AU1219301A - Serotype-specific identification of enterovirus 71 by RT-PCR - Google Patents

Description

WO 01/34848 PCTIUSOO/29021 SEROTYPE-SPECIFIC IDENTIFICATION OF ENTEROVIRUS 71 BY RT-PCR FIELD OF THE INVENTION The present invention relates to reagents and methods for the 5 detection and analysis of enterovirus 71. In particular, the present invention relates to nucleic acids, as well as kits and methods comprising these nucleic acids, for detecting, amplifying, and sequencing nucleic acids of enterovirus 71. BACKGROUND 10 The two leading agents responsible for large outbreaks of hand-foot and-mouth disease (HFMD), a common, usually benign, rash illness in children, are the enteroviruses coxsackievirus A16 (CA16) and enterovirus 71 (EV71). CA 16 and EV71 are closely related genetically, but EV71 is also associated with severe neurologic disease such as encephalitis, meningitis, 15 cranial nerve palsies, Guillan-Barre syndrome, and poliomyelitis-like syndrome much more frequently than is CA16 (reviewed in Alexander, J.P., et al., "Enterovirus 71 infections and neurologic disease - United States, 1977 1991." J. Infect. Dis. 169-: 905-908 (1994); Chumakov, M., et al., "Enterovirus 71 isolated from cases of epidemic poliomyelitis-like disease in Bulgaria," 20 Arch. Virol., 60:329-340 (1979); Gilbert et al., "Outbreak of enterovirus 71 infection in Victoria, Australia, with a high incidence of neurologic involvement," Pediatr. Infect. Dis. J., 7:484-488 (1988); Landry et al., "Fatal enterovirus type 71 infection: rapid detection and diagnostic pitfalls," Pediatr. Infect. Dis. J., 14:1095-2000 (1995)). Two recent EV71 outbreaks in Asia 25 (Malaysia, 1997, and Taiwan, 1998) have involved thousands of HFMD cases associated with severe neurologic disease and rapid death (CDC, "Deaths among children during an outbreak of hand, foot and mouth disease - Taiwan, Republic of China, April-July 1988," Morbidity and Mortality Weekly Report,47:629-632 (1998); Chang et al., "Fulminant neurogenic pulmonary 30 oedema with hand, foot, and mouth disease," Lancet, 352:352-367 (1998); Lum et al., "Fatal enterovirus 71 encephalomyelitis," J. Pediartrics 133:795 -1- WO 01/34848 PCTIUSOO/29021 798 (1998); World Health Organization, "Outbreak of hand, foot and mouth disease in Sarawak. Cluster of deaths among infants and young children," Wkly. Epidemiol. Rec., 72:211-212 (1997). Enterovirus 71 exhibits a wide variation in clinical presentation. EV71 5 has been associated with severe central nervous system disease with a case fatality rate of 0% to 6% (Landry et al., 1995). During a large EV71 outbreak in Bulgaria in 1975 (705 reported cases), there were 149 cases of paralytic disease and 44 fatalities. Forty-five cases of EV71 infection were reported in the United States in 1987, including eight cases of paralysis and one fatality. 10 (Alexander J.P., et al., 1994), and virus circulation was widespread, with isolates reported in at least seventeen states. Because of this wide variation in clinical presentation as well as increased public health concerns associated with EV71 and its potential for greater neurovirulence, it is important to be able to rapidly identify the specific 15 strain of EV71 during an HFMD outbreak and to be able to rapidly discriminate between EV71 and CA16. Since early symptoms are similar for HFMD associated with infections of different strains of EV71 or CA16, the etiologic diagnosis depends on virus isolation and serotyping. Standard serotyping involves neutralization tests with monospecific antiserum, which 20 are quite limited in their availability. Furthermore, antigenic typing is often hampered by non-neutralizable virus due to aggregation (Schmidt et al., "An apparently new enterovirus isolated from patients with disease of the central nervous system," J. Infect. Dis., 129:304-309 (1974); Blomberg et al., "New enterovirus type associated with epidemic of aseptic meningitis and/or hand, 25 foot, and mouth disease," Lancet, 12:112-113 (1974); Nagy et al., "Virological diagnosis of Enterovirus type 71 infections: experiences gained during an epidemic of acute CNS diseases in Hungary in 1978," Arch. Virology, 71:217 227 (1982). A second typing method using immunofluroescence techniques with commercially available monoclonal antibodies has also been employed. 30 End-labeled nucleic acid probes in the VP2 region have also been used in diagnostic tests for EV71 and CA16 (Kitamura et al., "Serotype determination of enteroviruses that cause hand-foot-and-mouth disease; Identification of -2- WO 01/34848 PCT/USOO/29021 enterovirus 71 and coxsackievirus A16 from clinical specimens by using specific probe," Kansenshogaku Zasshi, 71:715-723 (1997)). Since enterovirus serotypes are defined by neutralization using immune sera directed against the capsid proteins, nucleotide and amino acid 5 sequences of the capsid region correlate with serotype (Oberste et al., "Molecular evolution of the human enteroviruses: Correlation of serotype with VP1 sequence and application to Picornavirus classification," J. Virology, 73:1941-1948 (1999a)). In particular, the VP1-coding region has been shown to specifically correlate with serotype (Oberste et al., 1999a), and this region 10 has been successfully targeted for the development of molecular typing reagents (Kilpatrick et al., "Group-specific identification of polioviruses by PCR using primers containing mixed-base or deoxyinosine residues at positions of codon degeneracy," J. Clin. Microbiol., 34:2990-2996 (1996); Kilpatrick et al.,"Serotype-specific identification of polioviruses by PCR using 15 primers containing mixed-base or deoxyinosine residues at positions of codon degeneracy, J. Clin. Microbiol., 36:352-357 (1998); Oberste et al., "Typing of human enteroviruses of partial sequencing of VP1," J. Clin. Microbiol., 37:1288-1293 (1999b)). Despite the existence of typing methods, there remains a need for 20 reagents which can be used in a diagnostic assay to rapidly and accurately distinguish EV71 and CA16, and which can be used to identify the strain of EV71. A need also exists for a method for rapidly and accurately identifying the strain of EV71 and differentiating between EV71 and CA16. Such reagents and methods will allow the clinician to improve the speed and 25 accuracy of processing large numbers of clinical samples. Such reagents and methods will also aid the clinician in patient management, eliminate unnecessary tests, improve the speed and accuracy of diagnosis and prognosis, help control enterovirus 71 infection, and reduce the use of unnecessary antibiotics. 30 Accordingly, the present invention provides nucleic acids which can be used as primers in amplification and sequencing reactions to rapidly (generally within approximately 6 hours) amplify and sequence EV71 nucleic acids. A preferred group of nucleic acids of the present invention when used -3- WO 01/34848 PCT/USOO/29021 as primer pairs in amplification reactions, detect EV71 with a high degree of specificity and sensitivity. With these preferred primer pairs, the specificity of amplification methods of the present invention is such that target EV71 nucleic acids are amplified to a detectable level, whereas no detectable 5 product is obtained when CA16 nucleic acids are used. The nucleic acid primers of the present invention contain mixed bases or deoxyinosine residues at positions of codon degeneracy. DESCRIPTION OF THE RELATED ART Polymerase chain reaction primer sets containing mixed-base and, in 10 some cases, deoxyinosine residues is set forth in D. Kilpatrick, "Poliovirus specific primers and methods of detection utilizing the same," U.S. Pat. No. 5,691,134. The disclosed polymerase chain reaction primer sets distinguish between the three different serotypes of poliovirus and differentiate polioviruses from nonpolio enteroviruses. Amplification reactions utilizing the 15 disclosed primers do not amplify EV71 nucleic acid. Further, the primer sets have nucleotide sequences which are different from those of the nucleic acids of the present invention. A polymerase chain reaction primer set containing mixed-base and deoxyinosine residues is set forth in D. Kilpatrick et al. (1996). This 20 polymerase chain reaction primer set appears to differentiate polioviruses from nonpolio enteroviruses. Amplification reactions utilizing the disclosed primers do not amplify EV71 nucleic acid. Further, this primer set has nucleotide sequences which are different from those of the nucleic acids of the present invention. 25 None of the above-described publications teaches or describes the primers, or methods and kits using these primers. SUMMARY OF THE INVENTION The present invention provides nucleic acids which can be used as primers in amplification and sequencing reactions to rapidly amplify and 30 sequence target EV71 nucleic acids. Examples of these nucleic acid primers are set forth in the Sequence Listing as SEQ ID NOS:1-12. A preferred group -4- WO 01/34848 PCTUSOO/29021 of nucleic acids of the present invention (i.e., SEQ ID NOS: 1-4), when used as primer pairs in amplification reactions, detect EV71 with a high degree of specificity and sensitivity. With these preferred primer pairs, the specificity of amplification methods of the present invention is such that target EV71 5 nucleic acids are amplified to a detectable level, whereas no detectable product is obtained when CA16 nucleic acids are used. The present invention also provides purified nucleic acids which are complementary to nucleic acids having a nucleotide sequence selected from SEQ ID NOS 1-12. 10 The present invention also provides purified nucleic acids which are substantially the same as the above-described nucleic acids. These nucleic acids may vary from the above-described nucleic acids by one or more nucleotide substitutions, additions and/or deletions, or by the addition of an advantageous feature therein, such as, for example, a radiolabel or other 15 label for nucleic acid detection or immobilization, so long as they retain the ability of the above-described nucleic acids. The present invention also provides a method for detecting the presence or absence of EV71 in a sample containing nucleic acids, including clinical samples. The method comprises amplifying the nucleic acids present 20 in the sample with a primer pair comprising nucleic acids within the present invention, and determining the presence or absence of an amplification product having a size which is characteristic for EV71, thereby determining the presence or absence of EV71 in the sample. The present invention still further provides a kit for determining the 25 presence or absence of EV71 in a biological sample. The kit contains the nucleic acid primers disclosed in the present invention. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a dendrogram generated by neighbor-joining method with the DNADIST distance measure (Phylip 3.5). The phylogram was calculated 30 based on the nucleotide divergence of the VP1 gene (position 2442 to 3332). The last four or five characters of strain name indicate the state or country and two digit year of isolation. Branch lengths are proportional to the number -5- WO 01/34848 PCT/USOO/29021 of nucleotide differences and the frequencies with which the branches for genotype A, B, and C appeared in 1000 bootstrap replications (i.e. 898, 543 and 999, respectively). Clades with bootstrap numbers are expressed in percentile. The marker bar denotes a measurement of the relative 5 phylogenetic distance. (The branch length for the outgroup CA16 was reduced by 0.75 for space consideration.) Figure 2 is an alignment of genotype-consensus VP1 amino acid sequences. The EV71 consensus sequence shows amino acid residues that are identical in at least 85% of all strains (upper case letters) and those that 10 are identical in at least 50%, but less than 85% of all strains (lower case letters). Sites that are identical in all strains of all genotypes are double underlined; those that are identical in all strains of genotypes B and C, but different in BrCr-CA-70, are single-underlined. The genotype consensus sequences indicate sites of at least 85% consensus among all strains of a 15 given genotype (hyphens) and sites that are characteristic of one or more genotypes (upper case, 85% consensus within genotype; lower case 50% to 85% consensus within genotype). Figure 3 illustrates the position of PCR primers relative to the amino acid sequences of VP3 and VP1 (Brown et al., "Complete nucleotide 20 sequence of Enterovirus 71 is distinct from poliovirus," Virus Res., 39:195-205 (1995); Poyry et al., "Molecular analysis of coxsackievirus A16 reveals a new genetic group of enteroviruses," Virology, 292:982-987 (1994)). Primer position and sense are indicated by arrows. Amino acids at the annealing sites for primers 159S and 162A are boxed. Amino acids at the annealing 25 sites for primers 92S and 93A are underlined. Dots indicate sequences not shown. Numbers above sequence indicate relative amino acid positions in VP3 and VP1. Figure 4 shows ethidium bromide-stained gel sections containing amplification products produced by RT-PCR of EV71 RNA in the Examples 30 described hereinbelow using the primer pair 159S/162A or the primer pair 92S/93A. Sources of templates for the products in each lane were as follows: (A) (Primer pair 159S/ 162A and EV71 genotype A and genotype B strains), 1, CA70-BrCr; 2, NY72-2228; 3, AUS74-2610: 4, MN78-10181; 5, CA79 -6- WO 01/34848 PCT/USOO/29021 2258; 6, TN80-2114: 7, OH82-2381; 8, OK87-6910; 9, AL88-8149; 10, MS87 7423; (B) (Primer pair 159S/ 162A and EV71genotype C strains), 1, AK87 7238; 2, MA87-0915; 3, TX89-9978; 4, TX91-0443; 5, NC94-1997; 6, VA95 2132: 7, AUS95-2640; 8, MA97-2381; 9, OK97-2354; 10, M098-2814; (C) 5 Primer pair 92S/93A and genotype A and genotype B strains as listed in panel A. (D) Primer pair 92S/93A and genotype C strains as listed in panel B. DESCRIPTION OF THE PREFERRED EMBODIMENTS The present invention may be understood more readily by reference to the following detailed description of the preferred embodiments of the 10 invention, and to the Example, Tables, and Sequence Listings included therein. Abbreviations for "nucleotides" follow the nomenclature described by the Nomenclature Committee for the International Union of Biochemistry, "Nomenclature for Incompletely Specified Bases in Nucleic Acid Sequences," 15 Eur. J. Biochem. 150:1-5 (1985), in which "A" represents adenine residues, "C" represents cytosine residues, "T" represents thymine residues, "G" represents guanine residues, "I" represents deoxyinosine residues, "M" represents adenine or cytosine residues, "R" represents adenine or guanine residues and "Y" represents cytosine or thymine residues. 20 Definitions The terms "nucleic acid" and "oligonucleotide" refer to primers, probes, and/or oligomer fragments to be detected, and are generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to polyribonucleotides (containing D-ribose), and to any other type of 25 polynucleotide which is an N glycoside of a purine or pyrimidine base, or modified purine or pyrimidine base. The terms "nucleic acid" and "oligonucleotide" are used interchangeably herein. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. Nucleic 30 acids and oligonucleotides can be prepared by any of several well-known methods. For example, they may be prepared by cloning and restriction of -7- WO 01/34848 PCT/USOO/29021 desired sequences, or by direct chemical synthesis by the phosphotriester methods described by Narang et al., " Meth. Enzymol. 68:90-99 (1979) and Brown et al., Meth. Enzymol. 68:109-151 (1979); by the diethylphosphoramidite method described by Beaucage et al., Tetrahedron 5 Lett. 22:1859-1862 (1981); or by the solid support method described in U.S. Patent No. 4,458,066 and Matteucci, M. D., and Caruthers, M. H., J. Am. Chem. Soc. 103, 3185 (1981). A review of nucleic acid syntheses methods is provided in Goodchild, Bioconjugate Chemistry 1(3):165-187 (1990). The term "primer" refers to an oligonucleotide, whether natural or 10 synthetic, which is capable of hybridizing with a template nucleic acid (i.e., the nucleic acid being amplified), and which is capable of initiating the synthesis of a DNA extension product having a nucleotide sequence which is complementary to the template nucleic acid strand in the presence of four different nucleoside triphosphates and an agent for polymerization (i.e., DNA 15 polymerase or reverse transcriptase) present in an appropriate buffer and at a suitable temperature. The length of primers typically ranges between about 10 and about 100 nucleotides. Short primer molecules generally require cooler temperatures to form sufficiently stable hybrid complexes with the template. Primers need not reflect the exact sequence of the template 20 nucleic acid, but must be sufficiently complementary (at least 85%, preferably at least 90%, and more preferably at least 95% complimentary) to hybridize with the template. Extensions which are not capable of hybridizing with the target nucleic acid may generally be added to primers to allow the performance of a variety 25 of postamplification operations on the amplification product without significant perturbation of the amplification itself. For example, a primer can incorporate an additional feature, such as a radio- or non-radioactive label (biotin, etc.) which will allow for the detection or immobilization of the amplification product, but which will not alter the basic property of the primer (that of acting 30 as a point of initiation of DNA synthesis). For another example, a primer may contain an additional nucleic acid sequence at the 5' end which will not hybridize to the target nucleic acid, but which will facilitate the cloning of the amplified nucleic acid product. -8- WO 01/34848 PCTIUSOO/29021 The phrase "selectively hybridize" for the present invention indicates that the stringency of hybridization conditions can be set such that a nucleic acid hybridizes with target nucleic acid sequences present in EV71, but not with nucleotide sequences present in CA16. For example, the primers 93A 5 and 162A of the present invention selectively hybridize with target EV71 nucleic acids. This is demonstrated by the results of Example 2 which indicate that either of these primers, in combination with another primer that does not selectively hybridize, can be used to amplify EV71 target nucleic acids under conditions wherein CA16 nucleic acids are not amplified. 10 The term "hybridization" refers to the formation of a duplex structure by two single-stranded nucleic acids due to fully (100%) or less than fully (less than 100%) complementary base pairing. Hybridization can occur between fully complementary nucleic acid strands or between less than fully complementary nucleic acid strands which contain regions of mismatch due 15 to one or more nucleotide substitutions, deletions or additions. Hybridization can also occur when a nucleic acid is comprised of one or more modified nucleotides, such as inosine. Depending on the length of a primer of the present invention, the primer can generally range from between about 85% 90%, and more preferably 95% complementary bases and full 20 complementarity with a target region of a nucleic acid and still hybridize therewith. The term "purified" means that the nucleic acids are of sufficient purity so that they may be employed, and will function properly, in the methods of the present invention, as well as in a clinical, diagnostic, experimental or other 25 procedure, such as reverse transcription/polymerase chain reaction, Southern or dot blot hybridization, or gel electrophoresis. Many procedures are known by those of ordinary skill in the art for purifying nucleic acids prior to their use in other procedures. The term "substantially the same as" refers to a nucleic acid having a 30 nucleotide sequence which is similar to the nucleotide sequence of one of the nucleic acids set forth in the Sequence Listing as SEQ ID NOS:1-77, and which retains the functions of such nucleic acid, but which differs from such nucleic acid by the substitution, deletion and/or addition of one or more -9- WO 01/34848 PCT/USOO/29021 hybridizing or non-hybridizing nucleotides, and/or by the incorporation of some other feature into the nucleic acid, such as a radiolabel or other label (biotin, etc.) for nucleic acid detection or immobilization. These nucleic acids will have the ability of the primers whose nucleotide sequences are set forth in 5 the Sequence Listing to detect in a biological sample during amplification reactions, such as reverse transcription/polymerase chain reaction, nucleic acids present in EV71. Modifications at the 5'- end of a nucleic acid can include. for example, the addition of an isotope, such as "P, or a chemical, such as digoxigenin, for detection when using a commercial kit, such as the 10 Boehringer-Mannheim Dig/Genius detection system. In addition, restriction enzyme sites and/or cloning sites can be added to the 5'- end of a nucleic acid (from about 6 to more than about 12 nucleotides) for the direct cloning of the amplified product. The phrase "primer pair" refers to two primers that each hybridize to 15 different target sequences on different strands of a DNA molecule to prime amplification of a target nucleic acid. The primers are oriented upon hybridization with the target nucleic acid with their 3' ends pointing towards each other and prime enzymatic extension along the nucleic acid target in the presence of the four deoxyribonucleotide triphosphates. The primers of a 20 primer pair when used in an amplification reaction are capable of amplifying a target nucleic acid located between the primers. The phrases "target region" and "target nucleic acid" refer to a region of nucleic acid that is to be amplified, detected, sequenced, or otherwise analyzed. 