qiagen -Tissue Disruption equipment: Mixer MillTM 300 (Qiagen) The following method was followed: 10 1) Add to a 2 ml screw top tube: 1 tungsten carbide bead and 0.1 g glass beads 212 to 300 tm in Width + sample to be analysed + 500 tL of API buffer + 1 AL of Reagent DX + 1 pL of RNase A (100 mg/mL). Extraction control done without adding sample to be analysed. 2) heat in Dry-Bath at 80°C for 10 min. 15 3) mix in a Mixer Mill 300 (MM300) at frequency of 30 Hz [1/s], 2 min. 4) rotate tubes and let stand for 10 min at room temperature. 5) mix in a Mixer Mill 300, frequency 30 Hz, 2 min. 6) place tubes in boiling water for 5 min. 7) centrifuge with a quick spin. 20 8) add 150 AL of AP2 buffer. 9) mix at frequency of 30 Hz for 30 sec. Rotate tubes and repeat. 10) centrifuge at 13,000 rpm for 1 min. 11) place tubes at -20 0 C for 10 min. 12) centrifuge at 13,000 rpm for 1 min. 25 13) transfer supernatant in to a 2 mL screw top tube containing 850 PL of AP3/E buffer. 14) mix by inverting, centrifuge with a quick spin. 15) add 700 ItL of mixture from step 13 to a DNeasy binding column and centrifuge at 800 rpm for 1 minute. Discard eluted buffer. Repeat process with 30 leftover mixture from step 13. - 42 - WO 2005/108578 PCT/CA2005/000694 16) add 500 /pL of wash buffer (AW buffer) to binding columns and centrifuge for 1 minute at 800 rpm. Discard eluted buffer. 17) add 500 gL of wash buffer (AW buffer) to binding columns and centrifuge for 1 minute at 800 rpm. Discard eluted buffer. 5 18) centrifuge column again at 8000 rpm for 1 min. 19) place column in a sterile 2 mL tube and add 50 gL of AE elution buffer preheated at 80'C. 20) incubate for 1 min. Centrifuge at max speed for 2 min. Elute twice with 50 pL; final volume should be 100 yL. 10 21) keep elution for PCR amplification. Time of manipulation: 3 hours. Proceed to prepare PCR reaction for real-time detection. Example 5: Amplification of the prpR Target Sequence and Hybridization of Molecular Beacon Probe #1 in Real-Time 15 PCR amplification was undertaken using the conditions described in Tables 4 and 5 below. The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle. In Table 4, note that the PCR buffer contains 1.5 mM magnesium chloride (final concentration). Inclusion of additional magnesium chloride brings the final 20 concentration to 4 mM in the reaction mixture. Table 4: PCR Mix used for Validation Final concentration used in Reagent reconstituted mix Qiagen PCR buffer, 10X 1.5X Forward primer #1, 25 pM 0.5 jigM Reverse primer #1, 25 pM 0.5 pM dNTPs, 10 mM 0.2 mM -43 - WO 2005/108578 PCT/CA2005/000694 Reagent Final concentration used in Reagent reconstituted mix MgC1 2 , 25 mM 1.75 mM Molecular beacon #1, 10 gM 0.3 gM HotStarTaq, 5 U/pL 1 U/25 gL reaction Table 5 presents an overview of the cycles used for each step of the PCR amplification. Table 5: PCR Program used throughout Diagnostic Test Validation Step Temperature Duration Repeats Initial polymerase activation 95'C 15 min 1 Denaturation 94'C 15 sec Annealing '550C 15 sec 40 Elongation 720C 15 sec Fluorescence was detected in real-time using a fluorescence monitoring real-time 5 PCR instrument, for example, a BioRad iCycler iQTM or MJ Research OpticonM. Other instruments with similar fluorescent reading abilities can also be used. Example 6: Positive Validation of prpR Primers and Molecular Beacon Probe #1 The effectiveness of pipR forward primer #1, reverse primer #1 and molecular beacon probe #1 for amplifying and detecting E. coli isolates was demonstrated as described 10 generally below. Genomic DNA from the species and strains presented in Table 6 below was isolated and amplified as described in the preceding Examples (4 and 5). Results are presented in Table 6 and indicate that molecular beacon probe was capable of detecting 212 out of the 223 E. coli strains tested (i.e. sensitivity of 95%). - 44 - WO 2005/108578 PCT/CA2005/000694 Table 6. Positive Validation of prpR Molecular Beacon Probe #1, Forward Primer #1 and Reverse Primer #1 Interpretation Species ID Serovar (prpR) Escherichia coli 801 + Escherichia coli B02 + Escherichia coil B12 + Escherichia coil 813 O18AC:NM + Escherichia coli 814 01:NM + Escherichia coli 815 075:H5 + Escherichia coli B16 062:H32 + Escherichia coli 817 071:H12 + Escherichia coli B18 055:NM + Escherichia coli 819 050:H4 + Escherichia coli B20 044:H18 + Escherichia coil B21 045:H23 + Escherichia coli B23 028:NM + Escherichia coli B24 034:NM + Escherichia coli B25 026:NM + Escherichia coil B26 024:NM + Escherichia coli B27 078:H11 + Escherichia coli B28 08:H9 + Escherichia coli B29 0114:H32 + Escherichia coli B30 03:H44 + Escherichia coli B31 04:H5 + Escherichia coli B32 05:H4 + Escherichia coli B33 023:H15 + Escherichia coli B34 07:NM + Escherichia coli B35 018:H14 + Escherichia coli B36 09:H12 + Escherichia coli B37 010:NM Escherichia coli B38 012:NM + Escherichia coil B39 013:NM + Escherichia coil B40 014:NM + Escherichia coli B41 078:NM + Escherichia coli B42 06:H49 + Escherichia coli B43 0127:NM + - 45 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovar (prpR) Escherichia coli B44 Escherichia coli B45 + Escherichia coil B46 01 :H7 + Escherichia coli B47 0157:H19 + Escherichia coli B48 086:NM + Escherichia coli B49 086:NM + Escherichia coli B50 040:H(NT) + Escherichia coli B51 018:H14 + Escherichia coli B52 0136:NM Escherichia coil B53 077:NM + Escherichia coli B54 0113:H21 + Escherichia coil B55 080:H26 + Escherichia coli B56 0102:H40 + Escherichia coli B57 086:NM + Escherichia coil B58 + Escherichia coil B59 0112:H18 + Escherichia coli B60 0128AC:NM + Escherichia coli B61 0112AC:NM + Escherichia coli B62 0128AB:H2 + Escherichia coli B63 0117:H4 + Escherichia coli B64 0119:H18 Escherichia coli B65 0124:H25 + Escherichia coli B66 0125AB:H19 + Escherichia coil B67 0126:H2 + Escherichia coli B68 0128AB:H8 + Escherichia coil B69 B + Escherichia coli B71 0157:H7 + Escherichia coli B73 0157:H7 + Escherichia coli B74 0157:H7 + Escherichia coil B75 0157:H7 + Escherichia coil B76 0157:H7 + Escherichia coli B77 06:H1 + Escherichia coil B78 + Escherichia coli B79 + Escherichia coil B80 + - 46 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovar (prpR) Escherichia coli B81 0157:H7 + Escherichia coli B82 0157:H7 + Escherichia coli B83 0157:H7 + Escherichia coli B84 0157:H7 + Escherichia coli B85 0157:H7 + Escherichia coli B86 0157:H7 + Escherichia coli B87 0157:H7 + Escherichia coil B88 0157:H7 + Escherichia coli B89 0157:H7 + Escherichia coli B90 0157:H7 + Escherichia coil B91 0157:H7 + Escherichia coli B92 0157:H7 + Escherichia coli B93 0157:H7 + Escherichia coli B94 0157:H7 + Escherichia coli B95 0157:H7 + Escherichia coli B96 0157:H7 + Escherichia coil B97 0157:H7 + Escherichia coil B98 0157:H43 + Escherichia coli B99 0157:H43 + Escherichia coli B100 0157:H43 + Escherichia coli 8101 0157:HNM + Escherichia coli B102 0157:HNM + Escherichia coli B103 055:H6 + Escherichia coli 8104 055:H6 + Escherichia coli B105 055:H6 + Escherichia coli 8106 055:H6 + Escherichia coli 8107 055:H6 + Escherichia coli B108 055:H6 + Escherichia coli B109 055:NM + Escherichia coli 8110 055:H6 + Escherichia coli B111 055:H6 + Escherichia coli B112 055:H6 + Escherichia coil B113 055:H5 + Escherichia coil B114 055:H7 + Escherichia coil B115 055:H7 + - 47 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovar (prpR) Escherichia coli B116 055:H7 + Escherichia coli B117 055:H7 + Escherichia coli B118 0111:H21 + Escherichia coli B120 O111:H12 + Escherichia coli B121 O111:H12 + Escherichia coli B122 O111:NM + Escherichia coili B123 O111A:HNM + Escherichia coli B124 O111:H8 + Escherichia coil B125 0111:HNM + Escherichia coli B126 O111:H11 + Escherichia coli B127 O111:H8 + Escherichia coil B128 026:H11 + Escherichia coli B130 0111:H12 + Escherichia coli B131 026:H11 + Escherichia coil B132 026:H11 + Escherichia coli B133 026:H11 + Escherichia coli B134 026:H11 + Escherichia coli B135 026:H11 + Escherichia coli B136 026:H11 + Escherichia coli B137 026:Hll + Escherichia coli B138 0128A:H2 + Escherichia coli B139 0128A:H2 + Escherichia coli B140 045:H2 + Escherichia coli B141 0128:H2 + Escherichia coli B142 0128:H2 + Escherichia coil B143 O111:H2 + Escherichia coli B144 O111:H2 + Escherichia coli B145 O111:NM + Escherichia coli B146 O111:H2 + Escherichia coli B147 O111:HN + Escherichia coli B148 0128:H7 + Escherichia coli 8149 0128:H7 + Escherichia coli 8150 0128:H7 + Escherichia coli B151 0128:H7 + Escherichia coli 8153 0128:H21 + -48- WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovar (prpR) Escherichia coli B154 0128:H21 + Escherichia coli B155 0128a:H21 + Escherichia coli B156 0128:HNM + Escherichia coli B157 0128:H21 + Escherichia coli B158 0111:H21 + Escherichia coli B159 0111:H21 + Escherichia coil B160 0111:H21 + Escherichia coil B161 0111:H21 + Escherichia coli B162 0111:H21 + Escherichia coli B163 0157:H7 + Escherichia coli B164 0157:NM + Escherichia coil B165 015:NM + Escherichia coil B166 ON:HN + Escherichia coil B167 ON:H32 Escherichia coli B168 01:30 + Escherichia coli B169 ON:HN + Escherichia coli B170 079:NM + Escherichia coil B171 ON:NM Escherichia coli B172 085:HN + Escherichia coli B174 ON:NM + Escherichia coli B175 06:HO10 + Escherichia coil B176 06:HO10 Escherichia coli B179 OM:HN + Escherichia coli B180 014:H30 + Escherichia coil B181 ON:HO10 + Escherichia coli B182 0106:NM + Escherichia coli B183 05:NM + Escherichia coil B184 05:HN + Escherichia coli B185 089:HN + Escherichia coli B186 0121 :HN + Escherichia coli B187 ON:HN + Escherichia coil B188 086:H43 + Escherichia coil B189 015:NM + Escherichia coli B190 ON:HN + Escherichia coli B191 0104:H21 + - 49 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovar (prpR) Escheridhia coil B192 0104:NM + Escherichia coli B193 0104:NM + Escherichia coli B194 0150:H21 + Escherichia coli B195 0113:H21 + Escherichia coli B196 079:H43 + Escherichia coil B197 07:H21 + Escherichia coli B198 07:H21 + Escherichia coli B199 088:NM + Escherichia coli B200 01:NM Escherichia coli B201 079:H25 Escherichia coli B202 ON:HN + Escherichia coli B203 07:NM + Escherichia coil B204 07:NM + Escherichia coli B205 07:NM + Escherichia coil B206 07:NM + Escherichia coli B207 ON:H26 + Escherichia coli B208 ON:HN + Escherichia coil B209 ON:HN + Escherichia coli B210 ON:HN + Escherichia coli B211 01:H6 + Escherichia coli B212 OM:H18 + Escherichia coli B213 ON:HM + Escherichia coli B214 02:NM + Escherichia coli B215 02:HN + Escherichia coli B216 025:HN + Escherichia coli B217 025:H1 + Escherichia coil B218 04:HN + Escherichia coil B219 025:H1 + Escherichia coil B222 ON:NM + Escherichia coil B223 0112:H8 + Escherichia coli B224 04:H40 + Escherichia coil B225 04:HN + Escherichia coil B226 02:NM + Escherichia coli B227 02:NM + Escherichia coli B228 ON:NM + - 50 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovar (prpR) Escherichia coli B229 075:NM + Escherichia coli B230 ON:H10 + Escherichia coli B231 04:H40 + Escherichia coil B232 04:H43 + Escherichia coli B233 ON:NM + Escherichia coli B234 ON:NM + Escherichia coli B235 078:NM + Escherichia coli B236 078:NM + Escherichia coli B237 0144:H8 + Escherichia coli B239 010:K5(1):H4 Escherichia coli B240 0119:K69(b14) Escherichia coil B241 03:K2a,2b(1):H2 + Escherichia coli B242 0127:K63(b8) + Escherichia coli B243 0112a:112c:K66(b 11):NM + Escherichia coil B244 + Example 7: Negative Validation of the prpR Primers and Molecular Beacon #1 In order to test the ability of theprpR primers and molecular beacon probe to preferentially amplify and detect only E. coli, a number of bacteria from species other than E. coli were tested as generally described below. 5 Samples of genomic DNA from the bacteria presented in Table 7 below were isolated and amplified using prpR forward primer #1 and reverse primer #1 as described in the preceding Examples (4 and 5). When no probe was included in the amplification reaction, any amplicons produced were detected using SYBRo Green. No amplification products were observed (i.e. specificity of 100%). 10 Also included in additional rounds of tests was prpR molecular beacon probe #1. Seven strains out of a total of 262 yielded an amplification product under these conditions (two strains of Citrobacter braakii and five strains of E. fergusonii) and gave a positive signal under these conditions, however, when the upper limit of detection was set at 30 Ct, no hybridization of molecular beacon #1 was observed (i.e. 15 specificity of 100%). This upper limit also helped to eliminate false positives -51 - WO 2005/108578 PCT/CA2005/000694 resulting from the amplification of trace amounts of E. coli DNA present in the recombinant Taq polymerase used in the PCR reaction. The above results indicate that both the amplification primers and the molecular beacon #1 are specific for E. coli and can also detect strains of Citrobacter braakii 5 and E. fergusonii under appropriate conditions. Table 7. Negative Validation of the prpR Molecular Beacon Probe #1, Forward Primer #1 and Reverse Primer #1 Genus Species ID Result Interpretation (prpR) Acinetobacter calcoaceticus B01 Acinetobacter calcoaceticus B08 Acinetobacter iwoffi B02 Acinetobacter junii B01 Aeromonas hydrophila B03 Aeromonas hydrophila B04 Aeromonas salmonicida B02 Aeromonas salmonicida B05 Alcaligenes faecalis B01 Bacillus amyloliquefaciens B01 Bacillus amyloliquefaciens B02 Bacillus cereus B01 Bacillus; cereus B06 Bacillus circulans B04 Bacillus circulans B05 Bacillus coagulans B02 Bacillus coagulans B03 Bacillus firmus B01 Bacillus lentus B01 Bacillus licheniformis B01 Bacillus licheniformis B02 Bacillus megaterium B06 Bacillus megaterium B07 Bacillus mycoides B01 Bacillus pumilus B04 Bacillus pumilus B06 - 52 - WO 2005/108578 PCT/CA2005/000694 Genus Species ID Result Interpretation (prpR) Bacillus sphaericus B01 Bacillus stearothermophilus B03 Bacillus subtilis B04 Bacillus subtilis B09 Bacillus thuringiensis B01 Bacillus thuringiensis B03 Bacteroides fragills 801 Bifidobacterium adolescentis B01 Bifidobacterium animalis 801 Bifidobacterium bifidum B01 Bifidobacterium longum 801 Bifidobacterium pseudolongum 801 Bifidobacterium sp. 817 Bifidobacterium sp. B25 Bifidobacterium suis B01 Bifidobacterium thermophilus B01 Bordetella bronchiseptica B01 Bordetella pertussis B01 Borrelia burgdorferi BO1 Branhamella catarrhalis B01 Brevibacillus laterosporus 101 Campylobacter coli B01 Campylobacter jejuni B01 Campylobacter jejuni B02 Campylobacter lari 801 Campylobacter lari B02 Campylobacter rectus B01 Cellilomonea sp. B01 Chromobacterium violaceum B01 Chryseobacterium sp. B01 Chryseomonas luteola B02 Citrobacter amalonaticus B01 Citrobacter amalonaticus B02 Citrobacter braakii B01 + Citrobacter braakii B04 + Citrobacter diversus B01 -53 - WO 2005/108578 PCT/CA2005/000694 Genus Species ID Result Interpretation (prpR) Citrobacter freundii B03 Citrobacter freundii B05 Citrobacter freundii B06 Citrobacter freundii B07 Citrobacter freundii B08 Citrobacter freundii B09 Citrobacter koseri B01 Citrobacter koseri B03 Citrobacter werkmanii B01 Clostridium botulinum B01 Clostridium botulinum B12 Clostridium butyricum B01 Clostridium difficile B01 Clostridium perfringens B01 Clostridium perfringens B02 Clostridium sporogenes B01 Clostridium tetani Bo01 Clostridium tyrobutyricum B01 Corynebacterium xerosis B01 Edwardsiella tarda B01 Enterobacter aerogenes B04 Enterobacter aerogenes B08 Enterobacter amnigenus B01 Enterobacter cloacae B06 Enterobacter cloacae B09 Enterobacter intermedius B01 Enterobacter intermedius B02 Enterobacter taylorae B01 Enterococcus faecalis B05 Enterococcus faecalis B06 Enterococcus faecium B01 Enterococcus hirae B01 Enterococcus hirae B02 Erwinia herbicola B01 Escherichia blattae B01 Escherichia blattae B02 - 54 - WO 2005/108578 PCT/CA2005/000694 Genus Species ID Result Interpretation (prpR) Escherichia blattae B03 Escherichia fergusonili B01 + Escherichia fergusonii B02 + Escherichia fergusonii B03 + Escherichia fergusonii B04 + Escherichia fergusonii B05 + Escherichia hermannii B01 Escherichia hermannii B02 Escherichia hermannii B03 Escherichia vulneris B01 Escherichia vulneris B02 Escherichia vulneris B03 Haemophilus equigenitalis B01 Haemophilus influenzae B02 Haemophilus influenzae B04 Haemophilus paragallinarum B01 Hafnia alvei B01 Hafnia alvei B02 Helicobacter pylori B02 Klebsiella ornithinolytica B01 Klebsiella oxytoca B02 Klebsiella oxytoca B06 Klebsiella planticola B01 Klebsiella planticola B02 Klebsiella pneumoniae B08 Klebsiella pneumoniae B15 Klebsiella terrigena B01 Kocuria kristinae B01 Kurthia zopfii B01 Kurthia zopfii B02 Lactobacillus acidophilus B01 Lactobacillus casei B01 Lactobacillus case B03 Lactobacillus delbreuckii B01 Lactobacillus delbreuckil B03 Lactobacillus helveticus B01 -55- WO 2005/108578 PCT/CA2005/000694 Genus Species ID Result Interpretation (prpR) Lactobacillus pentosus B01 Lactobacillus plantarum B01 Lactobacillus plantarum B03 Lactobacillus rhamnosus B01 Lactobacillus rhamnosus B02 Lactococcus lactis B02 Lactococcus lactis B09 Lactococcus raffinolactis B01 Legionella pneumophila B02 Legionella pneumophila B04 Listeria grayl B01 Listeria innocua B02 Listeria innocua B07 Listeria i vanovii B01 Listeria ivanovii B02 Listeria monocytogenes 814 Listeria monocytogenes B27 Listeria seeligeri BO1 Listeria welshimeri B01 Listeria welshimeri B02 Mricrococcus luteus B01 Micrococcus luteus B03 Mycobacterium smegmatis 101 Neisseria gonorrhoeae B01 Neisseria lactamica B01 Nleisseria meningitidis B01 Neisseria meningitidis B02 Neisseria sica B02 Nocardia asteroides BO1 Pediococcus acidilactici 101 Pediococcus acidilactici B02 Pediococcus pentosaceus B01 Proteus mirabilis B05 Proteus mirabilis B10 Proteus penned B01 Proteus penneri B02 -56- WO 2005/108578 PCT/CA2005/000694 Genus Species ID Result Interpretation (prpR) Proteus vulgaris B02 Proteus vulgaris B05 Pseudomonas aeruginosa B12 Pseudomonas aeruginosa B17 Pseudomonas sp. B03 Pseudomonas mendocina B01 Pseudomonas