NZ536967A - Nucleic acids that encode an enzyme or transporter proteins such as a sucrose synthase (SS) polypeptide from lolium - Google Patents
Nucleic acids that encode an enzyme or transporter proteins such as a sucrose synthase (SS) polypeptide from loliumInfo
- Publication number
- NZ536967A NZ536967A NZ536967A NZ53696701A NZ536967A NZ 536967 A NZ536967 A NZ 536967A NZ 536967 A NZ536967 A NZ 536967A NZ 53696701 A NZ53696701 A NZ 53696701A NZ 536967 A NZ536967 A NZ 536967A
- Authority
- NZ
- New Zealand
- Prior art keywords
- nucleic acid
- sequence
- plant
- sequences
- sucrose
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2408—Glucanases acting on alpha -1,4-glucosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
- C12N15/8246—Non-starch polysaccharides, e.g. cellulose, fructans, levans
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
- C12N9/1062—Sucrose synthase (2.4.1.13)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
- C12N9/1066—Sucrose phosphate synthase (2.4.1.14)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Nutrition Science (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
A substantially purified or isolated nucleic acid encodes sucrose synthase (SS) and it's polypeptide from a ryegrass (Lolium) species are described. Vectors and plant cells comprising the nucleic acid are described. The nucleic acid can be introduced into a plant to modify soluble carbohydrate metabolism and/or transport in a plant, particularly fructose or sucrose, or can be used as a molecular marker.
Description
004823342
53 6 9 67
1
Manipulation of soluble carbohydrates (2)
This application is a divisional of NZ patent application 524587, the entire disclosure of which is incorporated herein by reference.
This application is the parent of a divisional application entitled "Manipulation of soluble 5 carbohydrates (3)".
The present invention relates to nucleic acid fragments encoding amino acid sequences for enzymes and transporter proteins involved in the metabolism and/or transport of soluble carbohydrates, such as sucrose and fructan, and the use thereof for the modification of soluble ^ carbohydrate metabolism and/or transport in plants.
Most higher plants uptake carbon dioxide from air. In photosynthetically active cells carbon dioxide is fixed in the chloroplast and then assimilated to produce carbohydrate. Fixed carbon can be used for synthesis of structural carbohydrates, such as cellulose, xyloglucan and pectin, or for the synthesis of non-structural storage carbohydrates such as sucrose, starch and fructan. Fixed carbon can be stored as starch in the chloroplast or exported from the chloroplast 15 to the cytosol where it can be converted into sucrose. Most of the sucrose formed in source organ cells is exported through the plant phloem to the receiver cells in sink organs, where it can be utilised for growth or can be stored.
The pathway of sucrose synthesis involves three key enzymes: fructose-1,6-biphosphatase, sucrose phosphate synthase (SPS) and phosphatase. Fructose-1,6-^|20 biphosphatase catalyses the synthesis of fructose-6-phosphate from fructose-1,6-biphosphate. Sucrose phosphate synthase (SPS) activity will produce sucrose phosphate from fructose-6-phosphate and UDP-glucose. The sucrose phosphate is then converted to sucrose by phosphatase action.
Sucrose phosphate synthase (SPS) plays a very important role as the limiting factor in 25 partitioning of carbon sources. The enhancement of SPS activity in plants thus may increase the ability of the source function-
In plants the breakdown of sucrose to fructose and glucose can be catalysed by invertase (INV) or sucrose synthase (SS). These enzymes are central to sucrose metabolism and they are involved in key physiological processes, such as source-sink interactions and 30 carbohydrate partitioning. Invertases can be divided into neutral (cytosolic) and acid (vacuolar and Tntellectual property office of n.z.
- 2 JUN 2006
received
apoplastic) classes. Sucrose synthase (SS) plays various roles in the synthesis and degradation of sucrose as well as in the flow of carbon from one plant organ to another.
Sugar transport is a fundamental process for the allocation of assimilates in 5 plants. Sucrose is the primary carbohydrate for long-distance transport of carbon assimilates through the vascular system in many plant species. Sucrose transporters (ST) are involved in sucrose phloem loading and transport in plants.
Fructan synthesis in grasses is complex. Three enzymes are involved; sucrosersucrose 1-fructosyltransferase (SST); fructan:fructan ^l-10 fructosyltransferase (FFT); and sucrose:fructan 6-fructosyltransferase (SFT) which synthesise the more complex fructans that prevail in grasses and cereals.
Fructans are associated with various advantageous characters in forage grasses, such as cold and drought tolerance, increased tiller survival, enhanced persistence, good regrowth after cutting or grazing, improved recovery from stress 15 and early spring growth. High amounts of fructans have been found to accumulate in ryegrasses (Lolium species) and fescues (Festuca species) in response to environmental stresses such as drought and cold.
Sugars affect growth and development throughout the plant life cycle, from germination to flowering to senescence. Sugars are not only important energy 20 sources in plants; they are also central regulatory molecules controlling physiology, metabolism and gene expression. Sugars are physiological signals repressing or activating plant genes involved in many essential processes, including photosynthesis, glyoxylate metabolism, respiration, starch and sucrose synthesis and breakdown, nitrogen metabolism, pathogen defense, wounding 25 response, senescence, pigmentation and cell cycle regulation.
Partitioning of assimilate between individual tissues and organs is essential for growth and development in higher plants. Sink-source interactions are closely associated to crop yields.
PCT/AI101,'01275
3
Furthermore, soluble carbohydrates such as fructans and sucrose in forage grasses contribute significantly to the readily available energy in the feed for grazing ruminant animals. The fermentation processes in the rumen require considerable readily available energy. The improvement of the readily available 5 energy in the rumen can increase the efficiency of rumen digestion. An increased efficiency in rumen digestion leads to an improved conversion of the forage protein fed to the ruminant animal into milk or meat, and to a reduction in nitrogenous waste as environmental pollutant.
Thus, it would be desirable to have methods of manipulating soluble carbohydrate metabolism (synthesis and degradation) and/or transport in plants, including grass species such as ryegrasses (Lolium species) and fescues (Festuca species), and legumes such as clovers (Trifolium species), lucerne and medics (Medicago species). For example, it may be desirable to facilitate the production of pasture grasses and pasture legumes with, for example, enhanced or modified soluble carbohydrate content or composition, enhanced tolerance to biotic and abiotic stresses, enhanced persistence and improved herbage quality, enhanced yield, altered growth and development, leading to improved pasture production and quality, improved animal production and reduced environmental pollution.
Perennial ryegrass (Lolium perenne L.) is a key pasture grass in temperate climates throughout the world. Perennial ryegrass is also an important turf grass.
Clovers (Trifolium species) such as white clover (7. repens), red clover (T. pratense) and subterranean clover ("T. subterraneum), and lucerne (M. sativa) and medics (Medicago species) are fructan-devoid, starch-accumulating key pasture legumes in temperate climates throughout the world.
While nucleic acid sequences encoding some of the enzymes involved in soluble carbohydrate metabolism and transport have been isolated for certain species of plants, there remains a need for materials useful in the modification of soluble carbohydrate metabolism and transport, for example sucrose metabolism,
4
sucrose transport and fructan metabolism, in a wide range of plants, particularly in forage grasses and legumes including ryegrasses and fescues, and for methods for their use. There remains further a need for materials useful in engineering fructan accumulation in plant species which are naturally fructan-devoid.
It is an object of the present invention to overcome, or at least alleviate, one or more of the difficulties or deficiencies associated with the prior art.
In one aspect, the present invention provides substantially purified or isolated nucleic acids or nucleic acid fragments encoding amino acid sequences for the following enzymes or transporter proteins from a ryegrass (Lolium) or fescue (Festuca) species, or functionally active fragments or variants thereof: sucrose phosphate synthase (SPS), invertase (INV), sucrose synthase (SS), sucrose transporter (ST), sucrose:sucrose 1-fructosyltransferase (SST), fructan:fructan 1-fructosyltransferase (FFT), and sucrose:fructan 6-fructosyltransferase (SFT)
The present invention also provides substantially purified or isolated nucleic acids or nucleic acid fragments encoding amino acid sequences for a class of proteins which are related to SPS, INV, SS, ST, SST, FFT and SFT, or functionally active fragments or variants thereof. Such proteins are referred to herein as SPS-like, INV-like, SS-like, ST-like, SST-like, FFT-like and SFT-like, respectively.
The ryegrass (Lolium) or fescue (Festuca) species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow fescue and red fescue. Preferably the species is a ryegrass, more preferably perennial ryegrass (L perenne).
The nucleic acid or nucleic acid fragment may be of any suitable type and 25 includes DNA (such as cDNA or genomic DNA) and RNA (such as mRNA) that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases, and combinations thereof.
PCT/AUO1/012 75
The term "isolated" means that the material is removed from its original environment (eg. the natural environment if it is naturally occurring). For example, a naturally occurring nucleic acid present in a living plant is not isolated, but the same nucleic acid separated from some or all of the coexisting materials in the 5 natural system, is isolated. Such nucleic acids could be part of a vector and/or such nucleic acids could be part of a composition, and still be isolated in that such a vector or composition is not part of its natural environment.
Such nucleic acids or nucleic acid fragments couid be assembled to form a consensus contig. As used herein, the term "consensus contig" refers to a ^ 10 nucleotide sequence that is assembled from two or more constituent nucleotide sequences that share common or overlapping regions of sequence homology. For example, the nucleotide sequence of two or more nucleic acids or nucleic acid fragments can be compared and aligned in order to identify common or overlapping sequences. Where common or overlapping sequences exist between 15 two or more nucleic acids or nucleic acid fragments, the sequences (and thus their corresponding nucleic acids or nucleic acid fragments) can be assembled into a single contiguous nucleotide sequence.
In a preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a SPS or SPS-^ 20 like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 5, 6, 8, 9, 11, 12, 14, 15 and 17 hereto; (Sequence ID Nos: 1, 3, 5 and 6, 7, 9 and 10, 11, 13 and 14, 15, 17 and 18, 19 and 21 to 23, respectively) (b) complements of the sequences recited in (a) ; (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally 25 active fragments and variants of the sequences recited in (a), (b) and (c).