25 The phrase "target sequence" refers to the sequence to which a primer hybridizes. Nucleic acid sequences and the relative genomic position of the "VP1"and 'VP3" genes are disclosed in GenBank entries referenced in Brown and Pallansch, 1995 and Poyry et al., 1994. 30 The term "amplification reaction mixture" refers to a mixture comprising four different nucleoside triphosphates and an agent for polymerization, preferably DNA polymerase or reverse transcriptase, present in an appropriate buffer. -10- WO 01/34848 PCT/USOO/29021 Oliqonucleotide Primers Used for RT-PCR and Sequencing of Target EV71 Nucleic Acids In one aspect, the present invention provides purified nucleic acids which hybridize with nucleic acids present in the EV71 VP1 gene and which 5 function as primers for amplification and sequencing of target nucleic acids of the EV71 VP1 gene. To account for the amino acid sequence variation within EV71 strains and for codon degeneracy, primers preferably contain sites of mixed-base composition and deoxyinosine at sites of fourfold codon degeneracy. When these primers are used in an amplification reaction, EV71 10 target nucleic acids are amplified for further analysis, such as for nucleic acid sequence analysis. These nucleic acids allow a clinician to rapidly and accurately detect and characterize, using amplification reactions and, in some cases, nucleic acid sequencing, the EV71 strain that may be present in a biological sample. 15 Examples of the nucleic acids of the present invention include DNA primers having the nucleotide sequences set forth below, and/or in the Sequence Listing. (SEQ ID NOS:1, 2, and 5-53). Table 1. EV71 Amplification and Sequencing Primers Primer Sequence Seq. Position Use 20 159S ACYATGAAAYTGTGCAAGG 1 2385-2403 P 197S CTCTCGATAGTTTCTTCAGCAG 5 2674-2695 S 172S TTCAGTAGGGCAGGCTTGGTAGG 6 2691-2714 P 204A CTGCTGAAGAAACTATCGAGAG 7 2698-2679 S 161S CTGGGACATAGAYATAACWGG 8 2766-2785 P 25 162A CCRGTAGGKGTRCACGCRAC 2 2869-2850 P 198A CCGTCATAGAACCATTGATAAG 9 3048-3037 S 163S GAGCAYAARCAGGAGAAAGAYC 10 3078-3100 S 169S ATAYATGAGAATGAAGCAYGT 11 3194-3215 S 174A GCTGACCAAACTTTCCAAGGG 12 3348-3328 P 30 NP1A GCICCICAYTGITGICCRAA 13 3355-3336 P -11- WO 01/34848 PCT/USOO/29021 In Table 1, the column labeled "Primer," "A" indicates an antisense or antigenome polarity primer, and "S" indicates a sense or genome polarity primer. In the column labeled "sequence," Y = C or T; R = A or G; I = inosine, K=G or T, W=A or T. In the column labeled "Position," the numbered position 5 is relative to 7423-MS-87 (Brown and Pallansch et al., 1995). Primer NP1A is discussed in Oberste, et al.,1 999a. In the column labeled "Use," "P" (PCR) and "S" (sequencing) indicates the preferred use for a given primer: of course, any of the primers could be used for either PCR or sequencing. For amplification reactions such as PCR, sense-oriented primers( such 10 as 159S, 161S, and the like) can be paired with antisense primers ( such as 174A, 198A, and the like) in any arrangement as long as they span a genomic region which produces an amplicon reasonably large enough to be analyzed, preferably on an agarose gel (approximately 100 bp in length). The following are effective primer pairs for amplification and sequencing: 159S/162A; 15 159S/204A; 161S/NP1A; 169S/NP1A; 163S/ 174A; 172S/174A; and 197S/198A. The consensus nucleotide sequence (SEQ ID NO:1) is the degenerate primer containing mixed-base nucleotide positions for primer 159S and denotes the four possible combinations (species) of nucleotides that are 20 found in SEQ ID NOS:5-8, as set forth below: SEQ ID NO:14 5'-ACC ATG AAA CTG TGC AAG G SEQ ID NO:15 5'-ACC ATG AAA TTG TGC AAG G SEQ ID NO:16 5'-ACT ATG AAA CTG TGC AAG G SEQ ID NO:17 5'-ACT ATG AAA TTG TGC AAG G 25 The consensus nucleotide sequence set forth in SEQ ID NO:2 for primer 162A denotes the sixteen possible combinations (species) of nucleotides that are found in SEQ ID NOS:18-33, as set forth below: SEQ ID NO: 18 5'-CCA GTA GGG GTA CAC GCA AC SEQ ID NO: 19 5'-CCA GTA GGG GTA CAC GCG AC 30 SEQ ID NO: 20 5'-CCA GTA GGG GTG CAC GCA AC SEQ ID NO: 21 5'-CCA GTA GGG GTG CAC GCG AC -1 2- WO 01/34848 PCT/USOO/29021 SEQ ID NO: 22 5-CCA GTA GGT GTA CAG GCA AC SEQ ID NO: 23 5'-CCA GTA GGT GTA CAC GCG AC SEQ ID NO: 24 5-CCA GTA GGT GTG CAC GCA AC SEQ ID NO: 25 5-CCA GTA GGT GTG GAO GOG AG 5 SEQ ID NO: 26 5-GGG GTA GOG GTA GAG GGA AC SEQ ID NO: 27 5-GGG GTA GGG OTA GAO GOG AC SEQ ID NO: 28 5-OG GTA GGG GTG GAGCA AC SEQ ID NO: 29 5-COG GTA GGG GTG GAO GOG AC SEQ ID NO: 30 5'-GGG GTA GGT GTA CAO GOA AC 10 SEQ ID NO: 31 5'-CCG GTA GGT GTA CAC GCG AC SEQ ID NO: 32 5'-CCG GTA GGT GTG CAC GCA AC SEQ ID NO: 33 5'-CCG GTA GGT GTG CAC GCG AC The consensus nucleotide sequence set forth in SEQ ID NO:8 for primer 161 denotes the four possible combinations (species) of nucleotidles 15 that are found in SEQ ID NOS:34-37, as set forth below: SEQ ID NO: 34 5'-CTG GTA CAT AGA CAT AAC AGC SEQ ID NO: 35 5'-CTG GTA CAT AGA CAT AAO TGC SEQ ID NO: 36 5'-CCG GGA CAT AGA TAT AAC AGC SEQ ID NO: 37 5'-CTG GGA CAT AGA TAT AAC TGC -13- WO 01/34848 PCT/USOO/29021 The consensus nucleotide sequence set forth in SEQ ID NO:10 for primer 163 denotes 8 possible combinations (species) of nucleotides that are found in SEQ ID NOS:38-45, as set forth below: SEQ ID NO: 38 5'-GAG CAC AAA CAG GAG AAA GAC 5 SEQ ID NO:39 5'-GAG CAC AAA CAG GAG AAA GAT SEQ ID NO: 40 5'-GAG CAC AAG CAG GAG AAA GAC SEQ ID NO: 41 5'-GAG CAC AAG CAG GAG AAA GAT SEQ ID NO: 42 5'- GAG CAT AAA CAG GAG AAA GAC SEQ ID NO: 43 5'-GAG CAT AAA CAG GAG AAA GAT 10 SEQ ID NO: 44 5'-GAG CAT AAG CAG GAG AAA GAC SEQ ID NO: 45 5'-GAG CAT AAG CAG GAG AAA GAT The consensus nucleotide sequence set forth in SEQ ID NO:11 for primer 169 denotes the four possible combinations (species) of nucleotides that are found in SEQ ID NOS:46-49, as set forth below: 15 SEQ ID NO:46 5'-ATA CAT GAG AAT GAA GCA CGT SEQ ID NO:47 5'-ATA CAT GAG AAT GAA GCA TGT SEQ ID NO:48 5'-ATA TAT GAG AAT GAA GCA TGT SEQ ID NO:49 5'-ATA TAT GAG AAT GAA GCA CGT The consensus nucleotide sequence set forth in SEQ ID NO:13 for 20 primer NP1A denotes the four possible combinations (species) of nucleotides that are found in SEQ ID NOS:50-53, as set forth below: SEQ ID NO:50 5'-GCI CCI CAC TGI TGI CCA AA SEQ ID NO:51 5'-GCI CCI CAT TGI TGI CCA AA SEQ ID NO:52 5'-GCI CCI CAC TGI TGI CCG AA 25 SEQ ID NO:53 5'-GCI CCI CAT TGI TGI CCG AA EV71 Serotype-Specific Primer Pairs In another aspect of the invention, preferred nucleic acids are disclosed which form primer pairs wherein one of the primers of the primer -14- WO 01/34848 PCT/USOO/29021 pairs selectively hybridizes to EV71 nucleic acids. When these primer pairs are used in an amplification reaction, EV71 target nucleic acids are amplified, but not CA16 nucleic acids. Determination of the desired nucleotide sequence for these EV71 serotype-specific primers is facilitated, in part, by 5 data obtained using the oligonucleotide primers used for RT-PCR and sequencing of EV71 nucleic acid described above. Analysis of amino acid sequences in and around the VP1 region of EV71 and CA16 strains reveal the presence of serotype-specific sequence motifs (Figs. 2-3). Pairs of EV71-specific PCR primers can be designed using 10 conserved motifs which amplify many strains of EV71. In a preferred embodiment, these pairs of primers are designed so that a target nucleic acid of EV71 is amplified, but no amplification product is detectable for CA16 nucleic acid. Preferably, at least one primer of the primer pair selectively hybridizes to a region of VP1. Most preferably, one primer of the primer pair 15 hybridizes to sequences at the carboxyl-terminus of the VP3 gene and the other primer of the primer pair selectively hybridizes near the center of VP1 gene (Fig. 3). To account for the amino acid sequence variation within EV71 strains and for codon degeneracy, primers preferably contain sites of mixed base composition and deoxyinosine at sites of fourfold codon degeneracy. 20 These preferred nucleic acids, especially when used in the disclosed primer pairs, allow a clinician to rapidly and accurately determine by amplification reactions, such as reverse transcription/polymerase chain reaction, whether or not EV71 is present in a biological sample. Examples of the nucleic acids of the present invention include DNA 25 primers having the nucleotide sequences set forth below, and/or in the Sequence Listing (SEQ ID NOS:1-4, and 54-77): Table 2. Preferred Group of EV71-Specific Oligonucleotide Primers Used in this Study Primer Sequence Position SNoD A geacids 30 159S ACYATGAAAYTGCAAGG 2385-2403 [ 1 TMKLCKD 162A CCRGTAGGKGTRCACGCRAC 2869-2850 2 VACTPTG -15- WO 01/34848 PCT/USOO/29021 92S GTIGARYTITTYACITAYATG 2808-2828 3 VELFTYM 93A ACIYCICCIGTRGGIGGIGTRCA 2859-2879 4 CTPTG(Q/R/E)V In Table 2, column labeled "Primer," "A" indicates an antisense or antigenome polarity primer, and "S" indicates a sense or genome polarity 5 primer. In the column labeled "sequence," Y = C or T; R = A or G; I = insosine; K = G or T. In the column labeled "Position," the numbered position is relative to 7423-MS-87 (Brown and Pallansch et al., 1995). Generally, these primers are intended to be used in primer sets for the identification of EV71. For example, primers 159S and 162A are preferably 10 used together as a primer set in an amplification reaction to specifically identify EV71. Likewise, primers 92S and 93A are preferably used together as a primer set in an amplification reaction to specifically identify EV71. These pairs of primers are degenerate primer sets that can be used to distinguish between EV71 and CA16. 