pseudoalcaligenes B01 Pseudomonas putida B04 Pseudomonas putida B05 Pseudomonas stutzeri B02 Salmonella agona B01 Salmonella arizonae BOI1 Salmonella arizonae B04 Salmonella bongori B01 Salmonella brandenburg B01 Salmonella choleraesuis B02 Salmonella choleraesuis B04 Salmonella diarizonae B01 Salmonella dublin B02 Salmonella dublin B05 Salmonella enteritidis B03 Salmonella enteritidis B09 Salmonella heidelberg B01 Salmonella heidelberg B02 Salmonella houtenae B01 Salmonella indica B01 Salmonella infantis B01 Salmonella infantis B02 Salmonella montevideo B01 Salmonella montevideo B02 Salmonella newport B02 Salmonella newport B04 Salmonella paratyphi B03 Salmonella paratyphi B06 Salmonella paratyphi 311 Salmonella paratyphi B13 -57- WO 2005/108578 PCT/CA2005/000694 Genus Species ID Result Interpretation (prpR) Salmonella saintpaul B04 Salmonella saintpaul B05 Salmonella senftenberg B01 Salmonella stanley B01 Salmonella thompson B01 Salmonella thompson B02 Salmonella typhi B03 Salmonella typhi B04 Salmonella typhimurium B04 Salmonella typhimurium B05 Salmonella typhisuis B01 Salmonella typhisuis B02 Serratia liquefaciens B01 Serratia liquefaciens B02 Serratia marcescens B04 Serratia marcescens B07 Serratia odorifera BO1 Shigella boydl B01 Shigella dysenteriae 801 Shigella dysenteriae B02 Shigella flexneri B11 Shigella flexneri B15 Shigella sonnei 801 Shigella sonnei B04 Staphylococcus aureus B06 Staphylococcus aureus B09 Staphylococcus chromogenes 801 Staphylococcus epidermidis B03 Staphylococcus epidermidis B04 Staphylococcus intermedius 801 Staphylococcus lentis B01 Staphylococcus ludgdunensis B01 Staphylococcus schieiferi B01 Staphylococcus xylosus B01 Stenotrophomonas maltophilia B02 Streptococcus agalactiae B01 -58- WO 2005/108578 PCT/CA2005/000694 Genus Species ID Result Interpretation (prpR) Streptococcus agalactiae B02 Streptococcus bovis B01 Streptococcus pneumoniae B01 Streptococcus pneumoniae B02 Streptococcus pyogenes B02 Streptococcus pyogenes B03 Streptococcus suis B01 Streptococcus thermophilus B01 Vibrio alginolyticus BO1 Vibrio cholerae B07 Vibrio cholerae B11 Vibrio editor B01 Vibrio fluvialis BO1 Vibrio hollisae B01 Vibrio vulnificus B01 Xanthomonas campestris B01 Yersinia enterocolitica B03 Yersinia enterocolitica B12 Yersinia frederiksenii B01 Yersinia kritensenii B01 Example 8: Determination of a Unique, Conserved DNA Region in E. coli vkgM 3' Regions Regions of the E. coli genome encompassing part of the ykgM gene from 10 different E. coli isolates were sequenced and aligned as described forprpR in Example 1. 5 Figure 4 depicts a sample of such an alignment in which a portion of the genome encompassing the 3' end of the ykgM gene of 10 different E. coli strains have been aligned. A 144 nucleotide conserved sequence (SEQ ID NO:36) was identified from the multiple sequence alignment. 10 CTTCACAATCTGACAGTCTGGATGGCGTTCTTTTGCGGTACGCAGAGAGTT AAGRACTTTCATCAYGCCCCCTTTTTCGTGCTAACAAAACGACCAAAACGT -59- WO 2005/108578 PCT/CA2005/000694 TGGGTGAAYCGTGCAACATTTCCTTCTGATGCCACTGTTCTC [SEQ ID NO:36] wherein: Y = T or C and R = A or G. This unique and conserved element of the E. coli ykgM 3'region sequences 5 (consensus sequence) was used to design highly specific primers for the PCR amplification of this conserved region. Example 9: Generation of PCR Primers for Amplification of the ykgM Consensus Sequence Within the conserved 144 nucleotide sequence identified as described in Example 8, 10 regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. The primer sequences are shown below: Forward primer #3: 5 '-CTTCACAATCTGACAGTCTGG-3' [SEQ ID NO:38] Reverse primer #2: 5'-GAGAACAGTGGCATCAGAAG-3' [SEQ ID NO:39] 15 In the alignment presented in Figure 4, the positions of forward primer #3 and reverse primer #2 are represented by shaded boxes. Forward primer #3 starts at position 212 and ends at position 232 of the alignment. Reverse primer #2 represents the reverse complement of the region starting at position 336 and ending at position 355. Example 10: Generation of Molecular Beacon Probes Specific for the E.coli 20 ykgM Consensus Sequence In order to design molecular beacon probes specific for E. coli, a region within the ykgM consensus sequence described above was identified which not only was highly conserved in all E. coli isolates, but was also exclusive to E. coli isolates. This sequence consisted of a 28 nucleotide region that would be suitable for use as a 25 molecular beacon target sequence. The sequence is provided below: - 60- WO 2005/108578 PCT/CA2005/000694 5'-GTACGCAGAGAGTTAAGR*ACTTTCATCA-3' [SEQ ID NO:37] * indicates A or G. The complement of this sequence [SEQ ID NO:43, see Table 1] is also suitable for use as a molecular beacon target sequence. 5 A molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc. ykgM molecular beacon probe #3: 5 '-cccgggGTACGCAGAGAGTTAAGR*ACTTTCATCAcccggg-3' [SEQ ID NO:40] The complement of this sequence (SEQ ID NO:42, shown below) can also be used as 10 a molecular beacon probe for the detecting E.coli. 5'- cccgggTGATGAAAGTYCTTAACTCTCTGCGTACcccggg-3' [SEQ ID NO:42] tY indicates T or C. The molecular beacons were designed as described in Example 3. Table 8 provides a general overview qf the characteristics of molecular beacon probe 15 #3. The beacon sequence shown in Table 8 indicates the stem region in lower case and the loop region in upper case. *R indicates A or G. Table 8: Description of ykgM Molecular Beacon Probe #1 Beacon sequence (5'-> 3') : cccgggGTACGCAGAGAGTTAAGR*ACTTTCATCAcccggg Fluorophore (5') : FAM Quencher (3'): DABCYL Table 9 provides an overview of the thermodynamics of the folding of molecular beacon probe #3. Calculations were made using MFOLDTM software, or the Oligo 20 Analyzer software package available on Integrated DNA Technologies Inc. web site. Figure 5 shows the arrangement of PCR primers and the molecular beacon probe in the ykgM consensus sequence. Numbers in parentheses indicate the positions of the -61 - WO 2005/108578 PCT/CA2005/000694 first and last nucleotides of each feature on the PCR product generated with the forward and reverse primers. Table 9: Thermodynamics of Molecular Beacon Probe #3 Tm loop (thermodynamics algorithm) 58.6 0 C to 60.0 0 C Tm stem (mINFOLD calculation) 65.9 0 C AG3 7 (mINFOLD calculation) -4.3 kCal/mol AH (mINFOLD calculation) -46.6 kCal/mol Three further ykgM specific molecular beacons suitable for the detection of E. coli 5 were also prepared as described above. The sequences are shown below (nucleotides in lower case represent the nucleotides that make up the stem of the beacon): ykgM molecular beacon probe #4: 5'-cctgcCATCACGCCCCCTTTTTCGgcagg-3' [SEQ ID NO:44] ykgM molecular beacon probe #5: 10 5 '-cctgccCATCACGCCCCCTTTTTCggcagg-3'[SEQ ID NO:48] ykgM molecular beacon probe #6: 5'-cgcgaCCCCTTTTTCGTGCTAACAAAACGtcgcg-3' [SEQ ID NO:52] ykgM molecular beacon probe #7: 5 '-cctgcCATCAY GMtCCCCTTTTTCGgcagg-3' [SEQ ID NO:56] 15 ykgM molecular beacon probe #8: 5 '-cctgcCATCAIGICCCCTTTTTCGgcagg-3' [SEQ ID NO:60] IY indicates T or C; tM indicates A or C; I indicates inosine. The complement of these sequences (SEQ ID NOs:46, 50, 54, 58 and 62, respectively, see below) can also be used as molecular beacon probes for the detection of E. coli. 20 5'-cctgcCGAAAAAGGGGGCGTGATGgcagg-3' [SEQ ID NO:46] 5 -cctgccGAAAAAGGGGGCGTGATGggcagg-3' [SEQ ID NO:50] - 62 - WO 2005/108578 PCT/CA2005/000694 5'-cgcgaCGTTTTGTTAGCACGAAAAAGGGGtcgcg-3' [SEQ ID NO:54] 5 '-cctgcCGAAAAAGGGGK CR TGATGgcagg-3'[SEQ ID NO:58] 5'-cctgcCGAAAAAGGGGICITGATGgcagg-3' [SEQ ID NO:62]. IK indicates T or G; TR indicates A or G; I indicates inosine. 5 Example 11: Positive Validation of vkgM Primers and Molecular Beacon Probe #3 The effectiveness ofykg forward primer #3, reverse primer #2 and molecular beacon probe #3 for amplifying and detecting E. coli isolates was demonstrated as described generally below. 