AU2013202730B2 - Manipulation of flowering and plant architecture (5) - Google Patents

Abstract

The present invention relates to nucleic acids or nucleic acid fragments encoding amino acid sequences for proteins involved in the control of plant life cycles and/or growth phases, flowering processes, flowering and/or plant architecture, and/or inflorescence and/or flower development in plants, and the use thereof for the modification of plant life cycles and/or growth phases, flowering processes, flowering and/or plant architecture, and/or inflorescence and/or flower development in plants.

Description

2013202730 05 Apr 2013 P/00/001 Regulation 3.2 AUSTRALIA Patents Act 1990

COMPLETE SPECIFICATION STANDARD PATENT

Invention title: Manipulation of Flowering and Plant Architecture (5)

The following statement is a full description of this invention, including the best method of performing it known to us: 1a 2013202730 05 Apr 2013 MANIPULATION OF FLOWERING AND PLANT ARCHITECTURE (5)

This application is a divisional of Australian patent application No. 2012200604, which in turn is a divisional of Australian patent application 2007231631, which in turn is a divisional of Australian patent application 5 2002210243, the entire disclosures of which are incorporated herein by reference.

The present invention relates to nucleic acids or nucleic acid fragments encoding amino acid sequences for proteins involved in the control of plant life cycles and/or growth phases, flowering processes, flowering and/or plant architecture, and/or inflorescence and/or flower development in plants, and the use 10 thereof for the modification of plant life cycles and/or growth phases, flowering processes, flowering and/or plant architecture, and/or inflorescence and/or flower development in plants.

Most plants have several growth phases. Following seed embryo germination, the plant apical meristem goes through a vegetative phase generating 15 leaf primordia with axillary meristems. The axillary meristems will generate side branches or will rest dormant until apical dominance is removed. Upon receiving appropriate signals, the apical meristem switches to reproductive development (flowering). The switch is controlled by various physiological signals and genetic pathways that will coordinate flowering. The apical meristem switched from 20 vegetative to reproductive phase will produce an inflorescence. Inflorescences are the flower-bearing parts of the plant. Flowers are plant structures that support gametophyte development. Inflorescences are of two basic types, determinate (where apical meristems grow indefinitely generating floral meristems from their periphery) and indeterminate (where apical meristem is transformed into a floral 25 meristem terminating apical growth and with subsequent growth taking place from axillary meristems). Floral meristems produce a defined number of floral organ primordia in concentric whorls, which develop into sepals, petals, stamens or carpels (in the dicot flower); and into palea, lodicule, stamens and carpels (in the grass flower). 2 2013202730 05 Apr 2013 A series of homeotic genes that specify floral meristem identity and determine the fate of floral organ primordia have been identified. These genes interact to specify the basic floral organs of the dicot flower. These interactions can be summarized through the ‘ABC” model of floral organ identity, where the first 5 (outer) whorl organs (sepals) are specified by A-function genes, the second whorl organs (petals) are specified by a combination of A- and B-function activities, third whorl organs (stamens) by a combination of B- and C-function, and fourth whorl (carpels) by a C-function activity.

Most of these genes belong to a family of transcription factors characterized 10 by the presence of a conserved DNA-binding domain, named the MADS-box. These genes (MADS-box genes or MADS) thus encode plant MADS-box proteins and are involved in flower and embryo development. Identified MADS-box genes in the model crucifer Arabidopsis thaliana include the meristem identity A-function genes APETALA1 (AP1) and CAULIFLOWER (CAL)] the organ identity B-function 15 genes APETALA3 (AP3) and PISTILLATA (PI)] and the organ identity C-function gene AGAMOUS (AG).

The gene CENTRORADIALIS (CEN) of snapdragon (Antirrhinum) is required to maintain an indeterminate shoot identity.

The APETALA2 (AP2) gene of Arabidopsis thaliana has a role in the 20 specification of floral meristem identity and floral organ identity. AP2 is required for A-function organ identity. Mutations of AP2 lead to homeotic conversion of floral organs, for example conversion of sepals to leaves or to carpels, conversion of petals to stamens, absence of petals.

Other plant genes involved in pattern formation and having a putative role in 25 vegetative and floral development have a conserved DNA-binding domain, named the Homeo-box. These genes (Homeo-box genes or HB genes) thus encode plant homeodomain proteins that may function as transcription factors in controlling downstream target genes. Mutations in HB genes may result in abnormal leaf and flower development. 3 2013202730 05 Apr 2013

It would be useful however if other genes involved in specifying floral meristem identity, involved in the fate of floral development could be identified. In this regard the inventors have identified the following new genes: LpMADS, LpCEN, LpAP2, and LpHB. 5 It would be desirable to have methods of manipulating plant life cycles and growth phases eg. the transition from the vegetative to the reproductive stage, flowering processes, flowering and plant architecture and inflorescence and flower development in plants, including grass species such as ryegrasses (Lolium species) and fescues (Festuca species), thereby facilitating the production of, for example, 10 pasture and turf grasses and pasture legumes with enhanced or shortened or modified life cycles, enhanced or reduced or otherwise modified inflorescence and flower development, inhibited flowering (eg. non-flowering), modified flowering architecture (eg. indeterminate and determinate), earlier or delayed flowering, enhanced or modified number of leaves, enhanced or reduced or otherwise 15 modified number of reproductive shoots, enhanced persistence and improved herbage quality, enhanced seed and leaf yield, altered growth and development, leading to improved seed production, improved biomass production, improved pasture production, improved pasture quality, improved animal production and reduced environmental pollution (e.g. reduced pollen allergens, reduced 20 nitrogenous waste).

Perennial ryegrass (Lolium perenne L.) is a key pasture grass in temperate climates throughout the world. Perennial ryegrass is also an important turf grass.

Clovers (Trifolium species) such as white clover (7. repens), red clover (7. pratense) and subterranean clover (7. subterraneum), and lucerne (M. sativa) and 25 medics (Medicago species) are fructan-devoid, starch-accumulating key pasture legumes in temperate climates throughout the world.

While nucleic acid sequences encoding some of the enzymes involved in the control of plant life cycles and growth phases, flowering processes, flowering and plant architecture and inflorescence and flower development have been isolated for 2013202730 05 Apr 2013 4 certain species of plants, there remains a need for materials useful in the control of plant life cycles and growth phases, flowering processes, flowering and plant architecture and inflorescence and flower development, in a wide range of plants, particularly in forage and turf grasses and legumes including ryegrasses and 5 fescues, and for methods for their use.

It is an object of the present invention to overcome, or at least alleviate, one or more of the difficulties or deficiencies associated with the prior art.

In one aspect, the present invention provides substantially purified or isolated nucleic acids or nucleic acid fragments encoding amino acid sequences for the 10 following proteins from a ryegrass (Lolium) or fescue (Festuca) species, or functionally active fragments or variants thereof: MADS-box proteins (MADS), CENTRORADIALIS (CEN), APETALA2 (AP2), and Homeo-box proteins (HB).

The present invention also provides substantially purified or isolated nucleic acids or nucleic acid fragments encoding amino acid sequences for a class of 15 proteins which are related to MADS, CEN, AP2 and HB. Such proteins are referred to herein as MADS-like, CEN-like, AP2-like, and HB-like, respectively.

The individual or simultaneous enhancement or down-regulation or otherwise manipulation of MADS-box gene activities in plants may alter flower and embryo and seed development, may for example enhance or inhibit embryo differentiation 20 and growth, may alter flower organ identity through conversion of one floral organ in another, may lead to absence of individual floral organs, may lead to male and/or female sterility, may increase the number of specific floral organs, may enhance or inhibit and otherwise alter flowering, may enhance or delay and otherwise alter flowering in time, and may increase or otherwise alter the number of leaves made 25 before flowering.

The enhancement or otherwise manipulation of CEN activity in plants may alter the control of phase change, may promote vegetative growth indefinitely, may 2013202730 05 Apr 2013 5 delay or otherwise alter flowering in time, and may increase or otherwise alter the number of leaves made before flowering.

The down-regulation or otherwise manipulation of AP2 activity in plants may alter flower organ identity through conversion of one floral organ in another, may 5 lead to absence of individual floral organs, may increase the number of specific floral organs, and may alter flowering architecture.

The enhancement or ectopic expression or otherwise manipulation of HB activity in plants may alter the control of phase change, may promote or reduce vegetative growth, may delay or otherwise alter flowering, may alter floral organ 10 identity, and may alter plant architecture e.g. enhanced branching, increased bushiness.

Manipulation of flowering and plant architecture has significant consequences for a wide range of applications in plant production. For example, it has applications in inducing male sterility for hybrid seed production, in changing 15 flower architecture for enhancing value of ornamentals, in delaying flowering in forage grasses thus stopping the formation of the less digestible stems and increasing herbage quality, in altering flowering time allowing early maturing crops, in delaying vegetative phase and thus increasing biomass production, in increasing branching and thus leading to enhanced bushiness in fruit trees, in altering plant 20 size and leading to shorter plant stature, in blocking flowering and reducing the release of allergenic pollen, etc.

The ryegrass (Lolium) or fescue (Festuca) species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow fescue and red fescue. Preferably the species is a ryegrass, more preferably 25 perennial ryegrass (L. perenne).

The nucleic acid or nucleic acid fragment may be of any suitable type and includes DNA (such as cDNA or genomic DNA) and RNA (such as mRNA) that is 6 2013202730 05 Apr 2013 single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases, and combinations thereof.

The term “isolated” means that the material is removed from its original environment (eg. the natural environment if it is naturally occurring). For example, a 5 naturally occurring nucleic acid present in a living plant is not isolated, but the same nucleic acid separated from some or all of the coexisting materials in the natural system, is isolated. Such nucleic acids could be part of a vector and/or such nucleic acids could be part of a composition, and still be isolated in that such a vector or composition is not part of its natural environment. 10 Such nucleic acids or nucleic acid fragments could be assembled to form a consensus contig. As used herein, the term “consensus contig” refers to a nucleotide sequence that is assembled from two or more constituent nucleotide sequences that share common or overlapping regions of sequence homology. For example, the nucleotide sequence of two or more nucleic acid fragments can be 15 compared and aligned in order to identify common or overlapping sequences. Where common or overlapping sequences exist between two or more nucleic acids or nucleic acid fragments, the sequences (and thus their corresponding nucleic acids or nucleic acid fragments) may be assembled into a single contiguous nucleotide sequence. 20 In a preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a MADS or MADS-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 14, 15, 17, 19, 21, 23, 25, 27, 29, 54, 59, 63, 68, 72, 76, 81, 86 and 90 hereto (Sequence ID Nos: 25 1,3 to 11, 12, 14 to 18, 19,21 to 23, 24, 26, 28 to 30, 31, 33, 35, 37, 39, 41, 43, 45 to 49, 90, 92, 94, 96, 98, 100, 102, 104 and 106, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c). 7 2013202730 05 Apr 2013

In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding a CEN or CEN-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 30, 32 and 49 hereto (Sequence ID 5 Nos: 50, 52 to 54 and 88, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c).