In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding an INV or INV-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 18, 20, 21, 23, 24, 26, 27, 29, 30, 30 32, 33, 35, 36, 38, 64 and 69 hereto (Sequence ID Nos: 24, 26 to 30, 31, 33 to 36,
6
PCT/AUO 1/01275
37, 39 and 40, 41, 43 to 58, 59, 61 and 62, 63, 65 to 70, 71, 73 to 75, 112 and 114, respectively); (b) complements of the sequences recited in (a) ; (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c).
In another preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding an SS or SS-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 39, 41, 43, 44, 46 and 74 hereto (Sequence ID Nos: 76, 78, 80 to 82, 83, 85 and 86, and 116, respectively); (b) 10 complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c).
In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a ST or ST-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 47, 49, 50, 52, 53, and 55 hereto (Sequence ID Nos: 87, 89 and 90, 91, 93 to 96, 97, and 99 and 100, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c).
In another preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a SST or SST-like protein includes a nucleotide sequence selected from the group consisting of (a) sequence shown in Figure 56 hereto (Sequence ID No: 101); (b) 25 a complement of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c).
In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a
# 20
004917004
intellectual property office of N.Z.
- 8 JAN 2007
received
FFT or FFT-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 58 and 60 hereto (Sequence ID Nos: 103 and 105 to 109, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active 5 fragments and variants of the sequences recited in (a), (b) and (c).
In another preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid fragment encoding a SFT or SFT-like protein includes a nucleotide sequence selected from the group consisting of (a) sequence shown in Figure 61 hereto (Sequence ID No: 110); (b) complement of the sequence recited in (a); 10 (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c).
In a particularly preferred embodiment, the present invention provides a substantially purified or isolated nucleic acid or nucleic acid fragment encoding an SS polypeptide and including a nucleotide sequence selected from the group consisting of (a) 15 sequences shown in Figures 39, 41, 43, 44, 46 and 74 hereto (Sequence ID Nos: 76, 78, 80 to 82, 83, 85 and 86, and 116, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants having at least approximately 90% identity with the sequences recited in (a), (b) and (c).
By "functionally active" in relation to nucleic acids it is meant that the fragment or variant (such as an analogue, derivative or mutant) encodes a polypeptide capable of modifying soluble carbohydrate metabolism and/or transport, for example sucrose biosynthesis, sucrose degradation, sucrose transport, fructan biosynthesis and/or fructan degradation, in a plant. Such variants include naturally occurring allelic variants and 25 non-naturally occurring variants. Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant. Preferably the functionally active fragment or variant has at least approximately 80% identity to the relevant part of the above mentioned sequence, more preferably at least approximately 90% identity, 30 most preferably at least approximately 95% identity. Such functionally active variants
004917004
7A
and fragments include, for example, those having nucleic acid changes which result in conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 10 nucleotides, more preferably at least 15 nucleotides, most preferably at least 20 nucleotides.
JAN 2007 I
fi£C ElVPn
8
The nucleic acid fragments encoding at least a portion of several sucrose metabolism or. sucrose metabolism-like enzymes, sucrose transporter or sucrose transporter-like proteins, and fructan metabolism or fructan metabolism-like enzymes have been isolated and identified. The nucleic acids and nucleic acid 5 fragments of the present invention may be used to isolate cDNAs and genes encoding homologous proteins from the same or other plant species. Isolation of homologous genes using sequence-dependent protocols is well known in the art. Examples of sequence-dependent protocols include, but are not limited to, methods of nucleic acid hybridisation, and methods of DNA and RNA amplification 10 as exemplified by various uses of nucleic acid amplification technologies (e.g. polymerase chain reaction, ligase chain reaction).
For example, genes encoding other sucrose metabolism or sucrose metabolism-like enzymes, sucrose transporter or sucrose transporter-like proteins, and fructan metabolism or fructan metabolism-like enzymes, either as cDNAs or 15 genomic DNAs, may be isolated directly by using all or a portion of the nucleic acids or nucleic acid fragments of the present invention as hybridisation probes to screen libraries from the desired plant employing the methodology well known to those skilled in the art. Specific oligonucleotide probes based upon the nucleic acid sequences of the present invention may be designed and synthesized by 20 methods known in the art. Moreover, the entire sequences may be used directly to synthesize DNA probes by methods known to the skilled artisan such as random primer DNA labelling, nick translation, or end-labelling techniques, or RNA probes using available in vitro transcription systems. In addition, specific primers may be designed and used to amplify a part or all of the sequences of the present 25 invention. The resulting amplification products may be labelled directly during amplification reactions or labelled after amplification reactions, and used as probes to isolate full length cDNA or genomic fragments under conditions of appropriate stringency.
In addition, short segments of the nucleic acids or nucleic acid fragments of the present invention may be used in amplification protocols to amplify longer nucleic acids or nucleic acid fragments encoding homologous genes from DNA or
9
PCT/AUO 1/01275
RNA. For example, the polymerase chain reaction may be performed on a library of cloned nucleic acid fragments wherein the sequence of one primer is derived from the nucleic acids or nucleic acid fragments of the present invention, and the sequence of the other primer takes advantage of the presence of the polyadenylic 5 acid tracts to the 3' end of the mRNA precursor encoding plant genes. Alternatively, the second primer sequence may be based upon sequences derived from the cloning vector. For example, those skilled in the art can follow the RACE protocol (Frohman et al. (1988) Proc. Natl. Acad Sci. USA 85:8998, the entire disclosure of which is incorporated herein by reference) to generate cDNAs by 10 using PCR to amplify copies of the region between a single point in the transcript and the 3' or 5' end. Using commercially available 3' RACE and 5' RACE systems (BRL), specific 3' or 5' cDNA fragments may be isolated (Ohara etal. (1989,) Proc. Natl. Acad Sci USA 86:5673; Loh et al. (1989) Science 243:217; the entire disclosures of which are incorporated herein by reference). Products generated by 15 the 3' and 5' RACE procedures may be combined to generate full-length cDNAs.
In a second aspect of the present invention there is provided a substantially purified or isolated polypeptide from a ryegrass (Lolium) or fescue (Festuca) species, selected from the group consisting of SPS and SPS-like, INV and INV-like, SS and SS-like, ST and ST-like, SST and SST-like, FFT and FFT-like, SFT 20 and SFT-like, enzymes and proteins; and functionally active fragments and variants thereof.
The ryegrass (Lolium) or fescue (Festuca) species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow fescue and red fescue. Preferably the species is a ryegrass, more preferably 25 perennial ryegrass (L perenne).
In a preferred embodiment of this aspect of the invention, the substantially purified or isolated SPS or SPS-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 2, 4, 7, 10, 13 and 16 hereto (Sequence ID Nos: 2, 4, 8, 12, 16 and 20, respectively); and 30 functionally active fragments and variants thereof.
PCT/AUO 1/01275
In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated INV or INV-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 19, 22, 25, 28, 31, 34, 37, 65 and 70 hereto (Sequence ID Nos: 25, 32, 38, 42, 60, 5 64, 72,113 and 115, respectively); and functionally active fragments and variants thereof.
In another preferred embodiment of this aspect of the invention, the substantially purified or isolated SS or SS-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 40, 10 42, 45 and 75 hereto (Sequence ID Nos: 77, 79, 84 and 117, respectively); and functionally active fragments and variants thereof.
In a still further preferred embodiment of this aspect of the invention, the substantially purified or isolated ST or ST-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 48, 15 51 and 54 hereto (Sequence ID Nos: 88, 92 and 98, respectively); and functionally active fragments and variants thereof.
In another preferred embodiment of this aspect of the invention, the substantially purified or isolated SST or SST-like polypeptide includes an amino acid sequence shown in Figure 57 hereto (Sequence ID No: 102); and functionally active fragments and variants thereof.
In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated FFT or FFT-like polypeptide includes an amino acid sequence shown in Figure 59 hereto (Sequence ID No: 104); and functionally active fragments and variants thereof.
In another preferred embodiment of this aspect of the invention, the substantially purified or isolated SFT or SFT-like polypeptide includes an amino acid sequence shown in Figure 62 hereto (Sequence ID No: 111); and functionally active fragments and variants thereof.
004917004
10A
In a particularly preferred embodiment, the present invention provides a substantially purified SS polypeptide including an amino acid sequence selected from the group consisting of (a) sequences shown in Figures 40, 42, 45 and 75 hereto (Sequence ID Nos: 77, 79 84 and 117, respectively); and (b) functionally active fragments and variants 5 thereof having at least 90% identity with the sequences recited in (a).
~ 8 JAN 2007 I
11
PCT7AU 0 ! /01275
By "functionally active" in relation to polypeptides it is meant that the fragment or variant has one or more of the biological properties for the proteins SPS, SPS-like, INV, INV-like, SS, SS-like, ST, ST-like, SST, SST-like, FFT, FFT-like, SFT and SFT-like, respectively. Additions, deletions, substitutions and 5 derivatizations of one or more of the amino acids are contemplated so long as the modifications do not result in loss of functional activity of the fragment or variant. Preferably the functionally active fragment or variant has at least approximately 60% identity to the relevant part of the above mentioned sequence, more preferably at least approximately 80% identity, most preferably at least 10 approximately 90% identity. Such functionally active variants and fragments include, for example, those having conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 10 amino acids, more preferably at least 15 amino acids, most preferably at least 20 amino acids.
In a further embodiment of this aspect of the invention, there is provided a polypeptide recombinantly produced from a nucleic acid or nucleic acid fragment according to the present invention. Techniques for recombinantly producing polypeptides are well known to those skilled in the art.
Availability of the nucleotide sequences of the present invention and 20 deduced amino acid sequences facilitates immunological screening of cDNA expression libraries. Synthetic peptides representing portions of the instant amino acid sequences may be synthesized. These peptides may be used to immunise animals to produce polyclonal or monoclonal antibodies with specificity for peptides and/or proteins including the amino acid sequences. These antibodies 25 may be then used to screen cDNA expression libraries to isolate full-length cDNA clones of interest.
A genotype is the genetic constitution of an individual or group. Variations in genotype are important in commercial breeding programs, in determining parentage, in diagnostics and fingerprinting, and the like. Genotypes can be 30 readily described in terms of genetic markers. A genetic marker identifies a
PCT/AUO 1/01275
12
specific region or locus in the genome. The more genetic markers, the finer defined is the genotype. A genetic marker becomes particularly useful when it is allelic between organisms because it then may serve to unambiguously identify an individual. Furthermore, a genetic marker becomes particularly useful when it is 5 based on nucleic acid sequence information that can unambiguously establish a genotype of an individual and when the function encoded by such nucleic acid is known and is associated with a specific trait. Such nucleic acids and/or nucleotide sequence information including single nucleotide polymorphisms (SNP's), variations in single nucleotides between allelic forms of Such nucleotide sequence, 10 can be used as perfect markers or candidate genes for the given trait.
