WO2006029522A1 - Polynucleotides for the detection of campylobacter species - Google Patents

Polynucleotides for the detection of campylobacter species Download PDF

Info

Publication number
WO2006029522A1
WO2006029522A1 PCT/CA2005/001403 CA2005001403W WO2006029522A1 WO 2006029522 A1 WO2006029522 A1 WO 2006029522A1 CA 2005001403 W CA2005001403 W CA 2005001403W WO 2006029522 A1 WO2006029522 A1 WO 2006029522A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
seq
consecutive nucleotides
set forth
polynucleotide
Prior art date
Application number
PCT/CA2005/001403
Other languages
French (fr)
Inventor
Nancy Bourassa
Eliane Ubalijoro
Géraldine ASSELIN
Original Assignee
Warnex Research Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Warnex Research Inc. filed Critical Warnex Research Inc.
Publication of WO2006029522A1 publication Critical patent/WO2006029522A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/205—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Campylobacter (G)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention pertains to the field of detection of microbial contaminants and, in particular, the invention relates to the detection of Campylobacter.
  • Campylobacter species such as Campylobacter jejuni, Campylobacter coli and Campylobacter lari are carried in the intestinal tract of warm-blooded animals and, therefore, contaminate foods of animal origin. These bacterial species are commonly associated with contamination of raw poultry products and dairy products. A recent outbreak of gastroenteritis in Canada was also linked to contamination of the water supply with Campylobacter (Can J Public Health 82(1):27-31).
  • C. jejuni is recognized as a leading cause of acute bacterial gastroenteritis and C. jejuni infections can lead to serious pathological sequelae.
  • C. coli and C. lari are also recognized causes of gastroenteritis, although infections with these bacteria occur less frequently than those with C. jejuni.
  • Campylobacter is the most common bacterial cause of gastroenteritis in the U.S with approximately 2.5 million cases of campylobacteriosis occurring annually. Within 2-5 days after exposure, individuals infected with the pathogen may develop diarrhea, abdominal pain, malaise, fever, nausea and vomiting. In rare cases febrile convulsions, Guillain-Barre syndrome and meningitis may result [Stern N., Line E., Chen HC, Chapter 31 in Compendium of Methods for the Microbiological Examination of Foods (2001) Fourth Edition by American Press Association, Washington DC].
  • a variety of methods are described in the art for the detection of bacterial contaminants.
  • One of these methods is the amplification of specific nucleotide sequences using specific primers in a PCR assay.
  • the presence of an amplicon is detected using agarose gel electrophoresis.
  • This method of detection while being more rapid than traditional methods requiring culturing bacterial samples, is still relatively time consuming and subject to post-PCR contamination during the running of the agarose gel.
  • nucleic acid hybridization An additional technology utilized for detection of bacterial contamination, is nucleic acid hybridization.
  • the target sequence of interest is typically amplified and then hybridized to an oligonucleotide probe which possesses a complementary nucleic acid sequence to that of the target molecule.
  • the probe can be modified so that detection of the hybridization product may occur, for example, the probe can be labelled with a radioisotope or fluorescent moiety.
  • Campylobacter nucleic acid sequences for detection of this bacterium has been described.
  • International Patent Application WO 03/014704 describes a method to detect, identify, and differentiate C. jejuni and C. coli based on the amplification of, or hybridization to, a part of the cadF gene of the bacteria.
  • Al Rashid et al. J. Clinical Microbiol. 38(4): 1488-1494; 2000 describe the use of degenerate primers to amplify fragments of the Campylobacter glyA gene and a PCR- Southern hybridization detection method using probes specific for C. jejuni, C. coli, C. lari, C. upsaliensis, Arcobacter butsleri and A.
  • This PCR-Southern hybridization detection method involved a PCR amplification step, followed by agarose gel electrophoresis and then Southern blotting. Four different hybridisation and washing conditions had to be developed in order to maximise the specificity of the probes. The sensitivity of the detection method with respect to the amount of genomic DNA required to yield sufficient PCR product to be detected by the probes was also investigated. The lowest amount of genomic DNA required was determined as being between 200 and 230,000 template copies.
  • a particularly useful modification of hybridization and amplification technology provides for the concurrent amplification and detection of a target sequence ⁇ i.e. in "real time") through the use of specially adapted oligonucleotide probes.
  • probes include molecular beacon probes (Tyagi et al., (1996) Nature Biotechnol. 14:303-308), TaqMan ® probes (U.S. Patent Nos. 5,691,146 and 5,876,930) and Scorpion probes (Whitcombe et al., (1999) Nature Biotechnol. 17:804-807).
  • Molecular beacons represent a powerful tool for the rapid detection of specific nucleotide sequences and are capable of detecting the presence of a complementary nucleotide sequence even in homogenous solutions.
  • Molecular beacons can be described as hairpin stem-and-loop oligonucleotide sequences, in which the loop portion of the molecule represents a probe sequence, which is complementary to a predetermined sequence in a target polynucleotide.
  • One arm of the beacon sequence is attached to a fluorescent moiety, while the other arm of the beacon is attached to a non- fluorescent quencher.
  • the stem portion of the stem-and-loop sequence holds the two arms of the beacon in close proximity. Under these circumstances, the fluorescent moiety is quenched.
  • the probe When the beacon encounters a nucleic acid sequence complementary to its probe sequence, the probe hybridizes to the nucleic acid sequence, forming a stable complex and, as a result, the arms of the probe are separated and the fluorophore emits light. Thus, the emission of light is indicative of the presence of the specific nucleic acid sequence.
  • Individual molecular beacons are highly specific for the DNA sequences they are complementary to.
  • the atpA gene which encodes one of the subunits of the ATP synthase complex.
  • the atpA gene is often referred to as a housekeeping gene and is not believed to be associated with virulence genes.
  • the yphC gene in Camplylobacter is believed to code for a guanine triphosphate binding protein of unknown function. To date, this gene has been identified only in C. jejuni (Suerbaum, S et al. (2001) Journal of Bacteriology 183:2553-2559).
  • the glyA gene which encodes serine hydroxymethyl transferase [Al Rashid, S. T. et al. (2000) Journal of Clinical Microbiology (38:1488-1494)], is also a highly conserved gene.
  • Serine hydroxymethyl transferase (SHMT), L-serine:tetrahydro folate 5,10- hydroxymethyltransferase is a pyridoxyl 5 '-phosphate (PLP)-dependent enzyme which catalyses the reversible interconversion of serine and glycine. This reaction is the major source of one-carbon groups in the cell. This carbon source is necessary for thymidate, purine, and methionine biosynthesis.
  • An object of the present invention is to provide polynucleotides for the detection of Campylobacter species.
  • a Campylobacter detection system comprising a combination of polynucleotides selected from the group of:
  • a) a combination of polynucleotides for detection of Campylobacter jejuni comprising a first C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:1; a second C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ED NO:1 and a C. jejuni polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO: 12, or the complement thereof;
  • a combination of polynucleotides for detection of Campylobacter coli comprising a first C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ED NOs:21, 22, 23, 24, 25, 26, 27, 28, 29 and 30; a second C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ED NOs:
  • C. coli polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:31, or the complement thereof;
  • a combination of polynucleotides for detection of Campylobacter lari comprising a first C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:39; a second C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ED NO:39, and a C. lari polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ED NOs: 50, 73 and 91 , or the complement thereof;
  • a method of detecting one or more of Campylobacter jejuni, Campylobacter coli and Campylobacter lari in a sample comprising the steps of:
  • a combination of polynucleotides for detection of C. jejuni comprising a first C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 1 ; a second C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:1 and a C. jejuni polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof;
  • a combination of polynucleotides for detection of C. coli comprising a first C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:21, 22, 23, 24, 25, 26, 27, 28, 29 and 30; a second C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30, and a C. coli polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof;
  • Campylobacter detection kit comprising:
  • a combination of polynucleotides for detection of C. jejuni comprising a first C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:1; a second C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO: 1 and a C. jejuni polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof;
  • a second C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30, and a C. coli polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ E) NO:31 , or the complement thereof;
  • a pair of polynucleotide primers for amplification of a portion of a C. jejuni atpA gene comprising a first polynucleotide primer. comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12 and a second polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO: 12.
  • a pair of polynucleotide primers for amplification of a portion of a C. coliyphC gene comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:21, 22, 23, 24, 25, 26, 27, 28 , 29 and 30; and a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28 , 29 and 30.
  • a pair of polynucleotide primers for amplification of a portion of a C. lari glyA gene comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91; and a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ED NOs:50, 73 and 91.
  • an isolated C. jejuni specific polynucleotide having the sequence as set forth in SEQ ID NO : 12, or the complement thereof.
  • an isolated C. coli specific polynucleotide having the sequence as set forth in SEQ ID NO:31, or the complement thereof.
  • an isolated C. lari specific polynucleotide having the sequence as set forth in SEQ ID NO:50, 73, or 91, or the complement thereof.
  • a polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of a C. jejuni atpA gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 13, 14 or 15, or the complement thereof.
  • a polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of a C. coliyphC gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof.
  • a polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of a C. lari glyA gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ED NOs:51, 52, 53, 74, 75, 76, 92, 93, 94, and 99, or the complement thereof.
  • a polynucleotide probe of between 7 and 100 nucleotides in length for detection of C. jejuni, said polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO: 12, or the complement thereof.
  • a polynucleotide probe of between 7 and 100 nucleotides in length for detection of C. coli, said polynucleotide comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:31, or the complement thereof.
  • a polynucleotide probe of between 7 and 100 nucleotides in length for detection of C. lari, said polynucleotide comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91 or the complement thereof.
  • Figure 1 presents a multiple sequence alignment showing conserved regions of a portion of the coding strand of atpA gene from various C. jejuni strains [SEQ ID NOs:2-l I]. Shaded blocks highlight the following regions: bases 65 to 90: forward primer #1 [SEQ ID NO:14]; bases 110 to 134: binding site for molecular beacon #1 [SEQ ID NO: 16]; bases 143 to 167: binding site for reverse primer #1 [SEQ ID NO:15];
  • Figure 2 presents the arrangement of PCR primers and a molecular beacon probe on the atpA gene sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs: 14 & 15;
  • Figure 3 presents the secondary structure of a molecular beacon probe [SEQ ID NO: 16] in accordance with one embodiment of the invention
  • Figure 4 presents a multiple sequence alignment of a portion of the coding strand of the yphC gene from several isolates of C. coli [SEQ ID NOs: 21-30]. Shaded blocks highlight the following regions: bases 70 to 91 : forward primer #2 [SEQ ID NO:33]; bases 101 to 123: binding site for molecular beacon #2 [SEQ ID NO:35]; bases 163 to 185: binding site for reverse primer #2 [SEQ ID NO:34];
  • Figure 5 presents the arrangement of PCR primers and a molecular beacon probe on the yphC consensus sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs:33 & 34; Figure 6 presents the secondary structure of a molecular beacon probe [SEQ ID NO:35] in accordance with one embodiment of the invention;
  • Figure 7 presents a multiple sequence alignment showing conserved regions of a portion of the non-coding strand of the glyA gene from various C. lari strains [SEQ ID NOs:40-49]. Shaded blocks highlight the following regions: bases 127 to 149: forward primer # 3 [SEQ ID NO:52]; bases 177 to 202: binding site for molecular beacon #3 [SEQ ID NO:54]; bases 219 to 243: binding site for reverse primer #3 [SEQ ID NO:53];
  • Figure 8 presents the arrangement of PCR primers and a molecular beacon probe on the glyA gene sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs: 52 & 53;
  • Figure 9 presents the secondary structure of a molecular beacon probe [SEQ ID NO:54] in accordance with one embodiment of the invention.
  • Figure 10 presents a multiple sequence alignment showing conserved regions of another portion of the non-coding strand of the glyA gene from various C. lari strains [SEQ ID NOs:63-72]. Shaded blocks highlight the following regions: bases 109 to 127: forward primer # 5 [SEQ ID NO:75]; bases 157 to 179: binding site for molecular beacon #5 [SEQ ID NO:77]; bases 214 to 233: binding site for reverse primer #4 [SEQ ID NO:76];
  • Figure 11 presents the arrangement of PCR primers and a molecular beacon probe on the glyA gene sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs:75 and 76;
  • Figure 12 presents the secondary structure of a molecular beacon probe [SEQ ID NO: 77] in accordance with one embodiment of the invention.
  • Figure 13 presents a multiple sequence alignment showing conserved regions of a further portion of the non-coding strand of the glyA gene from various C. lari strains [SEQ ED NOs:81-90]. Shaded blocks highlight the following regions: bases 84 to 103: forward primer #6 [SEQ ID NO:93]; bases 112 to 134: binding site for molecular beacon # 6 [SEQ ID NO:95]; bases 163 to 182: binding site for reverse primer #5 [SEQ ID NO:94];
  • Figure 14 presents the arrangement of PCR primers and a molecular beacon probe on the glyA gene sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs:93 and 94;
  • FIG. 15 presents the secondary structure of a molecular beacon probe [SEQ ID NO:95] in accordance with one embodiment of the invention.
  • Figure 16 presents (A) the sequence of a portion of a C. jejuni atpA gene [SEQ ID NO:1] comprising the atpA consensus sequence identified in one embodiment of the invention, (B) the sequence of the atpA conserved region (consensus sequence) [SEQ ID NO:12] and, (C) the sequence of a highly conserved region [SEQ ID NO:13] identified within the consensus sequence, R represents A or G;
  • Figure 17 presents (A) the sequence of the C. coliyphC consensus sequence [SEQ ID NO:31] identified in one embodiment of the invention and (B) the sequence of a highly conserved region [SEQ ID NO:32] identified within the consensus sequence; and
  • Figure 18 presents (A) the coding sequence of a C. lari glyA gene [SEQ ID NO:39] comprising the glyA consensus sequences identified in accordance with the invention, (B) the sequence of a C. lari glyA consensus sequence [SEQ ID NO:50], (C) the sequence of a highly conserved region [SEQ ID NO:51] identified within SEQ ID NO: 50 (D) the sequence of a second C. lari glyA consensus sequence [SEQ ID NO:73], (E) the sequence of a highly conserved region [SEQ ID NO:74] identified within SEQ DD NO:73; (F) the sequence of a third C.
  • the present invention provides for a Campylobacter detection system that is capable of simultaneously detecting multiple Campylobacter species in a test sample.
  • the three most clinically relevant Campylobacter species are Campylobacter jejuni, Campylobacter coli and Campylobacter lari. Detection of some or all of these three species, therefore, is important in various situations including, but not limited to, the food manufacturing and processing industries, during monitoring of water purity and in clinical settings.
  • the Campylobacter detection system is capable of detecting the presence of Campylobacter jejuni, Campylobacter coli and Campylobacter lari in a test sample.
  • the system provided by the present invention is capable of detecting all three of the above-listed Campylobacter species, it can also be employed, if desired, to detect just one or two of these Campylobacter species.
  • the system of the present invention provides for the detection of one or more of C. jejuni, C. coli and C. lari in a test sample.
  • the detection system provides for the detection of two or more of C. jejuni, C. coli and C. lari.
  • the detection system provides for the detection of all three of C. jejuni, C. coli and C. lari.
  • the Campylobacter detection system is useful in detecting the presence of one or more Campylobacter species in a variety of samples, such as clinical samples, microbiological pure cultures, or samples related to food, environmental or pharmaceutical quality control processes.
  • the Campylobacter detection system of the present invention comprises polynucleotides designed to amplify and/or detect one or more Campylobacter target nucleotide sequences.
  • a target nucleotide sequence is a nucleotide sequence that comprises one or more highly conserved regions (consensus sequences), or a portion of said one or more highly conserved regions, that are common to various strains within a Campylobacter species.
  • Polynucleotide primers and probes can be designed against the selected target sequence(s) to allow for the specific detection of the Campylobacter species in a test sample.
  • the target nucleotide sequence can be common to Campylobacter strains from one Campylobacter species or from more than one Campylobacter species. Accordingly, the Campylobacter detection system can comprise polynucleotides designed to amplify and/or detect one target nucleotide sequence or more than one target nucleotide sequence.
  • the target nucleotide sequences can be from the same target gene, or from different target genes.
  • the Campylobacter detection system comprises polynucleotides designed to amplify and/or detect more than one target nucleotide sequence.
  • the different target nucleotide sequences are found in different target genes.
  • at least one of the target nucleotide sequences is from the C. coliyphC gene.
  • the target nucleotide sequences are from the C. jejuni atpA gene, C. coli yphC gene and the C. lari glyA gene.
  • the present invention also provides for primer and probe polynucleotides that are capable of amplifying and/or detecting Campylobacter target nucleotide sequences and which are suitable for inclusion in the Campylobacter detection system.
  • the Campylobacter detection system can comprise primer and/or probe polynucleotides for detection of a single target nucleotide sequence or primer and/or probe polynucleotides for detection of a plurality of target nucleotide sequences.
  • the system can be designed to amplify and/or detect a single target nucleotide sequence and thereby detect various strains from a single species of Campylobacter, or to amplify and/or detect more than one target nucleotide sequence and thereby detect more than one species of Campylobacter. If desired, the system can be designed to distinguish one species of Campylobacter from another species by specifically amplifying and/or detecting sequences from the selected Campylobacter species.
  • primers and probes specific for a target nucleotide sequence from a single Campylobacter species can be combined with other primers and probes specific for target nucleotide sequences from one or more other species of Campylobacter to provide a system for detecting a plurality of Campylobacter species in a single test sample.
  • the target nucleotide sequences can be the same or different.
  • a system of the invention which amplifies and detects target nucleotide sequences from multiple species of Campylobacter allows for the detection of multiple species of Campylobacter in a single assay.
  • the present invention provides for a system that allows for simultaneous detection of multiple species of Campylobacter in a single diagnostic assay. Simultaneous detection of multiple species of Campylobacter in a single assay can be more efficient and/or more economical than performing multiple standard assays, each of which detects only a single Campylobacter species.
  • one embodiment of the present invention provides for a system comprising primer and probe polynucleotides that amplify and/or detect one or more target nucleotide sequences from one species of Campylobacter.
  • Another embodiment of the present invention provides for a system comprising a combination of primer and probe polynucleotides that amplify and/or detect the same or different target nucleotide sequences from at least two different Campylobacter species.
  • Another embodiment provides for a system comprising a combination of primer and probe polynucleotides that amplify and/or detect the same or different target nucleotide sequences from at least three different Campylobacter species.
  • the primers and probes of the invention demonstrate a specificity of at least 95%, as defined herein, for their selected target nucleotide sequence. In one embodiment, the primers and probes of the invention demonstrate a specificity for their selected target nucleotide sequence of at least 97%. In another embodiment, the primers and probes of the invention demonstrate a specificity for their selected target nucleotide sequence of at least 98%. hi further embodiments, the primers and probes of the invention demonstrate a specificity for their selected target sequence of at least 99%, and at least 99.5%.
  • the primer and probe polynucleotides are capable of specifically amplifying and/or detecting a target nucleotide sequence from a single Campylobacter species, i.e. are species-specific. Combinations of such species-specific primers and probes can be employed in the system of the present invention to detect a plurality of Campylobacter species in a test sample.
  • the species-specific primers and probes of the present invention are capable of detecting a wide variety of strains of the selected Camplyobacter species.
  • the species-specific primers and probes demonstrate a sensitivity in detecting strains of the selected Campylobacter species of at least 90%.
  • the species-specific primers and probes demonstrate a sensitivity of at least 91%. In further embodiments, the species-specific primers and probes demonstrate a sensitivity of at least 92%, of at least 93%, of at least 94%, of at least 95%, of at least 96%, of at least 97%, of at least 98% and of at least 99%.
  • the present invention provides for diagnostic assays that can be carried out in real-time and addresses the need for rapid detection of Campylobacter in a variety of biological samples.
  • a further embodiment of the present invention provides for a Campylobacter detection system that can detect fewer than 200 template copies of genomic DNA.
  • the Campylobacter detection system can detect fewer than 100 template copies of genomic DNA.
  • oligonucleotide and “polynucleotide” as used interchangeably in the present application refer to a polymer of greater than one nucleotide in length of ribonucleic acid (RNA), deoxyribonucleic acid (DNA), hybrid RNA/DNA, modified RNA or DNA, or RNA or DNA mimetics.
  • the polynucleotides may be single- or double-stranded.
  • the terms include polynucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as polynucleotides having non-naturally-occurring portions which function similarly.
  • backbone backbone linkages
  • Such modified or substituted polynucleotides are well-known in the art and for the purposes of the present invention, are referred to as "analogues.”
  • primer and “polynucleotide primer,” as used herein, refer to a short, single-stranded polynucleotide capable of hybridizing to a complementary sequence in a nucleic acid sample.
  • a primer serves as an initiation point for template- dependent nucleic acid synthesis. Nucleotides are added to a primer by a nucleic acid polymerase in accordance with the sequence of the template nucleic acid strand.
  • a “primer pair” or “primer set” refers to a set of primers including a 5' upstream primer that hybridizes with the 5 ' end of the sequence to be amplified and a 3 ' downstream primer that hybridizes with the complementary 3 ' end of the sequence to be amplified.
  • forward primer refers to a primer which anneals to the 5 ' end of the sequence to be amplified.
  • reverse primer refers to a primer which anneals to the complementary 3' end of the sequence to be amplified.
  • probe and “polynucleotide probe,” as used herein, refer to a polynucleotide used for detecting the presence of a specific nucleotide sequence in a sample. Probes specifically hybridize to a target nucleotide sequence, or the complementary sequence thereof, and can be single- or double-stranded.
  • hybridize refers to the ability of a polynucleotide to bind detectably and specifically to a target nucleotide sequence.
  • Polynucleotides specifically hybridize to target nucleotide sequences under hybridization and wash conditions that minimize appreciable amounts of detectable binding to non-specific nucleic acids.
  • High stringency conditions can be used to achieve specific hybridization conditions as is known in the art.
  • hybridization and washing are performed at high stringency according to conventional hybridization procedures and employing one or more washing step in a solution comprising 1-3 x SSC, 0.1-1% SDS at 50-70 0 C for 5-30 minutes.
  • sequences refers to the ability of a primer or primer pair to amplify, or a probe to detect, nucleic acid sequences from selected species of
  • the selected species can be a single Campylobacter species or a group of Campylobacter species.
  • "% specificity" is defined by a negative validation test wherein the primers and/or probe are tested against a panel of at least 100 bacterial species other than the selected Campylobacter species.
  • a pair of primers that does not amplify any nucleic acid sequences from the panel of bacterial species would be defined as demonstrating 100% specificity
  • a pair of primers that amplified a nucleic acid sequence from one bacterial species in a panel of 100 species would be defined as demonstrating 99% specificity.
  • kits-specific means that the primer specifically amplifies and the probe specifically detects a target sequence from a single species of Campylobacter.
  • % specificity when used in reference to a species-specific primer or probe therefore, defines the ability of the primer or probe to amplify or detect a target sequence from one selected species of Campylobacter when evaluated against a panel comprising other Campylobacter species in addition to unrelated bacterial species.
  • sensitivity refers to the ability of a species-specific primer or primer pair to amplify, or a species-specific probe to detect, nucleic acid sequences from a range of strains from Campylobacter species against which the primer/probe is targeted. "% sensitivity” is defined by a positive validation test wherein the primers and/or probe are tested against a panel of at least 10 strains from the selected Campylobacter species.
  • a pair of primers that amplifies nucleic acid sequences from all strains of the selected Campylobacter species in a panel of 10 strains would be defined as demonstrating 100% sensitivity and a pair of primers that amplified nucleic acid sequences from nine strains in a panel of 10 strains of a selected Campylobacter species would be defined as demonstrating 90% sensitivity.
  • strain refers to a subset of a bacterial species that shares at least one common identifiable characteristic that distinguishes members of the subset from other bacteria of the same species.
  • the characteristic(s) can be serological, genetic, immunologic, morphological, phenotypic, biochemical or a combination thereof.
  • corresponding to refers to a polynucleotide sequence that is identical to all or a portion of a reference polynucleotide sequence.
  • complementary to is used herein to indicate that the polynucleotide sequence is identical to all or a portion of the complementary strand of a reference polynucleotide sequence.
  • the nucleotide sequence "TATAC” corresponds to a reference sequence “TATAC” and is complementary to a reference sequence "GTATA.”
  • hairpin or “hairpin loop” refer to a single strand of DNA or RNA, the ends of which comprise complementary sequences, whereby the ends anneal together to form a "stem” and the region between the ends is not annealed and forms a "loop.”
  • Some probes, such as molecular beacons have such "hairpin” structure when not hybridized to a target sequence.
  • the loop is a single-stranded structure containing sequences complementary to the target sequence, whereas the stem self-hybridises to form a double-stranded region and is typically unrelated to the target sequence, however, nucleotides that are both complementary to the target sequence and that can self-hybridise can also be included in the stem region.
  • target gene refers to the gene within which a target nucleotide sequence is located.
  • target sequence or “target nucleotide sequence,” as used herein, refer to a particular nucleic acid sequence in a test sample to which a primer and/or probe is intended to specifically hybridize.
  • a “target sequence” is typically longer than the primer or probe sequence and thus can contain multiple “primer target sequences” and “probe target sequences.”
  • a target sequence may be single- or double-stranded.
  • primer target sequence refers to a nucleic acid sequence in a test sample to which a primer is intended to specifically hybridize.
  • probe target sequence refers to a nucleic acid sequence in a test sample to which a probe is intended to specifically hybridize.
  • the term "about” refers to a +/-10% variation from the nominal value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to.
  • the Campylobacter detection system of the present invention comprises polynucleotides designed to amplify and/or detect one or more Campylobacter target nucleotide sequences.
  • suitable Campylobacter target nucleotide sequences are first selected and then polynucleotide primers and/or probes are designed that are capable of amplifying and/or detecting the selected target nucleotide sequence(s).
  • a target gene is first selected.
  • the target gene is selected from the group of: the atpA gene, the yphC gene and the glyA gene.
  • a multiple sequence alignment of target gene sequences from strains of one or more Campylobacter species is then performed using one of a number of standard techniques known in the art in order to identify a region or regions of the target gene sequence that are highly conserved across all strains.
  • the target genes are selected from the atpA gene from Campylobacter jejuni, the yphC gene from Campylobacter coli and the glyA gene from Campylobacter lari. Representative multiple sequence, alignments of portions of these genes are shown in Figures 1, 4, 7, 10 and 13.
  • the coding strand of the C. jejuni atpA gene has a general sequence corresponding to SEQ ID NO:1 ( Figure 16A). From multiple sequence alignment analysis of portions of the coding strand of the atpA gene from various C. jejuni strains, an 103 nucleotide region of the atpA gene sequence, having a sequence corresponding to SEQ ID NO: 12 (shown in Figure 16B), was identified as being generally conserved in C jejuni isolates. This sequence is referred to herein as the atpA consensus sequence and can serve as a target nucleotide sequence for C. jejuni-specific primers and probes.
  • alignments similar to that depicted in Figure 1 can be conducted using longer sequences such as the region shown in Figure 16A and SEQ ID NO:1 and/or the non-coding strand of the atpA gene.
  • the present invention provides isolated species- specific polynucleotides that can be used as target sequences for the design of species- specific primers and/or probes for the specific detection of a selected Campylobacter species.
  • isolated C.y ' e/wm-specific polynucleotide consisting of the consensus sequence as set forth in SEQ ID NO: 12 (shown in Figure 16B), or the complement of this sequence
  • isolated C. co/7-specif ⁇ c polynucleotide consisting of the consensus sequence as set forth in SEQ ID NO:31 (shown in Figure 17A) or the complement of this sequence
  • an isolated C is provided an isolated C.
  • / ⁇ -specific polynucleotide consisting of the consensus sequence as set forth in any one of SEQ ID NO: 50, SEQ ID NO:73 and SEQ ID NO:91 (as shown in Figures 18B, D and F, respectively), or the complement of these sequences.
  • the target sequences may include additional nucleotide sequences that are found upstream and/or downstream of the respective consensus sequence in the genome.
  • the assays provided by the present invention typically include an amplification step, it may be desirable to select an overall length for the target sequence such that the assay can be conducted fairly rapidly.
  • the target nucleotide sequence typically has an overall length of less than about 500 nucleotides. In one embodiment, the target nucleotide sequence has an overall length of less than about 450 nucleotides. In another embodiment, the target sequence has an overall length of less than about 400 nucleotides. In another embodiment, the target sequence has an overall length of less than about 350 nucleotides. In other embodiments, the target sequence has an overall length of less than or equal to about 300, about 250, about 200, and about 150 nucleotides.
  • nucleic acid sequence comprising all, or a portion, of one of the consensus sequences set forth in any one of SEQ ED NO: 12, SEQ ID NO:31 or SEQ ID NOs: 50, 73 and 91 can be used as a target sequence for the specific detection of C. jejuni, C. coli or C. lari, respectively.
  • a species-specific target sequence that comprises at least 60% of the respective consensus sequence, or the complement thereof.
  • the species-specific target sequence comprises at least 75% of the respective consensus sequence, or the complement thereof.
  • the species-specific target sequence comprises at least 80% of the respective consensus sequence, or the complement thereof.
  • Species-specific target sequences comprising at least 85%, 90%, 95%, 98% and 99% of the respective consensus sequence, or the complement of the consensus sequence, are also contemplated. Accordingly, various embodiments of the present invention provide for C. ye/wm-specific target sequences comprising at least 60%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% and at least 99% of the sequence as set forth in SEQ ID NO: 12, or the complement thereof; C.
  • co/z-specific target sequences comprising at least 60%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% and at least 99% of the sequence as set forth in SEQ ID NO:31, or the complement thereof; and C. / ⁇ -specific target sequences comprising at least 60%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% and at least 99% of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof.
  • target sequences comprising portions of the consensus sequences that include at least 65, at least 70, at least 75, at least 80, at least 85, at least 90 and at least 95 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12, SEQ ID NO:31, SEQ ID NO:50, SEQ ID NO:73 or SEQ ID NO:91, or the complement thereof, are contemplated.
  • the target sequence may comprise any number of consecutive nucleotides between 65 and the full length of the consensus sequence (i.e. 103, 116, 117, 125 or 99 nucleotides, respectively), thus this range includes portions of the consensus sequence that comprise at least 66, at least 67, at least 68, at least 69, etc, consecutive nucleotides of the respective consensus sequence.
  • co/ ⁇ -specif ⁇ c target sequences that comprise all or a portion of a sequence corresponding to SEQ ID NO: 32, or the complement thereof.
  • a highly conserved region of 26 nucleotides in length was identified having a sequence corresponding to SEQ ID NO: 51 ( Figure 18C); within the C. lari glyA consensus sequence #2, the identified highly conserved region was 23 nucleotides in length and has a sequence corresponding to SEQ ID NO:74 ( Figure 18E); and within the C. lari glyA consensus sequence #3, the identified highly conserved region was 23 nucleotides in length and has a sequence corresponding to SEQ ID NO:92 ( Figure 18G). Accordingly, one embodiment of the present invention provides for C. / ⁇ -specific target sequences that comprise all or a portion of one or more of the sequences set forth in SEQ ED NOs: 51, 74 and 92, or the complement thereof.
  • the Campylobacter detection system of the present invention provides for the detection of one or more of C. jejuni, C. coli and C. lari using polynucleotide primers and/or probes that are based on the sequences of specific target nucleotide sequences, which are described above.
  • the detection system of the present invention comprises one or more polynucleotide probes capable of hybridising to a C. jejuni, C. coli or C. lari target nucleotide sequence.
  • the detection system comprises one or more probes selected from (i) a C.
  • jejuni-speci&c probe capable of hybridising to the consensus sequence as set forth in SEQ ID NO: 12; (ii) a C. co/z-specific probe capable of hybridising to the consensus sequence as set forth in SEQ ID NO:31, and (iii) a C. / ⁇ -specific probe capable of hybridising to one of the consensus sequences as set forth in SEQ ID NOs:50, 73 and 91.
  • Exemplary, non-limiting probe sequences are described below.
  • the detection system present invention comprises one or more polynucleotide primers capable of amplifying a C. jejuni, C. coli or C. lari target nucleotide sequence.
  • the detection system comprises one or more primers selected from (i) a C. ye/wm-specific primer capable of amplifying a C. jejuni target nucleotide sequence comprising all or a portion of the consensus sequence as set forth in SEQ ID NO: 12; (ii) a C. c ⁇ /z-specific primer capable of amplifying a C. coli target nucleotide sequence comprising all or a portion of the consensus sequence as set forth in SEQ ID NO:31, and (iii) a C.
  • / ⁇ -specific primer capable of amplifying a C. lari target nucleotide sequence comprising all or a portion of one or more of the consensus sequences as set forth in SEQ ID NOs:50, 73 and 91. Exemplary, non- limiting primer sequences are described below.
  • the detection system of the present invention comprises a combination of the polynucleotide primers and probes outlined above. Accordingly, the present invention provides for polynucleotides capable of amplifying and/or detecting a Campylobacter target nucleotide sequence in a sample that are suitable for inclusion in the above-described Campylobacter detection system.
  • the polynucleotides of the invention are capable of amplifying and/or detecting a species-specific target nucleotide sequence from one of C. jejuni, C. coli and C. lari.
  • the invention provides for polynucleotides that specifically amplify and/or detect a C.
  • jejuni-specific target nucleotide sequence polynucleotides that specifically amplify and/or detect a C. coli- specific target nucleotide sequence, and polynucleotides that specifically amplify and/or detect a C. / ⁇ -specific target nucleotide sequence.
  • Various combinations of these polynucleotides can be included in the detection system of the invention.
  • the polynucleotide primers and probes of the invention for amplification and/or detection of a C. ye/wm-specific target nucleotide sequence comprise a sequence that corresponds to or is complementary to a portion of the C. jejuni atpA gene shown in SEQ ID NO:1, are capable of specifically hybridizing to C. jejuni nucleic acids and are capable of amplifying and detecting a C.
  • the C. ye/wm-specific primers and probes comprise a sequence that corresponds to or is complementary to a portion of the C. jejuni gene shown in any one of SEQ ID Nos:2- 11.
  • the polynucleotide primers and probes of the invention for amplification and/or detection of a C. co/ ⁇ -specific target nucleotide sequence comprise a sequence that corresponds to or is complementary to a portion of the C. coliyphC gene as shown in any one of SEQ ID NOs:21-30, are capable of specifically hybridizing to C.
  • the polynucleotides and probes of the invention for the amplification and detection of a C. / ⁇ -specific target nucleotide sequence comprise a sequence that corresponds to or is complementary to a portion of the C. lari glyA gene as shown in SEQ ID NO:39, are capable of specifically hybridizing to C. lari nucleic acids and are capable of amplifying and detecting a C. / ⁇ -specific target nucleotide sequence comprising all or a portion of any one of SEQ ED NOs:50, 73 and 91.
  • the C. / ⁇ -specific primers and probes comprise a sequence that corresponds to or is complementary to a portion of the C. lari gene shown in any one of SEQ ID NOs:40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90.
  • the polynucleotides of the present invention are generally between about 7 and about 100 nucleotides in length.
  • primer, probe or combined primer/probe i.e. primer, probe or combined primer/probe
  • the optimal length for a selected polynucleotide will vary depending on its intended application (i.e. primer, probe or combined primer/probe) and on whether any additional features, such as tags, self-complementary "stems” and labels (as described below), are to be incorporated.
  • the polynucleotides are between about 10 and about 100 nucleotides in length.
  • the polynucleotides are between about 12 and about 100 nucleotides in length.
  • the polynucleotides are between about 12 and about 50 nucleotides and between 12 and 40 nucleotides in length.
  • the entire length of the polynucleotide primer or probe does not need to correspond to or be complementary to its target nucleotide sequence to specifically hybridize thereto.
  • the polynucleotide primers and probes may comprise nucleotides at the 5 ' and/or 3 ' termini that are not complementary to the target sequence.
  • Such non-complementary nucleotides may provide additional functionality to the primer/probe, for example, they may provide a restriction enzyme recognition sequence or a "tag" that facilitates detection, isolation or purification.
  • the additional nucleotides may provide a self- complementary sequence that allows the primer/probe to adopt a hairpin configuration. Such configurations are necessary for certain probes, for example, molecular beacon and Scorpion probes.
  • the present invention also contemplates that one or more positions within the polynucleotide can be degenerate, i.e. can be filled by one of two or more alternate nucleotides.
  • certain positions in a gene can vary in the nucleotide that is present at that position depending on the strain of bacteria that the gene originated from.
  • position 115 of the alignment shown in Figure 1 can contain a guanine ("G") or an adenine ("A”) nucleotide depending on the strain of C. jejuni the atpA gene originates from.
  • a "degenerate" primer or probe designed to correspond to this region of the gene can contain a "G" or an "A' at this position.
  • Such a degenerate primer or probe is typically prepared by synthesising a "pool" of polynucleotide primers or probes that contains approximately equal amounts of a polynucleotide containing a G at the degenerate position and a polynucleotide containing an A at the degenerate position.
  • the polynucleotide primers and probes of the invention comprise a sequence of at least 7 consecutive nucleotides that correspond to or are complementary to a portion of the target nucleotide sequence.
  • the optimal length of the sequence corresponding or complementary to the target nucleotide sequence will be dependent on the specific application for the polynucleotide, for example, whether it is to be used as a primer or a probe and, if the latter, the type of probe. Optimal lengths can be readily determined by the skilled artisan.
  • the polynucleotides comprise at least 10 consecutive nucleotides corresponding or complementary to a portion of the nucleotide sequence as shown in any one of SEQ ED NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90.
  • the polynucleotides comprise at least 12 consecutive nucleotides corresponding or complementary to a portion of the nucleotide sequence as shown in any one of SEQ ED NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90.
  • the polynucleotides comprise at least 14 consecutive nucleotides corresponding or complementary to a portion of the nucleotide sequence as shown in any one of SEQ ED NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90.
  • Polynucleotides comprising at least 16 and at least 18 consecutive nucleotides corresponding or complementary to a portion of the nucleotide sequence as shown in any one of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90 are also contemplated.
  • polynucleotides of the invention are set forth in Table 1. Further non-limiting examples for the polynucleotides of the invention include polynucleotides that comprise at least 7 consecutive nucleotides of any one of SEQ ID NOs: 14, 15, 17, 19, 33, 34, 36, 38, 52, 53, 55, 57, 58, 60, 62, 75, 76, 78, 80, 93, 94, 96, 98, 99, 101, 103, 104 and 105.
  • Primers contemplated by the present invention are capable of amplifying a Campylobacter target nucleotide sequence.
  • target nucleotide sequences contemplated by the present invention are those identified within the C. jejuni atpA gene, C. coliyphC gene and C. lariglyA gene.
  • the present invention provides for C. jejuni-specific primers that comprise a sequence that corresponds to or is complementary to a portion of the atpA gene sequence as shown in SEQ ID NO:1 and capable of amplifying a C. jejuni-specific target nucleotide sequence comprising all or a portion of the 103 nucleotide consensus sequence as shown in SEQ ID NO: 12.
  • the C. jejuni-specific primers that comprise a sequence that corresponds to or is complementary to a portion of the atpA gene sequence as shown in SEQ ID NO:1 and capable of amplifying a C. jejuni-specific target nucleotide sequence comprising all or a portion of the 103
  • jejuni-specific primers comprise a sequence that corresponds to or is complementary to a portion of the C. jejuni gene shown in any one of SEQ ID NOs:2-l 1.
  • the present invention provides for C. jejuni-specific primer pairs capable of amplifying a C. jejuni target nucleotide sequence, wherein the target sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of SEQ ID NO: 12, or the complement thereof.
  • pairs of C. ye/wm-specific primers can be selected to comprise a first primer corresponding to a portion of the C.
  • C. ye/wm-specif ⁇ c primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:1, or the complement thereof. In one embodiment, C.
  • ye/wm ' -specif ⁇ c primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-l 1, or the complement thereof
  • C.jejuni-specific primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof.
  • suitable C. jejuni-specific primer sequences include SEQ ID NOs: 14 and 15 shown in Table 1, as well as primers comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs:14, 15, 17, 19, 104 and 105.
  • the present invention further provides for C. co/z-specific primers that comprise a sequence that corresponds to or is complementary to a portion of the yphC gene as set forth in any one of SEQ ID NOs:21-30 and capable of amplifying a target nucleotide sequence comprising all or a portion of the 116 nucleotide consensus sequence as shown in SEQ ID NO:31.
  • the present invention provides for C. co/z ' -specific primer pairs capable of amplifying an C. coli target nucleotide sequence, wherein the target sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of SEQ ED NO:31, or the complement thereof.
  • pairs of C are possible to be amplifying an C. coli target nucleotide sequence, wherein the target sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of SEQ ED NO:31, or the complement thereof.
  • co/j-specific primers can therefore be selected to comprise a first primer corresponding to a portion of the C. coliyphC gene upstream of or within the region corresponding to SEQ ED NO:31 and a second primer that it is complementary to a portion of the C. coliyphC gene downstream of or within the region corresponding to SEQ ED NO:31.
  • C. co/z-specific primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ NOs:21-30, or the complement thereof.
  • C. co/ ⁇ -specific primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof.
  • Non-limiting examples of suitable C. co/z-specific primer sequences include SEQ ID NOs: 33 and 34 shown in Table 1 , as well as primers comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs: 33, 34, 36 and 38.
  • the present invention also provides for C. / ⁇ -specif ⁇ c primers that comprise a sequence that corresponds to or is complementary to a portion of the glyA gene sequence as shown in SEQ ED NO:39 and are capable of amplifying a target nucleotide sequence comprising all or a portion of one or more of the glyA consensus sequences as set forth in SEQ ED NOs: 50, 73 and 91.
  • the C. / ⁇ -specif ⁇ c primers are capable of amplifying a target nucleotide sequence comprising all or a portion of the sequence as shown in SEQ ED NO:50.
  • the C. / ⁇ -specif ⁇ c primers are capable of amplifying a target nucleotide sequence comprising all or a portion of the sequence as shown in SEQ ED NO:50.
  • / ⁇ -specif ⁇ c primers are capable of amplifying a target nucleotide sequence comprising all or a portion of the sequence as shown in SEQ ED NO: 73.
  • the C. / ⁇ -specif ⁇ c primers are capable of amplifying a target nucleotide sequence comprising all or a portion of the sequence as shown in SEQ ED NO:91.
  • the present invention provides for C. / ⁇ -specif ⁇ c primer pairs capable of amplifying a C. / ⁇ -specif ⁇ c target nucleotide sequence, wherein the target sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of any one of SEQ ED NOs:50, 73 or 91, or the complement thereof.
  • the present invention provides for C. / ⁇ -specif ⁇ c primer pairs capable of amplifying a C.
  • the present invention provides for C. / ⁇ -specif ⁇ c primer pairs capable of amplifying a C. / ⁇ -specif ⁇ c target nucleotide sequence, wherein the target sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of both SEQ ID NOs:50 and 91, or the complementary sequences thereof.
  • the present invention provides for C. / ⁇ -specific primer pairs capable of amplifying a C.
  • the present invention provides for C. /on-specific primer pairs capable of amplifying a C. / ⁇ -specific target nucleotide sequence, wherein the target sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of SEQ ID NOs:50, 73 and 91, or the complementary sequences thereof.
  • pairs of C. / ⁇ -specific primers can be selected that comprise a first primer corresponding to a portion of the C. lari glyA gene sequence upstream of or within the region of the gene corresponding to SEQ ID NO:50 and a second primer that it is complementary to a portion of the C. lari glyA gene sequence downstream of or within the region of the gene corresponding to SEQ ID NO:50.
  • pairs of C. / ⁇ -specific primers can be selected that comprise a first primer corresponding to a portion of the C. lari glyA gene upstream of or within the region corresponding to SEQ ID NO:91 and a second primer that it is complementary to a portion of the C.
  • Pairs of C. / ⁇ -specific primers can be selected that comprise a first primer corresponding to a portion of the C. lari glyA gene upstream of or within the region corresponding to SEQ ID NO: 73 and a second primer that it is complementary to a portion of the C. lari glyA gene downstream of or within the region corresponding to SEQ ID NO:73.
  • pairs of C. / ⁇ -specific primers can be selected that comprise a first primer corresponding to a portion of the C.
  • Non-limiting examples of suitable C. / ⁇ -specific primer sequences include SEQ ID NOs: 52, 53, 58, 75, 76, 93, 94 and 99 shown in Table 1, as well as primers comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs: 52, 53, 55, 57, 58, 60, 62, 75, 76, 78, 80, 93, 94, 96, 98, 99, 101 or 103.
  • primer pairs can be readily determined by a worker skilled in the art.
  • primers are selected that specifically hybridize to the appropriate target nucleotide sequence, as described above.
  • primers are selected that contain minimal sequence repeats and that demonstrate a low potential of forming dimers, cross dimers, or hairpin structures and of cross priming.
  • Such properties can be determined by methods known in the art, for example, using the computer modelling program OLIGO ® Primer Analysis Software (distributed by National Biosciences, Inc., Plymouth, MN).
  • target nucleotide sequences contemplated by the present invention include those identified within the C. jejuni atpA gene, C. coliyphC gene and C. lari glyA gene.
  • the probe polynucleotides of the present invention are designed to specifically hybridise to one of the consensus sequences set forth in SEQ ED NOs:12, 31, 50, 73 and 91.
  • the present invention provides for C. jejuni-specific probes that correspond to or are complementary to a portion of the consensus sequence as shown in SEQ ID NO: 12.
  • the C. ye/wm-specific probe polynucleotides comprise at least 7 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12, or the complement thereof. As indicated above, a highly conserved region was identified within the C. ye/wm-specific target sequence. In one embodiment, therefore, the present invention provides for C.
  • jejuni-specific probe polynucleotides comprising at least 7 consecutive nucleotides of the sequence set forth in SEQ E) NO: 13, or the complement thereof.
  • suitable C. jejuni-specific probe sequences include SEQ ID NOs: 17 and 19 shown in Table 1, as well as probes comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs:14, 15, 17, 19, 104 and 105.
  • the present invention also provides for C. co/z-specific probes that correspond to or are complementary to a portion of the consensus sequence as shown in SEQ ED NO:31.
  • the C. co/z-specif ⁇ c probe polynucleotides comprise at least 7 consecutive nucleotides of the sequence set forth in SEQ ID NO:31, or the complement thereof.
  • a highly conserved region was identified within the C. co/z-specific target sequence.
  • the present invention provides for C. co/z-specific probe polynucleotides comprising at least 7 consecutive nucleotides of the sequence set forth in SEQ ID NO:32, or the complement thereof.
  • suitable C. co/z-specific probe sequences include SEQ ID NOs: 36 and 38 shown in Table 1, as well as probes comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs: 33, 34, 36 and 38.
  • the present invention further provides for C. / ⁇ -specific probes that correspond to or are complementary to a portion of one of the consensus sequences as shown in SEQ ID NO:50, 73 and 91.
  • the C. / ⁇ ' -specific probe polynucleotides comprise at least 7 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof.
  • the C. / ⁇ -specific probe polynucleotides comprise at least 7 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof.
  • / ⁇ rz-specific probe polynucleotides comprise a sequence of at least 7 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof, wherein the sequence is other than: 5'- GGTTAGTAGCTCGGGTAAAATGTATGAAAGC-S'[SEQIDNO:107] and 5'-ATTCCCTTATGCTCATGTTGTAAGTTCTA-S' [SEQIDNO:108].
  • the present invention provides for C. / ⁇ -specific probe polynucleotides comprising at least 7 consecutive nucleotides of one of the sequences as set forth SEQ ID NO:51, 74 and 92, or the complement thereof.
  • Non-limiting examples of suitable C, / ⁇ -specific probe sequences include SEQ ID NOs:55, 57, 60, 62, 78, 80, 96, 98, 101 or 103 shown in Table 1 , as well as probes comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs:52, 53, 55, 57, 58, 60, 62, 75, 76, 78, 80, 93, 94, 96, 98, 99, 101 or 103.
  • the probe may be a hybridization probe, the binding of which to a target nucleotide sequence can be detected using a general DNA binding dye such as ethidium bromide, SYBR ® Green, SYBR ® Gold and the like.
  • the probe can incorporate one or more detectable labels. Detectable labels are molecules or moieties a property or characteristic of which can be detected directly or indirectly and are chosen such that the ability of the probe to hybridize with its target sequence is not affected. Methods of labelling nucleic acid sequences are well-known in the art (see, for example, Ausubel et ah, (1997 & updates) Current Protocols in Molecular Biology, Wiley & Sons, New York).
  • Labels suitable for use with the probes of the present invention include those that can be directly detected, such as radioisotopes, fluorophores, chemiluminophores, enzymes, colloidal particles, fluorescent microp articles, and the like.
  • directly detectable labels may require additional components, such as substrates, triggering reagents, light, and the like to enable detection of the label.
  • the present invention also contemplates the use of labels that are detected indirectly.
  • Indirectly detectable labels are typically specific binding members used in conjunction with a "conjugate" that is attached or coupled to a directly detectable label.
  • conjugates are well-known in the art and are designed such that the specific binding property of the specific binding member and the detectable property of the label remain intact.
  • “specific binding member” and “conjugate” refer to the two members of a binding pair, i.e. two different molecules, where the specific binding member binds specifically to the probe, and the “conjugate” specifically binds to the specific binding member. Binding between the two members of the pair is typically chemical or physical in nature.
  • binding pairs include, but are not limited to, antigens and antibodies; avidin/streptavidin and biotin; haptens and antibodies ' specific for haptens; complementary nucleotide sequences; enzyme cofactors / substrates and enzymes; and the like.
  • the probe is labelled with a fluorophore.
  • the probe may additionally incorporate a quencher for the fluorophore.
  • Fluorescently labelled probes can be particularly useful for the real-time detection of target nucleotide sequences in a test sample.
  • Examples of probes that are labelled with both a fluorophore and a quencher that are contemplated by the present invention include, but are not limited to, molecular beacon probes and TaqMan ® probes. Such probes are well known in the art (see for example, U.S. Patent Nos.
  • a molecular beacon probe is a hairpin shaped oligonucleotide sequence, which undergoes a conformational change when it hybridizes to a complementary target sequence.
  • the secondary structure of a typical molecular beacon probe includes a loop sequence, which is capable of hybridizing to a target sequence and a pair of arm (or "stem") sequences.
  • One arm is attached to a fluorophore, while the other arm is attached to a quencher.
  • the arm sequences are complementary to each other so as to enable the arms to hybridize together to form a molecular duplex and the beacon adopts a hairpin conformation in which the fluorophore and quencher are in close proximity and interact such that emission of fluorescence is prevented.
  • the sequence of molecular beacon probes is selected such that the stability of the probe-target helix is greater than the secondary structure of unbound probe. Hybridization between the loop sequence and the target sequence forces the molecular beacon probe to undergo a conformational change in which arm sequences are forced apart and the fluorophore is physically separated from the quencher. As a result, the fluorescence of the fluorophore is restored. The fluorescence generated can be monitored and related to the presence of the target nucleotide sequence. If no target sequence is present in the sample, no fluorescence will be observed. This methodology, as described further below, can also be used to quantify the amount of target nucleotide in a sample.
