AU2001295256B2 - Manipulation of soluble carbohydrates - Google Patents

Description

WO 02/31130 PCT/AU01/01275 MANIPULATION OF SOLUBLE CARBOHYDRATES The present invention relates to nucleic acid fragments encoding amino acid sequences for enzymes and transporter proteins involved in the metabolism and/or transport of soluble carbohydrates, such as sucrose and fructan, and the use thereof for the modification of soluble carbohydrate metabolism and/or transport in plants.

Most higher plants uptake carbon dioxide from air. In photosynthetically active cells carbon dioxide is fixed in the chloroplast and then assimilated to produce carbohydrate. Fixed carbon can be used for synthesis of structural carbohydrates, such as cellulose, xyloglucan and pectin, or for the synthesis of non-structural storage carbohydrates such as sucrose, starch and fructan. Fixed carbon can be stored as starch in the chloroplast or exported from the chloroplast to the cytosol where it can be converted into sucrose. Most of the sucrose formed in source organ cells is exported through the plant phloem to the receiver cells in sink organs, where it can be utilised for growth or can be stored.

The pathway of sucrose synthesis involves three key enzymes: fructose- 1,6-biphosphatase, sucrose phosphate synthase (SPS) and phosphatase.

Fructose-1,6-biphosphatase catalyses the synthesis of fructose-6-phosphate from fructose-1,6-biphosphate. Sucrose phosphate synthase (SPS) activity will produce sucrose phosphate from fructose-6-phosphate and UDP-glucose. The sucrose phosphate is then coverted to sucrose by phosphatase action.

Sucrose phosphate synthase (SPS) plays a very important role as the limiting factor in partitioning of carbon sources. The enhancement of SPS activity in plants thus may increase the ability of the source function.

In plants the breakdown of sucrose to fructose and glucose can be catalysed by invertase (INV) or sucrose synthase These enzymes are central to sucrose metabolism and they are involved in key physiological processes, such as source-sink interactions and carbohydrate partitioning.

Invertases can be divided into neutral (cytosolic) and acid (vacuolar and WO 02/31130 PCT/AU01/01275 2 apoplastic) classes. Sucrose synthase (SS) plays various roles in the synthesis and degradation of sucrose as well as in the flow of carbon from one plant organ to another.

Sugar transport is a fundamental process for the allocation of assimilates in plants. Sucrose is the primary carbohydrate for long-distance transport of carbon assimilates through the vascular system in many plant species. Sucrose transporters (ST) are involved in sucrose phloem loading and transport in plants.

Fructan synthesis in grasses is complex. Three enzymes are involved; sucrose:sucrose 1-fructosyltransferase (SST); fructan:fructan 1fructosyltransferase (FFT); and sucrose:fructan 6-fructosyltransferase (SFT) which synthesise the more complex fructans that prevail in grasses and cereals.

Fructans are associated with various advantageous characters in forage grasses, such as cold and drought tolerance, increased tiller survival, enhanced persistence, good regrowth after cutting or grazing, improved recovery from stress and early spring growth. High amounts of fructans have been found to accumulate in ryegrasses (Lolium species) and fescues (Festuca species) in response to environmental stresses such as drought and cold.

Sugars affect growth and development throughout the plant life cycle, from germination to flowering to senescence. Sugars are not only important energy sources in plants; they are also central regulatory molecules controlling physiology, metabolism and gene expression. Sugars are physiological signals repressing or activating plant genes involved in many essential processes, including photosynthesis, glyoxylate metabolism, respiration, starch and sucrose synthesis and breakdown, nitrogen metabolism, pathogen defense, wounding response, senescence, pigmentation and cell cycle regulation.

Partitioning of assimilate between individual tissues and organs is essential for growth and development in higher plants. Sink-source interactions are closely associated to crop yields.

WO 02/31130 PCT/AU01/01275 3 Furthermore, soluble carbohydrates such as fructans and sucrose in forage grasses contribute significantly to the readily available energy in the feed for grazing ruminant animals. The fermentation processes in the rumen require considerable readily available energy. The improvement of the readily available energy in the rumen can increase the efficiency of rumen digestion. An increased efficiency in rumen digestion leads to an improved conversion of the forage protein fed to the ruminant animal into milk or meat, and to a reduction in nitrogenous waste as environmental pollutant.

Thus, it would be desirable to have methods of manipulating soluble carbohydrate metabolism (synthesis and degradation) and/or transport in plants, including grass species such as ryegrasses (Lolium species) and fescues (Festuca species), and legumes such as clovers (Trifolium species), lucerne and medics (Medicago species). For example, it may be desirable to facilitate the production of pasture grasses and pasture legumes with, for example, enhanced or modified soluble carbohydrate content or composition, enhanced tolerance to biotic and abiotic stresses, enhanced persistence and improved herbage quality, enhanced yield, altered growth and development, leading to improved pasture production and quality, improved animal production and reduced environmental pollution.

Perennial ryegrass (Lolium perenne is a key pasture grass in temperate climates throughout the world. Perennial ryegrass is also an important turf grass.

Clovers (Trifolium species) such as white clover repens), red clover (T.

pratense) and subterranean clover subterraneum), and lucerne sativa) and medics (Medicago species) are fructan-devoid, starch-accumulating key pasture legumes in temperate climates throughout the world.

While nucleic acid sequences encoding some of the enzymes involved in soluble carbohydrate metabolism and transport have been isolated for certain species of plants, there remains a need for materials useful in the modification of soluble carbohydrate metabolism and transport, for example sucrose metabolism, WO 02/31130 PCT/AU01/01275 4 sucrose transport and fructan metabolism, in a wide range of plants, particularly in forage grasses and legumes including ryegrasses and fescues, and for methods for their use. There remains further a need for materials useful in engineering fructan accumulation in plant species which are naturally fructan-devoid.

It is an object of the present invention to overcome, or at least alleviate, one or more of the difficulties or deficiencies associated with the prior art.

In one aspect, the present invention provides substantially purified or isolated nucleic acids or nucleic acid fragments encoding amino acid sequences for the following enzymes or transporter proteins from a ryegrass (Lolium) or fescue (Festuca) species, or functionally active fragments or variants thereof: sucrose phosphate synthase (SPS), invertase (INV), sucrose synthase (SS), sucrose transporter sucrose:sucrose 1-fructosyltransferase (SST), fructan:fructan 1 -fructosyltransferase (FFT), and sucrose:fructan 6fructosyltransferase (SFT) The present invention also provides substantially purified or isolated nucleic acids or nucleic acid fragments encoding amino acid sequences for a class of proteins which are related to SPS, INV, SS, ST, SST, FFT and SFT, or functionally active fragments or variants thereof. Such proteins are referred to herein as SPSlike, INV-like, SS-like, ST-like, SST-like, FFT-like and SFT-like, respectively.

The ryegrass (Lolium) or fescue (Festuca) species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow fescue and red fescue. Preferably the species is a ryegrass, more preferably perennial ryegrass perenne).

The nucleic acid or nucleic acid fragment may be of any suitable type and includes DNA (such as cDNA or genomic DNA) and RNA (such as mRNA) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases, and combinations thereof.

11/10/2007 16:47 FREEHILLS 03 7/22 005038924 4A

O

c In a preferred embodiment, the present invention provides a substantially purified or 0 isolated nucleic acid or nucleic acid fragment encoding an enzyme or transporter protein

O

Sselected from the group consisting of sucrose phosphate synthase (SPS), invertase (INV), sucrose synthase sucrose transporter fructan:fructan 1fructosyltransferase (FFT), and sucrose:fructan 6-fructosyltransferase (SFT), and sucrose:sucrose 1-fructosyltransferase (SST), from a Lolium species, or a functionally active fragment or variant thereof.

SPreferably, the Lolium species is Lolium perenne or Lolium arundinaceum.

N In a preferred embodiment, the present invention provides a substantially purified or isolated nucleic acid or nucleic acid fragment encoding an INV, or complementary or antisense to an INV-encoding sequence, and including a nucleotide sequence selected from the group consisting of sequences shown in Figures 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 64 and 69 hereto; (Sequence ID Nos: 24, 26 to 30, 31, 33 to 36, 37, 39 and 40, 41, 43 to 58, 59, 61 and 62, 63, 65 to 70, 71, 73 to 75, 112 and 114, respectively); complements of the sequences recited in sequences antisense to the sequences recited in and and functionally active fragments and variants of the sequences recited in and Preferably, the functionally active fragments and variants have at least approximately identity to the relevant part of the sequences recited in and and have a size of at least 20 nucleotides.

COMS ID No: ARCS-164418 Received by IP Australia: Time 16:51 Date 2007-10-11 WO 02/31130 PCT/AU01/01275 The term "isolated" means that the material is removed from its original environment (eg. the natural environment if it is naturally occurring). For example, a naturally occurring nucleic acid present in a living plant is not isolated, but the same nucleic acid separated from some or all of the coexisting materials in the natural system, is isolated. Such nucleic acids could be part of a vector and/or such nucleic acids could be part of a composition, and still be isolated in that such a vector or composition is not part of its natural environment.

Such nucleic acids or nucleic acid fragments could be assembled to form a consensus contig. As used herein, the term "consensus contig" refers to a nucleotide sequence that is assembled from two or more constituent nucleotide sequences that share common or overlapping regions of sequence homology. For example, the nucleotide sequence of two or more nucleic acids or nucleic acid fragments can be compared and aligned in order to identify common or overlapping sequences. Where common or overlapping sequences exist between two or more nucleic acids or nucleic acid fragments, the sequences (and thus their corresponding nucleic acids or nucleic acid fragments) can be assembled into a single contiguous nucleotide sequence.