15 The consensus nucleotide sequence set forth in SEQ ID NO:3 for primer 92S denote the sixteen possible combinations (species) of nucleotides that are found in SEQ ID NOS:54-69, as set forth below: SEQ ID NO:54 5'-GTI GAA CTI TTC ACI TAC ATG SEQ ID NO:55 5'-GTI GAA CTI TTC ACI TAT ATG 20 SEQ ID NO:56 5'-GTI GAA CTI TTT ACI TAT ATG SEQ ID NO:57 5'-GTI GAA CTI TTT ACI TAC ATG SEQ ID NO:58 5'-GTI GAA TTI TTT ACl TAT ATG SEQ ID NO:59 5'-GTI GAA TTI TTC ACI TAT ATG SEQ ID NO.60 5'-GTI GAA TTI TTC ACI TAC ATG 25 SEQ ID NO:61 5'-GTI GAA TTI TTT ACl TAC ATG SEQ ID NO:62 5'-GTI GAG CTI TTC ACI TAC ATG SEQ ID NO:63 5'-GTI GAG CTI TTC ACl TAT ATG SEQ ID NO:64 5'-GTI GAG CTI TTT ACI TAT ATG SEQ ID NO:65 5'-GTI GAG CTI TTT ACI TAC ATG 30 SEQ ID NO:66 5'-GTI GAG TTI TTT ACI TAT ATG SEQ ID NO:67 5'-GTI GAG TTI TTC ACI TAT ATG SEQ ID NO:68 5'-GTI GAG TTI TTC ACI TAC ATG SEQ ID NO:69 5'-GTI GAG TTI TTT ACI TAC ATG -16- WO 01/34848 PCT/USOO/29021 The consensus nucleotide sequence set forth in SEQ ID NO:4 for primer 93A denotes the eight possible combinations (species) of nucleotides that are found in SEQ ID NOS:70-77, as set forth below: SEQ ID NO:70 5-ACI CCI CCI GTA GGI GGI GTA CA 5 SEQ ID NO:71 5'-ACI CCI CCI GTA GGI GGI GTG CA SEQ ID NO:72 5-ACI CCI CCI GTG GGI GGI GTG CA SEQ ID NO:73 5-ACI CCI CCI GTG GGI OGI GTA CA SEQ ID NO:74 5-ACl TO! CCI GTA GGI OGI GTA CA SEQ ID NO:75 5'-ACI TCI CCI GTA GGI GGI GTG CA 10 SEQ ID NO:76 5'-ACI TCI CCI GTG GGI GGI GTG CA SEQ ID NO:77 5'-ACl TCI CCI GTG GGI GGI GTA CA In order to compensate for the high level of degeneracy of EV71 genomic nucleotide sequences which encode the VP1 and VP3 proteins, degenerate codon positions on the EV71 genome template were matched by 15 mixed bases (i.e., more than one base used at a particular nucleotide position) or by deoxyinosine residues on the polymerase chain reaction primers. This was done even though some investigators have reported unsatisfactory losses in polymerase chain reaction sensitivity and diagnostic specificity when using degenerate primers. Because deoxyinosine residues 20 can pair with all four of the nucleotide bases, deoxyinosine residues were used in those positions where 3 or 4 different nucleotides were possible. The use of deoxyinosine residues in primers is discussed in F. Martin et al., "Base Pairing involving Deoxyinosine: Implications from Probe Design," Nucleic Acids Res., 13, 8927-8938 (1985), in M. Batzer et al., "Enhanced Evolutionary 25 PCR using Oligonucleotides with Inosine at the 3-Terminus," Nucleic Acids. Res., 19, 5081 (1991); in S. Case-Green, "Studies on the Base Pairing Properties of Deoxyinosine by Solid Phase Hybridisation to Oligonucleotides," Nucleic Acids Res., 22(2), 131-136 (1994); and in E. Ohtsuka et al., "An Alternative Approach to Deoxyoligonucleotides as Hybridization Probes by 30 Insertion of Deoxyinosine at Ambiguous Codon Positions," J. Biol. Chem., 260, 2605-2608 (1985). Deoxyinosine residues were incorporated into the polymerase chain -17- WO 01/34848 PCT/USOO/29021 reaction primers to match all template positions having a possible fourfold degeneracy. Other template positions with twofold degeneracy were complemented by twofold mixed residues. The positions of the primer nucleotide sequences in which either mixed bases or deoxyinosine residues 5 were used are shown in the nucleotide sequences set forth hereinabove, and in the Sequence Listing, for primers 159S (SEQ ID NO:1), 162A (SEQ ID NO:2), 92S (SEQ ID NO:3), and 93A (SEQ ID NO:4). Table 2 indicates the amino acid residues which are encoded by the nucleotide sequence recognized by each of these primers. 10 As is described in more detail in the Examples, the oligonucleotide primers used for RT-PCR and sequencing of EV71 nucleic acid described above were used to determine the nucleotide sequence of the VP1 region of 113 EV71 strains. Using the EV71 serotype-specific primer pairs, all strains of EV71 tested were detected, whereas all CA16 stains tested were not 15 detected. One of ordinary skill in the art can use the teachings of this invention to devise other primers that can be used to amplify and sequence target EV71 nucleic acids. The current invention teaches that primers constructed to hybridize in the VP1 gene region of EV71 can be successfully used to amplify 20 and sequence this region in a given EV71 isolate. Furthermore, the current invention facilitates the construction of other primers for amplifying EV71 target nucleic acids by providing fourteen examples of nucleotide sequences that are effective for this amplification. Finally, the current invention facilitates the construction of other primers for amplifying target nucleic acids in the 25 EV71 genome by providing the sequence of the VP1 gene for 113 strains of EV71 (available in GenBank sequence database, accession numbers AF009522 to AF009559 and AF135867 to AF135949, AF135911, AF135935, and AF135941 to AF135950). Therefore, primers can be constructed from highly conserved nucleotides across many strains of EV71 that will amplify 30 EV71 target nucleic acids from many strains of EV71. Not only do the teachings of the current invention facilitate the construction of primers for amplifying EV71 target nucleic acids, these teachings facilitate the construction of primers which selectively amplify EV71 -18- WO 01/34848 PCT/USOO/29021 target nucleic acids and not those of other enteroviruses, such as CA16. For example, by comparing the nucleotide sequences of the VP1 gene across the 113 strains of EV71 to other nucleotide sequences of other enteroviruses, such as CA16, primers can be constructed which selectively hybridize to 5 EV71 target nucleic acids. Alternatively, amino acid sequence comparisons can be used to construct primers that selectively amplify EV71 target nucleic acids based on nucleotide coding sequences for these amino acid sequences. In fact, Example 2 of this invention exemplifies the use of amino acid information to construct EV71-specific primers. Computer programs that 10 facilitate such nucleotide sequence comparisons across strains and species are readily available and well known to those of ordinary skill in the art. Specific nucleic acids within the scope of the invention include, but are not limited to, the nucleic acids described herein. Contemplated equivalents of the nucleic acids described herein include nucleic acids which otherwise 15 correspond thereto, and which have the same general properties thereof, wherein one or more simple variations are made which do not adversely affect the function of the nucleic acids as described herein. Modified Nucleic Acids Other examples of the nucleic acids of the present invention include 20 DNA molecules which are substantially the same as the nucleic acids having the nucleotide sequences set forth below, and in the Sequence Listing as SEQ ID NOS:1-77. Modifications to the nucleic acids set forth as SEQ ID NOS:1-77 (e.g., one or more nucleotide substitutions, additions, and/or deletions, or the 25 addition of some beneficial component to the nucleic acids, such as a radiolabel or non-radiolabel for nucleic acid detection or immobilization) can be made so long as they do not prevent these nucleic acids from annealing to cDNAs prepared from the conserved target EV71 sequences from which they were derived. For the oligonucleotide primers used for RT-PCR and 30 sequencing of EV71 nucleic acid described above, such modified nucleic acids are within the scope of the present invention if they have the ability to function as primers in amplification or sequencing reactions for EV71 nucleic -19- WO 01/34848 PCT/USOO/29021 acids. For the EV71 serotype-specific primer pairs described above, such modified nucleic acids are within the scope of the present invention if they have the ability, when used with a second EV71 serotype-specific primer, to detect EV71, but not CA16. 5 Computer programs are readily available to the skilled artisan which can be used to compare modified nucleotide sequences to nucleotide sequences of many strains of EV71 and CA16 to select the most appropriate sequences for priming amplification. The specificity of these sequences for EV71 and sensitivity of the sequences for various strains of EV71 can be 10 determined by conducting a computerized comparison with known sequences. Preferably these sequences are catalogued in GENBANK, a computerized database, and the search is performed using the FASTA tool of the Genetics Computer Group (Madison, WI), which facilitates searching the catalogued nucleotide sequences for similarities to the nucleic acid in 15 question. The modified nucleic acids of the invention have at least 85% homology (and preferably at least 90%, 95%, 97%, 98%, or 99% homology) with the nucleotide sequences set forth in the Sequence Listing as SEQ ID NOS:1-77, or at least 85% complementarity (and preferably at least 90%, 20 95%, 97%, 98%, or 99% complementarity) with the nucleic acid sequences to which nucleic acids having the nucleotide sequence set forth in the Sequence Listing as SEQ ID NOS:1-77 hybridize. The nucleic acids of the present invention can be used as primers in amplification reactions to detect EV71 or as primers in reverse transcription of 25 viral RNA from EV71 isolates. These oligonucleotides are typically between about 10 and about 100 nucleotides in length, preferably between about 12 and about 30 nucleotides in length, and most preferably between about 15 and about 25 nucleotides in length. An optimal length for a particular application is readily determined in the manner described in H. Erlich, PCR 30 Technology, Principles and Application for DNA Amplification, (1989). Several computer software programs are available to facilitate primer design, for example, T. Lowe, "Computer Program for Selection of Oligonucleotide Primers for Polymerase Chain Reactions," Nucl. Acids. Res., 18:1757-1761 -20- WO 01/34848 PCT/USOO/29021 (1991) and RT-PCR, Methods and Applications Book 1, (Clontech Laboratories, Inc. (1991)). If used as primers in an amplification reaction, at least two nucleic acids of the invention which hybridize with different regions of nucleic acid 5 present in EV71 should be employed, so as to amplify a desired region. These two nucleic acids should hybridize to opposite strands of the EV71 DNA in reverse orientation such that they direct extension toward each other. Nucleic acids present in EV71 can, thus, be detected with the nucleic acids of the present invention utilizing a nucleic acid amplification technique, such as 10 reverse transcription/polymerase chain reaction as taught in the Examples described hereinbelow. Where the detection method employed uses a nucleic acid amplification technique, EV71 polymerase chain reaction primers which hybridize to EV71 nucleic acids are utilized. The presence of an amplification 15 product having a size which is characteristic for EV71 after the performance of the amplification technique, such as a reverse transcription/polymerase