ES2349543T3 - COMPOSITIONS, METHODS AND EQUIPMENT FOR THE DETECTION OF NUCLEIC ACIDS OF HIV-1 AND HIV-2. - Google Patents

Abstract

A method for determining whether a test sample contains at least one of the HIV-1 and HIV-2 nucleic acids, said method comprises the steps of: (a) combining said test sample with a pair of the cross-reactive primers to form a reaction mixture, wherein said pair of primers with cross-reactivity is capable of co-amplifying nucleic acids of HIV-1 and HIV-2 and comprises a first primer sequence consisting of Seq. ID No.: 14 , which optionally comprises an upstream sequence that is not complementary to any HIV-1 or HIV-2 nucleic acid, and a second primer sequence consisting of either Seq. ID No.: 2 or Id. Sec. No.: 7, which optionally comprises an upstream sequence that is not complementary to any HIV-1 or HIV-2 nucleic acid; (b) amplifying, in an in vitro nucleic acid amplification reaction, the nucleic acids present in said reaction mixture of step (a); and (c) detecting in an hybridization reaction an HIV-1 amplicon, an HIV-2 amplicon, or a combination of both amplicons synthesized in step (b), thereby determining that said test sample contains at least one of the nucleic acids of HIV-1 and HIV-2.

Description

Field of the Invention

The present invention is related to the field of Biotechnology More specifically, the invention is related to individual trials that can detect nucleic acids of HIV-1, HIV-2 or the combination of HIV-1 and HIV-2. The invention is also related to multiplex assays that can detect both HIV-1 and HIV-2 nucleic acids using a probe and / or priming. Dores with cross reaction with both analytes.

Government interest of the invention

Certain aspects of the invention described here were carried out with the support of the government under the contracts of the National Heart, Lung and Blood Institute of the National Institutes of Health N01-HB-67130 and N01-HB-07148. Government of the United States has certain rights in these aspects of the invention.

Background of the invention

Although the HIV / AIDS pandemic is mainly due to HIV-1 infection, a different retrovirus has emerged as a cause of AIDS. This virus called "HIV-2" it was first isolated from AIDS in western Africa in 1986, and was subsequently detected as an agent infectious for the first time in the United States the year if

guiente In the United States less than 100 cases of HIV-2 until the end of 1994. Despite these apparently low values, HIV-2 has been identified as a growing etiologic agent causing diseases with immunosuppression that are clinically indistinguishable from AIDS cases resulting from an infection for HIV-1 (Kanki et al., Science 232: 238 (1986); Kanki et al., Science 236: 827 (1987); Clavel et al., Science 233: 343 (1986); Clavel et al., N. Engl. J. Med. 316: 1180 (1987)). Although HIV-2 is related to HIV-1 in terms of its morphology and tropism by CD4 + cells, this is clearly a distinct virus and not merely a variant of the HIV-1 cover.

Also, since HIV-2 is only related in a way distant with HIV-1, with approximately 50% of amino acids conserved in gag and pol proteins and less than one 30% conservation in env gene products, their presence is not detected effectively in the serological tests used for the detection of infection by HIV-1 (Constantine NT, AIDS 7: 1 (1993); Markovitz DM, Ann. Intern. Med. 118: 211 (1993)). Consequently, attempts have been made to develop nucleic acid probes that can used to specifically detect HIV-2 viral nucleic acids.

Interestingly, the genomes of both HIV-1 and of HIV-2 show substantial sequence heterogeneity between different isolates. As a consequence of this heterogeneity, it has been impossible to find regions

substantial with absolute sequence conservation among all HIV-1 isolates or all HIV-2 isolates (see European patent application published PE 0 887 427). In addition, numerous viral isolates with polynucleotide sequences have been identified. unique to each of these viruses, a factor that also complicates the construction of probes for a reliable and effective nucleic acid analysis.

Since HIV-2, like HIV-1, is also transmissible through an exchange of body fluids, what which includes blood and plasma, it is important to be able to detect infected body fluids before virus antibodies are detectable or symptoms are evident in an infected individual. For the protection of patients, who might otherwise receive an HIV-2 infected body fluid (for example whole blood or plasma during a transfusion), or blood or plasma derived products from donations, is particularly important detect the presence of viruses in body fluids of donation to avoid its use in such procedures

or products It is also important that the procedures and reagents used for the detection of HIV-2 can detect a relatively low number of viral copies that may be present in an infected individual, which may Be a donor, during the early stages of infection.

Assays and reagents have been previously described for

HIV-2 detection in, for example, patents are

Americans 6,020,123, 5,688,637, 5,545,726 and 5,310,651; European patents No. PE 0404625 B1 and PE 0239425 B1; Y published European patent applications No. PE 1026236 A2 and PE 0887427 A2.

Summary of the Invention

A first aspect of the description is related with a method to determine if a test sample contains HIV-1 analyte nucleic acids or nucleic acids HIV-2 analyte. The method includes a first phase in the that the test sample is combined with a pair of primers with cross reactivity. Next, there is an amplification step in an in vitro amplification reaction of nucleic acids of one of any of the HIV-1 analyte nucleic acid sequences that may be present in the test sample and one of any of the analyte nucleic acid sequences of the HIV-2 that may be present in the test sample. This nucleic acid amplification reaction uses a pair of cross-reactive primers that can co-amplify HIV-1 and HIV-2 nucleic acids. The reaction products may include a first amplicon of the HIV-1 and a first amplicon of HIV-2. Then there are a detection phase in a single hybridization reaction of one of any of the first amplicons of the HIV-1 and one of any of the first HIV-2 amplicons that may have been synthesized in the phase of amplification. A positive result in the reaction of hybridization will indicate that the test sample contained the

less an analyte nucleic acid of HIV-1 or an analyte nucleic acid of HIV-2. In a preferable embodiment, the in vitro amplification reaction of nucleic acids in The amplification phase is a TMA reaction, a NASBA reaction or a PCR reaction. In another embodiment preferable, the only hybridization reaction of the phase of detection involves the use of a cross-reactive probe that can hybridize with the first amplicon of the HIV-1 or with the first amplicon of HIV-2. More preferably, the hybridization reaction in the detection phase It also includes a specific HIV-1 probe that hybridizes only with the first amplicon of HIV-1 and not with the first HIV-2 amplicon. When this is the case, a positive signal indicating the hybridization of the probe with reactivity crossed together with the absence of a positive signal indicative of hybridization of the HIV-1 specific probe indicates that the test sample contains the analyte nucleic acids of HIV-2 and does not contain the analyte nucleic acids of HIV-1. In an alternative preferable embodiment, there is an additional detection phase in a hybridization reaction that includes an HIV-1 specific probe, only from the first amplicon of HIV-1, and the first amplicon of HIV-2 is not detected. In this example, the specific probe of the HIV-1 hybridizes only with the first HIV-1 amplicon and not with the first amplicon of HIV-2. When this is the case, a positive signal that indicates probe hybridization with cross reactivity together with the absence of a signal positive indicating hybridization of the specific probe of the

HIV-1 indicates that the test sample contains acids Nucleic analyte of HIV-2 and does not contain analyte nucleic acids of HIV-1. According to another embodiment preferably, the cross-reactivity probe used in the detection phase is marked with a detectable signal in a homogeneous way. The homogeneously detectable signal it can be, for example, a chemiluminescent label. In a highly preferable embodiment, when a chemiluminescent labeling, the detection phase involves detection with a luminometer, or perform a luminometry. In certain embodiments other than the method, the in vitro amplification reaction of nucleic acids performed in the amplification phase does not include a pair of primers. specific analyte conditions that amplify the first HIV-2 analyte nucleic acid sequence without also amplifying a first nucleic acid sequence HIV-1 analyte. In other embodiments, a positive result indicating a hybridization of the probe in the phase of detection does not distinguish between the presence of the first amplicon of HIV-1 and the first amplicon of HIV-2. Said of another mode, hybridization of the probe to nucleic acids Complementary target synthesized in the amplification reaction indicates only that HIV-1 nucleic acids

or HIV-2 are present in the test sample, without identifying which one is present. In other embodiments, the in vitro amplification reaction of nucleic acids in the amplification phase can also amplify at least one first sequence of at least one analyte nucleic acid that

It is different from HIV-1 and HIV-2. In this example the reaction amplification would be a "multiplex" amplification reaction. In a particularly preferable embodiment of method, nucleic acids of at least one of the hepatitis B and hepatitis C viruses can be amplified in the amplification reaction in addition to acids nuclei of HIV-1 and HIV-2.

A second aspect of the description is related with a method specifically to determine if a sample Test contains an analyte nucleic acid of HIV-1. He method includes a first phase in which the test sample with a pair of primers with reactivity crusade. Next, there is an amplification phase in an in vitro amplification reaction of nucleic acids of one of any of the acid sequences HIV-1 analyte nuclei that may be present in the test sample, and one of any of the HIV-2 analyte nucleic acid sequences that They may be present in the test sample. This amplification reaction is performed using a pair of priming. Doors with cross-reactivity that can co-amplify nucleic acids of HIV-1 and HIV-2. The products of the amplification reaction may include a first amplicon. of HIV-1 and a first amplicon of HIV-2. Then, there is a phase of detection of the first amplicon of HIV-1 that may have been synthesized in the amplification phase without detect the first amplicon of HIV-2. A positive result in the hybridization reaction will indicate that the sample of

assay contained the analyte nucleic acid of HIV-1. In a preferred embodiment, the in vitro amplification reaction of nucleic acids in the amplification phase is a TMA reaction, a NASBA reaction or a reaction of PCR When one of these amplification reactions is used, the detection phase preferably involves the hybridization of an HIV1 specific hybridization probe that is labeled with a homogeneously detectable signal. Such markings, advantageously, do not require a physical separation of the free hybridized probe from probe specific complexes: target to determine the formation of such complexes in a hybridization reaction. In certain preferable embodiments, the detectable signal of Homogeneous form is a chemiluminescent label. When this is the case, the detection phase may involve the Detection with a luminometer or perform a luminometry. In another embodiment, the in vitro amplification reaction of nucleic acids in the amplification phase does not include a pair of specific analyte primers that amplify the first sequence of the analyte nucleic acids of the HIV-2 without also amplifying the first sequence of HIV-1 analyte nucleic acids. In other embodiments, the in vitro amplification reaction of nucleic acids in the amplification phase it can also amplify at least a first sequence of at least one nucleic acid analyte that is different from HIV-1 and HIV-2. In this example the amplification reaction would be a "multiplex" amplification reaction. For example, in one parti

Highly preferable of the method, the nucleic acids of at least one of the hepatitis B viruses and the Hepatitis C can be amplified in the amplification reaction in addition to HIV-1 and HIV-2 nucleic acids.

A third aspect of the description is related with a method to determine specifically if a sample Test contains an analyte nucleic acid of HIV-2. He method includes a first phase in which the test sample with a pair of primers with reactivity crusade. Next, there is an amplification phase in an in vitro amplification reaction of nucleic acids of one of any of the acid sequences HIV-1 analyte nuclei that may be present in the test sample, and one of any of the HIV-2 analyte nucleic acid sequences that They may be present in the test sample. This amplification reaction is performed using a pair of priming. Doors with cross-reactivity that can co-amplify nucleic acids of HIV-1 and HIV-2. The products of the amplification reaction may include a first amplicon. of HIV-1 and a first amplicon of HIV-2. Then, there is a phase of detection of the first amplicon of HIV-2 that may have been synthesized in the amplification phase without detect the first amplicon of HIV-1. A positive result in the hybridization reaction will indicate that the sample of Assay contained the analyte nucleic acid of HIV-2. In a preferred embodiment, the in vitro amplification reaction of nucleic acids in the amplification phase is a

TMA reaction, a NASBA reaction or a reaction of PCR When one of these amplification reactions is used, the detection phase preferably involves the hybridization of an HIV2-specific hybridization probe that is labeled with a homogeneously detectable signal. Such markings, advantageously, do not require a physical separation of the free hybridized probe from probe specific complexes: target to determine the formation of such complexes in a hybridization reaction. In certain preferable embodiments, the detectable signal of Homogeneous form is a chemiluminescent label. When this is the case, the detection phase may involve the Detection with a luminometer or perform a luminometry. In another embodiment, the in vitro amplification reaction of nucleic acids in the amplification phase does not include a pair of specific analyte primers that amplify the first sequence of the analyte nucleic acids of the HIV-2 without also amplifying the first sequence of HIV-1 analyte nucleic acids. In other embodiments, the in vitro amplification reaction of nucleic acids in the amplification phase it can also amplify at least a first sequence of at least one nucleic acid analyte that is different from HIV-1 and HIV-2. In this example the amplification reaction would be a "multiplex" amplification reaction. For example, in a particularly preferable embodiment of the invented method, the nucleic acids of at least one of the hepatitis viruses B and hepatitis C can be amplified in the reaction of

amplification in addition to HIV-1 nucleic acids and HIV-2

A fourth aspect of the description is related with a method to determine if a test sample contains an analyte nucleic acid of HIV-1. The method involves a first amplification in a first reaction of in vitro nucleic acid amplification of one of any of the sequences of the HIV-1 analyte nucleic acids that may be present in the sample of assay, and one of any of the sequences of the analyte nucleic acids of HIV-2 that may be present in the test sample. The first reaction of amplification uses a pair of primers with reactivity crossed that can co-amplify the nucleic acids of HIV-1 and HIV-2. The products of the amplification reaction may include a first amplicon of HIV-1 and a first amplicon of HIV-2. Next, there is a detection phase in a single hybridization reaction of any of the first amplicons of HIV-1 and any of the first amplicons of HIV-2 that may have been synthesized in the first amplification reaction. The detection of one of the amplicons confirms that the test sample It contains the nucleic acids of HIV-1 or HIV-2. The next step is to amplify in a second in vitro nucleic acid amplification reaction any second sequence of the HIV-1 analyte nucleic acids that can be present in the test sample, resulting in the synthesis of a second amplicon of HIV-1. Finally,

there is a detection phase of the second HIV-1 amplicon using a probe that hybridizes with the second amplicon of HIV-1 but not with any of the HIV-2 amplicons which may have been synthesized in the second phase of amplification. Detection of the second HIV-1 amplicon will confirm that the test sample contains the nucleic acid HIV-1 analyte. In a preferable embodiment, the in vitro amplification reaction of nucleic acids in the first amplification phase is a TMA reaction, a NASBA reaction or a PCR reaction. When this is the case, the in vitro amplification reaction of nucleic acids in the second amplification phase can also be a TMA reaction, a NASBA reaction or a PCR reaction. In an alternative embodiment, the reaction of in vitro amplification of nucleic acids in the second amplification phase is a TMA reaction, a reaction NASBA or a PCR reaction, regardless of type amplification reaction used in the first phase amplification In accordance with a preferable embodiment different, the first in vitro amplification reaction of nucleic acids and the second amplification reaction in In vitro nucleic acids use different primers to synthesize the first amplicon of HIV-1 and the second amplicon of HIV-1. According to another different preferred embodiment, the first and second detection phase does not They use identical probes. However, it is preferable that in the only hybridization reaction of the first phase of amplification a probe with cross reactivity is included

that can hybridize with the first amplicon of HIV-1 or with the first amplicon of HIV-2. Even more preferably, the cross reactivity probe is marked with a signal homogeneously detectable. In certain embodiments, the homogeneously detectable signal is, for example, a chemiluminescent labeling.