In a preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a SPS or SPSlike protein includes a nucleotide sequence selected from the group consisting of sequences shown in Figures 1, 3, 5, 6, 8, 9, 11, 12, 14, 15 and 17 hereto; (Sequence ID Nos: 1, 3, 5 and 6, 7, 9 and 10, 11, 13 and 14, 15, 17 and 18, 19 and 21 to 23, respectively) complements of the sequences recited in (c) sequences antisense to the sequences recited in and and functionally active fragments and variants of the sequences recited in and In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding an INV or INV-like protein includes a nucleotide sequence selected from the group consisting of sequences shown in Figures 18, 20, 21, 23, 24, 26, 27, 29, 32, 33, 35, 36, 38, 64 and 69 hereto (Sequence ID Nos: 24, 26 to 30, 31, 33 to 36, WO 02/31130 PCT/AU01/01275 6 37, 39 and 40, 41, 43 to 58, 59, 61 and 62, 63, 65 to 70, 71, 73 to 75, 112 and 114, respectively); complements of the sequences recited in (c) sequences antisense to the sequences recited in and and functionally active fragments and variants of the sequences recited in and In another preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding an SS or SS-like protein includes a nucleotide sequence selected from the group consisting of sequences shown in Figures 39, 41, 43, 44, 46 and 74 hereto (Sequence ID Nos: 76, 78, 80 to 82, 83, 85 and 86, and 116, respectively); (b) complements of the sequences recited in sequences antisense to the sequences recited in and and functionally active fragments and variants of the sequences recited in and In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a ST or ST-like protein includes a nucleotide sequence selected from the group consisting of sequences shown in Figures 47, 49, 50, 52, 53, and 55 hereto (Sequence ID Nos: 87, 89 and 90, 91, 93 to 96, 97, and 99 and 100, respectively); complements of the sequences recited in sequences antisense to the sequences recited in and and functionally active fragments and variants of the sequences recited in and In another preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a SST or SST-like protein includes a nucleotide sequence selected from the group consisting of sequence shown in Figure 56 hereto (Sequence ID No: 101); (b) a complement of the sequences recited in sequences antisense to the sequences recited in and and functionally active fragments and variants of the sequences recited in and In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a WO 02/31130 PCT/AU01/01275 7 FFT or FFT-like protein includes a nucleotide sequence selected from the group consisting of sequences shown in Figures 58 and 60 hereto (Sequence ID Nos: 103 and 105 to 109, respectively); complements of the sequences recited in sequences antisense to the sequences recited in and and (d) functionally active fragments and variants of the sequences recited in and In another preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid fragment encoding a SFT or SFT-like protein includes a nucleotide sequence selected from the group consisting of (a) sequence shown in Figure 61 hereto (Sequence ID No: 110); complement of the sequence recited in sequences antisense to the sequences recited in and and functionally active fragments and variants of the sequences recited in and By "functionally active" in relation to nucleic acids it is meant that the fragment or variant (such as an analogue, derivative or mutant) encodes a polypeptide capable of modifying soluble carbohydrate metabolism and/or transport, for example sucrose biosynthesis, sucrose degradation, sucrose transport, fructan biosynthesis and/or fructan degradation, in a plant. Such variants include naturally occurring allelic variants and non-naturally occurring variants.

Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant. Preferably the functionally active fragment or variant has at least approximately 80% identity to the relevant part of the above mentioned sequence, more preferably at least approximately identity, most preferably at least approximately 95% identity. Such functionally active variants and fragments include, for example, those having nucleic acid changes which result in conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 10 nucleotides, more preferably at least 15 nucleotides, most preferably at least 20 nucleotides.

WO 02/31130 PCT/AU01/01275 8 The nucleic acid fragments encoding at least a portion of several sucrose metabolism or. sucrose metabolism-like enzymes, sucrose transporter or sucrose transporter-like proteins, and fructan metabolism or fructan metabolism-like enzymes have been isolated and identified. The nucleic acids and nucleic acid fragments of the present invention may be used to isolate cDNAs and genes encoding homologous proteins from the same or other plant species. Isolation of homologous genes using sequence-dependent protocols is well known in the art.

Examples of sequence-dependent protocols include, but are not limited to, methods of nucleic acid hybridisation, and methods of DNA and RNA amplification as exemplified by various uses of nucleic acid amplification technologies (e.g.

polymerase chain reaction, ligase chain reaction).

For example, genes encoding other sucrose metabolism or sucrose metabolism-like enzymes, sucrose transporter or sucrose transporter-like proteins, and fructan metabolism or fructan metabolism-like enzymes, either as cDNAs or genomic DNAs, may be isolated directly by using all or a portion of the nucleic acids or nucleic acid fragments of the present invention as hybridisation probes to screen libraries from the desired plant employing the methodology well known to those skilled in the art. Specific oligonucleotide probes based upon the nucleic acid sequences of the present invention may be designed and synthesized by methods known in the art. Moreover, the entire sequences may be used directly to synthesize DNA probes by methods known to the skilled artisan such as random primer DNA labelling, nick translation, or end-labelling techniques, or RNA probes using available in vitro transcription systems. In addition, specific primers may be designed and used to amplify a part or all of the sequences of the present invention. The resulting amplification products may be labelled directly during amplification reactions or labelled after amplification reactions, and used as probes to isolate full length cDNA or genomic fragments under conditions of appropriate stringency.

In addition, short segments of the nucleic acids or nucleic acid fragments of the present invention may be used in amplification protocols to amplify longer nucleic acids or nucleic acid fragments encoding homologous genes from DNA or 11/10/2007 16:47 FREEHILLS 03 8/22 005038924 0

I

RNA. For example, the polymerase chain reaction may be performed on a library of 0 cloned nucleic acid fragments wherein the sequence of one primer is derived from the nucleic acids or nucleic acid fragments of the present invention, and the sequence of the other primer takes advantage of the presence of the polyadenylic acid tracts to the 3' end of the mRNA precursor encoding plant genes. Alternatively, the second primer sequence may be based upon sequences derived from the cloning vector. For example, those skilled in the art can follow the RACE protocol (Frohman et al. (1988) Proc. Natl.

O Acad Sci. USA 85:8998, the entire disclosure of which is incorporated herein by Sreference) to generate cDNAs by using PCR to amplify copies of the region between a single point in the transcript and the 3' or 5' end. Using commercially available 3' RACE and 5' RACE systems (BRL), specific 3' or 5' cDNA fragments may be isolated (Ohara et al. (1989) Proc. Natl. Acad Sci USA 86:5673; Loh et al. (1989) Science 243:217; the entire disclosures of which are incorporated herein by reference). Products generated by the 3' and 5' RACE procedures may be combined to generate full-length cDNAs.

In a second aspect of the present invention there is provided a substantially purified or isolated polypeptide from a ryegrass (Lolium) or fescue (Festuca) species, selected from the group consisting of SPS and SPS-like, INV and INV-like, SS and SSlike, ST and ST-like, SST and SST-like, FFT and FFT-like, SFT and SFT-like, enzymes and proteins; and functionally active fragments and variants thereof.

The ryegrass (Lolium) or fescue (Festuca) species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow fescue and red fescue. Preferably the species is a ryegrass, more preferably perennial ryegrass (L.

perenne).

In a preferred embodiment the present invention provides a substantially purified polypeptide selected from the group consisting of the enzymes or transporter proteins SPS and SPS-like, INV and INV-like, SS and SS-like, ST and ST-like, FFT and FFTlike, SFT and SFT-like and SST and SST-like, from a Lolium species; and functionally active fragments and variants thereof.

Preferably, the Lolium species is Lolium perenne or Lolium arundinaceum.

COMS ID No: ARCS-164418 Received by IP Australia: Time 16:51 Date 2007-10-11 11/10/2007 18:47 FREEHILLS 03 9/22 C508924 9A N in a preferred embodiment, the present invention provides a substantially purified O INV or INV-like polypeptide including an amino acid sequence selected from the group C) of sequences shown in Figures 19, 22, 25, 28, 31, 34, 37, 65 and 70 hereto (Sequence ID Nos: 25, 32, 38, 42, 60. 64, 72, 113 and 115, respectively); and functionally active fragments and variants thereof.

VaO Preferably, the functionally active fragments and variants have at least ON approximately 95% identity with the recited sequences and have a size of at least amino acids.

in a preferred embodiment of this aspect of the invention, the substantially purified or isolated SPS or SPS-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 2, 4, 7, 10, 13 and 16 hereto (Sequence ID Nos: 2, 4, 8, 12, 16 and 20, respectively); and functionally active fragments and variants thereof.

COMS ID No: ARCS-164418 Received by IP Australia: Time (I-tm) 16:51 Date 2007-10-11 WO 02/31130 PCT/AU01/01275 In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated INV or INV-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 19, 22, 25, 28, 31, 34, 37, 65 and 70 hereto (Sequence ID Nos: 25, 32, 38, 42, 64, 72, 113 and 115, respectively); and functionally active fragments and variants thereof.

In another preferred embodiment of this aspect of the invention, the substantially purified or isolated SS or SS-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 42, 45 and 75 hereto (Sequence ID Nos: 77, 79, 84 and 117, respectively); and functionally active fragments and variants thereof.