10 Genomic DNA from the species and strains presented in Table 11 below was isolated as described in Example 4. Amplification was conducted as described in Example 5 with the exception that ykg forward primer #3 and reverse primer #2 and the following PCR mix were used. Table 10. PCR Mix used for Validation Final concentration used in Reagent reconstituted reaction Qiagen PCR buffer, 10X 1.5X Forward primer #3, 25 [M 0.5 RM Reverse primer #2, 25 4M 0.5 pM dNTPs, 10 mM 0.2 mM MgC1 2 , 25 mM 1.75 mM Molecular beacon #3, 10 pM 0.3 gM HotStarTaq, 5 U/pL 1 U/25 [tL reaction 15 Results are presented in Table 11 and indicate that of the 224 strains of E. coli tested, 213 gave a positive signal and 11 gave a negative signal (i.e. sensitivity of 95%). - 63 - WO 2005/108578 PCT/CA2005/000694 Table 11. Positive Validation of vkgM Molecular Beacon Probe #3 and Primers Interpretation Species ID Serovars (ykgM) Escherichia coli 801 + Escherichia coli B02 + Escherichia coli B12 + Escherichia coli B13 018AC:NM + Escherichia coli B14 01:NM + Escherichia coli B15 075:H5 + Escherichia coil 816 062:H32 + Escherichia coli B17 071:H12 + Escherichia coli 818 055:NM + Escherichia coil B19 050:H4 + Escherichia coli B20 044:H18 + Escherichia coli B21 045:H23 + Escherichia coil B23 028:NM + Escherichia coli B24 034:NM + Escherichia coli B25 026:NM + Escherichia coli B26 024:NM + Escherichia coli B27 078:H11 + Escherichia coli B28 08:H9 + Escherichia coil B29 0114:H32 + Escherichia coil B30 03:H44 Escherichia coli B31 04:H5 + Escherichia coli B32 05:H4 + Escherichia coli B33 023:H15 + Escherichia coli B34 07:NM + Escherichia coli B35 018:H14 + Escherichia coli B36 09:H12 + Escherichia coli B37 010:NM + Escherichia coli B38 012:NM + Escherichia coli B39 013:NM + Escherichia coli B40 014:NM + Escherichia coli B41 078:NM + Escherichia coli B42 06:H49 + Escherichia coli B43 0127:NM Escherichia coli B44 + - 64 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovars (ykgM) Escherichia coli B45 + Escherichia coli B46 01:H7 + Escherichia coli B47 0157:H19 + Escherichia coli B48 086:NM + Escherichia coil B49 086:NM + Escherichia coli B50 040:H(NT) + Escherichia coli B51 018:H14 + Escherichia coli B52 0136:NM + Escherichia coil B53 077:NM + Escherichia coli B54 0113:H21 + Escherichia coil B55 080:H26 + Escherichia coli B56 0102:H40 + Escherichia coli B57 086:NM + Escherichia coil B58 + Escherichia coli B59 0112:H18 + Escherichia coli B60 0128AC:NM + Escherichia coli B61 0112AC:NM Escherichia coil B62 0128AB:H2 + Escherichia coli B63 0117:H4 + Escherichia coil B64 0119:H18 + Escherichia coli B65 0124:H25 + Escherichia coli B66 0125AB:H19 + Escherichia coli B67 0126:H2 + Escherichia coli B68 0128AB:H8 + Escherichia coli B69 B + Escherichia coli B71 0157:H7 + Escherichia coli B73 0157:H7 + Escherichia coli B74 0157:H8 + Escherichia coli B75 0157:H9 + Escherichia coli B76 0157:H11 + Escherichia coil B77 06:H1 + Escherichia coli B78 Escherichia coli B79 Escherichia coli B80 Escherichia coil B81 0157:H7 + - 65 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovars (ykgM) Escherichia coil B82 0157:H7 + Escherichia coli B83 0157:H7 + Escherichia coli B84 0157:H7 + Escherichia coli B85 0157:H7 + Escherichia coil B86 0157:H7 + Escherichia coli B87 0157:H7 + Escherichia coli B88 0157:H7 + Escherichia coli B89 0157:H7 + Escherichia coli B90 0157:H7 + Escherichia coil B91 0157:H7 + Escherichia coil B92 0157:H7 + Escherichia coil B93 0157:H7 + Escherichia coli B94 0157:H7 + Escherichia coli B95 0157:H7 + Escherichia coil B96 0157:H7 + Escherichia coli B97 0157:H7 + Escherichia coli B98 0157:H43 + Escherichia coli B99 0157:H43 + Escherichia coli 8100 0157:H43 + Escherichia coli 8101 0157:HNM + Escherichia coil 8102 0157:HNM + Escherichia coli 8103 055:H6 + Escherichia coil 8104 055:H6 + Escherichia coil 8105 055:H6 + Escherichia coli 8106 055:H6 + Escherichia coli 8107 055:H6 + Escherichia coil 8108 055:H6 + Escherichia coli 8109 055:NM + Escherichia coli B110 055:H6 + Escherichia coli 8111 055:H6 + Escherichia coil B112 055:H6 + Escherichia coli 8113 055:H5 + Escherichia coli 8114 055:H7 + Escherichia coil B115 055:H7 + Escherichia coli 8116 055:H7 + - 66 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovars (ykgM) Escherichia coil B117 055:H7 + Escherichia coli B118 O111:H21 + Escherichia coli B120 O111:H12 + Escherichia coli B121 0111:H12 + Escherichia coli B122 O111:NM + Escherichia coli B123 0111A:HNM + Escherichia coli B124 O111:H8 + Escherichia coli B125 O111:HNM + Escherichia coil B126 0111:Hl1 + Escherichia coli B127 O111:H8 + Escherichia coli B128 026:H11 + Escherichia coli B130 0111:H12 + Escherichia coli B131 026:H 11 + Escherichia coli B132 026:H 11 + Escherichia coil B133 026:H 11 + Escherichia coil B134 026:H 11 + Escherichia coli B135 026:Hl1 + Escherichia coli B136 026:Hl1 + Escherichia coli B137 026:H11 + Escherichia coli B138 0128A:H2 + Escherichia coli B139 0128A:H2 + Escherichia coli B140 045:H2 + Escherichia coil B141 0128:H2 + Escherichia coli B142 0128:H2 + Escherichia coil B143 O111:H2 + Escherichia coil B144 O111:H2 + Escherichia coil B145 O111:NM + Escherichia coil B146 O111:H2 + Escherichia coli B147 O111:HN + Escherichia coil B148 0128:H7 + Escherichia coli B149 0128:H7 + Escherichia coli B150 0128:H7 + Escherichia coli B151 0128:H7 + Escherichia coli B152 0128:H47 + Escherichia coli B153 0128:H21 + - 67 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovars (ykgM) Escherichia coli B154 0128:H21 + Escherichia coli 8155 0128A:H21 + Escherichia coli 8156 0128:HNM + Escherichia coli B157 0128:H21 + Escherichia coil B158 0111:H21 + Escherichia coil 8159 0111:H21 + Escherichia coil B160 0111:H21 + Escherichia coli B161 0111:H21 + Escherichia coli B162 0111:H21 + Escherichia coli B163 0157:H7 + Escherichia coil B164 0157 + Escherichia coli B165 015:NM + Escherichia coli B166 ON:HN + Escherichia coli B167 ON:H32 + Escherichia coli B168 01:NM + Escherichia coli 8169 ON:HN + Escherichia coli B170 079:NM + Escherichia coli B171 ON:NM + Escherichia coli 8172 085:HN + Escherichia coil B174 ON:NM + Escherichia coil B175 06:H10 + Escherichia coli B 176 06:H10 + Escherichia coil B179 OM:HN + Escherichia coli 8180 025:NM + Escherichia coli 81 ON:H10 + Escherichia coli B182 0106:NM + Escherichia coli B183 05:NM + Escherichia coil B184 05:HN + Escherichia coli 8185 089:HN Escherichia coli B186 0121:HN Escherichia coli B187 ON:HN + Escherichia coli B188 086:H43 + Escherichia coil B189 015:NM + Escherichia coil B190 ON:HN + Escherichia coli B191 0104:H21 + - 68 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovars (ykgM) Escherichia coli B192 0104:NM + Escherichia coli B193 0104:NM + Escherichia coli B194 0150:H21 + Escherichia coli B195 0113:H21 + Escherichia coli B196 079:H43 + Escherichia coli B197 07:H21 + Escherichia coli B198 07:H21 + Escherichia coli B199 088:NM + Escherichia coli B200 01:NM + Escherichia coli B201 079:H25 + Escherichia coli B202 ON:HN + Escherichia coli B203 07:NM + Escherichia coli B204 07:NM + Escherichia coli B205 07:NM + Escherichia coil B206 07:NM + Escherichia coli B207 ON:H26 + Escherichia coli B208 ON:HN + Escherichia coil B209 ON:HN + Escherichia coil B210 ON:HN + Escherichia coli B211 01:H6 + Escherichia coli B212 OM:H18 + Escherichia coli B213 ON:HM + Escherichia coli B214 02:NM + Escherichia coli B215 02:HN + Escherichia coli B216 025:HN + Escherichia coli B217 025:H1 + Escherichia coli B218 04:HN + Escherichia coli B219 025:H1 + Escherichia coil B222 ON:NM + Escherichia coil B223 0112:H8 + Escherichia coli B224 04:H40 + Escherichia coli B225 04:HN + Escherichia coil B226 02:NM + Escherichia coli B227 02:NM + Escherichia coil B228 02:NM + - 69 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Serovars (ykgM) Escherichia coli B229 075:NM , + Escherichia coli B230 ON:H10 + Escherichia coil B231 04:H40 + Escherichia coli B232 04:H43 + Escherichia coil B233 ON:NM + Escherichia coli B234 ON:NM + Escherichia coil B235 078:NM + Escherichia coli B236 078:NM + Escherichia coli B237 0144:H8 + Escherichia coli B239 010:K5(1):H4 + Escherichia coli B240 0119:K69(bl4) + Escherichia coil B241 03:K2a,2b(1):H2 + Escherichia coil B242 0127:K63(b8) Escherichia coli B243 0112a:112c:K66(bli):NM Escherichia coli B244 Example 12: Negative Validation of the vkgM Primers and Molecular Beacon Probe #3 In order to test the ability of the ykgM forward primer #3, reverse primer #2 and molecular beacon #3 to preferentially amplify and detect only E. coli, a number of 5 bacteria other than E. coli were tested. Samples of genomic DNA from the bacteria presented in Table 12 below were isolated and amplified as described in the preceding Example. When no probe was included in the amplification reaction, any amplicons produced were detected using SYBR Green. No amplification products were observed (i.e. specificity of 100%). 