A fifth aspect of the description is related with a method to amplify analyte nucleic acids of HIV-1 and the analyte nucleic acids of HIV-2 that may be present in a test sample. The method begins with the step of combining the test sample with a pair of primers. These primers include a first primer with cross-reactivity that hybridizes independently with any first analyte nucleic acid chain of HIV-1 and any first nucleic acid chain HIV-2 analyte, if present in the test sample. Also included in the pair of primers with cross reactivity is a second primer with cross reactivity which independently hybridizes with any second chain of HIV-1 analyte nucleic acids and any second HIV-2 analyte nucleic acid chain, if present in the test sample. The primers have sequences such that an extension product of the first primers with cross reactivity, using as template the first analyte nucleic acid chain of HIV-1 or the first analyte nucleic acid chain of HIV-2, hybridizes with the second primer with cross reactivity. TO then there is an amplification phase in a reaction

in vitro amplification of nucleic acids from one of any of the nucleic acid sequences HIV-1 analyte that may be present in the sample test and one of any of the sequences of the analyte nucleic acids of HIV-2 that may be present in the test sample, using the pair of primers with cross-reactivity. This results in the synthesis of a first HIV-1 amplicon if the test sample contains the analyte nucleic acids of HIV-1, and in the synthesis of a first HIV-2 amplicon if the sample of Assay contains the analyte nucleic acids of HIV-2. In one embodiment, the invented method further includes a detection phase of at least a first amplicon of HIV-1 and a first amplicon of HIV-2. In a preferable embodiment, the detection phase involves detecting both the first HIV-1 amplicon and the first HIV-2 amplicon. More preferably, the detection phase involves performing a hybridization reaction that includes a probe with cross reactivity that hybridizes independently with the first amplicon of HIV-1 and with the first amplicon of HIV2 synthesized in the amplification phase. In another preferred embodiment, the detection phase involves the detection of only the first amplicon of HIV-1 and not the first amplicon of HIV-2. In another preferred embodiment, the phase Screening involves the detection of only the first amplicon of HIV-2 and not the first amplicon of HIV-1. According to another preferred embodiment, when the method invented further includes a detection phase of at least one

first amplicon of HIV-1 and a first amplicon of HIV-2, it is preferable that (a) the first acid sequence HIV-1 analyte nucleic is found in the gene of the integrasa p31 of HIV-1 and that the first sequence of HIV-2 analyte nucleic acids found in the gene of integrase p31 of HIV-2, or (b) the first sequence of the analyte nucleic acids of HIV-1 found in the HIV-1 p51 reverse transcriptase gene and the first HIV-2 analyte nucleic acid sequence are found in the p51 reverse transcriptase gene of the HIV-2

A sixth aspect of the description is related with a composition for amplifying analyte nucleic acids of HIV-1 or HIV-2 that may be present in a biological sample. The composition includes a first primer with cross reactivity that hybridizes independently with a first analyte nucleic acid chain of HIV-1 or a first analyte nucleic acid chain of HIV-2, if It is present in the biological sample. Also included in the composition a second primer with cross-reactivity that hybridizes independently with a second chain of HIV-1 analyte nucleic acids and a second chain of HIV-2 analyte nucleic acids, if present in the biological sample The nature of cross-reactive primers implies that an extension product of the first cross-reactivity primer, mediated by the activity of a template-dependent DNA polymerase, using the first analyte nucleic acid chain of the

HIV-1 or HIV-2 as a template, can hybridize with the second primer with cross-reactivity. In a preferable embodiment, the analyte nucleic acids of HIV-1 and HIV-2 that can be amplified by the first and second primer with cross reactivity encode viral p31 integrase or the viral p51 reverse transcriptase. Other realizations Preferable of the composition do not include a priming pair- specific areas of HIV-2 to amplify only acids HIV-2 analyte nuclei without amplifying also the HIV-1 analyte nucleic acids, but may include a pair of specific HIV-1 primers to amplify only the HIV-1 analyte nucleic acids without also amplifying the analyte nucleic acids of HIV-2. According to another realization regardless of whether the first and second primer with cross reactivity are useful for amplifying nucleic acids encoding integrase p31 or the p51 reverse transcriptase, the composition may also include a pair of HIV-1 specific primers to amplify only the HIV-1 analyte nucleic acids without also amplifying the HIV-2 analyte nucleic acids. In general, when the first and second primers with reactivity crossed are useful for amplifying nucleic acids that encode reverse transcriptase p51, the first primer with cross-reactivity includes a complementary sequence to the target at the 3 ’terminal end and optionally a sequence located upstream of the first primer with re- cross activity that is not complementary to the sequence of the analyte nucleic acids to be amplified. Sequence

complementary to the target at the 3 ’end of the first cross-reactivity primer includes about 22-28 contiguous bases contained in Sec. ID No. 60, allowing the presence of equivalent RNA and DNA bases and nucleotide analogues The composition also includes a second cross-reactivity primer that includes a complementary sequence to the target at the 3 ’terminal end and optionally a sequence upstream of the second primer with cross-reactivity that is not complementary to the target sequence of nucleic acids to be amplified. The complementary sequence to the target at the 3 ’end of the second primer with cross reactivity includes the Id. of Sec. No.: 61, allowing the presence of equivalent RNA and DNA bases and nucleotide analogs. More preferably, the sequence complementary to the target at the 3'-terminal end of the first cross-reactivity primer consists of 22-28 contiguous bases contained in Id. of Sec. No.: 60, allowing the presence of equivalent RNA and DNA bases and nucleotide analogs, and the sequence complementary to the target of the 3 ’terminal end of the second cross-reactivity primer consists of the ID of Sec. Nº: 61, allowing the presence of equivalent bases of RNA and DNA and nucleotide analogues. In certain preferred embodiments, the first primer and the second primer They are each of them up to 60 bases in length. In other preferable embodiments, the first primer does not include the optional sequence upstream of the first primer, the first primer is up to 28 bases in length, and the

Second primer is up to 60 bases in length. In others preferable embodiments, the first primer is up to 60 bases in length, and the second primer does not include the optional sequence upstream of the second primer, the second primer is 26 bases in length. In other embodiments Preferable, the first primer does not include the optional sequence upstream of the first primer, the first primer is up to 28 bases in length, and the second primer does not include the optional sequence upstream of the second primer, and the second primer is 26 bases in length. When this is the case, which means that the first primer is of up to 28 bases in length and the second primer is 26 length bases, there are certain preferable combinations of primers that can be used in the combination. In a first preferable combination, the complementary sequence to the target at the 3 ’end of the first primer is Sec. ID No.: 51, and the sequence complementary to the target at the 3 ’end of the second primer is the Sec. ID No.: 47, Sec. ID No.: 49 or Sec. ID No.:

50. In a second preferable combination, the sequence complementary to the target at the 3 ’end of the First primer is Sec. ID No.: 52, and the sequence Complementary to the target at the 3 'terminal end of the second primer is Sec. ID No.: 48. In a third preferable combination, the sequence complementary to the target at the 3 ’end of the first primer is the ID of Sec. No.: 53 and the complementary sequence to the target in the end 3 ’terminal of the second primer is Sec.

No.: 47, Sec. ID No.: 49 or Sec. ID No.: 50. In one fourth preferable combination, the complementary sequence to the target at the 3 ’end of the first primer is Sec. ID No.: 54, and the sequence complementary to the target at the 3 ’end of the second primer is the Sec. ID No.: 48. In a different embodiment, when the first primer and second primer are each of them up to 60 bases in length, the complementary sequence to the target at the 3 ’end of the first primer is any of Sec. ID No.: 51-54.

More preferably, the sequence complementary to the target at the 3 ’end of the second primer is any of Sec. ID No.: 47-50. In another different preferred embodiment, when the first primer is of up to 60 bases in length, and when the second primer does not includes the optional sequence upstream of the second primer, the second primer is 26 bases in length, and the complementary sequence to the target at the 3 ′ terminal end of the second primer is any of Sec. Nº: 47-50. More preferably, the first primer includes the upstream sequence of the first optional primer, and the complementary sequence to the target at the 3 ′ terminal end of the first primer is any of Sec. 51-54. When this is the case, there are certain preferable combinations of primers that can be used in the combination. In a preferable first combination, the sequence complementary to the target at the 3 ’terminal end of the first primer is Sec. ID No.: 51, and the sequence

Complementary to the target at the 3 ’end of the second primer is any of the Sec. 47, Sec. ID No.: 49 and Sec. ID No.: 50. In a second preferable combination, the sequence complementary to the target at the 3 ’end of the first primer is the Sec. ID No. 52, and the complementary sequence to the target at the 3 ′ terminal end of the second primer is to Id. of Sec. No.: 48. In a third preferable combination, the sequence complementary to the target at the 3 'terminal end of the first primer is Sec. ID No.: 53, and the sequence complementary to the target at the 3' terminal end of the second primer is any of the Sec. No.: 47, Sec. ID No.: 49 and Sec. ID No.: 50. In one fourth preferable combination, the complementary sequence to the target at the 3 ’end of the first primer is Sec. ID No.: 54, and the sequence complementary to the target at the 3 ’end of the second primer is the Sec. ID No.: 48. Again, in general, when the first and second cross-reactivity primer are useful for amplify nucleic acids encoding p31 integrase, the first cross-reactivity primer includes a sequence complementary to the target at the 3 ’terminal end and optionally a sequence upstream of the first primer with cross reactivity that is not complementary to the analyte nucleic acid sequence to be amplified. The complementary sequence to the target at the 3 ’end of the first cross-reactivity primer consists of any of Sec. ID No. 13-15. The composition

also includes a second primer with cross reactivity which includes a complementary sequence to the target in the end 3 ’terminal and optionally a sequence upstream of the second cross-reactivity primer that is not complementary to the target nucleic acid sequence a amplify. The complementary sequence to the target in the 3 ′ end of the second primer with reactivity cross includes the sequence ACARYAGTACWAATGGC (Sec. Nº: 10), which allows the replacement of up to two analogues base. In a preferable embodiment, the first primer with cross reactivity and the second primer with cross reactivity are each up to 75 bases in length. More preferably, the sequence complementary to the target at the 3 ’end of the second primer with cross reactivity is any of the Sec. No.: 2, Sec. ID No.: 7, Sec. ID No.: 8 and Sec. No.: 9. Even more preferably, the first cross-reactivity primer is Sec. ID No.: 14, and the second cross-reactivity primer is any of the Sec. ID No.: 2, Sec. ID No.: 7, Sec. ID No.: 8 e Sec. ID No.: 9. According to an even more embodiment Preferably, the first cross-reactivity primer is the Sec. ID No.: 14, and the second primer with reactivity crossed is Sec. ID No.: 7, or the first primer with re- cross activity is Sec. ID No.: 14, and the second primer with cross reactivity is the ID of Sec. No.: 2.

A seventh aspect of the description is related

with a probe for the detection of an HIV nucleic acid

1 or HIV-2. The invented probe includes a sequence probe consisting of a sequence of complementary bases to the target, and optionally one or more sequences of bases that are not complementary to nucleic acids that You want to detect. The sequence of bases complementary to the target can be any of the following: (a) ID of Sec. Nº: 42 or its complement, allowing the presence of equivalent bases of RNA and DNA; (b) ID of Sec. Nº: 43 or the complementary one of the same, allowing the presence of equivalent bases of RNA and DNA; or (c) ID of Sec. Nº: 44 or its complement, allowing the presence of equivalent bases of RNA and DNA. In all the examples the hybridization probe has a length of up to 60 bases. In a preferable embodiment, the probe also It includes a detectable signal. For example, the detectable signal may be a chemiluminescent label. In accordance with a different embodiment, the length of the probe Hybridization is up to 26 bases. According to a different embodiment, the probe does not include one or more of the optional base sequences that are not complementary to the nucleic acids that you want to detect, and the sequence of the probe is any of Seq. ID No.: 42 or the complementary of the same, Sec. ID No.: 43 or the complementary thereof, and Sec. ID No.: 44 or the complementary thereof.

An eighth aspect of the description is related with another probe for the detection of a nucleic acid from HIV-1 or HIV-2. The invented probe includes a sequence

probe consisting of a complementary base sequence to the target, and optionally one or more base sequences that are not complementary to the nucleic acids that are want to detect The sequence of bases complementary to the Target can be any of Sec. ID N °: 23-36.

Definitions

The following terms have the following meaning throughout this description, unless indicated specifically the opposite in the text.

As used herein, a "biological sample" is any tissue or material that contains polynucleotides, obtained from a human, animal or environmental sample. Biological samples according to the invention include peripheral blood, plasma, serum or other fluids. body, bone marrow or other organs, biopsied tissues or other materials of biological origin. A biological sample can be treated to destroy tissue or structure. cell, thus releasing intracellular components to a solution that may contain enzymes, buffers, salts, detergents and the like.

As used herein, "polynucleotide" means RNA or DNA, together with any synthetic nucleotide analogue or other molecules that may be present in the sequence and that do not prevent hybridization of the polynucleotide with a second molecule with a complementary sequence.

As used here, a "detectable signal" is a chemical species that can be detected or can lead to A detectable response. Acuer detectable signals

do with the invention can bind to the polynucleotide probe directly or indirectly, and include radioisotopes, enzymes, haptens, chromophores such as dyes or particles that provide a detectable color (for example, latex beads or metal particles), luminescent compounds (for example, bioluminescent, phosphorescent or chemiluminescent portions) and fluorescent compounds.

A "homogeneous detectable signal" refers to a signal that can be detected homogeneously by determining whether the signal is in a probe hybridized to a target sequence That is, the detectable signals Homogeneous can be detected without physically removing the hybridized forms of the non-hybridized signal or marked probe Homogeneous detectable signals are preferable when a labeled probe is used for the detection of HIV-1 or HIV-2 nucleic acids. Examples of Homogeneous signals include fluorescent labels, such as those associated with molecular beacons, and chemiluminescent labels such as those detailed by Arnold et al., in U.S. Patent No. 5,283,174; Woodhead et al., In U.S. Patent No. 5,656,207; and Nelson et al., in U.S. Patent No. 5,658,737. Preferable signals for use in homogeneous tests include chemiluminescent compounds (for example, see Woodhead et al., U.S. Patent No. 5,656,207; Nelson et al., U.S. Patent No. 5,658,737; and Arnold, Jr., et al., U.S. Patent No. 5,639,604). Sea

Preferable chemiluminescent cages are the compounds acridinium ester ("AE"), such as standard AE or derivatives thereof (for example, naphthyl-AE, ortho-AE, 1-or 3-methyl-AE, 2,7-dimethyl-AE, 4,5-dimethyl -AE, ortho-dibromo-AE, ortho-dimethyl-AE, meta-dimethyl-AE, ortho-methoxy-AE, orthomethoxy (cinnamon) -AE, ortho-methyl-AE, ortho-fluoro-AE, 1-or 3-methyl-ortho-fluoro-AE, 1- or 3-methyl-meta-difluoro-AE, and 2methyl-AE).

A "homogeneous test" refers to a procedure of detection that does not need a physical separation from the probe hybridization of the probe not hybridized prior to the determination of the extent of hybridization of the specific probe. Homogeneous example tests, such as those described here, you can use molecular beacons or other probes self-developers that emit fluorescent signals when hybridize with an appropriate target, ester labels of chemiluminescent acridinium that can be selectively destroyed by chemical agents except in the case that is present in a hybridization duplex, and others homogeneously detectable signals that will be familiar for experts in the field.

As used here, "amplification" refers to a in vitro procedure to obtain multiple copies of a target nucleic acid sequence, its complementary or fragments of it.

By "target nucleic acid" or "target" is meant a nucleic acid containing a sequence of target nucleic acids. In general, a nucleic acid sequence

target to be amplified will be positioned between two primers arranged opposite, and will include the portion of the target nucleic acids that is completely complementary to each of the primers.

By "target nucleic acid sequence" or "sequence target "or" target region "means a specific deoxyribonucleotide or ribonucleotide sequence comprising all or part of the nucleotide sequence of a single chain nucleic acid molecule, and the deoxyribonucleotide or ribonucleotide sequence complementary of this one.

By "transcription associated amplification" is understands any type of nucleic acid amplification that uses an RNA polymerase to produce multiple RNA transcripts from a template nucleic acid. An example of an amplification method associated with the transcription, called "transcription mediated amplification" (TMA), generally uses a polymerase of RNA, a DNA polymerase, deoxyribonucleoside triphosphate, ribonucleoside triphosphate and a complementary oligonucleotide promoter-template, and may optionally include one or more analog oligonucleotides. The variations of the TMAs are well known in the art as described in detail in Burg et al., U.S. Patent No. 5,437,990; Kacian et al., U.S. Patent No.

5,399,491 and 5,554,516; Kacian et al., PCT No. WO 93/22461; Gingeras et al., PCT No. WO 88/01302; Gingeras et al., PCT No. WO 88/10315; Malek et al., U.S. Patent No.

5,130,238; Urdea et al., U.S. Patent No.

4,868,105 and 5,124,246; McDonough et al., PCT No. WO 94/03472; and Ryder et al., PCT No. WO 95/03430. Methods from Kacian et al. they are preferable for performing nucleic acid amplification procedures of the type that They are described here.

As used herein, an "oligonucleotide" or "oligomer" is a polymer chain of at least two, generally between about 5 and 100, chemical subunits, in which each subunit comprises a nucleotide base portion, a sugar portion, and a binding portion that links the subunits in a linear spatial configuration. Common nucleotide base portions are guanine (G), adenine (A), cytosine (C), thymine (T) and uracil (U), although other rare or modified nucleotide bases that are capable of establishing hydrogen bonds are well known for experts in the field. The oligonucleotides may optionally include analogs of any of the sugar portions, base portions and constituents of the frame. Preferable oligonucleotides of the present invention have a length range of between about of 10 and about 100 waste. Oligonucleotides they can be purified from natural sources, but preferably they are synthesized using any of a variety of well-known enzymatic or chemical methods.

As used here, a "probe" is an oligonucleotti

do that specifically hybridizes with a target sequence in

a nucleic acid, preferably in an amplified nucleic acid, under conditions that promote hybridization, to form a detectable hybrid. A probe can contain optionally a detectable portion that can be attached at the ends of the probe or it can be internal. Probe nucleotides that combine with the target polynucleotide are not necessarily strictly contiguous, such as it may be the case with an internal portion detectable with the probe sequence. The detection can be direct (it is that is, resulting from a probe that hybridizes directly with the target sequence or amplified nucleic acid) or indirect (i.e., resulting from a probe that hybridizes with a intermediate molecular structure that binds the probe to the target sequence or amplified nucleic acid). The "target" of a probe generally refers to a sequence contained in an amplified nucleic acid sequence that specifically hybridizes with at least a portion of a probe oligonucleotide using standard hydrogen bonds (is say, base pairing). A probe can comprise target specific sequences and optionally other sequences that are not complementary to the target sequence that you want to detect. These non-complementary sequences they may comprise a promoter sequence, a restriction endonuclease recognition point, or sequences which contribute to the three-dimensional conformation of the probe (for example, as described in Lizardi et al., U.S. Patent Nos. 5,118,801 and 5,312,728). Sequences that are "sufficiently complementary" allow for

stable hybridization of a probe oligonucleotide to a target sequence that is not completely complementary to the specific sequence of the probe target.