In a still further preferred embodiment of this aspect of the invention, the substantially purified or isolated ST or ST-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 48, 51 and 54 hereto (Sequence ID Nos: 88, 92 and 98, respectively); and functionally active fragments and variants thereof.

In another preferred embodiment of this aspect of the invention, the substantially purified or isolated SST or SST-like polypeptide includes an amino acid sequence shown in Figure 57 hereto (Sequence ID No: 102); and functionally active fragments and variants thereof.

In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated FFT or FFT-like polypeptide includes an amino acid sequence shown in Figure 59 hereto (Sequence ID No: 104); and functionally active fragments and variants thereof.

In another preferred embodiment of this aspect of the invention, the substantially purified or isolated SFT or SFT-like polypeptide includes an amino acid sequence shown in Figure 62 hereto (Sequence ID No: 111); and functionally active fragments and variants thereof.

WO 02/31130 PCT/AU01/01275 11 By "functionally active" in relation to polypeptides it is meant that the fragment or variant has one or more of the biological properties for the proteins SPS, SPS-like, INV, INV-like, SS, SS-like, ST, ST-like, SST, SST-like, FFT, FFTlike, SFT and SFT-like, respectively. Additions, deletions, substitutions and derivatizations of one or more of the amino acids are contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant.

Preferably the functionally active fragment or variant has at least approximately identity to the relevant part of the above mentioned sequence, more preferably at least approximately 80% identity, most preferably at least approximately 90% identity. Such functionally active variants and fragments include, for example, those having conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 10 amino acids, more preferably at least 15 amino acids, most preferably at least 20 amino acids.

In a further embodiment of this aspect of the invention, there is provided a polypeptide recombinantly produced from a nucleic acid or nucleic acid fragment according to the present invention. Techniques for recombinantly producing polypeptides are well known to those skilled in the art.

Availability of the nucleotide sequences of the present invention and deduced amino acid sequences facilitates immunological screening of cDNA expression libraries. Synthetic peptides representing portions of the instant amino acid sequences may be synthesized. These peptides may be used to immunise animals to produce polyclonal or monoclonal antibodies with specificity for peptides and/or proteins including the amino acid sequences. These antibodies may be then used to screen cDNA expression libraries to isolate full-length cDNA clones of interest.

A genotype is the genetic constitution of an individual or group. Variations in genotype are important in commercial breeding programs, in determining parentage, in diagnostics and fingerprinting, and the like. Genotypes can be readily described in terms of genetic markers. A genetic marker identifies a WO 02/31130 PCT/AU01/01275 12 specific region or locus in the genome. The more genetic markers, the finer defined is the genotype. A genetic marker becomes particularly useful when it is allelic between organisms because it then may serve to unambiguously identify an individual. Furthermore, a genetic marker becomes particularly useful when it is based on nucleic acid sequence information that can unambiguously establish a genotype of an individual and when the function encoded by such nucleic acid is known and is associated with a specific trait. Such nucleic acids and/or nucleotide sequence information including single nucleotide polymorphisms (SNP's), variations in single nucleotides between allelic forms of such nucleotide sequence, can be used as perfect markers or candidate genes for the given trait.

Applicants have identified a number of SNP's of the nucleic acids and nucleic acid fragments of the present invention. These are indicated (marked with grey on the black background) in the figures that show multiple alignments of nucleotide sequences of nucleic acid fragments contributing to consensus contig sequences. See for example, Figures 5, 8, 14, 17, 20, 23, 29, 32, 35, 38, 43 and (Sequence ID Nos: 5 and 6, 9 and 10, 17 and 18, 21 to 23, 26 to 30, 33 to 36, 43 to 58, 61 and 62, 65 to 70, 73 to 75, 80 to 82, and 105 to 109, respectively).

Accordingly, in a further aspect of the present invention, there is provided a substantially purified or isolated nucleic acid or nucleic acid fragment including a single nucleotide polymorphism (SNP) from a nucleic acid or nucleic acid fragment according to the present invention, or complements or sequences antisense thereto, and functionally active fragments and variants thereof.

In a still further aspect of the present invention there is provided a method of isolating a nucleic acid or nucleic acid fragment of the present invention including a single nucleotide polymorphism (SNP), said method including sequencing nucleic acid fragments from a nucleic acid library.

The nucleic acid library may be of any suitable type and is preferably a cDNA library.

WO 02/31130 PCT/AU01/01275 13 The nucleic acid or nucleic acid fragment may be isolated from a recombinant plasmid or may be amplified, for example using polymerase chain reaction.

The sequencing may be performed by techniques known to those skilled in the art.

In a still further aspect of the present invention, there is provided use of nucleic acids or nucleic acid fragments of the present invention including SNPs, and/or nucleotide sequence information thereof, as molecular genetic markers.

In a still further aspect of the present invention there is provided use of a nucleic acid or nucleic acid fragment according to the present invention, and/or nucleotide sequence information thereof, as a molecular genetic marker.

More particularly, nucleic acids or nucleic acid fragments according to the present invention and/or nucleotide sequence information thereof may be used as a molecular genetic marker for quantitative trait loci (QTL) tagging, QTL mapping, DNA fingerprinting and in marker assisted selection, particularly in ryegrasses and fescues. Even more particularly, nucleic acids or nucleic acid fragments according to the present invention and/or nucleotide sequence information thereof may be used as molecular genetic markers in forage and turf grass improvement, e.g.

tagging QTLs for herbage quality traits, dry matter digestibility, biotic stress tolerance, abiotic stress tolerance, plant stature, leaf and stem colour, carbohydrate content, carbohydrate storage. Even more particularly, sequence information revealing SNPs in allelic variants of the nucleic acids or nucleic acid fragments of the present invention and/or nucleotide sequence information thereof may be used as molecular genetic markers for QTL tagging and mapping and in marker assisted selection, particularly in ryegrasses and fescues.

In a still further aspect of the present invention there is provided a construct including a nucleic acid or nucleic acid fragment according to the present invention.

WO 02/31130 PCT/AU01/01275 14 The term "construct" as used herein refers to an artificially assembled or isolated nucleic acid molecule which includes the gene of interest. In general a construct may include the gene or genes of interest, a marker gene which in some cases can also be the gene of interest and appropriate regulatory sequences. It should be appreciated that the inclusion of regulatory sequences in a construct is optional, for example, such sequences may not be required in situations where the regulatory sequences of a host cell are to be used. The term construct includes vectors but should not be seen as being limited thereto.

In a still further aspect of the present invention there is provided a vector including a nucleic acid or nucleic acid fragment according to the present invention.

The term "vector" as used herein includes both cloning and expression vectors. Vectors are often recombinant molecules including nucleic acid molecules from several sources.

In a preferred embodiment of this aspect of the invention, the vector may include a regulatory element such as a promoter, a nucleic acid or nucleic acid fragment according to the present invention and a terminator; said regulatory element, nucleic acid or nucleic acid fragment and terminator being operatively linked.

By "operatively linked" is meant that said regulatory element is capable of causing expression of said nucleic acid or nucleic acid fragment in a plant cell and said terminator is capable of terminating expression of said nucleic acid or nucleic acid fragment in a plant cell. Preferably, said regulatory element is upstream of said nucleic acid or nucleic acid fragment and said terminator is downstream of said nucleic acid or nucleic acid fragment.

The vector may be of any suitable type and may be viral or non-viral. The vector may be an expression vector. Such vectors include chromosomal, nonchromosomal and synthetic nucleic acid sequences, eg. derivatives of plant viruses; bacterial plasmids; derivatives of the Ti plasmid from Agrobacterium WO 02/31130 PCT/AU01/01275 tumefaciens, derivatives of the Ri plasmid from Agrobacterium rhizogenes; phage DNA; yeast artificial chromosomes; bacterial artificial chromosomes; binary bacterial artificial chromosomes; vectors derived from combinations of plasmids and phage DNA. However, any other vector may be used as long as it is replicable, integrative or viable in the plant cell.

The regulatory element and terminator may be of any suitable type and may be endogenous to the target plant cell or may be exogenous, provided that they are functional in the target plant cell.

Preferably the regulatory element is a promoter. A variety of promoters which may be employed in the vectors of the present invention are well known to those skilled in the art. Factors influencing the choice of promoter include the desired tissue specificity of the vector, and whether constitutive or inducible expression is desired and the nature of the plant cell to be transformed (eg.

monocotyledon or dicotyledon). Particularly suitable constitutive promoters include the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter, the maize Ubiquitin promoter, and the rice Actin promoter.

A variety of terminators which may be employed in the vectors of the present invention are also well known to those skilled in the art. The terminator may be from the same gene as the promoter sequence or a different gene.

Particularly suitable terminators are polyadenylation signals, such as the CaMV polyA and other terminators from the nopaline synthase (nos), the octopine synthase (ocs) and the rbcS genes.

The vector, in addition to the regulatory element, the nucleic acid or nucleic acid fragment of the present invention and the terminator, may include further elements necessary for expression of the nucleic acid or nucleic acid fragment, in different combinations, for example vector backbone, origin of replication (ori), multiple cloning sites, spacer sequences, enhancers, introns (such as the maize Ubiquitin Ubi intron), antibiotic resistance genes and other selectable marker genes [such as the neomycin phosphotransferase (npt2) gene, the hygromycin WO 02/31130 PCT/AU01/01275 16 phosphotransferase (hph) gene, the phosphinothricin acetyltransferase (bar or pat) gene], and reporter genes (such as beta-glucuronidase (GUS) gene (gusA)]. The vector may also contain a ribosome-binding site for translation initiation. The vector may also include appropriate sequences for amplifying expression.