In another preferred embodiment of this aspect of the invention, the 10 substantially purified or isolated nucleic acid or nucleic acid fragment encoding an AP2 or AP2-like protein includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 33, 35, 36, and 38 hereto (Sequence ID Nos: 55, 57 to 68, 69 and 71 to 74, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) 15 and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c).

In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated nucleic acid or nucleic acid fragment encoding an HB or HB-like protein includes a nucleotide sequence selected from the group 20 consisting of (a) sequences shown in Figures 39, 41, 43, 45, and 47 hereto (Sequence ID Nos: 75, 77, 79, 81 and 83 to 87, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c). 25 In a particularly preferred embodiment, the present invention provides a substantially purified or isolated nucleic acid or nucleic acid fragment encoding MADS-box protein (MADS) from Lolium perenne.

In another particularly preferred embodiment, the present invention provides a substantially purified or isolated nucleic acid or nucleic acid fragment encoding 8 2013202730 05 Apr 2013 MADS, or complementary or antisense to a sequence encoding MADS, said nucleic acid or nucleic acid fragment including a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 14, 15, 17, 19, 21, 23, 25, 27, 29, 54, 59, 63, 68, 72, 76, 81, 86 and 90 hereto (Sequence 5 ID Nos: 1, 3 to 11, 12, 14 to 18, 19, 21 to 23, 24, 26, 28 to 30, 31, 33, 35, 37, 39, 41, 43, 45 to 49, 90, 92, 94, 96, 98, 100, 102, 104 and 106, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c), wherein said functionally active 10 fragments and variants have at least approximately 80% identity to the sequences recited in (a), (b) and (c).

By “functionally active” in relation to nucleic acids it is meant that the fragment or variant (such as an analogue, derivative or mutant) encodes a polypeptide capable of modifying control of plant life cycles and/or growth phases, 15 flowering processes, flowering and/or plant architecture, and/or inflorescence and/or flower development, in a plant. Such variants include naturally occurring allelic variants and non-naturally occurring variants. Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are contemplated so long as the modifications do not result in loss of functional activity 20 of the fragment or variant. Preferably the functionally active fragment or variant has at least approximately 80% identity to the relevant part of the above mentioned nucleotide sequence, more preferably at least approximately 90% identity, most preferably at least approximately 95% identity. Such functionally active variants and fragments include, for example, those having nucleic acid changes which result in 25 conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 10 nucleotides, more preferably at least 15 nucleotides, most preferably at least 20 nucleotides.

The nucleic acids or nucleic acid fragments encoding at least a portion of several proteins involved in the control of plant life cycles and growth phases, 30 flowering processes, flowering and plant architecture and inflorescence and flower development have been isolated and identified. The nucleic acids or nucleic acid 9 2013202730 05 Apr 2013 fragments of the present invention may be used to isolate cDNAs and genes encoding homologous proteins from the same or other plant species. Isolation of homologous genes using sequence-dependent protocols is well known in the art. Examples of sequence-dependent protocols include, but are not limited to, methods 5 of nucleic acid hybridisation, and methods of DNA and RNA amplification as exemplified by various uses of nucleic acid amplification technologies (e.g. polymerase chain reaction, ligase chain reaction).

For example, genes encoding other proteins involved in the control of plant life cycles and growth phases, flowering processes, flowering and plant architecture 10 and inflorescence and flower development, either as cDNAs or genomic DNAs, may be isolated directly by using all or a portion of the nucleic acids or nucleic acid fragments of the present invention as hybridisation probes to screen libraries from the desired plant employing the methodology well known to those skilled in the art. Specific oligonucleotide probes based upon the nucleic acid sequences of the 15 present invention may be designed and synthesized by methods known in the art. Moreover, the entire sequences may be used directly to synthesize DNA probes by methods known to the skilled artisan such as random primer DNA labelling, nick translation, or end-labelling techniques, or RNA probes using available in vitro transcription systems. In addition, specific primers may be designed and used to 20 amplify a part or all of the sequences of the present invention. The resulting amplification products may be labelled directly during amplification reactions or labelled after amplification reactions, and used as probes to isolate full length cDNA or genomic fragments under conditions of appropriate stringency.

In addition, short segments of the nucleic acids or nucleic acid fragments of 25 the present invention may be used in amplification protocols to amplify longer nucleic acids or nucleic acid fragments encoding homologous genes from DNA or RNA. For example, polymerase chain reaction may be performed on a library of cloned nucleic acid fragments wherein the sequence of one primer is derived from the nucleic acids or nucleic acid fragments of the present invention, and the 30 sequence of the other primer takes advantage of the presence of the polyadenylic acid tracts to the 3’ end of the mRNA precursor encoding plant genes. Alternatively, 10 2013202730 05 Apr 2013 the second primer sequence may be based upon sequences derived from the cloning vector. For example, those skilled in the art can follow the RACE protocol (Frohman et al. (1988) Proc. Natl. Acad Sci. USA 85:8998, the entire disclosure of which is incorporated herein by reference) to generate cDNAs by using PCR to 5 amplify copies of the region between a single point in the transcript and the 3’ or 5’ end. Using commercially available 3’ RACE and 5’ RACE systems (BRL), specific 3’ or 5’ cDNA fragments may be isolated (Ohara et al. (1989,) Proc. Natl. Acad Sci USA 86:5673; Loh et al. (1989) Science 243:217; the entire disclosures of which are incorporated herein by reference). Products generated by the 3’ and 5’ RACE 10 procedures may be combined to generate full-length cDNAs.

In a second aspect of the present invention there is provided a substantially purified or isolated polypeptide from a ryegrass (Lolium) or fescue (Festuca) species, selected from the group consisting of MADS and MADS-like, CEN and CEN-like, AP2 and AP2-like, HB and HB-like proteins; and functionally active 15 fragments and variants thereof.

The ryegrass (Lolium) or fescue (Festuca) species may be of any suitable type, including Italian or annual ryegrass, perennial ryegrass, tall fescue, meadow fescue and red fescue. Preferably the species is a ryegrass, more preferably perennial ryegrass (L. perenne). 20 In a preferred embodiment of this aspect of the invention, the substantially purified or isolated MADS or MADS-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 2, 5, 8, 11, 13, 16, 18, 20, 22, 24, 26, 28, 55, 60, 64, 69, 73, 77, 82, 87 and 91 hereto (Sequence ID Nos: 2, 13, 20, 25, 27, 32, 34, 36, 38, 40, 42, 44, 91, 93, 95, 97, 99, 25 101, 103, 105 and 107, respectively); and functionally active fragments and variants thereof.

In a further preferred embodiment of this aspect of the invention, the substantially purified or isolated CEN or CEN-like polypeptide includes an amino acid sequence selected from the group consisting of sequences shown in Figures 11 2013202730 05 Apr 2013 31 and 50 hereto (Sequence ID Nos: 51 and 89, respectively); and functionally active fragments and variants thereof.

In another preferred embodiment of this aspect of the invention, the substantially purified or isolated AP2 or AP2-like polypeptide includes an amino 5 acid sequence selected from the group consisting of sequences shown in Figures 34 and 37 hereto (Sequence ID Nos: 56 and 70, respectively); and functionally active fragments and variants thereof.

In a still further preferred embodiment of this aspect of the invention, the substantially purified or isolated HB or HB-like polypeptide includes an amino acid 10 sequence selected from the group consisting of sequences shown in Figures 40, 42, 44 and 46 hereto (Sequence ID Nos: 76, 78, 80 and 82, respectively); and functionally active fragments and variants thereof.

In a particularly preferred embodiment, the present invention provides a substantially purified or isolated MADS polypeptide from Lolium perenne. 15 In another particularly preferred embodiment, the present invention provides a substantially purified and isolated MADS polypeptide, said polypeptide including an amino acid sequence selected from the group consisting of (a) sequences shown in Figures 2, 5, 8, 11, 13, 16, 18, 20, 22, 24, 26, 28, 55, 60, 64, 69, 73, 77, 82, 87 and 91 hereto (Sequence ID Nos: 2, 13, 20, 25, 27, 32, 34, 36, 38, 40, 42, 20 44, 91, 93, 95, 97, 99, 101, 103, 105 and 107, respectively); and (b) functionally active fragments and variants of the sequences recited in (a), wherein said functionally active fragments and variants have at least 80% identity to the sequences recited in (a).

By “functionally active” in relation to polypeptides it is meant that the 25 fragment or variant has one or more of the biological properties for the proteins MADS, MADS-like, CEN, CEN-like, AP2, AP2-like, FIB and HB-like, respectively. Additions, deletions, substitutions and derivatizations of one or more of the amino acids are contemplated so long as the modifications do not result in loss of 2013202730 09 Dec 2016 12 functional activity of the fragment or variant. Preferably the functionally active fragment or variant has at least approximately 60% identity to the relevant part of the above mentioned amino acid sequence, more preferably at least approximately 80% identity, most preferably at least approximately 90% identity. Such functionally 5 active variants and fragments include, for example, those having conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence. Preferably the fragment has a size of at least 10 amino acids, more preferably at least 15 amino acids, most preferably at least 20 amino acids.

In a further embodiment of this aspect of the invention, there is provided a 10 polypeptide recombinantly produced from a nucleic acid or nucleic acid fragment according to the present invention. Techniques for recombinantly producing polypeptides are well known to those skilled in the art.

In another preferred embodiment, there is provided a polypeptide recombinantly produced from a nucleic acid or nucleic acid fragment including a 15 nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 14, 15, 17, 19, 21, 23, 25, 27, 29, 54, 59, 63, 68, 72, 76, 81, 86 and 90 hereto (Sequence ID Nos: 1, 3 to 11, 12, 14 to 18, 19, 21 to 23, 24, 26, 28 to 30, 31, 33, 35, 37, 39, 41, 43, 45 to 49, 90, 92, 94, 96, 98, 100, 102, 104 and 106, respectively); (b) complements of the sequences recited in (a); (c) 20 sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c), wherein said functionally active fragments and variants have at least approximately 80% identity to the sequences recited in (a), (b) and (c).