  • Figures 3 and 6 depict the secondary structure of exemplary hairpin loop molecular beacons having sequences corresponding to SEQ ID NO: 16 and 35, respectively.
  • the loop portion of the molecular beacon may itself contain complementary sequences capable of forming short double stranded regions (for example, see Figure 6).
  • Such small stems within the probe's loop portion that are 2- to 4-nucleotides long do not adversely affect the performance of molecular beacons as these secondary structures typically disappear at increased temperatures, for example at temperatures of about 55 0 C.
  • Wavelength-shifting molecular beacon probes which incorporate two fluorophores, a "harvester fluorophore and an “emitter” fluorophore (see, Kramer, et al, (2000) Nature Biotechnology, 18 : 1191 - 1196) are also contemplated.
  • a wavelength- shifting molecular beacon binds to its target sequence and the hairpin opens, the energy absorbed by the harvester fluorophore is transferred by fluorescence resonance energy transfer (FRET) to the emitter, which then fluoresces.
  • FRET fluorescence resonance energy transfer
  • TaqMan ® probes are dual-labelled fluorogenic nucleic acid probes that function on the same principles as molecular beacons.
  • TaqMan ® probes are composed of a polynucleotide that is complementary to a target sequence and is labelled at the 5' terminus with a fluorophore and at the 3' terminus with a quencher.
  • TaqMan ® probes like molecular beacons, are typically used as real-time probes in amplification reactions, hi the free probe, the close proximity of the fluorophore and the quencher ensures that the fluorophore is internally quenched.
  • the probe is cleaved by the 5' nuclease activity of the polymerase and the fluorophore is released.
  • the released fluorophore can then fluoresce and produce a detectable signal.
  • Linear probes comprising a fluorophore and a high efficiency dark quencher, such as the Black Hole Quenchers (BHQTM; Biosearch Technologies, Inc., Novato, CA) are also contemplated.
  • BHQTM Black Hole Quenchers
  • the high quenching efficiency and lack of native fluorescence of the BHQTM dyes allows "random-coil" quenching to occur in linear probes labelled at one terminus with a fluorophore and at the other with a BHQTM dye thus ensuring that the fluorophore does not fluoresce when the probe is in solution.
  • the probe stretches out spatially separating the fluorophore and quencher and allowing the fluorophore to fluoresce.
  • the BHQTM dyes can also be used as the quencher moiety in molecular beacon or TaqMan ® probes.
  • two fluorescently labelled probes that anneal to adjacent regions of the target sequence can be used.
  • One of these probes a donor probe
  • a donor fluorophore such as fluorescein
  • the acceptor probe is labelled at the 5 ' end with an acceptor fluorophore, such as LC Red 640 or LC Red 705.
  • primers and probes are capable of functioning as both primer and probe in an amplification reaction.
  • combined primer/probe polynucleotides include, but are not limited to, Scorpion probes, duplex Scorpion probes, LuxTM primers and AmplifluorTM primers.
  • Scorpion probes consist of, from the 5 ' to 3 ' end, (i) a fluorophore, (ii) a specific probe sequence that is complementary to a portion of the target sequence and is held in a hairpin configuration by complementary stem loop sequences, (iii) a quencher, (iv) a PCR blocker (such as, hexethylene glycol) and (v) a primer sequence. After extension of the primer sequence in an amplification reaction, the probe folds back on itself so that the specific probe sequence can bind to its complement within the same DNA strand. This opens up the hairpin and the fluorophore can fluoresce.
  • Duplex Scorpion probes are a modification of Scorpion probes in which the fluorophore- coupled probe/primer containing the PCR blocker and the quencher-coupled sequence are provided as separate complementary polynucleotides. When the two polynucleotides are hybridized as a duplex molecule, the fluorophore is quenched. Upon dissociation of the duplex when the primer/probe binds the target sequence, the fluorophore and quencher become spatially separated and the fluorophore fluoresces.
  • the Amplifluor Universal Detection System also employs fluorophore/quencher combinations and is commercially available from Chemicon International (Temecula, CA).
  • LuxTM primers incorporate only a fluorophore and adopt a hairpin structure in solution that allows them to self-quench. Opening of the hairpin upon binding to a target sequence allows the fluorophore to fluoresce.
  • Suitable fluorophores and/or quenchers for use with the polynucleotides of the present invention are known in the art (see for example, Tyagi et al, Nature Biotechnol., 16:49-53 (1998); Marras et al, Genet. Anal: Biomolec. Eng., 14:151-156 (1999)). Many fluorophores and quenchers are available commercially, for example from Molecular Probes (Eugene, OR) or Biosearch Technologies, Inc. (Novato, CA).
  • fluorophores examples include, but are not limited to, fluorescein and fluorescein derivatives, such as 6-carboxyfluoroscein (FAM), 5 '-tetrachlorofluorescein phosphoroamidite (TET), tetrachloro-6- carboxyfluoroscein, VIC and JOE, 5-(2'-aminoethyl) aminonaphthalene-1-sulphonic acid (EDANS), coumarin and coumarin derivatives, Lucifer yellow, Texas red, tetramethylrhodamine, 5-carboxyrhodamine, cyanine dyes (such as Cy5) and the like.
  • fluorescein and fluorescein derivatives such as 6-carboxyfluoroscein (FAM), 5 '-tetrachlorofluorescein phosphoroamidite (TET), tetrachloro-6- carboxyfluoroscein, VIC and JOE, 5-(2'-aminoethy
  • Pairs of fluorophores suitable for use as FRET pairs include, but are not limited to, fluorescein/rhodamine, fluorescein/Cy5, fluorescein/Cy5.5, fluorescein/LC Red 640, fluorescein/LC Red 750, and phycoerythrin/Cy7.
  • Quenchers include, but are not limited to, 4'-(4-dimethylaminophenylazo)benzoic acid (DABCYL), 4- dimethylaminophenylazophenyl-4 -maleimide (DABMI), tetramethylrhodamine, carboxytetramethylrhodamine (TAMRA), BHQTM dyes and the like.
  • the polynucleotides can be prepared using conventional solid-phase synthesis using commercially available equipment, such as that available from Applied Biosystems USA Inc. (Foster City, California), DuPont, (Wilmington, Del.), or Milligen (Bedford, Mass.). Methods of coupling fluorophores and quenchers to nucleic acids are also in the art.
  • the probe polynucleotide is a molecular beacon. In general, in order to form a hairpin structure effectively, molecular beacons are at least 17 nucleotides in length.
  • the molecular beacon probe is typically between about 17 and about 40 nucleotides in length.
  • the loop sequence that corresponds to or is complementary to the target sequence typically is about 7 to about 32 nucleotides in length, while the stem (or arm) sequences are each between about 4 and about 9 nucleotides in length.
  • part of the stem sequences of a molecular beacon may also be complementary to the target sequence.
  • the loop sequence of the molecular beacon is between about 10 and about 32 nucleotides in length. In another embodiment, the loop sequence of the molecular beacon is between about 15 and about 30 nucleotides in length.
  • the loop sequence of the molecular beacon is between about 18 and about 30 nucleotides in length. In a further embodiment, the loop sequence of the molecular beacon is between about 20 and about 30 nucleotides in length. In a still further embodiment, the loop sequence is between about 22 and about 30 nucleotides in length.
  • the loop region of the molecular beacon probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:12, 31, 50, 73 and 91, or the complement thereof.
  • the loop region of the molecular beacon probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs: 17, 19, 36, 38, 55, 57, 60, 62, 78, 80, 96, 98, 101, 103, 104 and 105, or the complement thereof.
  • the loop region of the molecular beacon probe comprises at least 10, at least 12, at least 15, at least 18, at least 20 and at least 22 consecutive nucleotides of the sequence as set forth in any one of SEQ ED NOs: 17, 19, 36, 38, 55, 57, 60, 62, 78, 80, 96, 98, 101, 103, 104 and 105, or the complement thereof.
  • the Campylobacter detection system of the present invention can be used to detect Campylobacter target nucleotide sequence in a sample by contacting a sample known to contain or suspected of containing one or more target nucleotide sequences with one or more of the polynucleotide probes described above under conditions that permit hybridisation of the probe(s) to the target nucleotide sequence(s).
  • the hybridised probes can then be detected by conventional methods.
  • the detection system can comprise primers and probes to allow for the amplification of the target nucleotide sequence(s) to be detected prior to detection. Amplification of the target nucleotide sequence(s) prior to detection allows for the screening of test samples containing only small amounts of these sequences.
  • detection of Campylobacter in a test sample with the Campylobacter detection system involves subjecting the sample to one or more amplification reactions in order to obtain one or more amplification products, or amplicons, comprising a Campylobacter target sequence and detection of the amplicon(s).
  • an "amplification reaction” refers to a process that increases the number of copies of a particular nucleic acid sequence by enzymatic means.
  • Amplification procedures are well-known in the art and include, but are not limited to, polymerase chain reaction (PCR), TMA, rolling circle amplification, nucleic acid sequence based amplification (NASBA), strand displacement amplification (SDA) and Q-beta replicase amplification.
  • PCR polymerase chain reaction
  • TMA rolling circle amplification
  • NASBA nucleic acid sequence based amplification
  • SDA strand displacement amplification
  • Q-beta replicase amplification Q-beta replicase amplification.
  • SDA primers comprise additional nucleotides near the 5' end that constitute a recognition site for a restriction endonuclease.
  • NASBA primers comprise additional nucleotides near the 5 1 end that are not complementary to the target sequence but which constitute an RNA polymerase promoter. Polyn
  • the target sequence is amplified by PCR.
  • PCR is a method known in the art for amplifying a nucleotide sequence using a heat stable polymerase and a pair of primers, one primer (the forward primer) complementary to the (+)-strand at one end of the sequence to be amplified and the other primer (the reverse primer) complementary to the (-)- strand at the other end of the sequence to be amplified.
  • Newly synthesized DNA strands can subsequently serve as templates for the same primer sequences and successive rounds of strand denaturation, primer annealing, and strand elongation, produce rapid and highly specific amplification of the target sequence.
  • PCR can thus be used to detect the existence of a defined sequence in a DNA sample.
  • PCR refers to the various forms of PCR known in the art including, but not limited to, quantitative PCR, reverse-transcriptase PCR, real-time PCR, hot start PCR, long PCR, LAPCR, multiplex PCR, touchdown PCR, and the like.
  • Real-time PCR refers to a PCR reaction in which the amplification of a target sequence is monitored in real time by, for example, the detection of fluorescence emitted by the binding of a labelled probe to the amplified target sequence.
  • the present invention thus provides for a method of amplifying multiple Campylobacter target nucleotide sequences in a test sample, wherein the target nucleotide sequences are selected from a C. jejuni atpA target sequence, a C. coliyphC target sequence and a C. lari glyA target sequence as described above.
  • amplification of C. jejuni target nucleotide sequences, wherein the target nucleotide sequence is a portion of a C. jejuni atpA gene of less than about 500 nucleotides in length and comprising at least 65 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12 can be accomplished using pairs of C.
  • each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO:1, or the complement thereof.
  • Amplification of C. coli target nucleotide sequences, wherein the target nucleotide sequence is a portion of a C. coliyphC gene of less than about 500 nucleotides in length and comprising at least 65 consecutive nucleotides of the sequence set forth in SEQ ID NO:31 can be accomplished using pairs of C. coli- specific primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof.
  • lari target nucleotide sequences wherein the target nucleotide sequence is a portion of C. lari glyA gene of less than about 450 nucleotides in length and comprising at least 65 consecutive nucleotides of one or more of the sequences set forth in SEQ IQ NOs:50, 73 and 91 can be accomplished using pairs of polynucleotide primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO: 39, or the complement thereof.
  • the above-described method of the present invention can be employed, if desired, to amplify a single Campylobacter target nucleotide sequence, to amplify two or more Campylobacter target nucleotide sequences, or to amplify three or more Campylobacter target nucleotide sequences.
  • the target nucleotide sequences can be from the same or different species of Campylobacter.
  • the amplification reaction can be conducted sequentially or concurrently. When conducted concurrently, the amplification reaction can be performed in a single reaction vessel or each amplification reaction can be performed in a separate reaction vessel.
  • One embodiment of the present invention provides for a method of concurrently amplifying two or more Campylobacter target nucleotide sequences selected from the group of a C. ye/wm-specific target nucleotide sequence comprising SEQ ID NO: 13 or the complement thereof, a C. co/ ⁇ -specif ⁇ c target nucleotide sequence comprising SEQ ID NO:32 or the complement thereof, and a C. /on-specific target nucleotide sequence comprising one or more of SEQ ID NOs:51, 74 and 92 or the complement thereof, the method comprising two or more of the following steps: i) amplifying the C. ye/wm-specific target nucleotide sequence using a pair of C.
  • jejuni-specific primers each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO:1, or the complement thereof; ii) amplifying the C. coli- specific target nucleotide sequence using a pair of C. co/z ' -specif ⁇ c primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof, and iii) amplifying the C. / ⁇ ' -specific target nucleotide sequence using a pair of C.
  • each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO:39, or the complement thereof.
  • the product of the amplification reaction can be detected by a number of means known to individuals skilled in the art. Examples of such detection means include, for example, gel electrophoresis and/or the use of polynucleotide probes.- In one embodiment of the invention, the amplification products are detected through the use of polynucleotide probes. Such polynucleotide probes are described in detail above.
  • detection of Campylobacter with the Campylobacter detection system of the present invention involves amplification and detection of one or more target nucleotide sequences selected from a C, jejuni target sequence, a C. coli target sequence and a C. lari target sequence, using species-specific primers and probes as described above.
  • amplification and detection of C. jejuni target nucleotide sequences wherein the target nucleotide sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12, is accomplished using a combination of C. jejuni-specific polynucleotides, the combination comprising one or more C.
  • jejuni-specific primers comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO: 1, or the complement thereof, and a C. jejuni-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof.
  • Amplification and detection of C. coli target nucleotide 'sequences, wherein the target nucleotide sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, is accomplished using a combination of C. co/z ' -specific polynucleotides, the combination comprising one or more C.
  • co/7-specific primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof, and a C. c ⁇ / ⁇ -specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof.
  • Amplification and detection of C. lari target nucleotide sequences, wherein the target nucleotide sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of the sequence as set forth in one or more of SEQ ID NOs:50, 73 and 91 is accomplished using a combination of C. / ⁇ -specific polynucleotides, the combination comprising one or more C.
  • / ⁇ -specific primers comprising at least 7 nucleotides of the sequence as set forth in SEQ FD NO:39 or the complement thereof, and a C. / ⁇ -specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NO:50, 73 and 91, or the complement thereof.
  • the invention provides for a method of concurrently amplifying and detecting two or more target nucleotide sequences selected from the group of a C. ye/ «m-specific target nucleotide sequence of less than about 500 nucleotides in length comprising at least 65 consecutive nucleotides of SEQ ID NO: 12 or the complement thereof, a C. c ⁇ / ⁇ -specific target nucleotide sequence of less than about 500 nucleotides in length comprising at least 65 consecutive nucleotides of SEQ ID NO:31 or the complement thereof, and a C.
  • / ⁇ -specific target nucleotide sequence of less than 450 nucleotides in length comprising at least 65 consecutive nucleotides of one or more of SEQ ID NOs:50, 73 and 91, or the complement thereof, said method comprising two or more of the following steps: i) amplifying and detecting the C. _/e/wm-specif ⁇ c target nucleotide sequence using a combination of C. jejuni-specific polynucleotides comprising one or more C. ye/wm-specific primers comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO:1, or the complement thereof, and a C.
  • jejuni-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof; ii) amplifying and detecting the C. co/z-specific target nucleotide sequence using a combination of C. co/ ⁇ -specif ⁇ c polynucleotides comprising one or more C. coli- specific primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof, and a C. co/ ⁇ -specif ⁇ c probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof, and iii) amplifying and detecting the C.
  • Another embodiment provides for a method of concurrently amplifying and detecting two or more target nucleotide sequences selected from a C. ye/wm ' -specific target nucleotide sequence comprising SEQ ID NO: 13, a C. co/ ⁇ -specific target nucleotide sequence comprising SEQ ID NO:32 and a C. / ⁇ -specific target nucleotide sequence comprising one or more of SEQ ID NOs:51, 74 and 92, said method comprising two or more of the following steps: i) amplifying and detecting the C.ye/wra-specific target nucleotide sequence using a combination of C. ye/wm-specific polynucleotides comprising one or more C.
  • jejuni-speciftc primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-l 1, or the complement thereof, and a C. jejuni-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 13, or the complement thereof; ii) amplifying and detecting the C. co/ ⁇ -specific target nucleotide sequence using a combination of C. co/z-specific polynucleotides comprising one or more C. co/ ⁇ -specific primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof, and a C.
  • co/ ⁇ -specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:32, or the complement thereof, and iii) amplifying and detecting the C. / ⁇ -specific target nucleotide sequence using a combination of C. / ⁇ -specif ⁇ c polynucleotides comprising one or more C.
  • / ⁇ -specific primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:40, 41, 42, 43, 44, 45, 46, 47, 48, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89, and 90, or the complement thereof, and a C. / ⁇ -specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:51, 74 and 92, or the complement thereof.
  • the present invention thus provides for methods to specifically amplify and detect one or more target nucleotide sequences from one or more of C. jejuni, C. coli and C. lari in a test sample in a single tube format using the polynucleotide primers, and optionally one or more probes, described herein.
  • Such methods may employ dyes, such as SYBR ® Green or S YBR ® Gold that bind to the amplified target sequence, or an antibody that specifically detects the amplified target sequence.
  • the dye or antibody is included in the reaction vessel and detects the amplified sequences as it is formed.
  • a labelled polynucleotide probe such as a molecular beacon or TaqMan® probe
  • a labelled polynucleotide probe distinct from the primer sequences, which is complementary to a region of the amplified sequence, may be included in the reaction, or one of the primers may act as a combined primer/probe, such as a Scorpion probe.
  • a general method of detecting one or more of C. jejuni, C. coli and C. lari in a sample using the Campylobacter detection system of the present invention comprises contacting a test sample with one or more combinations of species- specific polynucleotides, each combination comprising at least one polynucleotide primer and at least one polynucleotide probe or primer/probe, as described above, under conditions that permit amplification and detection of the target sequence(s), and detecting any amplified target sequence(s) as an indication of the presence of the one or more Campylobacter species in the sample.
  • test sample is a biological sample suspected of containing, or known to contain, one or more of C. jejuni, C. coli and C. lari.
  • a method is provided to specifically amplify and detect one or more Campylobacter target nucleotide sequences in a test sample using the Campylobacter detection system, the method generally comprising the steps of:
  • reaction mixture comprising a test sample, amplification reagents, and one or more polynucleotide combinations, each combination comprising a labelled probe capable of specifically hybridising to a Campylobacter target nucleotide sequence, and one or more primers pairs capable of amplifying the target nucleotide sequence;
  • the method specifically amplifies and detects one or more target nucleotide sequences selected from the group of a C. jejuni atpA target nucleotide sequence, a C. coli yphC target nucleotide sequence and a C. lari glyA target nucleotide sequence and generally comprises the steps of:
  • coliyphC target nucleotide sequence and (iii) a labelled probe capable of specifically hybridising to a portion of a C. lari glyA target nucleotide sequence and one or more primers capable of amplifying the C. lari glyA target nucleotide sequence;
  • amplification reagents includes conventional reagents employed in amplification reactions and includes, but is not limited to, one or more enzymes having nucleic acid polymerase activity, enzyme cofactors (such as magnesium or nicotinamide adenine dinucleotide (NAD)), salts, buffers, nucleotides such as deoxynucleotide triphosphates (dNTPs; for example, deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and deoxythymidine triphosphate) and other reagents that modulate the activity of the polymerase enzyme or the specificity of the primers.
  • enzyme cofactors such as magnesium or nicotinamide adenine dinucleotide (NAD)
  • NAD nicotinamide adenine dinucleotide
  • salts such as magnesium or nicotinamide adenine dinucleotide (NAD)
  • step (b) of the above method can be repeated several times prior to step (c) by thermal cycling the reaction mixture by techniques known in the art and that steps (b), (c) and (d) may take place concurrently such that the detection of the amplified sequence takes place in real time.
  • the polynucleotide probe may be a combined primer/probe, or it may be a separate polynucleotide probe, in which case two different polynucleotide primers are used.
  • test sample may undergo enrichment, extraction and/or purification steps to isolate nucleic acids therefrom prior to the amplification reaction, and/or the amplified product may be submitted to purification/isolation steps or further amplification prior to detection, and/or the results from the detection step (d) may be analysed in order to quantify the amount of target present in the sample or to compare the results with those from other samples.
  • the method is a real-time PCR assay.
  • the real-time PCR assay employs one or more different species-specific primer pairs and molecular beacon probes for the detection of one or more different species of Campylobacter.
  • the real-time PCR assay employs at least two species-specific primer pairs and molecular beacons selected from the group of a C. ye/wm-specific primer pair and molecular beacon, a C. co/z-specific primer pair and molecular beacon and a C. / ⁇ -specific primer pair and molecular beacon for the simultaneous detection of at least two of C. jejuni, C. coli and C. lari.
  • the real-time PCR assay employs a C. ye/wm-specif ⁇ c primer pair and molecular beacon, a C. co/ ⁇ -specific primer pair and molecular beacon and a C. / ⁇ -specific primer pair and molecular beacon for the simultaneous detection of C. jejuni, C. coli and C. lari.
  • the present invention provides for diagnostic assays using the polynucleotide primers and/or probes that can be used for highly specific and sensitive detection of multiple Campylobacter species in a test sample.
  • the diagnostic assays comprise amplification and detection of one or more Campylobacter target nucleotide sequences as described above.
  • the present invention provides for diagnostic assays that can be used to detect one or more of C. jejuni, C. coli and C. lari.
  • the diagnostic assays can be qualitative or quantitative and can involve real time monitoring of the amplification reaction or conventional end-point monitoring.
  • the invention provides for diagnostic assays that do not require post-amplification manipulations and minimise the amount of time required to conduct the assay.
  • a diagnostic assay utilising the primers and probes described herein, that can be completed using real time PCR technology in, at most, 54 hours and generally less than 24 hours.
  • diagnostic assays of the present invention utilise species-specific primers and probes that amplify and detect their respective target nucleotide sequences under similar conditions, thus providing for assays that can be performed in a single reaction vessel for simultaneous detection of two or more of C. jejuni, C. coli and C. lari.
  • the single reaction vessel can be, for example, a microtitre plate or similar container, wherein each combination of species-specific primers plus probe can be provided in separate wells, or two or more such combinations can be provided in a single well.
  • a diagnostic assay for the detection of C. jejuni, C. coli and optionally C. lari is provided in a single reaction vessel, wherein C.
  • jejuni species-specific primers plus probe and C. coli species-specific primers plus probe are provided in a single well and optionally C. lari species-specific primers plus probe are provided in a separate well.
  • a diagnostic assay for the detection of C. jejuni, C. coli and C. lari is provided in a single reaction vessel, wherein C. jejuni species-specific primers plus probe, C. coli species-specific primers plus probe and C. lari species-specific primers plus probe are all provided in a single well.
  • the present invention provides a diagnostic assay for the detection of contamination of a food sample by one or more of C. jejuni, C. coli and C. lari.
  • the diagnostic assays provide for rapid and sensitive detection of contamination of a food sample by one or more of C. jejuni, C. coli and C. lari.
  • Foods that can be analysed using the diagnostic assays include, but are not limited to, dairy products such as milk, including raw milk, cheese, yoghurt, ice cream and cream; raw, cooked and cured meats and meat products, such as beef, pork, lamb, mutton, poultry (including turkey, chicken), game (including rabbit, grouse, pheasant, duck), minced and ground meat (including ground beef, ground turkey, ground chicken, ground pork); eggs; fruits and vegetables; nuts and nut products, such as nut butters; seafood products including fish and shellfish; and fruit or vegetable juices.
  • dairy products such as milk, including raw milk, cheese, yoghurt, ice cream and cream
  • raw, cooked and cured meats and meat products such as beef, pork, lamb, mutton, poultry (including turkey, chicken), game (including rabbit, grouse, pheasant, duck), minced and ground meat (including ground beef, ground turkey, ground chicken, ground pork); eggs; fruits and vegetables; nuts and nut products, such as
  • the present invention also contemplates the use of the primers and probes in diagnostic assays for the detection of contamination by one or more species of C. jejuni, C. coli and C. lari in other biological samples, such as patient specimens in a clinical setting, for example, faeces, blood, saliva, throat swabs, urine, mucous, and the like.
  • the diagnostic assays are also useful in the assessment of microbiologically pure cultures and water quality and in environmental and pharmaceutical quality control processes.
  • the test sample can be used in the assay either directly (i.e. as obtained from the source) or following one or more pre-treatment steps to modify the character of the sample.
  • the test sample can be pre-treated prior to use, for example, by disrupting cells or tissue, enhancing/enriching the microbial content of the sample by culturing in a suitable medium, preparing liquids from solid materials, diluting viscous fluids, filtering liquids, distilling liquids, concentrating liquids, inactivating interfering components, adding reagents, purifying nucleic acids, and the like.
  • the test sample is subjected to one or more steps to isolate, or partially isolate, nucleic acids therefrom.
  • the test sample is subjected to an enrichment procedure to enhance the microbial content of the sample prior to use in the assay.
  • the polynucleotide primers and probes of the invention can be used in assays to quantitate the amount of Campylobacter target nucleotide sequence(s) in a test sample.
  • the present invention provides for a method to specifically amplify, detect and quantitate one or more Campylobacter target nucleotide sequences in a test sample using the Campylobacter detection system, the method generally comprising the steps of:
  • reaction mixture comprising a test sample, amplification reagents, and one or more polynucleotide combinations, each combination comprising a labelled probe capable of specifically hybridising to a Campylobacter target nucleotide sequence, and one or more primers pairs capable of amplifying the target nucleotide sequence;
  • the steps of this method may also be varied and may employ combinations of primers and probes for different target sequences as described above for the amplification/detection method.
  • the method specifically amplifies and detects one or more target nucleotide sequences selected from the group of a C. jejuni atpA target nucleotide sequence, a C. coli yphC target nucleotide sequence and a C. lari glyA target nucleotide sequence and generally comprises the steps of:
  • coliyphC target nucleotide sequence and (iii) a labelled probe capable of specifically hybridising to a portion of a C. lari glyA target nucleotide sequence and one or more primers capable of amplifying the C. lari glyA target nucleotide sequence;
  • Step (e) in the above methods can be conducted, for example, by comparing the amount of signal produced to a standard or utilising one of a number of statistical methods known in the art that do not require a standard.
  • the standard can consist of a standard curve compiled by amplification and detection of known quantities of a Campylobacter target nucleotide sequence under the assay conditions.
  • relative quantitation can be performed without the need for a standard curve (see, for example, Pfaffl, MW. (2001) Nucleic Acids Research 29(9):2002-2007).
  • a reference gene is selected against which the expression of the target gene can be compared.
  • the reference gene is usually a gene that is expressed constitutively, for example, a house- keeping gene.
  • An additional pair of primers and an appropriate probe are included in the reaction in order to amplify and detect a portion of the selected reference gene.
  • a different reference gene can be selected for each Campylobacter species tested.
  • Another similar method of quantification is based on the inclusion of an internal standard in the reaction.
  • Such internal standards generally comprise a control target nucleotide sequence and a control polynucleotide probe.
  • the internal standard can further include an additional pair of primers that specifically amplify the control target nucleotide sequence and are unrelated to the polynucleotides of the present invention.
  • control target sequence can contain primer target sequences that allow specific binding of the assay primers but a different probe target sequence. This allows both the Campylobacter target sequence(s) and the control sequence to be amplified with the same primers, but the amplicons are detected with separate probe polynucleotides.
  • the reference/control probe incorporates a detectable label that is distinct from the label incorporated into the Campylobacter target sequence specific probe(s). The signals generated by these labels when they bind their respective target sequences can thus be distinguished.
  • a control target nucleotide sequence is a nucleic acid sequence that (i) can be amplified either by a pair of Campylobacter target sequence specific primers or by control primers, (ii) specifically hybridizes to the control probe under the assay conditions and (iii) does not exhibit significant hybridization to the Campylobacter target sequence specific probe(s) under the same conditions.
  • control primers specifically hybridizes to the control probe under the assay conditions and (iii) does not exhibit significant hybridization to the Campylobacter target sequence specific probe(s) under the same conditions.
  • the diagnostic assays can be readily adapted for high-throughput.
  • High-throughput assays provide the advantage of processing many samples simultaneously and significantly decrease the time required to screen a large number of samples.
  • the present invention contemplates the use of the polynucleotide primers and probes in high-throughput screening or assays to detect and/or quantitate one or more Campylobacter target nucleotide sequences in a plurality of test samples.
  • reaction components are usually housed in a multi- container carrier or platform, such as a multi-well microtitre plate, which allows a plurality of assays each containing a different test sample to be monitored simultaneously. Control samples can also be included in the plates to provide internal controls for each plate.
  • a multi- container carrier or platform such as a multi-well microtitre plate
  • Control samples can also be included in the plates to provide internal controls for each plate.
  • Many automated systems are now available commercially for high-throughput assays, as are automation capabilities for procedures such as sample and reagent pipetting, liquid dispensing, timed incubations, formatting samples into microarrays, microplate thermocycling and microplate readings in an appropriate detector, resulting in much faster throughput times.
  • kits comprising the Campylobacter detection system for detecting one or more of C. jejuni, C. coli and C. lari in a variety of samples, hi general, the kits comprise one or more pairs of primers capable of amplifying a Campylobacter target sequence and one or more probes capable of detecting the Campylobacter target sequence as described above.
  • a primer and probe may be provided in the form of a single polynucleotide, such as a Scorpion probe, as described above.
  • the probe(s) provided in the kit can incorporate a detectable label, such as a fluorophore or a fluorophore and a quencher, or the kit may include reagents for labelling the probe.
  • the primers and probes can be provided in separate containers or in an array format, for example, pre-dispensed into microtitre plates.
  • kits comprising Campylobacter species-specific primers and probes. Combinations of different species-specific primers and probes can be included such that the kits provides for amplification and detection of more than one Campylobacter species.
  • the present invention provides for kits comprising a combination of different species- specific primers and probes that are capable of amplifying and detecting one or more target nucleotide sequences selected from: a target nucleotide sequence derived from the atpA gene of C. jejuni, a target nucleotide sequence derived from the yphC gene of C. coli and a target nucleotide sequence derived from the glyA gene of C. lari.
  • the kit comprises i) a pair of C jejuni-specific primers capable of amplifying a C. jejuni atpA target sequence comprising SEQ ID NO: 13, ii) a C. jejuni-specific probe capable of hybridising to a target sequence comprising SEQ ID NO: 13, or the complement thereof, iii) a pair of C. co/ ⁇ -specific primers capable of amplifying a C. coli yph C target sequence comprising SEQ ID NO:32, iv) a C. coli- specif ⁇ c probe capable of hybridising to a target sequence comprising SEQ ID NO:32, or the complement thereof, v) a pair of C. / ⁇ -specific primers and a C.
  • lari-specif ⁇ c probe selected from: (a) a pair of primers capable of amplifying a C. lari target sequence comprising SEQ ED NO:51 and a C. / ⁇ rj-specific probe capable of hybridising to the target sequence comprising SEQ ID NO:51, or the complement thereof, (b) a pair of primers capable of amplifying a C. lari target sequence comprising SEQ ID NO:74, or the complement thereof, and a C. / ⁇ -specific probe capable of hybridising to the target sequence comprising SEQ ED NO:74 and (c) a pair of primers capable of amplifying a C. lari target sequence comprising SEQ ID NO:92 and a C. / ⁇ r/-specific probe capable of hybridising to the target sequence comprising SEQ ED NO:92, or the complement thereof.
  • kits can optionally include amplification reagents, such as buffers, salts, enzymes, enzyme co-factors, nucleotides and the like.
  • amplification reagents such as buffers, salts, enzymes, enzyme co-factors, nucleotides and the like.
  • Other components such as buffers and solutions for the enrichment, isolation and/or lysis of bacteria in a test sample, extraction of nucleic acids, purification of nucleic acids and the like may also be included in the kit.
  • One or more of the components of the kit may be lyophilised and the kit may further comprise reagents suitable for the reconstitution of the lyophilised components.
  • kits are provided in suitable containers. As indicated above, one or more of the containers may be a microtitre plate. Where appropriate, the kit may also optionally contain reaction vessels, mixing vessels and other components that facilitate the preparation of reagents or nucleic acids from the test sample.
  • the kit may additionally include one or more controls.
  • control polynucleotides primers, probes, target sequences, or a combination thereof
  • the kit can additionally contain instructions for use, which may be provided in paper form or in computer-readable form, such as a disc, CD, DVD or the like.
  • instructions for use may be provided in paper form or in computer-readable form, such as a disc, CD, DVD or the like.
  • the present invention further contemplates that the kits described above may be provided as part of a package that includes computer software to analyse data generated from the use of the kit.
  • FIG. 1 depicts a sample of such an alignment in which a portion of the atpA gene of 10 different C. jejuni strains have been aligned.
  • a 103 nucleotide conserved sequence was identified as described above (SEQ ID NO: 12).
  • Example 2 Generation of PCR Primers for Amplification of the atpA Consensus Sequence Within the conserved 103 nucleotide sequence identified as described in Example 1, regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. The primer sequences are shown below:
  • Reverse primer #1 5'- CAAT AGT AT ATTCCAT AGCACCATG -3' [SEQ ID NO: 15]
  • forward primer #1 starts at position 65 and ends at position 90 of the alignment.
  • Reverse primer #1 represents the reverse complement of the region starting at position 143 and ending at position 167.
  • SEQ ID NO: 18 The complement of this sequence (SEQ ID NO: 18, shown below) can also be used as a molecular beacon probe for detecting C. jejuni.
  • probes having the following loop sequences include probes having the following loop sequences:
  • the starting material for the synthesis of the molecular beacons was an oligonucleotide that contains a sulfhydryl group at its 5' end and a primary amino group at its 3' end.
  • DABCYL was coupled to the primary amino group utilizing an amine-reactive derivative of DABCYL.
  • the oligonucleotides that were coupled to DABCYL were then purified.
  • the protective trityl moiety was then removed from the 5'-sulfhydryl group and a fluorophore was introduced in its place using an iodoacetamide derivative.
  • Table 2 provides a general overview of the characteristics of molecular beacon probe #1.
  • the beacon sequence shown in Table 2 indicates the stem region in lower case and the loop region in upper case.
  • Table 3 provides an overview of the thermodynamics of the folding of molecular beacon probe #1. Calculations were made using MFOLDTM software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site.
  • Figure 2 shows the arrangement of PCR primers and the molecular beacon probe in the atpA consensus sequence. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward primer #1 and reverse primer #1.
  • step 15 add 700 ⁇ L of mixture from step 13 to a DNeasy binding column and centrifuge at 800 rpm for 1 minute. Discard eluted buffer. Repeat process with leftover mixture from step 13.
  • wash buffer (AW buffer) to binding columns and centrifuge for 1 minute at 800 rpm. Discard eluted buffer.
  • wash buffer (AW buffer) to binding columns and centrifuge for 1 minute at 800 rpm. Discard eluted buffer.
  • Time of manipulation 3 hours. Proceed to prepare PCR reaction for real-time detection.
  • Genomic DNA from C. jejuni and the species and strains presented in Table 6 below was isolated as described in Example 4.
  • PCR amplification was undertaken using the conditions described in Tables 4 and 5 below. Amplicons were detected with SYBR ® Green. The intensity of fluorescence emitted by the SYBR Green dye was detected at the elongation stage of each amplification cycle.
  • the Qiagen SyBrGreen buffer contains dNTPs and Taq polymerase and 0.125 mM magnesium chloride (final concentration). Inclusion of additional magnesium chloride brings the final concentration to 1.5 mM in the reaction mixture.
  • Table 5 presents an overview of the cycles used for each step of the PCR amplification.
  • Acinetobacter calcoaceticus (2) Lactobacillus helveticus
  • Aeromonas hydrophila Lactobacillus rhamnosus
  • thermophilus Pseudomonas pseudoalcaligenes Genus Serovars Genus Serovars
  • Lactobacillus acidophilus Yersinia enterocolitica (2)
  • Lactobacillus casei (2) Yersinia frederiksenii
  • PCR amplification was undertaken using the PCR Mix shown in Table 7 (below) and the PCR program shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle.
  • the PCR buffer contains 2.25 mM magnesium chloride (final concentration). Inclusion of additional magnesium chloride brings the final concentration to 4 mM in the reaction mixture.
  • a fluorescence monitoring real-time PCR instrument for example, a BioRad iCycler iQTM or MJ Research OpticonTM. Other instruments with similar fluorescent reading abilities can also be used.
  • Example 7 Positive Validation of atpA Primers and Molecular Beacon Probe #1
  • Genomic DNA from 24 C. jejuni strains was isolated and amplified as described in the preceding Examples (4 and 6). Results indicate that molecular beacon probe was capable of detecting all 24 strains of C jejuni tested ⁇ i.e. sensitivity of 100%).
  • Acinetobacter calcoaceticus (2) Lactobacillus acidophilus
  • Aeromonas hydrophila Lactobacillus helveticus
  • Aeromonas salmonicida Lactobacillus pentosus Genus Serovars Genus Serovars
  • Bacillus subtilis (2) Neisseria lactamica
  • Campylobacter upsaliensis (4) Salmonella heidelberg (2)
  • Clostridium botulinum Salmonella thompson (2)
  • Klebsiella terrigena Yersinia enterocolitica (2)
  • the yphC gene in C. coli is believed to code for a guanine triphosphate binding protein of unknown function.
  • a similar gene has been identified in the closely related species C. jejuni (Suerbaum, S et al. (2001) Journal of Bacteriology 183:2553-2559). Based on this sequence, the yphC gene from ten C. coli isolates was identified and sequenced. The yphC gene coding regions thus identified were aligned using the multiple alignment program Clustal WTM. The resulting alignment was used to identify short DNA regions that were conserved within the C. coli group, yet which are excluded from other bacteria.
  • Figure 4 depicts a sample of such an alignment in which a portion of the yphC gene of 10 different C. coli strains have been aligned.
  • a 116 nucleotide conserved sequence (SEQ ID NO:31) was identified from the multiple sequence alignment.
  • Example 10 Generation of PCR Primers for Amplification of the yphC Consensus Sequence Within the conserved 116 nucleotide sequence identified as described in Example 9, regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. The primer sequences are shown below:
  • Reverse primer #2 5'- CCTTCATTGGCATCT AAAACCAA -3' [SEQ ID NO:34]
  • forward primer #2 starts at position 70 and ends at position 91 of the alignment.
  • Reverse primer #2 represents the reverse complement of the region starting at position 163 and ending at position 185.
  • a molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc.
  • the molecular beacons were synthesized as described in Example 3.
  • Table 9 provides a general overview of the characteristics of molecular beacon probe #2.
  • the beacon sequence shown in Table 9 indicates the stem region in lower case and the loop region in upper case.
  • Table 10 provides an overview of the thermodynamics of the folding of molecular beacon probe #2. Calculations were made using MFOLDTM software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site.
  • Figure 5 shows the arrangement of PCR primers and the molecular beacon-probe in the yphC consensus sequence. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward and reverse primers.
  • Example 12 Amplification of yphC Consensus Sequence in Real Time with SybrGreen
  • Genomic DNA from the species and strains presented in Table 11 below was isolated as described in Example 4. PCR amplification was undertaken using the conditions described in Tables 4 and 5 in Example 5.
  • Aeromonas hydrophila Lactobacillus helveticus
  • Aeromonas salmonicida Lactobacillus pentosus
  • thermophilus Pseudomonas aeruginosa (2)
  • Branhamella catarrhal is Pseudomonas stutzeri Genus Serovars Genus Serovars
  • Campylobacter spotorum Salmonella heidelberg
  • Clostridium botulinum Salmonella typhi
  • Klebsiella terrigena Yersinia enterocolitica (2)
  • Example 13 Amplification of yphC Consensus Sequence and Hybridization of Molecular Beacon Probe #2 in Real Time
  • PCR amplification was undertaken using the PCR Mix shown in Table 7 (above) with the exception that the forward/reverse primer pair #2 and the molecular beacon #2 were used.
  • the PCR program used is shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle.
  • Genomic DNA from the species was isolated as described in Example 4. Amplification was conducted as described in Example 6 and Table 7 above with the exception that yphC forward primer #2, the reverse primer #2 and the molecular beacon #2 were used in the PCR mix in place of the atpA primers and probe.
  • Example 15 Negative Validation of the yphC Primers and Molecular Beacon #2
  • a number of bacteria (296) other than C. coli were tested.
  • Acinetobacter calcoaceticus (2) Lactobacillus acidophilus
  • Aeromonas hydrophila Lactobacillus helveticus
  • Aeromonas salmonicida Lactobacillus pentosus
  • Bacillus amyloliquefaciens (2) Lactobacillus rhamnosus (2)
  • Campylobacter upsaliensis (4) Salmonella heidelberg (2) Genus Serovars Genus Serovars
  • Clostridium botulinum Salmonella thompson (2)
  • Klebsiella terrigena Yersinia enterocolitica (2)
  • Example 16 Determination of a Unique, conserveed DNA Region in the C. lari slyA gene
  • FIG. 7 depicts a sample of such an alignment in which a portion of the glyA gene of 10 different C. lari strains have been aligned.
  • a 117 nucleotide conserved sequence (SEQ ID NO:50) was identified from the multiple sequence alignment.
  • primer target sequences Within the conserved 117 nucleotide sequence identified as described in Example 16, regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. The primer sequences are shown below:
  • Reverse primer #3 5'- GGTGTGTAT ATGGCATTGTT AAATC -3' [SEQ ID NO:53]
  • forward primer #3 starts at position 127 and ends at position 149 of the alignment.
  • Reverse primer #3 represents the reverse complement of the region starting at position 219 and ending at position 243.
  • forward primer #4 can also be used to amplify glyA consensus sequence #1: Forward primer #4: 5'- GCTTTCATAAACY*TTTCCAGAAG -3' [SEQ ID NO:58]
  • a molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc.
  • SEQ ID NO:56 The complement of this sequence (SEQ ID NO:56, shown below) can also be used as a molecular beacon probe for the detecting C. lari.
  • the molecular beacons were synthesized as described in Example 3.
  • Table 14 provides a general overview of the characteristics of molecular beacon probe #3.
  • the beacon sequence shown in Table 14 indicates the stem region in lower case and the loop region in upper case.
  • Table 13 Description of ⁇ ly ⁇ molecular beacon probe #3
  • Table 14 provides an overview of the thermodynamics of the folding of molecular beacon probe #3. Calculations were made using MFOLDTM software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site.
  • Figure 8 shows the arrangement of PCR primers and the molecular beacon probe in the glyA consensus sequence #1. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward and reverse primers.
  • a further glyA specific molecular beacon suitable for the detection of C. lari was also prepared as described above.
  • the sequence is shown below (nucleotides in lower case represent the nucleotides that make up the stem of the beacon):
  • SEQ ID NO:61 The complement of this sequence (SEQ ID NO:61) can also be used as molecular beacon probes for the detection of C. lari.
  • Genomic DNA from the species and strains presented in Tables 15 below was isolated as described in Example 4. PCR amplification was undertaken using the conditions described in Tables 4 and 5 in Example 5.
  • Aeromonas hydrophila Lactobacillus pentosus
  • Aeromonas salmonicida Lactobacillus plantarum
  • Salmonella enteritidis Salmonella enteritidis
  • Citrobacter diversus Salmonella newport (2) Citrobacter diversus Salmonella newport (2) .
  • Clostridium botulinum Salmonella
  • Example 20 Amplification of ⁇ lvA Consensus Sequence and Hybridization of Molecular Beacon Probe #3 in Real Time
  • PCR amplification was undertaken using the PCR Mix shown in Table 7 (above) with the exception that the forward/reverse primer pair #3 and the molecular beacon probe #3 were used in place of the atpA primers and probe.
  • the PCR program used is shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle
  • Genomic DNA from C. lari and other different species was isolated as described in Example 4. Amplification was conducted as described in Example 6 and the PCR mix as described in Table 7 with the exception that glyA forward primer #3, the reverse primer #3 and the molecular beacon #3 were used. Results indicate that all 15 C. lari strains tested are amplified and gave a positive signal ⁇ i.e. sensitivity of 100%).
  • FIG. 10 depicts a sample of such an alignment in which a portion of the glyA gene of 10 different C. lari strains have been aligned.
  • a 125 nucleotide conserved sequence (SEQ ID NO:73) was identified from the multiple sequence alignment.
  • primer target sequences were used to design primers to allow efficient PCR amplification.
  • the primer sequences are shown below:
  • Reverse primer #4 5'- GTGGTGCTAGTGCTT ATCCT -3' [SEQ ID NO:76]
  • forward primer #5 starts at position 119 and ends at position 127 of the alignment.
  • Reverse primer #4 represents the reverse complement of the region starting at position 214 and ending at position
  • a molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc.
  • SEQ ID NO:79 The complement of this sequence (SEQ ID NO:79, shown below) can also be used as a molecular beacon probe for the detecting C. lari.
  • the molecular beacons were synthesized as described in Example 3.
  • Table 16 provides a general overview of the characteristics of molecular beacon probe #5.
  • the beacon sequence shown in Table 16 indicates the stem region in lower case and the loop region in upper case.
  • Table 17 provides an overview of the thermodynamics of the folding of molecular beacon probe #5. Calculations were made using MFOLDTM software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site.
  • Figure 11 shows the arrangement of PCR primers and the molecular beacon probe in the glyA consensus sequence #2. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward and reverse primers. Table 17. Thermodynamics of molecular beacon probe #5.
  • Example 26 Amplification of ⁇ ly ⁇ Consensus Sequence #2 in Real Time with SybrGreen
  • Genomic DNA from the species and strains was isolated as described in Example 4. PCR amplification was undertaken using the conditions described in Tables 4 and 5 in Example 5.
  • Example 27 Amplification of ⁇ lv ⁇ Consensus Sequence #2 and Hybridization of Molecular Beacon Probe #5 in Real Time PCR amplification was undertaken using the PCR Mix shown in Table 7 (above) with the exception that the forward primer #5/reverse primer #4 and the molecular beacon probe #5 were used.
  • the PCR program used is shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle
  • Genomic DNA from different species was isolated as described in Example 4. Amplification was conducted as described in Example 6 with the exception that glyA forward primer #5, reverse primer #4 and the molecular beacon #5 were used in place of forward primer #1, reverse primer #1 and molecular beacon #1.
  • Results indicate that all of the 15 C. lari strains tested are amplified and gave a positive signal ⁇ i.e. sensitivity of 100%).
  • the glyA gene coding regions from 10 different C. lari isolates were sequenced and aligned using the multiple alignment program Clustal WTM. The resulting alignment was used to identify short DNA regions that were conserved within the C. lari group, yet which are excluded from other bacteria.
  • Figure 13 depicts a sample of such an alignment in which a portion of the glyA gene of 10 different C. lari strains have been aligned.
  • a 99 nucleotide conserved sequence (SEQ ID NO:91) was identified from the multiple sequence alignment.
  • primer target sequences were used to design primers to allow efficient PCR amplification.
  • the primer sequences are shown below:
  • forward primer #6 starts at position 84 and ends at position 103 of the alignment.
  • Reverse primer #5 represents the reverse complement of the region starting at position 163 and ending at position 182.
  • the following forward primer #7 can also be used to amplify glyA consensus sequence #3:
  • a molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc. glyA molecular beacon probe #6:
  • SEQ ID NO: 97 The complement of this sequence (SEQ ID NO: 97, shown below) can also be used as a molecular beacon probe for the detecting C. lari.
  • the molecular beacons were synthesized as described in Example 3.
  • Table 18 provides a general overview of the characteristics of molecular beacon probe #6.
  • the beacon sequence shown in Table 18 indicates the stem region in lower case and the loop region in upper case.
  • Table 19 provides an overview of the thermodynamics of the folding of molecular beacon probe #6. Calculations were made using MFOLDTM software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site.
  • Figure 14 shows the arrangement of PCR primers and the molecular beacon probe in the glyA consensus sequence #3. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward and reverse primers.
  • a further glyA specific molecular beacon suitable for the detection of C. lari was also prepared as described above.
  • the sequence is shown below (nucleotides in lower case represent the nucleotides that make up the stem of the beacon):
  • SEQ ID NO: 102 The complement of this sequence (SEQ ID NO: 102) can also be used as molecular beacon probes for the detection of C. lari,
  • Genomic DNA from the species and strains was isolated as described in Example 4. PCR amplification was undertaken using the conditions described in Tables 4 and 5 of Example 5.
  • the forward primer #7 and #6 also amplified all the C. lari strains but a few amplification products with a melting peak close to that of the C. lari amplicon were observed among the non C. lari strains tested.
  • Example 34 Amplification of ⁇ lvA Consensus Sequence #3 and Hybridization of Molecular Beacon Probe #6 in Real Time
  • PCR amplification was undertaken using the PCR Mix shown in Table 7 (above) with the exception that the forward primer #6, reverse primer #5 and the molecular beacon probe #6 were used.
  • the PCR program used is shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle.
  • Genomic DNA from different species was isolated as described in Example 4.
  • Amplification was conducted as described in Example 6 with the exception that glyA forward primer #6, reverse primer #5 and the molecular beacon #6 were used.
  • Results indicate that all 15 C. lari strains tested are amplified and gave a positive signal (i.e. sensitivity of 100%).
  • Example 36 Negative Validation of the ⁇ lvA Primers and Molecular Beacon #6
  • glyA forward primer #6 reverse primer #5 and molecular beacon #6 to preferentially amplify and detect only C. lari
  • a number of bacteria other than C. lari were tested.
  • Example 37 Quantification of atpA, yphC or ⁇ lv ⁇ Target Sequences in a Test Sample
  • DNA was isolated and amplified as described in the preceding Examples (4, 6, 11, 13 and 20). DNA was quantified using a standard curve constructed from serial dilutions of a target DNA solution of known concentration.
  • the ability of the C. lari g/y ⁇ -specific primers and probes, such as those described in Examples 17 and 18, to amplify and detect their target sequence under the same PCR conditions as the C. jejuni and C. coli primers and probes described in this Example will allow for the combination of all three sets of primers and probes in a single microtitre plate in order to simultaneously detect all three species of Campylobacter.
  • the C. lari primers and probe can be placed in a separate well for a singleplex reaction while the C. jejuni and C. coli primers and probes are multiplexed in another well.
  • the present invention also contemplates pooling of the C. lari primers and probe with the C. jejuni and C. coli primers and probes in a single "triplex" PCR reaction as described in Examples 39 and 40, below.
  • Example 39 Positive Validation of the Combination of atpA, yphC and ⁇ lvA Primers and Molecular Beacon Probes
  • AtpA forward primer#l and reverse primer #1 The combination of atpA forward primer#l and reverse primer #1, atpA molecular beacon #1 , yphC forward primer #2 and reverse primer #2, yphC molecular beacon #2, glyA forward primer #3 and glyA reverse primer #3, and glyA molecular beacon probe #3 were tested against a panel of 34 C. jejuni strains, 17 C. coli and 20 C. lari strains using the triplex PCR conditions described in Table 21, below.
  • AtpA molecular beacon # 1 In order to test the ability of the combination of atpA forward primer#l and reverse primer # 1 , atpA molecular beacon # 1 , yphC forward primer #2 and reverse primer #2, yphC molecular beacon #2, glyA forward primer #3 and glyA reverse primer #3, and glyA molecular beacon probe #3 to preferentially amplify and detect only the three target species of Campylobacter (i.e. C. jejuni, C. coli and C. /an), 278 strains of bacteria other than C. lari, C. coli and C. lari were tested.
  • Campylobacter i.e. C. jejuni, C. coli and C. /an
  • Salmonella typhi (2) Lactobacillus rhamnosus
  • Salmonella typhimurium Lactococcus lactis