As used here, an "amplification primer" is an oligonucleotide that hybridizes with a target nucleic acid,

or its complement, and participates in a nucleic acid amplification reaction. For example, the primers of amplification, or simply "primers", can be optionally modified oligonucleotides that can hybridize with a template nucleic acid and can have a 3 ’end which can be extended by a polymerase activity of DNA In general, a primer will have a sequence downstream which hybridizes with a target nucleic acid, and optionally an upstream sequence that is not complementary to acid target nucleic The optional upstream sequence can serve, for example, as an RNA polymerase promoter or contain cleavage sites for restriction endonucleases.

As used herein, and in reference to the probe or primer oligonucleotide, the term "cross-reactive"

or variants thereof means that the probe or primed- res are not strictly specific to a single species of target polynucleotide. A probe that hybridizes with HIV-1 nucleic acids but not with nucleic acids HIV-2 cannot be said to possess cross reactivity. On the contrary, a probe that can hybridize with both the target nucleic acids of HIV-1 and HIV-2 for forming detectable hybridization complexes would be considered

"With cross reactivity". Similarly, the primers with cross reactivity can participate in a reaction of nucleic acid amplification using acids nuclei of HIV-1 or HIV-2 as templates, resulting in the synthesis of HIV-1 amplicons and amplicons of HIV-2

By "substantially homologous", "substantially corresponding" or "substantially corresponding" means that the subject oligonucleotide has a base sequence which contains a region of at least 10 contiguous bases that It is at least 70% homologous, preferably homologous to at least 80%, more preferably homologous at least in 90%, and more preferably at least 100% homologous to a region of at least 10 contiguous bases present in a reference base sequence (which excludes the equivalents of RNA and DNA). Those skilled in the art will quickly appreciate that modifications can be made to the hybridization test conditions at various percentages homology to allow hybridization of the oligonucleotide to the target sequence, avoiding unacceptable levels of non-specific hybridization. The degree of similarity is determined by comparing the order of the nucleotide bases that make up the two sequences and is not taken into consideration other structural differences that may exist between the two sequences, since structural differences do not avoid the formation of hydrogen bonds with complementary bases. The degree of homology between two sequences It can also be expressed in terms of the unpacking number

base grids present in each group of at least 10 contiguous bases that are compared, which may be in the range between 0-2 base differences.

By "substantially complementary" means that the subject oligonucleotide has a base sequence that it contains a region of at least 10 contiguous bases that is complementary at least 70%, preferably complementary at least 80%, more preferably complementary at least 90%, and more preferably 100% complementary with a region of at least 10 contiguous bases present in a sequence of target nucleic acids (excluding RNA and DNA equivalents). (The experts in the matter will quickly appreciate that modifications can be made to the conditions of the hybridization assay at several percentages of complementarity to allow oligonucleotide hybridization to the target sequence avoiding unacceptable levels of non-specific hybridization). The degree of complementarity is determined by comparing the order of the nucleotide bases that make up the two sequences and does not take into consideration other structural differences that may exist between the two sequences, since that structural differences do not prevent the formation of hydrogen bridges with complementary bases. The degree of Complementarity between two sequences can also be expressed in terms of the number of base mismatches present in each subgroup of minus 10 bases adjacent to compare, which can range from 0-2 mismatches

of bases.

By "sufficiently complementary" is meant a sequence of contiguous nucleic acid bases that can hybridize with another sequence of bases by bridges of hydrogen between a series of complementary bases. Complementary base sequences can be complementary at each position of the oligonucleotide base sequence using standard base pairing. (for example, pairing G: C, A: T or A: U) or may contain one or more residues that are not complementary using standard hydrogen bridge formation (which it includes the "abyss nucleotides"), but in which the complete complementary base sequence can hybridize specifically with another base sequence under the appropriate hybridization conditions. The adjoining bases are complementary preferably at least around 80%, more preferably at least about 90%, and more preferably in about 100% to a sequence at which is intended that an oligonucleotide specifically hybridizes. Appropriate hybridization conditions are fine. known to those skilled in the art, can predict be easily based on the sequence composition of bases, or can be determined empirically using routine analyzes (for example, see Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) in Sections 1.90-1.91, 7.37-7.57, 9.47-9.51 and 11.47-11.57 particularly in §§ 9.50-9.51, 11.12-11.13, 11.45-11.47 and

11.55-11.57).

"Capture oligonucleotide" means at least a nucleic acid oligonucleotide that provides a specific means of binding to the target sequence and an immobilized oligonucleotide due to the hybridization of pairs of bases. A capture oligonucleotide preferably includes two binding regions: a binding region to the target sequence and a binding region to the immobilized probe, normally contiguous in the same oligonucleotide, although the capture oligonucleotide may include a region of target sequence binding and a probe binding region immobilized that are present in two oligonucleotides different joined by one or more linkers. For example, an immobilized probe binding region may be present in a first oligonucleotide, the region of binding to the target sequence may be present in a second oligonucleotide, and the two different oligonucleotides are bound by hydrogen bonding with a linker that is a third oligonucleotide that contains sequences that specifically hybridize with the sequences of the first and second oligonucleotides.

By "immobilized probe" or "immobilized nucleic acid" is meant a nucleic acid that binds directly

or indirectly, to a capture oligonucleotide on an immobilized support. An immobilized probe is an oligonucleotide bound to a solid support that facilitates separation of the bound target sequence from unbound material in a sample.

By "separate" or "purify" means that one or more

components of the biological sample are removed from among one or more different components of the sample. Sample components include nucleic acids in a generally aqueous solution phase that may also include materials such as proteins, carbohydrates, lipids and marked probes. Preferably, the separation step or purification removes at least 70%, more preferably at least 90% and, even more preferably, at least one 95% of the rest of the components present in the sample.

By "RNA and DNA equivalents" or "equivalent bases of RNA and DNA "are understood as molecules, such as RNA and DNA, with the same base pair hybridization properties complementary. RNA and DNA equivalents have different sugar portions (i.e. ribose versus deoxyribose) and may differ due to the presence of uracil in the RNA and thymine in the DNA. Differences between RNA and DNA equivalents do not contribute to differences in homology since equivalents have the same degree of complementarity with a particular sequence.

"Consists essentially of" means that the additional component (s), composition (s) or step (s) of the method that do not change substantially The basic and novel features of this description can be included in the compositions, equipment or methods Such features include the ability to selectively detect HIV-1 nucleic acids, of HIV-2 or the combination of HIV-1 and HIV-2 in samples biological as whole blood or plasma. Any make up

te (s), composition (s) or step (s) of the method that have a Substantial effect on the basic and novel features of this description would be outside this term.

Brief description of the figures

Figure 1 is a schematic diagram illustrating several polynucleotides that can be used for the detection of a target region in HIV-1 nucleic acids or HIV-2 (represented by a thick horizontal line). The positions of the following nucleic acids are indicated in relation to the target region: "capture oligonucleotide" is refers to nucleic acids used to hybridize and capture the target nucleic acids prior to amplification, in which "T" refers to a tail sequence used to hybridize with an oligonucleotide immobilized with a complementary sequence (not shown); "Primer no T7 "and" T7 promoter-primer "represent two primers of amplification used to initiate TMA, in which "P" indicates the promoter sequence of the T7 promoter-promoter; Y "probe" refers to the probe used for detection of the amplified nucleic acid.

Detailed description of the invention

The compositions, methods and equipment are described here for the detection of HIV-1 nucleic acids, from HIV-2, or a combination of HIV-1 and HIV-2 in biological samples such as blood, serum, plasma or other body fluids or tissues. Probes, primers and methods of the invention can be used in diagnostic applications

Ethics or for screening donations of blood and blood products or other tissues that may contain infectious particles.

Introduction and overview

The present invention includes compositions (ie, amplification oligonucleotides or primers, and probes), methods and equipment that are particularly useful for the nucleic acid detection of HIV-1, HIV-2, or a combination of HIV-1 and HIV-2 in a biological sample. To design appropriate oligonucleotide sequences for such utilization, the known sequences of HIV-1 and HIV-2 nucleic acids were first compared to identify candidate regions of the viral genomes that They could serve as reagents in a diagnostic test. As a result of these comparisons, particular sequences were selected and analyzed as detection targets using the capture oligonucleotide, the primers. res and probe shown schematically in Figure 1. Portions of sequences containing relatively few variants were chosen as starting points to design synthetic oligonucleotides suitable for your use in the capture, amplification and detection of amplified sequences

Based on these analyzes, the sequences were designed of the amplification primer and probe presented then. Those skilled in the art will appreciate that any specific primer sequence for HIV-1, HIV-2, or a combination of HIV-1 and HIV-2 targets, with or

without a T7 promoter sequence, it can be used as primer in the different in vitro amplification methods based on primers described below. I also know contemplates that oligonucleotides with the sequences here described may have alternative functions in trials for the detection of nucleic acids of HIV-1 and / or HIV-2 For example, capture oligonucleotides here described can be used as hybridization probes, the hybridization probe described herein can be used as amplification primers, and the amplification primers described herein can be used as a hybridization probe in alternative detection assays.

The amplification primers described herein are specifically contemplated as components of multiplex amplification reactions in which several can be obtained amplicon species from a selection of primers specific to the target. For example, it is contemplated that certain preferable primers described herein can be used in multiplex amplification reactions that can amplify unrelated virus polynucleotides without substantially compromise the sensitivity of these essays. Particular examples of these unrelated viruses include HCV and HBV.

Useful amplification methods

Useful amplification methods in relation with the present invention include: transcription mediated amplification (TMA), sequence based nucleic acid amplification (NASBA), chain reaction of

polymerase (PCR), displacement amplification of chain (SDA), and amplification methods that utilize self-replicating polynucleotide molecules and replication enzymes such as MDV-1 RNA and the Q-beta enzyme. The methods to perform all these amplification techniques can be found respectively in U.S. Patent No. 5,399,491, published European patent application PE 0.525.882, U.S. Patent No. 4,965,188, Patent U.S. No. 5,455,166, U.S. Patent No.

5,472,840 and in Lizardi et al., BioTechnology 6: 1197 (1988).

In a highly preferable embodiment of the invention, the analyte nucleic acid sequences are amplified using a TMA protocol. According to this protocol, the reverse transcriptase that provides DNA polymerase activity also possesses an endogenous RNase H activity. One of the primers used in this procedure contains a river positioned promoter sequence above a sequence that is complementary to a string of the target nucleic acids to be amplified. In the first step of amplification, a promoter-primer hybridize with the target RNA in a defined place. Reverse transcriptase creates a complementary DNA copy of the Target RNA by extension from the 3 ’end of promoter-primer. After the interaction of a primer of the opposite chain with the newly synthesized DNA chain, it synthesizes a second strand of DNA from the end of the primer by reverse transcriptase, thus creating a double stranded DNA molecule. RNA polymerase

recognize the promoter sequence in this double stranded DNA template and initiate transcription. Each of the newly synthesized RNA amplicons re-enters the TMA process and serves as a template for a new cycle of replication, thus leading to an exponential expansion of RNA amplicon. Since each of the DNA templates can generate 100-1000 copies of the RNA amplicon, this expansion can result in the production of 10 billion amplicons in less than an hour. The entire process is autocatalytic and is carried out at a constant temperature.

Structural characteristics of the primers

As indicated above, a "primer" refers to an optionally modified oligonucleotide that can participate in an acid amplification reaction nucleic Highly preferable primers can hybridize with a template nucleic acid and have a 3 ’end which can be extended by a polymerase activity of DNA The 5 ’region of the primer may not be complementary of the target nucleic acid. If region 5 ’would not complement it includes a promoter sequence, it is called a "promotorcerator". Those skilled in the art will appreciate that any oligonucleotide that can function as a primer (is that is, an oligonucleotide that hybridizes specifically with a target sequence and has a 3 ’end that can be extended by a DNA polymerase activity) can be modified to include a 5’ promoter sequence, and thus being able to function as a promoter-primer. Similarly, any promoter-primer can be modified by

you removing a promoter sequence, or the synthesis without it, and continue to function as a primer.

The base portions of the nucleotides of the primers can be modified (for example, by adding tip groups), provided the modified base portion maintain the ability to form a non-covalent association with G, A, C, T or U, and whenever an oligonucleotide that comprises at least one modified nucleotide base portion or an analogue does not sterically prevent hybridization with a single chain nucleic acid. As indicated to continuation in relation to the chemical composition of useful probes, the nitrogen bases of the primers of according to the invention they can be conventional bases (A, G, C, T, U), known analogues thereof (for example, inosine or "I" with hypoxanthine as the base portion; see The Biochemistry of Nucleic Acids 5-36, Adams et al., Ed., 11th Ed., 1992), known derivatives of purine bases or pyrimidine (for example, N4-methyldeoxyigaunosin, deaza-o aza-purines and deaza-o aza-pyrimidines, pyrimidine bases with substituent groups at position 5 or 6, purine bases with an altered or replaced substituent at positions 2, 6 or 8, 2-amino-6-methylaminopurine, O6-methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4-dimethylhydrazinpyrimidines and O4-alkyl pyrimidines (see, Cook, Pub. Int'1 PCT No. WO 93/13121) and "abasic" residues in which the skeleton of the molecule does not include nitrogenous bases in one

or more polymer residues (see Arnold et al., patent U.S. 5,585,481). The common sugar portions

comprising the primer skeleton include ribose and deoxyribose, although 2’-Ometilribose (OMe), halogenated sugars, and other portions can also be used modified sugar Normally, the primer skeleton binding group is a phosphorus-containing portion, more commonly a phosphodiester bond, although other linkages, such as, for example, phosphorothioates, methylphosphonates, and junctions that do not contain phosphorus such as type junctions peptides found in "peptide nucleic acids" (PNA) can also be used in the assay that Here it is described.

Probe marking systems and detectable portions of utility

Essentially any marking and detection system that can be used to monitor specific nucleic acid hybridization can be used herein invention. They are included among the various useful markings radiolabels, enzymes, haptens, bound oligonucleotides, chemiluminescent molecules, fluorescent portions (alone or in combination with "blocking" portions), and redox active portions that are suitable for electronic detection methods. Preferred chemiluminescent molecules include acridinium esters of type described by Arnold et al., in US Patent No. 5,283,174 for use in homogeneous protection tests, and of the type described by Woodhead et al., in US Patent No. 5,656,207 for use in assays that quantify multiple targets in one

only reaction. Marking and detection approaches Preferable electronics are described in U.S. Patent Nos. 5,591,578 and 5,770,369, and published international patent application WO 98/57158. Portions redox active useful as labels in the present invention include transition metals such as Cd, Mg, Cu, Co, Pd, Zn, Fe and Ru.

Particularly preferable detectable signals for the probe according to the present invention are detectable in homogeneous test systems (i.e., in which, in a mixture, the attached labeled probe shows a detectable change, such as stability or differential degradation, compared to the unbound labeled probe). Though other homogeneously detectable signals, such as fluorescent labels and electronically detectable signals, are useful for use in the practice of the present invention, a preferable signal for use in homogeneous assays is a chemiluminescent compound (for example, as described by Woodhead et al., in US Patent No. 5,656,207; by Nelson et al., in the U.S. Patent No. 5,658,737; or by Arnold et al., in U.S. Patent No. 5,639,604). The signs Particularly preferable chemiluminescent include compounds with acridinium esters ("AE"), such as AE standard or derivatives thereof, such as naphthyl-AE, ortho-AE, 1

or 3-methyl-AE, 2,7-dimethyl-AE, 4,5-dimethyl-AE, orthodibromo- AE, ortho-dimethyl-AE, meta-dimethyl-AE, ortho-methoxy-AE, orthomethoxy (cinnamon) -AE, ortho-methyl-AE, ortho-fluoro-AE, 1-or 3

methyl-ortho-fluoro-AE, 1-or 3-methyl-meta-difluoro-AE and 2methyl-AE.

In some applications, probes that are desirable show at least some degree of self-complementarity to facilitate the detection of probe duplexes: target in a test sample without elimination being necessary probe not hybridized prior to detection. How For example, structures called "molecular torches" are designed to include different regions of self-complementarity (called "domain binding to the target "and" target closing domain "that are connected by a junction region and that hybridize with each other under predetermined conditions of the hybridization assay. When exposed to denaturing conditions, the two Complementary regions (which may be totally or partially complementary) of the denatured molecular torch, leave the target binding domain available for hybridization with the target sequence when restored the predetermined conditions of the hybridization assay. Molecular torches are designed so that the target binding domain favors hybridization to the target sequence over the target's closing domain. He target binding domain and the closing domain of the target of a molecular torch include interacting labels (e.g. fluorescent / blocker) positioned so that a different signal is produced when the molecular torch is self-hybridized from that produced when the molecular torch is hybridized with a

target nucleic acid, thus allowing the detection of probe duplex: target in a test sample in the presence of probe not hybridized with a viable signal associated with it. Molecular torches are described more fully in U.S. Patent No. 6,361,945.

Another example of a self-complementary probe in one trial hybridization that can be used in the invention is a structure that is commonly called "molecular beacon". Molecular beacons comprise nucleic acid molecules with a complementary sequence of the target, a pair of affinity (or nucleic acid arms) that maintain the probe in a closed conformation in the absence of a target nucleic acid sequence, and a signal pair that interacts when the probe is in closed conformation. The hybridization of the target nucleic acids and the sequence complementary of the target separates the members of the pair of affinity, thus changing the conformation of the probe to a open position The change to open conformation can be detect due to reduced interaction of the pair of signal, which can be, for example, a fluorophore and a blocker (for example, DABCYL and EDANS). Molecular beacons are described in detail in U.S. Patent No. 5,925,517. Molecular beacons can be created useful for the specific detection of acid sequences nuclei adding to each end of one of the probe sequences described herein, a first arm of nucleic acids comprising a fluorophore and a second nucleic acid arm comprising a blo portion

queador In this configuration, the probe sequence here described serves as a complementary "loop" portion of the target of the resulting molecular beacon.