chain reaction, indicates the presence in the sample of EV71. The lack of a detectable amplification product after the performance of the amplification technique indicates that EV71 is not present in the sample. Amplification 20 products may be separated, for example, by electrophoresis on polyacrylamide or agarose gels, and visualized with ethidium bromide staining. As is described in the Examples, the degenerateEV71 polymerase chain reaction primers of the present invention can be utilized in polymerase 25 chain reactions in the combinations of nucleotide sequences set forth in the Sequence Listing as SEQ ID NOS:14-17 (for Primer 159S); SEQ ID NOS:18 33 (for Primer 162A); SEQ ID NOS:34-37 (for Primer 161); SEQ ID NOS:38 45 (for Primer 163); SEQ ID NOS:46-49 (for Primer 169);SEQ ID NOS:50-53 (for Primer NP1A); SEQ ID NOS:54-69 (for Primer 92S); and SEQ ID 30 NOS:70-77 (for Primer 93A). It is contemplated that the nucleic acids of the present invention can be utilized in any of a number of nucleic acid detection techniques including, but not limited to, reverse transcription/polymerase chain reaction, isothermal -21- WO 01/34848 PCTIUSOO/29021 DNA amplification, liquid hybridization, etc. It is also contemplated that the nucleic acids of the present invention can be labeled or tagged for use in radioactive, chemiluminescence, fluorescent, or other detection systems. In general, the nucleic acids of the present invention may be prepared and 5 tested for the ability to hybridize with an EV71 target nucleic acid in the manner described herein, or by modifications thereof, using readily-available starting materials, reagents, and equipment. However, a preferred method for preparing and testing these nucleic acids is described hereinbelow in the Examples. 10 Amplification and Hybridization In another aspect, the present invention provides a method for detecting the presence or absence of EV71 in a sample suspected of containing nucleic acids of enterovirus 71, said method comprising: (a) providing, in combination, (1) a primer pair comprising a first primer 15 that hybridizes to nucleic acids of enterovirus 71 and a second primer that hybridizes to nucleic acids of enterovirus 71, and (2) an amplification method reaction mixture; (b) amplifying nucleic acids from the sample suspected of containing nucleic acids of enterovirus 71 using the primer pair and amplification method 20 reaction mixture; and (c) determining the presence or absence of an amplification product having a size which is characteristic of enterovirus 71, thereby determining the presence or absence of enterovirus 71 in the sample. In a preferred embodiment, the second primer selectively hybridizes to 25 nucleic acids of enterovirus 71. In a further preferred embodiment, the first primer and the second primer recognize target sequences in an enterovirus 71 region selected from the group consisting of VP1 and VP3, preferably the second primer recognizes a target sequence in the VP1 region of enterovirus 71. One of ordinary skill in the art, preferably with the aid of a computer 30 program, could use the teachings of this disclosure to devise primers that hybridize to the VP1 or the VP3 genes of all known strains of EV71. Furthermore, one of ordinary skill could use this disclosure to construct -22- WO 01/34848 PCT/US00/29021 primers that hybridize to EV71 and not to CA16. Preferably, these primers that hybridize to EV71 but not CA16, hybridize to a portion of the VP1 gene of EV71. In a specific embodiment of this preferred embodiment, the first primer 5 is a purified nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1, or a nucleic acid that is substantially the same as the purified nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1; and the second primer is a purified nucleic acid comprising the nucleotide sequence set forth in the 10 Sequence Listing as SEQ ID NO:2, or a nucleic acid that is substantially the same as the purified nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:2. In another specific embodiment of this preferred embodiment the first primer is a purified nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as 15 SEQ ID NO:3, or a nucleic acid that is substantially the same as the purified nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:3; and the second primer is a purified nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:4, or a nucleic acid that is substantially the same as the purified nucleic 20 acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:4. A number of amplification methods are known in the art that could successfully employ the nucleic acid primers of the current invention to amplify EV71 nucleic acids. Preferably, the amplification method is a reverse 25 transcription/polymerase chain reaction. The polymerase chain reaction (for amplifying DNA) and the reverse transcription polymerase chain reaction (for amplifying cDNA generated from RNA, as would be used in amplification reactions performed with an RNA virus) are rapid methods for increasing the copy number of, and sensitively detecting, specific nucleic acid sequences. 30 These methods may be used for the rapid detection of viruses from clinical samples, such as feces, nasal wash, rectal swab, cerebrospinal fluid, throat swab, lung biopsy tissue, and like materials. These specimens may be collected by methods known in the art, such as by the methods described in -23- WO 01/34848 PCT/USOO/29021 T. Chonmaitree et al., "Comparison of Cell Cultures for Rapid Isolation of Enteroviruses," J. Clin. Microbiol., 26:2576-2580 (1988), and in C. Hall, "Clinically Useful Method for the Isolation of Respiratory Syncytial Virus," J. Infect. Dis., 131:1-5 (1975). 5 The nucleic acids present in a sample which are being amplified may be single- or double-stranded DNA or RNA. If the starting material is RNA, such as in EV71, reverse transcriptase is used to prepare a first strand cDNA prior to conventional polymerase chain reaction. General information concerning polymerase chain reaction, and the 10 amplification of specific sequences of nucleic acids, is present in U.S. Patent No. 4,683,195; U.S. Patent No. 4,683,202; U.S. Patent No. 4,965,188; U.S. Patent No. 5,578,467; U.S. Patent No. 5,545,522; U.S. Patent No. 5,624,833; F. M. Ausubel et al., "Current Protocols in Molecular Biology," Greene Publishing Associates and Wiley-Interscience, (John Wiley and Sons, New 15 York (1987; updated quarterly)); H. Rotbart, "Enzymatic RNA Amplification of the Enteroviruses," J. Clin. Microbiol., 28:438-442 (1990); E. Kawasaki, "Amplification of RNA," 21-27, in M. Innis et al., PCR Protocols (Academic Press, New York (1990)); and Rossolini et al., "Use of Deoxyinosine Containing Primers vs. Degenerate Primers for Polymerase Chain Reaction 20 Based on Ambiguous Sequence Information," Mol. Cell Probes, 8:91-98 (1994). The amplification of cDNA generated from RNA using a reverse transcription/polymerase chain reaction is described in U.S. Patent No. 5,310,652 and U.S. Patent No. 5,322,770. Commercial vendors, such as Perkin Elmer (Norwalk, Connecticut), 25 market polymerase chain reaction reagents and publish polymerase chain reaction protocols. In each cycle of an amplification reaction, a double-stranded target nucleic acid sequence present in a sample is denatured and, due to the presence of a large molar excess of the primers, primers are annealed to 30 each strand of the denatured target sequence. The primers, oriented with their 3' ends pointing towards each other, hybridize to opposite strands of the target sequence and, due to the action of DNA polymerase, prime enzymatic extension along the nucleic acid template in the presence of the four -24- WO 01/34848 PCT/USOO/29021 deoxyribonucleotide triphosphates. The two primers anneal to opposite ends of the target nucleic acid sequence, and in orientations such that the extension product of each primer is a complementary copy of the target nucleic acid sequence and, when separated from its complement, can 5 hybridize to the other primer. The end product is then denatured again for another cycle. After this three-step cycle has been repeated between about 25 and about 40 times, preferably about 30 times, amplification of a nucleic acid segment by more than one million-fold can be achieved. Each cycle, if 100% efficient, would result in a doubling of the number of target sequences 10 present, thereby leading to exponential increases in the concentration of desired nucleic acid sequences. The primers of the present invention are complementary to a cDNA generated by reverse transcription of an EV71 nucleotide sequence. Denaturation of nucleic acid strands usually takes place at about 94C. 15 The normal annealing (about 55 to about 60"C) and extension (about 65 to about 72=C) temperatures generally used for in vitro amplification by reverse transcription/polymerase chain reaction are generally unsuitable for use with the degenerate primers of the present invention because the presence of deoxyinosine residues results in low annealing temperatures with many 20 poliovirus cDNA templates. The optimal annealing temperature was determined to be approximately 42=C, near the temperature optimum for avian myeloblastosis virus reverse transcriptase. Annealing temperatures above about 463C or below about 38=C generally reduce the yield of the specific amplicon, and increase the generation of nonspecific amplification 25 products. Thus, the annealing temperature which may be employed with the primers and methods of the present invention ranges from about 38=C to about 46=C, and is preferably about 420C. The extension temperature was decreased to 60CC, which is still within the range for high Taq polymerase activity, in order to minimize dissociation of the primers from the templates. 