Availability of the nucleotide sequences of the present invention and 25 deduced amino acid sequences facilitates immunological screening of cDNA expression libraries. Synthetic peptides representing portions of the instant amino acid sequences may be synthesized. These peptides may be used to immunise animals to produce polyclonal or monoclonal antibodies with specificity for peptides and/or proteins including the amino acid sequences. These antibodies may be then 2013202730 09 Dec 2016 13 used to screen cDNA expression libraries to isolate full-length cDNA clones of interest. A genotype is the genetic constitution of an individual or group. Variations in genotype are important in commercial breeding programs, in determining 5 parentage, in diagnostics and fingerprinting, and the like. Genotypes can be readily described in terms of genetic markers. A genetic marker identifies a specific region or locus in the genome. The more genetic markers, the finer defined is the genotype. A genetic marker becomes particularly useful when it is allelic between organisms because it then may serve to unambiguously identify an individual. 10 Furthermore, a genetic marker becomes particularly useful when it is based on nucleic acid sequence information that can unambiguously establish a genotype of an individual and when the function encoded by such nucleic acid is known and is associated with a specific trait. Such nucleic acids and/or nucleotide sequence information including single nucleotide polymorphisms (SNP’s), variations in single 15 nucleotides between allelic forms of such nucleotide sequence, can be used as perfect markers or candidate genes for the given trait.

Applicants have identified a number of SNP’s of the nucleic acids and nucleic acid fragments of the present invention. These are indicated (marked with grey on the black background) in the figures that show multiple alignments of 20 nucleotide sequences of nucleic acid fragments contributing to consensus contig sequences. See for example, Figures 3, 6, 9, 14, 29, 35, 38 and 47 (Sequence ID Nos: 3 to 11, 14 to 18, 21 to 23, 28 to 30, 45 to 49, 57 to 68, 71 to 74, and 83 to 87, respectively).

Accordingly, in a further aspect of the present invention, there is provided a 25 substantially purified or isolated nucleic acid or nucleic acid fragment including a single nucleotide polymorphism (SNP) from a nucleic acid or nucleic acid fragment according to the present invention, or complements or sequences antisense thereto, and functionally active fragments and variants thereof. 14 2013202730 09 Dec 2016

In a still further aspect of the present invention there is provided a method of isolating a nucleic acid or nucleic acid fragment of the present invention including a single nucleotide polymorphism (SNP), said method including sequencing nucleic acid fragments from a nucleic acid library.

5 The nucleic acid library may be of any suitable type and is preferably a cDNA library.

The nucleic acid or nucleic acid fragment may be isolated from a recombinant plasmid or may be amplified, for example using polymerase chain reaction. 10 The sequencing may be performed by techniques known to those skilled in the art.

In a still further aspect of the present invention, there is provided use of nucleic acids or nucleic acid fragments of the present invention including SNP’s, and/or nucleotide sequence information thereof, as molecular genetic markers. 15 In a still further aspect of the present invention there is provided use of a nucleic acid or nucleic acid fragment according to the present invention, and/or nucleotide sequence information thereof, as a molecular genetic marker.

More particularly, nucleic acids or nucleic acid fragments according to the present invention and/or nucleotide sequence information thereof may be used as a 20 molecular genetic marker for quantitative trait loci (QTL) tagging, QTL mapping, DNA fingerprinting and in marker assisted selection, particularly in ryegrasses and fescues. Even more particularly, nucleic acids or nucleic acid fragments according to the present invention and/or nucleotide sequence information thereof may be used as molecular genetic markers in forage and turf grass improvement, e.g. 25 tagging QTLs for herbage quality traits, flowering intensity, flowering time, number of tillers, leafiness, bushiness, seasonal growth pattern, herbage yield, flower architecture, plant stature. Even more particularly, sequence information revealing 15 2013202730 09 Dec 2016 SNPs in allelic variants of the nucleic acids or nucleic acid fragments of the present invention and/or nucleotide sequence information thereof may be used as molecular genetic markers for QTL tagging and mapping and in marker assisted selection, particularly in ryegrasses and fescues. 5 In a still further aspect of the present invention there is provided a construct including a nucleic acid or nucleic acid fragment according to the present invention.

The term “construct” as used herein refers to an artificially assembled nucleic acid molecule which includes the gene of interest. In general a construct may include the gene or genes of interest, a marker gene and appropriate regulatory 10 sequences. It should be appreciated that the inclusion of regulatory sequences in a construct is optional, for example, such sequences may not be required in situations where the regulatory sequences of a host cell are to be used. The term construct includes vectors but should not be seen as being limited thereto.

In a preferred embodiment, there is provided an artificial construct including 15 (i) an isolated nucleic acid or nucleic acid fragment encoding a MADS- box protein (MADS) from Lolium perenne\ and (ii) a heterologous gene marker.

In another preferred embodiment, there is provided an artificial construct including 20 (i) a nucleic acid or nucleic acid fragment encoding MADS, or complementary or antisense to a sequence encoding MADS, wherein said nucleic acid or nucleic acid fragment includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 14, 15, 17, 19, 21, 23, 25, 27, 29, 54, 59, 63, 68, 72, 76, 81, 86 and 90 hereto (Sequence 25 ID Nos: 1, 3 to 11, 12, 14 to 18, 19, 21 to 23, 24, 26, 28 to 30, 31, 33, 35, 37, 39, 41, 43, 45 to 49, 90, 92, 94, 96, 98, 100, 102, 104 and 106, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c), wherein said functionally active 2013202730 09 Dec 2016 16 fragments and variants have at least approximately 80% identity to the sequences recited in (a), (b) and (c); and (ii) a heterologous gene marker.

In a still further aspect of the present invention there is provided a vector 5 including a nucleic acid or nucleic acid fragment according to the present invention.

The term “vector” as used herein includes both cloning and expression vectors. Vectors are often recombinant molecules including nucleic acid molecules from several sources.

In a preferred embodiment, there is provided a vector including a nucleic acid 10 or nucleic acid fragment encoding a MADS-box protein (MADS) from Lolium perenne.

In another preferred embodiment, there is provided a vector including a nucleic acid or nucleic acid fragment encoding MADS, or complementary or antisense to a sequence encoding MADS, wherein said nucleic acid or nucleic acid 15 fragment includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 14, 15, 17, 19, 21, 23, 25, 27, 29, 54, 59, 63, 68, 72, 76, 81, 86 and 90 hereto (Sequence ID Nos: 1, 3 to 11, 12, 14 to 18, 19, 21 to 23, 24, 26, 28 to 30, 31, 33, 35, 37, 39, 41, 43, 45 to 49, 90, 92, 94, 96, 98, 100, 102, 104 and 106, respectively); (b) complements of the 20 sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c), wherein said functionally active fragments and variants have at least approximately 80% identity to the sequences recited in (a), (b) and (c).

In a preferred embodiment of this aspect of the invention, the vector may 25 include a regulatory element such as a promoter, a nucleic acid or nucleic acid fragment according to the present invention and a terminator; said regulatory element, nucleic acid and terminator being operatively linked. 17 2013202730 09 Dec 2016

By “operatively linked” is meant that said regulatory element is capable of causing expression of said nucleic acid or nucleic acid fragment in a plant cell and said terminator is capable of terminating expression of said nucleic acid or nucleic acid fragment in a plant cell. Preferably, said regulatory element is upstream of said 5 nucleic acid or nucleic acid fragment and said terminator is downstream of said nucleic acid or nucleic acid fragment.

The vector may be of any suitable type and may be viral or non-viral. The vector may be an expression vector. Such vectors include chromosomal, non-chromosomal and synthetic nucleic acid sequences, eg. derivatives of plant viruses; 10 bacterial plasmids; derivatives of the Ti plasmid from Agrobacterium tumefaciens, derivatives of the Ri plasmid from Agrobacterium rhizogenes; phage DNA; yeast artificial chromosomes; bacterial artificial chromosomes; binary bacterial artificial chromosomes; vectors derived from combinations of plasmids and phage DNA. However, any other vector may be used as long as it is replicable, or integrative or 15 viable in the plant cell.

The regulatory element and terminator may be of any suitable type and may be endogenous to the target plant cell or may be exogenous, provided that they are functional in the target plant cell.

Preferably the regulatory element is a promoter. A variety of promoters which 20 may be employed in the vectors of the present invention are well known to those skilled in the art. Factors influencing the choice of promoter include the desired tissue specificity of the vector, and whether constitutive or inducible expression is desired and the nature of the plant cell to be transformed (eg. monocotyledon or dicotyledon). Particularly suitable constitutive promoters include the Cauliflower 25 Mosaic Virus 35S (CaMV 35S) promoter, the maize Ubiquitin promoter, and the rice Actin promoter. A variety of terminators which may be employed in the vectors of the present invention are also well known to those skilled in the art. The terminator may be from the same gene as the promoter sequence or a different gene. Particularly 18 2013202730 09 Dec 2016 suitable terminators are polyadenylation signals, such as the CaMV 35S polyA and other terminators from the nopaline synthase (nos), the octopine synthase (ocs) and the rbcS genes.

The vector, in addition to the regulatory element, the nucleic acid or nucleic 5 acid fragment of the present invention and the terminator, may include further elements necessary for expression of the nucleic acid or nucleic acid fragment, in different combinations, for example vector backbone, origin of replication (ori), multiple cloning sites, spacer sequences, enhancers, introns (such as the maize Ubiquitin Ubi intron), antibiotic resistance genes and other selectable marker genes 10 [such as the neomycin phosphotransferase (npt2) gene, the hygromycin phosphotransferase {hph) gene, the phosphinothricin acetyltransferase (bar or pat) gene], and reporter genes (such as beta-glucuronidase (GUS) gene (gusA)]. The vector may also contain a ribosome binding site for translation initiation. The vector may also include appropriate sequences for amplifying expression. 15 As an alternative to use of a selectable marker gene to provide a phenotypic trait for selection of transformed host cells, the presence of the vector in transformed cells may be determined by other techniques well known in the art, such as PCR (polymerase chain reaction), Southern blot hybridisation analysis, histochemical GUS assays, northern and Western blot hybridisation analyses. 20 Those skilled in the art will appreciate that the various components of the vector are operatively linked, so as to result in expression of said nucleic acid or nucleic acid fragment. Techniques for operatively linking the components of the vector of the present invention are well known to those skilled in the art. Such techniques include the use of linkers, such as synthetic linkers, for example 25 including one or more restriction enzyme sites.

The vectors of the present invention may be incorporated into a variety of plants, including monocotyledons (such as grasses from the genera Lolium, Festuca, Paspalum, Pennisetum, Panicum and other forage and turfgrasses, corn, oat, sugarcane, wheat and barley), dicotyledons (such as arabidopsis, tobacco, 19 2013202730 09 Dec 2016 white clover, red clover, subterranean clover, alfalfa, eucalyptus, potato, sugarbeet) and gymnosperms. In a preferred embodiment, the vectors may be used to transform monocotyledons, preferably grass species such as ryegrasses (Lolium species) and fescues (Festuca species), even more preferably perennial ryegrass, 5 including forage- and turf-type cultivars. In a preferred embodiment, the vectors may be used to transform dicotyledons, preferably forage legume species such as clovers (Trifolium species) and medics (Medicago species), more preferably white clover {Trifolium repens), red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum) and lucerne (Medicago sativa). 10 Techniques for incorporating the vectors of the present invention into plant cells (for example by transduction, transfection or transformation) are well known to those skilled in the art. Such techniques include Agrobacterium mediated introduction, electroporation to tissues, cells and protoplasts, protoplast fusion, injection into reproductive organs, injection into immature embryos and high velocity 15 projectile introduction to cells, tissues, calli, immature and mature embryos. The choice of technique will depend largely on the type of plant to be transformed.