Abstract

A system for the detection of one or more species of Campylobacter species in a test sample is provided. The system comprises polynucleotide primers and probes for the specific amplification and detection of one or more of Campylobacter jejuni, Campylobacter coli and Campylobacter lari. The primers and probes can be used in real time diagnostic assays for rapid detection of Campylobacter in a variety of situations. Kits comprising the primers and probes are also provided.

Description

POLYNUCLEOTIDES FOR THE DETECTION OF CAMPYLOBACTER SPECIES
FIELD OF THE INVENTION
The present invention pertains to the field of detection of microbial contaminants and, in particular, the invention relates to the detection of Campylobacter.
BACKGROUND OF THE INVENTION
Campylobacter species, such as Campylobacter jejuni, Campylobacter coli and Campylobacter lari are carried in the intestinal tract of warm-blooded animals and, therefore, contaminate foods of animal origin. These bacterial species are commonly associated with contamination of raw poultry products and dairy products. A recent outbreak of gastroenteritis in Canada was also linked to contamination of the water supply with Campylobacter (Can J Public Health 82(1):27-31). C. jejuni is recognized as a leading cause of acute bacterial gastroenteritis and C. jejuni infections can lead to serious pathological sequelae. C. coli and C. lari are also recognized causes of gastroenteritis, although infections with these bacteria occur less frequently than those with C. jejuni. Campylobacter is the most common bacterial cause of gastroenteritis in the U.S with approximately 2.5 million cases of campylobacteriosis occurring annually. Within 2-5 days after exposure, individuals infected with the pathogen may develop diarrhea, abdominal pain, malaise, fever, nausea and vomiting. In rare cases febrile convulsions, Guillain-Barre syndrome and meningitis may result [Stern N., Line E., Chen HC, Chapter 31 in Compendium of Methods for the Microbiological Examination of Foods (2001) Fourth Edition by American Press Association, Washington DC].
In order to prevent Campylobacter infections, methods of detection can be utilized that identify the presence of the bacteria in food or water, prior to consumer availability and consumption. However, due to relatively quick rates of food spoilage, many detection techniques, which require long time periods, are not time and cost effective. For example, a number of detection technologies require the culturing of bacterial samples for time periods of up to eight days. However, in that time, the product being tested must be placed in circulation for purchase and consumption. Therefore, a system that can rapidly identify the presence of one or more species of Campylobacter in a test sample is desirable.
A variety of methods are described in the art for the detection of bacterial contaminants. One of these methods is the amplification of specific nucleotide sequences using specific primers in a PCR assay. Upon completion of the amplification of a target sequence, the presence of an amplicon is detected using agarose gel electrophoresis. This method of detection, while being more rapid than traditional methods requiring culturing bacterial samples, is still relatively time consuming and subject to post-PCR contamination during the running of the agarose gel.
An additional technology utilized for detection of bacterial contamination, is nucleic acid hybridization. In such detection methodologies, the target sequence of interest is typically amplified and then hybridized to an oligonucleotide probe which possesses a complementary nucleic acid sequence to that of the target molecule. The probe can be modified so that detection of the hybridization product may occur, for example, the probe can be labelled with a radioisotope or fluorescent moiety.
The use of Campylobacter nucleic acid sequences for detection of this bacterium has been described. For example, International Patent Application WO 03/014704 describes a method to detect, identify, and differentiate C. jejuni and C. coli based on the amplification of, or hybridization to, a part of the cadF gene of the bacteria. Al Rashid et al. (J. Clinical Microbiol. 38(4): 1488-1494; 2000) describe the use of degenerate primers to amplify fragments of the Campylobacter glyA gene and a PCR- Southern hybridization detection method using probes specific for C. jejuni, C. coli, C. lari, C. upsaliensis, Arcobacter butsleri and A. butsleri-like species designed to distinguish these species from each other. This PCR-Southern hybridization detection method involved a PCR amplification step, followed by agarose gel electrophoresis and then Southern blotting. Four different hybridisation and washing conditions had to be developed in order to maximise the specificity of the probes. The sensitivity of the detection method with respect to the amount of genomic DNA required to yield sufficient PCR product to be detected by the probes was also investigated. The lowest amount of genomic DNA required was determined as being between 200 and 230,000 template copies.
A particularly useful modification of hybridization and amplification technology provides for the concurrent amplification and detection of a target sequence {i.e. in "real time") through the use of specially adapted oligonucleotide probes. Examples of such probes include molecular beacon probes (Tyagi et al., (1996) Nature Biotechnol. 14:303-308), TaqMan® probes (U.S. Patent Nos. 5,691,146 and 5,876,930) and Scorpion probes (Whitcombe et al., (1999) Nature Biotechnol. 17:804-807).
Molecular beacons represent a powerful tool for the rapid detection of specific nucleotide sequences and are capable of detecting the presence of a complementary nucleotide sequence even in homogenous solutions. Molecular beacons can be described as hairpin stem-and-loop oligonucleotide sequences, in which the loop portion of the molecule represents a probe sequence, which is complementary to a predetermined sequence in a target polynucleotide. One arm of the beacon sequence is attached to a fluorescent moiety, while the other arm of the beacon is attached to a non- fluorescent quencher. The stem portion of the stem-and-loop sequence holds the two arms of the beacon in close proximity. Under these circumstances, the fluorescent moiety is quenched. When the beacon encounters a nucleic acid sequence complementary to its probe sequence, the probe hybridizes to the nucleic acid sequence, forming a stable complex and, as a result, the arms of the probe are separated and the fluorophore emits light. Thus, the emission of light is indicative of the presence of the specific nucleic acid sequence. Individual molecular beacons are highly specific for the DNA sequences they are complementary to.
Certain genes have been identified as being fairly well-conserved in Campylobacter. For example, the atpA gene, which encodes one of the subunits of the ATP synthase complex. The atpA gene is often referred to as a housekeeping gene and is not believed to be associated with virulence genes. A sequence analysis of the atpA gene and six other housekeeping genes in 32 isolates of C. jejuni from North America, Asia and Europe, found that the atpA gene had the lowest allelic diversity and polymorphic sites [Hong, S and Pedersen, PL (2003) Journal Bioenergetics and Biomembranes 35: 95-120; Suerbaum, S et al. (2001) Journal of Bacteriology 183:2553-2559].
The yphC gene in Camplylobacter is believed to code for a guanine triphosphate binding protein of unknown function. To date, this gene has been identified only in C. jejuni (Suerbaum, S et al. (2001) Journal of Bacteriology 183:2553-2559).
The glyA gene, which encodes serine hydroxymethyl transferase [Al Rashid, S. T. et al. (2000) Journal of Clinical Microbiology (38:1488-1494)], is also a highly conserved gene. Serine hydroxymethyl transferase (SHMT), L-serine:tetrahydro folate 5,10- hydroxymethyltransferase is a pyridoxyl 5 '-phosphate (PLP)-dependent enzyme which catalyses the reversible interconversion of serine and glycine. This reaction is the major source of one-carbon groups in the cell. This carbon source is necessary for thymidate, purine, and methionine biosynthesis. SHMT from Escherichia coli, as well as from several other bacteria sources, is dimeric and contains 2 mol of PLP/mol of enzyme [Fu. T-F et al. (2003) The Journal of Biological Chemistry (278: 31088- 31094); Chaturvedi S. and Bhakuni V. (2003) The Journal of Biological Chemistry (278: 40793-40805)].
This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention.
SUMMARY OF THE INVENTION
An object of the present invention is to provide polynucleotides for the detection of Campylobacter species. In accordance with one aspect of the invention, there is provided a Campylobacter detection system comprising a combination of polynucleotides selected from the group of:
a) a combination of polynucleotides for detection of Campylobacter jejuni comprising a first C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:1; a second C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ED NO:1 and a C. jejuni polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO: 12, or the complement thereof;
b) a combination of polynucleotides for detection of Campylobacter coli comprising a first C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ED NOs:21, 22, 23, 24, 25, 26, 27, 28, 29 and 30; a second C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ED NOs:
21, 22, 23, 24, 25, 26, 27, 28, 29 and 30, and a C. coli polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:31, or the complement thereof;
c) a combination of polynucleotides for detection of Campylobacter lari comprising a first C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:39; a second C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ED NO:39, and a C. lari polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ED NOs: 50, 73 and 91 , or the complement thereof;
d) a combination of polynucleotides comprising two of the combinations of (a), (b) and (c), and
e) a combination of polynucleotides comprising the combinations of (a), (b) and (c).
In accordance with another aspect of the present invention, there is provided a method of detecting one or more of Campylobacter jejuni, Campylobacter coli and Campylobacter lari in a sample, said method comprising the steps of:
(a) contacting a sample suspected of containing, or known to contain, one or more Campylobacter target nucleotide sequences with the combination of polynucleotides under conditions that permit amplification, said combination selected from the group of:
(i) a combination of polynucleotides for detection of C. jejuni comprising a first C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 1 ; a second C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:1 and a C. jejuni polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof;
(ii) a combination of polynucleotides for detection of C. coli comprising a first C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:21, 22, 23, 24, 25, 26, 27, 28, 29 and 30; a second C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30, and a C. coli polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof;
(iii)a combination of polynucleotides for detection of C. lari comprising a first C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:39; a second C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:39, and a C. lari polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof;
(iv)a combination of polynucleotides comprising two of the combinations of (i),
(ii) and (iii), and
(v) a combination of polynucleotides comprising the combinations of (i), (ii) and (iii); and
(b) detecting any amplified target sequence(s), wherein detection of an amplified target sequence indicates the presence of C. jejuni, C. coli and/or C. lari in the sample.
In accordance with another aspect of the present invention, there is provided a Campylobacter detection kit comprising:
(a) a combination of polynucleotides selected from the group of:
(i) a combination of polynucleotides for detection of C. jejuni comprising a first C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:1; a second C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO: 1 and a C. jejuni polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof;
(ii) a combination of polynucleotides for detection of C. coli comprising a first C. coh polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:21, 22, 23, 24, 25, 26, 27, 28,
29 and 30; a second C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30, and a C. coli polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ E) NO:31 , or the complement thereof;
(iii)a combination of polynucleotides for detection of C. lari comprising a first C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:39; a secind C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:39, and a C. lari polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof;
(iv)a combination of polynucleotides comprising two of the combinations of (i), (ii) and (iii), and (v) a combination of polynucleotides comprising the combinations of (i), (ii) and (iii); and
(b) one or more containers.
In accordance with another aspect of the present invention, there is provided a pair of polynucleotide primers for amplification of a portion of a C. jejuni atpA gene, said pair of polynucleotide primers comprising a first polynucleotide primer. comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12 and a second polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO: 12.
In accordance with another aspect of the present invention, there is provided a pair of polynucleotide primers for amplification of a portion of a C. coliyphC gene, said pair of polynucleotide primers comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:21, 22, 23, 24, 25, 26, 27, 28 , 29 and 30; and a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28 , 29 and 30.
In accordance with another aspect of the present invention, there is provided a pair of polynucleotide primers for amplification of a portion of a C. lari glyA gene, said pair of polynucleotide primers comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91; and a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ED NOs:50, 73 and 91.
In accordance with another aspect of the present invention, there is provided an isolated C. jejuni specific polynucleotide having the sequence as set forth in SEQ ID NO : 12, or the complement thereof.
In accordance with another aspect of the present invention, there is provided an isolated C. coli specific polynucleotide having the sequence as set forth in SEQ ID NO:31, or the complement thereof. In accordance with another aspect of the present invention, there is provided an isolated C. lari specific polynucleotide having the sequence as set forth in SEQ ID NO:50, 73, or 91, or the complement thereof.
In accordance with another aspect of the present invention, there is provided a polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of a C. jejuni atpA gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 13, 14 or 15, or the complement thereof.
In accordance with another aspect of the present invention, there is provided a polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of a C. coliyphC gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof.
hi accordance with another aspect of the present invention, there is provided a polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of a C. lari glyA gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ED NOs:51, 52, 53, 74, 75, 76, 92, 93, 94, and 99, or the complement thereof.
In accordance with another aspect of the present invention, there is provided a polynucleotide probe of between 7 and 100 nucleotides in length for detection of C. jejuni, said polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO: 12, or the complement thereof.
In accordance with another aspect of the present invention, there is provided a polynucleotide probe of between 7 and 100 nucleotides in length for detection of C. coli, said polynucleotide comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:31, or the complement thereof.
In accordance with another aspect of the present invention, there is provided a polynucleotide probe of between 7 and 100 nucleotides in length for detection of C. lari, said polynucleotide comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91 or the complement thereof.
BRIEF DESCRIPTION OF THE DRAWINGS
These and other features of the invention will become more apparent in the following detailed description in which reference is made to the appended drawings wherein:
Figure 1 presents a multiple sequence alignment showing conserved regions of a portion of the coding strand of atpA gene from various C. jejuni strains [SEQ ID NOs:2-l I]. Shaded blocks highlight the following regions: bases 65 to 90: forward primer #1 [SEQ ID NO:14]; bases 110 to 134: binding site for molecular beacon #1 [SEQ ID NO: 16]; bases 143 to 167: binding site for reverse primer #1 [SEQ ID NO:15];
Figure 2 presents the arrangement of PCR primers and a molecular beacon probe on the atpA gene sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs: 14 & 15;
Figure 3 presents the secondary structure of a molecular beacon probe [SEQ ID NO: 16] in accordance with one embodiment of the invention;
Figure 4 presents a multiple sequence alignment of a portion of the coding strand of the yphC gene from several isolates of C. coli [SEQ ID NOs: 21-30]. Shaded blocks highlight the following regions: bases 70 to 91 : forward primer #2 [SEQ ID NO:33]; bases 101 to 123: binding site for molecular beacon #2 [SEQ ID NO:35]; bases 163 to 185: binding site for reverse primer #2 [SEQ ID NO:34];
Figure 5 presents the arrangement of PCR primers and a molecular beacon probe on the yphC consensus sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs:33 & 34; Figure 6 presents the secondary structure of a molecular beacon probe [SEQ ID NO:35] in accordance with one embodiment of the invention;
Figure 7 presents a multiple sequence alignment showing conserved regions of a portion of the non-coding strand of the glyA gene from various C. lari strains [SEQ ID NOs:40-49]. Shaded blocks highlight the following regions: bases 127 to 149: forward primer # 3 [SEQ ID NO:52]; bases 177 to 202: binding site for molecular beacon #3 [SEQ ID NO:54]; bases 219 to 243: binding site for reverse primer #3 [SEQ ID NO:53];
Figure 8 presents the arrangement of PCR primers and a molecular beacon probe on the glyA gene sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs: 52 & 53;
Figure 9 presents the secondary structure of a molecular beacon probe [SEQ ID NO:54] in accordance with one embodiment of the invention;
Figure 10 presents a multiple sequence alignment showing conserved regions of another portion of the non-coding strand of the glyA gene from various C. lari strains [SEQ ID NOs:63-72]. Shaded blocks highlight the following regions: bases 109 to 127: forward primer # 5 [SEQ ID NO:75]; bases 157 to 179: binding site for molecular beacon #5 [SEQ ID NO:77]; bases 214 to 233: binding site for reverse primer #4 [SEQ ID NO:76];
Figure 11 presents the arrangement of PCR primers and a molecular beacon probe on the glyA gene sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs:75 and 76;
Figure 12 presents the secondary structure of a molecular beacon probe [SEQ ID NO: 77] in accordance with one embodiment of the invention;
Figure 13 presents a multiple sequence alignment showing conserved regions of a further portion of the non-coding strand of the glyA gene from various C. lari strains [SEQ ED NOs:81-90]. Shaded blocks highlight the following regions: bases 84 to 103: forward primer #6 [SEQ ID NO:93]; bases 112 to 134: binding site for molecular beacon # 6 [SEQ ID NO:95]; bases 163 to 182: binding site for reverse primer #5 [SEQ ID NO:94];
Figure 14 presents the arrangement of PCR primers and a molecular beacon probe on the glyA gene sequence in one embodiment of the invention. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with primers SEQ ID NOs:93 and 94;
} Figure 15 presents the secondary structure of a molecular beacon probe [SEQ ID NO:95] in accordance with one embodiment of the invention;
Figure 16 presents (A) the sequence of a portion of a C. jejuni atpA gene [SEQ ID NO:1] comprising the atpA consensus sequence identified in one embodiment of the invention, (B) the sequence of the atpA conserved region (consensus sequence) [SEQ ID NO:12] and, (C) the sequence of a highly conserved region [SEQ ID NO:13] identified within the consensus sequence, R represents A or G;
Figure 17 presents (A) the sequence of the C. coliyphC consensus sequence [SEQ ID NO:31] identified in one embodiment of the invention and (B) the sequence of a highly conserved region [SEQ ID NO:32] identified within the consensus sequence; and
Figure 18 presents (A) the coding sequence of a C. lari glyA gene [SEQ ID NO:39] comprising the glyA consensus sequences identified in accordance with the invention, (B) the sequence of a C. lari glyA consensus sequence [SEQ ID NO:50], (C) the sequence of a highly conserved region [SEQ ID NO:51] identified within SEQ ID NO: 50 (D) the sequence of a second C. lari glyA consensus sequence [SEQ ID NO:73], (E) the sequence of a highly conserved region [SEQ ID NO:74] identified within SEQ DD NO:73; (F) the sequence of a third C. lari glyA consensus sequence [SEQ DD NO:91], and (G) the sequence of a highly conserved region [SEQ DD NO:92] identified within SEQ DD NO:91, R represents A or G. DETAILED DESCRIPTION OF THE INVENTION
The present invention provides for a Campylobacter detection system that is capable of simultaneously detecting multiple Campylobacter species in a test sample. As is known in the art, the three most clinically relevant Campylobacter species are Campylobacter jejuni, Campylobacter coli and Campylobacter lari. Detection of some or all of these three species, therefore, is important in various situations including, but not limited to, the food manufacturing and processing industries, during monitoring of water purity and in clinical settings. In accordance with the present invention, therefore, the Campylobacter detection system is capable of detecting the presence of Campylobacter jejuni, Campylobacter coli and Campylobacter lari in a test sample.
As will be readily appreciated by a worker skilled in the art, while the system provided by the present invention is capable of detecting all three of the above-listed Campylobacter species, it can also be employed, if desired, to detect just one or two of these Campylobacter species. Thus, the system of the present invention provides for the detection of one or more of C. jejuni, C. coli and C. lari in a test sample. In one embodiment of the present invention, the detection system provides for the detection of two or more of C. jejuni, C. coli and C. lari. In another embodiment, the detection system provides for the detection of all three of C. jejuni, C. coli and C. lari. The Campylobacter detection system is useful in detecting the presence of one or more Campylobacter species in a variety of samples, such as clinical samples, microbiological pure cultures, or samples related to food, environmental or pharmaceutical quality control processes.
The Campylobacter detection system of the present invention comprises polynucleotides designed to amplify and/or detect one or more Campylobacter target nucleotide sequences. A target nucleotide sequence is a nucleotide sequence that comprises one or more highly conserved regions (consensus sequences), or a portion of said one or more highly conserved regions, that are common to various strains within a Campylobacter species. Polynucleotide primers and probes can be designed against the selected target sequence(s) to allow for the specific detection of the Campylobacter species in a test sample. The target nucleotide sequence can be common to Campylobacter strains from one Campylobacter species or from more than one Campylobacter species. Accordingly, the Campylobacter detection system can comprise polynucleotides designed to amplify and/or detect one target nucleotide sequence or more than one target nucleotide sequence. The target nucleotide sequences can be from the same target gene, or from different target genes.
In one embodiment of the present invention, the Campylobacter detection system comprises polynucleotides designed to amplify and/or detect more than one target nucleotide sequence. In another embodiment, the different target nucleotide sequences are found in different target genes. In a further embodiment, at least one of the target nucleotide sequences is from the C. coliyphC gene. In a specific embodiment of the present invention, the target nucleotide sequences are from the C. jejuni atpA gene, C. coli yphC gene and the C. lari glyA gene.
The present invention also provides for primer and probe polynucleotides that are capable of amplifying and/or detecting Campylobacter target nucleotide sequences and which are suitable for inclusion in the Campylobacter detection system. In accordance with the present invention, the Campylobacter detection system can comprise primer and/or probe polynucleotides for detection of a single target nucleotide sequence or primer and/or probe polynucleotides for detection of a plurality of target nucleotide sequences. Accordingly, the system can be designed to amplify and/or detect a single target nucleotide sequence and thereby detect various strains from a single species of Campylobacter, or to amplify and/or detect more than one target nucleotide sequence and thereby detect more than one species of Campylobacter. If desired, the system can be designed to distinguish one species of Campylobacter from another species by specifically amplifying and/or detecting sequences from the selected Campylobacter species. Alternatively, primers and probes specific for a target nucleotide sequence from a single Campylobacter species can be combined with other primers and probes specific for target nucleotide sequences from one or more other species of Campylobacter to provide a system for detecting a plurality of Campylobacter species in a single test sample. In the latter system, the target nucleotide sequences can be the same or different. A system of the invention which amplifies and detects target nucleotide sequences from multiple species of Campylobacter allows for the detection of multiple species of Campylobacter in a single assay. Thus, in another embodiment, the present invention provides for a system that allows for simultaneous detection of multiple species of Campylobacter in a single diagnostic assay. Simultaneous detection of multiple species of Campylobacter in a single assay can be more efficient and/or more economical than performing multiple standard assays, each of which detects only a single Campylobacter species.
Accordingly, one embodiment of the present invention provides for a system comprising primer and probe polynucleotides that amplify and/or detect one or more target nucleotide sequences from one species of Campylobacter. Another embodiment of the present invention provides for a system comprising a combination of primer and probe polynucleotides that amplify and/or detect the same or different target nucleotide sequences from at least two different Campylobacter species. Another embodiment provides for a system comprising a combination of primer and probe polynucleotides that amplify and/or detect the same or different target nucleotide sequences from at least three different Campylobacter species.
The primers and probes of the invention demonstrate a specificity of at least 95%, as defined herein, for their selected target nucleotide sequence. In one embodiment, the primers and probes of the invention demonstrate a specificity for their selected target nucleotide sequence of at least 97%. In another embodiment, the primers and probes of the invention demonstrate a specificity for their selected target nucleotide sequence of at least 98%. hi further embodiments, the primers and probes of the invention demonstrate a specificity for their selected target sequence of at least 99%, and at least 99.5%.
As indicated above, in one embodiment of the present invention, the primer and probe polynucleotides are capable of specifically amplifying and/or detecting a target nucleotide sequence from a single Campylobacter species, i.e. are species-specific. Combinations of such species-specific primers and probes can be employed in the system of the present invention to detect a plurality of Campylobacter species in a test sample. The species-specific primers and probes of the present invention are capable of detecting a wide variety of strains of the selected Camplyobacter species. In one embodiment of the invention, the species-specific primers and probes demonstrate a sensitivity in detecting strains of the selected Campylobacter species of at least 90%. In another embodiment, the species-specific primers and probes demonstrate a sensitivity of at least 91%. In further embodiments, the species-specific primers and probes demonstrate a sensitivity of at least 92%, of at least 93%, of at least 94%, of at least 95%, of at least 96%, of at least 97%, of at least 98% and of at least 99%.
In one embodiment, the present invention provides for diagnostic assays that can be carried out in real-time and addresses the need for rapid detection of Campylobacter in a variety of biological samples. A further embodiment of the present invention provides for a Campylobacter detection system that can detect fewer than 200 template copies of genomic DNA. hi another embodiment, the Campylobacter detection system can detect fewer than 100 template copies of genomic DNA.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The terms "oligonucleotide" and "polynucleotide" as used interchangeably in the present application refer to a polymer of greater than one nucleotide in length of ribonucleic acid (RNA), deoxyribonucleic acid (DNA), hybrid RNA/DNA, modified RNA or DNA, or RNA or DNA mimetics. The polynucleotides may be single- or double-stranded. The terms include polynucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as polynucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted polynucleotides are well-known in the art and for the purposes of the present invention, are referred to as "analogues."
The terms "primer" and "polynucleotide primer," as used herein, refer to a short, single-stranded polynucleotide capable of hybridizing to a complementary sequence in a nucleic acid sample. A primer serves as an initiation point for template- dependent nucleic acid synthesis. Nucleotides are added to a primer by a nucleic acid polymerase in accordance with the sequence of the template nucleic acid strand. A "primer pair" or "primer set" refers to a set of primers including a 5' upstream primer that hybridizes with the 5 ' end of the sequence to be amplified and a 3 ' downstream primer that hybridizes with the complementary 3 ' end of the sequence to be amplified. The term "forward primer" as used herein, refers to a primer which anneals to the 5 ' end of the sequence to be amplified. The term "reverse primer", as used herein, refers to a primer which anneals to the complementary 3' end of the sequence to be amplified.
The terms "probe" and "polynucleotide probe," as used herein, refer to a polynucleotide used for detecting the presence of a specific nucleotide sequence in a sample. Probes specifically hybridize to a target nucleotide sequence, or the complementary sequence thereof, and can be single- or double-stranded.
The term "specifically hybridize," as used herein, refers to the ability of a polynucleotide to bind detectably and specifically to a target nucleotide sequence. Polynucleotides specifically hybridize to target nucleotide sequences under hybridization and wash conditions that minimize appreciable amounts of detectable binding to non-specific nucleic acids. High stringency conditions can be used to achieve specific hybridization conditions as is known in the art. Typically, hybridization and washing are performed at high stringency according to conventional hybridization procedures and employing one or more washing step in a solution comprising 1-3 x SSC, 0.1-1% SDS at 50-700C for 5-30 minutes.
The term "specificity," as used herein, refers to the ability of a primer or primer pair to amplify, or a probe to detect, nucleic acid sequences from selected species of
Campylobacter but not other bacterial species. The selected species can be a single Campylobacter species or a group of Campylobacter species. "% specificity" is defined by a negative validation test wherein the primers and/or probe are tested against a panel of at least 100 bacterial species other than the selected Campylobacter species. Thus, for example, a pair of primers that does not amplify any nucleic acid sequences from the panel of bacterial species would be defined as demonstrating 100% specificity and a pair of primers that amplified a nucleic acid sequence from one bacterial species in a panel of 100 species would be defined as demonstrating 99% specificity.
The term "species-specific," as used herein with reference to a polynucleotide primer and/or a polynucleotide probe, means that the primer specifically amplifies and the probe specifically detects a target sequence from a single species of Campylobacter. The term "% specificity" when used in reference to a species-specific primer or probe therefore, defines the ability of the primer or probe to amplify or detect a target sequence from one selected species of Campylobacter when evaluated against a panel comprising other Campylobacter species in addition to unrelated bacterial species.
The term "sensitivity," as used herein, refers to the ability of a species-specific primer or primer pair to amplify, or a species-specific probe to detect, nucleic acid sequences from a range of strains from Campylobacter species against which the primer/probe is targeted. "% sensitivity" is defined by a positive validation test wherein the primers and/or probe are tested against a panel of at least 10 strains from the selected Campylobacter species. Thus, for example, a pair of primers that amplifies nucleic acid sequences from all strains of the selected Campylobacter species in a panel of 10 strains would be defined as demonstrating 100% sensitivity and a pair of primers that amplified nucleic acid sequences from nine strains in a panel of 10 strains of a selected Campylobacter species would be defined as demonstrating 90% sensitivity.
As used herein, the term "strain" refers to a subset of a bacterial species that shares at least one common identifiable characteristic that distinguishes members of the subset from other bacteria of the same species. The characteristic(s) can be serological, genetic, immunologic, morphological, phenotypic, biochemical or a combination thereof.
The term "corresponding to" refers to a polynucleotide sequence that is identical to all or a portion of a reference polynucleotide sequence. In contradistinction, the term "complementary to" is used herein to indicate that the polynucleotide sequence is identical to all or a portion of the complementary strand of a reference polynucleotide sequence. For illustration, the nucleotide sequence "TATAC" corresponds to a reference sequence "TATAC" and is complementary to a reference sequence "GTATA."
The terms "hairpin" or "hairpin loop" refer to a single strand of DNA or RNA, the ends of which comprise complementary sequences, whereby the ends anneal together to form a "stem" and the region between the ends is not annealed and forms a "loop." Some probes, such as molecular beacons, have such "hairpin" structure when not hybridized to a target sequence. The loop is a single-stranded structure containing sequences complementary to the target sequence, whereas the stem self-hybridises to form a double-stranded region and is typically unrelated to the target sequence, however, nucleotides that are both complementary to the target sequence and that can self-hybridise can also be included in the stem region.
The term "target gene" as used herein, refers to the gene within which a target nucleotide sequence is located.
The terms "target sequence" or "target nucleotide sequence," as used herein, refer to a particular nucleic acid sequence in a test sample to which a primer and/or probe is intended to specifically hybridize. A "target sequence" is typically longer than the primer or probe sequence and thus can contain multiple "primer target sequences" and "probe target sequences." A target sequence may be single- or double-stranded. The term "primer target sequence" as used herein refers to a nucleic acid sequence in a test sample to which a primer is intended to specifically hybridize. The term "probe target sequence" refers to a nucleic acid sequence in a test sample to which a probe is intended to specifically hybridize.
As used herein, the term "about" refers to a +/-10% variation from the nominal value. It is to be understood that such a variation is always included in any given value provided herein, whether or not it is specifically referred to.
CAMPYLOBACTER DETECTION SYSTEM
Target Sequences As indicated above, the Campylobacter detection system of the present invention comprises polynucleotides designed to amplify and/or detect one or more Campylobacter target nucleotide sequences. Thus, suitable Campylobacter target nucleotide sequences are first selected and then polynucleotide primers and/or probes are designed that are capable of amplifying and/or detecting the selected target nucleotide sequence(s). In order to identify highly conserved regions in the genome of selected Campylobacter species that can serve as target nucleotide sequences, a target gene is first selected. In accordance with the present invention, the target gene is selected from the group of: the atpA gene, the yphC gene and the glyA gene. A multiple sequence alignment of target gene sequences from strains of one or more Campylobacter species is then performed using one of a number of standard techniques known in the art in order to identify a region or regions of the target gene sequence that are highly conserved across all strains.
In a specific embodiment of the present invention, the target genes are selected from the atpA gene from Campylobacter jejuni, the yphC gene from Campylobacter coli and the glyA gene from Campylobacter lari. Representative multiple sequence, alignments of portions of these genes are shown in Figures 1, 4, 7, 10 and 13.
The coding strand of the C. jejuni atpA gene has a general sequence corresponding to SEQ ID NO:1 (Figure 16A). From multiple sequence alignment analysis of portions of the coding strand of the atpA gene from various C. jejuni strains, an 103 nucleotide region of the atpA gene sequence, having a sequence corresponding to SEQ ID NO: 12 (shown in Figure 16B), was identified as being generally conserved in C jejuni isolates. This sequence is referred to herein as the atpA consensus sequence and can serve as a target nucleotide sequence for C. jejuni-specific primers and probes. One skilled in the art will appreciate that alignments similar to that depicted in Figure 1 can be conducted using longer sequences such as the region shown in Figure 16A and SEQ ID NO:1 and/or the non-coding strand of the atpA gene.
Multiple sequence alignment analysis of portions of the coding strand of theyphC gene from various C. coli strains (SEQ ID NOs:21-30) identified a 116 nucleotide region having a sequence corresponding to SEQ ID NO:31 (shown in Figure 17A) as being generally conserved in the various C. coli strains. This sequence is referred to herein as the C. coliyphC consensus sequence and can serve as a target nucleotide sequence for C. cø/ϊ-specific primers and probes. One skilled in the art will appreciate that alignments similar to that depicted in Figure 4 can be conducted using the non- coding strand of the yphC gene.