Molecular beacons are preferably marked with an interactive pair of detectable signals. The examples of detectable signals that are preferable as members of an interactive pair of signals interact with each other by means of FRET energy transfer mechanisms or not FRET. The energy transfer by resonance of the Fluorescence (FRET) involves transmission without radiation of how many energy from the point of absorption to the point of its use in the molecule or molecule system, through the interaction of resonance between chromophores, over distances considerably greater than interatomic distances, without conversion to thermal energy, and without the donor and the acceptor suffering a kinetic collision. The "donor" is the portion that initially absorbs energy, and the "acceptor" is the portion to which energy is then transferred. In addition to FRET, there are at least three other energy transfer processes "no FRET" through which the excitation energy can transfer from a donor molecule to an acceptor.

When two signals remain sufficiently nearby so that the energy emitted by a signal can be received or absorbed by a second signal, either by a FRET mechanism or not FRET, it is said that the two signals they are in "energy transfer ratio" between they. This is the case, for example, when a beacon mo

lecular is kept in a closed state by training of an original duplex, and fluorescence emission from a fluorophore attached to a probe arm is blocked by a blocking portion on the opposite arm.

The highly preferable signal portions for molecular beacons include a fluorophore and a second portion with fluorescence blocking properties (ie, a "blocker"). In this embodiment, the characteristic signal is probably the fluorescence of a length of a particular one, but alternatively it could be a visible light signal. When fluorescence is involved, changes in emission are preferably due to FRET, or to modes of transfer of radiative energy or not FRET. When a molecular beacon with a pair of interactive signals in the closed state is stimulated by an appropriate light frequency, a fluorescent signal is generated On a first level, it can be very low. When is same probe is in an open state and is stimulated by an appropriate light frequency, fluorophore portions and blocker are sufficiently separated between them so that the transfer of energy between them is eliminated substantially. Under such conditions, the blocking portion cannot block the fluorescence of the portion. fluorophore If the fluorophore is stimulated by energy light of an appropriate wavelength, a fluorescent signal of a second level, greater than the first level. The difference between the two levels of fluorescence It is detectable and measurable. Using the fluorophobic portions

ro and blocker in this way, the molecular beacon is only "Active" in the "open" conformation and indicates that the probe It is attached to the target emitting an easily detectable signal. The conformational state of the probe alters the signal generated from the probe regulating the interaction between the portions of the signal.

Examples of donor / acceptor signal pairs that can used in the invention, without being intended to distinguish FRET non-FRET pairs, include dyes fluorescein / tetramethylrodamine, IAEDANS / fluorescein, EDANS / DABCYL, coumarin / DABCYL, fluorescein / fluorescein, BODIPY FL / BODIPY FL, fluorescein / DABCYL, yellow Lucifer / DABCYL, BODIPY / DABCYL, Eosin / DABCYL, Erythrosine / DABCYL, Tetramethylrodamine / DABCYL, Texas Red / DABCYL, CY5 / BH1, CY5 / BH2, CY3 / BH1, CY3 / BH2 and fluorescein / QSY7. Those skilled in the art will understand that when donor and acceptor dyes are different, energy transfer can be detected by the appearance of sensitized acceptor fluorescence or by blocking donor fluorescence. When the species donor and acceptor are the same, energy can be detected by depolarization of the resulting fluorescence. Non-fluorescent acceptors such as DABCYL dyes and QSY 7 advantageously eliminates the potential problem of background fluorescence resulting from direct excitation (i.e., not sensitized) of the acceptor. Portions preferable fluorophore that can be used as one of donor-acceptor members include color

tes fluoresceína, ROX and CY (as CY5). The highly preferable blocking portions that can be used as the Another member of a donor-acceptor pair includes the DABCYL and BLACK HOLE QUENCHER portions available on Biosearch Technologies, Inc., (Novato, CA).

Synthetic techniques and methods of signal binding to nucleic acids and signal detection are well known in the art (for example, see Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), Ca

chapter

10; Nelson et to the., patent American No.

5,658,737;

Woodhead et to the., patent American No.

5,656,207;

Hogan et to the., patent American No.

5,547,842;

Arnold et to the., patent American No.

5,283,174;

Kourilsky et to the., patent American No.

4,581,333),

Y Becker et to the., patent American No.

0.747.706.

Chemical composition of the probes

The probes according to the invention comprise polynucleotides or polynucleotide analogs and optionally they can carry a detectable signal covalently linked to she. Nucleosides or nucleoside analogs of the probe they comprise nitrogenous heterocyclic bases, or analogs of base, in which the nucleosides are linked together, by example by phosphodiester bonds to form a polynucleotide. According to this, a probe can comprise Conventional ribonucleic acids (RNA) and / or deoxyribonucleic acids (DNA), but may also comprise

Chemical analogues of these molecules. The "frame" of a The probe may consist of a series of links known in the art, including one or more sugar-phosphodiester bonds, peptide-nucleic acid bridges (some sometimes referred to as "peptide nucleic acids" such as described in Hyldig-Nielsen et al., Pub. Int. PCT No. WO 95/32305), phosphorothioate bonds, methyl phosphonate bonds or combinations thereof. The sugar portions of the probe can be ribose or deoxyribose, or similar compounds with known substitutions, such as, for example, 2'-O-methylribose and 2 'halide substitutions (e.g., 2’F). The nitrogen bases may be conventional bases (A, G, C, T, U), known analogues thereof (for example, inosine or "I"; see "The Biochemistry of the Nucleic Acids" 5-36, Adams et al., ed., 11th Ed., 1992), known derivatives of the pyric or pyrimidine passes (for example, N4-methyl deoxyguanosine, deaza-or aza-purines and deaza-o aza-pyrimidines, the pyrimidine bases with substituent groups at position 5 or 6, the pyric bases with an altered or substituted substituent at positions 2, 6 or 8, 2-amino-6-methylaminopurine, O6 methylguanine, 4-thio-pyrimidines, 4-amino-pyrimidines, 4-dimethylhydrazine -pyrimidines, and O4-alkyl-pyrimidines (see, Cook, Pub. Int. PCT No. WO 93/13121) and "abasic" residues in which the framework does not include nitrogen base for one or more polymer residues (see Arnold et al., US Patent No. 5,585,481). A probe can comprise only conventional sugars, bases and bonds in

contracted in RNA and DNA, or it can include both conventional components and substitutions (for example, conventional bases bonded by a methoxy framework, or an acid nucleic that includes conventional bases and one or more base analogs).

While an oligonucleotide probe of different length and base composition can be used to nucleic acid detection of HIV-1, HIV-2, or the combination of HIV-1 and HIV-2, the preferable probe in this invention has lengths of up to 100 nucleotides, and more preferably up to 60 nucleotides. The preferable length ranges for the oligonucleotides of the invention they are between 10 and 100 bases in length, or more preferably between 15 and 50 bases in length, or even more preferably between 15 and 30 bases in length. However, the specific probe sequences described below can also be provided in a cloning vector or transcribed nucleic acids or other nucleic acids more long and can still be used for acid detection target nucleic Thus, useful probes according to the invention may include a sequence complementary to the base target with a limited length, and one or more attached sequences that are not complementary to the sequence target to be detected. For example, a molecular beacon may include a complementary sequence loop to the target flanked by "arm" sequences that are not complementary to the target to be detected.

Selection of amplification primers and probes of

detection

Useful guides to design primers probes amplification and with desired characteristics are described herein. Optimal sites for amplifying and probing HIV-1 and / or HIV-2 nucleic acids contain two, and preferably three, conserved regions each greater than the previous one of around 10-15 bases of length, within about 200-300 sequence bases contiguous The degree of amplification observed with the group of primers or promoter-primers depends on several factors, which includes the ability of oligonucleotides to hybridize with its complementary sequences and its ability of extending enzymatically. Due to the extent and specificity of hybridization reactions are affected by a number of factors, the manipulation of these factors will determine the exact sensitivity and specificity of a particular oligonucleotide, which can be perfectly complementary to its target or not. The effects of the variation of the test conditions are known by the experts in the field, and are described by Hogan et al., in U.S. Patent No. 5,840,488.

The length of the nucleic acid target sequence and, accordingly, the length of the primer sequence

or probe sequence may be important. In some cases, there may be several sequences from one particular target region, varying the location and length, which primers or probes can provide with the desired hybridization characteristics. While it is

possible to hybridize nucleic acids that are not perfectly complementary, the longest stretch of sequence perfectly homologous base, will usually determine the stability of the hybrid primarily.

The primers and the amplification probe will be positioned to minimize the stability of the oligonucleotide hybrid: non-target nucleic acid (ie, nucleic acids with sequence similar to the target nucleic acid). It is preferable that the amplification primers and the probe detection be able to distinguish between target sequence and not target. In the design of primers and probes, the differences in these Tm values will be as wide as possible (for example, at least 2˚C and preferably 5˚C).

The degree of non-specific extension (primer-dimer or non-target copy) may also affect the efficiency of amplification. For this reason, the primers are selected to have low self-complementarity or complementarity crossed, particularly at the 3 ’ends of the sequence. Long stretches of homopolymer and high content of GC are avoided to reduce the extent of primers that do not care. There are commercial computer programs that They can help in this aspect of the design. Some of these Available programs include MacDNASIS ™ 2.0 (Hitachi Software Engineering American Ltd.) and OLIGO ver. 6.6 (Molecular Biology Insights; Cascade, CO).

Those skilled in the art will realize that the hybridization involves the association of two single strands of complementary nucleic acids to form a

double chain linked by hydrogen bridges. It is implied that if one of the two chains is totally or partially involved in a hybrid, then that chain will be less available to participate in the formation of a new hybrid. When designing primers and shape probes that important portions of the sequences of interest are single chain, rate and extent of hybridization It can be greatly increased. If the target is one integrated genomic sequence, then it will appear natural in a double chain (as is the case with the product of the polymerase chain reaction). These targets of double chain naturally inhibit hybridization with a probe and requires denaturation before passing of hybridization.

The rate at which a polynucleotide hybridizes to its target It is a measure of the thermal stability of the structure secondary target in the target binding region. The standard measurement of the hybridization rate is C0t1 / 2 that is measured as moles of nucleotide per liter multiplied by seconds. Thus, it is the concentration of multiplied probe for the time at which 50% of maximum hybridization occurs at that concentration This value is determined by the hybridization of various amounts of polynucleotide to a constant amount of target for a fixed time. The C0t1 / 2 is graphically find standard procedures familiar to those skilled in the art.

Preferable amplification primers

The primers useful for carrying out the reactions

of amplification may have different lengths for accommodate the presence of foreign sequences that do not participate in the binding of the target, and that do not substantially affect mind amplification or detection processes. For example, the promoter-primers useful for performing the amplification reactions according to the invention have at least one minimal sequence that hybridizes with the target nucleic acid, and a river positioned promoter sequence above this minimum sequence. However, the insertion of sequences between the target binding sequence and the promoter sequence can change the length of the primer without compromising its usefulness in the amplification reaction. Additionally, the lengths of the primers amplification and detection probes can be always choose which sequences of these oligonucleotides conform to the minimum essential requirements for hybridize the desired complementary sequence.

Tables 1 and 2 present specific examples of oligonucleotide sequences that were used as priming. res to amplify HIV-1, HIV-2, or the combination of HIV-1 and HIV-2 nucleic acids in the region encoding the integrasa p31. Table 1 presents the priming sequences. teachers that are substantially complementary to a chain of the different target nucleic acids. The examples of primers presented in Table 1 possess complementary sequences to the target that includes a sequence nucleus 17-number of ACARYAGTACWAATGGC (Sec. ID No.: 10) (in which "R" represents A / G, and "W" represents A or T / U), which allows

replacing up to one, or even up to two analogs base. Inosine is an example of a highly preferable base analog that can be used for this purpose, and position 5 and / or position 11 of the sequence nucleus can be substituted with this base analog with very good results. It is preferable for one of the primers used in the amplification process to have a sequence complementary to the target that contains this core number 17. The primer may also include several nucleotides annexed to the upstream end of the sequence core, and may include a few nucleotides attached to the downstream end of the nucleus of the sequence. For example, you can have five, or even more nucleotides attached to the end Upstream. It is convenient to include one, two, or three nucleotides attached to the downstream end, if desired. Table 2 presents the sequences of the primers complementary to the target and the complete sequences of primer-promoters that were used during development of the invention. It can be noted that the sequences of oligonucleotides in Table 1 and Table 2 are substantial Complementary to the opposite chains of acids target nucleic to amplify.

The primers useful for amplifying the targets of HIV-1 and / or HIV-2 nucleic acids may include analogs nucleotide For example, when compared to the basic primer sequence of Sec. ID No.: 5, the primers- res with the ID of Sec. No.: 6, ID of Sec. No.: 7 and ID of Sec. No.: 9 differ in the presence of an inosine residue

unique in position 16, in the substitution of a residue T with a C in position 10 and an inosine residue in position 16, or inosine substitutions in positions 10 and 16, respectively. As confirmed by the 5 experimental findings presented here, these differences in the bases confer beneficial properties that had not been predicted before the discovery described here. More specifically, the results demonstrate that one of these mutant primers, when paired with a single primer of the opposite chain, loses the specificity for the HIV-1 template and acquires the ability to amplify both HIV-1 and HIV templates. -2 with almost the same efficiency. This illustrates how certain positions in the primers can be substituted with modified or analogous bases

15 bases.

Table 1

Polynucleotide sequences of amplification primers

Sequence

Identifier

ACAGCAGTACAAATGGCAG

Sec. ID No.: 1

ACAACAGTACAAATGGCAGT

Sec. ID No.: 2

ACAATAGTACTAATGGCAGT

Sec. ID No.: 3

TTAAGACAGCAGTACAAATGGC

Sec. ID No.: 4

TAGAGACAGCAGTACAAATGGC

Sec. ID No.: 5

TAGAGACAGCAGTACIAATGGC

Sec. ID No.: 6

TAGAGACAGTAGTACIAATGGC

Sec. ID No.: 7

TAGAGACAGCAGTACTAATGGC

Sec. ID No.: 8

TAGAGACAGIAGTACIAATGGC

Sec. ID No.: 9

Table 2 presents oligonucleotide sequences with

complementary to the target and the corresponding promoter-primer sequences that are used to amplify the nucleic acid sequences of HIV-1 and HIV-2. As indicated above, all included primer-promoter sequences 5 that are substantially complementary, that is, capable of hybridizing with a target sequence at its 3 ′ end, and a T7 promoter sequence at its 5 ′ end. The primers identified by Seq. ID No.: 1722 in Table 2 are primer-promoters corresponding to

10 primers identified as Sec. ID No.: 11-16, respectively. The bases corresponding to the T7 promoter sequences in the table are underlined.

Table 2

Polynucleotide sequences of amplification primers

Characteristic

Sequence Identifier

Complementary to the target

ATTTCTTGTTCTGTGGTAATCATGTTG Sec. ID No.: 11

Complementary to the target

TTGTTTTTGTAATAGTTGTATTTCTTGTTCTG Sec. ID No.: 12

Complementary to the target

image 1 Sec. ID No.: 13

Complementary to the target

image 1 Sec. ID No.: 14

Complementary to the target

image 1 Sec. ID No.: 15

Complementary to the target

GTTTGTATGTCTGTTGCTATTATGTCTA Sec. ID No. 16

Primer-Promoter

Sec. ID

T7

Nº: 17

T7 Primer-Promoter

image 1 ID No.: 18 Sec.

T7 Primer-Promoter

image 1 Nº ID: 19 Sec.

T7 Primer-Promoter

image 1 ID No.: 20 Sec.

T7 Primer-Promoter

image 1 Nº ID: 21 Sec.

T7 Primer-Promoter

image 1 ID No.: 22 Sec.

Preferable groups of primers to amplify HIV-1, HIV-2, or the combination of HIV-1 and HIV-2 sequences in the region encoding the p31 integrase includes a first primer that hybridizes the target nucleic acids that go

5 to be amplified (as one of the primers in Table 2) and a second primer that is complementary to the sequence of an extension product of the first primer (as one of the primer sequences of Table 1). In a highly preferable embodiment, the first primer is a

10 promoter-primer that includes a T7 promoter sequence at its 5 ′ end. Preferable detection probes Another aspect of the invention is related to oligonucleotides that can be used as hybrid probes.

15 tion for the detection of HIV-1, HIV-2, or the combination of HIV-1 and HIV-2 nucleic acids. In fact, the methods for amplifying a target sequence present in acids

HIV-1 or HIV-2 nuclei may include an optional step additional for the detection of amplicons. This procedure for the detection of nucleic acids of HIV-1 and / or HIV-2 includes a step to contact a test sample with a test hybridization probe that hybridizes with the target nucleic acid sequence, or the complement of it, under astringent hybridization conditions, thus forming a probe duplex: target that is stable for detection. Below is a step to determine if the Hybrid is present in the test sample as an indication of the presence or absence of HIV-1 or HIV-2 target nucleic acids in the test samples. This involves the detection of the probe duplex: target, and preferably It involves homogeneous test systems.