30 The extension temperature which may be employed with the primers and methods of the present invention ranges from about 56CC to about 640C, and is preferably about 60"C. When these preferred annealing and extension conditions were used in the Examples described hereinbelow, sequences of -25- WO 01/34848 PCT/USOO/29021 all EV71 cDNA templates tested were efficiently amplified. Examples of suitable reaction times are from about 15 seconds to about 1 minute denaturing, preferably about 45 seconds; from about 30 seconds to about 1.5 minutes of annealing, preferably about 45 seconds; and from about 30 5 seconds to about 1.5 minutes of extension, preferably about 1 minute. Of course, as those skilled in the art realize, modification of both temperature and duration of each portion of the annealing and extension cycles, as well as the minutes of total cycles, can be varied. Suitable assay formats for detecting amplification products or hybrids 10 formed between probes and target nucleic acid sequences in a sample are generally well known and are described, for example, in F. M. Ausubel et al., 1987: Sambrook et al., Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1985). Examples of these assay formats include dot-blot and reverse dot-blot assay formats. In a dot 15 blot format, amplified target DNA is immobilized on a solid support, such as a nylon membrane. The membrane-target complex is incubated with labeled probe under suitable hybridization conditions, unhybridized probe is removed by washing under suitable conditions, and the membrane is monitored for the presence of bound probe. An alternate format is a "reverse" dot-blot format, 20 in which the amplified target DNA is labeled and the probes are immobilized on a solid support, such as a nylon membrane. The target DNA is typically labeled during amplification by the incorporation of labeled primers therein. One or both of the primers can be labeled. The membrane-probe complex is incubated with the labeled amplified target DNA under suitable hybridization 25 conditions, unhybridized target DNA is removed by washing under suitably stringent conditions, and the filter is then monitored for the presence of bound target DNA. Conventional techniques of molecular biology and nucleic acid chemistry which may be employed in the preparative and testing processes of 30 the present invention are fully explained in the literature. See, for example, F. M. Ausubel et al., 1987; Sambrook et al., Molecular Cloninq-A Laboratory Manual, supra.; J. Watson et al., Molecular Biology of the Gene (Fourth Edition, The Benjamin/Cummings Publishing Company, Inc. 1987); -26- WO 01/34848 PCTUSOO/29021 Oligonucleotide Synthesis (M. J. Gait, ed., 1984): and Nucleic Acid Hybridization (B. D. Hames and S. J. Higgins. eds., 1984). Kits The present invention also provides a kit for detecting enterovirus 71 5 by nucleic acid amplification comprising one the primer pairs described hereinabove. Preferably, the kit will contain one (or more) of the primer pairs specifically described in the Example 2, and instructions describing the use of these primer pairs in the detection of enterovirus 71. If desired. the kit may also include, for example, suitable buffers, PCR enzymes, standards, and the 10 like. The following Examples are intended to describe and illustrate the methods for the preparation of primers within the present invention, the methods for using these primers in reverse transcription/polymerase chain reactions to amplify EV71 nucleic acids and to rapidly and accurately detect 15 EV71 in a sample, while not detecting CA16. The Examples are intended to be merely illustrative of the present invention. and not limiting thereof in either scope of spirit. Those of skill in the art will readily understand that variations of the conditions and processes of the procedures described in the Examples can be used to prepare and test these primers. 20 Unless otherwise stated, all percentages are by weight. All references cited in the present specification are hereby incorporated by reference. EXAMPLE I MOLECULAR EPIDEMIOLOGY AND EVOLUTION OF ENTEROVIRUS 71 STRAINS ISOLATED FROM 1970-1998 25 Viruses Analyzed The 113 EV71 strains examined in this study are listed in Table 3, with year and state or country of isolation, and, if known, associated clinical symptoms ("NA" indicates unknown or not reported). The strains were isolated between 1970 and 1998 at the Centers for Disease Control and 30 Prevention (CDC), Atlanta, Georgia, from 25 different laboratories of state health departments in the United States, and from 5 national enterovirus -27- WO 01/34848 PCT/USOO/29021 laboratories in other countries. Viruses were isolated from original clinical specimens by using a variety of cell lines and further propagated in rhabdomyosarcoma cells prior to sequencing. Most isolates were typed by neutralization assay with monospecific rabbit anti-EV71 antiserum. 5 Table 3. Code in Figure 1 j Year 1 Location Disease | Accession No. BrCr-CA-70 1970 California Encephalitis U22521 2228-NY-72 1972 New York NA AF135867 2604-AUS-74 1974 Australia Meningitis AF135883 10 2605-AUS-74 1974 Australia Meningitis AF135884 2608-AUS-74 1974 Australia Meningitis AF135885 2609-AUS-74 1974 Australia Meningitis AF135886 2610-AUS-74 1974 Australia NA AF135887 2229-NY-76 1976 New York NA AF135868 15 2230-NY-76 1976 New York NA AF135869 2231-NY-77 1977 New York NA AF135870 2232-NY-77 1977 New York NA AF135871 2234-NY-77 1977 New York NA AF135872 2235-NY-77 1977 New York NA AF135873 20 2236-NY-77 1977 New York NA AF135874 2237-NY-77 1977 New York NA AF135875 2238-NY-77 1977 New York NA AF135876 2239-NY-77 1977 New York NA AF135877 10181-NM-78 1978 New Mexico NA AF138675 25 1011-ND-79 1979 North Dakota NA AF135864 2241-NY-79 1979 New York NA AF135878 2243-NY-79 1979 New York NA AF135879 2258-CA-79 1979 California Tremor AF135880 2114-TN-80 1980 Tennessee NA AF135866 30 2952-SD-81 1981 South Dakota NA AF135888 3663-MA-82 1982 Massachusetts NA AF135889 3885-UT-82 1982 Utah NA AF135891 3874-ND-82 1982 North Dakota NA AF135890 3982-OH-82 1982 Ohio Rash AF135892 35 3984-OH-82 1982 Ohio NA AF009538 2259-CA-82 1982 California Diarrhea AF135881 -28- WO 01/34848 PCT/USOO/29021 Code in Figure 1 [Year | Location Disease ] Accession No. 4224-MA-82 1982 Massachusetts Encephalitis AF135893 4323-UT-83 1983 Utah NA AF135894 4599-OR-83 1983 Oregon CNS disorder AF135895 4644-AR-83 1983 Arkansas NA AF135896 5 4826-CT-83 1983 Connecticut NA AF135897 4827-CT-83 1983 Connecticut NA AF009529 5115-TX-83 1983 Texas NA AF135898 0667-CHN-85 1986 China HFM AF135934 2260-CA-86 1986 California Fever AF135882 10 2623-AUS-86 1986 Australia HFM AF135945 6762-OK-86 1986 Oklahoma NA AF135900 1410-CA-86 1986 California Paralysis AF009525 0915-MA-87 1987 California Meningitis AF009549 0916-MA-87 1987 Massachusetts NA AF009550 15 1061-TN-87 1987 Tennessee NA AF009528 1413-CA-87 1987 California Paralysis AF009527 2219-IA-87 1987 Iowa Meningitis AF009539 2246-NY-87 1987 NewYork Paralysis AF009542 6910-OK-87 1987 Oklahoma Rash AF135901 20 7234-AK-87 1987 Alaska Paralysis AF009522 7235-AK-87 1987 Alaska Respiratory AF135902 7237-AK-87 1987 Alaska Diarrhea AF135951 7238-AK-87 1987 Alaska Rash AF135952 7289-NC-87 1987 North Carolina NA AF135903 25 7298-AK-87 1987 Alaska Fatal AF135904 7423-MS-87 1987 Mississippi Paralysis U22522 7628-PA-87 1987 Pennsylvania Paralysis AF009530 7629-PA-87 1987 Pennsylvania Gastroenteritis AF009531 7630-PA-87 1987 Pennsylvania Gastroenteritis AF009532 30 7631-PA-87 1987 Pennsylvania Gastroenteritis AF009533 7632-PA-87 1987 Pennsylvania Gastroenteritis AF135905 7633-PA-87 1987 Pennsylvania Gastroenteritis AF009534 7635-WA-87 1987 Washington Meningitis AF135906 7673-CT-87 1987 Connecticut NA AF009535 35 7962-PA-87 1987 Pennsylvania Paralysis AF009523 7968-PA-87 1987 Pennsylvania NA AF009524 8102-WA-87 1987 Washington Meningitis AF009526 -29- WO 01/34848 PCT/USOO/29021 Code in Figure 1 1 Year Location Disease Accession No._I 8209-MD-87 1987 Maryland NA AF009536 8279-PA-87 1987 Pennsylvania NA AF009537 2222-IA-88 1988 Iowa Fever AF009540 8149-AL-88 1988 Alabama NA AF135907 5 8495-VA-88 1988 Virginia NA AF135953 9166-TX-89 1989 Texas NA AF135954 9243-OK-89 1989 Oklahoma NA AF135955 9323-TX-89 1989 Texas NA AF135956 9541-TX-89 1989 Texas NA AF009557 10 9718-TX-89 1989 Texas NA AF135957 9837-WA-89 1989 Washington NA AF135958 9873-NM-89 1989 New Mexico NA AF135959 9978-TX-89 1989 Texas Rash AF009558 0359-TX-90 1990 Texas NA AF135931 15 0390-TX-90 1990 Texas Otitis media AF135932 1411-CA-90 1990 California NA AF009551 0443-TX-90 1990 Texas NA AF135933 0925-OR-91 1991 Oregon Tremors AF009547 0926-OR-91 1991 Oregon NA AF009548 20 2261-CA-91 1991 California Meningitis AF135938 2583-CAN-91 1991 Quebec. Canada NA AF135944 2262-CA-92 1992 California Meningitis AF135939 2251-NY-93 1993 New York NA AF009543 1873-CT-94 1994 Connecticut Fatal AF009559 25 1919-NM-94 1994 New Mexico Rash AF009552 1924-AZ-94 1994 Arizona NA AF009553 1997-NC-94 1994 North Carolina NA AF135936 2006-CT-94 1994 Connecticut Rash AF009554 2007-CT-94 1994 Connecticut NA AF009555 30 2253-NY-94 1994 New York NA AF009544 2254-NY-94 1994 New York NA AF009545 2263-CA-94 1994 California Paralysis AF135940 2264-CA-94 1994 California Meningitis AF009546 6658-COL-94 1994 Colombia Paralysis AF135899 35 2037-MD-95 1995 Maryland NA AF009556 2132-VA-95 1995 Virginia NA AF135937 2640-AUS-95 1995 Australia NA AF135946 -30- WO 01/34848 PCT/USOO/29021 Code in Figure 1 1Year ILocation IDisease Accession N. 2641-AUS-95 1995 Australia HFM AF135947 2642-AUS-95 1995 Australia Encephalitis AF135948 2644-AUS-95 1995 Australia NA AF135949 0731-MAA-97 1997 Malaysia Fatal AF135911 5 0756-MAA-97 1997 Peninsular NA AF135935 2286-TX-97 1997 Texas NA AF135941 2355-OK-97 1997 Oklahoma NA AF135942 2381-MA-97 1997 Massachusetts Fatal AF135943 2814-MO-98 1998 Missouri Meningitis AF135950 10 Oligonucleotide Synthesis Synthetic oligonucleotide degenerate primers used to amplify nucleic acid present in enterovirus 71 by reverse polymerase/transcription chain reactions, and having the nucleotide sequences set forth hereinabove in Table 2, and in the corresponding sequences in the Sequence Listing, were 15 prepared by the 0-cyanoethyl phosphoramidite method using an automated synthesizer (Model 380A, Applied Biosystems, Foster City, CA), as described by Sinha et al., "Polymer Support Oligonucleotide Synthesis XVIII; Use of p cyanoethyl-N,N-dialkylamino-N-morpholino phosphoramidite of Deoxynucleosides for the Synthesis of DNA fragments Simplifying 20 Deprotection and Isolation of the Final Product, "Nucleic Acids Research, 12, 4539-4557 (1984). Reverse Transcription/Polymerase Chain Reaction Viral RNA was extracted from 200 pl of cell culture supernatant using UltraSpec III (Biotecx, Houston, Tx.) and resuspended in 20 pl of water or 25 with the Qiamp Viral RNA kit (Qiagen Inc.,Valencia, Calif.). The primers used for reverse transcription-polymerase chain reaction (RT-PCR) and sequencing are listed in Table 2. The following were effective primer pairs for amplification and sequencing: 159S/162A; 159S/204A; 161S/NP1A; 169S/NP1A; 163S/ 174A; 172S/174A; and 197S/198A. The VP1 gene was 30 amplified as a series of overlapping fragments in a one-tube RT-PCR reaction containing 2 pl of RNA, 20 pmol of each primer, 100 mM each dNTP, 2 mM -31- WO 01/34848 PCT/USOO/29021 MgCl 2 , 67 mM Tris-HCI (pH 8.8), 17 mM (NH 4