Applicants have identified a number of SNP's of the nucleic acids and nucleic acid fragments of the present invention. These are indicated (marked with grey on the black background) in the figures that show multiple alignments of nucleotide sequences of nucleic acid fragments contributing to consensus contig 15 sequences. See for example, Figures 5, 8, 14, 17, 20, 23, 29, 32, 35, 38, 43 and 60 (Sequence ID Nos: 5 and 6, 9 and 10, 17 and 18, 21 to 23, 26 to 30, 33 to 36, 43 to 58, 61 and 62, 65 to 70, 73 to 75, 80 to 82, and 105 to 109, respectively).
Accordingly, in a further aspect of the present invention, there is provided a substantially purified or isolated nucleic acid or nucleic acid fragment including a single nucleotide polymorphism (SNP) from a nucleic acid or nucleic acid fragment according to the present invention, or complements or sequences antisense thereto, and functionally active fragments and variants thereof.
In a still further aspect of the present invention there is provided a method of isolating a nucleic acid or nucleic acid fragment of the present invention 25 including a single nucleotide polymorphism (SNP), said method including sequencing nucleic acid fragments from a nucleic acid library.
0 20
The nucleic acid library may be of any suitable type and is preferably a cDNA library.
PCT/AU01,'01275
13
The nucleic acid or nucleic acid fragment may be isolated from a recombinant plasmid or may be amplified, for example using polymerase chain reaction.
The sequencing may be performed by techniques known to those skilled in 5 the art.
In a still further aspect of the present invention, there is provided use of nucleic acids or nucleic acid fragments of the present invention including SNPs, and/or nucleotide sequence information thereof, as molecular genetic markers.
In a still further aspect of the present invention there is provided use of a 10 nucleic acid or nucleic acid fragment according to the present invention, and/or nucleotide sequence information thereof, as a molecular genetic marker.
More particularly, nucleic acids or nucleic acid fragments according to the present invention and/or nucleotide sequence information thereof may be used as a molecular genetic marker for quantitative trait loci (QTL) tagging, QTL mapping, 15 DNA fingerprinting and in marker assisted selection, particularly in ryegrasses and fescues. Even more particularly, nucleic acids or nucleic acid fragments according to the present invention and/or nucleotide sequence information thereof may be used as molecular genetic markers in forage and turf grass improvement, e.g. tagging QTLs for herbage quality traits, dry matter digestibility, biotic stress 20 tolerance, abiotic stress tolerance, plant stature, leaf and stem colour, carbohydrate content, carbohydrate storage. Even more particularly, sequence information revealing SNPs in allelic variants of the nucleic acids or nucleic acid fragments of the present invention and/or nucleotide sequence information thereof may be used as molecular genetic markers for QTL tagging and mapping and in 25 marker assisted selection, particularly in ryegrasses and fescues.
In a still further aspect of the present invention there is provided a construct including a nucleic acid or nucleic acid fragment according to the present invention.
14
PCT/AU01 /01275
The term "construct" as used herein refers to an artificially assembled or isolated nucleic acid molecule which includes the gene of interest. In general a construct may include the gene or genes of interest, a marker gene which in some cases can also be the gene of interest and appropriate regulatory sequences. It 5 should be appreciated that the inclusion of regulatory sequences in a construct is optional, for example, such sequences may not be required in situations where the regulatory sequences of a host cell are to be used. The term construct includes vectors but should not be seen as being limited thereto.
In a still further aspect of the present invention there is provided a vector 10 including a nucleic acid or nucleic acid fragment according to the present invention.
The term "vector" as used herein includes both cloning and expression vectors. Vectors are often recombinant molecules including nucleic acid molecules from several sources.
in a preferred embodiment of this aspect of the invention, the vector may include a regulatory element such as a promoter, a nucleic acid or nucleic acid fragment according to the present invention and a terminator; said regulatory element, nucleic acid or nucleic acid fragment and terminator being operatively linked.
By "operatively linked" is meant that said regulatory element is capable of causing expression of said nucleic acid or nucleic acid fragment in a plant cell and said terminator is capable of terminating expression of said nucleic acid or nucleic acid fragment in a plant cell. Preferably, said regulatory element is upstream of said nucleic acid or nucleic acid fragment and said terminator is downstream of 25 said nucleic acid or nucleic acid fragment.
The vector may be of any suitable type and may be viral or non-viral. The vector may be an expression vector. Such vectors include chromosomal, non-chromosomal and synthetic nucleic acid sequences, eg. derivatives of plant viruses; bacterial piasmids; derivatives of the Ti plasmid from Agrobacterium
PCT/AUO I/O 1275
tumefaciens, derivatives of the Ri plasmid from Agrobacterium rhizogenesr, phage DNA; yeast artificial chromosomes; bacterial artificial chromosomes; binary bacterial artificial chromosomes; vectors derived from combinations of plasmids and phage DNA. However, any other vector may be used as long as it is 5 replicable, integrative or viable in the plant cell.
The regulatory element and terminator may be of any suitable type and may be endogenous to the target plant cell or may be exogenous, provided that they are functional in the target plant cell.
Preferably the regulatory element is a promoter. A variety of promoters 10 which may be employed in the vectors of the present invention are well known to those skilled in the art. Factors influencing the choice of promoter include the desired tissue specificity of the vector, and whether constitutive or inducible expression is desired and the nature of the plant cell to be transformed (eg. monocotyledon or dicotyledon). Particularly suitable constitutive promoters include 15 the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter, the maize Ubiquitin promoter, and the rice Actin promoter.
A variety of terminators which may be employed in the vectors of the present invention are also well known to those skilled in the art. The terminator may be from the same gene as the promoter sequence or a different gene. 20 Particularly suitable terminators are polyadenylation signals, such as the CaMV 35S polyA and other terminators from the nopaline synthase (nos), the octopine synthase (ocs) and the rbcS genes.
The vector, in addition to the regulatory element, the nucleic acid or nucleic acid fragment of the present invention and the terminator, may include further 25 elements necessary for expression of the nucleic acid or nucleic acid fragment, in different combinations, for example vector backbone, origin of replication (ori), multiple cloning sites, spacer sequences, enhancers, introns (such as the maize Ubiquitin Ubi intron), antibiotic resistance genes and other selectable marker genes [such as the neomycin phosphotransferase (npt2) gene, the hygromycin
16
phosphotransferase (hph) gene, the phosphinothricin acetyltransferase (bar or pat) gene], and reporter genes (such as beta-glucuronidase (GUS) gene (gusA)]. The vector may also contain a ribosome-binding site for translation initiation. The vector may also include appropriate sequences for amplifying expression.
As an alternative to use of a selectable marker gene to provide a phenotypic trait for selection of transformed host cells, the presence of the vector in transformed cells may be determined by other techniques well known in the art, such as PCR (polymerase chain reaction), Southern blot hybridisation analysis, histochemical GUS assays, northern and Western blot hybridisation analyses.
Those skilled in the art will appreciate that the various components of the vector are operatively linked, so as to result in expression of said nucleic acid or nucleic acid fragment. Techniques for operatively linking the components of the vector of the present invention are well known to those skilled in the art. Such techniques include the use of linkers, such as synthetic linkers, for example 15 including one or more restriction enzyme sites.
The vectors of the present invention may be incorporated into a variety of plants, including monocotyledons (such as grasses from the genera Lolium, Festuca, Paspalum, Pennisetum, Panicum and other forage and turfgrasses, corn, oat, sugarcane, wheat and barley), dicotyledons (such as arabidopsis, tobacco, 20 white clover, red clover, subterranean clover, alfalfa, eucalyptus, potato, sugarbeet) and gymnosperms. In a preferred embodiment, the vectors may be used to transform monocotyledons, preferably grass species such as ryegrasses (Lolium species) and fescues (Festuca species), even more preferably perennial ryegrass, including forage- and turf-type cultivars. In a preferred embodiment, the 25 vectors are used to transform dicotyledons, preferably forage legume species such as clovers (Trifolium species) and medics (Medicago species), more preferably white clover (Trifolium repens), red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum) and lucerne (Medicago sativa).
17
Techniques for incorporating the vectors of the present invention into plant cells (for example by transduction, transfection or transformation) are well known to those skilled in the art. Such techniques include Agrobacterium mediated introduction, electroporation to tissues, cells and protoplasts, protoplast fusion, 5 injection into reproductive organs, injection into immature embryos and high velocity projectile introduction to cells, tissues, calii, immature and mature embryos. The choice of technique will depend largely on the type of plant to be transformed.
Cells incorporating the vectors of the present invention may be selected, as ^ 10 described above, and then cultured in an appropriate medium to regenerate transformed plants, using techniques well known in the art. The culture conditions, such as temperature, pH and the like, will be apparent to the person skilled in the art. The resulting plants may be reproduced, either sexually or asexually, using methods well known in the art, to produce successive generations of transformed 15 plants.
In a further aspect of the present invention there is provided a plant cell, plant, plant seed or other plant part, including, e.g. transformed with, a construct or vector of the present invention.
The plant cell, plant, plant seed or other plant part may be from any suitable 20 species, including monocotyledons, dicotyledons and gymnosperms. In a preferred embodiment the plant cell, plant, plant seed or other plant part is from a monocotyledon, preferably a grass species, more preferably a ryegrass (Lolium species) or fescue (Festuca species), even more preferably perennial ryegrass, including both forage- and turf-type cultivars. In a preferred embodiment the plant 25 cell, plant, plant seed or other plant part is from a dicotyledon, preferably forage legume species such as clovers (Trifolium species) and medics (Medicago species), more preferably white clover (Trifolium repens), red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum) and lucerne (Medicago sativa).
18
PCT/AUO 1/012 75
The present invention also provides a plant, plant seed or other plant part derived from a plant cell of the present invention.
The present invention also provides a plant, plant seed or other plant part derived from a plant of the present invention.