Test hybridization probes useful for the detection of HIV-1, HIV-2, or the combination of HIV-1 and HIV-2 nucleic acids include a sequence of bases substantially complementary to these acid sequences target nucleic Thus, the probes of the invention hybridize a chain of a nucleic acid target sequence, or the complementary to it. These probes may optionally have additional bases outside the target region of nucleic acids that may or may not be complementary to target nucleic acids to be detected.

Preferable probes are sufficiently homologous to the target nucleic acids to hybridize under conditions astringent hybridization corresponding to about 60˚C when the salt concentration is in the range of

0.6-0.9 M. Preferable salts include lithium chloride, but other salts such as sodium chloride and citrate can also be used in the hybridization solution. sodium. An example of highly astringent hybridization conditions is provided alternately by 0.48 M sodium phosphate buffer, 0.1% sodium dodecyl sulfate, and 1 mM EDTA and EGTA, or by 0.6 M LiCl, lauryl sulfate 1% lithium, 60 mM lithium succinate and 10 mM EDTA and EGTA

The probes according to the invention have sequences substantially complementary to, or substantially corresponding to portions of the HIV-1 and HIV genomes

2. Certain probes that are preferable for the detection of HIV-1, HIV-2, or the combination of HIV-1 and HIV-2 nucleic acid sequences possess a probe sequence that includes a sequence of bases complementary to the target, and optionally one or more base sequences that are not complementary to the nucleic acids to be detected. The base sequence complementary to the target is preferably in the length range of 10-100 nucleotides and It is capable of hybridizing with the amplified nucleic acid. Certain preferable probes that are capable of detecting HIV1, HIV-2, or the combination of HIV-1 and HIV-2 nucleic acid sequences possess complementary sequences to the target in the length range of 10-100, from 15-60, from 15-45 or from 20-30 nucleotides. Of course, these complementary sequences to the target can be sequences linear, or may contain in its structure a beacon mo

lecular, a molecular torch or other construct that possesses one or more optional nucleic acid sequences that It is not complementary to the target sequence to be detected. As indicated above, the probes they can be constituted of DNA, RNA, a combination of DNA and RNA, a nucleic acid analog, or contain one or more modified nucleosides (for example, a ribonucleoside with a 2’-O-methyl substitution in the ribofuranosyl portion).

Certain probes according to the present invention Include a detectable mark. In one embodiment this mark is attached to the probe by a different link to a nucleotide For example, detection probes can labeling with chemiluminescent acridinium ester compounds that are attached by a linker substantially as described in US Pat. No. 5,585,481; and in U.S. Patent No. 5,639,604, particularly as described in column 10, line 6 to column 11, line 3, and in Example 8.

Table 3 presents the basic sequences of some of the hybridization probes that are used for the detection of HIV-1 target sequences, HIV2 target sequences, or both HIV-1 and HIV-2 target sequences. Since the Alternative probes for the detection of these target nucleic acids can hybridize with opposite strands, the present description also includes oligonucleotides that are complementary to the sequences presented in

the board.

Table 3

Polynucleotide sequences of the detection probes

Sequence

Identifier

CCTGAATTTTAAAAGAAGGGGG

Sec. ID No. 23

CCAGAATTTTAAAAGAAGGGGIGG

Sec. ID No.: 24

CCACAATTTTAAAAGAAGGGGIGG

Sec. ID No.: 25

CCTGAATTTTAAAAGAAGGGGIGG

Sec. ID No.: 26

CATGAATTTTAAAAGAAGGGGA

Sec. ID No. 27

CCTGAATTTTAAAAGAAIGGGG

Sec. ID No.: 28

CCIGAATTTTAAAAGAAGGGGG

Sec. ID No. 29

CCIIAATTTTAAAAGAAGGGGG

Sec. ID No.: 30

AAAGAAIGGIGGGGATIGGGIGG

Sec. ID No.: 31

AAAGAAIGGIGGGGATTGGGIGG

Sec. ID No.: 32

AATTTTAAAAGAAGAGGIGGGATTGGGGG

Sec. ID No.: 33

CAATTTTAAAAGAAGGGGIGGG

Sec. ID No. 34

GAATTTTAAAAGAAGIGGGGIG

Sec. ID No. 35

GAAUUUUAAAAGAAGGGGIGGG

Sec. ID No. 36

As indicated above, any number of different framework structures can be used as support for the sequences of the bases of the hybridization probes. In certain highly preferable embodiments, the probe includes a methoxy framework, or at least one methoxy bond in the support structure of the nucleic acids. 10 Selection and use of capture oligonucleotides Preferred capture oligonucleotides include a first sequence that is substantially complementary

to a target sequence (ie, a sequence "complementary to the target") covalently linked to a second sequence (that is, a "tail" sequence) that serves as target for immobilization on a solid support. May any frame used to link the base sequence of a capture oligonucleotide. In certain preferred embodiments, the capture oligonucleotide includes the minus a methoxy link in the frame. The tail sequence, which is preferably at the 3 ’end of a capture oligonucleotide, is used to hybridize a sequence of complementary bases to provide a means to capture hybridized target nucleic acids in preference to other components in the biological sample.

Although any base sequence can be used which hybridizes to a complementary base sequence in the tail sequence, it is preferable that the sequence that hybridizes cover a length of about 5-50 nucleotide residues. Particularly preferable tail sequences they are substantially homopolymeric, and contain around from 10 to about 40 nucleotide residues, or more preferably about 14 to about 30 residues. A Capture oligonucleotide may include a first sequence that hybridizes to a target polynucleotide, and a second sequence that hybridizes to a stretch of oligo (dT) immobilized on a solid support.

Using the components illustrated in Figure 1, an assay for the detection of HIV-1, HIV-2, or the combination of HIV-1 and HIV-2 sequences in a biological sample

includes the capture steps of target nucleic acids using the capture oligonucleotide, amplify the region target captured using at least two primers, and detect the amplified nucleic acids by first hybridizing a probe labeled with a sequence that contained in the amplified nucleic acid, and then detect a signal that results from the bound labeled probe.

The capture step preferably uses a capture oligonucleotide that, under hybridization conditions, a portion of the capture oligonucleotide hybridizes so specific a sequence in the target nucleic acids and a tail portion serves as a component of a couple binding, such as a ligand (for example, a binding partner biotin-avidin) that allows the target region to separate from Other components of the sample. Preferably, the tail portion of the capture oligonucleotide is a sequence. that hybridizes with a complementary sequence immobilized in a solid support particle. Preferably, first, the capture oligonucleotide and nucleic acids Target are in a solution to take advantage of the hybridization kinetics of the solution phase. Hybridization produces a capture oligonucleotide complex: acids target nuclei that can bind to a probe immobilized to through hybridization of the tail portion of the capture oligonucleotide with a complementary immobilized sequence. Thus, a complex comprising an acid is formed. target nucleic, a capture oligonucleotide and a probe immobilized under hybridization conditions. Preferable

mind, the immobilized probe is a repetitive sequence, and more preferably a homopolymeric sequence (for example, poly-A, poly-T, poly-C or poly-G), which is complementary to the tail sequence and is attached to a solid support. For example, if the tail portion of the oligonucleotide capture contains a poly-A sequence, then the probe immobilized will contain a poly-T sequence, although it can any combination of complementary sequences be used. The capture oligonucleotide may also contain "spacers" residues, which are one or more bases located between the base sequence that hybridizes with the target and the base sequence of the tail that hybridizes with the probe immobilized Any solid support can be used to bind the target nucleic acid complex: oligonucleotide of capture. Useful supports can be matrices or free particles in solution (for example, nitrocellulose, nylon, glass, polyacrylate, mixed polymers, polystyrene, polypropylene silane and, preferably, particles of magnetic attraction). The joining methods of an in- mobilized to solid support are well known. The support it is preferably a particle that can be recovered from the solution using standard methods (for example, centrifugation, magnetic attraction of magnetic particles, and the like). Preferable supports are particles for monodispersible magnetic (ie uniform in size 6 around 5%).

The recovery of the nucleic acid complex di-

ana: capture oligonucleotide: effective immobilized probe

mind concentrates the target nucleic acids (in relation to its concentration in the biological sample) and purifies the target nucleic acids of amplification inhibitors which may be present in the biological sample. The captured target nucleic acids can be washed one or more times, in addition to purifying the target, for example, by resuspension of the particles with the bound complex of target nucleic acid: capture oligonucleotide: probe immobilized in a wash solution and then recovered the particles with the bound complex of the wash solution as described above. In one embodiment preferable, the capture step takes place by means of the sequential hybridization of the capture oligonucleotide with target nucleic acids and then adjust the hybridization conditions to allow hybridization of the tail portion of the capture oligonucleotide with a complementary immobilized sequence (for example, as described in PCT No. WO 98/50583). After completing the step of capture and any optional washing step, the target nucleic acids can be amplified. To limit the number In handling steps, the target nucleic acids can optionally be amplified without being released from the capture oligonucleotides.

Useful capture oligonucleotides can also contain mismatches in the nucleic acid sequence to be amplified. The capture of successful target and nucleic acid amplification can be achieved as long as the mismatched sequences hybridize with the

nucleic acid molecule that contains the sequence that It must be amplified. In effect, oligonucleotides for capture of HIV-1 nucleic acids, as described in International patent application published and identified by WO 03/106714, are used to practice the methods described here, including methods to detect HIV-2.

Preferable methods to amplify and detect target polynucleotide sequences

Preferable methods of the present invention are describe and illustrated by the examples presented below. Figure 1 schematically illustrates a system that can be used for the detection of a region target of the viral genome (shown by a thick horizontal line). This basic system includes four oligonucleotides (shown by shorter lines): an oligonucleotide capture that includes a sequence that hybridizes with a sequence in the target region and a tail ("T") that hybridizes with a complementary sequence immobilized on a support solid to capture the target region present in a biological sample; a T7-primer promoter that includes a sequence that specifically hybridizes with an HIV-1 sequence

or HIV-2 in the target region and a T7 promoter sequence ("P") which, when double-stranded, serves as a promoter functional for T7 RNA polymerase; a non-T7 primer which includes a sequence that specifically hybridizes with a first cDNA chain consisting of the sequence of the target region using the T7 promoter-primer; and one

labeled probe that includes a sequence that specifically hybridizes with a portion of the target region that is amplified using the two primers.

As indicated above, amplify the target region captured using the two primers can achieved by any of a series of reactions of Known amplification of nucleic acids that are familiar to those skilled in the art. In one embodiment Preferably, an amplification reaction associated with transcription, such as AMT, is used. In said embodiment, many chains of nucleic acids are produced from a single copy of target nucleic acid, thus allowing target detection by detection probes that are linked to the amplified sequences. Preferably, the transcription-associated amplification uses two types of primers (one refers to the promoter-primer because it contains a promoter sequence, marked as "P" in Figure 1, for an RNA polymerase) two enzymes (a reverse transcriptase and an RNA polymerase), and sus- treatment (deoxyribonucleoside triphosphate, ribonucleoside triphosphate) with appropriate salts and buffers in solution to produce multiple RNA transcripts from templates of a nucleic acid.

Referring to Figure 1, during amplification Transcription-mediated, target nucleic acids captured are hybridized to a first primer (shown as a T7-primer promoter). Using reverse transcriptase, a complementary DNA chain is synthesized from

of the T7-primer promoter using the target RNA as a template. A second primer, shown as a non-T7 primer, hybridizes with the newly synthesized DNA chain and extends by the action of a reverse transcriptase to form a DNA duplex, thus forming a T7 promoter region of double chain T7 RNA polymerase then generates multiple RNA transcripts using this functional T7 promoter. The AMT autocatalytic mechanism employs repetitive hybridization and polymerization steps after the passage of cDNA synthesis using RNA transcripts as molds to produce additional transcripts, amplifying thus the specific nucleic acid sequences of the target region

The detection step uses at least one detection probe that specifically binds to RNA transcripts amplified or amplicons described above. Preferably, the detection probe is marked with a mark which can be detected using a detection system homogeneous. For example, the labeled probe can be marked with an acridinium ester compound from which a chemiluminescent signal can be produced and detected, as has been described before. Alternatively, the labeled probe can comprise a fluorophore or a pair of fluorophore and blocker. A molecular beacon is an embodiment of said labeled probe that can be used in a homogeneous detection system.

Methods for the detection of HIV-1 nucleic acids

and / or HIV-2

Three different methods have also been invented for detect HIV-1 and HIV-2 nucleic acids in multiplex assays. Each method is distinguished from the other by use of primers with cross-reactivity or analyte-specific, and also through the use of probes with reactivity cross or analyte specific.

In the first method, independent groups are used of specific analyte primers, that is, a first set of specific nucleic acid primers of HIV 1 (but not HIV-2 nucleic acids) and a second group of specific primers for HIV-2 (but not acids nuclei of HIV-1), to synthesize amplicons in a single amplification reaction. Synthesized amplicons were then detected using a cross-reactivity probe that is capable of detecting both amplicons of HIV-1 and HIV-2. Positive hybridization results obtained using this method indicate that the sample of assay that provides nucleic acid molds for the amplification contains HIV-1 or HIV-2, without distinguishing between the two analytes.

In the second method, a set of priming is used. Doors with cross-reactivity to synthesize HIV-1 and / or HIV-2 amplicons in a single amplification reaction. Synthesized amplicons were then detected using different analyte specific probes. One of the probes is specific for HIV1 amplicons (but not for HIV-2 amplicons) while another of the probes is specific for HIV-2 amplicons (but

no of HIV-1 amplicons). The step for detection of amplicons synthesized using primers with re- cross activity may involve the combination of probes specific analyte in a single hybridization reaction, or hybridize separately each of the probes analyte-specific aliquots containing the products of the amplification reaction. If the probes are combine in a single hybridization reaction, then a Positive result indicates that a test sample contains HIV-1 or HIV-2, without distinguishing between the two analytes. Alternatively, if the probes hybridize separately with aliquots independent of the amplification reaction, then a positive result in one of the hybridization reactions will indicate that the analyte complementary to the probe contained in the reaction was present. in the test sample that provides the nucleic acid templates for amplification.

In the third method, a priming set is used- beef with cross reactivity to synthesize amplicons of HIV-1 and / or HIV-2 amplicons in a single reaction of amplification. Synthesized amplicons were detected at then using a cross reactivity probe which is capable of detecting both HIV-1 amplicons and HIV-2 amplicons. Positive hybridization results obtained using this method indicate that the test sample that provides nucleic acid templates for amplification contains HIV-1 or HIV-2, without distinguishing between

The two analytes.

Primers with cross-reactivity are particularly useful in multiplex reactions to amplify HIV-1 and / or HIV-2. Conventional multiplex reactions they usually involve the use of a few, or even several sets of independent primers, with each set of primers capable of amplifying a different nucleic acid analyte that may be present in a sample being analyzed. When the number of primers reaches a threshold value, there is a possibility that they occur undesirable primer-primer interactions. When this is the case, the primers can be consumed in production of undesirable extension products, which inhibits the efficient synthesis of specific analyte amplicons. One solution to this problem is to use the primers. with cross reactivity that allow amplification of multiple analytes, thus reducing the number of species of primers that should be included in the reaction.

Another benefit of primers and probes with cross-reactivity is also related to multiplex amplification reactions. More particularly, the preferable use of at least one cross-reactive primer, and more preferably at least one set of two primers with re- cross activity, in a multiplex amplification reaction provides redundancy in the detection of at least One of the analytes. This redundant detection is highly advantageous when one of the analytes is prone to mutation or exists in alternative forms that may be lost by the use of a single set of amplifier primers

tion. For example, if a multiplex amplification reaction is capable of detecting HIV-1 and HIV-2, it is desirable, of according to the present invention, carry out reactions of amplification using at least one priming set- res that are capable of amplifying both HIV-1 and HIV-2. When this is the case, cross-reactive primers will provide a redundant way to amplify the HIV-1 analyte polynucleotide. Similarly, a cross-reactivity probe capable of hybridizing with HIV-1 amplicons and with HIV-2 amplicons provides a redundant way for polynucleotide detection HIV-1 analyte in a hybridization reaction that contains a probe specific for HIV-1 but not for HIV-2.

It should be noted that the desired level of cross-reactivity between multiplex assay primers capable of amplifying portions of more than two analyte polynucleotides is limited. For example, when a multiplex reaction is capable of amplifying portions of three different analyte polynucleotides, a set of primers with cross reactivity according to the invention will be able to amplify portions of only two of the three analytes. When a multiplex reaction is able to amplify portions of four different analyte polynucleotides, a set of primers with cross reactivity according with the invention will be able to amplify portions of just two of the four analytes or only three of the four analytes. In general, a set of primers with reactivity cross according to the invention will be able to amplify

car portions of less than the total number of polynucleotides analyte than can be amplified in the multiplex reaction. This is clearly different from a situation in the that all analyte polynucleotides of a reaction multiplexes are amplified, but it may be the case when one of the primers in a reaction is an oligo-dT primer.

Equipment for the detection of HIV-1, HIV-2, or the combination of HIV-1 and HIV-2 nucleic acids

This description also covers equipment for perform polynucleotide amplification reactions using molds of viral nucleic acids. Some Preferable equipment includes a hybridization assay probe that possesses a base sequence complementary to the target, and optionally includes primers or other oligonucleotides to amplify the target to be detected by the hybridization assay probe. Other equipment Preferable contain a pair of oligonucleotide primers that can be used to amplify nucleic acids target in an in vitro amplification reaction. Examples of equipment includes a first and a second oligonucleotide or amplification primer that are complementary to opposite strands of the nucleic acid target sequence They must be amplified. The equipment may also contain one or more probes for the detection of amplification products synthesized by priming action- res that are contained in the equipment. Still other teams may additionally include capture oligonucleotides to purify the mold nucleic acids of the others is

species before amplification.