As an alternative to use of a selectable marker gene to provide a phenotypic trait for selection of transformed host cells, the presence of the vector in transformed cells may be determined by other techniques well known in the art, such as PCR (polymerase chain reaction), Southern blot hybridisation analysis, histochemical GUS assays, northern and Western blot hybridisation analyses.

Those skilled in the art will appreciate that the various components of the vector are operatively linked, so as to result in expression of said nucleic acid or nucleic acid fragment. Techniques for operatively linking the components of the vector of the present invention are well known to those skilled in the art. Such techniques include the use of linkers, such as synthetic linkers, for example including one or more restriction enzyme sites.

The vectors of the present invention may be incorporated into a variety of plants, including monocotyledons (such as grasses from the genera Lolium, Festuca, Paspalum, Pennisetum, Panicum and other forage and turfgrasses, corn, oat, sugarcane, wheat and barley), dicotyledons (such as arabidopsis, tobacco, white clover, red clover, subterranean clover, alfalfa, eucalyptus, potato, sugarbeet) and gymnosperms. In a preferred embodiment, the vectors may be used to transform monocotyledons, preferably grass species such as ryegrasses (Lolium species) and fescues (Festuca species), even more preferably perennial ryegrass, including forage- and turf-type cultivars. In a preferred embodiment, the vectors are used to transform dicotyledons, preferably forage legume species such as clovers (Trifolium species) and medics (Medicago species), more preferably white clover (Trifolium repens), red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum) and lucerne (Medicago sativa).

WO 02/31130 PCT/AU01/01275 17 Techniques for incorporating the vectors of the present invention into plant cells (for example by transduction, transfection or transformation) are well known to those skilled in the art. Such techniques include Agrobacterium mediated introduction, electroporation to tissues, cells and protoplasts, protoplast fusion, injection into reproductive organs, injection into immature embryos and high velocity projectile introduction to cells, tissues, calli, immature and mature embryos. The choice of technique will depend largely on the type of plant to be transformed.

Cells incorporating the vectors of the present invention may be selected, as described above, and then cultured in an appropriate medium to regenerate transformed plants, using techniques well known in the art. The culture conditions, such as temperature, pH and the like, will be apparent to the person skilled in the art. The resulting plants may be reproduced, either sexually or asexually, using methods well known in the art, to produce successive generations of transformed plants.

In a further aspect of the present invention there is provided a plant cell, plant, plant seed or other plant part, including, e.g. transformed with, a construct or vector of the present invention.

The plant cell, plant, plant seed or other plant part may be from any suitable species, including monocotyledons, dicotyledons and gymnosperms. In a preferred embodiment the plant cell, plant, plant seed or other plant part is from a monocotyledon, preferably a grass species, more preferably a ryegrass (Lolium species) or fescue (Festuca species), even more preferably perennial ryegrass, including both forage- and turf-type cultivars. In a preferred embodiment the plant cell, plant, plant seed or other plant part is from a dicotyledon, preferably forage legume species such as clovers (Trifolium species) and medics (Medicago species), more preferably white clover (Trifolium repens), red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum) and lucerne (Medicago sativa).

WO 02/31130 PCT/AU01/01275 18 The present invention also provides a plant, plant seed or other plant part derived from a plant cell of the present invention.

The present invention also provides a plant, plant seed or other plant part derived from a plant of the present invention.

In a further aspect of the present invention there is provided a method of modifying soluble carbohydrate metabolism and/or transport in a plant, said method including introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment, construct and/or vector according to the present invention. The soluble carbohydrate metabolism and/or transport may be, for example, sucrose biosynthesis and/or sucrose degradation and/or sucrose transport and/or fructan biosynthesis and/or fructan degradation.

By "an effective amount" is meant an amount sufficient to result in an identifiable phenotypic trait in said plant, or a plant, plant seed or other plant part derived therefrom. Such amounts can be readily determined by an appropriately skilled person, taking into account the type of plant, the route of administration and other relevant factors. Such a person will readily be able to determine a suitable amount and method of administration. See, for example, Maniatis et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, the entire disclosure of which is incorporated herein by reference.

Using the methods and materials of the present invention, plant soluble carbohydrate metabolism and/or transport may be increased or decreased. For example, sucrose biosynthesis, sucrose degradation, sucrose transport, fructan biosynthesis and/or fructan degradation may be increased, decreased or otherwise modified relative to an untransformed control plant. They may be increased or otherwise modified, for example, by incorporating additional copies of a sense nucleic acid or nucleic acid fragment of the present invention. They may be decreased or otherwise modified, for example, by incorporating an antisense nucleic acid or nucleic acid fragment of the present invention. In addition, the number of copies of genes encoding different enzymes in the fructan biosynthetic WO 02/31130 PCT/AU01/01275 19 pathway may be manipulated to modify the degree of polymerization of the molecule synthesized, and/or the linkages between different fructose subunits in the molecule, thereby altering the composition of fructans produced.

In a still further aspect of the present invention there is provided a fructan or modified fructan or a sucrose or modified sucrose substantially or partially purified or isolated from a plant, plant seed or other plant part of the present invention.

Such fructan or sucrose may be modified from naturally occurring fructan or sucrose in terms of their monomeric sugar composition, the degree of linkage and/or nature of linkages between the monomers, the degree of polymerization (number of units) of the molecule.

The present invention will now be more fully described with reference to the accompanying Examples and drawings. It should be understood, however, that the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above.

In the Figures Figure 1 shows the nucleotide sequence of LpSPSa (Sequence ID No: 1).

Figure 2 shows the deduced amino acid sequence of LpSPSa (Sequence ID No: 2).

Figure 3 shows the consensus contig nucleotide sequence of LpSPSb (Sequence ID No: 3).

Figure 4 shows the deduced amino acid sequence of LpSPSb Sequence ID No: 4).

Figure 5 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSb (Sequence ID Nos: 5 and 6).

WO 02/31130 PCT/AU01/01275 Figure 6 shows the consensus contig nucleotide sequence of LpSPSc (Sequence ID No: 7).

Figure 7 shows the deduced amino acid sequence of LpSPSc (Sequence ID No: 8).

Figure 8 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSc (Sequence ID Nos: 9 and Figure 9 shows the consensus contig nucleotide sequence of LpSPSd (Sequence ID No: 11).

Figure 10 shows the deduced amino acid sequence of LpSPSd (Sequence ID No: 12).

Figure 11 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSd (Sequence ID Nos: 13 and 14).

Figure 12 shows the consensus contig nucleotide sequence of LpSPSe (Sequence ID No: Figure 13 shows the deduced amino acid sequence of LpSPSe (Sequence ID No: 16).

Figure 14 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSe (Sequence ID Nos: 17 and 18).

Figure 15 shows the consensus contig nucleotide sequence of LpSPSf (Sequence ID No: 19).

WO 02/31130 PCT/AU01/01275 21 Figure 16 shows the deduced amino acid sequence of LpSPSf (Sequence ID No: Figure 17 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSf (Sequence ID Nos: 21, 22 and 23).

Figure 18 shows the consensus contig nucleotide sequence of LplNVa (Sequence ID No: 24).

Figure 19 shows the deduced amino acid sequence of LplNVa (Sequence ID No: Figure 20 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVa (Sequence ID Nos: 26 to Figure 21 shows the consensus contig nucleotide sequence of LplNVb (Sequence ID No: 31).

Figure 22 shows the deduced amino acid sequence of LplNVb (Sequence ID No: 32).

Figure 23 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVb (Sequence ID Nos: 33 to 36).

Figure 24 shows the consensus contig nucleotide sequence of LplNVc (Sequence ID No: 37).

Figure 25 shows the deduced amino acid sequence of LplNVc (Sequence ID No: 38).

WO 02/31130 PCT/AU01/01275 22 Figure 26 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVc (Sequence ID Nos: 39 and Figure 27 shows the consensus contig nucleotide sequence of LplNVd (Sequence ID No: 41).

Figure 28 shows the deduced amino acid sequence of LplNVd (Sequence ID No: 42).

Figure 29 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVd (Sequence ID Nos: 43 to 58).

Figure 30 shows the consensus contig nucleotide sequence of LplNVe (Sequence ID No: 59).

Figure 31 shows the deduced amino acid sequence of LplNVe (Sequence ID No: Figure 32 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVe (Sequence ID Nos: 61 and 62).

Figure 33 shows the consensus contig nucleotide sequence of LplNVf (Sequence ID No: 63).

Figure 34 shows the deduced amino acid sequence of LplNVf (Sequence ID No: 64).

Figure 35 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVf (Sequence ID Nos: to WO 02/31130 PCT/AU01/01275 23 Figure 36 shows the consensus contig nucleotide sequence of LplNVg (Sequence ID No: 71).

Figure 37 shows the deduced amino acid sequence of LplNVg (Sequence ID No: 72).

Figure 38 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVg (Sequence ID Nos: 73 to Figure 39 shows the nucleotide sequence of LpSSa (Sequence ID No: 76).

Figure 40 shows the deduced amino acid sequence of LpSSa (Sequence ID No: 77).

Figure 41 shows the consensus contig nucleotide sequence of LpSSb (Sequence ID No: 78).