)

2

SO

4 , 1 mM -mercaptoethanol, 0.2 mg/ml gelatin, 10 U placental RNase inhibitor (Boehringer Mannheim Biochemicals, Indianapolis, Ind.), 12 U AMV reverse transcriptase (Boehringer Mannheim), and 5 U Taq polymerase (Boehringer Mannheim), in 5 a total volume of 50 pl. The amounts of primer used in each reaction depends on the number of species of that primer. Generally, 5 pmoles per species were used in each reaction. VP1-specific cDNA was synthesized by incubation of the reaction mixture for 30 min at 420C and 3 min at 940C, and amplified by 30 cycles of 94*C for 45 sec, 42"C for 45 sec, and 680C for 1 10 min. DNA fragments used for sequencing were gel-purified by using the QlAquick gel extraction kit (Qiagen). Cycle sequencing was performed with the Prism Ready Reaction Dyedeoxy Terminator Cycle Sequencing kit (Perkin-Elmer Corporation-Applied Biosystems, Foster City, Calif.). All sequences were determined on both strands. 15 Sequence analysis The assembled complete VP1 sequences were compared with one another using the GAP and PILEUP programs. Genetics Computer Group, Program Manual for the GCG Package version 9.0" (1996) (Genetics Computer Group, Madison, Wis). Phylogenetic trees were constructed by the 20 neighbor-joining method using PHYLIP 3.57. Felsenstein, J., "PHYLIP phylogeny inference package," (version 3.5), Cladistics, 5:164-166 (1989). Branch lengths were determined by the maximum likelihood method implemented in Puzzle (Strimmer, K., and A. V. Haeseler, "Quartet puzzling: a quartet maximum likelihood method for reconstructing tree topologies," Mol. 25 Biol. Evol., 13:964-969 (1996)). The reliability of the neighbor-joining tree was estimated by bootstrap analysis with 1000 pseudo-replicate data sets. Previously sequenced EV71 strains BrCr-CA-70 and 7423-MS-87 were also included in the analyses. The VP1 sequence of the CA16 prototype strain, G 10 (Poyry, T. et al., 1994), was included in the phylogenetic analysis as an 30 outgroup. The nucleotide sequence data generated in this analysis have been deposited in the GenBank sequence data base, accession numbers -32- WO 01/34848 PCT/USOO/29021 AF009522 to AF009559 and AF135867 to AF135949, AF135911, AF135935, and AF135941 to AF135950. Estimation of genetic distance and evolutionary rate Because of the lack of a true "founder" strain and the apparent 5 presence of multiple lineages, sequences were selected based on their relationships, as depicted in Figure 1, in order to estimate evolutionary rate. Genetic distances were calculated by pairwise comparison using the Kimura 2-parameter method of the Distances program (Genetics Computer Group, "Program Manual for the GCG Package version 9.0" (1996)), using the oldest 10 strain in each set as a reference. Two separate analyses were performed, one using all three positions (representative of both synonymous and nonsynonymous substitutions) and a second analysis using only synonymous substitutions. The evolutionary rate was calculated by linear regression of genetic distance from the earliest isolate versus year of isolation. The 15 synonymous substitution rate (Ks) was calculated from the number of nucleotide substitutions per synonymous site by using the computer program Diverge (Genetics Computer Group, "Program Manual for the GCG Package version 9.0" (1996)) based on a method of Li, W. H. et al. "A new method for estimating synonymous and nonsynonymous rates of nucleotide substitution 20 considering the relative likelihood of nucleotide and codon changes," Mol. Biol. Evol., 2:150-174 (1985). (The nonsynonymous rates [Ka], the number of nonsynonymous substitutions per nonsynonymous sites, were less than 3 x 10' and were not included in the data). Results 25 The complete VP1 gene sequences (891 nucleotides) were determined for 113 EV71 strains isolated in the United States, Australia, Colombia, China, Canada, and Malaysia from 1970 to 1998. A phylogenetic tree constructed by the neighbor-joining method indicated that EV71 strains were monophyletic with respect to other enterovirus serotypes (Figure 1). 30 The strains clustered in three distinct lineages (genotypes), designated A, B, and C. Genotype A contained a single member, BrCr-CA-70, the EV71 -33- WO 01/34848 PCT/USOO/29021 prototype, and differed from all other isolates by 16.5% to 19.7 %. Genotype B was represented by 65 strains isolated from 1972 to 1997 in the United States, Australia, Colombia, and Malaysia (Sarawak, island of Borneo). Genotype C, represented by 47 strains isolated from 1986 to 1998, included 5 viruses from the United States, Australia, China, Canada, and Malaysia (mainland). Genotypes B and C were further subdivided into clusters within each genotype, two for genotype B (Figure 1 B) and two for genotype C (Figure 1 C). Cluster B1 contained isolates from the United States and Australia during the 10 1970s, as well as a few U.S. isolates from the 1980s (2114-TN-80, 5115-TX 83, 6762-OK-86, and 6910-OK-87). Strains in cluster B1 were more diverse than the B1 strains, differing by up to 8.3% within the cluster and by 6.9% to 11 .1% from other genotype B strains. Cluster B2 contained strains isolated in the U.S. from 1981 to 1987, including most isolates from the 1987 nationwide 15 EV71 outbreak. Strain 6658-COL-94 was genetically distinct from all other genotype B strains (5.8% to 11. 1 % difference), but differed from strains of genotype C by 15.5% to 17.2%. Strain 0731-MAA-97, a typical representative of many Sarawak, Malaysia strains, was also distinct from other genotype B strains by 6.5% to 10.5% and differed from genotype C strains by 17.1% to 20 18.3%. The earliest genotype C strains in our collection were isolated in China in 1985 and Australia in 1986 (Figure 1C). Genotype C isolates differed from those of genotype B by 15.5% to 18.7%. Cluster C1 was composed of isolates from the United States and Australia from 1986 to 1995, as well as a 1997 isolate from peninsular Malaysia. Cluster C2 was 25 composed of U.S. and Australian isolates from 1995 to 1998. A 1985 isolate from China appeared to be intermediate between clusters C1 and C2. Viruses in cluster C1 differed from one another by 1.0% to 6.3% and from those in cluster C2 by 6.1% to 10.1%, while isolates in cluster C2 differed from one another by 0.7% to 1.1%. 30 Among all the EV71 isolates, 82% of the predicted VP1 amino acid residues were invariant (Figure 2). In comparison, the VP1 amino acids of Echovirus 30 isolates are at least 88% identical. The EV71 prototype strain, BrCr-CA-70 (genotype A) was 94.2% to 96.0% identical in VP1 amino acid -34- WO 01/34848 PCT/USOO/29021 sequence to all other EV71 isolates. Genotype B isolates were at least 97.9% identical to one another, whereas the genotype C isolates were 98.9% identical to one another. Residues 58, 184, 240 and 289 varied among different genotypes, but were invariant within a genotype. At four other sites 5 (residues 43, 124, 249, and 292), the predominant amino acid at the site differed between genotypes B and C (Figure 2). For the calculation of evolution rates, monophyletic clusters were identified that spanned a period of at least 10 years ( Figure 1 and Table 4). Within each cluster, one from genotype B and one from genotype C, the rate 10 was calculated by plotting the number of nucleotide changes between each strain and the oldest strain in the lineage versus the year of isolation (data not shown). Synonymous and nonsynonymous changes were plotted separately for each of the two data sets. The slope of the linear regression line fitted to the data points is the calculated rate of evolution in substitutions per 15 nucleotide per year. The overall evolutionary rates for all codon positions were 4.2 x 10^' and 3.4 and 10-3 substitutions per nucleotide per year for B and C genotypes, respectively. Approximately 93% of all substitutions in VP1 occurred in the third position, 98% of all substitutions in the third position were synonymous, consistent with the very small number of amino acid changes 20 observed among EV71 isolates. The synonymous substitution rates at the third codon position were 1.6 x 10-2 and 1.2 x 10- 2 substitutions per nucleotide per year, for the B and C genotypes, respectively (Table 4). TABLE 4. Estimation of the Nucleotide Substitution Rate in the Vp1 Region of Ev71 Substitution Rate (substitutions/year/nucleotide)a 25 Data Set Synonymous