Cells incorporating the vectors of the present invention may be selected, as described above, and then cultured in an appropriate medium to regenerate transformed plants, using techniques well known in the art. The culture conditions, 20 such as temperature, pH and the like, will be apparent to the person skilled in the art. The resulting plants may be reproduced, either sexually or asexually, using methods well known in the art, to produce successive generations of transformed plants.

In a further aspect of the present invention there is provided a plant cell, 25 plant, plant seed or other plant part, including, e.g. transformed with, a construct or a vector of the present invention.

The plant cell, plant, plant seed or other plant part may be from any suitable species, including monocotyledons, dicotyledons and gymnosperms. In a preferred embodiment the plant cell, plant, plant seed or other plant part is from a 20 2013202730 09 Dec 2016 monocotyledon, preferably a grass species, more preferably a ryegrass (Lolium species) or fescue (Festuca species), even more preferably perennial ryegrass, including both forage- and turf-type cultivars. In a preferred embodiment the plant cell, plant, plant seed or other plant part is from a dicotyledon, preferably forage 5 legume species such as clovers (Trifolium species) and medics (Medicago species), more preferably white clover (Trifolium repens), red clover (Trifolium pratense), subterranean clover (Trifolium subterraneum) and lucerne (Medicago sativa).

The present invention also provides a plant, plant seed or other plant part 10 derived from a plant cell of the present invention.

The present invention also provides a plant, plant seed or other plant part derived from a plant of the present invention.

In a further aspect of the present invention there is provided a method of modifying the control of plant life cycles and/or growth phases, flowering processes, 15 flowering and/or plant architecture and/or flower and/or inflorescence development in a plant, said method including introducing into said plant an effective amount of a nucleic acid or nucleic acid fragment, construct and/or vector according to the present invention.

By “an effective amount” it is meant an amount sufficient to result in an 20 identifiable phenotypic trait in said plant, or a plant, plant seed or other plant part derived therefrom. Such amounts can be readily determined by an appropriately skilled person, taking into account the type of plant, the route of administration and other relevant factors. Such a person will readily be able to determine a suitable amount and method of administration. See, for example, Sambrook et al, Molecular 25 Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, the entire disclosure of which is incorporated herein by reference.

Using the methods and materials of the present invention, plant life cycles and/or growth phases, flowering processes, flowering and/or plant architecture 21 2013202730 09 Dec 2016 and/or inflorescence and/or flower development may be increased, decreased or otherwise modified relative to an untransformed control plant. For example, the number of leaves produced before flowering, the number of floral organs, the number of branches, the plant stature, the number of phytomers, the number of 5 inflorescences and/or flowers, may be increased, decreased or otherwise modified. They may be increased or otherwise modified, for example, by incorporating additional copies of a sense nucleic acid or nucleic acid fragment of the present invention. They may be decreased or otherwise modified, for example, by incorporating an antisense nucleic acid or nucleic acid fragment of the present 10 invention.

The present invention will now be more fully described with reference to the accompanying Examples and drawings. It should be understood, however, that the description following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above. 15 In the Figures

Figure 1 shows the consensus contig nucleotide sequence of LpMADSa (Sequence ID No: 1).

Figure 2 shows the deduced amino acid sequence of LpMADSa (Sequence ID No: 2). 20 Figure 3 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpMADSa (Sequence ID Nos: 3 to 11).

Figure 4 shows the consensus contig nucleotide sequence of LpMADSb (Sequence ID No: 12). 25 Figure 5 shows the deduced amino acid sequence of LpMADSb (Sequence ID No: 13). 2013202730 09 Dec 2016 22

Figure 6 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpMADSb (Sequence ID Nos: 14 to 18). .

Figure 7 shows the consensus contig nucleotide sequence of LpMADSc 5 (Sequence ID No: 19).

Figure 8 shows the deduced amino acid sequence of LpMADSc (Sequence ID No: 20).

Figure 9 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpMADSc (Sequence ID Nos: 21 to 10 23).

Figure 10 shows the nucleotide sequence of LpMADSd (Sequence ID No: 24).

Figure 11 shows the deduced amino acid sequence of LpMADSd (Sequence ID No: 25). 15 Figure 12 shows the consensus contig nucleotide sequence of LpMADSe (Sequence ID No: 26).

Figure 13 shows the deduced amino acid sequence of LpMADSe (Sequence ID No: 27).

Figure 14 shows the nucleotide sequences of the nucleic acid fragments 20 contributing to the consensus contig sequence LpMADSe (Sequence ID Nos: 28 to 30).

Figure 15 shows the nucleotide sequence of LpMADSf (Sequence ID No: 31). 2013202730 09 Dec 2016 23

Figure 16 shows the deduced amino acid sequence of LpMADSf (Sequence ID No: 32).

Figure 17 shows the nucleotide sequence of LpMADSg (Sequence ID No: 33). 5 Figure 18 shows the deduced amino acid sequence of LpMADSg (Sequence ID No: 34).

Figure 19 shows the nucleotide sequence of LpMADSh (Sequence ID No: 35).

Figure 20 shows the deduced amino acid sequence of LpMADSh (Sequence 10 ID No: 36).

Figure 21 shows the nucleotide sequence of LpMADSi (Sequence ID No: 37).

Figure 22 shows the deduced amino acid sequence of LpMADSi (Sequence ID No: 38). 15 Figure 23 shows the nucleotide sequence of LpMADSj (Sequence ID No: 39).

Figure 24 shows the deduced amino acid sequence of LpMADSj (Sequence ID No: 40).

Figure 25 shows the nucleotide sequence of LpMADSk (Sequence ID No: 20 41).

Figure 26 shows the deduced amino acid sequence of LpMADSk (Sequence ID No: 42). 2013202730 09 Dec 2016 24

Figure 27 shows the consensus contig nucleotide sequence of LpMADSI (Sequence ID No: 43).

Figure 28 shows the deduced amino acid sequence of LpMADSI (Sequence ID No: 44). 5 Figure 29 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpMADSI (Sequence ID Nos: 45 to 49).

Figure 30 shows the consensus contig nucleotide sequence of LpCENa (Sequence ID No: 50). 10 Figure 31 shows the deduced amino acid sequence of LpCENa (Sequence ID No: 51).

Figure 32 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpCENa (Sequence ID Nos: 52 to 54). 15 Figure 33 shows the consensus contig nucleotide sequence of LpAP2a (Sequence ID No: 55).

Figure 34 shows the deduced amino acid sequence of LpAP2a (Sequence ID No: 56).

Figure 35 shows the nucleotide sequences of the nucleic acid fragments 20 contributing to the consensus contig sequence LpAP2a (Sequence ID Nos: 57 to 68).

Figure 36 shows the consensus contig nucleotide sequence of LpAP2b (Sequence ID No: 69). 25 2013202730 09 Dec 2016

Figure 37 shows the deduced amino acid sequence of LpAP2b (Sequence ID No: 70).

Figure 38 shows the nucleotide sequences of the nucleic acid fragments contributing to the consensus contig sequence LpAP2b (Sequence ID Nos: 71 to 5 74).

Figure 39 shows the nucleotide sequence of LpFIBa (Sequence ID No: 75).

Figure 40 shows the deduced amino acid sequence of LpFIBa (Sequence ID No: 76).

Figure 41 shows the nucleotide sequence of LpFIBb (Sequence ID No: 77).

10 Figure 42 shows the deduced amino acid sequence of LpFIBb (Sequence ID

No: 78).

Figure 43 shows the nucleotide sequence of LpFIBc (Sequence ID No: 79).

Figure 44 shows the deduced amino acid sequence of LpFIBc (Sequence ID No: 80). 15 Figure 45 shows the consensus contig nucleotide sequence of LpFIBd (Sequence ID No: 81).

Figure 46 shows the deduced amino acid sequence of LpFIBd (Sequence ID No: 82).

Figure 47 shows the nucleotide sequences of the nucleic acid fragments 20 contributing to the consensus contig sequence LpFIBd (Sequence ID Nos: 83 to 87).

Figure 48 shows a plasmid map of the cDNA encoding perennial ryegrass LpCen. 2013202730 09 Dec 2016 26

Figure 49 shows the nucleotide sequence of perennial ryegrass LpCen cDNA (Sequence ID No: 88).

Figure 50 shows the deduced amino acid sequence of perennial ryegrass LpCen cDNA (Sequence ID No: 89). 5 Figure 51 shows plasmid maps of sense and antisense constructs of LpCen in pDH51 transformation vector.

Figure 52 shows screening by Southern hybridisation for RFLPs using LpCen as a probe.

Figure 53 shows a plasmid map of the cDNA encoding perennial ryegrass 10 LpMADSl

Figure 54 shows the nucleotide sequence of perennial ryegrass LpMADSl cDNA (Sequence ID No: 90).

Figure 55 shows the deduced amino acid sequence of perennial ryegrass LpMADSl cDNA (Sequence ID No: 91). 15 Figure 56 shows plasmid maps of sense and antisense constructs of

LpMADSl in pDH51 transformation vector.

Figure 57 shows screening by Southern hybridisation for RFLPs using LpMADSl as a probe.

Figure 58 shows a plasmid map of the cDNA encoding perennial ryegrass 20 LpMADSl b.

Figure 59 shows the nucleotide sequence of perennial ryegrass LpMADSl b cDNA (Sequence ID No: 92). 2013202730 09 Dec 2016 27

Figure 60 shows the deduced amino acid sequence of perennial ryegrass LpMADSIb cDNA (Sequence ID No: 93).

Figure 61 shows plasmid maps of sense and antisense constructs of LpMADSIb in pDH51 transformation vector. 5 Figure 62 shows a plasmid map of the cDNA encoding perennial ryegrass

LpMADS2-1.

Figure 63 shows the nucleotide sequence of perennial ryegrass LpMADS2-1 cDNA (Sequence ID No: 94).

Figure 64 shows the deduced amino acid sequence of perennial ryegrass 10 LpMADS2-1 cDNA (Sequence ID No: 95).

Figure 65 shows plasmid maps of sense and antisense constructs of LpMADS2-1 in pDH51 transformation vector.

Figure 66 shows screening by Southern hybridisation for RFLPs using LpMADS2-1 as a probe. 15 Figure 67 shows a plasmid map of the cDNA encoding perennial ryegrass

LpMADS2-2.