In a further aspect of the present invention there is provided a method of modifying soluble carbohydrate metabolism and/or transport in a plant, said method including introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment, construct and/or vector according to the present invention. The soluble carbohydrate metabolism and/or transport may be, for 10 example, sucrose biosynthesis and/or sucrose degradation and/or sucrose transport and/or fructan biosynthesis and/or fructan degradation.
By "an effective amount" is meant an amount sufficient to result in an identifiable phenotypic trait in said plant, or a plant, plant seed or other plant part derived therefrom. Such amounts can be readily determined by an appropriately 15 skilled person, taking into account the type of plant, the route of administration and other relevant factors. Such a person will readily be able to determine a suitable amount and method of administration. See, for example, Maniatis et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, the entire disclosure of which is incorporated herein by reference.
Using the methods and materials of the present invention, plant soluble carbohydrate metabolism and/or transport may be increased or decreased. For example, sucrose biosynthesis, sucrose degradation, sucrose transport, fructan biosynthesis and/or fructan degradation may be increased, decreased or otherwise modified relative to an untransformed control plant. They may be 25 increased or otherwise modified, for example, by incorporating additional copies of a sense nucleic acid or nucleic acid fragment of the present invention. They may be decreased or otherwise modified, for example, by incorporating an antisense nucleic acid or nucleic acid fragment of the present invention. In addition, the number of copies of genes encoding different enzymes in the fructan biosynthetic
13
PCT/AUO 1/01275
pathway may be manipulated to modify the degree of polymerization of the molecule synthesized, and/or the linkages between different fructose subunits in the molecule, thereby altering the composition of fructans produced.
In a still further aspect of the present invention there is provided a fructan or 5 modified fructan or a sucrose or modified sucrose substantially or partially purified or isolated from a plant, plant seed or other plant part of the present invention.
Such fructan or sucrose may be modified from naturally occurring fructan or sucrose in terms of their monomeric sugar composition, the degree of linkage and/or nature of linkages between the monomers, the degree of polymerization (number of units) of the molecule.
The present invention will now be more fully described with reference to the accompanying Examples and drawings. It should be understood, however, that the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above.
In the Figures
Figure 1 shows the nucleotide sequence of LpSPSa (Sequence ID No: 1).
Figure 2 shows the deduced amino acid sequence of LpSPSa (Sequence ID No: 2).
Figure 3 shows the consensus contig nucleotide sequence of LpSPSb 20 (Sequence ID No: 3).
Figure 4 shows the deduced amino acid sequence of LpSPSb Sequence ID No: 4).
Figure 5 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSb (Sequence ID Nos: 25 5 and 6).
PCT/AUO 1/01275
Figure 6 shows the consensus contig nucleotide sequence of LpSPSc (Sequence ID No: 7).
Figure 7 shows the deduced amino acid sequence of LpSPSc (Sequence ID No: 8).
Figure 8 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSc (Sequence ID Nos: 9 and 10).
Figure 9 shows the consensus contig nucleotide sequence of LpSPSd (Sequence ID No: 11).
Figure 10 shows the deduced amino acid sequence of LpSPSd (Sequence ID No: 12).
Figure 11 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSd (Sequence ID Nos: 13 and 14).
Figure 12 shows the consensus contig nucleotide sequence of LpSPSe (Sequence ID No: 15).
Figure 13 shows the deduced amino acid sequence of LpSPSe (Sequence ID No: 16).
Figure 14 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSe (Sequence ID Nos: 17 and 18).
Figure 15 shows the consensus contig nucleotide sequence of LpSPSf (Sequence ID No: 19).
21
Figure 16 shows the deduced amino acid sequence of LpSPSf (Sequence ID No: 20).
Figure 17 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSPSf (Sequence ID Nos: 21, 22 and 23).
Figure 18 shows the consensus contig nucleotide sequence of LplNVa (Sequence ID No: 24).
Figure 19 shows the deduced amino acid sequence of LplNVa (Sequence ID No: 25).
Figure 20 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVa (Sequence ID Nos: 26 to 30).
Figure 21 shows the consensus contig nucleotide sequence of LplNVb (Sequence ID No: 31).
Figure 22 shows the deduced amino acid sequence of LplNVb (Sequence ID No: 32).
Figure 23 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVb (Sequence ID Nos: 33 to 36).
Figure 24 shows the consensus contig nucleotide sequence of LplNVc (Sequence ID No: 37).
Figure 25 shows the deduced amino acid sequence of LplNVc (Sequence ID No: 38).
Figure 26 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVc (Sequence ID Nos: 39 and 40).
Figure 27 shows the consensus contig nucleotide sequence of LplNVd (Sequence ID No: 41).
Figure 28 shows the deduced amino acid sequence of LplNVd (Sequence ID No: 42).
Figure 29 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVd (Sequence ID Nos: 43 to 58).
Figure 30 shows the consensus contig nucleotide sequence of LplNVe (Sequence ID No: 59).
Figure 31 shows the deduced amino acid sequence of LplNVe (Sequence ID No: 60).
Figure 32 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVe (Sequence ID Nos: 61 and 62).
Figure 33 shows the consensus contig nucleotide sequence of LplNVf (Sequence ID No: 63).
Figure 34 shows the deduced amino acid sequence of LplNVf (Sequence ID No: 64).
Figure 35 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVf (Sequence ID Nos: 65 to 70).
23
PCT/AU01/OI275
Figure 36 shows the consensus contig nucleotide sequence of LplNVg (Sequence ID No: 71).
Figure 37 shows the deduced amino acid sequence of LplNVg (Sequence ID No: 72).
Figure 38 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LplNVg (Sequence ID Nos: 73 to 75).
Figure 39 shows the nucleotide sequence of LpSSa (Sequence ID No: 76).
Figure 40 shows the deduced amino acid sequence of LpSSa (Sequence ID No: 77).
Figure 41 shows the consensus contig nucleotide sequence of LpSSb (Sequence ID No: 78).
Figure 42 shows the deduced amino acid sequence of LpSSb (Sequence ID No: 79).
Figure 43 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSSb (Sequence ID Nos: 80 to 82).
Figure 44 shows the consensus contig nucleotide sequence of LpSSc (Sequence ID No: 83).
Figure 45 shows the deduced amino acid sequence of LpSSc (Sequence ID No: 84).
Figure 46 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSSc (Sequence ID Nos: 85 and 86).
24
Figure 47 shows the consensus contig nucleotide sequence of LpSTa (Sequence ID No: 87).
Figure 48 shows the deduced amino acid sequence of LpSTa (Sequence ID No: 88).
Figure 49 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSTa (Sequence ID Nos: 89 and 90).
Figure 50 shows the consensus contig nucleotide sequence of LpSTb (Sequence ID No: 91).
Figure 51 shows the deduced amino acid sequence of LpSTb (Sequence ID No: 92).
Figure 52 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSTb (Sequence ID Nos: 93 to 96).
Figure 53 shows the consensus contig nucleotide sequence of LpSTc (Sequence ID No: 97).
Figure 54 shows the deduced amino acid sequence of LpSTc (Sequence ID No: 98).
Figure 55 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpSTc (Sequence ID No: 99 and 100).
Figure 56 shows the nucleotide sequence of LpSSTa (Sequence ID No: 101).
Figure 57 shows the deduced amino acid sequence of LpSSTa (Sequence ID No: 102).
Figure 58 shows the consensus contig nucleotide sequence of LpFFTa (Sequence ID No: 103).
Figure 59 shows the deduced amino acid sequence of LpFFTa (Sequence ID No: 104).
Figure 60 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpFFTa (Sequence ID Nos: 105 to 109).
Figure 61 shows the nucleotide sequence of LpSFTa (Sequence ID No: 110).
Figure 62 shows the deduced amino acid sequence of LpSFTa (Sequence ID No: 111).
Figure 63 shows the plasmid map of the cDNA encoding perennial ryegrass, Invertasel (LpCWInvertasel).
Figure 64 shows the nucleotide sequence of perennial ryegrass Invertasel (Sequence ID No: 112).
Figure 65 shows the deduced amino acid sequence of perennial ryegrass Invertasel cDNA (Sequence ID No: 113).
Figure 66 shows plasmid maps of sense and antisense constructs of Lplnvertasel in pDH51 transformation vector.
Figure 67 shows screening by Southern hybridisation for RFLPs using Lplnvertasel as a probe.
26
Figure 68 shows the plasmid map of the cDNA encoding perennial ryegrass Invertase2 (LpCWInvertase2).
Figure 69 shows the nucleotide sequence of perennial ryegrass Invertase2 (Sequence ID No: 114).
Figure 70 shows the deduced amino acid sequence of perennial ryegrass Invertase2 cDNA (Sequence ID No: 115).
Figure 71 shows plasmid maps of sense and antisense constructs of Lplnvertase2 in pDH51 transformation vector.
Figure 72 shows screening by Southern hybridisation for RFLPs using Lplnvertase2 as a probe.
Figure 73 shows the plasmid map of the cDNA encoding perennial ryegrass Sucrose Synthase (LpSucrose Synthase).
Figure 74 shows the nucleotide sequence of perennial ryegrass Sucrose Synthase (Sequence ID No: 116).
Figure 75 shows the deduced amino acid sequence of perennial ryegrass Sucrose Synthase cDNA (Sequence ID No: 117).
Figure 76 shows plasmid maps of sense and antisense constructs of LpSucrose Synthase in pDH51 transformation vector.
Figure 77 shows screening by Southern hybridisation for RFLPs using LpSucrose Synthase as a probe.
Figure 78 shows the regeneration of transgenic tobacco plants from direct gene transfer to protoplasts of chimeric genes encoding perennial ryegrass enzymes involved in metabolism and transport of soluble carbohydrates.
27
Figure 79 shows a subgrid of a microarray for the expression profiling of perennial ryegrass genes involved in metabolism and transport of soluble carbohydrates. Red represents up-regulated expression, green represents down-regulated expression and yellow represents no change in expression. 5 For example, an overlay of microarray images probed with 10LS tissues
(red) and 10DS tissues (green). Expression level is relatively expressed as up-regulated in 10LS (red), down-regulated in 10LS (green) and no change in expression (yellow).
Figure 80 shows the genetic linkage map of perennial ryegrass NA6 showing map location of ryegrass genes encoding enzymes involved in metabolism and transport of soluble carbohydrates.