Figure 42 shows the deduced amino acid sequence of LpSSb (Sequence ID No: 79).

Figure 43 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSSb (Sequence ID Nos: to 82).

Figure 44 shows the consensus contig nucleotide sequence of LpSSc (Sequence ID No: 83).

Figure 45 shows the deduced amino acid sequence of LpSSc (Sequence ID No: 84).

Figure 46 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSSc (Sequence ID Nos: and 86).

WO 02/31130 PCT/AU01/01275 24 Figure 47 shows the consensus contig nucleotide sequence of LpSTa (Sequence ID No: 87).

Figure 48 shows the deduced amino acid sequence of LpSTa (Sequence ID No: 88).

Figure 49 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSTa (Sequence ID Nos: 89 and Figure 50 shows the consensus contig nucleotide sequence of LpSTb (Sequence ID No: 91).

Figure 51 shows the deduced amino acid sequence of LpSTb (Sequence ID No: 92).

Figure 52 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSTb (Sequence ID Nos: 93 to 96).

Figure 53 shows the consensus contig nucleotide sequence of LpSTc (Sequence ID No: 97).

Figure 54 shows the deduced amino acid sequence of LpSTc (Sequence ID No: 98).

Figure 55 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSTc (Sequence ID No: 99 and 100).

Figure 56 shows the nucleotide sequence of LpSSTa (Sequence ID No: 101).

WO 02/31130 PCT/AU01/01275 Figure 57 shows the deduced amino acid sequence of LpSSTa (Sequence ID No: 102).

Figure 58 shows the consensus contig nucleotide sequence of LpFFTa (Sequence ID No: 103).

Figure 59 shows the deduced amino acid sequence of LpFFTa (Sequence ID No: 104).

Figure 60 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpFFTa (Sequence ID Nos: 105 to 109).

Figure 61 shows the nucleotide sequence of LpSFTa (Sequence ID No: 110).

Figure 62 shows the deduced amino acid sequence of LpSFTa (Sequence ID No: 111).

Figure 63 shows the plasmid map of the cDNA encoding perennial ryegrass Invertasel (LpCWlnvertasel).

Figure 64 shows the nucleotide sequence of perennial ryegrass Invertasel (Sequence ID No: 112).

Figure 65 shows the deduced amino acid sequence of perennial ryegrass Invertasel cDNA (Sequence ID No: 113).

Figure 66 shows plasmid maps of sense and antisense constructs of Lplnvertasel in pDH51 transformation vector.

Figure 67 shows screening by Southern hybridisation for RFLPs using Lplnvertasel as a probe.

WO 02/31130 PCT/AU01/01275 26 Figure 68 shows the plasmid map of the cDNA encoding perennial ryegrass Invertase2 (LpCWlnvertase2).

Figure 69 shows the nucleotide sequence of perennial ryegrass Invertase2 (Sequence ID No: 114).

Figure 70 shows the deduced amino acid sequence of perennial ryegrass Invertase2 cDNA (Sequence ID No: 115).

Figure 71 shows plasmid maps of sense and antisense constructs of Lplnvertase2 in pDH51 transformation vector.

Figure 72 shows screening by Southern hybridisation for RFLPs using Lplnvertase2 as a probe.

Figure 73 shows the plasmid map of the cDNA encoding perennial ryegrass Sucrose Synthase (LpSucrose Synthase).

Figure 74 shows the nucleotide sequence of perennial ryegrass Sucrose Synthase (Sequence ID No: 116).

Figure 75 shows the deduced amino acid sequence of perennial ryegrass Sucrose Synthase cDNA (Sequence ID No: 117).

Figure 76 shows plasmid maps of sense and antisense constructs of LpSucrose Synthase in pDH51 transformation vector.

Figure 77 shows screening by Southern hybridisation for RFLPs using LpSucrose Synthase as a probe.

Figure 78 shows the regeneration of transgenic tobacco plants from direct gene transfer to protoplasts of chimeric genes encoding perennial ryegrass enzymes involved in metabolism and transport of soluble carbohydrates.

WO 02/31130 PCT/AU01/01275 27 Figure 79 shows a subgrid of a microarray for the expression profiling of perennial ryegrass genes involved in metabolism and transport of soluble carbohydrates. Red represents up-regulated expression, green represents down-regulated expression and yellow represents no change in expression.

For example, an overlay of microarray images probed with 10LS tissues (red) and 10DS tissues (green). Expression level is relatively expressed as up-regulated in 10LS (red), down-regulated in 10LS (green) and no change in expression (yellow).

Figure 80 shows the genetic linkage map of perennial ryegrass NA6 showing map location of ryegrass genes encoding enzymes involved in metabolism and transport of soluble carbohydrates.

EXAMPLE 1 Preparation of cDNA libraries, isolation and sequencing of cDNAs coding for SPS, INV, SS, ST, SST, FFT, and SFT from perennial ryegrass (Lolium perenne) cDNA libraries representing mRNAs from various organs and tissues of perennial ryegrass (Lolium perenne) were prepared. The characteristics of the libraries are described in Table 1.

TABLE 1 cDNA libraries from perennial ryegrass (Lolium perenne) Library Organ/Tissue 01 rg Roots from 3-4 day old light-grown seedlings 02rg Leaves from 3-4 day old light-grown seedlings 03rg Etiolated 3-4 day old dark-grown seedlings 04rg Whole etiolated seedlings (1-5 day old and 17 days old) Senescing leaves from mature plants 06rg Whole etiolated seedlings (1-5 day old and 17 days old) 07rg Roots from mature plants grown in hydroponic culture 08rg Senescent leaf tissue WO 02/31130 PCT/AU01/01275 09rg Whole tillers and sliced leaves 1, 3, 6, 12 and 24 h after harvesting) Embryogenic suspension-cultured cells 11rg Non-embryogenic suspension-cultured cells 12rg Whole tillers and sliced leaves 1,3, 6, 12 and 24 h after harvesting) 13rg Shoot apices including vegetative apical meristems 14rg Immature inflorescences including different stages of inflorescence meristem and inflorescence development Defatted pollen 16rg Leaf blades and leaf sheaths (rbcL, rbcS, cab, wir2A subtracted) 17rg Senescing leaves and tillers 18rg Drought-stressed tillers (pseudostems from plants subjected to PEGsimulated drought stress) 19rg Non-embryogenic suspension-cultured cells subjected to osmotic stress (grown in media with half-strength salts) 2, 3, 4, 5, 6, 24 and 48 h after transfer) Non-embryogenic suspension-cultured cells subjected to osmotic stress (grown in media with double-strength salts) 2, 3, 4, 5, 6, 24 and 48 h after transfer) 21rg Drought-stressed tillers (pseudostems from plants subjected to PEGsimulated drought stress) 22rg Spikelets with open and maturing florets 23rg Mature roots (specific subtraction with leaf tissue) The cDNA libraries may be prepared by any of many methods available.

For example, total RNA may be isolated using the Trizol method (Gibco-BRL, USA) or the RNeasy Plant Mini kit (Qiagen, Germany), following the manufacturers' instructions. cDNAs may be generated using the SMART PCR cDNA synthesis kit (Clontech, USA), cDNAs may be amplified by long distance polymerase chain reaction using the Advantage 2 PCR Enzyme system (Clontech, USA), cDNAs may be cleaned using the GeneClean spin column (Bio 101, USA), tailed and size fractionated, according to the protocol provided by Clontech. The cDNAs may be introduced into the pGEM-T Easy Vector system 1 (Promega, USA) according to the protocol provided by Promega. The cDNAs in the pGEM-T Easy plasmid vector are transfected into Escherichia coli Epicurian coli ultra competent cells (Stratagene, USA) according to the protocol provided by Stratagene.

WO 02/31130 PCT/AU01/01275 29 Alternatively, the cDNAs may be introduced into plasmid vectors for first preparing the cDNA libraries in Uni-ZAP XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, CA, USA). The Uni-ZAP XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBluescript. In addition, the cDNAs may be introduced directly into precut pBluescript II vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into E. coli DH10B cells according to the manufacturer's protocol (GIBCO BRL Products).

Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant plasmids, or the insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Plasmid DNA preparation may be performed robotically using the Qiagen QiaPrep Turbo kit (Qiagen, Germany) according to the protocol provided by Qiagen. Amplified insert DNAs are sequenced in dye-terminator sequencing reactions to generate partial cDNA sequences (expressed sequence tags or "ESTs"). The resulting ESTs are analyzed using an Applied Biosystems ABI 3700 sequence analyser.

EXAMPLE 2 DNA sequence analyses The cDNA clones encoding SPS, INV, SS, ST, SST, FFT, and SFT were identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al.

(1993) J. Mol. Biol. 215:403-410) searches. The cDNA sequences obtained were analysed for similarity to all publicly available DNA sequences contained in the eBioinformatics nucleotide database using the BLASTN algorithm provided by the National Center for Biotechnology Information (NCBI). The DNA sequences were translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the SWISS-PROT protein sequence database using BLASTx algorithm (v 2.0.1) (Gish and States (1993) Nature Genetics 3:266- 272) provided by the NCBI.

WO 02/31130 PCT/AU01/01275 The cDNA sequences obtained and identified were then used to identify additional identical and/or overlapping cDNA sequences generated using the BLASTN algorithm. The identical and/or overlapping sequences were subjected to a multiple alignment using the CLUSTALw algorithm, and to generate a consensus contig sequence derived from this multiple sequence alignment. The consensus contig sequence was then used as a query for a search against the SWISS-PROT protein sequence database using the BLASTx algorithm to confirm the initial identification.