Figure 68 shows the nucleotide sequence of perennial ryegrass LpMADS2-2 cDNA (Sequence ID No: 96).

Figure 69 shows the deduced amino acid sequence of perennial ryegrass 20 LpMADS2-2 cDNA (Sequence ID No: 97).

Figure 70 shows plasmid maps of sense and antisense constructs of LpMADS2-2 in pDH51 transformation vector. 2013202730 09 Dec 2016 28

Figure 71 shows a plasmid map of the cDNA encoding perennial ryegrass LpMADS2-3.

Figure 72 shows the nucleotide sequence of perennial ryegrass LpMADS2-3 cDNA (Sequence ID No: 98). 5 Figure 73 shows the deduced amino acid sequence of perennial ryegrass

LpMADS2-3 cDNA (Sequence ID No: 99).

Figure 74 shows plasmid maps of sense and antisense constructs of LpMADS2-3 in pDH51 transformation vector.

Figure 75 shows a plasmid map of the cDNA encoding perennial ryegrass 10 LpMADS3.

Figure 76 shows the nucleotide sequence of perennial ryegrass LpMADS3 cDNA (Sequence ID No: 100).

Figure 77 shows the deduced amino acid sequence of perennial ryegrass LpMADS3 cDNA (Sequence ID No: 101). 15 Figure 78 shows plasmid maps of sense and antisense constructs of

LpMADS3 in pDH51 transformation vector.

Figure 79 shows screening by Southern hybridisation for RFLPs using LpMADS3 as a probe.

Figure 80 shows a plasmid map of the cDNA encoding perennial ryegrass 20 LpMADS4.

Figure 81 shows the nucleotide sequence of perennial ryegrass LpMADS4 cDNA (Sequence ID No: 102). 2013202730 09 Dec 2016 29

Figure 82 shows the deduced amino acid sequence of perennial ryegrass LpMADS4 cDNA (Sequence ID No: 103).

Figure 83 shows plasmid maps of sense and antisense constructs of LpMADS4 in pDH51 transformation vector. 5 Figure 84 shows screening by Southern hybridisation for RFLPs using

LpMADS4 as a probe.

Figure 85 shows a plasmid map of the cDNA encoding perennial ryegrass LpMADS4-2.

Figure 86 shows the nucleotide sequence of perennial ryegrass LpMADS4-2 10 cDNA (Sequence ID No: 104).

Figure 87 shows the deduced amino acid sequence of perennial ryegrass LpMADS4-2 cDNA (Sequence ID No: 105).

Figure 88 shows plasmid maps of sense and antisense constructs of LpMADS4-2 in pDH51 transformation vector. 15 Figure 89 shows a plasmid map of the cDNA encoding perennial ryegrass

LpMADS5.

Figure 90 shows the nucleotide sequence of perennial ryegrass LpMADS5 cDNA (Sequence ID No: 106).

Figure 91 shows the deduced amino acid sequence of perennial ryegrass 20 LpMADS5 cDNA (Sequence ID No: 107).

Figure 92 shows plasmid maps of sense and antisense constructs of LpMADS5 in pDH51 transformation vector. 30 2013202730 09 Dec 2016

Figure 93 shows screening by Southern hybridisation for RFLPs using LpMADS5 as a probe.

Figure 94 shows the regeneration of transgenic tobacco plants from direct gene transfer to protoplasts of chimeric ryegrass genes involved in flowering and 5 plant development.

Figure 95 shows a subgrid of a microarray for the expression profiling of perennial ryegrass flowering and plant development genes. Red represents up-regulated expression, green represents down-regulated expression and yellow represents no change in expression. For example, an overlay of microarray images 10 probed with leaf blade tissues (red) and root tissues (green). Expression level is relatively expressed as up-regulated in leaf blade (red), down-regulated in leaf blade (green) and no change in expression (yellow).

Figure 96 shows a genetic linkage map of perennial ryegrass NA6 showing map location of ryegrass genes involved in flowering and plant development. 15 EXAMPLE 1

Preparation of cDNA libraries, isolation and sequencing of cDNAs coding for MADS, Cen, AP2, and HB proteins from perennial ryegrass (Lolium perenne) cDNA libraries representing mRNAs from various organs and tissues of 20 perennial ryegrass (Lolium perenne) were prepared. The characteristics of the libraries are described in Table 1. TABLE 1 cDNA libraries from perennial ryegrass (Lolium perenne)

Library Organ/Tissue 01 rg Roots from 3-4 day old light-grown seedlings 02rg Leaves from 3-4 day old light-grown seedlings 2013202730 09 Dec 2016 31 Library Organ/Tissue 03rg Etiolated 3-4 day old dark-grown seedlings 04rg Whole etiolated seedlings (1-5 day old and 17 days old) 05rg Senescing leaves from mature plants 06rg Whole etiolated seedlings (1-5 day old and 17 days old) 07rg Roots from mature plants grown in hydroponic culture 08rg Senescent leaf tissue 09rg Whole tillers and sliced leaves (0, 1, 3, 6, 12 and 24 h after harvesting) 10rg Embryogenic suspension-cultured cells 11 rg Non-embryogenic suspension-cultured cells 12rg Whole tillers and sliced leaves (0, 1, 3, 6, 12 and 24 h after harvesting) 13rg Shoot apices including vegetative apical meristems 14rg Immature inflorescences including different stages of inflorescence meristem and inflorescence development 15rg Defatted pollen 16rg Leaf blades and leaf sheaths (rbcL, rbcS, cab, wir2A subtracted) 17rg Senescing leaves and tillers 18rg Drought-stressed tillers (pseudostems from plants subjected to PEG-simulated drought stress) 19rg Non-embryogenic suspension-cultured cells subjected to osmotic stress (grown in media with half-strength salts) (1, 2, 3, 4, 5, 6, 24 and 48 h after transfer) 20rg Non-embryogenic suspension-cultured cells subjected to osmotic stress (grown in media with double-strength salts) (1, 2, 3, 4, 5, 6, 24 and 48 h after transfer) 21 rg Drought-stressed tillers (pseudostems from plants subjected to PEG-simulated drought stress) 22rg Spikelets with open and maturing florets 23rg Mature roots (specific subtraction with leaf tissue)

The cDNA libraries may be prepared by any of many methods available. For example, total RNA may be isolated using the Trizol method (Gibco-BRL, USA) or the RNeasy Plant Mini kit (Qiagen, Germany), following the manufacturers’ 5 instructions. cDNAs may be generated using the SMART PCR cDNA synthesis kit 2013202730 09 Dec 2016 32 (Clontech, USA), cDNAs may be amplified by long distance polymerase chain reaction using the Advantage 2 PCR Enzyme system (Clontech, USA), cDNAs may be cleaned using the GeneClean spin column (Bio 101, USA), tailed and size fractionated, according to the protocol provided by Clontech. The cDNAs may be 5 introduced into the pGEM-T Easy Vector system 1 (Promega, USA) according to the protocol provided by Promega. The cDNAs in the pGEM-T Easy plasmid vector are transfected into Escherichia coli Epicurian coli XL10-Gold ultra competent cells (Stratagene, USA) according to the protocol provided by Stratagene.

Alternatively, the cDNAs may be introduced into plasmid vectors for first 10 preparing the cDNA libraries in Uni-ZAP XR vectors according to the manufacturer’s protocol (Stratagene Cloning Systems, La Jolla, CA, USA). The Uni-ZAP XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBluescript. In addition, the cDNAs may be introduced directly into precut 15 pBluescript II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into E. coli DH10B cells according to the manufacturer’s protocol (GIBCO BRL Products).

Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant plasmids, or the 20 insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Plasmid DNA preparation may be performed robotically using the Qiagen QiaPrep Turbo kit (Qiagen, Germany) according to the protocol provided by Qiagen. Amplified insert DNAs are sequenced in dye-terminator sequencing reactions to generate partial 25 cDNA sequences (expressed sequence tags or “ESTs”). The resulting ESTs are analyzed using an Applied Biosystems ABI 3700 sequence analyser. 2013202730 09 Dec 2016 33 EXAMPLE 2 DNA sequence analyses

The cDNA clones encoding MADS, CEN, AP2 and HB proteins were identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al. 5 (1993) J. Mol. Biol. 215:403-410) searches. The cDNA sequences obtained were analysed for similarity to all publicly available DNA sequences contained in the eBioinformatics nucleotide database using the BLASTn algorithm provided by the National Center for Biotechnology Information (NCBI). The DNA sequences were translated in all reading frames and compared for similarity to all publicly available 10 protein sequences contained in the SWISS-PROT protein sequence database using BLASTx algorithm (v 2.0.1) (Gish and States (1993) Nature Genetics 3:266-272) provided by the NCBI.

The cDNA sequences obtained and identified were then used to identify additional identical and/or overlapping cDNA sequences generated using the 15 BLASTN algorithm. The identical and/or overlapping sequences were subjected to a multiple alignment using the CLUSTALw algorithm, and to generate a consensus contig sequence derived from this multiple sequence alignment. The consensus contig sequence was then used as a query for a search against the SWISS-PROT protein sequence database using the BLASTx algorithm to confirm the initial 20 identification. EXAMPLE 3

Identification and full-length sequencing of perennial ryegrass MADS and Cen cDNAs encoding flowering and plant development proteins.

To fully characterise for the purposes of the generation of probes for 25 hybridisation experiments and the generation of transformation vectors, a set of perennial ryegrass cDNAs encoding flowering and plant development proteins was identified and fully sequenced. 34 2013202730 09 Dec 2016

Full-length cDNAs were identified from our EST sequence database using relevant published sequences (NCBI databank) as queries for BLAST searches. Full-length cDNAs were identified by alignment of the query and hit sequences using Sequencher (Gene Codes Corp., AnnArbor, Ml 48108, USA). The original 5 plasmid was then used to transform chemically competent XL-1 cells (prepared in-house, CaCb protocol). After colony PCR (using HotStarTaq, Qiagen) a minimum of three PCR-positive colonies per transformation were picked for initial sequencing with M13F and M13R primers. The resulting sequences were aligned with the original EST sequence using Sequencher to confirm identity and one of the three 10 clones was picked for full-length sequencing, usually the one with the best initial sequencing result.