The general principles of the present invention can be fully appreciated by reference to the Following Non-limiting Examples.

Example 1 describes the procedures that identify some of the hybridization probes that follow they are used in assays for the detection of HIV-1, HIV2, or the combination of HIV-1 and HIV-2 nucleic acids. More particularly, the following procedures employ synthetic oligonucleotides as targets for the probes of hybridization. As indicated below, one of the probes used in the procedure have a substantially equivalent specificity for HIV-1 targets and HIV-2

Example 1

Oligonucleotide probes for the detection of HIV-1 and / or HIV-2

Synthetic target oligonucleotides were prepared from according to standard laboratory procedures using 2’-OMe nucleotide analogs to mimic RNA structures. The HIV-1 target model has the sequence of TCCCCCCTTTTCTTTTAAAATTGTGGATGA (Sec. ID No.: 37), while the HIV-2 target model has the sequence of TTCCTCCCCTTCTTTTAAAATTCATGCAAT (Sec. ID No.: 38). The probes to hybridize these synthetic targets possess the sequences given in Table 3, and were also prepared using 2'-OMe nucleotide analogs.

Hybridization reactions include about 2

x 106 Probe URL marked with AE with a specific activity of about 1-7 x 108 URL / pmol, and about 0.5 pmol of synthetic target oligonucleotide. The reactions of Negative control omit the target oligonucleotide. The numbered probes in Table 3 were marked with an AE portion attached to the oligonucleotide structure by a non-nucleotide linker disposed internally in accordance with the procedures described in US Pat. No. 5,585,481 and 5,639,604. The binders in the probes of Sec. ID No.: 23, Sec. ID No.: 30, Sec. ID No.: 27, Sec. ID No.: 28 and Sec. ID No.: 29 were located between positions 7 and 8. The linkers in the probes of Id. of Sec. No.: 24 and Sec. of Sec. No.: 25 were located between positions 13 and 14. The linker in the probe of Sec. Nº: 26 was located between positions 12 and 13. The linkers in the probes of Sec. ID No.: 31 and Id. Of Sec. No. 32 were located between positions 17 and 18. The linker in the probe of Sec. ID No. 33 was located between positions 26 and 27. The linker in the probe ID of Sec. No.: 34 was located between positions 9 and 10. The linker in the probe of Sec. ID No.: 35 was located between positions 8 and 9. The linker in the probe ID of Sec. No.: 36 was located between positions 11 and 12. The use of all these different binder positions confirm the versatility of this marking technique. Probe hybridizations were carried out at 60˚C for 15 minutes in 50 ml volumes of a Tris buffered solution that includes reagents used in the amplifi cation reaction

The reaction described in Example 2. The hybridization reactions were followed by the addition of a 0.15 M sodium tetraborate aliquot (pH 8.5), and 1% TRITON X-100 (Union Carbide Corporation; Danbury, CT). These mixtures were first incubated at 60 ° C for 10 minutes to inactivate the chemiluminescent label attached to the unhybridized probe, and cooled briefly to 4 ° C before reading the hybridization signal. The chemiluminescence of the hybridized probe in each sample was analyzed using a LUMISTAR GALAXY plate miniscence reader (BMG Labtechnologies Inc .; Durham, NC) configured for automatic injection of 1mM nitric acid and 0.1% hydrogen peroxide (v / v), followed by the injection of a solution containing 1 N sodium hydroxide. The results of the chemiluminescent qui15 reactions were measured in relative light units (URL). The representative results of this procedure are summarized in Table 4 for each of the three different target regions. In this procedure, the value of the signal / noise corresponds to the chemiluminescent signal (me

20 given in URL) generated by the label associated with the probe specifically hybridized by a background signal measured in the absence of a target nucleic acid. Each value represents the average of 5 replicas.

25

Table 4

Probe Hybridization Results

Probe of the Integrasa region p31

Diana HIV-1 (Sec. ID No. 37) Diana HIV-2 (Sec. ID No. 38)

URL remaining as% of T0 value

Signal / Noise  URL remaining as% of T0 value Signal / Noise

Sec. ID No. 23

2 one 101 58

Sec. ID No.: 24

7 one 61 8

Sec. ID No.: 25

110 12 107 eleven

Sec. ID No.: 26

6 one 72 13

Sec. ID No. 27

7 one 70 eleven

Sec. ID No.: 28

one one 49 35

Sec. ID No. 29

3 one 57 18

Sec. ID No.: 30

4 one 30 10

Sec. ID No.: 31

80 7 42 4

Sec. ID No.: 32

60 10 14 2

Sec. ID No.: 33

fifty 3. 4 2 one

Sec. ID No. 34

twenty-one 3 fifty 8

Sec. ID No. 35

2 one 54 31

Sec. ID No. 36

13 one 61 5

The results presented in Table 4 show that Some of the probes analyzed in the procedure provided a strong hybridization signal after interaction with one or both target sequences. Just some of the probes used in the procedure provided S / R values substantially greater than 10 when

hybridize with at least one of the synthetic targets.

It is striking that useful probe sequences they are distinguished between them by very subtle differences. For example, when compared to the probe that has the Sequence ID of Sec. No.: 24, the probe of Sec. of Sec. Nº: 26 differs only in two of the twenty-four nucleotide positions and retains a strong specificity for the target of HIV-2. On the other hand, a probe with the sequence of Sec. ID No.: 25 differs from the probe of Sec. Nº: 24 in just one of these two nucleotide positions different and have no specificity for the target of HIV-2 In fact, the probe of Sec. ID No.: 25 does not present a substantial specificity for neither of the two targets and was able to hybridize with substantially the same specificity to the targets of HIV-1 and HIV-2. In all three cases, the probes include a single inosine analog base and by which does not correspond to any natural form of nucleic acid sequence of HIV-1 or HIV-2.

Unusual properties of probe hybridization with the sequence of Sec. ID No.: 25 makes it very useful for the detection of HIV-1 or HIV-2. A positive result that indicates that this probe hybridizes with the products of a multiplex reaction that is capable of amplifying HIV-1 or HIV-2 indicates that the test sample that provides the molds of nucleic acids for amplification contain at least one of the two analytes. The use of the cross-reactivity probe of Sec. ID No.: 25 as a component in a hybridization probe reagent containing a probe is

separate species for HIV-1 (but not for HIV-2) advantageously provides a way to detect redundant the HIV-1 analyte while providing simultaneously a way to detect an analyte HIV-2 Although less preferable due to recovery reduced signal (see Table 4), a probe with the sequence of Sec. ID No.: 31 instead of the Probe of Sec. ID No.: 25 in applications where it is desirable to employ a probe that is capable of hybridizing with the nucleic acids of HIV-1 and HIV-2.

Highly preferable embodiments of the description employ the cross-reactive probe of ID of Sec. No.: 25 for the detection of nucleic acids from HIV-1 or HIV-2. For example, teams may include a Packaged combination of: Probe ID Sec. No.: 25 and a set of oligonucleotide primers that are specific for HIV-1 (but not for HIV-2) and a set of oligonucleotide primers that are specific for HIV-2 (but not for HIV-1). An alternative team may include a Packaged combination of: Probe ID Sec. No.: 25 and a set of oligonucleotide primers that have cross-reactivity with HIV-1 and HIV-2, indicating that they are capable of amplifying both HIV-1 and HIV nucleic acids

2.

Probes that are useful for acid detection nuclei of HIV-2, but not of nucleic acids of HIV-1, include: Sec. ID No.: 23, Sec. ID No.: 24, ID Sec. No.: 26, Sec. ID No.: 27, Sec. ID No.: 28, Id.

Sec. No.: 29, Sec. ID No.: 30, Sec. ID No.: 35, and Id. Sec. No.: 36.

Preferred primer combinations to amplify HIV-1, HIV-2, or the nucleic acid combination of HIV-1 and HIV-2 are identified in a series of procedures which use virions as a source of nucleic acid molds. Primers-promoter and primers of opposite chain in combination using the described method later. Although these procedures were carried out particularly using an amplification protocol Transcription-mediated (AMT) primers described herein can be used to produce amplicons by alternative nucleic acid amplification methods in vitro that will be familiar to experts in the field.

Example 2 describes the methods that identify primers useful for amplifying the p31 integrase region of HIV-1 and / or HIV-2.

Example 2

Identification of amplification primers

A high titration cell lysate containing HIV-2 B6 virus particles served as a source of sequences HIV-2 template in amplification reactions that used groups of primer pairs. Serum was used virus negative to prepare diluted stock solutions containing 100 copies / ml of HIV-1 nucleic acid template, or 300 copies / ml of HIV-2 nucleic acid template. For example, a solution was prepared that Contains 100 copies / ml of nucleic acid template

HIV-2 The nucleic acids underwent a processing of samples and target capture before amplification essentially in accordance with the procedures described in the Published International Patent Application No. PCT / US2000 / 18685, with the exception that the molds were captured using the oligonucleotides described in the Application of published International patent identified by WO 03/106714 for the capture of HIV-1 nucleic acids. In in particular, capture oligonucleotides do not participate in the steps of amplification or detection of the test. The samples containing viruses with volumes of 0.5 ml are combined with a target capture reagent to facilitate nucleic acid release and hybridization to capture oligonucleotides arranged in magnetic beads. AMT reactions were carried out essentially as described in Kacian et al., in US Patent No. 5,399,491. The promoter primers include a T7 promoter sequence AATTTAATACGACTCACTATAGGGAGA (Id. Sec. Nº: 39) upstream of a sequence complementary to the Diana. The amplification reactions were performed to several primer combinations using 15 pmol of each primer in 100 ml of reaction buffer. The isolated target nucleic acids were combined with primers in a buffer of standard nucleic acid amplification, heated to 60˚C for 10 minutes and then cooled to 42˚C to facilitate primer hybridization. Muroney leukemia Moloney virus reverse transcriptase was added (MMLV) (5,600 units / reaction) and T7 RNA polymerase

(3,500 units / reaction) to the mixtures. The reactions of amplification were carried out in a buffered Tris solution (pH 8.2 to 8.5) containing KCl, 5'-triphosphate deoxyribonucleoside, 5'-triphosphate ribonucleoside, N-acetyl-Lcysteine, and 5% glycerol (w / v), as experts in the field know. After one hour of incubation at 42˚C, the 100 ml of the amplification reaction was subjected to an hybridization assay essentially as described in Example 1 using an independent HIV-1 specific probe that does not cross-hybridize with HIV-2, and HIV-2 specific probe of Sec. ID No.: 23 not have cross hybridization with HIV-1. The probes were labeled with acridinium ester for specific activities of about 1-7 x 108 URL / pmol and then used in amounts equivalent to about 2 x 106 URLs for Each hybridization reaction. Specifically hybridized probes were quantified after chemical inactivation of the chemiluminescent label associated with the unhybridized probe in a homogeneous assay essentially as described in Example 1. The tests were performed using 10 replicas Judging by the positive result, the chemiluminescent signal indicated that probe hybridization had exceeded 50,000 URLs in one trial.

Table 5 presents the results of the amplification procedures that were performed using different combinations of amplification primers. The numerical values that appear in the table represent the per

percentage of positive trials.

Table 5

Amplification of HIV-1 polynucleotide sequences and HIV-2 using various combinations of primers

primer no T7

Diana (c / ml) Sequence of T7 primer complementary to the target

Sec. ID No. 11

Sec. ID No. 12 Sec. ID No. 13 Sec. ID No. 14 Sec. ID No. 15 Sec. ID No. 16

ID of

HIV-1 (100) 0% 0% 100% ND ND 100%

Sec. No. 1

HIV-2 (100) 100% 100% 0% ND ND 0%

ID of

HIV-1 (100) 0% 0% 100% ND ND 100%

Sec. No. 2

HIV-2 (100) 100% 100% 0% ND ND ND

HIV-2 (300)

ND ND ND ND ND 100%

ID of

HIV-1 (100) 0% ND ND ND ND ND

Sec. No. 3

HIV-2 (100) 100% 100% 100% ND ND ND

ID of

HIV-1 (100) ND ND ND 100% ND ND

Sec. No. 4

HIV-2 (300) ND ND ND 0% ND ND

ID of

HIV-1 (100) ND ND ND 100% ND ND

Sec. No. 5

HIV-2 (300) ND ND ND 0% ND ND

ID of

HIV-1 (100) ND ND ND 100% ND ND

Sec. No. 6

HIV-2 (300) ND ND ND 0% ND ND

ID of

HIV-1 (100) ND ND ND 100% ND ND

Sec. No. 7

HIV-2 (300) ND ND ND 100% ND ND

ID of

HIV-1 (100) ND ND ND 100% ND ND

Sec. No. 8

HIV-2 (300) ND ND ND 57% ND ND

ID of

HIV-1 (100) ND ND ND 80% ND ND

Sec. No. 9

HIV-2 (300) ND ND ND fifty% ND ND

"ND" indicates not determined (pair of primers not analyzed)

The results presented in Table 5 show that some of the primer combinations provide levels very high detectability of HIV-1 and HIV-2, even in levels as low as 50 copies of the viral template per reaction. More specifically, excellent results were obtained using a primer with the complementary sequence to the target ID of Sec. No.: 2 in combination with a primer with the sequence complementary to the target of any of Sec. ID No.: 13, Sec. ID No.: 14, Sec. Nº: 15, or ID of Sec. Nº: 16. They also achieved excellent results using a primer with the sequence complementary to the target ID of Sec. No.: 14 in combination with a primer with the sequence complementary to the target of any of Sec. ID No.: 7, Sec. ID No.: 8, or ID of Sec. No.: 9. The target complementary portions of these last three primers formed the consensus sequence TAGAGACAGNAGTACNAATGGC (Seq. ID No.: 40), in which the position 10 is occupied by C, T or I, and in which position 16 is occupied by T or I. The primers that make up this consensus are preferable to amplify acids HIV-1 or HIV-2 target nuclei. A combination of primers with the complementary sequences to the target ID of Sec. No.: 14 and Sec. ID No.: 7 are advantageously capable of amplifying the largest number of genetic variants of HIV-1 and HIV-2. In particular, no reactions were observed

of false positives in these procedures.

Although the previous Example describes the tests performed using independent probes that were specific for HIV-1 (but not for HIV-2) and for HIV-2 (but not for HIV-1), the description also covers compositions, equipment and methods that employ probes that present cross reactivity with HIV-1 and HIV-2. Particular examples of cross-reactive probes that can be used along with any combination of primers above described that have the sequences of Sec. ID No. 25 e Sec. ID No.: 31.

The ability of a selected set of oligonucleotides to amplify and detect a series of different HIV-2 isolates is demonstrated below.

Example 3 describes procedures that demonstrate that the primers and probes of the invention are useful for the detection of a wide range of HIV-2 isolates.

Example 3

Wide range of HIV-2 detectability

Primers that have the sequences complementary to the target of Sec. ID No.: 7 and Sec. ID No.: 14 are used in combination to amplify nucleic acids HIV-2 template from seven different strains of HIV-2 which are available as lysates with high titration. These specimens were diluted in serum negative for virus to produce solutions with viral mold concentrations of 300 copies / ml. As in the previous Example, samples containing viruses with volumes of 0.5 ml are combined with a target capture reagent for faci

Limit nucleic acid release and hybridization to capture oligonucleotides that are arranged in magnetic beads. The amplification reactions were carried out as described in the previous Example. Amplicons were detected essentially as described in Example 1, except that an HIV-2-specific AE-labeled probe was used with the sequence of Seq. ID No.: 23, and the detection step was carried out using a LEADER HC + luminometer (Gen-Probe Incorporated, CA). Trials that provided specific hybridization signals of at least 50,000 URLs were considered positive. All trials were carried out in replicas of ten. The results of these procedures are presented in Table 6.

Table 6

Amplification and detection of different HIV-2 isolates

HIV-2 strain

Positive% (N = 10)

HIV-2 B2

100

HIV-2 B3

100

HIV-2 B4

100

HIV-2 B5

100

HIV-2 B7

100

HIV-2 B8

100

HIV-2 B9

100

The results presented in Table 6 showed that primers with cross-reactivity with the sequences complementary to the target ID of Sec. No.: 7 and ID of Sec. No.: 14 were able to amplify nucleic acids to from a series of different strains of HIV-2, and for

ma similar to an HIV-2 specific probe with the sequence of Sec. ID No.: 23 was able to detect nucleic acids from a number of different strains of HIV-2. These primers and this probe represent preferable embodiments of the invention.

Although the above Example illustrates an essay based on the combined use of primers with cross-reactivity and an analyte specific probe, the present invention also encompasses the embodiments in which the primers with Cross reactivity is used in combination, or packaged in a kit, with a probe that also has cross reactivity, indicating that the probe is capable of hybridize independently with nucleic acids or amplicons of HIV-1 and HIV-2. Particular examples of primers with cross-reactivity and probes with reactivity crossed are described in this document. For example, the Illustrative HIV-2 specific probe used in this Example can be replaced by a probe with reactivity cross identified by Sec. ID No.: 25 or Sec. Nº: 31.

The following Example demonstrates that the two different primer combinations were able to amplify a HIV-2 nucleic acid template in an amount equal to 150 copies / reaction. Significantly, these amplification and detection procedures were performed in a reaction mixture that was capable of multiplex amplification of HIV-1, HIV-2, HBV and HCV. These results showed that the presence of specific primers for ex targets

Trañas do not adversely affect HIV detection

2.