EXAMPLE 3 Identification and full-length sequencing of perennial ryegrass Invertasel, Invertase2 and Sucrose Synthase cDNAs encoding enzymes involved in metabolism and transport of soluble carbohydrates To fully characterise for the purposes of the generation of probes for hybridisation experiments and the generation of transformation vectors, a set of perennial ryegrass cDNAs encoding enzymes involved in soluble carbohydrate metabolism was identified and fully sequenced.

Full-length cDNAs were identified from our EST sequence database using relevant published sequences (NCBI databank) as queries for BLAST searches.

Full-length cDNAs were identified by alignment of the query and hit sequences using Sequencher (Gene Codes Corp., AnnArbor, MI 48108, USA). The original plasmid was then used to transform chemically competent XL-1 cells (prepared inhouse, CaCI 2 protocol). After colony PCR (using HotStarTaq, Qiagen) a minimum of three PCR-positive colonies per transformation were picked for initial sequencing with M13F and M13R primers. The resulting sequences were aligned with the original EST sequence using Sequencher to confirm identity and one of the three clones was picked for full-length sequencing, usually the one with the best initial sequencing result.

Sequencing was completed by primer walking, i.e. oligonucleotide primers were designed to the initial sequence and used for further sequencing. In most WO 02/31130 PCT/AU01/01275 31 cases the sequencing could be done from both 5' and 3' end. The sequences of the oligonucleotide primers are shown in Table 2. In some instances, however, an extended poly-A tail necessitated the sequencing of the cDNA to be completed from the 5' end.

TABLE 2 List of primers used for sequencing of full-length oDNAs Gene name clone ID primer primer sequence(5-3 LpCWnvertasel t 6r92sF6i2 07rg2lsFOl .f1 ACATAAGCGGTTGCTGGAC IsFOl .f2 GGATGGACTG'rCGAGGATAG T O7rg2lsFO1 .f3 TCGGTTCAGGTGCATAG; IO7rg2lsFOl .f4 TCGGTT~CAACGTGGCATAGG fLpCWlnvertase2 }O7rgl NsBi 0.2 1 07rgl Nsl31 01 ATCTCGCCGACCATCCCG___ O7rgl NsB31 0.4 AGGATGGATACGGCAAAC LpSucroseSynthase 1Org2QsEO9.1 $1 Org2QsEO9.fl TTCAATGCTTCCTTCCCC- 1 org2QsEQ9.2 CGTCCTCTGAGTTCAACCAC 1Org2QsE09.f3

ATCCTCATTGTCACCAGGC

1Org2QsEO9.f4 TTGTGAATGGTGTCTCTGG 1Org2QsEO9.rl TTGTCCGTGTTCTCGCCATC =Org2QsEO9.r2

GGAGCAGGCTGAGTTCAAA

Contigs were then assembled in Sequencher. The contigs include the sequences of the SMART primers used to generate the initial cDNA library as well as pGEM-T Easy vector sequence up to the EcoRI cut site both at the 5' and 3' end.

Plasmid maps and the full cDNA sequences of perennial ryegrass Invertasel, Invertase2 and Sucrose Synthase were obtained (Figures 63, 68 and 73).

WO 02/31130 PCT/AU01/01275 32 EXAMPLE 4 Development of transformation vectors containing chimeric genes with Invertasel, Invertase2 and Sucrose Synthase cDNA sequences from perennial ryegrass To alter the expression of the enzymes involved in soluble carbohydrate metabolism Invertasel, Invertase2 and Sucrose Synthase, through antisense and/or sense suppression technology and for over-expression of these key enzymes in transgenic plants, a set of sense and antisense transformation vectors was produced.

cDNA fragments were generated by high fidelity PCR using the original pGEM-T Easy plasmid cDNA as a template. The primers used (Table 3) contained restriction sites for EcoRI and Xbal for directional and non-directional cloning into the target vector.

TABLE 3 List of primers used to PCR-amplify the open reading frames Gene name clone ID Primer primer sequence LpCWinvertasel 07rg21sFO1.2 Lpinvertaself GAATTCTAGATCCTCCCTCCTTCTGTCC Lpinvertasel r GAATTCTAGACCAGTCGTCTAATCACAGGTC LpCWnvertase2 07rgl NsB1 0.2 Lplnvertase2f GAATTCTAGATCCATCCATCCTTGTCTC Lpinvertase2r GAATTCTAGAACGAAATGCGAGGAAGCG LpSucroseSynthase 10rg2QsEO9.1 LpSuSyf GAATTCTAGACTTCTCCCCTCACACACC LpSuSyr GAATTCTAGACGGTAGAC AATCAAATCATAGC After PCR amplification and restriction digest with the appropriate restriction enzyme (usually Xbal), the cDNA fragments were cloned into the corresponding site in pDH51, a pUC18-based transformation vector containing a CaMV expression cassette. The orientation of the constructs (sense or antisense) was checked by DNA sequencing through the multi-cloning site of the vector.

WO 02/31130 PCT/AU01/01275 33 Transformation vectors containing chimeric genes using full-length open reading frame cDNAs of perennial ryegrass Invertasel, Invertase2 and Sucrose Synthase in sense and antisense orientations under the control of the CaMV 35S promoter were generated (Figures 66, 71 and 76).

EXAMPLE Production of transgenic tobacco plants carrying chimeric Invertasel, Invertase2 and Sucrose Synthase genes from perennial ryegrass A set of transgenic tobacco plants carrying chimeric Invertasel, Invertase2 and Sucrose Synthase cDNA genes from perennial ryegrass were produced.

pDH51-based transformation vectors with Lplnvertasel, Lplnvertase2 and LpSucrose Synthase cDNAs comprising the full open reading frame sequences in sense and antisense orientations under the control of the CaMV 35S promoter were generated.

Direct gene transfer experiments to tobacco protoplasts were performed using these transformation vectors.

The production of transgenic tobacco plants carrying the perennial ryegrass Invertasel, Invertase2 and Sucrose Synthase cDNAs under the control of the constitutive CaMV 35S promoter is described here in detail.

Isolation of mesophyll protoplasts from tobacco shoot cultures 2-4 fully expanded leaves of a 6 week-old shoot culture were placed under sterile conditions (work in laminar flow hood, use sterilized forceps, scalpel and blades) in a 9 cm plastic culture dish containing 12 ml enzyme solution (w/v) cellulase "Onozuka" R10 and 1.0% Macerozyme® R10]. The leaves were wetted thoroughly with enzyme solution and the mid-ribs removed. The leaf halves were cut into small pieces and incubated overnight (14-18 h) at 250C in the dark without shaking.

WO 02/31130 PCT/AU01/01275 34 The protoplasts were released by gently pipetting up and down, and the suspension poured through a 100 pm stainless steel mesh sieve on a 100 ml glass beaker. The protoplast suspension was mixed gently, distributed into two 14 ml sterile plastic centrifuge tubes and carefully overlayed with 1 ml W5 solution. After centrifugation for 5 min. at 70g (Clements Orbital 500 bench centrifuge, swing-out rotor, 400 rpm), the protoplasts were collected from the interphase and transferred to one new 14 ml centrifuge tube. 10 ml W5 solution were added, the protoplasts resuspended by gentle tilting the capped tube and pelleted as before. The protoplasts were resuspended in 5-10 ml W5 solution and the yield determined by counting a 1:10 dilution in a haemocytometer.

Direct gene transfer to protoplasts using polyethylene glycol The protoplasts were pelleted [70g (Clements Orbital 500 bench centrifuge, 400 rpm) for 5 min.] and resuspended in transformation buffer to a density of 1.6 x 106 protoplasts/ml. Care should be taken to carry over as little as possible solution into the transformation mix. 300 pl samples of the protoplast suspension (ca. 5 x 105 protoplasts) were aliquotted in 14 ml sterile plastic centrifuge tubes, pl of transforming DNA were added. After carefully mixing, 300 pl of PEG solution were added and mixed again by careful shaking. The transformation mix was incubated for 15 min. at room temperature with occasional shaking. 10 ml solution were gradually added, the protoplasts pelleted [70g (Clements Orbital 500 bench centrifuge, 400 rpm) for 5 min.] and the supernatant removed. The protoplasts were resuspended in 0.5 ml K3 medium and ready for cultivation.

Culture of protoplasts and selection of transformed lines and regeneration of transgenic tobacco plants Approximately 5 x 105 protoplasts were placed in a 6 cm petri dish. 4.5 ml of a pre-warmed (melted and kept in a water bath at 40-45 0 C) 1:1 mix of K3:H medium containing 0.6% SeaPlaqueTM agarose were added and, after gentle mixing, allowed to set.

WO 02/31130 PCT/AU01/01275 After 20-30 min the dishes were sealed with Parafilm® and the protoplasts were cultured for 24 h in darkness at 24°C, followed by 6-8 days in continuous dim light (5 pmol m' 2 s- 1 Osram L36 W/21 Lumilux white tubes), where first and multiple cell divisions occur. The agarose containing the dividing protoplasts was cut into quadrants and placed in 20 ml of A medium in a 250 ml plastic culture vessel. The corresponding selection agent was added to the final concentration of mg/l kanamycin sulphate (for npt2 expression) or 25 mg/I hygromycin B (for hph expression) or 20 mg/l phosphinotricin (for bar expression). Samples were incubated on a rotary shaker with 80 rpm and 1.25 cm throw at 24 0 C in continuous dim light.