Multiple sequence alignment analysis of portions of the non-coding strand of the glyA gene from various C. lari strains identified three regions of the glyA gene sequence as being generally conserved in C. lari isolates. These regions are: an 117 nucleotide region of the glyA gene sequence, having a sequence corresponding to SEQ ID NO:50 (Figure 18B), referred to herein as the glyA consensus sequence #1; a 125 nucleotide region of the glyA gene having a sequence corresponding to SEQ ID NO:73 (Figure 18D), referred to herein as the glyA consensus sequence #2 and a 99 nucleotide region of the glyA gene having a sequence corresponding to SEQ ID NO:91 (Figure 18F), referred to herein as the glyA consensus sequence #3. One skilled in the art will appreciate that alignments similar to those depicted in Figures 7, 10 and 13 can be conducted using longer sequences and/or the coding strand of the glyA gene, which is shown generally in Figure 18A and SEQ ID NO:39.
Accordingly in one embodiment, the present invention provides isolated species- specific polynucleotides that can be used as target sequences for the design of species- specific primers and/or probes for the specific detection of a selected Campylobacter species. Thus, there is provided an isolated C.y'e/wm-specific polynucleotide consisting of the consensus sequence as set forth in SEQ ID NO: 12 (shown in Figure 16B), or the complement of this sequence; an isolated C. co/7-specifϊc polynucleotide consisting of the consensus sequence as set forth in SEQ ID NO:31 (shown in Figure 17A) or the complement of this sequence; and an isolated C. /απ-specific polynucleotide consisting of the consensus sequence as set forth in any one of SEQ ID NO: 50, SEQ ID NO:73 and SEQ ID NO:91 (as shown in Figures 18B, D and F, respectively), or the complement of these sequences.
It will also be appreciated that the target sequences may include additional nucleotide sequences that are found upstream and/or downstream of the respective consensus sequence in the genome. As the assays provided by the present invention typically include an amplification step, it may be desirable to select an overall length for the target sequence such that the assay can be conducted fairly rapidly. Thus, the target nucleotide sequence typically has an overall length of less than about 500 nucleotides. In one embodiment, the target nucleotide sequence has an overall length of less than about 450 nucleotides. In another embodiment, the target sequence has an overall length of less than about 400 nucleotides. In another embodiment, the target sequence has an overall length of less than about 350 nucleotides. In other embodiments, the target sequence has an overall length of less than or equal to about 300, about 250, about 200, and about 150 nucleotides.
It will be recognised by those skilled in the art that a nucleic acid sequence comprising all, or a portion, of one of the consensus sequences set forth in any one of SEQ ED NO: 12, SEQ ID NO:31 or SEQ ID NOs: 50, 73 and 91 can be used as a target sequence for the specific detection of C. jejuni, C. coli or C. lari, respectively. Thus, one embodiment of the invention provides for a species-specific target sequence that comprises at least 60% of the respective consensus sequence, or the complement thereof. In another embodiment, the species-specific target sequence comprises at least 75% of the respective consensus sequence, or the complement thereof. In a further embodiment, the species-specific target sequence comprises at least 80% of the respective consensus sequence, or the complement thereof. Species-specific target sequences comprising at least 85%, 90%, 95%, 98% and 99% of the respective consensus sequence, or the complement of the consensus sequence, are also contemplated. Accordingly, various embodiments of the present invention provide for C. ye/wm-specific target sequences comprising at least 60%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% and at least 99% of the sequence as set forth in SEQ ID NO: 12, or the complement thereof; C. co/z-specific target sequences comprising at least 60%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% and at least 99% of the sequence as set forth in SEQ ID NO:31, or the complement thereof; and C. /απ-specific target sequences comprising at least 60%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98% and at least 99% of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof. In an alternative embodiment, appropriate portions of the species-specific consensus sequence that can be included in the target sequence are expressed in terms of consecutive nucleotides of the sequences set forth in SEQ ID NO:12, 31, 50, 73 and 91. Accordingly, target sequences comprising portions of the consensus sequences that include at least 65, at least 70, at least 75, at least 80, at least 85, at least 90 and at least 95 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12, SEQ ID NO:31, SEQ ID NO:50, SEQ ID NO:73 or SEQ ID NO:91, or the complement thereof, are contemplated. By "at least 65 consecutive nucleotides" it is meant that the target sequence may comprise any number of consecutive nucleotides between 65 and the full length of the consensus sequence (i.e. 103, 116, 117, 125 or 99 nucleotides, respectively), thus this range includes portions of the consensus sequence that comprise at least 66, at least 67, at least 68, at least 69, etc, consecutive nucleotides of the respective consensus sequence.
Within each consensus sequence indicated above, an additional highly conserved region was identified. Within the C. jejuni atpA consensus sequence, a highly conserved region of 25 nucleotides in length was identified having a sequence corresponding to SEQ ID NO:13 (as shown in Figure 16C). Accordingly, one embodiment of the present invention provides for C.ye/wm-specific target sequences that comprise all or a portion of a sequence corresponding to SEQ ID NO: 13, or the complement thereof. Within the C. coliyphC consensus sequence, a highly conserved region of 23 nucleotides in length was identified having a sequence corresponding to SEQ ID NO:32 (as shown in Figure 17B). Accordingly, one embodiment of the present invention provides for C. co/ϊ-specifϊc target sequences that comprise all or a portion of a sequence corresponding to SEQ ID NO: 32, or the complement thereof. Within the C. lari glyA consensus sequence #1, a highly conserved region of 26 nucleotides in length was identified having a sequence corresponding to SEQ ID NO: 51 (Figure 18C); within the C. lari glyA consensus sequence #2, the identified highly conserved region was 23 nucleotides in length and has a sequence corresponding to SEQ ID NO:74 (Figure 18E); and within the C. lari glyA consensus sequence #3, the identified highly conserved region was 23 nucleotides in length and has a sequence corresponding to SEQ ID NO:92 (Figure 18G). Accordingly, one embodiment of the present invention provides for C. /απ-specific target sequences that comprise all or a portion of one or more of the sequences set forth in SEQ ED NOs: 51, 74 and 92, or the complement thereof.
Polynucleotide Primers and Probes
The Campylobacter detection system of the present invention provides for the detection of one or more of C. jejuni, C. coli and C. lari using polynucleotide primers and/or probes that are based on the sequences of specific target nucleotide sequences, which are described above. Thus, in one of its simplest aspects, the detection system of the present invention comprises one or more polynucleotide probes capable of hybridising to a C. jejuni, C. coli or C. lari target nucleotide sequence. In one embodiment, the detection system comprises one or more probes selected from (i) a C. jejuni-speci&c probe capable of hybridising to the consensus sequence as set forth in SEQ ID NO: 12; (ii) a C. co/z-specific probe capable of hybridising to the consensus sequence as set forth in SEQ ID NO:31, and (iii) a C. /απ-specific probe capable of hybridising to one of the consensus sequences as set forth in SEQ ID NOs:50, 73 and 91. Exemplary, non-limiting probe sequences are described below.
In another aspect, the detection system present invention comprises one or more polynucleotide primers capable of amplifying a C. jejuni, C. coli or C. lari target nucleotide sequence. In one embodiment, the detection system comprises one or more primers selected from (i) a C. ye/wm-specific primer capable of amplifying a C. jejuni target nucleotide sequence comprising all or a portion of the consensus sequence as set forth in SEQ ID NO: 12; (ii) a C. cø/z-specific primer capable of amplifying a C. coli target nucleotide sequence comprising all or a portion of the consensus sequence as set forth in SEQ ID NO:31, and (iii) a C. /απ-specific primer capable of amplifying a C. lari target nucleotide sequence comprising all or a portion of one or more of the consensus sequences as set forth in SEQ ID NOs:50, 73 and 91. Exemplary, non- limiting primer sequences are described below.
In a third aspect, the detection system of the present invention comprises a combination of the polynucleotide primers and probes outlined above. Accordingly, the present invention provides for polynucleotides capable of amplifying and/or detecting a Campylobacter target nucleotide sequence in a sample that are suitable for inclusion in the above-described Campylobacter detection system. In one embodiment, the polynucleotides of the invention are capable of amplifying and/or detecting a species-specific target nucleotide sequence from one of C. jejuni, C. coli and C. lari. Thus, in an exemplary embodiment, the invention provides for polynucleotides that specifically amplify and/or detect a C. jejuni-specific target nucleotide sequence, polynucleotides that specifically amplify and/or detect a C. coli- specific target nucleotide sequence, and polynucleotides that specifically amplify and/or detect a C. /απ-specific target nucleotide sequence. Various combinations of these polynucleotides can be included in the detection system of the invention.
Suitable C. ye/wrø'-specific, C. co/z-specific and C. /απ-specific target nucleotide sequences for the design of species-specific primers and probes are described above. Accordingly, the polynucleotide primers and probes of the invention for amplification and/or detection of a C. ye/wm-specific target nucleotide sequence comprise a sequence that corresponds to or is complementary to a portion of the C. jejuni atpA gene shown in SEQ ID NO:1, are capable of specifically hybridizing to C. jejuni nucleic acids and are capable of amplifying and detecting a C. _/e/wra-specific target sequence comprising all or a portion of SEQ ID NO: 12. In one embodiment, the C. ye/wm-specific primers and probes comprise a sequence that corresponds to or is complementary to a portion of the C. jejuni gene shown in any one of SEQ ID Nos:2- 11. The polynucleotide primers and probes of the invention for amplification and/or detection of a C. co/ϊ-specific target nucleotide sequence comprise a sequence that corresponds to or is complementary to a portion of the C. coliyphC gene as shown in any one of SEQ ID NOs:21-30, are capable of specifically hybridizing to C. coli nucleic acids and are capable of amplifying and detecting a C. cø/z-specific target nucleotide sequence comprising all or a portion of SEQ ID NO:31. The polynucleotides and probes of the invention for the amplification and detection of a C. /απ-specific target nucleotide sequence comprise a sequence that corresponds to or is complementary to a portion of the C. lari glyA gene as shown in SEQ ID NO:39, are capable of specifically hybridizing to C. lari nucleic acids and are capable of amplifying and detecting a C. /απ-specific target nucleotide sequence comprising all or a portion of any one of SEQ ED NOs:50, 73 and 91. In one embodiment the C. /απ-specific primers and probes comprise a sequence that corresponds to or is complementary to a portion of the C. lari gene shown in any one of SEQ ID NOs:40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90.
The polynucleotides of the present invention are generally between about 7 and about 100 nucleotides in length. One skilled in the art will understand that the optimal length for a selected polynucleotide will vary depending on its intended application (i.e. primer, probe or combined primer/probe) and on whether any additional features, such as tags, self-complementary "stems" and labels (as described below), are to be incorporated. In one embodiment of the present invention, the polynucleotides are between about 10 and about 100 nucleotides in length. In another embodiment, the polynucleotides are between about 12 and about 100 nucleotides in length. In other embodiments, the polynucleotides are between about 12 and about 50 nucleotides and between 12 and 40 nucleotides in length.
One skilled in the art will also understand that the entire length of the polynucleotide primer or probe does not need to correspond to or be complementary to its target nucleotide sequence to specifically hybridize thereto. Thus, the polynucleotide primers and probes may comprise nucleotides at the 5 ' and/or 3 ' termini that are not complementary to the target sequence. Such non-complementary nucleotides may provide additional functionality to the primer/probe, for example, they may provide a restriction enzyme recognition sequence or a "tag" that facilitates detection, isolation or purification. Alternatively, the additional nucleotides may provide a self- complementary sequence that allows the primer/probe to adopt a hairpin configuration. Such configurations are necessary for certain probes, for example, molecular beacon and Scorpion probes.
The present invention also contemplates that one or more positions within the polynucleotide can be degenerate, i.e. can be filled by one of two or more alternate nucleotides. As is known in the art, certain positions in a gene can vary in the nucleotide that is present at that position depending on the strain of bacteria that the gene originated from. By way of example, position 115 of the alignment shown in Figure 1 can contain a guanine ("G") or an adenine ("A") nucleotide depending on the strain of C. jejuni the atpA gene originates from. Thus a "degenerate" primer or probe designed to correspond to this region of the gene can contain a "G" or an "A' at this position. Such a degenerate primer or probe is typically prepared by synthesising a "pool" of polynucleotide primers or probes that contains approximately equal amounts of a polynucleotide containing a G at the degenerate position and a polynucleotide containing an A at the degenerate position.
Typically, the polynucleotide primers and probes of the invention comprise a sequence of at least 7 consecutive nucleotides that correspond to or are complementary to a portion of the target nucleotide sequence. As is known in the art, the optimal length of the sequence corresponding or complementary to the target nucleotide sequence will be dependent on the specific application for the polynucleotide, for example, whether it is to be used as a primer or a probe and, if the latter, the type of probe. Optimal lengths can be readily determined by the skilled artisan.
In one embodiment, the polynucleotides comprise at least 10 consecutive nucleotides corresponding or complementary to a portion of the nucleotide sequence as shown in any one of SEQ ED NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90. In another embodiment, the polynucleotides comprise at least 12 consecutive nucleotides corresponding or complementary to a portion of the nucleotide sequence as shown in any one of SEQ ED NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90. In a further embodiment, the polynucleotides comprise at least 14 consecutive nucleotides corresponding or complementary to a portion of the nucleotide sequence as shown in any one of SEQ ED NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90. Polynucleotides comprising at least 16 and at least 18 consecutive nucleotides corresponding or complementary to a portion of the nucleotide sequence as shown in any one of SEQ ID NOs: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89 and 90 are also contemplated.
Sequences of exemplary polynucleotides of the invention are set forth in Table 1. Further non-limiting examples for the polynucleotides of the invention include polynucleotides that comprise at least 7 consecutive nucleotides of any one of SEQ ID NOs: 14, 15, 17, 19, 33, 34, 36, 38, 52, 53, 55, 57, 58, 60, 62, 75, 76, 78, 80, 93, 94, 96, 98, 99, 101, 103, 104 and 105.
Table 1 : Exemplary polynucleotides of the invention
Figure imgf000029_0001
Figure imgf000030_0001
1 R represents A or G
2 Y represents T or C
Primers
Primers contemplated by the present invention are capable of amplifying a Campylobacter target nucleotide sequence. As indicated above, target nucleotide sequences contemplated by the present invention are those identified within the C. jejuni atpA gene, C. coliyphC gene and C. lariglyA gene. Accordingly, the present invention provides for C. jejuni-specific primers that comprise a sequence that corresponds to or is complementary to a portion of the atpA gene sequence as shown in SEQ ID NO:1 and capable of amplifying a C. jejuni-specific target nucleotide sequence comprising all or a portion of the 103 nucleotide consensus sequence as shown in SEQ ID NO: 12. In one embodiment, the C. jejuni-specific primers comprise a sequence that corresponds to or is complementary to a portion of the C. jejuni gene shown in any one of SEQ ID NOs:2-l 1. hi another embodiment, the present invention provides for C. jejuni-specific primer pairs capable of amplifying a C. jejuni target nucleotide sequence, wherein the target sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of SEQ ID NO: 12, or the complement thereof. Thus, pairs of C. ye/wm-specific primers can be selected to comprise a first primer corresponding to a portion of the C. jejuni atpA gene sequence upstream of or within the region of the gene corresponding to SEQ ID NO: 12 and a second primer that it is complementary to a portion of the C. jejuni atpA gene sequence downstream of or within the region of the gene corresponding to SEQ ID NO: 12. Accordingly, C. ye/wm-specifϊc primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:1, or the complement thereof. In one embodiment, C. ye/wm'-specifϊc primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-l 1, or the complement thereof, hi another embodiment, C.jejuni- specific primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof. Non-limiting examples of suitable C. jejuni-specific primer sequences include SEQ ID NOs: 14 and 15 shown in Table 1, as well as primers comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs:14, 15, 17, 19, 104 and 105.
The present invention further provides for C. co/z-specific primers that comprise a sequence that corresponds to or is complementary to a portion of the yphC gene as set forth in any one of SEQ ID NOs:21-30 and capable of amplifying a target nucleotide sequence comprising all or a portion of the 116 nucleotide consensus sequence as shown in SEQ ID NO:31. In one embodiment, the present invention provides for C. co/z'-specific primer pairs capable of amplifying an C. coli target nucleotide sequence, wherein the target sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of SEQ ED NO:31, or the complement thereof. Thus, pairs of C. co/j-specific primers can therefore be selected to comprise a first primer corresponding to a portion of the C. coliyphC gene upstream of or within the region corresponding to SEQ ED NO:31 and a second primer that it is complementary to a portion of the C. coliyphC gene downstream of or within the region corresponding to SEQ ED NO:31. Accordingly, C. co/z-specific primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ NOs:21-30, or the complement thereof. In one embodiment, C. co/ϊ-specific primers are provided that comprise at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof. Non-limiting examples of suitable C. co/z-specific primer sequences include SEQ ID NOs: 33 and 34 shown in Table 1 , as well as primers comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs: 33, 34, 36 and 38.
The present invention also provides for C. /απ-specifϊc primers that comprise a sequence that corresponds to or is complementary to a portion of the glyA gene sequence as shown in SEQ ED NO:39 and are capable of amplifying a target nucleotide sequence comprising all or a portion of one or more of the glyA consensus sequences as set forth in SEQ ED NOs: 50, 73 and 91. In one embodiment, the C. /απ-specifϊc primers are capable of amplifying a target nucleotide sequence comprising all or a portion of the sequence as shown in SEQ ED NO:50. In another embodiment, the C. /απ-specifϊc primers are capable of amplifying a target nucleotide sequence comprising all or a portion of the sequence as shown in SEQ ED NO: 73. In a further embodiment, the C. /απ-specifϊc primers are capable of amplifying a target nucleotide sequence comprising all or a portion of the sequence as shown in SEQ ED NO:91.
Accordingly, in one embodiment, the present invention provides for C. /απ-specifϊc primer pairs capable of amplifying a C. /απ-specifϊc target nucleotide sequence, wherein the target sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of any one of SEQ ED NOs:50, 73 or 91, or the complement thereof. In another embodiment, the present invention provides for C. /απ-specifϊc primer pairs capable of amplifying a C. /απ-specifϊc target nucleotide sequence, wherein the target sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of both SEQ ED NOs:50 and 73, or the complementary sequences thereof. In a further embodiment, the present invention provides for C. /απ-specifϊc primer pairs capable of amplifying a C. /απ-specifϊc target nucleotide sequence, wherein the target sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of both SEQ ID NOs:50 and 91, or the complementary sequences thereof. In another embodiment, the present invention provides for C. /απ-specific primer pairs capable of amplifying a C. /απ-specific target nucleotide sequence, wherein the target sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of both SEQ ID NOs:73 and 91, or the complementary sequences thereof. In another embodiment, the present invention provides for C. /on-specific primer pairs capable of amplifying a C. /απ-specific target nucleotide sequence, wherein the target sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of SEQ ID NOs:50, 73 and 91, or the complementary sequences thereof.
Thus, pairs of C. /απ-specific primers can be selected that comprise a first primer corresponding to a portion of the C. lari glyA gene sequence upstream of or within the region of the gene corresponding to SEQ ID NO:50 and a second primer that it is complementary to a portion of the C. lari glyA gene sequence downstream of or within the region of the gene corresponding to SEQ ID NO:50. Similarly, pairs of C. /απ-specific primers can be selected that comprise a first primer corresponding to a portion of the C. lari glyA gene upstream of or within the region corresponding to SEQ ID NO:91 and a second primer that it is complementary to a portion of the C. lari glyA gene downstream of or within the region corresponding to SEQ ED NO:91. Pairs of C. /απ-specific primers can be selected that comprise a first primer corresponding to a portion of the C. lari glyA gene upstream of or within the region corresponding to SEQ ID NO: 73 and a second primer that it is complementary to a portion of the C. lari glyA gene downstream of or within the region corresponding to SEQ ID NO:73. In addition, pairs of C. /απ-specific primers can be selected that comprise a first primer corresponding to a portion of the C. lari glyA gene sequence upstream of or within the region of the gene corresponding to SEQ ED NO:73 and a second primer that it is complementary to a portion of the C. lari glyA gene sequence downstream of or within the region of the gene corresponding to SEQ ED NO:50; a first primer corresponding to a portion of the C. lari glyA gene sequence upstream of or within the region of the gene corresponding to SEQ ED NO:91 and a second primer that it is complementary to a portion of the C. lari glyA gene sequence downstream of or within the region of the gene corresponding to SEQ ED NO:73, and a first primer corresponding to a portion of the C. lari glyA gene sequence upstream of or within the region of the gene corresponding to SEQ ID NO:91 and a second primer that it is complementary to a portion of the C. lari glyA gene sequence downstream of or within the region of the gene corresponding to SEQ ID NO:50. Non-limiting examples of suitable C. /απ-specific primer sequences include SEQ ID NOs: 52, 53, 58, 75, 76, 93, 94 and 99 shown in Table 1, as well as primers comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs: 52, 53, 55, 57, 58, 60, 62, 75, 76, 78, 80, 93, 94, 96, 98, 99, 101 or 103.
Appropriate primer pairs can be readily determined by a worker skilled in the art. In general, primers are selected that specifically hybridize to the appropriate target nucleotide sequence, as described above. In addition, primers are selected that contain minimal sequence repeats and that demonstrate a low potential of forming dimers, cross dimers, or hairpin structures and of cross priming. Such properties can be determined by methods known in the art, for example, using the computer modelling program OLIGO® Primer Analysis Software (distributed by National Biosciences, Inc., Plymouth, MN).
Probes
The present invention provides for polynucleotide probes for the detection of a Campylobacter target nucleotide sequence in a sample. As indicated above, target nucleotide sequences contemplated by the present invention include those identified within the C. jejuni atpA gene, C. coliyphC gene and C. lari glyA gene.
The probe polynucleotides of the present invention are designed to specifically hybridise to one of the consensus sequences set forth in SEQ ED NOs:12, 31, 50, 73 and 91. Thus the present invention provides for C. jejuni-specific probes that correspond to or are complementary to a portion of the consensus sequence as shown in SEQ ID NO: 12. In one embodiment of the present invention, the C. ye/wm-specific probe polynucleotides comprise at least 7 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12, or the complement thereof. As indicated above, a highly conserved region was identified within the C. ye/wm-specific target sequence. In one embodiment, therefore, the present invention provides for C. jejuni-specific probe polynucleotides comprising at least 7 consecutive nucleotides of the sequence set forth in SEQ E) NO: 13, or the complement thereof. Non-limiting examples of suitable C. jejuni-specific probe sequences include SEQ ID NOs: 17 and 19 shown in Table 1, as well as probes comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs:14, 15, 17, 19, 104 and 105.
The present invention also provides for C. co/z-specific probes that correspond to or are complementary to a portion of the consensus sequence as shown in SEQ ED NO:31. In one embodiment of the present invention, the C. co/z-specifϊc probe polynucleotides comprise at least 7 consecutive nucleotides of the sequence set forth in SEQ ID NO:31, or the complement thereof. As indicated above, a highly conserved region was identified within the C. co/z-specific target sequence. In one embodiment, therefore, the present invention provides for C. co/z-specific probe polynucleotides comprising at least 7 consecutive nucleotides of the sequence set forth in SEQ ID NO:32, or the complement thereof. Non-limiting examples of suitable C. co/z-specific probe sequences include SEQ ID NOs: 36 and 38 shown in Table 1, as well as probes comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs: 33, 34, 36 and 38.
The present invention further provides for C. /απ-specific probes that correspond to or are complementary to a portion of one of the consensus sequences as shown in SEQ ID NO:50, 73 and 91. In one embodiment of the present invention, the C. /απ'-specific probe polynucleotides comprise at least 7 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof. In another embodiment, the C. /αrz-specific probe polynucleotides comprise a sequence of at least 7 consecutive nucleotides of the sequence set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof, wherein the sequence is other than: 5'- GGTTAGTAGCTCGGGTAAAATGTATGAAAGC-S'[SEQIDNO:107] and 5'-ATTCCCTTATGCTCATGTTGTAAGTTCTA-S' [SEQIDNO:108].
As indicated above, highly conserved regions were identified within the C. /on- specific target sequences. In one embodiment, therefore, the present invention provides for C. /απ-specific probe polynucleotides comprising at least 7 consecutive nucleotides of one of the sequences as set forth SEQ ID NO:51, 74 and 92, or the complement thereof. Non-limiting examples of suitable C, /απ-specific probe sequences include SEQ ID NOs:55, 57, 60, 62, 78, 80, 96, 98, 101 or 103 shown in Table 1 , as well as probes comprising at least 7 consecutive nucleotides of any one of SEQ ID NOs:52, 53, 55, 57, 58, 60, 62, 75, 76, 78, 80, 93, 94, 96, 98, 99, 101 or 103.
Various types of probes known in the art are contemplated by the present invention. For example, the probe may be a hybridization probe, the binding of which to a target nucleotide sequence can be detected using a general DNA binding dye such as ethidium bromide, SYBR® Green, SYBR® Gold and the like. Alternatively, the probe can incorporate one or more detectable labels. Detectable labels are molecules or moieties a property or characteristic of which can be detected directly or indirectly and are chosen such that the ability of the probe to hybridize with its target sequence is not affected. Methods of labelling nucleic acid sequences are well-known in the art (see, for example, Ausubel et ah, (1997 & updates) Current Protocols in Molecular Biology, Wiley & Sons, New York).
Labels suitable for use with the probes of the present invention include those that can be directly detected, such as radioisotopes, fluorophores, chemiluminophores, enzymes, colloidal particles, fluorescent microp articles, and the like. One skilled in the art will understand that directly detectable labels may require additional components, such as substrates, triggering reagents, light, and the like to enable detection of the label. The present invention also contemplates the use of labels that are detected indirectly. Indirectly detectable labels are typically specific binding members used in conjunction with a "conjugate" that is attached or coupled to a directly detectable label. Coupling chemistries for synthesising such conjugates are well-known in the art and are designed such that the specific binding property of the specific binding member and the detectable property of the label remain intact. As used herein, "specific binding member" and "conjugate" refer to the two members of a binding pair, i.e. two different molecules, where the specific binding member binds specifically to the probe, and the "conjugate" specifically binds to the specific binding member. Binding between the two members of the pair is typically chemical or physical in nature. Examples of such binding pairs include, but are not limited to, antigens and antibodies; avidin/streptavidin and biotin; haptens and antibodies ' specific for haptens; complementary nucleotide sequences; enzyme cofactors / substrates and enzymes; and the like.
In one embodiment of the present invention, the probe is labelled with a fluorophore. The probe may additionally incorporate a quencher for the fluorophore. Fluorescently labelled probes can be particularly useful for the real-time detection of target nucleotide sequences in a test sample. Examples of probes that are labelled with both a fluorophore and a quencher that are contemplated by the present invention include, but are not limited to, molecular beacon probes and TaqMan® probes. Such probes are well known in the art (see for example, U.S. Patent Nos. 6,150,097; 5,925,517 and 6,103,476; Marras et al, "Genotyping single nucleotide polymorphisms with molecular beacons." In Kwok, P.Y. (ed.), "Single nucleotide polymorphisms: methods and protocols," Vol. 212, pp. 111-128, Humana Press, Totowa, NJ.)
A molecular beacon probe is a hairpin shaped oligonucleotide sequence, which undergoes a conformational change when it hybridizes to a complementary target sequence. The secondary structure of a typical molecular beacon probe includes a loop sequence, which is capable of hybridizing to a target sequence and a pair of arm (or "stem") sequences. One arm is attached to a fluorophore, while the other arm is attached to a quencher. The arm sequences are complementary to each other so as to enable the arms to hybridize together to form a molecular duplex and the beacon adopts a hairpin conformation in which the fluorophore and quencher are in close proximity and interact such that emission of fluorescence is prevented. The sequence of molecular beacon probes is selected such that the stability of the probe-target helix is greater than the secondary structure of unbound probe. Hybridization between the loop sequence and the target sequence forces the molecular beacon probe to undergo a conformational change in which arm sequences are forced apart and the fluorophore is physically separated from the quencher. As a result, the fluorescence of the fluorophore is restored. The fluorescence generated can be monitored and related to the presence of the target nucleotide sequence. If no target sequence is present in the sample, no fluorescence will be observed. This methodology, as described further below, can also be used to quantify the amount of target nucleotide in a sample. By way of example, Figures 3 and 6 depict the secondary structure of exemplary hairpin loop molecular beacons having sequences corresponding to SEQ ID NO: 16 and 35, respectively. A worker skilled in the art would appreciate that the loop portion of the molecular beacon may itself contain complementary sequences capable of forming short double stranded regions (for example, see Figure 6). Such small stems within the probe's loop portion that are 2- to 4-nucleotides long do not adversely affect the performance of molecular beacons as these secondary structures typically disappear at increased temperatures, for example at temperatures of about 55 0C.
Wavelength-shifting molecular beacon probes which incorporate two fluorophores, a "harvester fluorophore and an "emitter" fluorophore (see, Kramer, et al, (2000) Nature Biotechnology, 18 : 1191 - 1196) are also contemplated. When a wavelength- shifting molecular beacon binds to its target sequence and the hairpin opens, the energy absorbed by the harvester fluorophore is transferred by fluorescence resonance energy transfer (FRET) to the emitter, which then fluoresces. Wavelength-shifting molecular beacons are particularly suited to multiplex assays.
TaqMan® probes are dual-labelled fluorogenic nucleic acid probes that function on the same principles as molecular beacons. TaqMan® probes are composed of a polynucleotide that is complementary to a target sequence and is labelled at the 5' terminus with a fluorophore and at the 3' terminus with a quencher. TaqMan® probes, like molecular beacons, are typically used as real-time probes in amplification reactions, hi the free probe, the close proximity of the fluorophore and the quencher ensures that the fluorophore is internally quenched. During the extension phase of the amplification reaction, the probe is cleaved by the 5' nuclease activity of the polymerase and the fluorophore is released. The released fluorophore can then fluoresce and produce a detectable signal.
Linear probes comprising a fluorophore and a high efficiency dark quencher, such as the Black Hole Quenchers (BHQ™; Biosearch Technologies, Inc., Novato, CA) are also contemplated. As is known in the art, the high quenching efficiency and lack of native fluorescence of the BHQ™ dyes allows "random-coil" quenching to occur in linear probes labelled at one terminus with a fluorophore and at the other with a BHQ™ dye thus ensuring that the fluorophore does not fluoresce when the probe is in solution. Upon binding its target sequence, the probe stretches out spatially separating the fluorophore and quencher and allowing the fluorophore to fluoresce. One skilled in the art will appreciate that the BHQ™ dyes can also be used as the quencher moiety in molecular beacon or TaqMan® probes.
As an alternative to including a fluorophore and a quencher in a single molecule, two fluorescently labelled probes that anneal to adjacent regions of the target sequence can be used. One of these probes, a donor probe, is labelled at the 3' end with a donor fluorophore, such as fluorescein, and the other probe, the acceptor probe, is labelled at the 5 ' end with an acceptor fluorophore, such as LC Red 640 or LC Red 705. When the donor fluorophore is stimulated by the excitation source, energy is transferred to the acceptor fluorophore by FRET resulting in the emission of a fluorescent signal.
In addition to providing primers and probes as separate molecules, the present invention also contemplates polynucleotides that are capable of functioning as both primer and probe in an amplification reaction. Such combined primer/probe polynucleotides are known in the art and include, but are not limited to, Scorpion probes, duplex Scorpion probes, Lux™ primers and Amplifluor™ primers.
Scorpion probes consist of, from the 5 ' to 3 ' end, (i) a fluorophore, (ii) a specific probe sequence that is complementary to a portion of the target sequence and is held in a hairpin configuration by complementary stem loop sequences, (iii) a quencher, (iv) a PCR blocker (such as, hexethylene glycol) and (v) a primer sequence. After extension of the primer sequence in an amplification reaction, the probe folds back on itself so that the specific probe sequence can bind to its complement within the same DNA strand. This opens up the hairpin and the fluorophore can fluoresce. Duplex Scorpion probes are a modification of Scorpion probes in which the fluorophore- coupled probe/primer containing the PCR blocker and the quencher-coupled sequence are provided as separate complementary polynucleotides. When the two polynucleotides are hybridized as a duplex molecule, the fluorophore is quenched. Upon dissociation of the duplex when the primer/probe binds the target sequence, the fluorophore and quencher become spatially separated and the fluorophore fluoresces. The Amplifluor Universal Detection System also employs fluorophore/quencher combinations and is commercially available from Chemicon International (Temecula, CA).
In contrast, Lux™ primers incorporate only a fluorophore and adopt a hairpin structure in solution that allows them to self-quench. Opening of the hairpin upon binding to a target sequence allows the fluorophore to fluoresce.