EXAMPLE 1
Preparation of cDNA libraries, isolation and sequencing of cDNAs coding for SPS, INV, SS, ST, SST, FFT, and SFT from perennial ryegrass (Lolium 15 perenne)
cDNA libraries representing mRNAs from various organs and tissues of perennial ryegrass (Lolium perenne) were prepared. The characteristics of the libraries are described in Table 1.
TABLE 1
cDNA libraries from perennial ryegrass (Lolium perenne)
Library
Organ/Tissue
01 rg
Roots from 3-4 day old light-grown seedlings
02rg
Leaves from 3-4 day old light-grown seedlings
03rg
Etiolated 3-4 day old dark-grown seedlings
04rg
Whole etiolated seedlings (1-5 day old and 17 days old)
05rg
Senescing leaves from mature plants
06rg
Whole etiolated seedlings (1-5 day old and 17 days old)
07rg
Roots from mature plants grown in hydroponic culture
08rg
Senescent leaf tissue
• 10
28
PCT/AUO 1/012 75
09rg
Whole tillers and sliced leaves (0,1, 3, 6,12 and 24 h after harvesting)
10rg
Embryogenic suspension-cultured cells
11rg
Non-embryogenic suspension-cultured cells
12rg
Whole tillers and sliced leaves (0,1, 3, 6,12 and 24 h after harvesting)
13rg
Shoot apices including vegetative apical meristems
14rg immature inflorescences including different stages of inflorescence meristem and inflorescence development
15rg
Defatted pollen
16rg
Leaf blades and leaf sheaths (rbcL, rbcS, cab, wir2A subtracted)
17rg
Senescing leaves and tillers
18rg
Drought-stressed tillers (pseudostems from plants subjected to PEG-simulated drought stress)
19rg
Non-embryogenic suspension-cultured cells subjected to osmotic stress (grown in media with half-strength salts)
(1,2, 3, 4, 5, 6, 24 and 48 h after transfer)
20rg
Non-embryogenic suspension-cultured cells subjected to osmotic stress (grown in media with double-strength salts)
(1, 2, 3, 4, 5, 6, 24 and 48 h after transfer)
21 rg
Drought-stressed tillers (pseudostems from plants subjected to PEG-simulated drought stress)
22rg
Spikelets with open and maturing florets
23rg
Mature roots (specific subtraction with leaf tissue)
The cDNA libraries may be prepared by any of many methods available. For example, total RNA may be isolated using the Trizol method (Gibco-BRL, USA) or the RNeasy Plant Mini kit (Qiagen, Germany), following the manufacturers' instructions. cDNAs may be generated using the SMART PCR cDNA synthesis kit (Clontech, USA), cDNAs may be amplified by long distance polymerase chain reaction using the Advantage 2 PCR Enzyme system (Clontech, USA), cDNAs may be cleaned using the GeneClean spin column (Bio 101, USA), tailed and size fractionated, according to the protocol provided by Clontech. The cDNAs may be introduced into the pGEM-T Easy Vector system 1 (Promega, USA) according to the protocol provided by Promega. The cDNAs in the pGEM-T Easy plasmid vector are transfected into Escherichia coli Epicurian coli XL10-Gold ultra competent cells (Stratagene, USA) according to the protocol provided by Stratagene.
29
• 10
Alternatively, the cDNAs may be introduced into plasmid vectors for first preparing the cDNA libraries in Uni-ZAP XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, CA, USA). The Uni-ZAP XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBluescript. In addition, the cDNAs may be introduced directly into precut pBluescript II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into E. coli DH10B cells according to the manufacturer's protocol (GIBCO BRL Products).
Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant plasmids, or the. insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Plasmid DNA preparation may be performed robotically using the Qiagen QiaPrep Turbo kit (Qiagen, Germany) according to the protocol provided by Qiagen. Amplified insert DNAs are sequenced in dye-terminator sequencing reactions to generate partial cDNA sequences (expressed sequence tags or "ESTs"). The resulting ESTs are analyzed using an Applied Biosystems ABI 3700 sequence analyser.
EXAMPLE 2
DNA sequence analyses
The cDNA clones encoding SPS, INV, SS, ST, SST, FFT, and SFT were identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al. (1993) J. Mol. Biol. 215:403-410) searches. The cDNA sequences obtained were analysed for similarity to all publicly available DNA sequences contained in the eBioinformatics nucleotide database using the BLASTn algorithm provided by the National Center for Biotechnology Information (NCBl). The DNA sequences were translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the SWISS-PROT protein sequence database using BLASTx algorithm (v 2.0.1) (Gish and States (1993) Nature Genetics 3:266-272) provided by the NCBl.
The cDNA sequences obtained and identified were then used to identify additional identical and/or overlapping cDNA sequences generated using the BLASTn algorithm. The identical and/or overlapping sequences were subjected to a multiple alignment using the CLUSTALw algorithm, and to generate a consensus 5 contig sequence derived from this multiple sequence alignment. The consensus contig sequence was then used as a query for a search against the SWISS-PROT protein sequence database using the BLASTx algorithm to confirm the initial identification.
EXAMPLE 3
Identification and full-length sequencing of perennial ryegrass Invertasel, Invertase2 and Sucrose Synthase cDNAs encoding enzymes involved in metabolism and transport of soluble carbohydrates
To fully characterise for the purposes of the generation of probes for hybridisation experiments and the generation of transformation vectors, a set of 15 perennial ryegrass cDNAs encoding enzymes involved in soluble carbohydrate metabolism was identified and fully sequenced.
Full-length cDNAs were identified from our EST sequence database using relevant published sequences (NCBl databank) as queries for BLAST searches. Full-length cDNAs were identified by alignment of the query and hit sequences 20 using Sequencher (Gene Codes Corp., AnnArbor, Ml 48108, USA). The original plasmid was then used to transform chemically competent XL-1 cells (prepared in-house, CaCl2 protocol). After colony PCR (using HotStarTaq, Qiagen) a minimum of three PCR-positive colonies per transformation were picked for initial sequencing with M13F and M13R primers. The resulting sequences were aligned 25 with the original EST sequence using Sequencher to confirm identity and one of the three clones was picked for full-length sequencing, usually the one with the best initial sequencing result.
Sequencing was completed by primer walking, i.e. oligonucleotide primers were designed to the initial sequence and used for further sequencing. In most
31
cases the sequencing could be done from both 5' and 3' end. The sequences of the oligonucleotide primers are shown in Table 2. In some instances, however, an extended poly-A tail necessitated the sequencing of the cDNA to be completed from the 5' end.
TABLE 2
List of primers used for sequencing of full-length cDNAs
Gene name clone ID
primer primer sequence (5'->3')
LpCW Invertasel
07rg2lsF01.2
07rg2lsF01.f1
ACATAAGCGGTTGCTGGAC
07rg2lsF01.f2
GGATGGACTGTGGAGGATAG
07rg2!sF01.f3
TCGGTTCAAGGTGGCATAGG
07rg2lsF01.f4
TCGGTTCAAGGTGGCATAGG
LpCWlnvertase2
07rg1NsB10.2
07rg1NsB10.f1
ATCTCGCCGACCATCCCG
07rg1NsB10.f2
TTCAAGCACTGGGTCCGC
07rg1 NsB10.f3
CGACTACGGCAACTTCTACG
07rg1NsB10.f4
AGGATGGATAC GGC AAAC
LpSucroseSynthase
10rg2QsE09.1
10rg2QsE09.f1
TTCAATGCTTCCTTCCCG
10rg2QsE09.f2
CGTCCTCTGAGTTCAACCAC
10rg2QsE09.f3
ATCCTCATTGTCACCAGGC
10rg2QsE09.f4
TTGTGAATGGTGTCTCTGG
10rg2QsE09.r1
TTGTCCGTGTTCTCGCCATC
10rg2QsE09.r2
GGAGCAGGCTGAGTTCAAA
Contigs were then assembled in Sequencher. The contigs include the 10 sequences of the SMART primers used to generate the initial cDNA library as well as pGEM-T Easy vector sequence up to the EcoRl cut site both at the 5' and 3' end.
Plasmid maps and the full cDNA sequences of perennial ryegrass Invertasel, Invertase2 and Sucrose Synthase were obtained (Figures 63, 68 and 15 73).
32
EXAMPLE 4
Development of transformation vectors containing chimeric genes with Invertasel, Invertase2 and Sucrose Synthase cDNA sequences from perennial ryegrass
To alter the expression of the enzymes involved in soluble carbohydrate metabolism Invertasel, Invertase2 and Sucrose Synthase, through antisense and/or sense suppression technology and for over-expression of these key enzymes in transgenic plants, a set of sense and antisense transformation vectors was produced.
cDNA fragments were generated by high fidelity PCR using the original pGEM-T Easy plasmid cDNA as a template. The primers used (Table 3) contained restriction sites for EcoRl and Xbal for directional and non-directional cloning into the target vector.
TABLE 3
List of primers used to PCR-amplify the open reading frames
Gene name clone ID
Primer primer sequence (5'->3')
LpCW Invertasel
07rg2lsF01.2
Lplnvertasel f
GAATTCTAGATCCTCCCTCCTTCTGTCC
Lplnvertasel r
GAATTCTAGACCAGTCGTCTAATCACAGGTC
LpCWInvertase2
07rg1NsB10.2
Lplnvertase2f
GAATTCTAGATCCATCCATCCTTGTCTC
Lplnvertase2r
GAATTCTAGAACGAAATGCGAGGAAGCG
LpSucroseSynthase
10rg2QsE09.1
LpSuSyf
GAATTCTAGACTTCTCCCCTCACACACC
LpSuSyr
GAATTCTAGACGGTAGACAATCAAATCATAGC
After PCR amplification and restriction digest with the appropriate restriction enzyme (usually Xbal), the cDNA fragments were cloned into the corresponding site in pDH51, a pUC18-based transformation vector containing a CaMV 35S expression cassette. The orientation of the constructs (sense or antisense) was checked by DNA sequencing through the multi-cloning site of the vector.
33
PCT/AU 01/01275
Transformation vectors containing chimeric genes using full-length open reading frame cDNAs of perennial ryegrass Invertasel, Invertase2 and Sucrose Synthase in sense and antisense orientations under the control of the CaMV 35S promoter were generated (Figures 66, 71 and 76).