R

2 All sites _____ sitsR2__All sites_ R_ _ _ sites; B1 1.5 x 10-2 0.74 4.2 x 10-3 0.68 C1c 1.2 x 102 0.85 3.4 x 10- 0.73 AveraC1)e 1.35 x 10 2 3.71 x 104 30 a R 2 denotes linear regression coefficient -35- WO 01/34848 PCT/USOO/29021 25 isolates, 1972 - 1987 39 isolates, 1986-1987 weighted average for sets B1 and C1 Example 2. 5 SEROTYPE-SPECIFIC IDENTIFICATION OF ENTEROVIRUS 71 BY PCR Viruses Analyzed The 124 EV71 strains examined in this study include the 113 strains listed in Table 3 and the following additional isolates, with year and state or country of isolation: OK97-2354, CA87-3105, CA88-3104, CA90- 3103, 10 MD87-9256, and TA198-2731, TA198-2732, TA198-2733, TA198-2734, TA198 2735, and TA198-2785. The 125 EV71 strains were isolated between 1970 and 1998 at the Centers for Disease Control and Prevention, Atlanta, Georgia, from 25 different laboratories of state health departments in the United States, and from 5 national enterovirus laboratories in other countries. 15 Thirty-two coxsackievirus A16 (CA16) strains tested included CA16-G10-51 (prototype), TX88-8799, PA88-8888, IL89-0255, PA89-9544, PA89-9263, PA89-9280, PA89-9281, PA89-9282, PA89-9283, TN89-9328, TN89-9330, KY89-9352, OR89-9354, OR89-9359, TX89-9538, SD89-9704, MN89-9712, WA89-9840, WA89-9838, WA89-9389, NC89-9853, PA90-9876, NM92-1450, 20 TX92-1576, TX92-1577, TN92-1603, PA94-5753, CT94-2004, CT94 2005,TX95-2147, and AZ97-2446. A panel of enterovirus prototype strains vas tested and included echoviruses 1 to 9, 11 to 21, 24 to 27, and 29 to 33; coxsackievirus Al to A6, A8 to A22, A24, and B1 to B6; Polio Sabin1, Polio Sabin2, and Polio Sabin3; and enteroviruses 68, 69,70, and 71. Viruses were 25 isolated from original clinical specimens by using various cell culture lines and further propagated in human rhabdomyosarcoma cells. Most isolates were typed by neutralization assay; all EV71 strains and six (20%) of the CA16 strains were sequenced in the VP1 gene region by dideoxy sequencing. PCR amplification and analysis of EV71 strains 30 Viral RNA was extracted from 200 pl of cell culture supernatant using by UltraSpec IlI (Biotecx) and resuspended in 20 pl of water or extracted with -36- WO 01/34848 PCT/USOO/29021 the Qiamp Viral RNA kit (Qiagen). The primers used for RT-PCR are listed in Table 2. RT-PCR amplifications were performed in a one-tube RT-PCR assay containing 2 pl of RNA, 20 pmol of each primer, 100 mM each dNTP, 2 mM MgCl 2 , 67 mM Tris-HCI (pH 8.8), 17 mM (NH 4

)

2

SO

4 , 1 mM b 5 mercaptoethanol, 0.2 mg/ml gelatin, 10 U placental RNase inhibitor (Boehringer Mannheim), 12 U AMV reverse transcriptase (Boehringer Mannheim), and 5 U Taq polymerase (Boehringer Mannheim), in a total volume of 50 pl. In the reactions using inosine-containing primers, 80 pmol of each primer was used. VP1-specific cDNA was synthesized by incubation of 10 the reaction mixture for 30 min at 42*C and 3 min at 94*C, and amplified by 30 cycles of 940C for 45 sec, 420C for 45 sec, and 60'C for 1 min. Reaction products (10 pl each) were visualized by ethidium bromide staining and UV transillumination following electrophoretic separation in 12% polyacrylamide gels for 71-bp products or in 1% agarose gels for 484-bp products. 15 Results Analysis of amino acid sequences in and around the VP1 region of EV71 and CA16 strains revealed the presence of serotype-specific sequence motifs (Figure 3). Two pairs of EV71-specific PCR primers were designed using conserved motifs at the carboxyl-terminus of VP3 and near the center 20 of VP1 (Figure 3). To account for the amino acid sequence variation within EV71 strains and for codon degeneracy, all four primers contain sites of mixed-base composition, and primers 92S and 93A contain deoxyinosine at sites of fourfold codon degeneracy. Primers 92S and 93A were directed to sequences encoding the motifs 25 VELFTYM (VP1-123 to VP1-129) and CTPTG(E/Q/R)V (VP1-140 to VP1 146), respectively (Figure 3 and Table 2). These primers produced a 71-bp amplification product from EV71 RNA templates derived from 20 geographically and temporally distinct strains (Figure 4 and Table 2). Primers 92S and 93A did not amplify RNA templates from any of 19 CA16 strains, nor 30 did they amplify templates from the prototype strains of 60 other serotypes (Table 5). -37- WO 01/34848 PCTIUSOO/29021 Table 5. Primer Pair EV71 strains tested CA16 strains tested Prototypes tested positive/total Positive/total Positive/total 159S/162A 125/125 0/31 3/61' 92S/93A 20/20 0/19 1/61" 5 a Prototypes listed in Methods; EV71 prototype provided a strong signal; two prototypes (CA3 and Echovirus 32) gave very weak positive signals with the primer pair 159S/162A. A second EV71-specific primer pair, 159S and 162A, was designed for use in sequencing and molecular epidemiology studies to provide for the 10 rapid genotyping of EV71 isolates during outbreaks. Primers 159S and 162A were directed to sequences encoding the motifs TMKLCKD (VP3-225 to VP3 232) and VACTPTG (VP1-138 to VP1-144), respectively (Figure 3 and Table 2). These primers produced a 484 bp amplification product from EV71 RNA templates derived from 125 geographically and temporally distinct strains 15 (Figure 4, Table 3, and Table 5. Primers 159S and 162A did not amplify RNA templates from any of 31 CA16 strains (Table 5). -38-

Claims (26)

1. A purified nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, or comprising a nucleotide sequence that is substantially the same as the nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.

2. A purified nucleic acid as defined in claim 1, wherein the nucleotide sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, or is substantially the same as the nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

3. A purified nucleic acid as defined in claim 2, wherein the nucleotide sequence is SEQ ID NO:1 or is substantially the same as SEQ ID NO:1.

4. A purified nucleic acid as defined in claim 2, wherein the nucleotide sequence is SEQ ID NO:2 or is substantially the same as SEQ ID NO:2.

5. A purified nucleic acid as defined in claim 2, wherein the nucleotide sequence is SEQ ID NO:3 or is substantially the same as SEQ ID NO:3.

6. A purified nucleic acid as defined in claim 2, wherein the nucleotide sequence is SEQ ID NO:4 or is substantially the same as SEQ ID NO:4.

7. A purified nucleic acid as defined in claim 1, wherein the nucleotide sequence is SEQ ID NO:5 or is substantially the same as SEQ ID NO:5. -39- WO 01/34848 PCTIUSOO/29021

8. A purified nucleic acid as defined in claim 1, wherein the nucleotide sequence is SEQ ID NO:6 or is substantially the same as SEQ ID NO:6.

9. A purified nucleic acid as defined in claim 1, wherein the nucleotide sequence is SEQ ID NO:7 or is substantially the same as SEQ ID NO:7.

10. A purified nucleic acid as defined in claim 1, wherein the nucleotide sequence is SEQ ID NO:8 or is substantially the same as SEQ ID NO:8.

11. A purified nucleic acid as defined in claim 1, wherein the nucleotide sequence is SEQ ID NO:9 or is substantially the same as SEQ ID NO:9.

12. A purified nucleic acid as defined in claim 1, wherein the nucleotide sequence is SEQ ID NO:10 or is substantially the same as SEQ ID NO:10.

13. A purified nucleic acid as defined in claim 1, wherein the nucleotide sequence is SEQ ID NO:11 or is substantially the same as SEQ ID NO:11.

14. A purified nucleic acid as defined in claim 1, wherein the nucleotide sequence is SEQ ID NO:12 or is substantially the same as SEQ ID NO: 12.

15. A method for detecting the presence or absence of enterovirus 71 in a sample suspected of containing nucleic acids from enterovirus 71, said method comprising: (a) providing: (1) a primer pair comprising a first primer that hybridizes to nucleic acids of enterovirus 71, and a second primer that hybridizes to nucleic acids of enterovirus 71; and -40- WO 01/34848 PCT/USOO/29021 (2) an amplification method reaction mixture; (b) amplifying nucleic acids from the sample using the primer pair and the amplification reaction mixture; and (c) determining the presence or absence of an amplification product having a size which is characteristic of enterovirus 71, thereby determining the presence or absence of enterovirus 71 in the sample.

16. The method of claim 15, wherein, the second primer selectively hybridizes to nucleic acids of enterovirus 71.

17. The method of claim 16, wherein the first primer and the second primer recognize target sequences in an Enterovirus 71 region selected from the group consisting of VP1 and VP3.

18. The method of claim 17, wherein the second primer recognizes a target sequence in the VP1 region of enterovirus 71.

19. The method of claim 18, wherein: the first primer is a nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1, or a nucleic acid that is substantially the same as the nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1; and the second primer is a nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:2, or a nucleic acid that is substantially the same as the nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:2.

20. The method of claim 18, wherein: the first primer is a nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:3, or a nucleic acid that is substantially the same as the nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:3; and the second primer is a nucleic acid comprising the nucleotide -41- WO 01/34848 PCTUSOO/29021 sequence set forth in the Sequence Listing as SEQ ID NO:4, or a nucleic acid that is substantially the same as the nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:4.

21. A kit for detecting enterovirus 71 by nucleic acid amplification comprising : a first nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1, or a nucleic acid that is substantially the same as the nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:1; and a second nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:2, or a nucleic acid that is substantially the same as the nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:2.

22. A kit for detecting enterovirus 71 by nucleic acid amplification comprising: a first nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:3, or a nucleic acid that is substantially the same as the nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:3; and a second nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:4, or a nucleic acid that is substantially the same as the nucleic acid comprising the nucleotide sequence set forth in the Sequence Listing as SEQ ID NO:4.

23. A purified nucleic acid comprising a nucleotide sequence that is complementary to the nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO: 11, and SEQ ID NO:12, or is substantially the same as a nucleotide sequence that is complementary to the nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID -42- WO 01/34848 PCT/USOO/29021 NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12.

24. A purified nucleic acid as defined in claim 23, wherein the nucleotide sequence is complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4, or is substantially the same as a nucleotide sequence that is complementary to a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, and SEQ ID NO:4.

25. A method for determining the nucleotide sequence of an enterovirus 71 nucleic acid, said method comprising the steps of: (a) providing in combination: a sample suspected of containing enterovirus 71 nucleic acids; a primer comprising a nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, or comprising a nucleotide sequence that is substantially the same as the nucleotide sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12., and a nucleic acid sequencing reaction mixture; (b) allowing addition of nucleotides to the primer to form extended sequencing primers, said nucleotides being complimentary to an enterovirus 71 nucleic acid template; and (c) determining the sequence of the enterovirus 71 nucleic acid by analyzing the extended sequencing primers.

26. The method of claim 24, wherein the primer comprises the nucleotide sequence of SEQ ID NO:8 or a nucleotide sequence that is substantially the same as the nucleotide sequence of SEQ ID NO:8. -43-