Suitable fluorophores and/or quenchers for use with the polynucleotides of the present invention are known in the art (see for example, Tyagi et al, Nature Biotechnol., 16:49-53 (1998); Marras et al, Genet. Anal: Biomolec. Eng., 14:151-156 (1999)). Many fluorophores and quenchers are available commercially, for example from Molecular Probes (Eugene, OR) or Biosearch Technologies, Inc. (Novato, CA). Examples of fluorophores that can be used in the present invention include, but are not limited to, fluorescein and fluorescein derivatives, such as 6-carboxyfluoroscein (FAM), 5 '-tetrachlorofluorescein phosphoroamidite (TET), tetrachloro-6- carboxyfluoroscein, VIC and JOE, 5-(2'-aminoethyl) aminonaphthalene-1-sulphonic acid (EDANS), coumarin and coumarin derivatives, Lucifer yellow, Texas red, tetramethylrhodamine, 5-carboxyrhodamine, cyanine dyes (such as Cy5) and the like. Pairs of fluorophores suitable for use as FRET pairs include, but are not limited to, fluorescein/rhodamine, fluorescein/Cy5, fluorescein/Cy5.5, fluorescein/LC Red 640, fluorescein/LC Red 750, and phycoerythrin/Cy7. Quenchers include, but are not limited to, 4'-(4-dimethylaminophenylazo)benzoic acid (DABCYL), 4- dimethylaminophenylazophenyl-4 -maleimide (DABMI), tetramethylrhodamine, carboxytetramethylrhodamine (TAMRA), BHQ™ dyes and the like.
Methods of selecting appropriate sequences for and preparing the various primers and probes are known in the art. For example, the polynucleotides can be prepared using conventional solid-phase synthesis using commercially available equipment, such as that available from Applied Biosystems USA Inc. (Foster City, California), DuPont, (Wilmington, Del.), or Milligen (Bedford, Mass.). Methods of coupling fluorophores and quenchers to nucleic acids are also in the art. In one embodiment of the present invention, the probe polynucleotide is a molecular beacon. In general, in order to form a hairpin structure effectively, molecular beacons are at least 17 nucleotides in length. In accordance with this aspect of the invention, therefore, the molecular beacon probe is typically between about 17 and about 40 nucleotides in length. Within the probe, the loop sequence that corresponds to or is complementary to the target sequence typically is about 7 to about 32 nucleotides in length, while the stem (or arm) sequences are each between about 4 and about 9 nucleotides in length. As indicated above, part of the stem sequences of a molecular beacon may also be complementary to the target sequence. In one embodiment of the present invention, the loop sequence of the molecular beacon is between about 10 and about 32 nucleotides in length. In another embodiment, the loop sequence of the molecular beacon is between about 15 and about 30 nucleotides in length. In another embodiment, the loop sequence of the molecular beacon is between about 18 and about 30 nucleotides in length. In a further embodiment, the loop sequence of the molecular beacon is between about 20 and about 30 nucleotides in length. In a still further embodiment, the loop sequence is between about 22 and about 30 nucleotides in length.
In accordance with the present invention, the loop region of the molecular beacon probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:12, 31, 50, 73 and 91, or the complement thereof. In a specific embodiment, the loop region of the molecular beacon probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs: 17, 19, 36, 38, 55, 57, 60, 62, 78, 80, 96, 98, 101, 103, 104 and 105, or the complement thereof. In further embodiments, the loop region of the molecular beacon probe comprises at least 10, at least 12, at least 15, at least 18, at least 20 and at least 22 consecutive nucleotides of the sequence as set forth in any one of SEQ ED NOs: 17, 19, 36, 38, 55, 57, 60, 62, 78, 80, 96, 98, 101, 103, 104 and 105, or the complement thereof.
Amplification and/or Detection The Campylobacter detection system of the present invention can be used to detect Campylobacter target nucleotide sequence in a sample by contacting a sample known to contain or suspected of containing one or more target nucleotide sequences with one or more of the polynucleotide probes described above under conditions that permit hybridisation of the probe(s) to the target nucleotide sequence(s). The hybridised probes can then be detected by conventional methods. Alternatively, the detection system can comprise primers and probes to allow for the amplification of the target nucleotide sequence(s) to be detected prior to detection. Amplification of the target nucleotide sequence(s) prior to detection allows for the screening of test samples containing only small amounts of these sequences.
Accordingly, in one embodiment of the present invention detection of Campylobacter in a test sample with the Campylobacter detection system involves subjecting the sample to one or more amplification reactions in order to obtain one or more amplification products, or amplicons, comprising a Campylobacter target sequence and detection of the amplicon(s).
As used herein, an "amplification reaction" refers to a process that increases the number of copies of a particular nucleic acid sequence by enzymatic means. Amplification procedures are well-known in the art and include, but are not limited to, polymerase chain reaction (PCR), TMA, rolling circle amplification, nucleic acid sequence based amplification (NASBA), strand displacement amplification (SDA) and Q-beta replicase amplification. One skilled in the art will understand that for use in certain amplification techniques the primers described above may need to be modified, for example, SDA primers comprise additional nucleotides near the 5' end that constitute a recognition site for a restriction endonuclease. Similarly, NASBA primers comprise additional nucleotides near the 51 end that are not complementary to the target sequence but which constitute an RNA polymerase promoter. Polynucleotides thus modified are considered to be within the scope of the present invention.
In one embodiment of the present invention, the target sequence is amplified by PCR. PCR is a method known in the art for amplifying a nucleotide sequence using a heat stable polymerase and a pair of primers, one primer (the forward primer) complementary to the (+)-strand at one end of the sequence to be amplified and the other primer (the reverse primer) complementary to the (-)- strand at the other end of the sequence to be amplified. Newly synthesized DNA strands can subsequently serve as templates for the same primer sequences and successive rounds of strand denaturation, primer annealing, and strand elongation, produce rapid and highly specific amplification of the target sequence. PCR can thus be used to detect the existence of a defined sequence in a DNA sample. The term "PCR" as used herein refers to the various forms of PCR known in the art including, but not limited to, quantitative PCR, reverse-transcriptase PCR, real-time PCR, hot start PCR, long PCR, LAPCR, multiplex PCR, touchdown PCR, and the like. "Real-time PCR" refers to a PCR reaction in which the amplification of a target sequence is monitored in real time by, for example, the detection of fluorescence emitted by the binding of a labelled probe to the amplified target sequence.
In one embodiment, the present invention thus provides for a method of amplifying multiple Campylobacter target nucleotide sequences in a test sample, wherein the target nucleotide sequences are selected from a C. jejuni atpA target sequence, a C. coliyphC target sequence and a C. lari glyA target sequence as described above. In accordance with this embodiment, amplification of C. jejuni target nucleotide sequences, wherein the target nucleotide sequence is a portion of a C. jejuni atpA gene of less than about 500 nucleotides in length and comprising at least 65 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12 can be accomplished using pairs of C. y'e/wm-specific primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO:1, or the complement thereof. Amplification of C. coli target nucleotide sequences, wherein the target nucleotide sequence is a portion of a C. coliyphC gene of less than about 500 nucleotides in length and comprising at least 65 consecutive nucleotides of the sequence set forth in SEQ ID NO:31 can be accomplished using pairs of C. coli- specific primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof. Amplification of C. lari target nucleotide sequences, wherein the target nucleotide sequence is a portion of C. lari glyA gene of less than about 450 nucleotides in length and comprising at least 65 consecutive nucleotides of one or more of the sequences set forth in SEQ IQ NOs:50, 73 and 91 can be accomplished using pairs of polynucleotide primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO: 39, or the complement thereof.
As will be readily appreciated by a worker skilled in the art, the above-described method of the present invention can be employed, if desired, to amplify a single Campylobacter target nucleotide sequence, to amplify two or more Campylobacter target nucleotide sequences, or to amplify three or more Campylobacter target nucleotide sequences. The target nucleotide sequences can be from the same or different species of Campylobacter. When amplifying more than one target nucleotide sequence, the amplification reaction can be conducted sequentially or concurrently. When conducted concurrently, the amplification reaction can be performed in a single reaction vessel or each amplification reaction can be performed in a separate reaction vessel.
One embodiment of the present invention provides for a method of concurrently amplifying two or more Campylobacter target nucleotide sequences selected from the group of a C. ye/wm-specific target nucleotide sequence comprising SEQ ID NO: 13 or the complement thereof, a C. co/ϊ-specifϊc target nucleotide sequence comprising SEQ ID NO:32 or the complement thereof, and a C. /on-specific target nucleotide sequence comprising one or more of SEQ ID NOs:51, 74 and 92 or the complement thereof, the method comprising two or more of the following steps: i) amplifying the C. ye/wm-specific target nucleotide sequence using a pair of C. jejuni-specific primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO:1, or the complement thereof; ii) amplifying the C. coli- specific target nucleotide sequence using a pair of C. co/z'-specifϊc primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof, and iii) amplifying the C. /απ'-specific target nucleotide sequence using a pair of C. lari- specific primers, each member of the primer pair comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO:39, or the complement thereof. The product of the amplification reaction can be detected by a number of means known to individuals skilled in the art. Examples of such detection means include, for example, gel electrophoresis and/or the use of polynucleotide probes.- In one embodiment of the invention, the amplification products are detected through the use of polynucleotide probes. Such polynucleotide probes are described in detail above.
In one embodiment, therefore, detection of Campylobacter with the Campylobacter detection system of the present invention involves amplification and detection of one or more target nucleotide sequences selected from a C, jejuni target sequence, a C. coli target sequence and a C. lari target sequence, using species-specific primers and probes as described above. Thus, amplification and detection of C. jejuni target nucleotide sequences, wherein the target nucleotide sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of the sequence set forth in SEQ ID NO: 12, is accomplished using a combination of C. jejuni-specific polynucleotides, the combination comprising one or more C. jejuni- specific primers comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO: 1, or the complement thereof, and a C. jejuni-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof. Amplification and detection of C. coli target nucleotide 'sequences, wherein the target nucleotide sequence is less than about 500 nucleotides in length and comprises at least 65 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, is accomplished using a combination of C. co/z'-specific polynucleotides, the combination comprising one or more C. co/7-specific primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof, and a C. cø/ϊ-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof. Amplification and detection of C. lari target nucleotide sequences, wherein the target nucleotide sequence is less than about 450 nucleotides in length and comprises at least 65 consecutive nucleotides of the sequence as set forth in one or more of SEQ ID NOs:50, 73 and 91 is accomplished using a combination of C. /απ-specific polynucleotides, the combination comprising one or more C. /απ-specific primers comprising at least 7 nucleotides of the sequence as set forth in SEQ FD NO:39 or the complement thereof, and a C. /απ-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NO:50, 73 and 91, or the complement thereof.
In an alternative embodiment, the invention provides for a method of concurrently amplifying and detecting two or more target nucleotide sequences selected from the group of a C. ye/«m-specific target nucleotide sequence of less than about 500 nucleotides in length comprising at least 65 consecutive nucleotides of SEQ ID NO: 12 or the complement thereof, a C. cø/ϊ-specific target nucleotide sequence of less than about 500 nucleotides in length comprising at least 65 consecutive nucleotides of SEQ ID NO:31 or the complement thereof, and a C. /απ-specific target nucleotide sequence of less than 450 nucleotides in length comprising at least 65 consecutive nucleotides of one or more of SEQ ID NOs:50, 73 and 91, or the complement thereof, said method comprising two or more of the following steps: i) amplifying and detecting the C. _/e/wm-specifϊc target nucleotide sequence using a combination of C. jejuni-specific polynucleotides comprising one or more C. ye/wm-specific primers comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO:1, or the complement thereof, and a C. jejuni-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof; ii) amplifying and detecting the C. co/z-specific target nucleotide sequence using a combination of C. co/ϊ-specifϊc polynucleotides comprising one or more C. coli- specific primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof, and a C. co/ϊ-specifϊc probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof, and iii) amplifying and detecting the C. lari- specific target nucleotide sequence using a combination of C. /απ'-specific polynucleotides comprising one or more C. /απ-specific primers comprising at least 7 nucleotides of the sequence as set forth in SEQ ID NO:39, or the complement thereof, and a C. /απ-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NO:50, 73 and 91, or the complement thereof.
Another embodiment provides for a method of concurrently amplifying and detecting two or more target nucleotide sequences selected from a C. ye/wm'-specific target nucleotide sequence comprising SEQ ID NO: 13, a C. co/ϊ-specific target nucleotide sequence comprising SEQ ID NO:32 and a C. /απ-specific target nucleotide sequence comprising one or more of SEQ ID NOs:51, 74 and 92, said method comprising two or more of the following steps: i) amplifying and detecting the C.ye/wra-specific target nucleotide sequence using a combination of C. ye/wm-specific polynucleotides comprising one or more C. jejuni-speciftc primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-l 1, or the complement thereof, and a C. jejuni-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 13, or the complement thereof; ii) amplifying and detecting the C. co/ϊ-specific target nucleotide sequence using a combination of C. co/z-specific polynucleotides comprising one or more C. co/ϊ-specific primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:21-30, or the complement thereof, and a C. co/ϊ-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:32, or the complement thereof, and iii) amplifying and detecting the C. /απ-specific target nucleotide sequence using a combination of C. /απ-specifϊc polynucleotides comprising one or more C. /απ-specific primers comprising at least 7 nucleotides of the sequence as set forth in any one of SEQ ID NOs:40, 41, 42, 43, 44, 45, 46, 47, 48, 48, 49, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 81, 82, 83, 84, 85, 86, 87, 88, 89, and 90, or the complement thereof, and a C. /απ-specific probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:51, 74 and 92, or the complement thereof.
When concurrently amplifying and detecting more than one target nucleic acid sequence, a worker skilled in the art would readily appreciate that different labels may be used for each of the probes if desired in order to determine which target nucleotide sequence(s) are present in a sample.
It will be readily appreciated that a procedure that allows both amplification and detection of target nucleotide sequences from more than one Campylobacter species to take place concurrently in a single unopened reaction vessel would be advantageous. Such a procedure would avoid the risk of "carry-over" contamination in the post-amplification processing steps, and would also facilitate high-throughput screening or assays and the adaptation of the procedure to automation. Furthermore, this type of procedure allows "real time" monitoring of the amplification reaction, as discussed above, as well as more conventional "end-point" monitoring. In one embodiment, the detection is accomplished in real time in order to facilitate rapid detection. Li a specific embodiment, detection is accomplished in real time through the use of molecular beacon probes.
The present invention thus provides for methods to specifically amplify and detect one or more target nucleotide sequences from one or more of C. jejuni, C. coli and C. lari in a test sample in a single tube format using the polynucleotide primers, and optionally one or more probes, described herein. Such methods may employ dyes, such as SYBR® Green or S YBR® Gold that bind to the amplified target sequence, or an antibody that specifically detects the amplified target sequence. The dye or antibody is included in the reaction vessel and detects the amplified sequences as it is formed. Alternatively, a labelled polynucleotide probe (such as a molecular beacon or TaqMan® probe) distinct from the primer sequences, which is complementary to a region of the amplified sequence, may be included in the reaction, or one of the primers may act as a combined primer/probe, such as a Scorpion probe. Such options are discussed in detail above.
Thus, a general method of detecting one or more of C. jejuni, C. coli and C. lari in a sample using the Campylobacter detection system of the present invention is provided that comprises contacting a test sample with one or more combinations of species- specific polynucleotides, each combination comprising at least one polynucleotide primer and at least one polynucleotide probe or primer/probe, as described above, under conditions that permit amplification and detection of the target sequence(s), and detecting any amplified target sequence(s) as an indication of the presence of the one or more Campylobacter species in the sample. A worker skilled in the art would readily appreciate that when more than one probe is employed, each of the probes can be labelled with a different label in order to determine which target nucleotide sequence(s) are present in the test sample if desired. A "test sample" as used herein is a biological sample suspected of containing, or known to contain, one or more of C. jejuni, C. coli and C. lari. In one embodiment of the present invention, therefore, a method is provided to specifically amplify and detect one or more Campylobacter target nucleotide sequences in a test sample using the Campylobacter detection system, the method generally comprising the steps of:
(a) forming a reaction mixture comprising a test sample, amplification reagents, and one or more polynucleotide combinations, each combination comprising a labelled probe capable of specifically hybridising to a Campylobacter target nucleotide sequence, and one or more primers pairs capable of amplifying the target nucleotide sequence; ,
(b) subjecting the mixture to amplification conditions to generate at least one copy of the target nucleotide sequence(s), or a nucleic acid sequence complementary thereto, thereby producing amplified target nucleotide sequences;
(c) hybridizing the probe(s) to the target nucleotide sequences, so as to form one or more probe:target hybrids; and
(d) detecting the probe:target hybrids as an indication of the presence of the one or more Campylobacter target nucleotide sequences in the test sample.
In a specific embodiment of the present invention, the method specifically amplifies and detects one or more target nucleotide sequences selected from the group of a C. jejuni atpA target nucleotide sequence, a C. coli yphC target nucleotide sequence and a C. lari glyA target nucleotide sequence and generally comprises the steps of:
(a) forming a reaction mixture comprising a test sample, amplification reagents, and one or more polynucleotide combinations comprising a labelled probe and one or more primer selected from (i) a labelled probe capable of specifically hybridising to a portion of a C. jejuni atpA target nucleotide sequence and one or more primers capable of amplifying the C. jejuni atpA target nucleotide sequence; (ii) a labelled probe capable of specifically hybridising to a portion of a C. coliyphC target nucleotide sequence and one or more primers capable of amplifying the C. coliyphC target nucleotide sequence, and (iii) a labelled probe capable of specifically hybridising to a portion of a C. lari glyA target nucleotide sequence and one or more primers capable of amplifying the C. lari glyA target nucleotide sequence;
(b) subjecting the mixture to amplification conditions to generate at least one copy of the target nucleotide sequence(s), or a nucleic acid sequence complementary thereto, thereby producing amplified target nucleotide sequences;
(c) hybridizing the probe(s) to their target nucleotide sequence, so as to form one or more probe:target hybrids; and
(d) detecting the probe:target hybrids as an indication of the presence of one or more of a C. jejuni atpA target nucleotide sequence, a C. coliyph C target nucleotide sequence and a C. lari glyA target nucleotide sequence in the test sample.
The term "amplification reagents" includes conventional reagents employed in amplification reactions and includes, but is not limited to, one or more enzymes having nucleic acid polymerase activity, enzyme cofactors (such as magnesium or nicotinamide adenine dinucleotide (NAD)), salts, buffers, nucleotides such as deoxynucleotide triphosphates (dNTPs; for example, deoxyadenosine triphosphate, deoxyguanosine triphosphate, deoxycytidine triphosphate and deoxythymidine triphosphate) and other reagents that modulate the activity of the polymerase enzyme or the specificity of the primers.
It will be readily understood by one skilled in the art that step (b) of the above method can be repeated several times prior to step (c) by thermal cycling the reaction mixture by techniques known in the art and that steps (b), (c) and (d) may take place concurrently such that the detection of the amplified sequence takes place in real time. In addition, variations of the above method can be made depending on the intended application of the method, for example, the polynucleotide probe may be a combined primer/probe, or it may be a separate polynucleotide probe, in which case two different polynucleotide primers are used. Additional steps may be incorporated before, between or after those listed above as necessary, for example, the test sample may undergo enrichment, extraction and/or purification steps to isolate nucleic acids therefrom prior to the amplification reaction, and/or the amplified product may be submitted to purification/isolation steps or further amplification prior to detection, and/or the results from the detection step (d) may be analysed in order to quantify the amount of target present in the sample or to compare the results with those from other samples. These and other variations will be apparent to one skilled in the art and are considered to be within the scope of the present invention.
In one embodiment of the present invention, the method is a real-time PCR assay. In a further embodiment, the real-time PCR assay employs one or more different species-specific primer pairs and molecular beacon probes for the detection of one or more different species of Campylobacter. In a further embodiment, the real-time PCR assay employs at least two species-specific primer pairs and molecular beacons selected from the group of a C. ye/wm-specific primer pair and molecular beacon, a C. co/z-specific primer pair and molecular beacon and a C. /απ-specific primer pair and molecular beacon for the simultaneous detection of at least two of C. jejuni, C. coli and C. lari. In a still further embodiment, the real-time PCR assay employs a C. ye/wm-specifϊc primer pair and molecular beacon, a C. co/ϊ-specific primer pair and molecular beacon and a C. /απ-specific primer pair and molecular beacon for the simultaneous detection of C. jejuni, C. coli and C. lari.
Diagnostic Assays to Detect Campylobacter Species
The present invention provides for diagnostic assays using the polynucleotide primers and/or probes that can be used for highly specific and sensitive detection of multiple Campylobacter species in a test sample. The diagnostic assays comprise amplification and detection of one or more Campylobacter target nucleotide sequences as described above. Thus, in one embodiment, the present invention provides for diagnostic assays that can be used to detect one or more of C. jejuni, C. coli and C. lari. The diagnostic assays can be qualitative or quantitative and can involve real time monitoring of the amplification reaction or conventional end-point monitoring.
In one embodiment, the invention provides for diagnostic assays that do not require post-amplification manipulations and minimise the amount of time required to conduct the assay. For example, in a specific embodiment, there is provided a diagnostic assay, utilising the primers and probes described herein, that can be completed using real time PCR technology in, at most, 54 hours and generally less than 24 hours.
Diagnostic assays that allow the simultaneous detection of more than one Campylobacter species can provide time and cost benefits over methods that require separate assays to be conducted for each test species. In one embodiment, the
) diagnostic assays of the present invention utilise species-specific primers and probes that amplify and detect their respective target nucleotide sequences under similar conditions, thus providing for assays that can be performed in a single reaction vessel for simultaneous detection of two or more of C. jejuni, C. coli and C. lari. The single reaction vessel can be, for example, a microtitre plate or similar container, wherein each combination of species-specific primers plus probe can be provided in separate wells, or two or more such combinations can be provided in a single well. In one embodiment of the present invention, a diagnostic assay for the detection of C. jejuni, C. coli and optionally C. lari is provided in a single reaction vessel, wherein C. jejuni species-specific primers plus probe and C. coli species-specific primers plus probe are provided in a single well and optionally C. lari species-specific primers plus probe are provided in a separate well. In another embodiment, a diagnostic assay for the detection of C. jejuni, C. coli and C. lari is provided in a single reaction vessel, wherein C. jejuni species-specific primers plus probe, C. coli species-specific primers plus probe and C. lari species-specific primers plus probe are all provided in a single well.
Such diagnostic assays are particularly useful in the detection of Campylobacter contamination of various foodstuffs. Thus, in one embodiment, the present invention provides a diagnostic assay for the detection of contamination of a food sample by one or more of C. jejuni, C. coli and C. lari. In another embodiment, the diagnostic assays provide for rapid and sensitive detection of contamination of a food sample by one or more of C. jejuni, C. coli and C. lari. Foods that can be analysed using the diagnostic assays include, but are not limited to, dairy products such as milk, including raw milk, cheese, yoghurt, ice cream and cream; raw, cooked and cured meats and meat products, such as beef, pork, lamb, mutton, poultry (including turkey, chicken), game (including rabbit, grouse, pheasant, duck), minced and ground meat (including ground beef, ground turkey, ground chicken, ground pork); eggs; fruits and vegetables; nuts and nut products, such as nut butters; seafood products including fish and shellfish; and fruit or vegetable juices.
While the primary focus of detection of Campylobacter is food products, the present invention also contemplates the use of the primers and probes in diagnostic assays for the detection of contamination by one or more species of C. jejuni, C. coli and C. lari in other biological samples, such as patient specimens in a clinical setting, for example, faeces, blood, saliva, throat swabs, urine, mucous, and the like. The diagnostic assays are also useful in the assessment of microbiologically pure cultures and water quality and in environmental and pharmaceutical quality control processes.
The test sample can be used in the assay either directly (i.e. as obtained from the source) or following one or more pre-treatment steps to modify the character of the sample. Thus, the test sample can be pre-treated prior to use, for example, by disrupting cells or tissue, enhancing/enriching the microbial content of the sample by culturing in a suitable medium, preparing liquids from solid materials, diluting viscous fluids, filtering liquids, distilling liquids, concentrating liquids, inactivating interfering components, adding reagents, purifying nucleic acids, and the like. In one embodiment of the present invention, the test sample is subjected to one or more steps to isolate, or partially isolate, nucleic acids therefrom. In another embodiment of the invention, the test sample is subjected to an enrichment procedure to enhance the microbial content of the sample prior to use in the assay.
As indicated above, the polynucleotide primers and probes of the invention can be used in assays to quantitate the amount of Campylobacter target nucleotide sequence(s) in a test sample. Thus, the present invention provides for a method to specifically amplify, detect and quantitate one or more Campylobacter target nucleotide sequences in a test sample using the Campylobacter detection system, the method generally comprising the steps of:
(a) forming a reaction mixture comprising a test sample, amplification reagents, and one or more polynucleotide combinations, each combination comprising a labelled probe capable of specifically hybridising to a Campylobacter target nucleotide sequence, and one or more primers pairs capable of amplifying the target nucleotide sequence;
(b) subjecting the mixture to amplification conditions to generate at least one copy of the target nucleotide sequence(s), or a nucleic acid sequence complementary thereto, thereby producing amplified target nucleotide sequences;
(c) hybridizing the probe(s) to the target nucleotide sequences, so as to form one or more probe:target hybrids;
(d) detecting the probe:target hybrids as an indication of the presence of the one or more Campylobacter target nucleotide sequences in the test sample; and
(e) analysing the amount of signal produced as an indication of the amount of target nucleotide sequences present in the test sample.
The steps of this method may also be varied and may employ combinations of primers and probes for different target sequences as described above for the amplification/detection method.
In" a specific embodiment of the present invention, the method specifically amplifies and detects one or more target nucleotide sequences selected from the group of a C. jejuni atpA target nucleotide sequence, a C. coli yphC target nucleotide sequence and a C. lari glyA target nucleotide sequence and generally comprises the steps of:
(a) forming a reaction mixture comprising a test sample, amplification reagents, and one or more polynucleotide combinations comprising a labelled probe and one or more primer selected from (i) a labelled probe capable of specifically hybridising to a portion of a C. jejuni atpA target nucleotide sequence and one or more primers capable of amplifying the C. jejuni atpA target nucleotide sequence; (ii) a labelled probe capable of specifically hybridising to a portion of a C. coliyphC target nucleotide sequence and one or more primers capable of amplifying the C. coliyphC target nucleotide sequence, and (iii) a labelled probe capable of specifically hybridising to a portion of a C. lari glyA target nucleotide sequence and one or more primers capable of amplifying the C. lari glyA target nucleotide sequence;
(b) subjecting the mixture to amplification conditions to generate at least one copy of the target nucleotide sequence(s), or a nucleic acid sequence complementary thereto, thereby producing amplified target nucleotide sequences;
(c) hybridizing the probe(s) to the target nucleotide sequences, so as to form one or more probe:target hybrids;
(d) detecting the probe:target hybrids as an indication of the presence of one or more of a C. jejuni atpA target nucleotide sequence, a C. coliyph C target nucleotide sequence and a C. lari glyA target nucleotide sequence in the test sample, and
(e) analysing the amount of signal produced as an indication of the amount of target nucleotide sequence(s) present in the test sample.
Step (e) in the above methods can be conducted, for example, by comparing the amount of signal produced to a standard or utilising one of a number of statistical methods known in the art that do not require a standard.
Various types of standards for quantitative assays are known in the art. For example, the standard can consist of a standard curve compiled by amplification and detection of known quantities of a Campylobacter target nucleotide sequence under the assay conditions. Alternatively, relative quantitation can be performed without the need for a standard curve (see, for example, Pfaffl, MW. (2001) Nucleic Acids Research 29(9):2002-2007). In this method, a reference gene is selected against which the expression of the target gene can be compared. The reference gene is usually a gene that is expressed constitutively, for example, a house- keeping gene. An additional pair of primers and an appropriate probe are included in the reaction in order to amplify and detect a portion of the selected reference gene. If desired, a different reference gene can be selected for each Campylobacter species tested. Another similar method of quantification is based on the inclusion of an internal standard in the reaction. Such internal standards generally comprise a control target nucleotide sequence and a control polynucleotide probe. The internal standard can further include an additional pair of primers that specifically amplify the control target nucleotide sequence and are unrelated to the polynucleotides of the present invention.
Alternatively, the control target sequence can contain primer target sequences that allow specific binding of the assay primers but a different probe target sequence. This allows both the Campylobacter target sequence(s) and the control sequence to be amplified with the same primers, but the amplicons are detected with separate probe polynucleotides. Typically, when a reference gene or an internal standard is employed, the reference/control probe incorporates a detectable label that is distinct from the label incorporated into the Campylobacter target sequence specific probe(s). The signals generated by these labels when they bind their respective target sequences can thus be distinguished.
In the context of the present invention, a control target nucleotide sequence is a nucleic acid sequence that (i) can be amplified either by a pair of Campylobacter target sequence specific primers or by control primers, (ii) specifically hybridizes to the control probe under the assay conditions and (iii) does not exhibit significant hybridization to the Campylobacter target sequence specific probe(s) under the same conditions. One skilled in the art will recognise that the actual nucleic acid sequences of the control target nucleotide and the control probe are not important provided that they both meet the criteria outlined above.
The diagnostic assays can be readily adapted for high-throughput. High-throughput assays provide the advantage of processing many samples simultaneously and significantly decrease the time required to screen a large number of samples. The present invention, therefore, contemplates the use of the polynucleotide primers and probes in high-throughput screening or assays to detect and/or quantitate one or more Campylobacter target nucleotide sequences in a plurality of test samples.
For high-throughput assays, reaction components are usually housed in a multi- container carrier or platform, such as a multi-well microtitre plate, which allows a plurality of assays each containing a different test sample to be monitored simultaneously. Control samples can also be included in the plates to provide internal controls for each plate. Many automated systems are now available commercially for high-throughput assays, as are automation capabilities for procedures such as sample and reagent pipetting, liquid dispensing, timed incubations, formatting samples into microarrays, microplate thermocycling and microplate readings in an appropriate detector, resulting in much faster throughput times.
Kits and Packages for the Detection ø/Campylobacter Species
The present invention further provides for kits comprising the Campylobacter detection system for detecting one or more of C. jejuni, C. coli and C. lari in a variety of samples, hi general, the kits comprise one or more pairs of primers capable of amplifying a Campylobacter target sequence and one or more probes capable of detecting the Campylobacter target sequence as described above. If desired, a primer and probe may be provided in the form of a single polynucleotide, such as a Scorpion probe, as described above. The probe(s) provided in the kit can incorporate a detectable label, such as a fluorophore or a fluorophore and a quencher, or the kit may include reagents for labelling the probe. The primers and probes can be provided in separate containers or in an array format, for example, pre-dispensed into microtitre plates.
One embodiment of the present invention provides for kits comprising Campylobacter species-specific primers and probes. Combinations of different species-specific primers and probes can be included such that the kits provides for amplification and detection of more than one Campylobacter species. Thus, in another embodiment, the present invention provides for kits comprising a combination of different species- specific primers and probes that are capable of amplifying and detecting one or more target nucleotide sequences selected from: a target nucleotide sequence derived from the atpA gene of C. jejuni, a target nucleotide sequence derived from the yphC gene of C. coli and a target nucleotide sequence derived from the glyA gene of C. lari.