10 Also included in additional rounds of tests was ykgM molecular beacon #3. No hybridization of the molecular beacon was observed (i.e. specificity of 100%). These results indicate that both the amplification primers and the molecular beacon #3 are highly specific for E. coli. - 70 - WO 2005/108578 PCT/CA2005/000694 Table 12. Negative Validation of the vkgM Primers and Molecular Beacon Probe #3 Interpretation Species ID Result (ykgM) Acinetobacter calcoaceticus B01 Acinetobacter calcoaceticus B08 Acinetobacter iwoffi B02 Acinetobacter junii B01 Aeromonas hydrophila B03 Aeromonas hydrophila B04 Aeromonas salmonicida B02 Aeromonas salmonicida B05 Alcaligenes faecalis B01 Bacillus amyloliquefaciens 801 Bacillus amyloliquefaciens B02 Bacillus cereus 801 Bacillus cereus B06 Bacillus circulans B04 Bacillus circulans B05 Bacillus coagulans B02 Bacillus coagulans B03 Bacillus firmus 801 Bacillus lentus 801 Bacillus licheniformis 801 Bacillus licheniformis B02 Bacillus megaterium B06 Bacillus megaterium B07 Bacillus mycoides B01 Bacillus pumilus B04 Bacillus pumilus B06 Bacillus sphaericus 801 Bacillus stearothermophilus B03 Bacillus subtilis B04 Bacillus subtilis B09 Bacillus thuringiensis B01 Bacillus thuringiensis B03 Bacteroides fragilis 801 -71 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Result (ykgM) Bifidobacterium adolescentis B01 Bifidobacterium animalis B01 Bifidobacterium bifidum B01 Bifidobactenrum longum 801 Bifidobacterium pseudolongum 801 Bifidobacterium sp. B17 Bifidobactenrium sp. B25 Bifidobacterium suis 801 Bifidobacterium thermophilus B01 Bordetella bronchiseptica B01 Bordetella pertussis B01 Borrelia burgdorferi B01 Branhamella catarrhalis 801 Brevibacillus laterosporus 801 Campylobacter coli B01 Campylobacter jejuni 801 Campylobacter jejuni B02 Campylobacter lan B01 Campylobacter lari 802 Campylobacter rectus B01 Cellilomonea sp. 801 Chromobacterium violaceum 801 Chryseobacterium sp. 801 Chryseomonas luteola B02 Citrobacter amalonaticus B01 Citrobacter amalonaticus B02 Citrobacter diversus 801 Citrobacter freundii B03 Citrobacter freundii 809 Citrobacter koseri 801 Citrobacter koseri B03 Citrobacter werkmanil B01 Clostridium botulinum B01 Clostridium botulinum B12 Clostridium butyricum B01 - 72 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Result (ykgM) Clostridium difficile B01 Clostridium perfringens 101 Clostridium perfringens B02 Clostridium sporogenes 801 Clostridium tetani B01 Clostridium tyrobutyricum 801 Corynebacterium xerosis B01 Edwardsiella tarda B01 Enterobacter aerogenes B04 Enterobacter aerogenes B08 Enterobacter amnigenus 801 Enterobacter cloacae B06 Enterobacter cloacae B09 Enterobacter intermedius B Enterobacter intermedius B02 Enterobacter taylorae BO1 Enterococcus faecalis 805 Enterococcus faecalls B06 Enterococcus faecium BO1 Enterococcus hirae BO1 Enterococcus hirae B02 Erwinia herbicola B01 Escherichia blattae 801 Escherichia blattae B02 Escherichia blattae B03 Escherichia fergusonil 801 Escherichia hermannii 801 Escherichia hermannii B02 Escherichia hermannii B03 Escherichia vulneris 801 Escherichia vulneris B02 Escherichia vulneris B03 Haemophilus equigenitalis 801 Haemophilus influenzae B02 Haemophilus influenzae B04 - 73 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Result (ykgM) Haemophilus paragallinarum B01 Hafnia alvei B01 Hafnia alvei B02 Helicobacter pylori B02 Klebsiella ornithinolytica B01 Klebsiella oxytoca .B02 Klebsiella oxytoca B06 Klebsiella planticola B01 Klebsiella planticola B02 Klebsiella pneumoniae BOB Klebsiella pneumoniae B15 Klebsiella terrigena B01 Kocuria kristinae B01 Kurthia zopfii B01 Kurthia zopfii B02 Lactobacillus acidophilus B01 Lactobacillus casei B01 Lactobacillus case B03 Lactobacillus delbreuckil B01 Lactobacillus delbreuckii B03 Lactobacillus helveticus B01 Lactobacillus pentosus B01 Lactobacillus plantarum B01 Lactobacillus plantarum B03 Lactobacillus rhamnosus B01 Lactobacillus rhamnosus B02 Lactococcus lactis B02 Lactococcus lactis B09 Lactococcus raffinolactis B01 Legionella pneumophila B02 Legionella pneumophila B04 Listeria grayi B01 Listeria innocua B02 Listeria innocua B07 Listeria ivanovii B01 - 74 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Result (ykgM) Listeria ivanovii B02 Listeria monocytogenes B14 Listeria monocytogenes B27 Listeria seeligeri B01 Listeria welshimeri B01 , Listeria welshimeri B02 Micrococcus luteus B01 Micrococcus luteus B03 Mycobacterium smegmatis B01 Neisseria gonorrhoeae B01 Neisseria lactamica B01 Neisseria meningitidis B01 Neisseria meningitidis B02 Neisseria sica B02 Nocardia asteroides B01 Pediococcus acidilactici B01 Pediococcus acidilactici B02 Pediococcus pentosaceus B01 Proteus mirabilis B05 Proteus mirabilis BO10 Proteus penneri B01 Proteus penneri B02 Proteus vulgaris B02 Proteus vulgaris B05 Pseudomonas aeruginosa B12 Pseudomonas aeruginosa B17 Pseudomonas sp. B03 Pseudomonas mendocina B01 Pseudomonas pseudoalcaligenes B01 Pseudomonas putida B04 Pseudomonas putida B05 Pseudomonas stutzeri B02 Salmonella agona B01 Salmonella arizonae B01 Salmonella arizonae B04 - 75 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Result (ykgM) Salmonella bongori BOI Salmonella brandenburg 801 Salmonella choleraesuis B02 Salmonella choleraesuis B04 Salmonella diarizonae B01 Salmonella dublin B02 Salmonella dublin 805 Salmonella enteritidis B03 Salmonella enteritidis B09 Salmonella heidelberg 801 Salmonella heidelberg 802 Salmonella houtenae B01 Salmonella indica 801 Salmonella infantis B01 Salmonella infantis B02 Salmonella montevideo 801 Salmonella montevideo B02 Salmonella newport B02 Salmonella newport B04 Salmonella paratyphi B03 Salmonella paratyphi B06 Salmonella paratyphi BI1I Salmonella paratyphi B13 Salmonella saintpaul B04 Salmonella saintpaul 805 Salmonella senftenberg 801 Salmonella stanley B01 Salmonella thompson B01 Salmonella thompson B02 Salmonella typhi 803 Salmonella typhi B04 Salmonella typhimurium B04 Salmonella typhimurium 805 Salmonella typhisuis 801 Salmonella typhisuis B02 - 76 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Result (ykgM) Serratia liquefaciens B01 Serratia liquefaciens B02 Serratia marcescens B04 Serratia marcescens B07 Serratia odorifera B01 Shigella boydii B01 Shigella dysenteriae B01 Shigella dysenteriae B02 Shigella flexneri B11 Shigella flexneri B15 Shigella sonnei B01 Shigella sonnei B04 Staphylococcus aureus B06 Staphylococcus aureus B09 Staphylococcus chromogenes B01 Staphylococcus epidermidis B03 Staphylococcus epidermidis B04 Staphylococcus intermedius B01 Staphylococcus lentis B01 Staphylococcus ludgdunensis B01 Staphylococcus schieiferi B01 Staphylococcus xylosus B01 Stenotrophomonas maltophilia B02 Streptococcus agalactiae B01 Streptococcus agalactiae B02 Streptococcus bovis B01 Streptococcus pneumoniae B01 Streptococcus pneumoniae B02 Streptococcus pyogenes B02 Streptococcus pyogenes B03 Streptococcus suis B01 Streptococcus thermophilus B01 Vibrio alginolyticus B01 Vibrio cholerae B07 Vibrio cholerae B11 - 77 - WO 2005/108578 PCT/CA2005/000694 Interpretation Species ID Result (ykgM) Vibrio eltor B01 Vibrio fluvialis B01 Vibrio hollisae B01 Vibrio vulnificus B01 Xanthomonas campestris B01 Yersinia enterocolitica B03 Yersinia enterocolitica B12 Yersinia frederiksenii B01 Yersinia kritensenii B01 Escherichia fergusonii B02 Escherichia fergusonii B03 Escherichia fergusonli B04 Escherichia fergusonii B05 Citrobacter braakii BO1 Citrobacter braakii B04 Citrobacter freundil B05 Citrobacter freundii B06 Citrobacter freundli B07 Citrobacter freundii B08 Example 13: Quantification of prpR and yvkgM Target Sequences in a Test Sample In order to quantify the amount of target sequence in a sample, DNA was isolated and amplified as described in the preceding Examples (4, 5 and 11). DNA was quantified 5 using a standard curve constructed from serial dilutions of a target DNA solution of known concentration. Example 14: Testing prpR-Specific and vkgM-Specific Primers and Molecular Beacon Probes and Combinations Thereof The prpR and ykgMprimers and molecular beacon probes were tested for sensitivity 10 against a panel of 223 E. coli strains and for specificity against a panel of 262 other bacterial species. -78- WO 2005/108578 PCT/CA2005/000694 For testing described in this Example that uses one pair of primers alone or in combination with a single beacon, the PCR mix and parameters in Tables 4, 5 and 10 were used, for multiplex PCR, the parameters in Table 5 were used together with the following PCR mix (Table 14). The final concentration of MgCl 2 in the reaction mix 5 is 4mM. Table 14. Multiplex PCR Reaction Mix Final concentration in Reagent reconstituted reaction Qiagen PCR buffer, 10X 1.5X prpR Forward primer #1, 25 jLM 0.4 gM prpR Reverse primer #1, 25 pM 0.4 jtM ykgMForward primer #3, 25 pM 0.4 [tM ykgMReverse primer #2, 25 gM 0.4 jigM dNTPs, 10 mM 0.2 mM MgC1 2 , 25 mM 1.75 mM prpR Molecular beacon #1, 10 gM 0.2 gM ykgM Molecular beacon #3, 10 gM 0.2 gM HotStarTaq, 5 U/pL 1 U/25gL reaction When a molecular beacon was not included in the reaction, amplicons were detected with SYBR® Green. An example of a suitable reaction mix for use with SYBR® Green is provided in Table 15 (dNTPs and Taq polymerase are included in the Qiagen 10 SyBrGreen Mix). Table 15. SyBrGreen Reaction Mix Final concentration in Reagent reconstituted reaction Qiagen SyBrGreen, 2X 1.0X Forward primer #1, 25 gM 0.5 gM - 79 - WO 2005/108578 PCT/CA2005/000694 Reverse primer #1, 25 gM 0.5 jiM MgC1 2 , 5 mM 1.5 mM Fluorescein 1 pM 0.01 gM 14.1 Specificity and Sensitivity ofPrimers The sensitivity of the primer pairprpR forward primer #1/reverse primer #1 was tested against a panel of 66 E. coli strains using the SYBR Green Reaction Mix shown above. The primer pair amplified 92% of the panel of E.coli strains. Five E.coli 5 strains were-not amplified. The primer pairprpR forward primer #2/reverse primer #1 gave similar results except one more E. coli strain was amplified than when the prpR forward primer #1/reverse primer #1 pair were used. From the panel of bacterial species other than E. coli, the prpR forward primer #1/reverse primer #1 pair amplified sequences from Escherichiafergusonii and 10 