Sequencing was completed by primer walking, i.e. oligonucleotide primers were designed to the initial sequence and used for further sequencing. In most cases the sequencing could be done from both 5’ and 3’ end. The sequences of the 15 oligonucleotide primers are shown in Table 2. In some instances, however, an extended poly-A tail necessitated the sequencing of the cDNA to be completed from the 5’ end. TABLE 2

List of primers used for sequencing of the full-length cDNAs

j Gene name Clone ID Sequencing primer Primer sequence (5'->3') jLpCen 06rg1XsB06.1 ;06rg1XsB06.f1 : G C TAT GAGAG C C CAAAG C C \ j06rg1XsB06.f2 jGATCTTGGCCTCCCTGTGG ij jLpMADSI j14rg1UsD10.5 j14rg1ZsF09.fl :AGGCAC'I"I'GAAAGCiC(iA/\G !LpMADS2-1 j19rg1AsG12.1 j19rg1AsG12.fi jACTTGAGAGATACCGCACC jLpMADS3 j13rg2CsB07.1 j13rg2CsB07.fl jCACTGCTGCTACAATGCTC i13rg2CsB07.f2 : GGGAGAAAT CAATAGGCAAC ;LpMADS4-1 i19rg2MsF05.2 j11rg2YsG07.fl jACTCACACGAAGCAAACCC jl_pMADS4-2 j11rg2YsG07.3 j11rg2YsG07.fl j AC T CAC AC GAAG CAAAC C C ;LpMADS5 13rg1SsH07.2 M3rg1SsH07.f1 j GTGTGAAGGCAACCATTG 2013202730 09 Dec 2016 35

Contigs were then assembled in Sequencher. The contigs include the sequences of the SMART primers used to generate the initial cDNA library as well as pGEM-T Easy vector sequence up to the EcoRI cut site both at the 5’ and 3’ 5 end.

Plasmid maps and the full cDNA sequences of perennial ryegrass Cen, MADS1, MADSIb, MADS2-1, MADS2-2, MADS2-3, MADS3, MADS4, MADS4-2 and MADS5 were obtained (Figures 48, 49, 53, 54, 58, 59, 62, 63, 67, 68, 71, 72, 75, 76, 80, 81, 85, 86, 89 and 90). 10 EXAMPLE 4

Development of transformation vectors containing chimeric genes with Cen, MADS1, MADSIb, MADS2-1, MADS2-2, MADS2-3, MADS3, MADS4, MADS4-2 and MADS5 cDNA sequences from perennial ryegrass

To alter the expression of flowering and plant development proteins Cen, 15 MADS1, MADSIb, MADS2-1, MADS2-2, MADS2-3, MADS3, MADS4, MADS4-2 and MADS5, through antisense and/or sense suppression technology and for overexpression of these key enzymes in transgenic plants, a set of sense and antisense transformation vectors was produced. cDNA fragments were generated by high fidelity PCR using the original 20 pGEM-T Easy plasmid cDNA as a template. The primers used (Table 3) contained restriction sites for EcoRI and Xbal for directional and non-directional cloning into the target vector. 36 2013202730 09 Dec 2016

TABLE 3 List of primers used to PCR-amplify the open reading frames Gene name Clone ID Primer Primer sequence (5'->3') LpCen 06rg1XsB06.1 LpCenf GAATTCTAGAGATAGAGCATTCACCGTGC LpCenr GAATTCTAGATT GG CACAACT G GAATAG C LpMADSI 14rg1UsD10.5 LpMADSIf GAATTCTAGAGAGGAAGAAGAAGGAGCG LpMADSIr GAATTCTAGACATTTGATGGAATAGGAGTGG LpMADSIb 14rg10sG05.2 LpMADSI bf GAATTCTAGAGAGGAAGAAGAAGGAGCG LpMADSI br GAATT C TAGAT T GAT G GAATAG GAGT G GAG LpMADS2-1 19rg1AsG12.1 LpMADS2-1 f C C C G G GAT C CAG CACAG G GAGAAGAAAG G LpMADS2-1 r CCCGGGATCCCCTCTCGTCGTCTGAACC LpMADS2-2 14rg 11sH 11.2 LpMADS2-2f GAATTCTAGAAGGAGAGGAGAGAGAGCCG LpMADS2-2r GAATTCTAGACCTCTCGTCGTCTGAACC LpMADS2-3 13rg2GsF08.1 LpMADS2-3f GAATTCTAGAGAGGAAGAAGAAGGAGCG LpMADS2-3r GAATTCTAGACATTTGATGGAATAGGAGTGG LpMADS3 13rg2CsB07.1 LpMADS3f GAATTCTAGAAGTGGTGCTTTCCTTGGTCG LpMADS3r GAATTCTAGAAGAACACG CATT TTATTAGC LpMADS4 19rg2MsF05.2 LpMADS4-1 f CCCGGGATCCAGAGAGGAGAGGGGAAGG LpMADS4-1 r CCCGGGATCCTCCAGGTTCTCCATTCGG LpMADS4-2 11 rg2YsG07.3 LpMADS4-2f GAATTCTAGAAGAGAGGAGAGGGGAAGGG LpMADS4-2r GAATTCTAGACTATGTCTTTGTTGTTCAGC LpMADS5 13rg1SsH07.2 LpMADS5f GAAT T C TAGAG C T C C CACAGAAACAAG C LpMADS5r GAATTCTAGABCAAAGCCTTACTTATGGG 5 After PCR amplification and restriction digest with the appropriate restriction enzyme (usually Xbal), the cDNA fragments were cloned into the corresponding site in pDH51, a pUC18-based transformation vector containing a CaMV 35S expression cassette. The orientation of the constructs (sense or antisense) was checked by DNA sequencing through the multi-cloning site of the vector. 10 Transformation vectors containing chimeric genes using full-length open reading frame cDNAs of perennial ryegrass Cen, MADS1, MADSIb, MADS2-1, MADS2-2, MADS2-3, MADS3, MADS4, MADS4-2 and MADS5 in sense and antisense orientations under the control of the CaMV 35S promoter were generated (Figures 51, 56, 61,65, 70, 74, 78, 83, 88 and 92). 2013202730 09 Dec 2016 37 EXAMPLE 5

Production of transgenic tobacco plants carrying chimeric Cen, MADS1, MADSIb, MADS2-1, MADS2-2, MADS2-3, MADS3, MADS4, MADS4-2 and MADS5 genes from perennial ryegrass 5 A set of transgenic tobacco plants carrying chimeric Cen, MADS1, MADSIb, MADS2-1, MADS2-2, MADS2-3, MADS3, MADS4, MADS4-2 and MADS5 cDNA genes from perennial ryegrass were produced. pDH51-based transformation vectors with LpCen, LpMADSI, LpMADSIb, LpMADS2-1, LpMADS2-2, LpMADS2-3, LpMADS3, LpMADS4, LpMADS4-2 and 10 LpMADS5 cDNAs comprising the full open reading frame sequences in sense and antisense orientations under the control of the CaMV 35S promoter were generated.

Direct gene transfer experiments to tobacco protoplasts were performed using these transformation vectors. 15 The production of transgenic tobacco plants carrying the perennial ryegrass

Cen, MADS1, MADSIb, MADS2-1, MADS2-2, MADS2-3, MADS3, MADS4, MADS4-2 and MADS5 cDNAs under the control of the constitutive CaMV 35S promoter is described here in detail.

Isolation of mesophyll protoplasts from tobacco shoot cultures 20 2-4 fully expanded leaves of a 6 week-old shoot culture were placed under sterile conditions (work in laminar flow hood, use sterilized forceps, scalpel and blades) in a 9 cm plastic culture dish containing 12 ml enzyme solution [1.0% (w/v) cellulase “Onozuka” R10 and 1.0% (w/v) Macerozyme® R10], The leaves were wetted thoroughly with enzyme solution and the mid-ribs removed. The leaf halves 25 were cut into small pieces and incubated overnight (14-18 h) at 25°C in the dark without shaking 2013202730 09 Dec 2016 38

The protoplasts were released by gently pipetting up and down, and the suspension poured through a 100 pm stainless steel mesh sieve on a 100 ml glass beaker. The protoplast suspension was mixed gently, distributed into two 14 ml sterile plastic centrifuge tubes and carefully overlayed with 1 ml W5 solution. After 5 centrifugation for 5 min. at 70g (Clements Orbital 500 bench centrifuge, swing-out rotor, 400 rpm), the protoplasts were collected from the interphase and transferred to one new 14 ml centrifuge tube. 10 ml W5 solution were added, the protoplasts resuspended by gentle tilting the capped tube and pelleted as before. The protoplasts were resuspended in 5-10 ml W5 solution and the yield determined by 10 counting a 1:10 dilution in a haemocytometer.

Direct gene transfer to protoplasts using polyethylene glycol

The protoplasts were pelleted [70g (Clements Orbital 500 bench centrifuge, 400 rpm) for 5 min.] and resuspended in transformation buffer to a density of 1.6 x 106 protoplasts/ml. Care should be taken to carry over as little as possible W5 15 solution into the transformation mix. 300 μΙ samples of the protoplast suspension (ca. 5 x 105 protoplasts) were aliquotted in 14 ml sterile plastic centrifuge tubes, 30 μΙ of transforming DNA were added. After carefully mixing, 300 μΙ of PEG solution were added and mixed again by careful shaking. The transformation mix was incubated for 15 min. at room temperature with occasional shaking. 10 ml W5 20 solution were gradually added, the protoplasts pelleted [70g (Clements Orbital 500 bench centrifuge, 400 rpm) for 5 min.] and the supernatant removed. The protoplasts were resuspended in 0.5 ml K3 medium and ready for cultivation

Culture of protoplasts, selection of transformed lines and regeneration of transgenic tobacco plants 25 Approximately 5 x 105 protoplasts were placed in a 6 cm petri dish. 4.5 ml of a pre-warmed (melted and kept in a water bath at 40-45°C) 1:1 mix of K3:H medium containing 0.6% SeaPlaque™ agarose were added and, after gentle mixing, allowed to set. 39 2013202730 09 Dec 2016

After 20-30 min the dishes were sealed with Parafilm® and the protoplasts were cultured for 24 h in darkness at 24°C, followed by 6-8 days in continuous dim light (5 pmol m'2 s'1, Osram L36 W/21 Lumilux white tubes), where first and multiple cell divisions occur. The agarose containing the dividing protoplasts was cut into 5 quadrants and placed in 20 ml of A medium in a 250 ml plastic culture vessel. The corresponding selection agent was added to the final concentration of 50 mg/l kanamycin sulphate (for npt2 expression) or 25 mg/l hygromycin B (for hph expression) or 20 mg/l phosphinotricin (for bar expression). Samples were incubated on a rotary shaker with 80 rpm and 1.25 cm throw at 24°C in continuous 10 dim light.