In a specific embodiment, the kit comprises i) a pair of C jejuni-specific primers capable of amplifying a C. jejuni atpA target sequence comprising SEQ ID NO: 13, ii) a C. jejuni-specific probe capable of hybridising to a target sequence comprising SEQ ID NO: 13, or the complement thereof, iii) a pair of C. co/ϊ-specific primers capable of amplifying a C. coli yph C target sequence comprising SEQ ID NO:32, iv) a C. coli- specifϊc probe capable of hybridising to a target sequence comprising SEQ ID NO:32, or the complement thereof, v) a pair of C. /απ-specific primers and a C. lari-specifϊc probe selected from: (a) a pair of primers capable of amplifying a C. lari target sequence comprising SEQ ED NO:51 and a C. /αrj-specific probe capable of hybridising to the target sequence comprising SEQ ID NO:51, or the complement thereof, (b) a pair of primers capable of amplifying a C. lari target sequence comprising SEQ ID NO:74, or the complement thereof, and a C. /απ-specific probe capable of hybridising to the target sequence comprising SEQ ED NO:74 and (c) a pair of primers capable of amplifying a C. lari target sequence comprising SEQ ID NO:92 and a C. /αr/-specific probe capable of hybridising to the target sequence comprising SEQ ED NO:92, or the complement thereof.
The kits can optionally include amplification reagents, such as buffers, salts, enzymes, enzyme co-factors, nucleotides and the like. Other components, such as buffers and solutions for the enrichment, isolation and/or lysis of bacteria in a test sample, extraction of nucleic acids, purification of nucleic acids and the like may also be included in the kit. One or more of the components of the kit may be lyophilised and the kit may further comprise reagents suitable for the reconstitution of the lyophilised components.
The various components of the kit are provided in suitable containers. As indicated above, one or more of the containers may be a microtitre plate. Where appropriate, the kit may also optionally contain reaction vessels, mixing vessels and other components that facilitate the preparation of reagents or nucleic acids from the test sample.
The kit may additionally include one or more controls. For example, control polynucleotides (primers, probes, target sequences, or a combination thereof) may be provided that allow for quality control of the amplification reaction and/or sample preparation, or that allow for the quantitation of one or more Campylobacter target nucleotide sequences.
The kit can additionally contain instructions for use, which may be provided in paper form or in computer-readable form, such as a disc, CD, DVD or the like. The present invention further contemplates that the kits described above may be provided as part of a package that includes computer software to analyse data generated from the use of the kit.
The invention will now be described with reference to specific examples. It will be understood that the following examples are intended to describe specific embodiments of the invention and are not intended to limit the invention in any way.
EXAMPLES
Example 1: Determination of a Unique, Conserved DNA Region in the C. jejuni atpA Gene Sequences
The atpA gene coding regions from 10 different C. jejuni isolates were sequenced and aligned using the multiple alignment program Clustal W™. The resulting alignment was used to identify short DNA regions that were conserved within the C. jejuni group, yet which are excluded from other bacteria. Figure 1 depicts a sample of such an alignment in which a portion of the atpA gene of 10 different C. jejuni strains have been aligned.
A 103 nucleotide conserved sequence (consensus sequence) was identified as described above (SEQ ID NO: 12).
5'-CAAGGAGTTATCTGTATATATGTTGCAATTGGTCAAAAGCAAAGTACAG TR+GCACAAGTGGTTAAAAGACTAGAAGAACATGGTGCTATGGAATATAC TATTG-31
*R represents A or G
This unique and conserved element oϊ C. jejuni atpA-gene sequences was used to design highly specific primers for the PCR amplification of the conserved region of the atpA gene.
Example 2: Generation of PCR Primers for Amplification of the atpA Consensus Sequence Within the conserved 103 nucleotide sequence identified as described in Example 1, regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. The primer sequences are shown below:
Forward primer #1: 5'- C AAGGAGTT ATCTGT AT AT ATGTTGC -3 ' [SEQ ID
NO: 14]
Reverse primer #1: 5'- CAAT AGT AT ATTCCAT AGCACCATG -3' [SEQ ID NO: 15]
In the alignment presented in Figure 1, the positions of forward primer #1 and the reverse primer #1 are represented by shaded boxes. Forward primer #1 starts at position 65 and ends at position 90 of the alignment. Reverse primer #1 represents the reverse complement of the region starting at position 143 and ending at position 167.
Example 3: Generation of Molecular Beacon Probes Specific for the C. jejuni atpA Consensus Sequence
In order to design molecular beacon probes specific for C. jejuni, a region within the consensus sequence described above was identified which not only was highly conserved in all C. jejuni isolates but was also exclusive to C. jejuni isolates. This sequence consisted of a 25 nucleotide region that would be suitable for use as a molecular beacon target sequence. The sequence is provided below:
5'- ACAGTR*GCACAAGTGGTTAAAAGAC -3' [SEQ ID NO: 13] *R represents A or G
The complement of this sequence [SEQ ID NO: 106] is also suitable for use as a molecular beacon target sequence:
5'-GTCTTTTAACCACTTGTGCY* ACTGT-3' [SEQ ID NO:106] *Y represents T or C
■ A molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc. Molecular beacon probe #1 :
5'- cgcgctACAGTGGCACAAGTGGTTAAAAGACagcgcg -3' [SEQ ID NO: 16]
The complement of this sequence (SEQ ID NO: 18, shown below) can also be used as a molecular beacon probe for detecting C. jejuni.
5 '- cgcgctGTCTTTT AACCACTTGTGCCACTGTagcgcg -3 ' [SEQ ID NO: 18]
Other suitable probes include probes having the following loop sequences:
S'-ACAGTAGCACAAGTGGTTAAAAGAC-S' [SEQ ID NO: 104]
5'-GTCTTTTAACCACTTGTGCTACTGT-S ' [SEQ ID NO: 105]
The starting material for the synthesis of the molecular beacons was an oligonucleotide that contains a sulfhydryl group at its 5' end and a primary amino group at its 3' end. DABCYL was coupled to the primary amino group utilizing an amine-reactive derivative of DABCYL. The oligonucleotides that were coupled to DABCYL were then purified. The protective trityl moiety was then removed from the 5'-sulfhydryl group and a fluorophore was introduced in its place using an iodoacetamide derivative.
An individual skilled in the art would recognize that a variety of methodologies could be used for synthesis of the molecular beacons. For example, a controlled-pore glass column that introduces a DABCYL moiety at the 3' end of an oligonucleotide has recently become available, which enables the synthesis of a molecular beacon completely on a DNA synthesizer.
Table 2 provides a general overview of the characteristics of molecular beacon probe #1. The beacon sequence shown in Table 2 indicates the stem region in lower case and the loop region in upper case.
Table 2. Description of molecular beacon probe #1 Beacon sequence (5'-> 3'): cgcgctACAGTGGCACAAGTGGTT AAAAGACagcgcg
Fluorophore (5') : FAM
Quencher (3') : DABCYL
Table 3 provides an overview of the thermodynamics of the folding of molecular beacon probe #1. Calculations were made using MFOLD™ software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site. Figure 2 shows the arrangement of PCR primers and the molecular beacon probe in the atpA consensus sequence. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward primer #1 and reverse primer #1.
Table 3. Thermodynamics of molecular beacon probe #1.
Figure imgf000062_0001
Example 4: Isolation of DNA from Test Samples
The following protocol was utilized in order to isolate DNA from test samples.
Material needed for DNA extraction:
-Tungsten carbide beads: Qiagen -Reagent DX: Qiagen -DNeasy Plant Mini Kit: Qiagen ' -Tissue Disruption equipment: Mixer Mill™ 300 (Qiagen)
The following method was followed: I) Add to a 2 ml screw top tube: 1 tungsten carbide bead and 0.1 g glass beads 212 to 300 μm in width + sample to be analysed + 500 μL of API buffer + 1 μL of Reagent DX + 1 μL of RNase A (100 mg/mL). Extraction control done without adding sample to be analysed. 2) heat in Dry-Bath at 80°C for 10 min.
3) mix in a Mixer Mill 300 (MM300) at frequency of 30 Hz [1/s], 2 min.
4) rotate tubes and let stand for 10 min at room temperature.
5) mix in a Mixer Mill 300, frequency 30 Hz, 2 min.
6) place tubes in boiling water for 5 min. 7) centrifuge with a quick spin.
8) add 150 μL of AP2 buffer.
9) mix at frequency of 30 Hz for 30 sec. Rotate tubes and repeat.
10) centrifuge at 13,000 rpm for 1 min.
I 1 ) place tubes at -2O0C for 10 min. 12) centrifuge at 13,000 rpm for 1 min.
13) transfer supernatant in to a 2 mL screw top tube containing 850 μL of AP3/E buffer.
14) mix by inverting, centrifuge with a quick spin.
15) add 700 μL of mixture from step 13 to a DNeasy binding column and centrifuge at 800 rpm for 1 minute. Discard eluted buffer. Repeat process with leftover mixture from step 13.
16) add 500 μL of wash buffer (AW buffer) to binding columns and centrifuge for 1 minute at 800 rpm. Discard eluted buffer.
17) add 500 μL of wash buffer (AW buffer) to binding columns and centrifuge for 1 minute at 800 rpm. Discard eluted buffer.
18) centrifuge column again at 8000 rpm for 1 min. 19) place column in a sterile 2 mL tube and add 50 μL of AE elution buffer preheated at 8O0C.
20) incubate for 1 min. Centrifuge at max speed for 2 min. Elute twice with 50 μL; final volume should be 100 μL. 21) keep elution for PCR amplification.
Time of manipulation: 3 hours. Proceed to prepare PCR reaction for real-time detection.
Example 5: Amplification of atpA Consensus Sequence in Real Time with SybrGreen
The effectiveness of forward primer #1 and reverse primer #1 for amplification of C. jejuni isolates was demonstrated as described generally below.
Genomic DNA from C. jejuni and the species and strains presented in Table 6 below was isolated as described in Example 4. PCR amplification was undertaken using the conditions described in Tables 4 and 5 below. Amplicons were detected with SYBR® Green. The intensity of fluorescence emitted by the SYBR Green dye was detected at the elongation stage of each amplification cycle. In Table 4, note that the Qiagen SyBrGreen buffer contains dNTPs and Taq polymerase and 0.125 mM magnesium chloride (final concentration). Inclusion of additional magnesium chloride brings the final concentration to 1.5 mM in the reaction mixture.
Table 4. SyBR Green Reaction mix
Figure imgf000064_0001
Figure imgf000065_0001
Table 5 presents an overview of the cycles used for each step of the PCR amplification.
Table 5. PCR Program v
Figure imgf000065_0002
Fluorescence was detected in real-time using a fluorescence monitoring real-time PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used.
All 24 strains of C. jejuni tested were amplified with forward primer #1 and reverse primer #1.
With the 257 non-C. jejuni strains tested (see Table 6), no amplification products were observed {i.e. specificity of 100%). In Table 6, the figures in parentheses indicate the number of strains of each species that were tested (if more than one). None of the tested strains provided a positive result.
Table 6. Strains used for Negative Validation
Genus Serovars Genus Serovars
Acinetobacter calcoaceticus (2) Lactobacillus helveticus
Acinetobacter iwoffi Lactobacillus pentosus
Acinetobacter junii .actobacillus plantarum (2) Genus Serovars Genus Serovars
Aeromonas hydrophila (2) Lactobacillus rhamnosus (2)
Aeromonas salmonicida (2) Lactococcus lactis (2)
Alcaligenes faecalis Lactococcus raffinolactis
Bacillus amyloliquefaciens (2) Legionella pneumophila (2)
Bacillus cereus (2) Listeria grayi
Bacillus circulans (2) .isteria innocua (2)
Bacillus coagulans (2) Listeria ivanovii (2)
Bacillus firmus Listeria monocytogenes (2)
Bacillus lentus Listeria seeligeri
Bacillus licheniformis (2) Listeria welshimeri (2)
Bacillus megaterium (2) Micrococcus luteus (2)
Bacillus mycoides Mycobacterium smegmatis
Bacillus pumilus (2) Neisseria gonorrhoeae
Bacillus sphaericus Neisseria lactam ica
Bacillus stearothermophilus Neisseria meningitidis (2)
Bacillus subtilis (2) Neisseria sica
Bacillus thuringiensis (2) Nocardia asteroides
Bacteroides fragilis Pediococcus acidilactici (2)
Bifidobacterium adolescentis Pediococcus pentosaceus
Bifidobacterium animalis Proteus mirabilis (2)
Bifidobacterium bifidum Proteus penneri (2)
Bifidobacterium longum Proteus vulgaris (2)
Bifidobacterium pseudolongum Pseudomonas aeruginosa (2)
Bifidobacterium sp. (2) Pseudomonas sp.
Bifidobacterium suis Pseudomonas mendocina
Bifidobacterium thermophilus Pseudomonas pseudoalcaligenes Genus Serovars Genus Serovars
Bordetella bronchiseptica Pseudomonas putida (2)
Bordetella pertussis Pseudomonas stutzeri
Borrelia burgdorferi Salmonella agona
Branhamella catarrhal is Salmonella arizonae (2)
Brevibacillus laterosporus Salmonella bongori
Campylobacter coli (3) Salmonella brandenburg
Campylobacter fetus (4) Salmonella choleraesuis (2)
Campylobacter lari (2) Salmonella diarizonae
Campylobacter rectus Salmonella dublin (2)
Cellilomonea sp. Salmonella enteritidis (2)
Chromobacterium violaceum Salmonella heidelberg (2)
Chryseobacterium sp. Salmonella houtenae
Chryseomonas luteola Salmonella indica
Citrobacter amalonaticus (2) Salmonella infantis (2)
Citrobacter diversus Salmonella montevideo (2)
Citrobacter freundii (2) Salmonella newport (2)
Citrobacter koseri (2) Salmonella paratyphi (4)
Citrobacter werkmanii Salmonella saintpaul (2)
Clostridium botulinum (2) Salmonella senftenberg
Clostridium butyricum Salmonella Stanley
Clostridium difficile Salmonella thompson (2)
Clostridium perfringens (2) Salmonella typhi (2)
Clostridium sporogenes Salmonella typhimurium (2)
Clostridium tetani Salmonella typhisuis (2)
Clostridium tyrobutyricum Serratia liquefaciens (2)
Corynebacterium xerosis Serratia marcescens (2) Genus Serovars Genus Serovars
Edwardsiella tarda Serratia odorifera
Enterobacter aerogenes (2) Shigella boydii
Enterobacter amnigenus Shigella dysenteriae (2)
Enterobacter cloacae (2) Shigella flexneri (2)
Enterobacter intermedius (2) Shigella sonnei (2)
Enterobacter taylorae Staphylococcus aureus (2)
Enterococcus faecalis (2) Staphylococcus chromogenes
Enterococcus faecium Staphylococcus epidermidis (2)
Enterococcus hirae (2) Staphylococcus intermedius
Erwinia herbicola Staphylococcus lentis
Escherichia blattae (2) Staphylococcus ludgdunensis
Escherichia coli (4) Staphylococcus schieiferi
Escherichia fergusonii Staphylococcus xylosus
Escherichia hermannii (2) Stenotrophomonas maltophilia
Escherichia vulneris (2) Streptococcus agalactiae (2)
Haemophilus equigenitalis Streptococcus bovis
Haemophilus influenzae (2) Streptococcus pneumoniae (2)
Haemophilus paragallinarum Streptococcus pyogenes (2)
Hafnia alvei (2) Streptococcus suis
Helicobacter pylori Streptococcus thermophilus
Klebsiella ornithinolytica Vibrio alginolyticus
Klebsiella oxytoca (2) Vibrio cholerae (2)
Klebsiella planticola (2) Vibrio eltor
Klebsiella pneumoniae (2) Vibrio fluvialis
Klebsiella terrigena Vibrio hollisae
Kocuria kristinae Vibrio vulnificus Genus Serovars Genus Serovars
Kurthia zopfii (2) Xanthomonas campestris
Lactobacillus acidophilus Yersinia enterocolitica (2)
Lactobacillus casei (2) Yersinia frederiksenii
Lactobacillus delbreuckii (2) Yersinia kritensenii
Example 6: Amplification of atpA Consensus Sequence and Hybridization of Molecular Beacon Probe #1 in Real Time
PCR amplification was undertaken using the PCR Mix shown in Table 7 (below) and the PCR program shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle. In Table 7, note that the PCR buffer contains 2.25 mM magnesium chloride (final concentration). Inclusion of additional magnesium chloride brings the final concentration to 4 mM in the reaction mixture.
Table 7. PCR Mix
Figure imgf000069_0001
Fluorescence was detected in real-time using a fluorescence monitoring real-time PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used. Example 7: Positive Validation of atpA Primers and Molecular Beacon Probe #1
The effectiveness oiatpA forward primer #1, reverse primer #1 and molecular beacon probe #1 for amplifying and detecting C. jejuni isolates was demonstrated as described generally below.
Genomic DNA from 24 C. jejuni strains was isolated and amplified as described in the preceding Examples (4 and 6). Results indicate that molecular beacon probe was capable of detecting all 24 strains of C jejuni tested {i.e. sensitivity of 100%).
Example 8: Negative Validation of the atpA Primers and Molecular Beacon #1
In order to test the ability of the atpA primers and molecular beacon probe to preferentially amplify and detect only C. jejuni, a number of bacteria from species other than C. jejuni were tested as generally described below.
Samples of genomic DNA from the bacteria presented in Table 8 below were isolated and amplified using atpA forward primer #1 and reverse primer #1 as described in the preceding Examples (4 and 6).
No amplification product was observed with the 289 non C. jejuni strains tested.
The above results suggest that both the amplification primers and the molecular beacon #1 are specific for C. jejuni.
Table 8. Negative Validation of the atpA molecular beacon probe #1, forward primer #1 and reverse primer #1.
Genus Serovars Genus Serovars
Acinetobacter calcoaceticus (2) Lactobacillus acidophilus
Acinetobacter iwoffi Lactobacillus casei (2)
Acinetobacter junii Lactobacillus delbreuckii (2)
Aeromonas hydrophila (2) Lactobacillus helveticus
Aeromonas salmonicida (2) Lactobacillus pentosus Genus Serovars Genus Serovars
Alcaligenes faecalis Lactobacillus plantarum (2)
Bacillus amyloliquefaciens (2) .actobacillus rhamnosus (2)
Bacillus cereus (2) Lactococcus lactis (2)
Bacillus circulans (2) Lactococcus raffinolactis
Bacillus coagulans (2) Listeria grayi
Bacillus firmus Listeria innocua (2)
Bacillus lentus .isteria ivanovii (2)
Bacillus licheniformis (2) Listeria monocytogenes (2)
Bacillus megaterium (2) .isteria seeligeri
Bacillus mycoides Listeria welshimeri (2)
Bacillus pumilus (2) Micrococcus luteus (2)
Bacillus sphaericus Mycobacterium smegmatis
Bacillus stearothermophilus Neisseria gonorrhoeae
Bacillus subtilis (2) Neisseria lactamica
Bacillus thuringiensis (2) Neisseria meningitidis (2)
Bacteroides fragilis Neisseria sica
Bifidobacterium adolescentis Nocardia asteroides
Bifidobacterium animalis Pediococcus acidilactici (2)
Bifidobacterium bifidum Pediococcus pentosaceus
Bifidobacterium longum Proteus mirabilis (2)
Bifidobacterium pseudolongum Proteus penneri (2)
Bifidobacterium sp. (2) Proteus vulgaris (2)
Bifidobacterium suis Pseudomonas aeruginosa (2)
Bifidobacterium thermophilus Pseudomonas sp.
Bordetella bronchiseptica Pseudomonas mendocina
Bordetella pertussis Pseudomonas pseudoalcaligenes Genus Serovars Genus Serovars
Borrelia burgdorferi Pseudomonas putida (2)
Branhamella catarrhal is Pseudomonas stutzeri
Brevibacillus laterosporus Salmonella agona
Campylobacter coli (2) Salmonella arizonae (2)
Campylobacter lari (4) Salmonella bongori
Campylobacter fetus (6) Salmonella brandenburg
Campylobacter hyointestinalis (4) Salmonella choleraesuis (2)
Campylobacter mucosalis (2) Salmonella diarizonae
Campylobacter rectus Salmonella dublin (2)
Campylobacter spotorum (2) Salmonella enteritidis (2)
Campylobacter upsaliensis (4) Salmonella heidelberg (2)
Cellilomonea sp. Salmonella houtenae
Chromobacterium violaceum Salmonella indica
Chryseobacterium sp. Salmonella infantis (2)
Chryseomonas luteola Salmonella montevideo (2)
Citrobacter amalonaticus (2) Salmonella newport (2)
Citrobacter diversus Salmonella paratyphi (4)
Citrobacter freundii (2) Salmonella saintpaul (2)
Citrobacter koseri (2) Salmonella senftenberg
Citrobacter werkmanii Salmonella Stanley
Clostridium botulinum (2) Salmonella thompson (2)
Clostridium butyricum Salmonella typhi (2)
Clostridium difficile Salmonella typhimurium (2)
Clostridium perfringens (2) Salmonella typhisuis (2)
Clostridium sporogenes Serratia liquefaciens (2)
Clostridium tetani Serratia marcescens (2) Genus Serovars Genus Serovars
Clostridium tyrobutyricum Serratia odorifera
Corynebacterium xerosis Shigella boydii
Edwardsiella tarda Shigella dysenteriae (2)
Enterobacter aerogenes (2) Shigella flexneri (2)
Enterobacter amnigenus Shigella sonnei (2)
Enterobacter cloacae (2) Staphylococcus aureus (2)
Enterobacter intermedius (2) Staphylococcus chromogenes
Enterobacter taylorae Staphylococcus epidermidis (2)
Enterococcus faecalis (2) Staphylococcus intermedius
Enterococcus faecium Staphylococcus lentis
Enterococcus hirae (2) Staphylococcus ludgdunensis
Erwinia herbicola Staphylococcus schieiferi
Escherichia blattae (2) Staphylococcus xylosus
Escherichia coli (4) Stenotrophomonas maltophilia
Escherichia fergusonii Streptococcus agalactiae (2)
Escherichia hermannii (2) Streptococcus bovis
Escherichia vulneris (2) Streptococcus pneumoniae (2)
Haemophilus , equigenitalis Streptococcus pyogenes (2)
Haemophilus influenzae (2) Streptococcus suis
Haemophilus paragallinarum Streptococcus thermophilus
Hafnia alvei (2) Vibrio alginolyticus
Helicobacter cinaedi (4) Vibrio cholerae (2)
Helicobacter pylori Vibrio eltor
Klebsiella ornithinolytica Vibrio fluvialis
Klebsiella oxytoca (2) Vibrio hollisae
Klebsiella planticola (2) Vibrio vulnificus Genus Serovars Genus Serovars
Klebsiella pneumoniae (2) Xanthomonas campestris
Klebsiella terrigena Yersinia enterocolitica (2)
Kocuria kristinae Yersinia frederiksenii
Kurthia zopfii (2) Yersinia kritensenii
Example 9: Determination of a Unique, Conserved DNA Region in the C. coli VP hC Gene
The yphC gene in C. coli is believed to code for a guanine triphosphate binding protein of unknown function. A similar gene has been identified in the closely related species C. jejuni (Suerbaum, S et al. (2001) Journal of Bacteriology 183:2553-2559). Based on this sequence, the yphC gene from ten C. coli isolates was identified and sequenced. The yphC gene coding regions thus identified were aligned using the multiple alignment program Clustal W™. The resulting alignment was used to identify short DNA regions that were conserved within the C. coli group, yet which are excluded from other bacteria. Figure 4 depicts a sample of such an alignment in which a portion of the yphC gene of 10 different C. coli strains have been aligned.
A 116 nucleotide conserved sequence (SEQ ID NO:31) was identified from the multiple sequence alignment.
5'-GCAGGTATTAGAAAGCGAGGTAAAATTCAAGGGCTTGAGCGTTTTGCA TTAAACCGCACAGAAAAGATTTTATCTAATTCTCAAATCGCACTTTTGGTT TTAGATGCCAATGAAGG-S'
This unique and conserved element of the C. coliyphC gene sequences (consensus sequence) was used to design highly specific primers for the PCR amplification of this conserved region.
Example 10: Generation of PCR Primers for Amplification of the yphC Consensus Sequence Within the conserved 116 nucleotide sequence identified as described in Example 9, regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. The primer sequences are shown below:
Forward primer #2: 5'- GCAGGTATT AGAAAGCGAGGTA -3 ' [SEQ ID NO:33]
Reverse primer #2: 5'- CCTTCATTGGCATCT AAAACCAA -3' [SEQ ID NO:34]
In the alignment presented in Figure 4, the positions of forward primer #2 and reverse primer #2 are represented by shaded boxes. Forward primer #2 starts at position 70 and ends at position 91 of the alignment. Reverse primer #2 represents the reverse complement of the region starting at position 163 and ending at position 185.
Example 11: Generation of Molecular Beacon Probes Specific for the C. coli VphC Consensus Sequence
In order to design molecular beacon probes specific for C. coli, a region within the yphC consensus sequence described above was identified which not only was highly conserved in all C. coli isolates, but was also exclusive to C. coli isolates. This sequence consisted of a 23 nucleotide region that would be suitable for use as a molecular beacon target sequence. The sequence is provided below:
5'- GGCTTGAGCGTTTTGCATTAAAC -3' [SEQ ID NO:32]
The complement of this sequence [SEQ ID NO:38] is also suitable for use as a molecular beacon target sequence:
5,_GTTTAATGCAAAACGCTCAAGCC_3, -SEQ JJ3 NQ138]
A molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc.
yphC molecular beacon probe #2:
5 '- cgcagGGCTTGAGCGTTTTGCATTAAACctgcg -3 ' [SEQ ID NO:35] The complement of this sequence (SEQ ID NO:37, shown below) can also be used as a molecular beacon probe for the detecting C. coli.
5'- cgcagGTTTAATGCAAAACGCTCAAGCCctgcg -3' [SEQ ID NO:37]
The molecular beacons were synthesized as described in Example 3.
Table 9 provides a general overview of the characteristics of molecular beacon probe #2. The beacon sequence shown in Table 9 indicates the stem region in lower case and the loop region in upper case.
Table 9. Description of yphC molecular beacon probe #2
Beacon sequence (5»-> 3') : cgcagGGCTTGAGCGTTTTGCATTAAACctgcg
Fluorophore (5') : FAM
Quencher (3') : DABCYL
Table 10 provides an overview of the thermodynamics of the folding of molecular beacon probe #2. Calculations were made using MFOLD™ software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site. Figure 5 shows the arrangement of PCR primers and the molecular beacon-probe in the yphC consensus sequence. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward and reverse primers.
Table 10. Thermodynamics of molecular beacon probe #2.
Figure imgf000076_0001
Example 12: Amplification of yphC Consensus Sequence in Real Time with SybrGreen
The effectiveness of forward primer #2 and reverse primer #2 for amplification of C. coli isolates was demonstrated as described generally below.
Genomic DNA from the species and strains presented in Table 11 below was isolated as described in Example 4. PCR amplification was undertaken using the conditions described in Tables 4 and 5 in Example 5.
Fluorescence was detected in real-time using a fluorescence monitoring real-time PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used.
All 17 strains of C. coli tested were amplified with forward primer #2 and reverse primer #2.
With the 290 non-C coli strains tested (see Table 11), amplicons from two C. jejuni strains having a melting peak close to C. coli amplicon were observed (i.e. specificity of 99.32%). In Table 11 , the figures in parentheses indicate the number of strains of each species that were tested (if more than one). None of the tested strains provided a positive result apart from the two C. jejuni strains indicated above.
Table 11. Strains used for Negative Validation of forward primer #2 and reverse primer #2
Genus Serovars Genus Serovars
Acinetobacter calcoaceticus (2) Lactobacillus casei (2)
Acinetobacter iwoffi Lactobacillus delbreuckii (2)
Aeromonas hydrophila (2) Lactobacillus helveticus
Aeromonas salmonicida (2) Lactobacillus pentosus
Alcaligenes faecalis Lactobacillus plantarum (2)
Bacillus amyloliquefaciens (2) Lactobacillus rhamnosus (2) Genus Serovars Genus Serovars
Bacillus cereus (2) .actococcus raffinolactis
Bacillus circulans (2) Lactococcus lactis (2)
Bacillus coagulans (2) Listeria grayi
Bacillus firmus Listeria innocua (2)
Bacillus lentus Listeria ivanovii (2)
Bacillus licheniformis (2) Listeria monocytogenes (2)
Bacillus megaterium (2) Listeria seeligeri
Bacillus mycoides Listeria welshimeri (2)
Bacillus pumilus (2) Micrococcus luteus
Bacillus sphaericus Moraxella sp.
Bacillus stearothermophilus Mycobacterium smegmatis
Bacillus subtilis (2) Neisseria gonorrhoeae
Bacillus thuringiensis (2) Neisseria lactamica
Bacteroides fragilis Neisseria meningitidis (2)
Bifidobacterium adolescentis Neisseria sica
Bifidobacterium animalis Nocardia asteroides
Bifidobacterium bifidum Pediococcus acidilactici (2)
Bifidobacterium longum Pediococcus pentosaceus
Bifidobacterium pseudolongum Proteus mirabilis (2)
Bifidobacterium sp. (2) Proteus penneri (2)
Bifidobacterium suis Proteus vulgaris (2)
Bifidobacterium thermophilus Pseudomonas aeruginosa (2)
Bordetella bronchiseptica Pseudomonas mendocina
Bordetella pertussis Pseudomonas pseudoalcaligenes
Borrelia burgdorferi Pseudomonas putida (2)
Branhamella catarrhal is Pseudomonas stutzeri Genus Serovars Genus Serovars
Brevibacillus laterosporus Salmonella agona
Burkholderia cepacia (2) Salmonella arizonae (2)
Campylobacter jejuni (22) Salmonella bongori
Campylobacter fetus (5) Salmonella brandenburg
Campylobacter hyointestinalis (4) Salmonella choleraesuis (2)
Campylobacter mucosalis (2) Salmonella diarizonae
Campylobacter lari (4) Salmonella dublin (2)
Campylobacter rectus Salmonella enteritidis (2)
Campylobacter spotorum (2) Salmonella heidelberg (2)
Campylobacter upsaliensis (4) Salmonella houtenae
Cellilomonea sp. Salmonella lndica
Chromobacterium violaceum Salmonella infantis (2)
Chryseobacterium sp. Salmonella montevideo (2)
Chryseomonas luteola Salmonella newport (2)
Citrobacter amalonaticus (2) Salmonella paratyphi (4)
Citrobacter diversus Salmonella saintpaul (2)
Citrobacter freundii (2) Salmonella senftenberg
Citrobacter koseri (2) Salmonella Stanley
Citrobacter werkmanii Salmonella thompson (2)
Clostridium botulinum (2) Salmonella typhi (2)
Clostridium butyricum Salmonella typhimurium (2)
Clostridium difficile Salmonella typhisuis (2)
Clostridium perfringens (2) Serratia liquefaciens (2)
Clostridium sporogenes Serratia marcescens (2)
Clostridium tyrobutyricum Serratia odorifera
Corynebacterium xerosis Shigella boydii Genus Serovars Genus Serovars
Edwardsiella tarda Shigella dysenteriae (2)
Enterobacter aerogenes (2) Shigella flexneri (2)
Enterobacter amnigenus Shigella sonnei (2)
Enterobacter cloacae (2) Staphylococcus aureus (2)
Enterobacter intermedius (2) Staphylococcus chromogenes
Enterobacter taylorae Staphylococcus epidermidis (2)
Enterococcus faecalis (2) Staphylococcus intermedius
Enterococcus faecium Staphylococcus lentis
Enterococcus hirae (2) Staphylococcus ludgdunensis
Erwinia herbicola Staphylococcus schieiferi
Escherichia blattae (2) Staphylococcus xylosus
Escherichia coli (4) Stenotrophomonas maltophilia
Escherichia fergusonii Streptococcus agalactiae (2)
Escherichia hermannii (2) Streptococcus bovis
Escherichia vulneris (2) Streptococcus pneumoniae (2)
Haemophilus equigenitalis Streptococcus pyogenes (2)
Haemophilus influenzae (2) Streptococcus salivarius
Haemophilus paragallinarum Streptococcus thermophilus
Hafnia alvei (2) Vibrio alginolyticus
Helicobacter pylori Vibrio cholerae (3)
Klebsiella ornithinolytica Vibrio fluvialis
Klebsiella oxytoca (2) Vibrio hollisae
Klebsiella planticola (2) Vibrio vulnificus
Klebsiella pneumoniae (2) Xanthomonas campestris
Klebsiella terrigena Yersinia enterocolitica (2)
Kocuria kristinae Yersinia frederiksenii
Figure imgf000081_0001
Example 13: Amplification of yphC Consensus Sequence and Hybridization of Molecular Beacon Probe #2 in Real Time
PCR amplification was undertaken using the PCR Mix shown in Table 7 (above) with the exception that the forward/reverse primer pair #2 and the molecular beacon #2 were used. The PCR program used is shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle.
Fluorescence was detected in real-time using a fluorescence monitoring realtime PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used.
Example 14: Positive Validation of yph C Primers and Molecular Beacon Probe
#2 ■
The effectiveness oϊyphC forward primer #2, reverse primer #2 and molecular beacon probe #2 for amplifying and detecting C. coli isolates was demonstrated as described generally below.
Genomic DNA from the species was isolated as described in Example 4. Amplification was conducted as described in Example 6 and Table 7 above with the exception that yphC forward primer #2, the reverse primer #2 and the molecular beacon #2 were used in the PCR mix in place of the atpA primers and probe.
Results indicated that all 17 C. coli strains tested were amplified and gave a positive signal {i.e. sensitivity of 100%).
Example 15: Negative Validation of the yphC Primers and Molecular Beacon #2 In order to test the ability of the yphC forward primer #2, reverse primer #2 and molecular beacon #2 to preferentially amplify and detect only C. coli, a number of bacteria (296) other than C. coli were tested.
Samples of genomic DNA from the bacteria presented in Table 12 below were isolated and amplified as described in the preceding Example.
No hybridization of the molecular beacon was observed {i.e. specificity of 100%).
These results suggest that both the amplification primers and the molecular beacon #2 are highly specific for C. coli.
Table 12. Negative Validation of the yphC Primers and Molecular Beacon #2
Genus Serovars Genus Serovars
Acinetobacter calcoaceticus (2) Lactobacillus acidophilus
Acinetobacter iwoffi .actobacillus casei (2)
Acinetobacter junii Lactobacillus delbreuckii (2)
Aeromonas hydrophila (2) Lactobacillus helveticus
Aeromonas salmonicida (2) Lactobacillus pentosus
Alcaligenes faecalis Lactobacillus plantarum (2)
Bacillus amyloliquefaciens (2) Lactobacillus rhamnosus (2)
Bacillus cereus (2) Lactococcus lactis (2)
Bacillus circulans (2) Lactococcus raffinolactis
Bacillus coagulans (2) Listeria grayi
Bacillus firmus Listeria innocua (2)
Bacillus lentus Listeria ivanovii (2)
Bacillus licheniformis (2) Listeria monocytogenes (2)
Bacillus megaterium (2) Listeria seeligeri
Bacillus mycoides Listeria welshimeri (2)
Bacillus pumilus (2) Micrococcus luteus (2) Genus Serovars Genus Serovars
Bacillus sphaericus Mycobacterium smegmatis
Bacillus stearothermophilus Neisseria gonorrhoeae
Bacillus subtilis (2) Neisseria lactam ica
Bacillus thuringiensis (2) Neisseria meningitidis (2)
Bacteroides fragilis Neisseria s ica
Bifidobacterium adolescentis Nocardia asteroides
Bifidobacterium animalis Pediococcus acidilactici (2)
Bifidobacterium bifidum Pediococcus pentosaceus
Bifidobacterium longum Proteus mirabilis (2)
Bifidobacterium pseudolongum Proteus penneri (2)
Bifidobacterium sp. (2) Proteus vulgaris (2)
Bifidobacterium suis Pseudomonas aeruginosa (2)
Bifidobacterium thermophilus Pseudomonas sp.
Bordetella bronchiseptica Pseudomonas mendocina
Bordetella pertussis Pseudomonas pseudoalcaligenes
Borrelia burgdorferi Pseudomonas putida (2)
Branhamella catarrhal is Pseudomonas stutzeri
Brevibacillus laterosporus Salmonella agona
Campylobacter jejuni (24) Salmonella arizonae (2)
Campylobacter lari (4) Salmonella bongori
Campylobacter fetus (6) Salmonella brandenburg
Campylobacter hyointestinalis (4) Salmonella choleraesuis (2)
Campylobacter mucosalis (2) Salmonella diarizonae
Campylobacter rectus Salmonella dublin (2)
Campylobacter spotorum (2) Salmonella enteritidis (2)
Campylobacter upsaliensis (4) Salmonella heidelberg (2) Genus Serovars Genus Serovars
Cellilomonea sp. Salmonella houtenae
Chromobacteriurπ violaceum Salmonella indica
Chryseobacterium sp. Salmonella . infantis (2)
Chryseomonas luteola Salmonella montevideo (2)
Citrobacter amalonaticus (2) Salmonella newport (2)
Citrobacter diversus Salmonella paratyphi (4)
Citrobacter freundii (2) Salmonella saintpaul (2)
Citrobacter koseri (2) Salmonella senftenberg
Citrobacter werkmanii Salmonella Stanley
Clostridium botulinum (2) Salmonella thompson (2)
Clostridium butyricum Salmonella typhi (2)
Clostridium difficile Salmonella typhimurium (2)
Clostridium perfringens (2) Salmonella typhisuis (2)
Clostridium sporogenes Serratia liquefaciens (2)
Clostridium tetani Serratia marcescens (2)
Clostridium tyrobutyricum Serratia odorifera
Corynebacterium xerosis Shigella boydii
Edwardsiella tarda Shigella dysenteriae (2)
Enterobacter aerogenes (2) Shigella v flexneri (2)
Enterobacter amnigenus Shigella sonnei (2)
Enterobacter cloacae (2) Staphylococcus aureus (2)
Enterobacter intermedius (2) Staphylococcus chromogenes
Enterobacter taylorae Staphylococcus epidermidis (2)
Enterococcus faecalis (2) Staphylococcus intermedius
Enterococcus faecium Staphylococcus lentis
Enterococcus hirae (2) Staphylococcus ludgdunensis Genus Serovars Genus Serovars
Erwinia herbicola Staphylococcus schieiferi
Escherichia blattae (2) Staphylococcus xylosus
Escherichia coli (4) Stenotrophomonas maltophilia
Escherichia fergusonii Streptococcus agalactiae (2)
Escherichia hermannii (2) Streptococcus bovis
Escherichia vulneris (2) Streptococcus pneumoniae (2)
Haemophilus equigenitalis Streptococcus pyogenes (2)
Haemophilus influenzae (2) Streptococcus suis
Haemophilus paragallinarum Streptococcus thermophilus
Hafnia alvei (2) Vibrio alginolyticus
Helicobacter cinaedi (4) Vibrio cholerae (2)
Helicobacter pylori Vibrio eltor
Klebsiella ornithinolytica Vibrio fluvialis
Klebsiella oxytoca (2) Vibrio hollisae
Klebsiella planticola (2) Vibrio vulnificus
Klebsiella pneumoniae (2) Xanthomonas campestris
Klebsiella terrigena Yersinia enterocolitica (2)
Kocuria kristinae Yersinia frederiksenii
Kurthia zopfii (2) Yersinia kritensenii
Example 16: Determination of a Unique, Conserved DNA Region in the C. lari slyA gene
The glyA gene coding regions from 10 different C. lari isolates were sequenced and aligned using the multiple alignment program Clustal W™. The resulting alignment was used to identify short DNA regions that were conserved within the C. lari group, yet which are excluded from other bacteria. Figure 7 depicts a sample of such an alignment in which a portion of the glyA gene of 10 different C. lari strains have been aligned.
A 117 nucleotide conserved sequence (SEQ ID NO:50) was identified from the multiple sequence alignment.
5'-GCTTTCATAAACY*TTTCCAGAAGAACTTACTTTAGAACCATGAGTTAA GTGTCCTCCATGGCTTAAATCCATACCCAAAATTCTATCACCAGGATTTAA CAATGCCATATACACACC-3'
* Y- represents T or C
This unique and conserved element of the C. lari glyA gene sequences (consensus sequence) was used to design highly specific primers for the PCR amplification of this conserved region.
Example 17; Generation of PCR Primers for Amplification of the εlvA Consensus Sequence #1
Within the conserved 117 nucleotide sequence identified as described in Example 16, regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. The primer sequences are shown below:
Forward primer #3: 5'- GCTTTCAT AAACTTTTCCAGAAG -3' [SEQ ID NO:52]
Reverse primer #3: 5'- GGTGTGTAT ATGGCATTGTT AAATC -3' [SEQ ID NO:53]
In the alignment presented in Figure 7, the positions of forward primer #3 and reverse primer #3 are represented by shaded boxes. Forward primer #3 starts at position 127 and ends at position 149 of the alignment. Reverse primer #3 represents the reverse complement of the region starting at position 219 and ending at position 243.
The following forward primer #4 can also be used to amplify glyA consensus sequence #1: Forward primer #4: 5'- GCTTTCATAAACY*TTTCCAGAAG -3' [SEQ ID NO:58]
* indicates T or C
Example 18: Generation of Molecular Beacon Probes Specific for the C. lariεlvΛ Consensus Sequence #1
In order to design molecular beacon probes specific for C. lari, a region within the glyA consensus sequence described above was identified which not only was highly conserved in all C. lari isolates, but was also exclusive to C. lari isolates. This sequence consisted of a 26 nucleotide region that would be suitable for use as a molecular beacon target sequence. The sequence is provided below:
5 '- GTCCTCCATGGCTTAAATCCATACCC -3 ' [SEQ ID NO:51 ]
The complement of this sequence [SEQ ID NO:57] is also suitable for use as a molecular beacon target sequence:
5'-GGGTATGGATTT AAGCCATGGAGGAC-S1 [SEQ ID NO:57]
A molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc.
glyA molecular beacon probe #3:
5'- cgcgtGTCCTCCATGGCTTAAATCCATACCCacgcg -3' [SEQ ID NO:54]
The complement of this sequence (SEQ ID NO:56, shown below) can also be used as a molecular beacon probe for the detecting C. lari.
5 '- cgcgtGGGTATGGATTTAAGCCATGGAGGACacgcg -3 ' [SEQ ID NO:56]
The molecular beacons were synthesized as described in Example 3.
Table 14 provides a general overview of the characteristics of molecular beacon probe #3. The beacon sequence shown in Table 14 indicates the stem region in lower case and the loop region in upper case. Table 13. Description of εlyΛ molecular beacon probe #3
Beacon sequence (5'-> 3') : cgcgtGTCCTCCATGGCTTAAATCCATACCCacgcg
Fluorophore (5') : FAM
Quencher (3') : DABCYL