EXAMPLE 5
Production of transgenic tobacco plants carrying chimeric Invertasel, Invertase2 and Sucrose Synthase genes from perennial ryegrass
A set of transgenic tobacco plants carrying chimeric Invertasel, Invertase2 10 and Sucrose Synthase cDNA genes from perennial ryegrass were produced.
pDH51-based transformation vectors with (Lplnvertasel, Z.plnvertase2 and LpSucrose Synthase cDNAs comprising the full open reading frame sequences in sense and antisense orientations under the control of the CaMV 35S promoter were generated.
Direct gene transfer experiments to tobacco protoplasts were performed using these transformation vectors.
The production of transgenic tobacco plants carrying the perennial ryegrass Invertasel, Invertase2 and Sucrose Synthase cDNAs under the control of the constitutive CaMV 35S promoter is described here in detail.
Isolation of mesophyll protoplasts from tobacco shoot cultures
2-4 fully expanded leaves of a 6 week-old shoot culture were placed under sterile conditions (work in laminar flow hood, use sterilized forceps, scalpel and blades) in a 9 cm plastic culture dish containing 12 ml enzyme solution [1.0% (w/v) cellulase "Onozuka" R10 and 1.0% (w/v) Macerozyme® R10]. The leaves were 25 wetted thoroughly with enzyme solution and the mid-ribs removed. The leaf halves were cut into small pieces and incubated overnight (14-18 h) at 25°C in the dark without shaking.
34
The protoplasts were released by gently pipetting up and down, and the suspension poured through a 100 jjm stainless steel mesh sieve on a 100 ml glass beaker. The protoplast suspension was mixed gently, distributed into two 14 ml sterile plastic centrifuge tubes and carefully overlayed with 1 ml W5 solution. After 5 centrifugation for 5 min. at 70g (Clements Orbital 500 bench centrifuge, swing-out rotor, 400 rpm), the protoplasts were collected from the interphase and transferred to one new 14 ml centrifuge tube. 10 ml W5 solution were added, the protoplasts resuspended by gentle tilting the capped tube and pelleted as before. The protoplasts were resuspended in 5-10 ml W5 solution and the yield determined by 10 counting a 1:10 dilution in a haemocytometer.
Direct gene transfer to protoplasts using polyethylene glycol
The protoplasts were pelleted [70g (Clements Orbital 500 bench centrifuge, 400 rpm) for 5 min.] and resuspended in transformation buffer to a density of 1.6 x 10s protoplasts/ml. Care should be taken to carry over as little as possible W5 15 solution into the transformation mix. 300 jj\ samples of the protoplast suspension (ca. 5 x 105 protoplasts) were aliquotted in 14 ml sterile plastic centrifuge tubes, 30 fj\ of transforming DNA were added. After carefully mixing, 300 //I of PEG solution were added and mixed again by careful shaking. The transformation mix was incubated for 15 min. at room temperature with occasional shaking. 10 ml W5 20 solution were gradually added, the protoplasts pelleted [70g (Clements Orbital 500 bench centrifuge, 400 rpm) for 5 min.] and the supernatant removed. The protoplasts were resuspended in 0.5 ml K3 medium and ready for cultivation.
Culture of protoplasts and selection of transformed lines and regeneration of transgenic tobacco plants
Approximately 5 x 105 protoplasts were placed in a 6 cm petri dish. 4,5 ml of a pre-warmed (melted and kept in a water bath at 40-45°C) 1:1 mix of K3:H medium containing 0.6% SeaPlaque™ agarose were added and, after gentle mixing, allowed to set.
PCT/AUO 1/012 75
After 20-30 min the dishes were sealed with Parafilm® and the protoplasts were cultured for 24 h in darkness at 24°C, followed by 6-8 days in continuous dim light (5 //mol nrf2 s"\ Osram L36 W/21 Lumilux white tubes), where first and multiple cell divisions occur. The agarose containing the dividing protoplasts was 5 cut into quadrants and placed in 20 ml of A medium in a 250 ml plastic culture vessel. The corresponding selection agent was added to the final concentration of 50 mg/l kanamycin sulphate (for npt2 expression) or 25 mg/l hygromycin B (for hph expression) or 20 mg/l phosphinotricin (for bar expression). Samples were incubated on a rotary shaker with 80 rpm and 1.25 cm throw at 24°C in continuous 10 dim light.
Resistant colonies were first seen 3-4 weeks after protoplast plating, and after a total time of 6-8 weeks protoplast-derived resistant colonies (when 2-3 mm in diameter) were transferred onto MS morpho medium solidified with 0.6% (w/v) agarose in 12-well plates and kept for the following 1-2 weeks at 24°C in 15 continuous dim light (5 //mol m'2 s"1, Osram L36 W/21 Lumilux white tubes), where calli proliferated, reached a size of 8-10 mm, differentiated shoots that were rooted on MS hormone free medium leading to the recovery of transgenic tobacco plants (Table 4, Figure 78).
TABLE 4
Production of transgenic tobacco calli carrying chimeric ryegrass genes, (in sense and antisense orientation) encoding enzymes involved in soluble carbohydrate metabolism and transport, from direct gene transfer to protoplasts
Construct
Transfected protoplasts transformed calli transformation efficiency pDH51 Lplnvertasel
1.5x10°
68
4.53x10"°
pDH51 Lplnvertasel anti
1.5x10"
85
.66x10"°
pDH51 Lplnvertase2
1.5x10°
96
6.40x10'°
pDH51 Lpinvertase2 anti
1.5x10°
73
4.86x10"°
pDH51 LpSucrose Synthase
1.5x10°
115
7.66x10°
pDH51 LpSucrose Synthase anti
1.5x10°
97
6.46x10°
36
PCT/AIJ01/01275
EXAMPLE 6
Genetic mapping of perennial ryegrass genes encoding enzymes involved in metabolism and transport of soluble carbohydrates
Perennial ryegrass SPS, INV, SS, ST, SST, FFT, and SFT cDNAs were 5 either PCR-amplified or cut from their respective plasmids, gel-purified and radio-labelled for use as probes to detect restriction fragment length polymorphisms (RFLPs). RFLPs were mapped in the F-j (first generation) population, NA6 x Atfe. This population was made by crossing an individual (NAe) from a North African ecotype with an individual (Alk) from the cultivar Aurora, which is derived from a 10 Swiss ecotype. Genomic DNA of the 2 parents and 114 progeny was extracted using the 1 x CTAB method of Fulton et al. (1995).
Probes were screened for their ability to detect polymorphism using the DNA (10 jag) of both parents and 5 Fi progeny restricted with the enzymes Dral, EcoRI, EcoRV or Hindlll. Hybridisations were carried out using the method of 15 Sharp et al. (1988). Polymorphic probes were screened on a progeny set of 114 individuals restricted with the appropriate enzyme (Figures 67, 72 and 77).
RFLP bands segregating within the population were scored and the data was entered into an Excel spreadsheet. Alleles showing the expected 1:1 ratio were mapped using MAPMAKER 3.0 (Lander et al. 1987). Alleles segregating from, and unique to, each parent, were mapped separately to give two different linkage maps. Markers were grouped into linkage groups at a LOD of 5.0 and ordered within each linkage group using a LOD threshold of 2.0.
LpSPS, LplNV, LpSS, LpST, LpSST, LpFFT, and LpSFT loci mapped to the linkage groups as indicated in Table 5 and in Figure 80. These gene locations can 25 now be used as candidate genes for quantitative trait loci for traits associated with metabolism and transport of soluble carbohydrates, such as carbohydrate content, herbage quality, dry matter digestibility, plant organ size, plant height, plant yield, carbohydrate storage, tolerance to abiotic stresses such as drought and cold.
pct7au01/01275
37
TABLE 5
Map locations of ryegrass genes encoding enzymes, involved in metabolism and transport of soluble carbohydrates, across two genetic linkage maps of perennial ryegrass (N6 and AU6)
Probe
Poly
Mapped
Locus
Linkage
morphic with
Group
NA6
AU6
LpCW I nvertasel/LplNVb
Y
Hind III
LpCWInvertasel
3
3
LpCWlnvertase2
Y
EcoRI
LpCWlnvertase2
6
LpFFTa
Y
Dra 1
LpFFTa.1
4
4
LpFFTa.2
6
LplNVa
Y
EcoRI
LplNVa
LplNVc
Y
EcoRV
LplNVc
3
LplNVg
Y
Dra 1
LplNVg
3
3
LpSFTa
Y
Hind III
LpSFTa.1
3
3
LpSFTa.2
3
LpSPSf
Y
Dra I
LpSPSf
6
6
LpSSa (LpSucroseSynthase)
Y
EcoRI
LpSSa.1
3
LpSSa.2
1
LpSSc
Y
EcoRV
LpSSc
4
LpSucroseSynthase
Y
Dra 1
LpSucroseSynthase
7
7
♦ EXAMPLE 7
Expression profiling of cDNAs encoding ryegrass enzymes involved in metabolism and transport of soluble carbohydrates using microarray 10 technology
Genes and cDNAs encode for the enzymes involved in metabolism and transport of soluble carbohydrates were PCR amplified and purified. The amplified products were spotted thrice on each amino-silane coated glass slide (CMT-GAPS, Corning, USA) using microgridder (BioRobotics, UK). Spotting solution was 15 also spotted in every subgrids of the microarray as negative and background controls. The duplicates were placed about 800 micron apart to prevent competitive hybridisation (Table 6).
33
TABLE 6
List of hybridization probes used in expression profiling of perennial ryegrass genes encoding enzymes involved in metabolism and transport of soluble carbohydrates using microarrays
Hybridization probe for microarrays
Organ specificity (3-month old plants grown hydroponically)
Leaf blade
Sheath
Root
Seedling grown under light condition
-day old shoot (5LS)
7-day old shoot (7LS)
-day old shoot (10LS)
-day old root (5LR)
7-day old root (7LR)
-day old root (10LR)
Seedling grown under dark condition
-day old shoot (5DS)
7-day old shoot (7DS)
-day old shoot (10DS)
-day old root (5DR)
7-day old root (7DR)
-day old root (10DR)
The following tissues were used to extract total RNA. Fluorescence labelled probes were synthesis by reversed transcribing RNA and incorporating Cyanine 3 or 5 labelled dCTP. The probes were hybridised onto microarrays. In each case 10 the experiment was repeated on two microarrays. After overnight (16 hours) hybridisation, the microarrays were washed and scanned using confocal laser scanner (ScanArray 3000, Packard, USA). The images obtained were quantified and analysed using lmagene 4.1 and GeneSight 2.1 (BioDiscovery, USA). Data were judged as not present (-), low expression (+), medium expression (++), high 15 expression (+++) and highly expression (mi i-) (Table 7).