Example 4 describes the procedures that demonstrate how the primers of the invention can be combined in a multiplex nucleic acid amplification reaction capable of detecting HIV-1, HIV-2, HBV and HCV.

Example 4

Amplification of HIV-2 nucleic acids in a multiplex test

The primers with the sequences of Sec. ID No.: 20 (Sequence complementary to the target of (Sec. ID No.: 14) and Sec. ID No.: 2 or Sec. ID No.: 7 were added to a reaction formulation that includes primers capable of amplify analytes that includes HIV-1, HBV and HCV. Multiplex test formulations to capture target, amplification and detection based on the probe of these targets is described in the international patent application published and identified by WO 03/106714. Like in In Example 2, samples containing HIV-1 or HIV-2 virions were prepared by diluting titration solutions elevated with virus-free serum. Capture reactions Target and nucleic acid amplification were performed using 0.5 ml of diluted virus sample, such as It is described in this document. Amplicon detection of HIV-2 by the procedures described above were carried out using the specific probe of HIV-2 of Sec. ID No.: 23, together with the specific probes for the detection of amplicons of HIV-1, HBV and HCV.

-90 Trials that provide specific hybridization signals of at least 50,000 URLs were considered positive. The results of these procedures appear in the Table 7.

Table 7

HIV-2 detection in a multiplex trial

Primer sequences complementary to the target

Diana % Positive

Sec. ID No.: 2

HIV-1 Type B (100 c / ml) 100% (N = 10)

Sec. ID No.: 14

HIV-2 B8 (300 c / ml) 100% (N = 10)

Sec. ID No.: 7

HIV-1 Type B (100 c / ml) 100% (N = 40)

Sec. ID No.: 14

HIV-2 B7 (300 c / ml) 100% (N = 40)

The results presented in Table 7 confirmed that the different combinations of the primers of the invention were able to efficiently detect HIV-2 target nucleic acids in multiplex reactions that were

10 also capable of amplifying and detecting HIV-1, HBV and HCV. In addition to the assays described above that detect HIV-1 and HIV-2 sequences in the regions encoding p31 integrase, a second target region, located in the gene encoding p51 reverse transcriptase

15 (TI), it was also found to be useful for the detection of HIV-1 and HIV-2 nucleic acids. The methods used to make this second demonstration were essentially as described before. The oligonucleotide probes used in the procedures to identify with are

-91 days of cross-reactivity in the RT target region of p51 possess the sequences presented in Table 8.

Table 8

Sequences of detection probes

Sequence

Identifier

AGGCAGUAUACUGCAUUUACCIUACC

Sec. ID No.: 41

GTATACTGCATTTACCCTACC

Sec. ID No. 42

AGGAAGUAUACUGCAUUUACCIUACC

Sec. ID No. 43

AGGAAGUAUACUGCAUUUACCAUACC

Sec. ID No. 44

Example 5 describes the procedures used

5 to identify candidate probes with cross-reactivity that hybridize with the p51 RT regions of HIV-1 and HIV-2 nucleic acids.

Example 5

Oligonucleotide probes for the detection of HIV-1

10 and / or HIV-2 Synthetic target oligonucleotides were prepared according to standard laboratory procedures. The HIV-1 target model has the sequence CUAGGUAUGGUAAAUGCAGUAUACUUC (Sec. ID No.: 45), while the HIV-2 target

15 model has the sequence of GAUGGUAGGGUAAAUGCAGUAUACU (Sec. ID No. 46). The targets of HIV-1 and HIV-2 were synthesized using RNA precursors. The probes to hybridize these synthetic targets possess the sequences given in Table 8, and were prepared using nucleotide analogs

20 2’-OMe. Hybridization reactions include about 2 x 106 probe URLs labeled with AE with a specific activity

Physical of about 1-7 x 108 URL / pmol, and about 0.5 pmol of synthetic target oligonucleotide. The reactions of Negative control omitted the target oligonucleotide. The Table 8 probes were marked with an AE portion together with the oligonucleotide structure by a linker non-nucleotide disposed internally in accordance with procedures described in US Pat. Nos.

5,585,481 and 5,639,604. The linker in the ID probe of Sec. No.: 42, alternatively located between nucleotides 7 and 8, between nucleotides 11 and 12, or between nucleotides 12 and 13. The linkers in the probes of ID. Sec. No.: 41, Sec. ID No.: 43, and Sec. ID No.: 44 were all located between nucleotides 12 and 13. The use of these different linker positions confirmed the versatility of this labeling technique. . The hybridizations of the probe were carried out at 60˚C for 15 minutes in 50 ml volumes of a Tris buffered solution that includes the reagents used in the amplification reaction described in Example 2. Hybridization reactions were followed by the addition of a 0.15 M sodium tetraborate aliquot (pH 8.5), and 1% TRITON X-100 (Union Carbide Corporation; Danbury, CT). These mixtures were first incubated at 60˚C for 10 minutes to inactivate labeling. Chemiluminescent bound to the unhybridized probe, and briefly cooled to 4˚C before reading the hybridization signal. Chemiluminescence due to the hybridized probe in each sample was analyzed using a luminescence reader in LUMISTAR GALAXY plates (BMG Labtechnologies Inc .; Durham,

NC) configured for automatic injection of 1 mM nitric acid and 0.1% (v / v) hydrogen peroxide, followed by injection of a solution containing 1 N sodium hydroxide. Results for chemilumines5 cents reactions were measured. in relative units of light (URL). The representative results of this procedure are summarized in Table 9 for each of the three different probe sequences. In this procedure, the signal / noise value corresponds to the chemiluminescent signal (measured

10 in URL) generated by the label associated with the specifically hybridized probe divided by the background signal measured in the absence of a target nucleic acid. Each value represents the average of 5 replicas.

Table 9

Results of probe hybridization

RT probe region of p51

Diana HIV-1 (Sec. ID No. 45) Diana HIV-2 (Sec. ID No. 46)

URL remaining as% of T0 value

Signal / Noise  URL remaining as% of T0 value Signal / Noise

Sec. ID No.: 41

66.7 5.1 66.1 5.0

Sec. ID No. 42

111.4 296.2 101.5 269.8

Sec. ID No. 43

103.7 159.9 97.7 150.7

Sec. ID No. 44

112.8 162.8 114.1 164.6

The results presented in Table 9 show that most of the probes analyzed in the procedure provided strong signs of hybridization and relationships signal / noise after interaction with each of the different

Rents target sequences. In particular, the result presented for the probe of Sec. ID No.: 42 was obtained using the probe with its label positioned between nucleotides 12 and 13. However, excellent results were also achieved. results using the same probe sequence with the alternately positioned markings. More specific- mind, signal / noise values for the collection of three probes of Sec. ID No.: 42 were in the range from about 218 to about 296 for the target HIV-1, and from about 220 to about 282 for the HIV-2 target. In addition to probes with the sequence of Id. of Sec. No.: 42, the probes of Sec. ID No.: 43 and Id. of Sec. No.: 44 are also highly preferable for the detection of one or both HIV-1 and HIV target nucleic acids.

2. Of course, the complements of these sequences They are also preferable alternatives.

It is striking that the probes with high performance in the test described above, they included all the target complementary sequences of the adjacent bases 21-26, contained in the consensus sequence provided by AGGAAGTATACTGCATTTACCNTACC (Sec. ID No. 62), allowing the equivalent bases of RNA and DNA, in which "N" is any of A, C or 1. The 26-meter probe of Sec. ID No.: 41 did not perform well in the hybridization test (see Table 9), and does not fit the consensus sequence. In In particular, this low-performance probe differs from the cross-reactivity probe of Sec. ID No. 43, which performed well in the assay, with only one change

single base. This illustrates the unusual and unexpected nature of the advantages of the cross-reactivity probe. as described before.

The highly preferable embodiments of the invention employ one or more probes with cross-reactivity of Sec. ID No.: 42, Sec. ID No.: 43 or Sec. ID No.: 44 for the detection of any of the nucleic acids of HIV-1 or HIV-2. However, teams may include in packaged combinations: any probe with the sequence of Sec. ID No.: 42, Sec. ID No.: 43 or Sec. ID No.: 44 and a set of oligonucleotide primers that are specific for HIV-1 (but not for HIV-2) and / or a set of oligonucleotide primers that are specific for HIV-2 (but not for HIV-1). An alternative team may include in packaged combinations: any probe with the sequence of Sec. ID No.: 42, Sec. ID No.: 43 or Sec. No.: 44 and a set of oligonucleotide primers that have cross-reactivity with HIV-1 and HIV-2, indicating that they are primers capable of amplifying both nucleic acids of HIV-1 and HIV-2. Probes with cross reactivity are particularly preferable for use in the methods in which synthesized HIV-1 or HIV-2 amplicons are detected using the cross-reactivity amplification primers described in the following Example.

In particular, in certain embodiments it will be desirable. use probes with the sequences attached to the 5 ’end 3 'of the sequences of the complementary probe to the target, whose sequences are not complementary, what you want from

cir that do not hybridize with HIV-1 or HIV-2 amplicons. In these cases it is preferable that the total length of the probe molecule is up to 60 bases, more preferably up to 26 bases in length. Sequence Examples together that are not complementary to HIV-1 amplicons

or HIV-2 include the "arm" sequences that comprise the "main" portions of the molecular beacons.

Preferred primer combinations to amplify HIV-1 or HIV-2, or the nucleic acid combination of HIV-1 and HIV-2 were identified in a series of procedures that used virions as the source of the mold of the nucleic acids. The promoter primers and the primers of the opposite chain were analyzed in combination using The method described above. Although these procedures were carried out particularly using a transcription-mediated amplification protocol (AMT), the primers described herein can be used to produce amplicons by in vitro alternative nucleic acid amplification methods that will be familiar to subject matter experts. Tables 10 and 11 present the amplification primer sequences that were used in the procedures described under Example 6. In particular, the primers of Sec. ID No.: 51-54 correspond to the primers of Sec. ID No.: 55-58, respectively, but also include river promoter sequences above that are not complementary to the targets of HIV-1 and HIV-2

Table 10

Sequence of amplification primers

Sequence

Identifier

CTTAGATAAAGAITTCAGGAAGTATA

Sec. ID No. 47

CTTAGATAAAGATTTTAGGAAGTATA

Sec. ID No. 48

CTTAGATAAAGATTTTAGGCAGTATA

Sec. ID No. 49

CTTAGATAAAGATTTTAGGIAGTATA

Sec. ID No.: 50

Table 11

Sequence of amplification primers

Characteristic

Sequence Identifier

Complementary to the target

TTGCTGGTGATCCCTTCCATCCTTGTGG Sec. ID No. 51

Complementary to the target

TTGCTGGTGATCCCTTCCATCCCTGTGG Sec. ID No. 52

Complementary to the target

TTGCTGGTGATCCTTTCCATCC Sec. ID No. 53

Complementary to the target

TTGCTGGTGATCCCTTCCATCC Sec. ID No.: 54

T7 Promoter Primer

image 1 Sec. ID No.: 55

T7 Promoter Primer

image 1 Sec. ID No. 56

T7 Promoter Primer

image 1 Sec. ID No. 57

T7 Promoter Primer

image 1 Sec. ID No. 58

Example 6 describes the methods that identify the

primers useful for amplifying the RT region of p51 of HIV-1 and / or HIV-2.

Example 6

Identification of amplification primers

Cultivated HIV-2 B6 virus particles of tissues served as a source of HIV-2 template sequences in amplification reactions that employed groups of primer pairs. The virus-free serum was used to prepare diluted stock solutions containing 100 copies / ml of the HIV-1 nucleic acid template, or 300 copies / ml of the HIV-2 nucleic acid template. Acids nuclei underwent specimen processing and target capture before essentially amplification of in accordance with the procedures described in the application for published international patent No. PCT / US2000 / 18685, except that the templates were captured using the oligonucleotides described in the published international patent application and identified by WO 03/1061414 for HIV-1 nucleic acid capture. In particular, the capture oligonucleotides do not participate in the steps of amplification or detection of the assay. Samples containing viruses that have 0.5 ml volumes were combined. with a target capture reagent to facilitate nucleic acid release and hybridization to capture oligonucleotides arranged in the magnetic beads. AMT reactions were carried out essentially as described in Kacian et al., In US Patent No. 5,399,491. Primer-promoters include

a T7 promoter sequence provided by Sec. Nº: 39 upstream of a complementary sequence to the target. Amplification reactions were performed for various primer combinations using 15 pmol of each primer in 100 ml of reaction buffer. The isolated target nucleic acids were combined with primers in a buffer nucleic acid amplification standard, heated to 60˚C for 10 minutes and then cooled to 42˚C to facilitate primer hybridization. It was added to the mixtures Moloney murine leukemia virus (MMLV), reverse transcriptase (5,600 units / reaction) and T7 RNA polymerase

(3,500 units / reaction). Amplification reactions were carried out in a buffered Tris solution (pH 8.2 a 8.5) containing KCl, 5'-triphosphate deoxyribonucleoside, 5'-triphosphate ribonucleoside, N-acetyl-L-cysteine, and 5% (w / v) glycerol, as is familiar to those skilled in the art. After one hour of incubation at 42˚C, the 100 ml of the amplification reaction were subjected to an assay of hybridization essentially as described in Example 1 using a mixture of the probe described above with the sequence of Sec. ID No.: 42. For the purpose of this demonstration, a mixture of probes with the sequence of Sec. ID No.: 42 with the markings positioned between the nucleotides 7 and 8, 11 and 12, and 12 and 13 were used in a 2: 1: 1 ratio, respectively. The probes were marked with acridinium ester for specific activities about 1-7 x 108 URL / pmol and then they were used in amounts equivalent to about 2 x 106 URLs for

Each hybridization reaction. The probe specifically hybridized was quantified after chemical inactivation of the chemiluminescent label associated with the unhybridized probe in a homogeneous test essentially as described in the

5 Example 1. The tests were performed using 10 replicates. Judging by the positive result, the chemiluminescent signal that indicates probe hybridization must exceed 50,000 URLs in one trial.

Table 12 presents the results of the procedures.

10 hundred amplifications that were performed using different combinations of amplification primers. The numerical values that appear in the Table represent the percentage of positive trials. Table 12

15 Amplification of HIV-1 and HIV-2 polynucleotide sequences using various combinations of primers

primer no T7

Diana (c / ml) Sequence of T7 primer complementary to the target

Sec. ID No. 51

Sec. ID No. 52 Sec. ID No. 53 Sec. ID No. 54

Sec. ID No. 47

HIV-1 (100) 100% ND 100% ND

HIV-2 (300)

100% ND 100% ND

Sec. ID No. 48

HIV-1 (100) ND 100% ND 100%

HIV-2 (300)

ND 100% ND 100%

Sec. ID No. 49

HIV-1 (100) 100% ND 100% ND

HIV-2 (300)

100% ND 100% ND

Sec. ID No. 50

HIV-1 (100) 100% ND 100% ND

HIV-2 (300)

100% ND 100% ND

The results presented in Table 12 show that all selected primer combinations were useful for the detection of HIV-1 and HIV-2. Portions complementary to the target of useful primers complementary to a chain of the target to be amplified, includes a sequence consisting of the consensus TTGCTGGTGATCCYTTCCATCC (Sec. ID No. 59), in which position 14 is occupied by C or T, and has a length of up to 28 bases. In a preferable embodiment, the primer constituted by the consensus sequence TTGCTGGTGATCCYTTCCATCCYTGTGG (S Id. of Sec. No.: 60), in which positions 14 and 23 are independently occupied by C or T. Preferable primers may also include optional 5 'sequences that do not they are complementary to the target of HIV-1 or HIV-2 to amplify. Complementary portions of the fattening target useful values of a chain opposite the consensus sequence CTTAGATAAAGANTTYAGGNAGTATA (Sec. ID No. 61), in which position 13 is occupied by T or I, in which position 16 is occupied by C or T, and in which position 20 is occupied by A, C or I. The primers that make up this consensus are also preferable for amplifying target nucleic acids of HIV-1 or HIV-2, and may also include optional 5 'sequences that are not complementary to that of target HIV-1 or HIV-2 to amplify. In particular, no false positive reactions were observed in the procedures described above.

Although the above Example illustrates an essay based on

the combined use of primers with cross-reactivity and

with probes with cross reactivity, the present description it also encompasses embodiments in which the primers with cross reactivity are used in combination, or packaged in a team, with independent probes, specific to HIV-1 and HIV-2 analyte.

The following Example demonstrates that the primers of the RT region of p51 with cross reactivity described herein were able to amplify molds of HIV-1 and HIV-2 even when the procedures were performed in a mixture of reaction that was able to multiplex amplification of HTV-1, HIV-2, HBV and HCV. These results show that the presence of specific primers for non-target targets adversely impact HIV-2 detection.

Example 7 describes the procedures that demonstrate how primers can be combined in a reaction nucleic acid amplification multiplex capable of detecting HIV-1, HIV-2, HBV and HCV.