Citrobacter braakii. When an upper limit of 30 Ct was used, the primer pair demonstrated 100% specificity. A summary of the sensitivity and specificity of the prpR forward primer #1/reverse primer #1 pair is shown in Table 16. Table 16. Summary for prpR Forward Primer #1 and reverse primer #1 Sensitivity 92.4% Specificity 99.6% False Positives 7.6% False Negatives 0.4% Efficiency of Primer Pair 98.1% 15 The primer pair ykgM forward primer #3/reverse primer #2 amplified 94% of the panel of 66 E.coli strains. Four E.coli strains were not amplified. This primer pair did not amplify any sequences from the panel of non-E. coli bacteria. A summary of the - 80- WO 2005/108578 PCT/CA2005/000694 sensitivity and specificity of the ykgM forward primer #3/reverse primer #2 pair is shown in Table 17. Table 17. Summary for vgkM Forward Primer #3 and Reverse Primer #2 Sensitivity 93.9% Specificity 100% False Positives 6.1% False Negatives 0.0% Efficiency of Primer Pair 98.7% Combination of the pipR forward primer #1/reverse primer #1 pair with the ykgM 5 forward primer #3/reverse primer #2 pair resulted in a greater overall efficiency (see Table 18). Table 18. Summary for Combination of Primer Pairs Sensitivity 98.5% Specificity 99.6% False Positives 1.5% False Negatives 0.4% Efficiency of Primer Pair 99.4% 14.2 Optimal Primer Concentrations Optimal concentrations for the two primer pairs were also determined by testing the 10 pairs under standard PCR conditions at the following concentrations: 200nM, 400nM, 500nM and 600nM. The optimal concentration for pipR forward primer #1 and reverse primer #1 under standard conditions was 600nM. The optimal concentration for ykgM forward primer #3 and reverse primer #2 under 15 atandard conditions was 500nM. -81 - WO 2005/108578 PCT/CA2005/000694 14.3 Primer Annealing Temperatures Annealing temperatures were determined using the optimal concentrations indicated in Section 14.2 and using a temperature gradient of 45 0 C to 65 0 C (45 0 C, 46.4 0 C, 48.8 0 C, 52.3 0 C, 57.5 0 C, 61.1 0 C, 63.6 0 C and 65 0 C). DNA from E. coli strain ATCC 5 8739 at a 1:10 dilution was used. Measurements were made in triplicate. prpR forward primer #1 and reverse primer #1 annealed to their target sequence under these conditions up to 61.1 0 C. ykgM forward primer #3 and reverse primer #2 annealed to their target sequence under these conditions up to 65°C. 10 14.4 Molecular Beacon Efficiencies Efficiencies were tested for prpR molecular beacon #2 and ykgMmolecular beacons #3, #4, #5 and #6 using DNA from E. coli strain 012:NM at dilutions from 1x10 0 to 1x10 -6 . The results were as follows: For prpR molecular beacon #2: Efficiency 89%, detection to 4 logs of dilution. 15 For ykgM molecular beacon #3: Detection to 4 logs of dilution. For ykgM molecular beacon #4: Efficiency 97%, detection to 5 logs of dilution. For ykgM molecular beacon #5: Efficiency 96%, detection to 4 logs of dilution. For ykgM molecular beacon #6: Detection to 5 logs of dilution. 14.5 Specificity and Sensitivity ofMolecular Beacon Probes 20 A summary of the sensitivity and specificity of the prpR molecular beacon #1 is shown in Table 19A. When an upper limit of 30 Ct was used in the reactions, the sensitivity and specificity values were as shown in Table 19B. Table 19A. Summary for prpR Molecular Beacon #1 Sensitivity 95.1% Specificity 97.3% False Positives 2.7% - 82 - WO 2005/108578 PCT/CA2005/000694 False Negatives 4.4% Efficiency of Primer Pair 96.3% Table 19B. Summary for prpR Molecular Beacon #1 with a Cut-Off of 30 Ct Sensitivity 95.1% Specificity 98.8% False Positives 1.1% False Negatives 4.4% Efficiency of Primer Pair 97.1% The prpR molecular beacon #2 detected 96.5% of the panel of E.coli strains. Five E.coli strains were not detected. One Escherichiafergusonii strain was tested and detected. 5 A summary of the sensitivity and specificity ofykgM molecular beacon #3 is shown in Table 20. Table 20. Summary for vkgM Molecular Beacon #3 Sensitivity 95.1% Specificity 100% False Positives 0% False Negatives 4.9% Efficiency of Primer Pair 98.3% The ykgM molecular beacon #3 detected 95.1% of the panel of E.coli strains. Eleven E coli strains were not detected. No non-E. coli strains were detected. 10 Combination of the prpR molecular beacon #1 with the molecular beacon #3 resulted in a greater overall efficiency (see Table 21A). The results for this combination when an upper limit of 30 Ct was used are shown in Table 21B. - 83 - WO 2005/108578 PCT/CA2005/000694 Table 21A. Summary for Combination of Molecular Beacon Probes #1 and #3 Sensitivity 100% Specificity 97.3% False Positives 0.4% False Negatives 0% Efficiency of Primer Pair 98.6% Table 21B. Summary for Combination of Molecular Beacon Probes #1 and #3 with a Cut-Off of 30 Ct Sensitivity 100% Specificity 100% False Positives 0.0% False Negatives 0.0% Efficiency of Primer Pair 100% Example 15: Positive Validation of the Combination of prpR and ykgM Primers 5 and Molecular Beacon Probes The combination ofprpR forward primer #1 and reverse primer #1, prpR molecular beacon #1, ykgM forward primer #3 and reverse primer #2 and ykgM molecular beacon #3 were tested against a panel of E. coli strains using the multiplex PCR conditions described in Table 14, above. 10 The results are shown in Table 22, the figures in parentheses indicate the number of strains that were tested (if more than one). The combination of the primers and the molecular beacons for both the prpR and ykgM genes detected all strains of E. coli tested. - 84 - WO 2005/108578 PCT/CA2005/000694 Table 22. Positive Validation of the Combination of Primers and Probes Escherichia coli Escherichia coli Escherichia coli Escherichia coli (10) 040:H(NT) 045:H2 079:H25 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 018AC:NM 018:H14 0111:H2 (3) 07:NM (4) Escherichia coli Escherichia coli Escherichia coli Escherichia coli 01:NM 0136:NM 0111:HN ON:H26 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 075:H5 077:NM 0128:H7 (4) 01:H6 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 062:H32 0113:H21 0128:H47 OM:H18 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 071:H12 080:H26 0128:H21 (3) 02:NM (4) Escherichia coli Escherichia coli Escherichia coli Escherichia coli 055:NM 0102:H40 0128A:H21 02:HN Escherichia coli Escherichia coli Escherichia coli Escherichia coli 050:H4 O112AC:NM 0128:HNM 025:HN Escherichia coli Escherichia coli Escherichia coli Escherichia coli 044:H18 0112:H18 0157 025:H1 (2) Escherichia coli Escherichia coli Escherichia coli Escherichia coli 045:H23 0128AC:NM4 015:NM 04:HN (2) Escherichia coli Escherichia coli Escherichia coli Escherichia coli 028:NM 0128AB:H2 ON:HN (8) 0112:H8 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 0127:NM 0117:H4 ON:H32 04:H40 (2) Escherichia coli Escherichia coli Escherichia coli Escherichia coli 034:NM 0119:H18 01:NM 075:NM Escherichia coli Escherichia coli Escherichia coli Escherichia coli 026:NM 0124:H25 079:NM ON:H10 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 024:NM 0125AB:H19 ON:NM (5) 011:HNM - 85 - WO 2005/108578 PCT/CA2005/000694 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 078:H11l 0126:H2 085:HN 04:H43 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 08:H9 0128AB:H8 06:H10 (2) 078:NM (2) Escherichia coli Eschechia cli Escherichia cli Escherichia cloli Escherichia coli 0114:H32 0157:H7 (23) OM:HN 0144:H8 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 04:H5 06:H1 025:NM 010:K5(1)H4 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 05:H4 0157:H43 (3) ON:H10 0119:K69(b14) Escherichia coli Escherichia coli Escherichia coli Escherichia coli 023:H15 0157:HNM (2) 0106:NM 03:K2a,2b(1):H2 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 07:NM 055:H5 05:NM 0127:K63(b8) Escherichia coli Escherichia coli Escherichia coli Escherichia coli 0112A:112C:K66 018:H14 055:H6 (9) 05:HN (bll):NM Escherichia coli Escherichia coli Escherichia coli Escherichia coli 09:H12 055:H7 (4) 086:H43 03:H44 Escherichia coli Escherichia coli Escherichia coli Escherichia coli 010:NM 0111:H21 (6) 015:NM 089:HN Escherichia coli Escherichia coli Escherichia coli Escherichia coli 012:NM 0111:H12 (3) 0104:H21 0121:HN Escherichia coli Escherichia coli Escherichia coli Escherichia coli 013:NM 0111:NM (2) 0104:NM (2) 0127:NM Escherichia coli Escherichia coli Escherichia coli Escherichia coli B 014:NM O111A:HNM 0150:H21 Escherichia coli Escherichia coli Escherichia coli 078:NM 0111:H8 (2) 0113:H21 Escherichia coli Escherichia coli Escherichia coli 06:H49 0111:H1 079:H43 -86- WO 2005/108578 PCT/CA2005/000694 Escherichia coli Escherichia coli Escherichia coli 01:H7 026:H11 (8) 07:H21 (2) Escherichia coli Escherichia coli Escherichia coli 0157:H19 0128A:H2 (2) 088:NM Escherichia coli Escherichia coli Escherichia coli 086:NM (3) 0128:H2 (2) 01:NM Example 16: Negative Validation of the Combination of prpR and kgM Primers and Molecular Beacon Probes The combination ofprpR forward primer #1 