Resistant colonies were first seen 3-4 weeks after protoplast plating, and after a total time of 6-8 weeks protoplast-derived resistant colonies (when 2-3 mm in diameter) were transferred onto MS morpho medium solidified with 0.6% (w/v) agarose in 12-well plates and kept for the following 1-2 weeks at 24°C in continuous 15 dim light (5 pmol m'2 s'1, Osram L36 W/21 Lumilux white tubes), where calli proliferated, reached a size of 8-10 mm, differentiated shoots that were rooted on MS hormone free medium leading to the recovery of transgenic tobacco plants (Table 4 and Figure 94). TABLE 4 20 Production of transgenic tobacco calli carrying chimeric ryegrass genes (in sense and antisense orientaion) involved in the regulation of flowering and plant development

Construct Transfected protoplasts Transformed calli Transformation efficiency pDH51LpCen 1.5 x 10s 78 5.20x1 O'5 pDH51LpCen anti 1.5 x 10s 56 3.73x1 O'5 pDH51 LpMADSI 1.5 x 10s 97 6.46x1 O'5 pDH51 LpMADSI anti 1.5 x 106 69 4.60x1 O'5 pDH51 LpMADSI b 1.5 x 106 67 4.47x1 O'5 pDH51 LpMADSI b anti 1.5 x 106 48 3.20x1 O'5 2013202730 09 Dec 2016 40 pDH51 LpMADS2-1 1.5 x 106 56 3.73x105 pDH51 LpMADS2-1 anti 1.5 x 106 82 5.46 x10 s pDH51 LpMADS2-2 1.5 x 106 52 3.46 x10 s pDH51 LpMADS2-2 anti 1.5 x 106 32 2.13x10s pDH51 LpMADS2-3 1.5 x 106 55 3.66 x10 s j pDH51 LpMADS2-3 anti 1.5 x 106 74 4.93 x10 s pDH51 LpMADS3 1.5 x 106 58 3.87 x10 s pDH51LpMADS3 anti 1.5 x 106 67 4.47 x10 s pDH51 LpMADS4 1.5 x 106 84 5.60 x10 s pDH51 LpMADS4 anti 1.5 x 106 53 3.53 x10 s pDH51 LpMADS4-2 1.5 x 106 54 3.60 x10 s pDH51LpMADS4-2 anti 1.5 x 106 65 4.33 x10 s pDH51 LpMADS5 1.5 x 106 89 5.93 x10 s pDH51LpMADS5 anti 1.5 x 106 78 5.20 x10 s EXAMPLE 6

Genetic mapping of perennial ryegrass genes involved in flowering and plant development 5 The cDNAs representing genes involved in flowering and plant development were amplified by PCR from their respective plasmids, gel-purified and radio-labelled for use as probes to detect restriction fragment length polymorphisms (RFLPs). RFLPs were mapped in the Fi (first generation) population, ΝΑβ x ΑΙΙθ. This population was made by crossing an individual (NA6) from a North African 10 ecotype with an individual (ΑΙΙθ) from the cultivar Aurora, which is derived from a Swiss ecotype. Genomic DNA of the 2 parents and 114 progeny was extracted using the 1 x CTAB method of Fulton et al. (1995).

Probes were screened for their ability to detect polymorphism using the DNA (10 μg) of both parents and 5 F-ι progeny restricted with the enzymes Dral, EcoRI, 15 EcoRV or Hindlll. Hybridisations were carried out using the method of Sharp et al. 41 2013202730 09 Dec 2016 (1988). Polymorphic probes were screened on a progeny set of 114 individuals restricted with the appropriate enzyme (Figures 52, 57, 66, 79, 84, and 93). RFLP bands segregating within the population were scored and the data was entered into an Excel spreadsheet. Alleles showing the expected 1:1 ratio were 5 mapped using MAPMAKER 3.0 (Lander et al. 1987). Alleles segregating from, and unique to, each parent, were mapped separately to give two different linkage maps. Markers were grouped into linkage groups at a LOD of 5.0 and ordered within each linkage group using a LOD threshold of 2.0.

Loci representing genes involved in flowering and plant development 10 mapped to the linkage groups as indicated in Table 5 and in Figure 96. These gene locations can now be used as candidate genes for quantitative trait loci for flowering and plant development. TABLE 5

Map locations of ryegrass genes encoding proteins involved in flowering and 15 plant development across two genetic linkage maps of perennial ryegrass (NA6 and AU6)

Linkage group

Probe Polymorphic Mapped with Locus NA6 AU6 LpAP2b Y Hind III LpAP2b. 1 1 LpAP2b.2 1 1 LpCENa Y Dra 1 LpCENa 5 LpHBa Y EcoRV LpHBa.1 6 LpHBa.2 7 LpHBb Y EcoR 1 LpHBb 5 5 LpHBd Y Hind III LpHBd.1 6 6 LpHBd.2 6 LpMADS1/L pMADSIa Y EcoRV LpMADSI 3 42 2013202730 09 Dec 2016

LpMADS3 Y EcoR V LpMADS3 7 5

LpMADS4-1 Y EcoR I LpMADS4-1 7 EXAMPLE 7

Expression profiling of cDNAs encoding proteins involved in flowering and plant development using microarray technology 5 cDNAs encoding proteins involved in flowering and plant development were PCR amplified and purified. The amplified products were spotted three times on each amino-silane coated glass slide (CMT-GAPS, Corning, USA) using a microarrayer MicroGrid (BioRobotics, UK). Spotting solution was also spotted in every subgrid of the microarray as negative and background controls. The 10 duplicates were placed about 800 micron apart to prevent competitive hybridisation.

Table 6 gives details on the tissues used to extract total RNA. TABLE 6

List of hybridization probes used in expression profiling of perennial ryegrass genes encoding proteins involved in flowering and plant development using 15 microarrays

Hybridization probe for microarrays Organ specificity (3-month old plants grown hydroponically) Leaf blade Sheath Root Seedling grown under light condition 5-day old shoot (5LS) 7-day old shoot (7LS) 10-day old shoot (10LS) 5-day old root (5LR) 7-day old root (7LR) 2013202730 09 Dec 2016 43 10-day old root (10LR) Seedling grown under dark condition 5-day old shoot (5DS) 7-day old shoot (7DS) 10-day old shoot (10DS) 5-day old root (5DR) 7-day old root (7DR) 10-day old root (10DR)

Fluorescence labelled probes were synthesis by reversed transcribing RNA and incorporating Cyanine 3 or 5 labelled dCTP. The probes were hybridised onto microarrays. In each case the experiment was repeated on two microarrays. After 5 hybridisation for 16 hours (overnight), the microarrays were washed and scanned using a confocal laser scanner (ScanArray 3000, Packard, USA). The images obtained were quantified and analysed using Imagene 4.1 and GeneSight 2.1 (BioDiscovery, USA). Data were judged as not present (-), low expression (+), medium expression (++), high expression (+++) and highly expression (++++) 10 (Table 7). 2013202730 09 Dec 2016 44 TABLE 7

Results of expression profiling of ryegrass genes encoding proteins involved in flowering and plant development plate row column gene id clone id gene seq notes sheath leaf blade root 5LS 7LS 10LS 5LR 7LR 10LR 5DS 7DS 10DS 5DR 7DR 10DR Array2Vrg a 12 XnsCC2_VIGUN-7659 01 rg1 KsB05 LpMADSa partial - + + + + - - - - - - - - - - - - Array2Vrg b 1 TsfAP1_ARATH-7660 07rg1 AsC11 LpMADSa partial - - - - - - - - - - - - - - - Array2Vrg b 2 TsfAG 15_B RAN A7661 07rg2GsF11 LpMADSa partial - - - - - - - - - - - - - - - Array2Vrg b 3 T sfAG15_ARATH7662 07rg1 lsB02 LpMADSa partial - - - - - - - - - - - - - - - Array2Vrg b 4 T sfAG15_ARATH7663 07rg1 lsF01 LpMADSa partial - - - - - - - - + + - - - - - + Array2Vrg b 5 TsfAP1_ARATH-7664 07rg1 UsF06 LpMADSa partial + - - - - - - - - - - + - - - Array2Vrg b 6 TsfC Μ B1 _D I AC A7665 13rg 1 lsA09 LpMADSa partial - - - - - - - - - - - - - - - Array2Vrg b 7 TsfAP1_ARATH-7666 14rg 1 lsC10 LpMADSa partial + + - + - - + - - - - - - - - Array2Vrg b 8 TsfAP1_ARATH-7667 14rg1 VsH01 LpMADSa partial + + + + + + - + + - - - + + - - - - Array2Vrg b 9 T sfAGL6_ARATH7668 13rg2CsB07 LpMADSb full + - - - - - - - - - - - - - - Array2Vrg b 10 TsfAP1_ARATH-7669 13rg1KsG07 LpMADSc partial + + + + + + - + - + - - - - - - - - - Array2Vrg b 11 TsfAP1_ARATH-7670 07rg2BsG12 LpMADSc partial - + + + + - - - + - - - - - - - + + Array2Vrg b 12 T sfAP1 _ARATH-7671 07rg2DsA06 LpMADSc partial + + + + + + + - - + + - - - + - - - - Array2Vrg c 1 T sfAGL2_ARATH7672 13rg1BsF09 LpMADSd partial - - - - - + - - - - - - - - - Array2Vrg c 2 T sfAGL2_ARATH7673 14rg 11sH 11 LpMADSe full - - - - - - - - - - - - - - - Array2Vrg c 3 T sfFBP2_PETHY7674 13rg1FsD06 LpMADSf partial - - - - - - - - - - - - - - - Array2Vrg c 4 TsfC Μ B1 _D I AC A7675 13rg2GsF08 LpMADSg full - - - - - - - - - - - - - - - Array2Vrg c 5 ZhyNHPX_CAEEL7676 17rg1QsC11 LpMADSh partial - - - - - - - - - - - - - - - Array2Vrg c 6 TsfC Μ B1 _D I AC A7677 19rg2MsF05 LpMADSi full - - - - - - - - - - - - - - - Array2Vrg c 7 T sfFBP2_PETHY7678 11 rg2YsG07 LpMADSj full - - - - - - - - - - - - - - - Array2Vrg c 8 TsfAG_TOBAC—7679 13rg1SsH07 LpMADSk full - - - - - - - - - - - - - - - Array2Vrg c 9 TsfMAD2_PETHY7680 14rg1EsG10 LpMADSi full - - - - - + - - - - - - - - - Array2Urg f 3 MSPS_BETVU—7618 14rg1PsE12 LpMADSi full - - - - - - - - - - - - - + - Array2Vrg c 10 CcgCEN_ANTMA-7681 06rg10sH07 LpCENa full + + + + + + + + + + + + + + + ++ + + + + + + + + + + + + + + + + + ++ + + + Array2Vrg c 11 XnsOTXI _BRARE7682 06rg1 WsC09 LpAP2b partial - - - + + - - - - - - - - - - - Array2Vrg c 12 T sfAF048900—7683 10rg1RsC04 LpAP2b partial - - - + - - + + - - + + + - - + - Array2Vrg d 1 XnsOTXI _BRARE7684 10rg1RsE02 LpAP2b partial - - - + + + + + + + - + + + + + + + + + + + + + + Array2Vrg d 2 TsfAHNK_HUMAN7685 17rg1PsH01 LpAP2b partial - + - - + - - + - + - + + - - + 45 2013202730 09 Dec 2016 TABLE 7 (cont.) Array2Vrg d 3 T sfHT 14_ARATH7686 10rg2OsD06 LpHBa Full - - - - - - - - - - - - - - - Array2Vrg d 4 T sfATH 1 _ARATH7687 16rg 1 lsF03 LpHBb Full - + - - - - - - - - + + - - - - Array2Vrg d 5 T sfHX1 A_MAIZE7688 19rg2EsA05 LpHBc Full - - - - - - - - - - - - - - - Array2Vrg d 6 TsfHKL3_MALD07689 10rg2HsH12 LpHBd Full - - - - - - - - - - - - - - - Array2Vrg d 7 TsfHKL3_MALDO7690 10rg2JsF02 LpHBd Full + - + - - - - - - + - - - - - Array2Vrg d 8 TsfHKL3_MALD07691 10rg1WsD10 LpHBd full - - - - - - - - - - - - - - - Array2Vrg d 9 TsfHKL3_ARATH7692 17rg1SsE04 LpHBd full - - - + + + - - - - - - - - - - Array2Vrg d 10 T sfAGL6_ARATH7693 13rg1WsA10 LpMADSb full - - - - - - - - - - - - - - - Array2Vrg d 11 T sfAG_T OBAC-7694 13rg1SsH07 LpMADSk Full - - - - - - - - - - - - - - - 2013202730 09 Dec 2016 46

REFERENCES

Feinberg, A.P., Vogelstein, B. (1984). A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13.