Example 7

Amplification of HIV-2 nucleic acids in a multiplex assay

The primers with the sequences of Sec. ID No.: 57 (Sequence complementary to the target ID of Sec. No.: 53) and Sec. ID No. 49 were added to the reaction formulation that includes primers capable of amplifying analytes that include any combination of HBV and HCV, or combination of HIV-1, HBV and HCV. Multiplex test formulations to perform target captures, amplification and probe-based detection of these targets are

described in the international patent application published and identified by WO 03/106714. As in Example 2, samples containing HIV-1 or HIV-2 virions were prepared by diluting high titration stock solutions with serum without virus. Target capture reactions and nucleic acid amplification reactions were performed using 0.5 ml of diluted virus samples, as described herein. The detection of HIV-2 amplicons was carried out using the probe reagent described in the previous Example. The detection of HBV and HCV amplicons was carried out using the labeled hybridization probes specific for these targets. Assays that provide specific hybridization signals of at least 50,000 URLs were considered positive. The results of these procedures

coughs appear in Table 13.

Table 13

HIV-2 detection in a multiplex trial

Sequence of primer complementary to the target

Diana % Positive

Sec. ID No. 53

HIV-1 type B (100 c / ml) 100%

HIV-2 type A (300 c / ml)

100%

Sec. ID No. 49

HCV (60 c / ml) 100%

HBV (15 IU / ml)

100%

The results presented in Table 13 confirm that the primers were able to efficiently amplify the nucleic acids of the HIV-1 and HIV-2 target in multiplex reactions that were also able to amplify and detect other viral targets. Also as shown in the table, low levels of HBV targets (15 IU / ml) and HCV subtype 2b (60 copies / ml) were efficiently detected in multiplex reactions capable of amplifying HIV-1 and HIV-2. Significantly, the same results were obtained using the reaction conditions included or omitted with the specific HIV-1 amplification primers. Thus, the described primers of HIV-1 / -2 with reactant

10 cross-lives efficiently detected both HIV-1 and HIV2, and do not interfere with the amplification and detection of the remaining viral targets in the multiplex reaction.

SEQUENCE LIST

<110> Gen-Probe Incorporated Linnen, Jeffrey M. Wu, Wen

<120> Compositions, Methods and Equipment for the detection of nucleic acids of HIV-1 and HIV-2

<130> GP149

<150> US 60 / 531,183

<151> 2003-12-19

<150> US 60 / 584,706

<151> 2004-06-30

<160> 62

<170> PatentIn version 3.3

<210> 1

<211> 19

<212> DNA

<213> Human immunodeficiency virus

<400> 1 acagcagtac aaatggcag 19

<210> 2

<211> 20

<212> DNA

<213> Human immunodeficiency virus

<400> 2 acaacagtac aaatggcagt 20

<210> 3

<211> 20

<212> DNA

<213> Human immunodeficiency virus

<400> 3 acaatagtac taatggcagt 20

<210> 4

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<400> 4 ttaagacagc agtacaaatg gc 22

<210> 5

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<400> 5 tagagacagc agtacaaatg gc 22

<210> 6

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (16) .. (16)

<223> inosine

<400> 6 tagagacagc agtacnaatg gc 22

<210> 7

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (16) .. (16)

<223> inosine

<400> 7 tagagacagt agtacnaatg gc 22

<210> 8

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<400> 8 tagagacagc agtactaatg gc 22

<210> 9

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (10) .. (10)

<223> inosine

<220>

<221> miscellaneous feature

<222> (16) .. (16)

<223> inosine

<400> 9 tagagacagn agtacnaatg gc 22

<210> 10

<211> 17

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (11) .. (11)

<223> position 11 occupied by A or T / U

<400> 10 to caryagtac waatggc 17

<210> 11

<211> 27

<212> DNA

<213> Human immunodeficiency virus

<400> 11 atttcttgtt ctgtggtaat catgttg 27

<210> 12

<211> 32

<212> DNA

<213> Human immunodeficiency virus

<400> 12 ttgtttttgt aatagttgta tttcttgttc tg 32

<210> 13

<211> 44

<212> DNA

<213> Human immunodeficiency virus

<400> 13 gtttgtatgt ctgttgctat tatgtctatt agtctttctg ctgg 44

<210> 14

<211> 38

<212> DNA

<213> Human immunodeficiency virus

<400> 14 gtttgtatgt ctgttgctat catgttgatt attctttc 38

<210> 15

<211> 35

<212> DNA

<213> Human immunodeficiency virus

<400> 15 atttgttttt gtaattcttg tatttctatg tctgt 35

<210> 16

<211> 28

<212> DNA

<213> Human immunodeficiency virus

<400> 16 gtttgtatgt ctgttgctat tatgtcta 28

<210> 17

<211> 54

<212> DNA

<213> Artificial

<220>

<223> T7 promoter-primer

<400> 17

aatttaatac gactcactat agggagaatt tcttgttctg tggtaatcat gttg 54

<210> 18

<211> 59

<212> DNA

<213> Artificial

<220>

<223> T7 promoter-primer

<400> 18

aatttaatac gactcactat agggagattg tttttgtaat agttgtattt cttgttctg 59

<210> 19

<211> 71

<212> DNA

<213> Artificial

<220>

<223> T7 promoter-primer

<400> 19

image 1

<210> 20

<211> 65

<212> DNA

<213> Artificial

<220>

<223> T7 promoter-primer

<400> 20

<210> 21

image 1

<211> 62

<212> DNA

<213> Artificial

<220>

<223> T7 promoter-primer

<400> 21

image 1

<210> 22

<211> 55

<212> DNA

<213> Artificial

<220>

<223> T7 promoter-primer

<400> 22 aatttaatac gactcactat agggagagtt tgtatgtctg ttgctattat gtcta 55

<210> 23

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<400> 23 cctgaatttt aaaagaaggg gg 22

<210> 24

<211> 24

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (22) .. (22)

<223> inosine

<400> 24

ccagaatttt aaaagaaggg gngg 24

<210> 25

<211> 24

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (22) .. (22)

<223> inosine

<400> 25 ccacaatttt aaaagaaggg gngg 24

<210> 26

<211> 24

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (22) .. (22)

<223> inosine

<400> 26 cctgaatttt aaaagaaggg gngg 24

<210> 27

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<400> 27 catgaatttt aaaagaaggg ga 22

<210> 28

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (18) .. (18)

<223> inosine

<400> 28 cctgaatttt aaaagaangg gg 22

<210> 29

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (3) .. (3)

<223> inosine

<400> 29 ccngaatttt aaaagaaggg gg 22

<210> 30

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (3) .. (3)

<223> inosine

<220>

<221> miscellaneous feature

<222> (4) .. (4)

<223> inosine

<400> 30 ccnnaatttt aaaagaaggg gg 22

<210> 31

<211> 23

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (7) .. (7)

<223> inosine

<220>

<221> miscellaneous feature

<222> (10) .. (10)

<223> inosine

<220>

<221> miscellaneous feature

<222> (17) .. (17)

<223> inosine

<220>

<221> miscellaneous feature

<222> (21) .. (21)

<223> inosine

<400> 31 23 aaagaanggn ggggatnggg ngg 23

<210> 32

<211> 23

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (7) .. (7)

<223> inosine

<220>

<221> miscellaneous feature

<222> (10) .. (10)

<223> inosine

<220>

<221> miscellaneous feature

<222> (21) .. (21)

<223> inosine

<400> 32 23 aaagaanggn ggggattggg ngg 23

<210> 33

<211> 29

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (18) .. (18)

<223> inosine

<400> 33 aattttaaaa gaagaggngg gattggggg 29

<210> 34

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (19) .. (19)

<223> inosine

<400> 34 caattttaaa agaaggggng gg 22

<210> 35

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (16) .. (16)

<223> inosine

<220>

<221> miscellaneous feature

<222> (21) .. (21)

<223> inosine

<400> 35 gaattttaaa agaagngggg ng 22

<210> 36

<211> 22

<212> RNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (19) .. (19)

<223> inosine

<400> 36 gaauuuuaaa agaaggggng gg 22

<210> 37

<211> 30

<212> DNA

<213> Human immunodeficiency virus

<400> 37 tccccccttt tcttttaaaa ttgtggatga 30

<210> 38

<211> 30

<212> DNA

<213> Human immunodeficiency virus

<400> 38 ttcctcccct tcttttaaaa ttcatgcaat 30

<210> 39

<211> 27

<212> DNA

<213> Artificial

<220>

<223> phage promoter sequence T7

<400> 39 aatttaatac gactcactat agggaga 27

<210> 40

<211> 22

<212> DNA

<213> Artificial

<220>

<223> HIV artificial consensus sequence

<220>

<221> miscellaneous feature

<222> (10) .. (10)

<223> position occupied by C, T or I (inosine)

<220>

<221> miscellaneous feature

<222> (16) .. (16)

<223> position occupied by T or I (inosine)

<400> 40 tagagacagn agtacnaatg gc 22

<210> 41

<211> 26

<212> RNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (22) .. (22)

<223> inosine

<400> 41 aggcaguaua cugcauuuac cnuacc 26

<210> 42

<211> 21

<212> DNA

<213> Human immunodeficiency virus

<400> 42

gtatactgca tttaccctac c 21

<210> 43

<211> 26

<212> RNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (22) .. (22)

<223> inosine

<400> 43 aggaaguaua cugcauuuac cnuacc 26

<210> 44

<211> 26

<212> RNA

<213> Human immunodeficiency virus

<400> 44 aggaaguaua cugcauuuac cauacc 26

<210> 45

<211> 27

<212> RNA

<213> Human immunodeficiency virus

<400> 45 cuagguaugg uaaaugcagu auacuuc 27

<210> 46

<211> 25

<212> RNA

<213> Human immunodeficiency virus

<400> 46

gaugguaggg uaaaugcagu auacu 25

<210> 47

<211> 26

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (13) .. (13)

<223> inosine

<400> 47 cttagataaa ganttcagga agtata 26

<210> 48

<211> 26

<212> DNA

<213> Human immunodeficiency virus

<400> 48 cttagataaa gattttagga agtata 26

<210> 49

<211> 26

<212> DNA

<213> Human immunodeficiency virus

<400> 49 cttagataaa gattttaggc agtata 26

<210> 50

<211> 26

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (20) .. (20)

<223> inosine

<400> 50 cttagataaa gattttaggn agtata 26

<210> 51

<211> 28

<212> DNA

<213> Human immunodeficiency virus

<400> 51 ttgctggtga tcccttccat ccttgtgg 28

<210> 52

<211> 28

<212> DNA

<213> Human immunodeficiency virus

<400> 52 ttgctggtga tcccttccat ccctgtgg 28

<210> 53

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<400> 53 ttgctggtga tcctttccat cc 22

<210> 54

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<400> 54

ttgctggtga tcccttccat cc 22

<210> 55

<211> 55

<212> DNA

<213> Artificial

<220>

<223> T7 promoter-primer

<400> 55 aatttaatac gactcactat agggagattg ctggtgatcc cttccatcct tgtgg 55

<210> 56

<211> 55

<212> DNA

<213> Artificial

<220>

<223> T7-primer promoter

<400> 56 aatttaatac gactcactat agggagattg ctggtgatcc cttccatccc tgtgg 55

<210> 57

<211> 49

<212> DNA

<213> Artificial

<220>

<223> T7-primer promoter

<400> 57 aatttaatac gactcactat agggagattg ctggtgatcc tttccatcc 49

<210> 58

<211> 49

<212> DNA

<213> Artificial

<220>

<223> T7 promoter-primer

<400> 58 aatttaatac gactcactat agggagattg ctggtgatcc cttccatcc 49

<210> 59

<211> 22

<212> DNA

<213> Human immunodeficiency virus

<400> 59 ttgctggtga tccyttccat cc 22

<210> 60

<211> 28

<212> DNA

<213> Human immunodeficiency virus

<400> 60 ttgctggtga tccyttccat ccytgtgg 28

<210> 61

<211> 26

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous feature

<222> (13) .. (13)

<223> position occupied by T or I (inosine)

<220>

<221> miscellaneous feature

<222> (20) .. (20)

<223> position occupied by A, C or I (inosine)

<400> 61 cttagataaa ganttyaggn agtata 26

<210> 62 5 <211> 26

<212> DNA

<213> Human immunodeficiency virus

<220>

<221> miscellaneous characteristic 10 <222> (22) .. (22)

<223> position occupied by A, C or I (inosine)

<400> 62 aggaagtata ctgcatttac cntacc 26

Claims (20)

 Claims   1. A method to determine if a test sample It contains at least one of the HIV-1 nucleic acids and HIV-2, this method includes the steps of:

(to)

combine said test sample with a couple of primers with cross reactivity to form a mixture of reaction, wherein said pair of primers with reactivity Crusade is capable of co-amplifying HIV-1 nucleic acids and HIV-2 and comprises a first primer sequence that It consists of Sec. ID No.: 14, which includes optional- mind an upstream sequence that is not complementary to no HIV-1 or HIV-2 nucleic acid, and a second primer sequence consisting of any of ID of Sec. No.: 2 or Sec. ID No.: 7, optionally comprising an upstream sequence that is not complementary to any HIV-1 or HIV-2 nucleic acid;

(b)

amplify, in an amplification reaction of nucleic acids in vitro, the nucleic acids present in said reaction mixture of step (a); Y

(C)

detect in an hybridization reaction an HIV-1 amplicon, an HIV-2 amplicon, or a combination of both amplicons synthesized in step (b), determining so that said test sample contains at least one of the nucleic acids of HIV-1 and HIV-2.

2.

The method of claim 1, wherein said in vitro nucleic acid amplification reaction the amplification step, is selected from the group that it consists of an amplification reaction mediated by the

transcription (AMT), an amplification reaction based in the nucleic acid sequence (NASBA) and a reaction polymerase chain (PCR).

3.

The method of claim 1, wherein said hybridization reaction in the detection step comprises a cross-reactive probe that hybridizes independently with said HIV-1 amplicon and to said amplicon of HIV-2

Four.

The method of claim 3, wherein said hybridization reaction in the detection step further comprises an HIV-1 specific probe that hybridizes only with said HIV-1 amplicon and not with said HIV-2 amplicon.

5.

The method of claim 4, wherein a positive signal indicating hybridization of the probe with cross-reactivity together with the absence of a positive signal indicating hybridization of the HIV-1 specific probe indicates that said test sample contains nucleic acids of HIV-2 and does not contain HIV-1 nucleic acids.

6.

The method of claim 3, comprising further a step for detection in a hybridization reaction comprising an HIV-1 specific probe, said HIV-1 amplicon without also detecting said amplicon of HIV-2, wherein said specific probe of HIV-1 hybridizes only with said HIV-1 amplicon and not with said amplicon of HIV-2

7.

The method of claim 6, wherein a positive signal indicating hybridization of the probe with cross-reactivity together with the absence of a positive signal

which indicates hybridization of the HIV-1 specific probe that indicates that said test sample contains HIV-2 nucleic acids and does not contain HIV-1 nucleic acids.

8.

The method of claim 3, wherein said cross-reactivity probe is marked with a label homogeneously detectable.

9.

The method of claim 8, wherein said Homogeneously detectable label is a chemiluminescent label.

10.

The method of claim 9, wherein said Detection step comprises detection with a luminometer.

eleven.

The method of claim 1, wherein a positive result obtained in said detection step does not distinguishes between said HIV-1 amplicon and said amplicon of HIV-2

12.

The method of claim 1, wherein said in vitro nucleic acid amplification reaction in the amplification step is an amplification reaction multiplex that can also amplify, with a series of specific target primers, at least one nucleic acid which is different from HIV-1 and HIV-2.

13.

The method of claim 12, wherein said At least one nucleic acid that is different from HIV-1 and HIV2 is selected from the group consisting of HBV and HCV.

14.

A composition to amplify any analyte of HIV-1 nucleic acids and any acid analyte HIV-2 nuclei that may be present in a sample

biological, which includes:

(to)

a first primer consisting of Sec. Nº: 14, which optionally comprises a first sequence of upstream primer that is not complementary to any of said nucleic acids of HIV-1 or HIV-2; Y

(b)

a second primer consisting of Sec. Nº: 2 or ID of Sec. Nº: 7, which optionally includes a second upstream primer sequence that is not complementary to any of said HIV-1 nucleic acids or HIV-2

fifteen.

The composition of claim 14, wherein the first primer is up to 75 bases in length, and in the that the second primer consists of Sec. ID No.: 2.

16.

The composition of claim 14, wherein the first primer is up to 75 bases in length, and in the that the second primer consists of Sec. ID No.: 7.

17.

A composition to amplify any analyte of HIV-1 nucleic acids and any acid analyte HIV-2 nuclei that may be present in a sample biological, which includes:

(to)

a first primer consisting of any of Sec. ID No.: 13, Sec. ID No.: 14 or Sec. ID No.: 15, said first primer optionally comprises a first upstream primer sequence that is not complementary to none of said nucleic acids of HIV-1 or HIV-2; Y

(b)

a second primer consisting of Sec. Nº: 2, which optionally comprises a second sequence of upstream primer that is not complementary to any of

-129 said nucleic acids of HIV-1 or HIV-2. 18. The composition of claim 17, wherein the first and second primers are each up to 75 bases in length, and in which the first primer consists of the 5 Sec. ID No.: 13 optionally comprising the first upstream primer sequence that is not complementary to any of said HIV-1 or HIV-2 nucleic acids. 19. The composition of claim 17, wherein the first and second primers are each up to 75 bases 10 in length, and wherein the first primer consists of Sec. ID No.: 14 which optionally comprises the first upstream primer sequence that is not complementary to any of said HIV-1 or HIV-2 nucleic acids . 20. The composition of claim 17, wherein The first and second primers are each up to 75 bases in length, and in which the first primer consists of Sec. ID No.: 15 which optionally comprises the first upstream primer sequence that is not complementary to any of said nucleic acids of HIV-1 or HIV-2.