and reverse primer #1, prpR molecular beacon #1, ykgMforward primer #3 and reverse primer #2 and ykgMmolecular 5 beacon #3 were tested against a panel of non-E. coli bacterial species using the multiplex PCR conditions as described in Table 14, above. The results are shown in Table 23, the figures in parentheses indicate the number of strains that were tested (if more than one). None of the tested strains provided a positive result when an upper limit of 30 Ct was employed. For higher Ct cut-off 10 values, Escherichiafergusonii (5 strains) and Citrobacter braakii (2 strains) also gave a positive result. Table 23. Negative Validation of the Combination of Primers and Probes (usin a 30 Ct Cut-Off) Salmonella Acinetobacter Citrobacter Lactobacillus enterica subsp. calcoaceticus (2) amalonaticus (2) pentosus enterica serovar Newport (2) Acinetobacter Citrobacter Lactobacillus Salmonella iwoffi diversus plantarum (2) paratyphi (4) - 87 - WO 2005/108578 PCT/CA2005/000694 Salmonella Acinetobacter Citrobacter Lactobacillus enterica subsp. junii freundii (4) rhamnosus (2) enterica serovar Saintpaul (2) Salmonella Aeromonas Citrobacter koseri Lactococcus lactis enterica subsp. hydrophila (2) (2) (2) enterica serovar Senftenberg Salmonella Aeromonas Citrobacter Lactococcus enterica subsp. salmonicida (2) werkmanii raffinolactis enterica serovar Stanley Salmonella Alcaligenes Clostridium Legionella enterica subsp. faecalis botulinum (2) pneumophila (2) enterica serovar Thompson (2) Bacillus Clostridium Salmonella typhi amyloliquefaciens trium Listeria grayi ( butyricum (2) (2) Clostridium Listeria innocua Salmonella Bacillus cereus (2) Bacillus cereus (2)difficile (2) typhimurium (2) Salmonella Bacillus circulans Clostridium Listeria ivanovii enterica subsp. (2) perfringens (2) (2) enterica serovar Typhisuis (2) Bacillus Clostridium Listeria Serratia coagulans (2) sporogenes monocytogenes (2) liquefaciens (2) Serratia Bacillus firmus Clostridium tetani Listeria seeligeri marcescens (2) Clostridiumn Listeria Bacillus lentus tyrobutyricum welshierSerratia odorifera tyrobutyri-um welshimeri (2) - 88 - WO 2005/108578 PCT/CA2005/000694 Bacillus Corynebacterium Micrococcus licheniformis (2) xerosis luteus (2) Shigella boydii Bacillus Edwardsiella Mycobacterium Shigella megaterium (2) tarda smegmatis dysenteriae (2) Enterobacter Neisseria Shigellaflexneri Bacillus mycoides aerogenes (2) gonorrhoeae (2) Bacillus pumilus Enterobacter Neisseria Shigella sonnei (2) (2) amnigenus lactaminica Shigella sonnei (2) Bacillus Enterobacter Neisseria Staphylococcus sphaericus cloacae (2) meningitidis (2) aureus (2) Bacillus Enterobacter Staphylococcus stearothermophilu Neisseria sica Staphylococcus intermedius (2) chromogenes s Bacillus subtilis Enterobacter Nocardia Staphylococcus (2) taylorae asteroides epidermnidis (2) Bacillus Enterococcus Pediococcus Staphylococcus thuringiensis (2) faecalis (2) acidilactici (2) intermedius Bacteroides Enterococcus Pediococcus Staphylococcus fragilis faecium pentosaceus lentis Bifidobacterium Enterococcus Proteus mirabilis Staphylococcus adolescentis hirae (2) (2) ludgdunensis Bifidobacteriunt Erwinmia herbicola Proteus penneri Staphylococcus Erwinia herbicola animalis (2) schieiferi Bifidobacterium Escherichia Proteus vulgaris Staphylococcus bifidum blattae (3) (2) xylosus Bifidobacteriumn Escherichia Pseudomonas Stehotrophomonas longum hermanii (3) aeruginosa (2) maltophilia Bifidobacterium Escherichia Pseudomonas Streptococcus pseudolongumn vulneris (3) mendocina agalactiae (2) Bifidobacterium Haemophilus Pseudomonas Streptococcus spp. (2) equigenitalis pseudoalcaligenes bovis - 89- WO 2005/108578 PCT/CA2005/000694 Bifidobacterium Haemophilus Pseudomonas Streptococcus suis influenzae (2) putida (2) pneumoniae (2) Bifidobacterium Haemophilus Pseudomonas Streptococcus thermophilus paragallinarum stutzeri pyogenes (2) Salmonella Bordetella enterica, subsp. brneta Hafnia alvei (2) enterica, subsp. Streptococcus suis bronchiseptica enterica serovar Agona Salmonella Bordetella Helicobacter choleraesuis Streptococcus pertussis pylori subsp. Arizonae thermophilus (2) Borrelia Klebsiella Salmonella Vibrio burgdorferi ornithinolytica bongori alginolyticus S Salmonella Branhamella Klebsiella oxytoca enterica, subsp. Vibrio cholerae catarrhalis (2) enterica serovar (2) Brandenburg Brevibacillus Klebsiella Salmonella Vibrio eltor laterosporus planticola (2) choleraesuis (2) Vibrio eltor Salmonella Campylobacter Klebsiella Salmonella enterica, subsp. Vibriofluvialis coli pneumoniae (2) diarizonae Salmonella Campylobacter Klebsiella enterica subsp. Vibrio hollisae jejuni (2) terrigena enterica serovar Dublin (2) Campylobacter Salmonella Kocuria kristinae Vibrio vulnficus lari (2) enteritidis (2) - 90 - WO 2005/108578 PCT/CA2005/000694 Salmonella Campylobacter enterica, subsp. Xanthomonas Kurthia zopfii (2) rectus enterica serovar campestris Heidelberg (2) Lactobacillus Salmonella Yersinia Cellilomonea spp. acidophilus enterica, subsp. enterocolitica (2) houtenae Salmonella Chromobacterium Lactobacillus Salmonella Yersinia violaceum casei (2) enterica subsp. frederiksenii indica Sahnonella Chryseobacterium Lactobacillus enterica subsp. Yersinia spp. delbreuckii (2) enterica serovar kritensenii Infantis (2) Salmonella Chryseomonas Lactobacillus enterica subsp. luteola helveticus enterica serovar Montevideo (2) Example 17: Enrichment Procedure for Test Samples Samples to be tested can be enriched prior to use in the assay using standard enrichment procedures. The following are representative protocols for food samples based on various regulatory limits. 5 Protocol A (Regulatory Limit of 0 cfu/g): 1) Place 25 g or 25 ml of the sample in a stomacher filter bag with 225 mL of Tryptic Soy Broth (TSB) to make a 1:10 dilution. 2) Homogenize the contents of the bag for 10 sec using a Stomacher instrument (BagMixer). 10 3) Incubate the stomacher bag at 35 0 C for 18-24 hours in a storage rack with a closure clip attached to bag. -91- WO 2005/108578 PCT/CA2005/000694 4) After incubation, shake to stomacher bag to homogenise the content. 5) Transfer 1 mL of the cell suspension in the bag (taking care not to take samples from the side of the stomacher bag that contains food particles) to a 2 mL sterile tube and proceed with DNA extraction (for example, following the protocol in 5 Example 4). Protocol B (Regulatory Limit of 10 cfu/g): 1) Place 10 g or 10 ml of the sample in a stomacher filter bag with 90 ml of Peptone Water 0.1%. 2) Homogenize the contents of the bag for 10 sec using a Stomacher instrument 10 (BagMixer). 3) Transfer 1500 pL of sample from the stomacher bag into a tube with 1500 pL of TSB 2X. Use 2 tubes per sample to be tested. 4) Vortex the inoculated tubes to homogenise the contents. 5) Incubate at 35 0 C for 18 hours. 15 6) After incubation, vortex tubes to resuspend the cells. 7) Transfer 1 ml of the cell suspension into a sterile tube and proceed with DNA extraction (for example, following the protocol in Example 4). Protocol C (Regulatoy Limit >10 cfu/g): 1) Place 10 g or 10 ml of the sample in a stomacher filter bag with 90 ml of 20 Peptone Water 0.1%. 2) Homogenize the contents of the bag for 10 sec using a Stomacher instrument (BagMixer). 3) Transfer the required inoculation volume of the sample fr-om the Stomacher bag into a Tryptic Soy Agar tube. Use two tubes per sample to be tested. The - 92 - WO 2005/108578 PCT/CA2005/000694 required inoculation volume can be determined using the guidelines provided in Table 24 (based on the regulatory guidelines for food in Canada). 4) Spread the liquid over the surface of the agar by gently rotating the tube. 5) Incubate at 35 0 C for 18 hours in a slanted position while keeping the agar 5 surface facing upward. 6) After incubation, add 2 ml of sterile Peptone Water 0.1% to each tube. 7) Vortex to resuspend cells. 8) Transfer 1 ml of the cell suspension into a sterile tube and proceed with DNA extraction (for example, following the protocol in Example 4). 10 Table 24. Regulatory Limits for Food (Canada) Regulatory limit Primary dilution Secondary Volume to be for food in of food sample dilution of food inoculated (pL) Canada (cfu/g) sample 50 1:10 N/A 350 100 1:10 N/A 350 250 1:10 N/A 150 500 1:10 N/A 75 1000 1:10 1:10 350 The disclosure of all patents, publications, including published patent applications, and database entries referenced in this specification are specifically incorporated by reference in their entirety to the same extent as if each such individual patent, publication, and database entry were specifically and individually indicated to be 15 incorporated by reference. Although the invention has been described with reference to certain specific embodiments, various modifications thereof will be apparent to those skilled in the art - 93 - WO 2005/108578 PCT/CA2005/000694 without departing from the spirit and scope of the invention as outlined in the claims appended hereto. - 94 -