Frohman et al. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad Sci. USA 85:8998

Gish and States (1993) Identification of protein coding regions by database similarity serach. Nature Genetics 3:266-272

Lander, E.S., Green P., Abrahamson, J., Barlow, A., Daly, M.J., Lincoln, S.E., Newburg, L. (1987). MAPMAKER: an interactive computer package for constructing primary linkage maps of experimental and natural populations. Genomics 1: 174-181.

Loh, E.Y., Elliott, J.F., Cwirla, S., Lanier, L.L., Davis, M.M. (1989). Polymerase chain reaction with single-sided specificity: Analysis of T-cell receptor delta chain. Science 243:217-220

Ohara, 0., Dorit, R.L., Gilbert, W. (1989). One-sided polymerase chain reaction: The amplification of cDNA. Proc. Natl. Acad Sci USA 86:5673-5677

Sambrook, J., Fritsch, E.F., Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual. Cold Spring Harbour Laboratory Press

Sharp, P.J., Kreis, M., Shewry, P.R., Gale, M.D. (1988). Location of a-amylase sequences in wheat and its relatives. Theor. Appl. Genet. 75: 286-290. 2013202730 09 Dec 2016 47

Finally, it is to be understood that various alterations, modifications and/or additions may be made without departing from the spirit of the present invention as outlined herein.

It will also be understood that the term “comprises” (or its grammatical variants) as used in this specification is equivalent to the term “includes” and should not be taken as excluding the presence of other elements or features.

Documents cited in this specification are for reference purposes only and their inclusion is not an acknowledgement that they form part of the common general knowledge in the relevant art.

Claims (24)

1. THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS:

   1. An artificial construct including (i) an isolated nucleic acid or nucleic acid fragment encoding a MADS-box protein (MADS) from Lolium perenne; and (ii) a heterologous gene marker.
2. 2. A vector including a nucleic acid or nucleic acid fragment encoding a MADS-box protein (MADS) from Lolium perenne.
3. 3. An artificial construct including (i) a nucleic acid or nucleic acid fragment encoding MADS, or complementary or antisense to a sequence encoding MADS, wherein said nucleic acid or nucleic acid fragment includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 14, 15, 17, 19, 21, 23, 25, 27, 29, 54, 59, 63, 68, 72, 76, 81, 86 and 90 hereto (Sequence ID Nos: 1, 3 to 11, 12, 14 to 18, 19, 21 to 23, 24, 26, 28 to 30, 31, 33, 35, 37, 39, 41, 43, 45 to 49, 90, 92, 94, 96, 98, 100, 102, 104 and 106, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c), wherein said functionally active fragments and variants have at least approximately 80% identity to the sequences recited in (a), (b) and (c); and (ii) a heterologous gene marker.
4. 4. A vector including a nucleic acid or nucleic acid fragment encoding MADS, or complementary or antisense to a sequence encoding MADS, wherein said nucleic acid or nucleic acid fragment includes a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 14, 15, 17, 19, 21, 23, 25, 27, 29, 54, 59, 63, 68, 72, 76, 81, 86 and 90 hereto (Sequence ID Nos: 1, 3 to 11, 12, 14 to 18, 19, 21 to 23, 24, 26, 28 to 30, 31, 33, 35, 37, 39, 41, 43, 45 to 49, 90, 92, 94, 96, 98, 100, 102, 104 and 106, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c), wherein said functionally active fragments and variants have at least approximately 80% identity to the sequences recited in (a), (b) and (c).
5. 5. An artificial construct according to claim 3, or a vector according to claim 4, wherein said functionally active fragments and variants have at least approximately 90% identity to sequences recited in (a), (b) and (c).
6. 6. An artificial construct according to claim 3, or a vector according to claim 4, wherein said functionally active fragments and variants have at least approximately 95% identity to sequences recited in (a), (b) and (c).
7. 7. An artificial construct according to claim 3, or a vector according to claim 4, wherein said nucleic acid or nucleic acid fragment includes a nucleotide sequence selected from the group consisting of sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 14, 15, 17, 19, 21, 23, 25, 27, 29, 54, 59, 63, 68, 72, 76, 81, 86 and 90 hereto (Sequence ID Nos: 1, 3 to 11, 12, 14 to 18, 19, 21 to 23, 24, 26, 28 to 30, 31, 33, 35, 37, 39, 41, 43, 45 to 49, 90, 92, 94, 96, 98, 100, 102, 104 and 106, respectively).
8. 8. An artificial construct according to any one of claims 3 and 5 to 7, or a vector according to anyone of claims 4 to 7, wherein said nucleic acid or nucleic acid fragment is from Lolium perenne.
9. 9. A polypeptide recombinantly produced from a nucleic acid or nucleic acid fragment including a nucleotide sequence selected from the group consisting of (a) sequences shown in Figures 1, 3, 4, 6, 7, 9, 10, 12, 14, 15, 17, 19, 21, 23, 25, 27, 29, 54, 59, 63, 68, 72, 76, 81, 86 and 90 hereto (Sequence ID Nos: 1, 3 to 11, 12, 14 to 18, 19, 21 to 23, 24, 26, 28 to 30, 31, 33, 35, 37, 39, 41, 43, 45 to 49, 90, 92, 94, 96, 98, 100, 102, 104 and 106, respectively); (b) complements of the sequences recited in (a); (c) sequences antisense to the sequences recited in (a) and (b); and (d) functionally active fragments and variants of the sequences recited in (a), (b) and (c), wherein said functionally active fragments and variants have at least approximately 80% identity to the sequences recited in (a), (b) and (c).
10. 10. An artificial construct according to any one of claims 1, 3 and 5 to 8, or a vector according to any one of claims 2 and 4 to 8, further including a promoter and a terminator, said promoter, nucleic acid or nucleic acid fragment and terminator being operatively linked.
11. 11. A plant cell, plant, plant seed or other plant part including an artificial construct according to any one of claims 1, 3, 5 to 8 and 10, or a vector according to any one of claims 2, 4 to 8 and 10.
12. 12. A plant, plant seed or other plant part derived from a plant cell or plant according to claim 11 and including an artificial construct according to anyone of claims 1, 3, 5 to 8 and 10, or a vector according to any one of claims 2, 4 to 8 and 10.
13. 13. A method of modifying plant life cycles and/or growth phases, flowering processes, flowering and/or plant architecture and/or flower and/or inflorescence development in a plant, said method including introducing into said plant an effective amount of an artificial construct according to any one of claims 1, 3, 5 to 8 and 10, and/or a vector according to anyone of claims 2, 4 to 8 and 10.
14. 14. Use of a nucleic acid or nucleic acid fragment and/or single nucleotide polymorphisms thereof as a molecular genetic marker in one of more of quantative trait loci (QTL) tagging, QTL mapping, DNA fingerprinting and marker assisted selections, wherein said nucleic acid or nucleic acid fragment encodes MADS from Lolium perenne.
15. 15. The use according to claim 14, wherein the molecular genetic marker is used in Lolium species.
16. 16. The use according to claim 14 or 15, wherein the molecular genetic marker is used as a tagging QTL for herbage quality traits; flowering intensity; flowering time; number of tillers; leafiness; bushiness; season growth pattern; herbage yield; flower architecture or plant stature.
17. 17. An artificial construct according to any one of claims 1, 3, 5 to 8 and 10, or a vector according to any one of claims 2, 4 to 8 and 10, wherein said nucleic acid or nucleic acid fragment includes a single nucleotide polymorphism (SNP).
18. 18. A substantially purified or isolated MADS polypeptide from Lolium perenne.
19. 19. A substantially purified and isolated MADS polypeptide, said MADS polypeptide including an amino acid sequence selected from the group consisting of (a) sequences shown in Figures 2, 5, 8, 11, 13, 16, 18, 20, 22, 24, 26, 28, 55, 60, 64, 69, 73, 77, 82, 87 and 91 hereto (Sequence ID Nos: 2, 13, 20, 25, 27, 32, 34, 36, 38, 40, 42, 44, 91, 93, 95, 97, 99, 101, 103, 105 and 107, respectively); and (b) functionally active fragments and variants of the sequences recited in (a), wherein said functionally active fragments and variants have at least 80% identity to the sequences recited in (a).
20. 20. A polypeptide according to claim 19, wherein said functionally active fragments and variants have at least approximately 90% identity to the sequences recited in (a).
21. 21. A polypeptide according to claim 19, wherein said functionally active fragments and variants have at least approximately 95% identity to the sequences recited in (a).
22. 22. A polypeptide according to claim 19, wherein said polypeptide includes an amino acid sequence selected from the group of sequences shown in Figures 2, 5, 8, 11, 13, 16, 18, 20, 22, 24, 26, 28, 55, 60, 64, 69, 73, 77, 82, 87 and 91 hereto (Sequence ID Nos: 2, 13, 20, 25, 27, 32, 34, 36, 38, 40, 42, 44, 91, 93, 95, 97, 99, 101, 103, 105 and 107, respectively).
23. 23. A polypeptide according to any one of claims 19 to 22, wherein said polypeptide is from Lolium perenne.
24. 24. An artificial construct according to claim 1, a vector according to claim 2 or a polypeptide according to claim 18, substantially as hereinbefore described, with reference to any one of the figures or examples.