TABLE 7
Results of expression profiling of ryegrass genes encoding enzymes involved in metabolism and transport of soluble carbohydrates plate row
Column gene id clone id
Gene seq notes sheath leaf blade root
5LS
7LS
10LS
6LR
7LR
10LR
5DS
7DS
10DS
5DR
7DR
10DR
Array2Urg e
12
McaSPS2_CRAPL7615
10rg2JsE05
LpSPSa partial
-
-
-
-
-
■
-
-
-
-
-
Array2Urg l
1
MSPS_BETVU--76i 6
11rg1FsD02
LpSPSb partial
-
-
+
-
-
-
-
-
-
-
Array2Urg f
2
MSPS1_CITUN-7617
16rg1DsA12
LpSPSb partial
+++
-
•H+
-
-
4++
4+4+
+4+
4-4+
+4+
4+4-
+
+4+
Array2Urg f
4
MSPS_BETVU—7619
17rg1DsF04
LpSPSc partial
-
Array2Urg f
MSPS1_CITUN~7620
14rg1RsE07
LpSPSd partial
+++
++
4+
+
-
-
4+
-
-
Array2Urg f
6
McaSPSl_CRAPL7621
14rg2CsC07
LpSPSd partial
-
-
-
4+
•
-
-
-
-
Array2Urg
»
7
McaSPS_MAIZE-7622
15rg1NsG08
LpSPSe partial
Array2Urg f
8
McaSPSJ/IAIZE-7623
1Srg1RsA10
LpSPSe partial
Array2Urg f
9
MSPS1_CITUN~7624
01rg1DsF09
LpSPSf partial
Array2Urg f
MSPS_BETVU—7625
16tg1CsC09
LpSPSi partial
-
-
-
+
-
ArrayZUrg l
11
McaSPS_SPIOL-7620
19rg1ZsC01
LpSPSf partial
-
-
-
-
-
-
■
-
-
Array2Urg f
12
XnsRL23_.TRYCR7627
01rg1SsG04
LplNVa partial
-
-
-
-
-
-
-
•
-
Array2Urg g
1
XnsRRA_MOUSE-7628
13rg2HsC10
LpfNVa partial
++++
++++
+4+
4+4+
4+4+
+
-
4+
4-4++
-
4+
+
Atray2Urg
9
2
ZbyRL23JTRYCR7629
16rg1Ds010
LplNVa partial
+
-
4+
4-
-
4+
+
-
4-4-4-
-
+
-
Array2Urg
9
3
ZhyRL23_TRYCR7630
16rg1EsA02
LplNVa partial
-
+
4+
-
-
4-4-
+
4-
4+
-
4++
4-4+
+
Avray2Urg g
4
ZhyRL23_TRYCR7631
16rg1JsB05
LplNVa partial?
-
-
+
-
-
+
-
-
-
-
-
-
■
Array2Urg
9
McalNV1_PEA--7632
07rg2lsF01
LplNVb full
+++
++
4++
4+
+
+
4++
4+4+
4+
4+4+
4-4++
4+
4-4+4-
4-4+4-
+4-
Array2Urg g
6
McalNV1_PEA—7633
06rg1MsA12
LplNVc full
++
-
4+
-
-
4++
4+
-
4+
4+4+
-
4+4+
+
+
Array2Urg
9
7
McalNVA_PHAAU7634
02rg1EsA07
LplNVe partial
++++
4+4+
4+4+
4+
4+
Array2Urg
9
8
McalNVA_PHAAU7635
02rg1 FsH02
.pINVe partial
++
+
4+
+
4+
+
-
-
-
-
-
Array2Urg
9
9
McalNV2_DAUCA7636
06rg2QsF09
LplNVI
partial
-
-
-
-
-
-
-
-
4+
-
- '
4+
Array2Urg
9
Mca/NV2_OAUCA7637
08rg1PsH09
LplNVf partial
•H-
4+4+
4+
4+
4+4-
4++
4-4+
4+4-
4+4-
+
4+4+
4-4+
4+4+
4+4-
4-4-4*4' ;Array2Urg ;9 ;11 ;McalNV2_DAUCA7638 ;08rg1YsA09 ;LplNVf partial ;++ ;4+4+ ;4-4+ ;4+ ;4++ ;4++ ;4+4+ ;4++ ;4+4+ ;+ ;4+4+ ;4++ ;4+4+ ;4+4-4- ;4-4+4- ;Array2Urg g ;12 ;McalNV1_CAPAN7639 ;13rg1LsQ12 ;LplNVf partial ;- ;4++ ;+ ;- ;4-+ ;- ;4+ ;- ;- ;- ;4+ ;- ;4+4- ;44+ ;- ;Artay2Urg h ;1 ;XnsNU6MJ\LCT07640 ;13rg1WsG07 ;LplNVf partial ;++ ;44+ ;+4-+ ;4-4+ ;+4-+ ;4+4 ;+4+4- ;4+ ;+4++ ;+ ;4-4-4+ ;4++ ;4-4++ ;4-4+4- ;++4+ ;Array2Urg h ;2 ;McalNV1_PEA~7641 ;11rg1EsF06 ;LplNVg partial ;- ;Array2Urg h ;3 ;McalNV1_PEA~7642 ;11rglEsG04 ;LplNVg partial ;- ;- ;- ;- ;- ;- ;- ;- ;- ;4-+ ;+4+ ;- ;4-4-4+ ;- ;- ;Array2Urg h ;4 ;McalNV1wPEA—7643 ;13rg1QsB04 ;LplNVg partial ;- ;+ ;- ;+ ;- ;- ;- ;- ;- ;+ ;- ;++ ;- ;- ;Array2Urg h ;6 ;McaSUS1_HORVU7645 ;10rg2QsE09 ;LpSSa ;(LpSucrose ;Synthase) ;partial ;++ ;+++ ;+++ ;+++ ;++ ;++ ;+++ ;++ ;++++ ;++ ;++++ ;Array2Urg h ;7 ;McaSUS2jORYSA7646 ;20rg1SsH05 ;LpSSa ;(LpSucrose ;Synthase) ;partial ;++ ;+ ;+- ;Array2Urg h ;8 ;McaSUSSLORYSA7647 ;07rg1VsC02 ;LpSSb partial ;++ ;++ ;-H- ;+++ ;++++ ;++ ;+++ ;++++ ;++++ ;■H- ;++++ ;+++ ;+-H-+ ;++++ ;++++ ;Array2Urg h ;12 ;XnsHSA244516-7964 ;17rg1AsG09 ;LplNVf partial ;+ ;- ;- ;- ;+ ;++ ;- ;+ ;- ;+++ ;- ;+++ ;++ ;Array2Vrg a ;1 ;McaSUS2_ORYSA7648 ;07rg2MsC02 ;LpSSb partial ;• ;4 ;- ;Array2Vrg a ;2 ;McaSUS2_ORYSA7649 ;20rg10sB08 ;LpSSb partial ;- ;- ;- ;- ;- ;+ ;- ;- ;++ ;- ;- ;- ;- ;Array2Vrg a ;3 ;McaSUS2_PEA-7650 ;19rg1HsE03 ;LpSSc partial ;Array2Vrg a ;4 ;McaSUS2_PEA—7651 ;20rg1TsG12 ;LpSSc partfaf ;ArrayZVrg a ;5 ;McalNVA_LYCES7652 ;08rg1DsC08 ;LpSSTas partial ;- ;Array2Vrg a ;6 ;McaIN VIJWAIZE7653 ;06rg10sA05 ;LpFFTa partial ;++++ ;+++ ;++++ ;++++ ;++-H- ;- ;++++ ;++-H- ;++ ;+4++ ;++++ ;++++ ;++++ ;- ;Array2Vrg a ;7 ;McalNV1_MAIZE7654 ;06rg1WsB01 ;LpFFTa partial ;++++ ;+-H- ;+++ ;++ ;- ;- ;+++ ;+ ;• ;++++ ;■H-H- ;++++ ;++ ;- ;Array2Vrg a ;8 ;McalNV1_MAIZE7655 ;06rg2ZsE11 ;LpFFTa partial ;++++ ;+ ;++++ ;+++ ;+++4*
++
+++
+++
+++
++++
++++
+++
++++
+++
+++
Array2Vrg a
9
McalNV1_MAIZE7656
14rg1TsF06
LpFFTa partial
-
-
-
++
+
-
•
-
-
++
•
-
•
-
Array2Vrg a
McalNV1_MA!ZE7657
14rg2EsB06
LpFFTa partial
-
+
-
++
+
+
-
-
-
++
+
-
■
-
Array2Vrg a
11
McalNV 1 __MAIZE765B
iBrglBsDOl
LpSFTa partial
-
"
"
++
+
-
++++
-
-
+
44
-
+++
++
-
WO iwmiw
41
pct/au01/01275
REFERENCES
Feinberg, A.P., Vogelstein, B. (1984). A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem.
132:6-13.
Frohman et al. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad Sci. USA 85:8998
Gish and States (1993) Identification of protein coding regions by database
similarity search. Nature Genetics 3:266-272
Lander, E.S., Green P., Abrahamson, J„ Barlow, A., Daly, M.J., Lincoln, S.E., Newburg, L. (1987). MAPMAKER: an interactive computer package for constructing primary linkage maps of experimental and natural populations. Genomics 1:174-181.
Loh, E.Y., Elliott, J.F., Cwirla, S., Lanier, L.L., Davis, M.M. (1989). Polymerase chain reaction with single-sided specificity: Analysis of T-celi receptor delta chain. Science 243:217-220
Ohara, 0., Dorit, R.L., Gilbert, W. (1989). One-sided polymerase chain reaction: The amplification of cDNA. Proc. Natl. Acad Sci USA 86:5673-5677
Sambrook, J., Fritsch, E.F., Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual. Cold Spring Harbour Laboratory Press
Sharp, P.J., Kreis, M., Shewry, P.R., Gale, M.D. (1988). Location of a-amylase sequences in wheat and its relatives. Theor. Appl. Genet. 75:286-290.
42
Finally, it is to be understood that various alterations, modifications and/or additions may be made without departing from the spirit of the present invention as outlined herein.