Claims (23)

1. A combination of polynucleotides for amplification and detection of E. coli nucleic acid sequences, said combination selected from the group of: (a) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-11; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-11 and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:12, or the complement thereof; (b) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35 and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof, and (c) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-11; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-11, a third polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35; a fourth polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35, a first polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof, and a second polynucleotide probe comprising at - 95 - WO 2005/108578 PCT/CA2005/000694 least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof.

2. The combination of polynucleotides according to claim 1(a) or 1(c), wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 1 and said second polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO: 1.

3. The combination of polynucleotides according to claim 1(a), 1(c) or 2, wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:14 or 20; said second polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:15 and said polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:17, 19, 22 or24.

4. The combination ofpolynucleotides according to claim 1(b), wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:38; said second polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:39, and said polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63.

5. The combination ofpolynucleotides according to claim 1(c), wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:14 or 20; said second polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:15; said first polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:17, 19, 22 or 24; said third polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:38; said fourth polynucleotide primer comprises at least 7 consecutive nucleotides of - 96 - WO 2005/108578 PCT/CA2005/000694 the sequence as set forth in SEQ ID NO:39, and said second polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63.

6. A method of detecting E. coli in a sample, said method comprising the steps of: (i) contacting a sample suspected of containing, or known to contain, E.coli with a first pair of polynucleotide primers capable of amplifying a first E. coli target sequence within the prpR gene, or a second pair of polynucleotide primers capable of amplifying a second E. coli target sequence within the ykgM gene, or both said first and second pair of polynucleotide primers, under conditions that permit amplification of said target nucleotide sequence(s), and (ii) detecting any amplified target sequence(s), wherein detection of an amplified target sequence indicates the presence of E. coli in the sample.

7. The method according to claim 6, wherein said first pair ofpolynucleotide primers comprises a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-11 and a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-11 and said first E. coli target sequence comprises at least 65 consecutive nucleotides of the sequence set forth in SED ID NO:12, and said second pair ofpolynucleotide primers comprises a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35 and a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35 and said second E. coli target sequence - 97 - WO 2005/108578 PCT/CA2005/000694 comprises at least 65 consecutive nucleotides of the sequence set forth in SED ID NO:36.

8. The method according to claim 6 or 7, wherein step (ii) comprises detecting any amplified target sequence(s) by contacting said amplified target sequences with one or more polynucleotide probes selected from the group of: (a) a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:12, or the complement thereof, and (b) a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof.

9. The method according to any one of claims 6, 7 or 8 wherein steps (i) and (ii) are conducted simultaneously.

10. The method according to any one of claims 6, 7, 8 or 9 further comprising a step to enrich the microbial content of the sample prior to step (i).

11. A method of detecting E. coli in a sample, said method comprising the steps of: (i) contacting a sample suspected of containing, or known to contain, one or more E. coli target nucleotide sequences with the combination of polynucleotides according to any one of claims 1 to 5 under conditions that permit amplification of said target sequence(s), and (ii) detecting any amplified target sequence(s), wherein detection of an amplified target sequence indicates the presence of E. coli in the sample.

12. A kit for the detection of E. coil, said kit comprising a combination of polynucleotides selected from the group of: (a) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ -98- WO 2005/108578 PCT/CA2005/000694 ID NOs:2-11; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-11 and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:12, or the complement thereof; (b) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35 and a polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof, and (c) a combination comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-11; a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-11, a third polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35; a fourth polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26-35, a first polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof, and a second polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof.

13. The kit according to claim 12(a) or 12(c), wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 1 and said second polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to the sequence as set forth in SEQ ID NO: 1. - 99 - WO 2005/108578 PCT/CA2005/000694

14. The kit according to claim 12(a), 12(c) or 13, wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:14 or 20; said second polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:15 and said polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:17, 19, 22 or 24.

15. The kit according to claim 12(b), wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:38; said second polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:39, and said polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63.

16. The kit according to claim 12(c), wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:14 or 20; said second polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 15; said first polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:17, 19, 22 or 24; said third polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:38; said fourth polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:39, and said second polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63.

17. The kit according to any one of claims 12, 13, 14, 15 or 16, further comprising one or more amplification reagents selected from the group of: buffers, salts, enzymes, enzyme co-factors, and nucleotides.

18. A pair of polynucleotide primers for amplification of a portion of an E. coli prpR gene, said pair of polynucleotide primers comprising: - 100 - WO 2005/108578 PCT/CA2005/000694 (a) a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-11; and (b) a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-11.

19. The pair of polynucleotide primers according to claim 18, wherein said portion of the E. coli prpR gene is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of the sequence set forth in SED ID NO:12.

20. The pair of polynucleotide primers according to claim 18 or 19, wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 1 and said second polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:1.

21. The pair of polynucleotide primers according to any one of claims 18, 19 or 20, wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:14 or 20 and said second polynuicleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:15.

22. A pair of polynucleotide primers for amplification of a portion of an E. coli genome comprising the 3' region of the ykgM gene, said pair of polynucleotide primers comprising: (a) a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:26-35; and (b) a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:26

35. 23. The pair of polynucleotide primers according to claim 22, wherein said portion of the E. coli genome comprising the 3' region of the ykgM gene is less than - 101 - WO 2005/108578 PCT/CA2005/000694 about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of the sequence set forth in SED ID NO:36. 24. The pair of polynucleotide primers according to claim 22 or 23, wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:38 and said second polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:39. 25. An isolated E. coli specific polynucleotide consisting essentially of: (a) the sequence as set forth in SEQ ID NO:12 or SEQ ID NO:36, or a fragment of said sequence, or (b) a sequence that is the complement of (a). 26. A polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of an E. coli prpR gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof. 27. The polynucleotide primer according to claim 26, wherein said polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of: SEQ ID NOs:14, 15, 17, 19, 20, 22 or 24. 28. A polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of an E. coli genome comprising the 3' region of the ykgM gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:36, or the complement thereof. 29. The polynucleotide primer according to claim 28, wherein said polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of: SEQ ID NOs:38, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63. -102- WO 2005/108578 PCT/CA2005/000694 30. A polynucleotide probe of between 7 and 100 nucleotides in length for detection of E. coli, said polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12 or 36, or the complement thereof. 31. The polynucleotide probe according to claim 30, wherein said polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of: SEQ ID NOs:14, 15, 17, 19, 20, 22, 24, 38, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61 or 63. 32. The polynucleotide probe according to claim 30 or 31, wherein said polynucleotide probe further comprises a fluorophore, a quencher, or a combination thereof. - 103 -