Table 14 provides an overview of the thermodynamics of the folding of molecular beacon probe #3. Calculations were made using MFOLD™ software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site. Figure 8 shows the arrangement of PCR primers and the molecular beacon probe in the glyA consensus sequence #1. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward and reverse primers.
Table 14. Thermodynamics of molecular beacon probe #3.
Figure imgf000088_0001
A further glyA specific molecular beacon suitable for the detection of C. lari was also prepared as described above. The sequence is shown below (nucleotides in lower case represent the nucleotides that make up the stem of the beacon):
glyA molecular beacon probe #4 :
5'- cgcagtGCTCTCCATGGCTTAAATCCATActgcg -3' [SEQ ID NO:59]
The complement of this sequence (SEQ ID NO:61) can also be used as molecular beacon probes for the detection of C. lari.
5'- cgcagT ATGGATTT AAGCCATGGAGAGCactgcg -3' [SEQ ID NO:61] Example 19: Amplification of elvA Consensus Sequence #1 in Real Time with SybrGreen
The effectiveness of forward primer #3 and reverse primer #3 for amplification of C. lari isolates was demonstrated as described generally below.
Genomic DNA from the species and strains presented in Tables 15 below was isolated as described in Example 4. PCR amplification was undertaken using the conditions described in Tables 4 and 5 in Example 5.
Fluorescence was detected in real-time using a fluorescence monitoring real-time PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used.
All 15 strains of C. lari tested were amplified with forward primer #3 and reverse primer #3 and with the forward primer #4 and reverse primer #3.
With the 315 non-C coli strains tested (Table 15 below), no amplification products were observed with the primer pair #3 or with the forward primer #4/reverse primer #3 {i.e. specificity of 100%). In Table 15, the figures in parentheses indicate the number of strains of each species that were tested (if more than one). None of the tested strains provided a positive result.
Table 15. Strains used for Negative Validation of forward primer #3 / reverse primer #3 and forward primer #4/ reverse primer #3
Genus Serovars Genus Serovars
Acinetobacter calcoaceticus (2) Lactobacillus delbreuckii (2)
Acinetobacter iwoffi Lactobacillus helveticus
Aeromonas hydrophila (2) Lactobacillus pentosus
Aeromonas salmonicida (2) Lactobacillus plantarum (2)
Alcaligenes faecalis Lactobacillus rhamnosus (2)
Bacillus amyloliquefaciens (2) Lactococcus raffinolactis
Figure imgf000090_0001
Genus Serovars Genus Serovars
Brevibacillus laterosporus Pseudomonas putida
Burkholderia cepacia (2) Pseudomonas stutzeri
Campylobacter coli (18) Salmonella agona
Campylobacter fetus (13) Salmonella arizonae (2)
Campylobacter hyointestinalis (4) Salmonella bongori
Campylobacter jejuni (22) Salmonella brandenburg
Campylobacter mucosalis (4) Salmonella choleraesuis (2)
Campylobacter rectus Salmonella diarizonae
Campylobacter sputorum (4) Salmonella dublin (2)
Campylobacter upsaliensis (5) Salmonella enteritidis (2)
Cellilomonea sp. Salmonella heidelberg (2)
Chromobacterium violaceum Salmonella houtenae
Chryseobacterium sp. Salmonella indica
Chryseomonas luteola Salmonella infantis (2)
Citrobacter amalonaticus (2) Salmonella montevideo (2)
Citrobacter diversus Salmonella newport (2) .
Citrobacter freundii (2) Salmonella paratyphi (4)
Citrobacter koseri (2) Salmonella saintpaul (2)
Citrobacter werkmanii Salmonella senftenberg
Clostridium botulinum (2) Salmonella Stanley
Clostridium butyricum Salmonella thompson (2)
Clostridium difficile Salmonella typhi (2)
Clostridium perfringens (2) Salmonella typhimurium (2)
Clostridium sporogenes Salmonella typhisuis (2)
Clostridium tyrobutyricum Serratia liquefaciens (2)
Corynebacterium xerosis Serratia marcescens (2) Genus Serovars Genus Serovars
Edwardsiella tarda Serratia odorifera
Enterobacter aerogenes (2) Shigella boydii
Enterobacter amnigenus Shigella dysenteriae (2)
Enterobacter cloacae (2) Shigella flexneri (2)
Enterobacter intermedius (2) Shigella flexneri
Enterobacter taylorae Shigella sonnei (2)
Enterococcus faecalis (2) Staphylococcus aureus (2)
Enterococcus faecium Staphylococcus 'chromogenes
Enterococcus hirae (2) Staphylococcus epidermidis (2)
Erwinia herbicola Staphylococcus intermedius
Escherichia blattae (2) Staphylococcus lentis
Escherichia coli (4) Staphylococcus ludgdunensis
Escherichia fergusonii Staphylococcus schieiferi
Escherichia hermannii (2) Staphylococcus xylosus
Escherichia vulneris Stenotrophomonas maltophilia
Enterobacter aerogenes Streptococcus agalactiae (2)
Haemophilus equigenitalis Streptococcus bovis
Haemophilus influenzae (2) Streptococcus pneumoniae (2)
Haemophilus paragallinarum Streptococcus pyogenes (2)
Hafnia alvei (2) Streptococcus salivarius
Helicobacter pylori Streptococcus thermophilus
Klebsiella ornithinolytica Vibrio alginolyticus
Klebsiella oxytoca (2) Vibrio cholerae (3)
Klebsiella planticola (2) Vibrio fluvial is
Klebsiella pneumoniae Vibrio hollisae
Klebsiella oxytoca Vibrio vulnificus Genus Serovars Genus Serovars
Klebsiella terrigena Xanthomonas campestris
Kocuria kristinae Yersinia enterocolitica (2)
Kurthia zopfii (2) Yersinia frederiksenii
Lactobacillus acidophilus Yersinia kritensenii
Lactobacillus casei (2)
Example 20: Amplification of εlvA Consensus Sequence and Hybridization of Molecular Beacon Probe #3 in Real Time
PCR amplification was undertaken using the PCR Mix shown in Table 7 (above) with the exception that the forward/reverse primer pair #3 and the molecular beacon probe #3 were used in place of the atpA primers and probe. The PCR program used is shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle
Fluorescence was detected in real-time using a fluorescence monitoring real-time PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used.
Example 21: Positive Validation of εlyΛ Primers and Molecular Beacon Probe #3
The effectiveness of glyA forward primer #3, reverse primer #3 and molecular beacon probe #3 for amplifying and detecting C. lari isolates was demonstrated as described generally below.
Genomic DNA from C. lari and other different species was isolated as described in Example 4. Amplification was conducted as described in Example 6 and the PCR mix as described in Table 7 with the exception that glyA forward primer #3, the reverse primer #3 and the molecular beacon #3 were used. Results indicate that all 15 C. lari strains tested are amplified and gave a positive signal {i.e. sensitivity of 100%).
All 15 strains of C. lari were also detected with the molecular beacon #4 but with a later Ct.
Example 22: Negative Validation of the εlvA Primers and Molecular Beacon #3
In order to test the ability of the glyA forward primer #3, reverse primer #3 and molecular beacon #3 to preferentially amplify and detect only C. lari, a number of bacteria other than C. lari were tested.
Samples of genomic DNA from the bacteria presented in Table 15 above were isolated and amplified as described in the preceding Example.
No hybridization of the molecular beacon was observed (i.e. specificity of 100%).
These results suggest that both the amplification primers and the molecular beacon #3 are highly specific for C. lari.
Example 23: Determination of a Second Unique, Conserved DNA Region in the C. lariεlvA Gene
The glyA gene coding regions from 10 different C. lari isolates were sequenced and aligned using the multiple alignment program Clustal W™. The resulting alignment was used to identify short DNA regions that were conserved within the C. lari group, yet which are excluded from other bacteria. Figure 10 depicts a sample of such an alignment in which a portion of the glyA gene of 10 different C. lari strains have been aligned.
A 125 nucleotide conserved sequence (SEQ ID NO:73) was identified from the multiple sequence alignment.
S'-ATGCTCACCTGCTACAACCAAACCTGCAATATGTGCAATATCAGCAAA CAAATACGCACCAACCTCATCTGCTATTTCTCTAAATTTRGCAAAATCAAT CACTCTAGGATAAGCACTAGCACCAC-S1
This unique and conserved element of the C. lari glyA gene sequences (consensus sequence #2) was used to design highly specific primers for the PCR amplification of this conserved region.
Example 24: Generation of PCR Primers for Amplification of the εlvΛ Consensus Sequence #2
Within the conserved 125 nucleotide sequence identified as described in Example 23, regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. The primer sequences are shown below:
Forward primer #5: 5'- ATGCTCACCTGCTACAACC -3' [SEQ ID NO:75]
Reverse primer #4: 5'- GTGGTGCTAGTGCTT ATCCT -3' [SEQ ID NO:76]
In the alignment presented in Figure 10, the positions of forward primer #5 and reverse primer #4 are represented by shaded boxes. Forward primer #5 starts at position 119 and ends at position 127 of the alignment. Reverse primer #4 represents the reverse complement of the region starting at position 214 and ending at position
233.
Example 25: Generation of Molecular Beacon Probes Specific for the C. lariεlvΛ Consensus Sequence #2
In order to design molecular beacon probes specific for C. lari, a region within the glyA consensus sequence #2 described above was identified which not only was highly conserved in all C. lari isolates, but was also exclusive to C. lari isolates. This sequence consisted of a 23 nucleotide region that would be suitable for use as a molecular beacon target sequence. The sequence is provided below:
5'- CAAATACGCACCAACCTCATCTG -3' [SEQ ID NO:74] The complement of this sequence [SEQ ID NO: 80] is also suitable for use as a molecular beacon target sequence:
5l-CAGATGAGGTTGGTGCGTATTTG-31 [SEQ ED NO:80]
A molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc.
glyA molecular beacon probe #5:
5'- ccgaaCAAATACGCACCAACCTCATCTGttcgg -3' [SEQ ID NO:77]
The complement of this sequence (SEQ ID NO:79, shown below) can also be used as a molecular beacon probe for the detecting C. lari.
5 '- ccgaaCAGATGAGGTTGGTGCGTATTTGttcgg -3 ' [SEQ ID NO:79]
The molecular beacons were synthesized as described in Example 3.
Table 16 provides a general overview of the characteristics of molecular beacon probe #5. The beacon sequence shown in Table 16 indicates the stem region in lower case and the loop region in upper case.
Table 16. Description of εlvA molecular beacon probe #5
Beacon sequence (5'-» 3') : ccgaaCAAATACGCACCAACCTCATCTGttcgg
Fluorophore (5') : FAM
Quencher (3') : DABCYL
Table 17 provides an overview of the thermodynamics of the folding of molecular beacon probe #5. Calculations were made using MFOLD™ software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site. Figure 11 shows the arrangement of PCR primers and the molecular beacon probe in the glyA consensus sequence #2. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward and reverse primers. Table 17. Thermodynamics of molecular beacon probe #5.
Figure imgf000097_0001
Example 26: Amplification of εlyΛ Consensus Sequence #2 in Real Time with SybrGreen
The effectiveness of forward primer #5 and reverse primer #4 for amplification of C. lari isolates was demonstrated as described generally below.
Genomic DNA from the species and strains was isolated as described in Example 4. PCR amplification was undertaken using the conditions described in Tables 4 and 5 in Example 5.
Fluorescence was detected in real-time using a fluorescence monitoring real-time PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used.
All 15 strains of C. lari tested were amplified with forward primer #5 and reverse primer #4.
With the 315 non-C. lari strains tested (as listed in Table 15 above, except that the forward primer #5/reverse primer pair #4 was used), an amplification product was observed for 1 isolate of C. jejuni and 3 isolates of C. mucosalis {i.e. specificity of 98.73%). In Table 15, the figures in parentheses indicate the number of strains of each species that were tested (if more than one).
Example 27: Amplification of εlvΛ Consensus Sequence #2 and Hybridization of Molecular Beacon Probe #5 in Real Time PCR amplification was undertaken using the PCR Mix shown in Table 7 (above) with the exception that the forward primer #5/reverse primer #4 and the molecular beacon probe #5 were used. The PCR program used is shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle
Fluorescence was detected in real-time using a fluorescence monitoring real-time PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used.
Example 28: Positive Validation of six A Primers and Molecular Beacon Probe #5
The effectiveness of glyA forward primer #5, reverse primer #4 and molecular beacon probe #5 for amplifying and detecting C. lari isolates was demonstrated as described generally below.
Genomic DNA from different species was isolated as described in Example 4. Amplification was conducted as described in Example 6 with the exception that glyA forward primer #5, reverse primer #4 and the molecular beacon #5 were used in place of forward primer #1, reverse primer #1 and molecular beacon #1.
Results indicate that all of the 15 C. lari strains tested are amplified and gave a positive signal {i.e. sensitivity of 100%).
Example 29: Negative Validation of the εlvA Primers and Molecular Beacon #5
In order to test the ability of the glyA forward primer #5, reverse primer #4 and molecular beacon #5 to preferentially amplify and detect only C. lari, a number of bacteria other than C. lari were tested.
Samples of genomic DNA from the bacteria presented in Table 15 above were isolated and amplified as described in the preceding Example.
No hybridization of the molecular beacon #5 was observed (i.e. specificity of 100%). These results suggest that the amplification forward primer #5, reverse primer #4 and the molecular beacon #5 are highly specific for C. lari.
Example 30: Determination of a Third Unique, Conserved DNA Region in the C. lariεlvΛ Gene
The glyA gene coding regions from 10 different C. lari isolates were sequenced and aligned using the multiple alignment program Clustal W™. The resulting alignment was used to identify short DNA regions that were conserved within the C. lari group, yet which are excluded from other bacteria. Figure 13 depicts a sample of such an alignment in which a portion of the glyA gene of 10 different C. lari strains have been aligned.
A 99 nucleotide conserved sequence (SEQ ID NO:91) was identified from the multiple sequence alignment.
5'- ATGAGCATR* AGGGAATGGACTR*GGATGCTCACCTR*CTACAACCAA R*CCTGCAATATGTGCAATATCAGC AAACAAATACGCACCAACCTCATCTG CTAT-31
* R represents A or G
This unique and conserved element of the C. lari glyA gene sequences (consensus sequence #3) was used to design highly specific primers for the PCR amplification of this conserved region.
Example 31 : Generation of PCR Primers for Amplification of the εlvA Consensus Sequence #3
Within the conserved 99 nucleotide sequence identified as described in Example 30, regions that could serve as primer target sequences were identified. These primer target sequences were used to design primers to allow efficient PCR amplification. The primer sequences are shown below:
Forward primer #6: 5'- ATGAGCATR* AGGGAATGGAC -3' [SEQ ID NO:93] Reverse primer #5: 5'- ATAGCAGATGAGGTTGGTGC -3' [SEQ ID NO:94]
""indicates A or G
In the alignment presented in Figure 13, the positions of forward primer #6 and reverse primer #5 are represented by shaded boxes. Forward primer #6 starts at position 84 and ends at position 103 of the alignment. Reverse primer #5 represents the reverse complement of the region starting at position 163 and ending at position 182.
The following forward primer #7 can also be used to amplify glyA consensus sequence #3:
Forward primer #7: 5'- ATGAGCATGAGGGAATGGAC -3' [SEQ ID NO:99]
Example 32: Generation of Molecular Beacon Probes Specific for the C. lariεlyA Consensus Sequence #3
In order to design molecular beacon probes specific for C. lari, a region within the glyA consensus sequence #3 described above was identified which not only was highly conserved in all C. lari isolates, but was also exclusive to C. lari isolates. This sequence consisted of a 23 nucleotide region that would be suitable for use as a molecular beacon target sequence. The sequence is provided below:
5'- TCACCTGCTACAACCAAR*CCTGCA-3' [SEQ ID NO:92]
""indicates A or G
The complement of this sequence [SEQ ID NO:98] is also suitable for use as a molecular beacon target sequence:
51-TGCAGGY§TTGGTTGTAGCAGGTGA-31 [SEQ ID NO:98]
indicates T or C
A molecular beacon probe having the sequence shown below was synthesized by Integrated DNA Technologies Inc. glyA molecular beacon probe #6:
5'- ccggcTCACCTGCTACAACCAAR*CCTGCAgccgg -3' [SEQ ID NO:95]
*indicates A or G
The complement of this sequence (SEQ ID NO: 97, shown below) can also be used as a molecular beacon probe for the detecting C. lari.
5'- ccggcTGCAGGY§TTGGTTGTAGCAGGTGAgccgg -3' [SEQ ID NO:97]
indicates T or C
The molecular beacons were synthesized as described in Example 3.
Table 18 provides a general overview of the characteristics of molecular beacon probe #6. The beacon sequence shown in Table 18 indicates the stem region in lower case and the loop region in upper case.
Table 18. Description of glyA molecular beacon probe #6
Beacon sequence (5'-> 3') : ccggcTCACCTGCTACAACCAARCCTGCAgccgg
Fluorophore (5') : FAM
Quencher (3') : DABCYL
Table 19 provides an overview of the thermodynamics of the folding of molecular beacon probe #6. Calculations were made using MFOLD™ software, or the Oligo Analyzer software package available on Integrated DNA Technologies Inc. web site. Figure 14 shows the arrangement of PCR primers and the molecular beacon probe in the glyA consensus sequence #3. Numbers in parentheses indicate the positions of the first and last nucleotides of each feature on the PCR product generated with the forward and reverse primers.
Table 19. Thermodynamics of molecular beacon probe #6.
Figure imgf000102_0001
A further glyA specific molecular beacon suitable for the detection of C. lari was also prepared as described above. The sequence is shown below (nucleotides in lower case represent the nucleotides that make up the stem of the beacon):
glyA molecular beacon probe #7 :
5 '- cgcgcTC ACCTGCTACAACCAAACCTGC Agcgcg-3 ' [SEQ ID NO: 100]
The complement of this sequence (SEQ ID NO: 102) can also be used as molecular beacon probes for the detection of C. lari,
5'- cgcgcTGCAGGTTTGGTTGT AGC AGGTGAgcgcg -3' [SEQ ID NO: 102]
Example 33: Amplification of slvΛ Consensus Sequence #3 in Real Time with SvbrGreen
The effectiveness of forward primer #6 and reverse primer #5 for amplification of C. lari isolates was demonstrated as described generally below.
Genomic DNA from the species and strains was isolated as described in Example 4. PCR amplification was undertaken using the conditions described in Tables 4 and 5 of Example 5.
Fluorescence was detected in real-time using a fluorescence monitoring real-time PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used.
All 15 strains of C. lari tested were amplified with forward primer #6 and reverse primer #5. With the 315 non-C. lari strains tested (see Table 15 above), one amplification product with a C. jejuni strain was observed (i.e. specificity of 99.69%).
The forward primer #7 and #6 also amplified all the C. lari strains but a few amplification products with a melting peak close to that of the C. lari amplicon were observed among the non C. lari strains tested.
Example 34: Amplification of εlvA Consensus Sequence #3 and Hybridization of Molecular Beacon Probe #6 in Real Time
PCR amplification was undertaken using the PCR Mix shown in Table 7 (above) with the exception that the forward primer #6, reverse primer #5 and the molecular beacon probe #6 were used. The PCR program used is shown in Table 5 (above). The intensity of fluorescence emitted by the fluorophore component of the molecular beacon was detected at the annealing stage of each amplification cycle.
Fluorescence was detected in real-time using a fluorescence monitoring real-time PCR instrument, for example, a BioRad iCycler iQ™ or MJ Research Opticon™. Other instruments with similar fluorescent reading abilities can also be used.
Example 35: Positive Validation of εlvA Primers and Molecular Beacon Probe #6
The effectiveness of glyA forward primer #6, reverse primer #5 and molecular beacon probe #6 for amplifying and detecting C. lari isolates was demonstrated as described generally below.
Genomic DNA from different species was isolated as described in Example 4.
Amplification was conducted as described in Example 6 with the exception that glyA forward primer #6, reverse primer #5 and the molecular beacon #6 were used.
Results indicate that all 15 C. lari strains tested are amplified and gave a positive signal (i.e. sensitivity of 100%).
Example 36: Negative Validation of the εlvA Primers and Molecular Beacon #6 In order to test the ability of the glyA forward primer #6, reverse primer #5 and molecular beacon #6 to preferentially amplify and detect only C. lari, a number of bacteria other than C. lari were tested.
Samples of genomic DNA from the bacteria presented in Table 15 above were isolated and amplified as described in the preceding Example.
No hybridization of the molecular beacon #6 was observed (i.e. specificity of 100%).
These results suggest that both the amplification forward primer pair #6/reverse primer #5 and the molecular beacon #6 are highly specific for C. lari.
Example 37: Quantification of atpA, yphC or εlvΛ Target Sequences in a Test Sample
In order to quantify the amount of target sequence in a sample, DNA was isolated and amplified as described in the preceding Examples (4, 6, 11, 13 and 20). DNA was quantified using a standard curve constructed from serial dilutions of a target DNA solution of known concentration.
Example 38: Positive Validation of the Combination of atpA and yphC Primers and Molecular Beacon Probes
The combination of atpA forward primer#l and reverse primer #1, atpA molecular beacon #\, yphC forward primer #2 and reverse primer #2 znάyphC molecular beacon #2 were tested against a panel of 24 C. jejuni strains and 17 C. coli strains using the "duplex" PCR conditions described in Table 20, below. The final concentration OfMgCl2 in the reaction mix is 4mM.
All the C. jejuni and C. coli strains tested were detected with the same efficiency under duplex conditions as they were under the "singleplex" conditions as described in Examples 7 and 14.
Table 20: Duplex PCR Reaction Mix
Figure imgf000105_0001
The ability of the C. lari g/yΛ-specific primers and probes, such as those described in Examples 17 and 18, to amplify and detect their target sequence under the same PCR conditions as the C. jejuni and C. coli primers and probes described in this Example will allow for the combination of all three sets of primers and probes in a single microtitre plate in order to simultaneously detect all three species of Campylobacter. The C. lari primers and probe can be placed in a separate well for a singleplex reaction while the C. jejuni and C. coli primers and probes are multiplexed in another well. The present invention also contemplates pooling of the C. lari primers and probe with the C. jejuni and C. coli primers and probes in a single "triplex" PCR reaction as described in Examples 39 and 40, below.
Example 39: Positive Validation of the Combination of atpA, yphC and εlvA Primers and Molecular Beacon Probes
The combination of atpA forward primer#l and reverse primer #1, atpA molecular beacon #1 , yphC forward primer #2 and reverse primer #2, yphC molecular beacon #2, glyA forward primer #3 and glyA reverse primer #3, and glyA molecular beacon probe #3 were tested against a panel of 34 C. jejuni strains, 17 C. coli and 20 C. lari strains using the triplex PCR conditions described in Table 21, below.
All the C. jejuni and C. coli strains tested were detected with the same efficiency under triplex conditions as they were under the "singleplex" conditions as described in Examples 7, 14 and 21.
Table 21: Triplex PCR Reaction Mix
Figure imgf000106_0001
Example 40: Negative Validation of the Combination of atpA, yphC and elvΛ Primers and Molecular Beacon Probes
In order to test the ability of the combination of atpA forward primer#l and reverse primer # 1 , atpA molecular beacon # 1 , yphC forward primer #2 and reverse primer #2, yphC molecular beacon #2, glyA forward primer #3 and glyA reverse primer #3, and glyA molecular beacon probe #3 to preferentially amplify and detect only the three target species of Campylobacter (i.e. C. jejuni, C. coli and C. /an), 278 strains of bacteria other than C. lari, C. coli and C. lari were tested.
Samples of genomic DNA from the bacteria presented in Table 22 below were isolated and amplified as described in the preceding Examples. All the strains tested were negative.
Table 22. Strains used for Negative Validation
Genus Serovars Genus Serovars
Escherichia coli (31 ) nterobacter aerogenes
Listeria grayi (3) nterobacter amnigenus
Listeria innocua (4) nterobacter cloacae
Listeria ivanovii (4) Ξnterobacter intermedius
Listeria monocytogenes (4) Enterobacter taylorae
Listeria seeligeri (3) Enterococcus faecium
Listeria welsh imeri (3) Enterococcus hirae
Salmonella agona Flavobacterium odoratum
Salmonella arizonae (2) Geobacillus stearothermophilus
Salmonella berta Hafnia alvei
Salmonella bradford Haemophilus equigenitalis
Salmonella braenderup Haemophilus influenzae
Salmonella bongori Helicobacter cinaedi
Salmonella choleraesuis Helicobacter fennelliae
Salmonella derby Helicobacter hepaticus
Salmonella dublin (2) Helicobacter pylori
Salmonella enteritidis (2) Kocuria kristinae
Salmonella flint Kocuria rosea Genus Serovars Genus Serovars
Salmonella hadar Kocuria varians
Salmonella heidelberg (2) Kurthia zopfii
Salmonella indica. Klebsiella ornithinolytica
Salmonella infantis (2) Klebsiella oxytoca
Salmonella montevideo (2) Klebsiella planticola
Salmonella muenchen Klebsiella pneumoniae
Salmonella muenster Klebsiella terrigena
Salmonella newport (2) Lactobacillus bifermentans
Salmonella paratyphi (2) Lactobacillus casei
Salmonella saintpaul (2) Lactobacillus coryniformis
Salmonella senftenberg Lactobacillus delbreuckii
Salmonella simulans Lactobacillus helveticus
Salmonella Stanley Lactobacillus plantarum
Salmonella thompson .actobacillus pentosus
Salmonella typhi (2) Lactobacillus rhamnosus
Salmonella typhimurium (2) Lactococcus lactis
Salmonella virchow Lactococcus raffinolactis
Staphylococcus aureus (2) Legionella anisa
Staphylococcus chromogenes Legionella geestiana
Staphylococcus epidermidis Legionella hackeliae
Staphylococcus hyicus Legionella micdadei
Staphylococcus intermedius Legionella pneumophila
Staphylococcus lentis Legionella spiritensis
Staphylococcus lugdunensis .egionella wadsworthii
Staphylococcus saprophytics (2) Mycobacterium fortuitum
Staphylococcus schieiferi Mycobacterium murale Genus Serovars Genus Serovars
Staphylococcus xylosus Mycobacterium smegmatis
Acinetobacter calcoaceticus Microbacterium laevaniformans
Acinetobacter iwoffi Micrococcus luteus
Acinetobacter junii Micrococcus roseus
Acinetobacter baumannii Moraxella sp.
Aeromonas hydrophila Moraxella lacunata
Aeromonas salmonicida Morganella morganii
Alcaligenes faecal is Neisseria gonorrhoeae
Bacillus amyloliquefaciens Neisseria lactam ica
Bacillus cereus Neisseria meningitidis
Bacillus circulans Neisseria sica
Bacillus coagulans Nocardia asteroides
Bacillus firmus Nocardia otitidiscaviar
Bacillus lentus Pantoea agglomerans
Bacillus licheniformis Pediococcus acidilactici
Bacillus megaterium Pediococcus pentosaceus
Bacillus mycoides 'seudomonas aeruginosa
Bacillus pumilus Pseudomonas chlororaphis
Bacillus stearothermophilus Pseudomonas mendocina
Bacillus sphaericus Pseudomonas oleovorans
Bacillus subtilis Pseudomonas pseudoalcaligenes
Bacillus thuringiensis Pseudomonas fuscovaginae
Bacteroides fragilis Pseudomonas putida
Bifidobacterium adolescentis Pseudomonas reptilovora
Bifidobacterium animalis Pseudomonas stutzeri
Bifidobacterium bifidum Proteus mirabilis
Figure imgf000110_0001
Genus Serovars Genus Serovars
Citrobacter werkmanii Tatlockia micdadei
Clostridium botulinum Vibrio parahemolyticus
Clostridium difficile Vibrio hollisae
Clostridium novyii Vibrio vulnificus
Clostridium perfringens Vibrio alginolyticus
Clostridium sporogenes Vibrio cholerae
Clostridium tertium Vibrio fluvialis
Clostridium thermosaccharolyticum Vibrio furnissii
Clostridium tyrobutyricum Xanthomonas campestris
Escherichia blattae Yersinia bercovieri
Escherichia fergusonii Yersinia enterocolitica
Escherichia hermannii Yersinia frederiksenii
Escherichia vulneris Yersinia kritensenii
Edwardsiella tarda Yersinia pseudotuberculosis
Erwinia herbicola
Example 41: Specificity and Sensitivity of Primers
39.1 Specificity and Sensitivity of Primers
The sensitivity of the primer pair atpA forward primer #1 /reverse primer #1 was tested against a panel of 24 C. jejuni strains using the SYBR® Green Reaction Mix shown in Table 4. The primer pair amplified 100% of the panel of C. jejuni strains.
A summary of the sensitivity and specificity of the atpA forward primer #l/reverse primer #1 pair is shown in Table 21.
From the panel of bacterial species other than C. jejuni, the atpA forward primer
#1 /reverse primer #1 pair do not amplify any sequences. A summary of the sensitivity and specificity of the atpA forward primer #1 /reverse primer #1 pair is shown in Table
23.
Table 23: Summary for C. jejuni atpA forward primer #1 and reverse primer #1
Sensitivity 100.0%
Specificity 100.0%
False positives 0.0%
False negatives 0.0%
Efficiency of primer pair 100.0%
The primer pair yphC forward primer #2/reverse primer #2 was tested against a panel of 17 strains of C. coli. The primer pair amplified 100% of the panel of C. coli strains. A summary of the sensitivity and specificity of the yphC forward primer #2/reverse primer #2 pair is shown in Table 24.
From the panel of bacterial species other than C. coli, the yphC forward primer #2/reverse primer #2 pair no sequences were amplified demonstrating a specificity of 100.0%. A summary of the sensitivity and specificity of the yphC forward primer #2/reverse primer #2 pair is shown in Table 24.
Table 24: Summary for yphC forward primer #2 and reverse primer #2
Sensitivity 100.0%
Specificity 99.32%
False positives 0.68%
False negatives 0.0%
Efficiency of primer pair 100.0%
The primer pair glyA forward primer #3/reverse primer #3 was tested against a panel of 15 strains of C. lari. 100.0% of the C. lari panel strains was amplified. No strains of the panel of bacterial species other than C. lari, were amplified with the glyA forward primer #3/reverse primer #3 pair demonstrating a specificity of 100.0%. A summary of the sensitivity and specificity of the glyA forward primer #3/reverse primer #3 pair is shown in Table 25.
Table 25: Summary for glyA forward primer #3 and reverse primer #3
Sensitivity 100.0%
Specificity 100.0%
False positives 0.0%
False negatives 0.0%
Efficiency of primer pair 100.0%
The sensitivity of the primer pair glyA forward primer #5/reverse primer #4 was tested against a panel of 15 C. lari strains using the S YBR® Green Reaction Mix shown in Table 4. The primer pair amplified 100% of the panel of C. lari strains.
A summary of the sensitivity and specificity of the glyA forward primer #5/reverse primer #4 pair is shown in Table 26.
From the panel of bacterial species other than C. lari, the glyA forward primer #5/reverse primer #4 pair 4 amplification products were observed (1 C. jejuni and 3 C. mucosalis). A summary of the sensitivity and specificity of the atpA forward primer #5/reverse primer #4 pair is shown in Table 26.
Table 26: Summary for C. lariglyA forward primer #5 and reverse primer #4
Sensitivity 100.0%
Specificity 98.73%
False positives 1.27%
False negatives 0.0%
Efficiency of primer pair 98.75% The sensitivity of the primer pair glyA forward primer #6/reverse primer #5 was tested against a panel of 15 C. lari strains using the SYBR® Green Reaction Mix shown in Table 4. The primer pair amplified 100% of the panel of C. lari strains.
A summary of the sensitivity and specificity of the glyA forward primer #6/reverse primer #5 pair is shown in Table 27.
From the panel of bacterial species other than C. lari, the glyA forward primer #6/reverse primer #5 pair one product was amplified. A summary of the sensitivity and specificity of the atpA forward primer #6/reverse primer #5 pair is shown in Table 27. The use of the forward primer #7 and the reverse primer #6, increased the non specific amplification products observed, (one strain of C. fetus, C. upsaliensis, C. jejuni and 2 strains of C. sporotum)
Table 27: Summary for C. lariεhA forward primer #6 and reverse primer #5
Sensitivity 100.0%
Specificity 99.69%
False positives 0.31%
False negatives 0.0%
Efficiency of primer pair 99.69%
39.2 Primer Efficiency
Efficiency of primers was determined using 50OnM and using serial dilution of C. jejuni, C. coli and C. lari strains from 200 000 copies of the genome to 0.2 copies. Measurements were made in triplicate.
atpA forward primer #1 and reverse primer #1 detect as few as 2 copies per PCR reaction; PCR efficiency reaction 96.8%.
yphC forward primer #2 and reverse primer #2 detect as few as 0.2 copy per PCR reaction; PCR efficiency reaction 89.9%. glyA forward primer #3 and reverse primer #3 detect as few as 2 copies per PCR reaction; PCR efficiency reaction 100.0%.
glyA forward primer #4 and reverse primer #3 detect as few as 2 copies per PCR reaction; PCR efficiency reaction 105.0%.
glyA forward primer #5 and reverse primer #4 detect as few as 2 copies per PCR reaction; PCR efficiency reaction 100.0%.
glyA forward primer #6 and reverse primer #5 detect as few as 0.2 copies per PCR reaction; PCR efficiency reaction 102.0%.
glyA forward primer #7 and reverse primer #6 detect as few as 0.2 copies per PCR reaction; PCR efficiency reaction 104.0%.
39.3 Primer Annealing Temperatures
Annealing temperatures were determined using the optimal primer concentration and using a temperature gradient of 5O0C to 650C (500C, 51.1°C, 52.9°C, 55.50C, 59.3°C, 62.10C, 63.9°C and 65°C). DNA from C. jejuni or C. coli or C. lari strains at a concentration of 0.5ng/μl dilution was used. Measurements were made in triplicate.
/ atpA forward primer #1 and reverse primer #1 annealed to their target sequence up to 59.30C.
yphC forward primer #2 and reverse primer #2 annealed to their target sequence up to 62.10C.
glyA forward primer #3 and reverse primer #3 annealed to their target sequence up to 59.3°C.
glyA forward primer #4 and reverse primer #3 annealed to their target sequence up to 59.30C.
glyA forward primer #5 and reverse primer #4 annealed to their target sequence up to 63.90C/ glyA forward primer #6 and reverse primer #5 annealed to their target sequence up to 650C.
glyA forward primer #7 and reverse primer #6 annealed to their target sequence up to 63.90C.
39.4 Molecular Beacon Efficiencies
Efficiencies were tested for molecular beacon #1 using C. jejuni strain, for molecular beacon #2 using C. coli strain, for molecular #3 and 4 with C. lari strain, and for the combination of molecular beacons #1, #2, #3 with all 3 strains of Campylobacter. DNA dilutions from Ix 10° (200000 copies of the genome) to 1x10'6 (0.2 copy of the genome) were made. In addition dilutions of a pure culture of the corresponding strain were made and plated on a Petri dish to allow a colony forming unit (CFU) count and tested by PCR at the same time. A correlation was made between the count and the PCR reaction. The results were as follows:
For molecular beacon #1: Efficiency 94.6%, detection of as few as 20 copies of the genome per PCR reaction. 2.5 CFU/PCR were detected
For molecular beacon #2: Efficiency 92.2%, detection of as few as 2 copies of the genome per PCR reaction. 6.9 CFU/PCR were detected.
For molecular beacon #3: Efficiency 98.8%, detection of as few as 2 copies of the genome per PCR reaction. 1.7CFU/PCR
For molecular beacon #4: Efficiency 106.6%, detection of as few as 2 copies of the genome per PCR reaction.
For molecular beacon #5: Efficiency 99.3%, detection of as few as 2 copies of the genome per PCR reaction.
For molecular beacon #6: Efficiency 105%, detection of as few as 2 copies of the genome per PCR reaction. For molecular beacon #7: Efficiency 131%, detection between 20 to 2 copies of the genome per PCR reaction.
For molecular beacon #1 and #2: Efficiency 100%, detection up to 7 CFUs per PCR reaction.
For the combination of molecular beacons #1 #2 and #3: Detection up to 0.6 CFU per PCR reaction for C.coli; detection up to 0.08 CFU per PCR reaction for C.jejuni, and detection up to 0.05 CFU per PCR reaction for C.lari.
Although the specificity of molecular beacons #3 and #4 is similar (see below), detection of C. lari occurs approximately 3-4Ct earlier when molecular beacon #3 is used compared to molecular beacon #4 under the same conditions. In addition, the fluorescence of molecular beacon #3 is approximately 2 times greater than that of molecular beacon #4. Similarly, detection of C. lari occurs 7Ct earlier when molecular beacon #6 is used compared to molecular beacon #7 and the fluorescence of molecular beacon #6 is approximately 2 times greater than that of molecular beacon #6.
39.5 Specificity and Sensitivity of Molecular Beacon Probes
A summary of the sensitivity and specificity of the molecular beacon #1, 2, 3, 4, 5 and 6 is shown in Table 28, 29, 30, 31, 32, 33 and 34.
Table 28; Summary for molecular beacon #1
Sensitivity 100.0%
Specificity 100.0%
J False positives 0.0%
False negatives 0.0%
Efficiency of beacon 100.0%
Table 29: Summary for molecular beacon #2 Sensitivity 100.0%
Specificity 100.0%
False positives 0.0%
False negatives 0.0%
Efficiency of beacon 100.0%
Table 30: Summary for molecular beacon #3
Sensitivity 100.0%
Specificity 100.0%
False positives 0.0%'
False negatives 0.0%
Efficiency of beacon 100.0%
Table 31: Summary for molecular beacon #4
Sensitivity 100.0%
Specificity 100.0%
False positives 0.0%
False negatives 0.0%
Efficiency of beacon 100.0%
Table 32: Summary for molecular beacon #5
Sensitivity 100.0%
Specificity 100.0%
False positives 0.0%
False negatives 0.0%
Figure imgf000119_0001
Table 33; Summary for molecular beacon #6
Sensitivity 100.0%
Specificity 100.0%
False positives 0.0%
False negatives 0.0%
Efficiency of beacon 100.0%
Table 34: Summary for the combination of molecular beacons #1, #2 and #3
Sensitivity 100.0%
Specificity 100.0%
False positives 0.0%
False negatives 0.0%
Efficiency of beacon 100.0%
Example 42: Enrichment Procedure for Test Samples
A test sample can be submitted to an enrichment procedure prior to DNA extraction in order to enrich the bacterial content of the sample.
The following protocol can be followed for the enrichment of a test sample:
1. Place 25 g or 25 ml of the sample in a Stomacher filter bag.
2. Add 100 ml of Bolton Broth with supplement (Bolton Broth Selective supplement) to the Stomacher filter bag.
3. Homogenize the bag contents with a Stomacher instrument.
4. Incubate the stomacher filter bag at 35°C for 4 hours. 5. Transfer the stomacher filter bag at 42°C and incubate for 44 additional hours in a storage rack.
6. After incubation, shake the stomacher bag to homogenise the content.
7. Transfer 1 mL of the cell suspension in the bag (taking care not to take samples from the side of the stomacher bag that contains food particles) to a 2 mL sterile tube and proceed with DNA extraction (for example, following the protocol in Example 4).
The disclosure of all patents, publications, including published patent applications, and database entries referenced in this specification are specifically incorporated by reference in their entirety to the same extent as if each such individual patent, publication, and database entry were specifically and individually indicated to be incorporated by reference.
Although the invention has been described with reference to certain specific embodiments, various modifications thereof will be apparent to those skilled in the art without departing from the spirit and scope of the invention as outlined in the following claims.