It will also be understood that the term "comprises" (or its grammatical variants) as used in this specification is equivalent to the term "includes" and should not be taken as excluding the presence of other elements or features.
Documents cited in this specification are for reference purposes only and their inclusion is not an acknowledgment that they form part of the common general knowledge in the relevant art.
004917004
43
Claims (21)
1. A substantially purified or isolated nucleic acid or nucleic acid fragment encoding a sucrose synthase (SS) polypeptide from a ryegrass (Lolium) species.
2. A nucleic acid or nucleic acid fragment according to Claim 1, wherein said 5 ryegrass species is perennial ryegrass (Lolium perenne).
3. A substantially purified or isolated nucleic acid or nucleic acid fragment encoding an SS polypeptide and including a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 39, 41, 43, 44, 46 and 74 hereto (Sequence ID Nos: 76, 78, 80 to 82, 83, 85 and 86, and 116, respectively); (b) 10 complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants having at least approximately 90% identity with the sequences recited in (a), (b) and (c).
4. A construct including a nucleic acid or nucleic acid fragment according to any one of Claims 1-3. 15
5. A vector including a nucleic acid or nucleic acid fragment according to any one of Claims 1-3.
6. A vector according to Claim 5, further including a promoter and a terminator, said promoter, nucleic acid or nucleic acid fragment and terminator being operatively linked.
7. A plant cell, plant, plant seed or other plant part, including a construct according 20 to claim 4 or a vector according to Claim 5 or 6.
8. A plant, plant seed or other plant part derived from a plant cell or plant according to Claim 7.
9. A method of modifying soluble carbohydrate metabolism and/or transport in a plant, said method including introducing into said plant an effective amount of a nucleic intellectual property office of n.z. - 8 JAN 2007 received 004917004 44 acid or nucleic acid fragment according to any one of Claims 1-3, a construct according to claim 4 and/or a vector according to Claim 5 or 6.
10. Use of a nucleic acid or nucleic acid fragment according to any one of Claims 1-3, and/or nucleotide sequence information thereof, and/or single nucleotide 5 polymorphisms thereof as a molecular genetic marker.
11. The use according to claim 10 wherein the molecular genetic marker is for one or more quantitative trait loci (QTL) tagging, QTL mapping, DNA fingerprinting or marker assisted selections.
12. The use according to claim 10 or 11 wherein the molecular marker is used in 10 ryegrass species.
13. The use according to any one of claims 10 to 12 wherein the molecular marker is used to select for a herbage quality trait.
14. The use according to claim 13 wherein the trait is selected from the group consisting of dry matter digestibility, biotic stress tolerance, abiotic stress tolerance, 15 plant stature, leaf and stem colour, carbohydrate content and carbohydrate storage.
15. A substantially purified or isolated nucleic acid or nucleic acid fragment including a single nucleotide polymorphism from a nucleic acid or nucleic acid fragment according to any one of claims 1-3.
16. A substantially purified SS polypeptide from a ryegrass (Lolium) species. 20
17. A polypeptide according to Claim 16, wherein said ryegrass is perennial ryegrass (Lolium perenne).
18. A substantially purified SS polypeptide including an amino acid sequence selected from the group consisting of (a) sequences shown in Figures 40, 42, 45 and 75 hereto (Sequence ID Nos: 77, 79 84 and 117, respectively); and (b) functionally active 25 fragments and variants thereof having at least 90% identity with the sequences recited in (a). intellectual property office of n.z. - 8 JAN 2007 pcrciwcn 45
19. A fructan or modified fructan or a sucrose or modified sucrose substantially or partially purified or isolated from a plant, plant seed or other plant part according to Claim 7 or 8.
20. A substantially purified or isolated nucleic acid or nucleic acid fragment according to Claim 1, substantially as hereinbefore described with reference to the examples.
21. A substantially purified or isolated polypeptide according to Claim 16, substantially as hereinbefore described with reference to any one of the examples.
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
AUPR0673A AUPR067300A0 (en) | 2000-10-10 | 2000-10-10 | Manipulation of soluble carbohydrates |
Publications (1)
Publication Number | Publication Date |
---|---|
NZ536967A true NZ536967A (en) | 2007-05-31 |
Family
ID=3824731
Family Applications (5)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
NZ575554A NZ575554A (en) | 2000-10-10 | 2001-10-10 | Manipulation of soluble carbohydrates (5) with fructan metabolism enzymes |
NZ561249A NZ561249A (en) | 2000-10-10 | 2001-10-10 | Nucleic acids that encode sucrose transporter (ST) protein from lolium species |
NZ536967A NZ536967A (en) | 2000-10-10 | 2001-10-10 | Nucleic acids that encode an enzyme or transporter proteins such as a sucrose synthase (SS) polypeptide from lolium |
NZ547618A NZ547618A (en) | 2000-10-10 | 2001-10-10 | Nucleic acids that encode an enzyme or transporter such as a sucrose phosphate synthase (SPS) from Lolium |
NZ524587A NZ524587A (en) | 2000-10-10 | 2001-10-10 | Enzymes from ryegrass (Lolium) and fescue (Festuca) species |
Family Applications Before (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
NZ575554A NZ575554A (en) | 2000-10-10 | 2001-10-10 | Manipulation of soluble carbohydrates (5) with fructan metabolism enzymes |
NZ561249A NZ561249A (en) | 2000-10-10 | 2001-10-10 | Nucleic acids that encode sucrose transporter (ST) protein from lolium species |
Family Applications After (2)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
NZ547618A NZ547618A (en) | 2000-10-10 | 2001-10-10 | Nucleic acids that encode an enzyme or transporter such as a sucrose phosphate synthase (SPS) from Lolium |
NZ524587A NZ524587A (en) | 2000-10-10 | 2001-10-10 | Enzymes from ryegrass (Lolium) and fescue (Festuca) species |
Country Status (3)
Country | Link |
---|---|
AU (3) | AUPR067300A0 (en) |
NZ (5) | NZ575554A (en) |
WO (1) | WO2002031130A1 (en) |
Families Citing this family (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
NZ532712A (en) | 2001-11-07 | 2006-12-22 | Genesis Res & Dev Corp Ltd | Polynucleotides isolated from forage grass tissues, specifically Lolium perenne (perennial ryegrass) and Festuca arundinacea (tall fescue) |
WO2003093464A1 (en) * | 2002-05-06 | 2003-11-13 | Genesis Research And Development Corporation Limited | Compositions isolated from forage grasses and methods for their use |
WO2023000243A1 (en) * | 2021-07-22 | 2023-01-26 | 深圳先进技术研究院 | Method for producing glucose by recombinant yeast biotransformation |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US5981852A (en) * | 1990-07-20 | 1999-11-09 | Calgene Llc | Modification of sucrose phosphate synthase in plants |
DE4220758A1 (en) * | 1992-06-24 | 1994-01-05 | Inst Genbiologische Forschung | DNA sequence and plasmids for the production of plants with a modified sucrose concentration |
-
2000
- 2000-10-10 AU AUPR0673A patent/AUPR067300A0/en not_active Abandoned
-
2001
- 2001-10-10 AU AU9525601A patent/AU9525601A/en active Pending
- 2001-10-10 NZ NZ575554A patent/NZ575554A/en not_active IP Right Cessation
- 2001-10-10 AU AU2001295256A patent/AU2001295256B2/en not_active Ceased
- 2001-10-10 NZ NZ561249A patent/NZ561249A/en not_active IP Right Cessation
- 2001-10-10 WO PCT/AU2001/001275 patent/WO2002031130A1/en active IP Right Grant
- 2001-10-10 NZ NZ536967A patent/NZ536967A/en not_active IP Right Cessation
- 2001-10-10 NZ NZ547618A patent/NZ547618A/en not_active IP Right Cessation
- 2001-10-10 NZ NZ524587A patent/NZ524587A/en not_active IP Right Cessation
Also Published As
Publication number | Publication date |
---|---|
WO2002031130A1 (en) | 2002-04-18 |
NZ561249A (en) | 2009-05-31 |
NZ524587A (en) | 2005-01-28 |
NZ547618A (en) | 2007-10-26 |
AU9525601A (en) | 2002-04-22 |
AUPR067300A0 (en) | 2000-11-02 |
AU2001295256B2 (en) | 2007-10-25 |
WO2002031130A9 (en) | 2003-08-14 |
NZ575554A (en) | 2010-12-24 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
AU2011202252B2 (en) | Manipulation of plant cell walls (3) | |
AU2002210243B2 (en) | Manipulation of flowering and plant architecture | |
AU2001295256B2 (en) | Manipulation of soluble carbohydrates | |
AU2013202733B2 (en) | Manipulation of soluble carbohydrates (5) | |
AU2007237376B2 (en) | Manipulation of soluble carbohydrates (2) | |
AU2012202979B2 (en) | Manipulation of soluble carbohydrates (3) | |
AU2001295256A1 (en) | Manipulation of soluble carbohydrates | |
AU2013202704B2 (en) | Manipulation of plant cell walls (4) | |
AU2013202728B2 (en) | Manipulation of flowering and plant architecture (4) | |
AU2011211347B2 (en) | Modification of plant and seed development and plant responses to stresses and stimuli (3) | |
AU2008201822B2 (en) | Modification of plant and seed development and plant responses to stresses and stimuli (2) | |
NZ560800A (en) | Modification of plant and seed development and plant responses to stresses and stimuli (3) | |
AU2007231631A1 (en) | Manipulation of flowering and plant architecture (2) |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PSEA | Patent sealed | ||
RENW | Renewal (renewal fees accepted) | ||
RENW | Renewal (renewal fees accepted) | ||
RENW | Renewal (renewal fees accepted) | ||
RENW | Renewal (renewal fees accepted) |
Free format text: PATENT RENEWED FOR 7 YEARS UNTIL 10 OCT 2021 BY JONES TULLOCH Effective date: 20140901 |
|
ERR | Error or correction |
Free format text: THE OWNER HAS BEEN CORRECTED TO 857141, AGRESEARCH LIMITED, 5TH FLOOR, TOWER BLOCK, RUAKURA RESEARCH CENTRE, HAMILTON, NZ; 2429761, AGRICULTURE VICTORIA SERVICES PTY LTD, 475 MICKLEHAM ROAD, ATTWOOD, VICTORIA 3049, AU Effective date: 20150821 |
|
EXPY | Patent expired |