Resistant colonies were first seen 3-4 weeks after protoplast plating, and after a total time of 6-8 weeks protoplast-derived resistant colonies (when 2-3 mm in diameter) were transferred onto MS morpho medium solidified with 0.6% (w/v) agarose in 12-well plates and kept for the following 1-2 weeks at 24 0 C in continuous dim light (5 pmol m" 2 s Osram L36 W/21 Lumilux white tubes), where calli proliferated, reached a size of 8-10 mm, differentiated shoots that were rooted on MS hormone free medium leading to the recovery of transgenic tobacco plants (Table 4, Figure 78).

TABLE 4 Production of transgenic tobacco calli carrying chimeric ryegrass genes, (in sense and antisense orientation) encoding enzymes involved in soluble carbohydrate metabolism and transport, from direct gene transfer to protoplasts Construct Transfected transformed calli transformation protoplasts efficiency pDH51 Lplnvertasel 1.5x10 68 4.53x10 pDH51Lplnvertasel anti 1.5x10O 85 5.66x10 pDH51 Lplnvertase2 1.5x10i 96 6.40x10 pDH51Lplnvertase2 anti 1.5x10 6 73 4.86x10 pDH51 LpSucrose Synthase 1.5x10 5 115 7.66x10pDH51 LpSucrose Synthase anti 1.5x106 97 6.46x10-- WO 02/31130 PCT/AU01/01275 36 EXAMPLE 6 Genetic mapping of perennial ryegrass genes encoding enzymes involved in metabolism and transport of soluble carbohydrates Perennial ryegrass SPS, INV, SS, ST, SST, FFT, and SFT cDNAs were either PCR-amplified or cut from their respective plasmids, gel-purified and radiolabelled for use as probes to detect restriction fragment length polymorphisms (RFLPs). RFLPs were mapped in the F, (first generation) population, NA6 x AUe.

This population was made by crossing an individual (NA 6 from a North African ecotype with an individual (AU 6 from the cultivar Aurora, which is derived from a Swiss ecotype. Genomic DNA of the 2 parents and 114 progeny was extracted using the 1 x CTAB method of Fulton et al. (1995).

Probes were screened for their ability to detect polymorphism using the DNA (10 jig) of both parents and 5 F, progeny restricted with the enzymes Dral, EcoRI, EcoRV or Hindlll. Hybridisations were carried out using the method of Sharp et al. (1988). Polymorphic probes were screened on a progeny set of 114 individuals restricted with the appropriate enzyme (Figures 67, 72 and 77).

RFLP bands segregating within the population were scored and the data was entered into an Excel spreadsheet. Alleles showing the expected 1:1 ratio were mapped using MAPMAKER 3.0 (Lander et al. 1987). Alleles segregating from, and unique to, each parent, were mapped separately to give two different linkage maps. Markers were grouped into linkage groups at a LOD of 5.0 and ordered within each linkage group using a LOD threshold of LpSPS, LplNV, LpSS, LpST, LpSST, LpFFT, and LpSFT loci mapped to the linkage groups as indicated in Table 5 and in Figure 80. These gene locations can now be used as candidate genes for quantitative trait loci for traits associated with metabolism and transport of soluble carbohydrates, such as carbohydrate content, herbage quality, dry matter digestibility, plant organ size, plant height, plant yield, carbohydrate storage, tolerance to abiotic stresses such as drought and cold.

WO 02/31130 PCT/AU01/01275 37 TABLE Map locations of ryegrass genes encoding enzymes, involved in metabolism and transport of soluble carbohydrates, across two genetic linkage maps of perennial ryegrass (N6 and AU-6) Probe Poly- Mapped Locus Linkage morphic with Group NA6 AU6 LpCWlnvertase1/LpINVb Y Hind III LpCfflnvertasel 3 3 LpCWlnvertase2 Y EcoR I LpCWlnvertase2 6 LpFFTa Y DralI LpFFTa.1 4 4 LpFFTa.2 6 LpINVa Y EcoR I LpINVa LpINVc Y EcoR V LpINVc 3 LpINVg Y Dra I LpINVg 3 3 LpSFTa Y Hind III LpSFTa.1 3 3 LpSFTa.2 3 LpSPSf Y DralI LpSPSf 6 6 LpSSa (LpSucroseSynthase) Y EcoR I LpSSa.1 3 LpSSa.2 1 LpSSc Y EcoR V LpSSc 4 LpSucroseSynthase Y Dra I LpSucroseSynthase 7 7 EXAMPLE 7 Expression profiling of cDNAs encoding ryegrass enzymes involved in metabolism and transport of soluble carbohydrates using microarray technology Genes and cDNAs encode for the enzymes involved in metabolism and transport of soluble carbohydrates were PCR amplified and purified. The amplified products were spotted thrice on each amino-silane coated glass slide (CMT- GAPS, Corning, USA) using microgridder (BioRobotics, UK). Spotting solution was also spotted in every subgrids of the microarray as negative and background controls. The duplicates were placed about 800 micron apart to prevent competitive hybridisation (Table 6).

WO 02/31130 PCT/AU01/01275 38 TABLE 6 List of hybridization probes used in expression profiling of perennial ryegrass genes encoding enzymes involved in metabolism and transport of soluble carbohydrates using microarrays Hybridization probe for microarrays Organ specificity (3-month old plants Leaf blade grown hydroponically) Sheath Root Seedling grown under light condition 5-day old shoot 7-day old shoot (7LS) old shoot old root 7-day old root (7LR) old root Seedling grown under dark condition 5-day old shoot 7-day old shoot (7DS) old shoot old root 7-day old root (7DR) old root The following tissues were used to extract total RNA. Fluorescence labelled probes were synthesis by reversed transcribing RNA and incorporating Cyanine 3 or 5 labelled dCTP. The probes were hybridised onto microarrays. In each case the experiment was repeated on two microarrays. After overnight (16 hours) hybridisation, the microarrays were washed and scanned using confocal laser scanner (ScanArray 3000, Packard, USA). The images obtained were quantified and analysed using Imagene 4.1 and GeneSight 2.1 (BioDiscovery, USA). Data were judged as not present low expression medium expression high expression and highly expression (Table 7).

TABLE 7 Results of expression profiling of ryegrass genes encoding enzymes involved in metabolism and transport of soluble carbohydrates plate row Columin gene id clone [d Gene seq notes sheath leaf blade root 5L-S 71-S 1 OLS 5LR 7LR 1OLR 5DS 705 1ODS 5DR_ 7IR IODR Array2Urg e 12 MaSPSCRAPL7615 lOrg2JsEO5 LpSPSa partial Array2Urg f 1 MSPS-BETVU 7616 11lrgl FsD02 LpSPSb partial Array2Urg 1 2 MSPSL-CITUN--7617 16rgl~sAl2 LpSPSb partial 4-1 4 444 4 Array2Urg f 4 MSPS&BETVU 7619 l7rglDaFO4 LpSPSo partial Array2Urg f 5 MSPSICITUN--7620 14rQIRsED7 LpSPSd partial Array2Urg f 6 McaSPSICRAPL7621 14rg2CsCO7 LpSPSd partial 4 Array2Urg f McSSPSMAIZE-7622 15rgllsGOB LpSPSe partial Array2Urg f 8 MoaSPSMAIZE-7623 15rgl~sAlO LpSPSe partial Array2Urg f 9 MSPSI-CITUN--7624 OIrgIDaFO9 LpSPSf partial Array2Urg f 10 MSPSBETVU 7625 l6rglCscO9 LpSPSf partial Array2Urg 1 11 McaSPSSPlOL-7626 l9rgl ZsCOl LpSPSI partial Array2Urg 1 12 XnsRL-2rLTRYCR7627 01 rgl SsGO4 LpINVa partial Array2LUrg g 1 XnsRRAMOUSE-762B 13rg2HsC1O LpINVa partial -4-14 .+44 444 4 Array2Urg g 2 ZhyRL23_TRYCA37629 l6rgl[)sDlO LpINVa partial 44 4+ Array2Urg g 3 ZhyRL23jTRYCR7630 16rgl EsAO2 LpINVa partial +4 +4 Array2Urg g 4 ZhyRL223jRYCR7631 16rglJaBos LpINVa partial? Array2Urg g 5 Mcall'VLPEA--7632 O7rg2lsFOl LpINVbJ full +44 4+4+ 44+4+4+ 44 Array2ftr g 6 McaINV1-PEA--7633 06rglMsAl2 LpINVc tull +4 4+ Array2Urg g 7 McaiNVAPH-AAU7634 02rgl EaA07 LpINVe partial -44 -pt 4+-4 -4-I Array2Urg g 8 McaINVA-PHAAU7635 C2rglFsHO2 LpINVe partial 4+ +4 Array2Urg g 9 McaINV2-DAUcA7036 06rg2Qa9FO9 LpINVf partial Array2Urg g 10 McaINV2LPAUCA7637 O8rgl PsH09 LpINVI partial +4 +4 44 444 4 Array2Urg g I11 McaiNV2-DAUCA7638 08rgl YaAO9 LpINVf partial +4 4 4+4 I4 +44+ i +4H Array2Urg g 12 McaINV1_CAPAN7639 13rg1 LsG1 2 LpINVf partial 4+ +4 4+ 44 Array2Urg h 1 XnsNU6MJALOT07640 13rglWaGO7 LpINVf partial 4+ 4+4 +44 4 4444+-H 44++ Array2lirg h 2 McaiNVLPEA--7641 I IrgI EsPO6 LpINVg partial Array2Urg h 3 McaINV1_YEA--7642 11 rglEsG04 LpINVg partial 4 +44 Array2Urg h 4 McaINVL-PEA-7643 13rgl QsBO4 LpINVg partial- I Array2Urg h 6 McaSUSiJ-H0RVU7645 lOrg2QsEO9 LpSSa partial -i-i I-i+ +-Ii i itii I--I (LpSucrose Synthasa) Array2Urg h 7 McaSUS2_ORYSA7646 2OrgISaHO5 LpSSa partial i +i (LpSuicrose ISyrithase)II III

I

Array2Urg h 83 McaSUS2LOFIYSA7647 U7rgl VsGU2 LpSSb partial -i-i -i-i-i i H- +4 Array2Urg hI 12 XnsH-SA244516-7964 17rglAsGO9 LpINVf partial -i-I I H Array2Vrg a 1 McaSUS2OQRYSA7648 O7rg2MsCO2 LpSSb partial Array2Vrg a 2 McaSUS20ORYSA7649 2OrglOsBO8 LpSSb partial Array2Vrg a 2 McaSUS2_PEA-7650 i9rgIl-sE03 LpSSo Ipartial Array2Vrg a 14 IMCaSUSZ2YEA-7651 2Org1TsG12 LpSSo partial- Array2Vrg a 5 McaINVALYCES7652 08rgl COsC LpSSTaa partial- Array2Vrg a 6 McaINVI-MAIZE7653 OOrgi OsAC5 LpFFTa partial ti-i 4 i-I ttt t i Array2Vrg a 7 McaINVL-MAIZE7654 06rg1WasO1 LpFFTa partial +-i-ii -i-i-i -i-i i Array2Vrg a B MealSIV1 MAIZE7655 06rg2ZsEIl LpFFTa partial ti-i-i -i-i-i-i +i-i-i i-I H 4 -it Array2Vrg a 9 McaINV1_jMAIZE7656 14rglTsFO6 LpFi-Ta partial 4 t IArray2Vrg a 110 IMcaINVIMA1ZE7657 14rg2EsBO6 LpFFTa partial +i i-i -7 -H lArray2Vrg la ill IMCaINV1MAIZE765B l8rgl BaDO1 LpSFra partial H 4+ +7 WO 02/31130 PCT/AU01/01275 41

REFERENCES

Feinberg, Vogelstein, B. (1984). A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem.

132: 6-13.

Frohman et al. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl.

Acad Sci. USA 85:8998 Gish and States (1993) Identification of protein coding regions by database similarity search. Nature Genetics 3:266-272 Lander, Green Abrahamson, Barlow, Daly, Lincoln, S.E., Newburg, L. (1987). MAPMAKER: an interactive computer package for constructing primary linkage maps of experimental and natural populations.

Genomics 1: 174-181.

Loh, Elliott, Cwirla, Lanier, Davis, M.M. (1989). Polymerase chain reaction with single-sided specificity: Analysis of T-cell receptor delta chain. Science 243:217-220 Ohara, Dorit, Gilbert, W. (1989). One-sided polymerase chain reaction: The amplification of cDNA. Proc. Natl. Acad Sci USA 86:5673-5677 Sambrook, Fritsch, Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual. Cold Spring Harbour Laboratory Press Sharp, Kreis, Shewry, Gale, M.D. (1988). Location of a-amylase sequences in wheat and its relatives. Theor. Appl. Genet. 75: 286-290.

WO 02/31130 PCT/AU01/01275 42 Finally, it is to be understood that various alterations, modifications and/or additions may be made without departing from the spirit of the present invention as outlined herein.

It will also be understood that the term "comprises" (or its grammatical variants) as used in this specification is equivalent to the term "includes" and should not be taken as excluding the presence of other elements or features.

Documents cited in this specification are for reference purposes only and their inclusion is not an acknowledgment that they form part of the common general knowledge in the relevant art.

Claims (16)

1. 2. A nucleic acid or nucleic acid fragment according to Claim 1, wherein said Lolium n species is Lolium perenne or Lolium arundinaceum. o 3. A substantially purified or isolated nucleic acid or nucleic acid fragment encoding an INV, or complementary or antisense to an INV-encoding sequence, and including a nucleotide sequence selected from the group consisting of sequences shown in Figures 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 64 and 69 hereto; (Sequence ID Nos: 24, 26 to 30, 31, 33 to 36, 37, 39 and 40, 41, 43 to 58, 59, 61 and 62, 63, 65 to 70, 71, 73 to 75, 112 and 114, respectively); complements of the sequences recited in sequences antisense to the sequences recited in and and functionally active fragments and variants of the sequences recited in and
2. 4. A nucleic acid or nucleic acid fragment according to claim 3, wherein said functionally active fragments and variants have at least approximately 90% identity to the relevant part of the sequences recited in and and have a size of at least nucleotides.
3. 5. A nucleic acid or nucleic acid fragment according to claim 3, including a nucleotide sequence selected from the group consisting of sequences shown in Figures 18, 20, 21, 23, 24, 26, 27, 29, 30, 32, 33, 35, 36, 38, 64 and 69 hereto; (Sequence ID Nos: 24, 26 to 30, 31, 33 to 36, 37, 39 and 40, 41, 43 to 58, 59, 61 and 62, 63, 65 to 71,73 to 75, 112 and 114, respectively).
4. 6. A nucleic acid or nucleic acid fragment according to any one of claims 3 to wherein said nucleic acid or nucleic acid fragment is from a Lolium species. COMS ID No: ARCS-164418 Received by IP Australia: Time 16:51 Date 2007-10-11 11/10/2007 18:47 FREEHILLS 03 11/22 005038924 44 0
5. 7. A construct including a nucleic acid or nucleic acid fragment according to any one Sof Claims 1 to 6.
6. 8. A vector including a nucleic acid or nucleic acid fragment according to any one of Claims I to 6. Va S 5 9. A vector according to Claim 8, further including a promoter and a terminator, said C promoter, nucleic acid or nucleic acid fragment and terminator being operatively linked. A plant cell, plant, plant seed or other plant part, including a construct according Sto claim 7 or a vector according to Claim 8 or 9.
7. 11. A plant, plant seed or other plant part derived from a plant cell or plant according to Claim 10 and including a construct according to claim 7 or a vector according to Claim 8 or 9.
8. 12. A method of modifying soluble carbohydrate metabolism and/or transport in a plant, said method including introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment according to any one of Claims 1 to 6, a construct according to claim 7 andlor a vector according to Claim 8 or 9.
9. 13. Use of a nucleic acid or nucleic acid fragment according to any one of Claims 1 to 6, and/or nucleotide sequence information thereof, and/or single nucleotide polymorphisms thereof as a molecular genetic marker.
10. 14. The use according to Claim 13 wherein the molecular genetic marker is for one or more quantative trait loci (QTL) tagging, QTL mapping, DNA fingerprinting or marker assisted selections. The use according to Claim 13 or 14 wherein the molecular marker is used in a Lolium species. COMS ID No: ARCS-164418 Received by IP Australia: Time 16:51 Date 2007-10-11 11/10/2007 16:47 FREEHILLS 03 12/22 005038924 O 0
11. 16. The use according to any one of Claims 13 to 15 wherein the molecular marker is 0 used to select for a herbage quality trait selected from the group consisting of dry matter O Sdigestibility, biotic stress tolerance, abiotic stress tolerance, plant stature, leaf and stem colour, carbohydrate content and carbohydrate storage. N O 5 17. A substantially purified or isolated nucleic acid or nucleic acid fragment including N a single nucleotide polymorphism from a nucleic acid or nucleic acid fragment according Sto any one of Claims 3 to 6. o 18. A substantially purified INV polypeptide from a Lolium species; or a functionally active fragment or variant thereof.
12. 19. A polypeptide according to claim 18 wherein said Lolium species is Lolium perenne or Lolium arundinaceum. A substantially purified INV polypeptide including an amino acid sequence selected from the group of sequences shown in Figures 19, 22, 25, 28, 31, 34, 37, and 70 hereto (Sequence ID Nos: 25, 32, 38, 42, 60. 64, 72, 113 and 115, respectively); and functionally active fragments and variants thereof.
13. 21. A polypeptide according to claim 20, wherein said functionally active fragments and variants have at least approximately 95% identity with the recited sequences and have a size of at least 20 amino acids.
14. 22. A polypeptide according to claim 20 including an amino acid sequence selected from the group of sequences shown in Figures 19, 22, 25, 28, 31, 34, 37, 65 and hereto (Sequence ID Nos: 25, 32, 38,42, 60.64, 72,113 and 115, respectively).
15. 23. A polypeptide according to any one of claims 20 to 22 wherein said polypeptide is from a Lolium species. COMS ID No: ARCS-164418 Received by IP Australia: Time 16:51 Date 2007-10-11 11/10/2007 16:47 FREEHILLS 03 13/22 005038924 S 46 C
16. 24. A fructan or modified fructan or a sucrose or modified sucrose substantially or Spartially purified or isolated from a plant, plant seed or other plant part according to claim or 11. COMS ID No: ARCS-164418 Received by IP Australia: Time 16:51 Date 2007-10-11