Claims

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS FOLLOWS:
1. A Campylobacter detection system comprising a combination of polynucleotides selected from the group of:
a) a combination of polynucleotides for detection of Campylobacter jejuni comprising a first C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:1; a second C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:1 and a C. jejuni polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof;
b) a combination of polynucleotides for detection of Campylobacter coli comprising a first C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:21, 22, 23, 24, 25, 26, 27, 28, 29 and 30; a second C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30, and a C. coli polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof;
c) a combination of polynucleotides for detection of Campylobacter lari comprising a first C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:39; a second C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:39, and a C. lari polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof; d) a combination of polynucleotides comprising two of the combinations of (a), (b) and (c), and
e) a combination of polynucleotides comprising the combinations of (a), (b) and (c).
2. The system according to claim 1, wherein said first C. jejuni polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-l 1; said second C. jejuni polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-l 1, and said C. jejuni polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID N0:12.
3. The system according to claim 1, wherein said first C. jejuni polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 14; said second C. jejuni polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 15, and said C. jejuni polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 17 or 19.
4. The system according to claim 1 , wherein said first C. coli polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:33; said second C. coli polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:34, and said C. coli polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NOs:36 or 38.
5. The system according to claim 1, wherein said first C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:40-49; said second C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:40-49, and said C. lari polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:50.
6. The system according to claim 1, wherein said first C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:53; said second C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:52, and said C. lari polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:55 or 57.
7. The system according to claim 1, wherein said first C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 76; said second C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NO: 75, and said C. lari polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 78 or 80.
8. The system according to claim 1, wherein said first C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:94; said second C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 93, and said C. lari polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs: 96, 98, 101 and 103.
9. A method of detecting one or more of Campylobacter jejuni, Campylobacter coli and Campylobacter lari in a sample, said method comprising the steps of:
(a) contacting a sample suspected of containing, or known to contain, one or more Campylobacter target nucleotide sequences with the combination of polynucleotides under conditions that permit amplification, said combination selected from the group of:
(i) a combination of polynucleotides for detection of C. jejuni comprising a first C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:1; a second C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:1 and a C. jejuni polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ TD NO: 12, or the complement thereof;
(ii) a combination of polynucleotides for detection of C. coli comprising a first C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:21, 22, 23, 24, 25, 26, 27, 28, 29 and 30; a second C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30, and a C. coli polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof;
(iii) a combination of polynucleotides for detection of C. lari comprising a first C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:39; a secind C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:39, and a C. lari polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof;
(iv) a combination of polynucleotides comprising two of the combinations of (i), (ii) and (iii), and
(v) a combination of polynucleotides comprising the combinations of (i), (ii) and (iii); and
(b) detecting any amplified target sequence(s), wherein detection of an amplified target sequence indicates the presence of C. jejuni, C. coli and/or C. lari in the sample.
10. The method according to claim 9, wherein steps (a) and (b) are conducted concurrently.
11. The method according to claim 9 or 10 further comprising a step to enrich the microbial content of the sample prior to step (a).
12. A Campylobacter detection kit comprising:
(a) a combination of polynucleotides selected from the group of:
(i) a combination of polynucleotides for detection of C. jejuni comprising a first C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:1; a second C. jejuni polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ BD NO:1 and a C. jejuni polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof;
(ii) a combination of polynucleotides for detection of C. coli comprising a first C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:21, 22, 23, 24, 25, 26, 27, 28, 29 and 30; a second C. coli polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs: 21, 22, 23, 24, 25, 26, 27, 28, 29 and 30, and a C. coli polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof;
(iii) a combination of polynucleotides for detection of C. lari comprising a first C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:39; a secind C. lari polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO:39, and a C. lari polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91, or the complement thereof;
(iv) a combination of polynucleotides comprising two of the combinations of (i), (ii) and (iii), and
(v) a combination of polynucleotides comprising the combinations of (i), (ii) and (iii); and
(b) one or more containers.
13. The kit according to claim 12, wherein said first C. jejuni polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:2-l 1; said second C. jejuni polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:2-l 1, and said C. jejuni polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12.
14. The kit according to claim 12, wherein said first C. jejuni polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 14; said second C. jejuni polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 15, and said C. jejuni polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 17 or 19.
15. The kit according to claim 12, wherein said first C. coli polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:33; said second C. coli polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:34, and said C. coli polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NOs:36 or 38.
16. The kit according to claim 12, wherein said first C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ID NOs:40-49; said second C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:40-49, and said C. lari polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:50.
17. The kit according to claim 12, wherein said first C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:53; said second C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:52, and said C. lari polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:55 or 57.
18. The kit according to claim 12, wherein said first C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 76; said second C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NO: 75, and said C. lari polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 78 or 80.
19. The kit according to claim 12, wherein said first C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:94; said second C. lari polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 93, and said C. lari polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs: 96, 98, 101 and 103.
20. A pair of polynucleotide primers for amplification of a portion of a C. jejuni atpA gene, said pair of polynucleotide primers comprising a first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12 and a second polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to SEQ ID NO: 12.
21. The pair of polynucleotide primers according to claim 20, wherein said first primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 14 and said second primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO: 15.
22. A pair of polynucleotide primers for amplification of a portion of a C. coliyphC gene, said pair of polynucleotide primers comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:21, 22, 23, 24, 25, 26, 27, 28 , 29 and 30; and a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ED NOs: 21, 22, 23, 24, 25, 26, 27, 28 , 29 and 30.
23. The pair of polynucleotide primers according to claim 22, wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:31 and said second polynucleotide primer comprises at least 7 consecutive nucleotides of a sequence complementary to SEQ ED NO:31.
24. The pair of polynucleotide primers according to claim 22, wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ED NO:33 and said second polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:34.
25. A pair of polynucleotide primers for amplification of a portion of a C. lari glyA gene, said pair of polynucleotide primers comprising a first polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ED NOs:50, 73 and 91; and a second polynucleotide primer comprising at least 7 consecutive nucleotides of a sequence complementary to any one of SEQ ED NOs:50, 73 and 91.
26. The pair of polynucleotide primers according to claim 25, wherein said first polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:52 and said second polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:53.
27. The pair of polynucleotide primers according to claim 25, wherein said third polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 75 and said fourth polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:76.
28. The pair of polynucleotide primers according to claim 25, wherein said fifth polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 93 and said sixth polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 94.
29. An isolated C. jejuni specific polynucleotide having the sequence as set forth in SEQ ID NO: 12, or the complement thereof.
30. An isolated C. coli specific polynucleotide having the sequence as set forth in SEQ ID NO:31, or the complement thereof.
31. An isolated C. lari specific polynucleotide having the sequence as set forth in SEQ ID NO:50, 73, or 91, or the complement thereof.
32. A polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of a C. jejuni atpA gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 13, 14 or 15, or the complement thereof.
33. A polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of a C. coliyphC gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof.
34. The polynucleotide primer according to claim 33, wherein said polynucleotide primer comprises at least 7 consecutive nucleotides of the sequence as set forth in SEQ K) NO:32, 33 or 34, or the complement thereof.
35. A polynucleotide primer of between 7 and 100 nucleotides in length for the amplification of a portion of a C. lari glyA gene, said polynucleotide primer comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:51, 52, 53, 74, 75, 76, 92, 93, 94, and 99, or the complement thereof.
36. A polynucleotide probe of between 7 and 100 nucleotides in length for detection of C. jejuni, said polynucleotide probe comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO: 12, or the complement thereof.
37. The polynucleotide probe according to claim 36, wherein said polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs: 13, 17 and 19, or the complement thereof.
38. A polynucleotide probe of between 7 and 100 nucleotides in length for detection of C. coli, said polynucleotide comprising at least 7 consecutive nucleotides of the sequence as set forth in SEQ ID NO:31, or the complement thereof.
39. The polynucleotide probe according to claim 38, wherein said polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:32, 36 and 37, or the complement thereof.
40. A polynucleotide probe of between 7 and 100 nucleotides in length for detection of C. lari, said polynucleotide comprising at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:50, 73 and 91 or the complement thereof.
41. The polynucleotide probe according to claim 40, wherein said polynucleotide probe comprises at least 7 consecutive nucleotides of the sequence as set forth in any one of SEQ ID NOs:51, 57, 59, 74, 78, 80, 96, 98, 101 and 103, or the complement thereof.
42. The polynucleotide probe according to any one of claims 36-41, wherein said probe further comprises a fluorophore, a quencher, or a combination thereof.
PCT/CA2005/001403 2004-09-14 2005-09-14 Polynucleotides for the detection of campylobacter species WO2006029522A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US60966604P 2004-09-14 2004-09-14
US60/609,666 2004-09-14

Publications (1)

Publication Number Publication Date
WO2006029522A1 true WO2006029522A1 (en) 2006-03-23

Family

ID=36059674

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2005/001403 WO2006029522A1 (en) 2004-09-14 2005-09-14 Polynucleotides for the detection of campylobacter species

Country Status (1)

Country Link
WO (1) WO2006029522A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8637249B2 (en) 2008-11-14 2014-01-28 Gen-Probe Incorporated Compositions, kits and methods for detection of Campylobacter nucleic acid
CN111793586A (en) * 2020-08-13 2020-10-20 石河子大学 Breast milk source pediococcus pentosaceus and application thereof

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
AL RASHID S.T. ET AL: "Identification of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, Arcobacter butzleri, and A. butzleri-Like Species Based on the glyA gene", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 38, no. 4, April 2000 (2000-04-01), pages 1488 - 1494 *
DINGLE K.E. ET AL: "Multilocus Sequence Typing System for Campylobacter jejuni", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 39, no. 1, January 2001 (2001-01-01), pages 14 - 23 *
IIJIMA Y. ET AL: "Improvement in the detection rate of diarrhoeagenic bacteria in human stool specimens by a rapid real-time PCR assay", JOURNAL OF MEDICAL MICROBIOLOGY, vol. 53, no. 7, July 2004 (2004-07-01), pages 617 - 622 *
SUERBAUM S. ET AL: "Allelic Diversity and Recombination in Campylobacter jejuni", JOURNAL OF BACTERIOLOGY, vol. 183, no. 8, April 2001 (2001-04-01), pages 2553 - 2559 *
VAN DOORN L-J. ET AL: "Rapid Identification of Thermotolerant Campylobacter jejuni, Campylobacter coli,Campylobacter lari, and Campylobacter upsaliensis from Various Geographic Locations by a GTPase-Base PCR-Reverse Hybridization Assay", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 37, no. 6, June 1999 (1999-06-01), pages 1790 - 1796 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8637249B2 (en) 2008-11-14 2014-01-28 Gen-Probe Incorporated Compositions, kits and methods for detection of Campylobacter nucleic acid
US9175353B2 (en) 2008-11-14 2015-11-03 Gen-Probe Incorporated Compositions, kits and methods for detection of campylobacter nucleic acid
US10829824B2 (en) 2008-11-14 2020-11-10 Gen-Probe Incorporated Compositions, kits and methods for detection of campylobacter nucleic acid
CN111793586A (en) * 2020-08-13 2020-10-20 石河子大学 Breast milk source pediococcus pentosaceus and application thereof
CN111793586B (en) * 2020-08-13 2022-05-20 石河子大学 Breast milk source pediococcus pentosaceus and application thereof

Similar Documents

Publication Publication Date Title
US20080254449A1 (en) Polynucleotides For the Detection of Escherichia Coli 0157
Björnsdóttir-Butler et al. Development of molecular-based methods for determination of high histamine producing bacteria in fish
JP2010532665A (en) Nucleic acid sequences and their combinations for sensitive amplification and detection of bacterial and fungal sepsis pathogens
AU782980B2 (en) Nucleic acid molecules for detecting bacteria and phylogenetic units of bacteria
EP2748332B1 (en) Compositions and methods for the detection of multiple microorganisms
US9024002B2 (en) Compositions and methods for detection of Salmonella species
US20030113757A1 (en) Rapid and specific detection of campylobacter
AU2002210536B9 (en) Detection of pathogenic bacteria
US20140005061A1 (en) Compositions and methods for detection of multiple microorganisms
EP1176215B1 (en) Amplification and detection of mycoplasma pneumoniae
US20080108060A1 (en) Polynucleotides for the Detection of Staphylococcus Aureus
WO2006002546A1 (en) Polynucleotides for the detection of listeria species
WO2006029522A1 (en) Polynucleotides for the detection of campylobacter species
EP2929052B1 (en) Compositions and methods for detecting gastrointestinal pathogen nucleic acid
US20070141572A1 (en) Polynucleotides for the detection of listeria moncytogenes
US20070134659A1 (en) Polynucleotides for the detection of salmonella species
EP1344833B1 (en) Method for detecting staphylococcus aureus
WO2003062463A2 (en) One-step multiplex pcr for the identification and differentiation of campylobacter species
CA2569085A1 (en) Polynucleotides for the detection of escherichia coli

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase