WO2015163711A1

WO2015163711A1 - Talen targeting myostatin gene and method for making animal with knockout myostatin gene using same

Info

Publication number: WO2015163711A1
Application number: PCT/KR2015/004068
Authority: WO
Inventors: 윤희준; 김석중; 김진수; 강금단
Original assignee: 윤희준; 주식회사 툴젠
Priority date: 2014-04-23
Filing date: 2015-04-23
Publication date: 2015-10-29
Also published as: CN103952424A; CN103952424B; KR20170023043A; KR20150123187A; KR101748823B1

Abstract

The present invention relates to a transcription activator like effector-nuclease (TALEN) targeting a myostatin (MSTN) gene and a method for making an animal with a knockout myostatin gene. The present invention has confirmed that, in the case of using TALEN specific to the myostatin gene and a somatic cell nuclear transplantation technique, a transgenic pig with a knockout myostatin gene can be effectively made. Therefore, when the method for making a transgenic animal with a knockout myostatin gene of the present invention is employed, a pig with an increased muscle amount can be effectively produced, and this method can also be used for other animals that provide meat to humans.

Description

【Specification】

[Name of Invention] TALEN Targeting Myostatin Gene and Method for Manufacturing Animal with Myostatin Gene Knocked Out [Technical Field] This patent application is filed with the Chinese Patent Office on April 23, 2014 in China. Priority is claimed on patent application 201410168615.5, the disclosure of which is incorporated herein by reference. The present invention relates to a Transcription Activator Like Effector Nuclease (TALEN) that targets a myostatin (MSTN) gene and a method of producing an animal knocked out of the myostatin gene.

[Background technology]

Recently, as the interest in health problems as well as nutritional problems due to pork intake is increasing, the demand for lean meat less fat is increasing. Meanwhile, as China, the world's largest producer and producer of pork, grows, per capita pork consumption is on the rise, while breeding is not up to this trend. One way to solve this problem has been to research and develop pigs with increased muscle mass.

Myostatin (MSTN) is a protein belonging to the TGF-β family and is a regulatory factor that inhibits muscle differentiation and growth during muscle differentiation and is also known as growth differentiation factor 8 (GDF-8). . Myostatin is produced primarily from bone cells and circulates through the blood to act on muscle tissue. Therefore, if there is no myostatin gene in animals or inhibits the activity of myostatin, it can be expected to increase muscle. Humans and cattle (Ravi ambadur et al., Genome Res., 7: 910- 915, 2007), sheep and dogs (Dana S. Mosher et al., Plos genet., 3: 779-786, 2007) have identified a myostatin mutation present in nature. If present, muscle phenotype was increased compared to wild-type. In addition, when mice knocked out the myostatin gene were made, a small amount of muscle was increased when the gene knockout was a heterozygote and a double-muscle when the knockout was a homozygote. Muscle growth was observed (Se-Jin Lee et al. Nature, 16; 98: 9306-9311, 1997).

Therefore, if the myostatin gene can be knocked out effectively in pigs, production of pigs with increased muscle can be expected. In the case of the recently filed Chinese patent (application number CN101892264A), a transgenic pig that knocked out myostatin gene was produced using a technique other than TALEN (Trans Activation Like Effector-Nuclease). Heterozygotes have not been reported in pigs with homozygotes knocked out of both myostatin genes.

[Content of invention]

[Problem to solve]

The present inventors have tried to find a method for producing a transgenic pig knocked out of the myostatin gene. As a result, the present inventors have completed the present invention by confirming that, when using TALEN and somatic cell nuclear transfer technology specific to myostatin gene, it is possible to effectively make a transgenic pig knocked out of myostatin gene.

It is an object of the present invention to provide a TALEN having the activity of binding to and cleaving a specific sequence of myostatin gene.

Another object of the present invention is to provide a recombinant expression vector for myostatin gene knockout using TALEN.

Another object of the present invention to provide a method for producing a cell knocked out myostatin gene using TALEN and to provide a cell knocked out myostatin gene prepared using the same. Another object of the present invention to provide a method for producing a transgenic animal other than a human knocked out myostatin gene using TALEN and a transgenic animal other than a human knocked out myostatin gene prepared using the same There is.

Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.

[Measures of problem]

According to one aspect of the present invention, there is provided a fusion protein having the activity of binding to and cleaving a specific sequence of a myostatin (MSTN) gene:

(a) a TALEdranscription Activator Like Effector) domain; And

(b) nucleotide cleavage domains.

The term "statin Maio (myostatin: MSTN)" in the present invention is known as GDF8 _(. Growth differentiation factor 8), is known as a gene that suppresses muscle growth and differentiation ol. Myostatin is a regulatory ligand belonging to the TGF-β superfamily and its gene structure is similar to other genes belonging to the TGF-β superfamily. Myostatin gene sequence and the like can be obtained from a known database (GenBank et al.).

Myostatin acts as a negative regulator involved in the development, growth, and regulation of muscle homeostasis in the musculoskeletal structure, so if the animal lacks the myostatin gene or inhibits the activity of myostatin, muscle can be expected to increase. have. Myostatin mutations in nature have been identified in cattle, sheep and dogs, and the deletion of the myostatin gene showed an increased phenotype compared to the wild-type. In addition, when mice knocked out the myostatin gene were made, a small amount of muscle was increased when the gene knockout was a heterozygote, and a double-muscle when the knockout was a homozygote. It was observed that the muscles are greatly increased. Therefore, if the myostatin gene can be effectively knocked out in an animal that supplies meat to humans, the production of an animal with increased muscles can be expected. For example, to produce pigs with increased muscle mass, they tried to knock out the myostatin gene in pigs.

In the present invention, the term "having the activity of binding to and cleaving a specific sequence of myostatin gene" means that the specific nucleic acid sequence of the myostatin gene is specifically recognized and cleaved. Recognizing a specific nucleic acid sequence of the ostatin specifically, it means that the cleavage is generated in the myostatin gene by the nucleotide cleavage domain connected by the TALE domain and the peptide bond. The term “sequence” means a nucleotide sequence regardless of its length, which may be linear, circular or branched DNA or RNA, and may be single helical or double helical.

Several factors can be considered to select specific sequences to which TALENs bind and cut. First, only target myostatin genes must be specifically recognized and cleaved, and other gene sequences not to be cleaved. To this end, various known bioinformatics methods can be used. In addition, the TALENs of the present invention should be able to effectively bind and cleave sequences at specific positions. Theoretically, TALE domains can be designed for all specific sequences, but experimentally, the length of specific sequences to which TALE domains bind, the length of the spacer between two half-digits forming one target region, etc. This is known to affect the effective action of TALENs. According to the experiment, the half-digits are 15-20 bp in length, the spacers are 12-14 bp in length, the total sequence length is 42-54 bp, and the starting sequence of the specific sequence is thymine (T) and the last sequence. In the case of this adenine (A) TALEN works effectively. Therefore, in consideration of these factors, specific positions should be selected so that TALENs can cleave myostatin genes specifically and effectively. According to a specific example of the present invention, four specific sequences of the sequence of the pig myostatin gene using the database of TALEN cleavage ability for various specific sequences possessed by Bioinformatics Co., Ltd. (SEQ ID NO: TALEN for 1 to 4 sequences) _. The U sequence located in exon 1 was selected as a specific sequence to be cleaved by TALEN. The "Transcription Activator Like Effector (TALE) domain" of the present invention is described in detail in the Korean patent application 'Genome engineering through designed TAL effector nuclease' (Application No. 10-2013-7018743). TALE is a protein that is secreted through their type m secretion system when xanthonomonas bacteria are infected with various plant species, and can bind to promoter sequences in the host plant to activate expression of plant genes that aid bacterial infection. The TALE protein recognizes plant specific DNA sequences through a central repeat domain consisting of up to 34 different numbers of amino acid repeats, allowing these features to be used as a novel platform for genome engineering tools.

TALE domains of the invention refer to protein domains that bind to nucleotides in a sequence-specific manner by a combination of one or more TALE-repeat parents. The TALE domain includes, but is not limited to, at least one TALE-repeats moiety, specifically 1-30 TALE-repeats moieties. TALE-repeat parents may have the following general amino acid sequence as a site that recognizes a particular nucleotide sequence in the TALE domain:

H2N-LTPEQWA I ASXXGGKQALETVQRLLPVLCQAHG-COOH. XX refers to the super-modified amino acids at positions 12 and 13 to determine the specificity of base recognition. Specifically, the twelfth and thirteenth amino acids of the TALE-repeat parent recognize one specific nucleic acid. When XX is HD, the TALE-repeat modalities recognize C, T when XX is NG, A when XX is NI, and G when XX is NN, respectively, thus combining various TALE-repeat mods In this case, a TALE domain capable of recognizing a specific position in the target gene can be prepared. A method for preparing a specific TALE domain is described in detail in the Korean patent application 'Genome Engineering ¹ through Designed TAL Effector Nuclease (Application No. 10-2013-7018743). On the other hand, since TALEN generally acts as a dimer, it is necessary to design two TALEN monomers to cut a specific position in the target gene (FIG. 1). In the present invention, the specific position on the left to which the TALE domain binds is named as a first half-site and the specific position on the right as a second half-site based on the cleavage site. Two TALEN monomers are each made up of two half-sites in different target genes. One recognizes and the two half-digits are designed to be separated from each other by spacers of 9 to 14-bp. According to a specific example of the present invention, it is separated from each other by a 12-bp spacer and recognizes 21 bp (first half-digit, sequence listing first sequence) and 20 bp (second half-site, sequence listing second sequence), respectively. The TALEN monomer was designed and used to effectively induce knockout of porcine myostatin gene.

As used herein, the term "cutting" refers to unlinking the covalently bonded backbone of the myostatin nucleotide molecule, and the "nucleotide cleavage domain" 'is a polypeptide having enzymatic activity for nucleotide cutting of such myostatin. Refers to the sequence.

remind . Nucleotide cleavage domains can be obtained from endonucleases or exonucleases. Examples of endonucleases from which nucleotide cleavage domains can be obtained include, but are not limited to, endogenous nucleases, recurrent endonucleases, and the like. It is not limited. Such enzymes can be used as the origin of the nucleotide cleavage domain. In addition, the nucleotide cleavage domain can cleave a single nucleotide sequence, as well as cleave a nucleotide sequence of a double bond, depending on the origin of the cleavage domain.

The restriction endonuclease is capable of sequence specific binding with DNA (recognition site), and can cleave DNA in the vicinity of the binding site. For example, Fokl, a type lis enzyme, promotes double helix cleavage of DNA at 9 nucleotides from the recognition site in one helix and 13 nucleotides from the recognition site in the other helix.

Nucleotide cleavage domains of the invention may be derived from type lis restriction endonucleases, wherein the type lis restriction endonucleases are described, for example, in Fokl, Aarl, Acelll, Acil, AloI, ^' BaeI, Bbr7I, Cdil, CjePI, Ecil, Esp3I, Finl, Mbol, sa I or SspD51 may be, but is not limited thereto. Specifically, the nucleotide cleavage domain of the present invention may be Fokl.

The fusion protein of the present invention may further comprise a nuclear localization signal sequence. The nuclear position signal of the present invention TALENs targeting myostatin can be used as a means to move into the nucleus to knock out the myostatin gene. According to another aspect of the present invention, a nucleotide sequence encoding the fusion protein; And (b) provides a recombinant expression vector for knockout myostatin gene comprising a transcriptional regulatory sequence operably linked to the nucleotide sequence (operat i ve lyli nked). The expression vector may be introduced into a cell to express a fusion protein (TALEN) of the present invention, and a known expression vector such as a plasmid vector, a cosmid vector, and a bacteriophage vector may be used. It can be easily prepared by those skilled in the art according to any known method.

The term “operat i ve ly li nked” refers to a functional binding between a nucleic acid expression control sequence (eg, an array of promoters, signal sequences, or transcriptional regulator binding sites) and other nucleic acid sequences. Whereby the regulatory sequence controls transcription and / or translation of the other nucleic acid sequence. In the present invention, the transcriptional regulatory sequence bound to the nucleotide sequence encoding the fusion protein is capable of controlling transcription of the nucleotide encoding the fusion protein by operating in an animal cell (eg, a mammalian cell), which is derived from a mammalian virus. Promoters and promoters derived from genomes of mammalian cells, such as, for example, cyt omega lo virus (CMV) promoter, adenovirus late promoter, vaccinia virus 7. 5K promoter, SV40 promoter, tk promoter of HSV, RSV Promoter, EF1 alpha promoter, metallothionine promoter, beta-actin promoter, promoter of human IL-2 gene, promoter of human IFN gene, promoter of human IL-4 gene, promoter of human lymphotoxin gene and human GM-CSF Including but not limited to promoters of genes. In addition, the combinatorial expression vector of the present invention may comprise a polyaninated sequence.

According to another aspect of the invention, there is provided a method of producing a cell knocked out myostatin gene comprising the following steps.

(a) introducing into the cell a recombinant expression vector for myostatin gene knockout using TALEN;

(b) by TALEN expressed from an expression vector introduced into said cell Cleaving the myostatin gene; And ᅳ

(C) mutagenesis of the myostatin gene by the cleavage.

Any method known in the art may be used to introduce a recombinant expression vector for myostatin gene knockout into a cell. For example, calcium phosphate-DNA co-precipitation, DEAE-dextran-mediated transfection, polybrene-mediated transfection, electroporation, microinjection, liposome fusion to introduce the recombinant expression vector into cells. Various methods known in the art, such as lipofectamine and protoplast fusion methods, can be used. According to a specific example of the present invention, a recombinant expression vector for myostatin gene knockout was introduced into porcine fetal fibroblasts using electroporation. When the recombinant expression vector for knockout of the myostatin gene is introduced into the cell and the TALEN fusion protein is expressed therefrom, the double-strand damage on the myostatin gene can be induced. When they occur, the cell repairs the damaged area using its own repair mechanism. At this time, the cell repairs the damaged region by non-homologous end j oini ng (NHEJ) method, and insertion (i nser ti on) or deletion (de l et i on) at the end of the broken DNA strand is performed. Repairs are made in the direction of error-prone. Thus, mutations are induced in the myostatin gene, which results in knockout of the myostatin gene. Specifically, the mutation may be a mutation by substitution, deletion, insertion, and a combination thereof. According to a specific example of the present invention, various mutations such as insertion and deletion were induced by the TALEN fusion protein, thereby successfully knocking out the myostatin gene.

According to another aspect of the present invention, a cell in which myostatin gene is knocked out by the above method is provided. The cell may be a variety of animal cells, but for the purposes of the present invention, since the myostatin gene may be used in the process of preparing a knocked out transgenic animal, it may specifically mean a cell of an animal to be transformed. . According to a specific example of the present invention, a pig fetus for preparing a transformed pig in which the myostatin gene is knocked out Fibroblasts were used to prepare cells knocked out of the myostatin gene. According to another aspect of the present invention, there is provided a method for producing a transgenic animal other than a human whose knocked out myostatin gene comprises the following steps:

(a) introducing a recombinant expression vector for myostatin gene knockout using TALEN into cells of an animal to be transformed to prepare a transformed cell;

(b) harvesting the egg from the ovary of the animal to be transformed, and then removing the nucleus from the egg;

(c) transplanting the nucleus of the transformed cell of step (a) into a somatic cell nuclear transfer step of transplanting the nucleus of step (b); And

(d) implanting the embryo cells in which the somatic cells of step (c) have been nuclear-transplanted into the oviduct of the surrogate mother of the animal to be transformed and pregnant.

More specifically, each step is as follows:

(A) preparing a transformed cell by introducing a recombinant expression vector for myostatin gene knockout using TALEN into the cells of the animal to be transformed

Since the above steps are detailed in the method for preparing cells knocked out of the myostatin gene, the description thereof is omitted to avoid excessive duplication.

(b) collecting eggs from the ovaries of the animals to be transformed and removing the nuclei from the eggs;

To harvest eggs from animal ovaries, conventional methods known in the art can be used. To remove nuclei from eggs, physical methods, chemical methods or centrifugation using Cytocha l as in B can be used. have. According to a specific example of the present invention, the follicles are extracted from the ovary of a female pig and matured in oocyte in vitro mature culture medium (in vi t ro maturat i on medi a, IVM med ia), and then, the oocytes are collected using an egg collecting needle The nucleus of the egg was then removed using chemical and physical methods.

(c) the nucleus of the transformed cell of step (a) is replaced by the nucleus of step (b) Somatic cell nuclear transfer to transplant the removed ovum

As used herein, the term “Somat i c-cel l nuc lear transfer (SCNT)” refers to a technique for transplanting a nucleus of a cell into an egg which has already had its nucleus removed. After activating cytin to progress, an individual born from a surrogate mother becomes a genetically identical clone because the genetic material of the donor cell is transferred to the nuclear donor cytoplasm. As the somatic cell nuclear transfer method, cell membrane fusion, cytoplasmic microinjection, or the like can be used. Cell membrane fusion has the advantage of being simple and suitable for large-scale fertilized egg production, and intracellular microinjection has the advantage of maximizing contact between the nucleus and egg material. Fusion of somatic cells and nuclei from which the nucleus has been removed is achieved through a method of fusion by changing the viscosity of the cell membrane through electrical stimulation. According to a specific example of the present invention, a cell membrane fusion method was used in which oocytes from which nuclei were removed and donor cells to be transplanted with the somatic cell nucleus were paralleled with electrodes, and then fusion was performed by applying a DC current pill to the fusion device.

(d) implanting embryos in which the somatic cells of step (C) have been nuclear-transplanted and implanted into a fallopian tube of a surrogate mother of an animal to be transformed

Implantation of embryonic cells in the surrogate mother's oviduct can be carried out using a conventional method known in the art, and is not particularly limited. The method for preparing a transgenic animal other than a human in which the myostatin gene is knocked out may further include the following steps.

(e) separating the fetus from the surrogate mother whose pregnancy in step (d) is confirmed and confirming whether the myostatin gene is knocked out;

(f) the nuclei of fetal cells in which myostatin gene is knocked out

a somatic cell nuclear transfer step of implanting an egg from which the nucleus of (b) was removed; And

(g) implanting embryonic cells cultured with the cells transplanted with the somatic cells of step (f) into the oviduct of the surrogate mother to be pregnant.

The additional steps above are for more effectively producing a transgenic animal knocked out of the myostatin gene, and the second somatic cell nuclear transfer using the nucleus of the fetal cell whose knockout of the myostatin gene is confirmed. And the embryo is to proceed. Since the specific somatic cell nuclear transfer and embryo transfer method is the same as the above method, the description is omitted to avoid excessive duplication. According to a specific example of the present invention, secondary somatic cell nuclear transfer and embryo transfer could effectively produce a transformed pig in which myostatin gene was knocked out.

According to another aspect of the present invention, a transgenic animal other than a human whose myostatin gene is knocked out by the above method is provided. In the present invention, the term "transgenic animals other than human" may be mammalian fish, birds, and the like, and specifically, may be an edible animal which may provide meat useful to humans for the purposes of the present invention. According to a specific example of the invention provides a transformed pig knocked out myostatin gene by the above method.

【Effects of the Invention】

The features and advantages of the present invention are summarized as follows:

(a) The present invention provides a TALEN having the activity of binding to and cleaving a specific position of the myostatin gene.

(b) The present invention provides a recombinant expression vector for myostatin gene knockout using TALEN.

(c) The present invention provides a method for producing a transgenic animal other than a human whose myostatin gene is knocked out using TALEN.

(d) By using the method of the present invention, it is possible to effectively produce a transformed pig in which the myostatin gene is knocked out, so that a pig having an increased muscle mass can be obtained, and this method is also used for other animals supplying meat to humans Can be.

[Brief Description of Drawings]

1 is a view showing a general principle of the working TALEN of the present invention.

Figure 2 is a chart analyzing and analyzing the activity of TALEN produced by targeting a specific sequence of porcine MSTN gene. A is SEQ ID NO: 1, B is SEQ ID NO: 2, C is SEQ ID NO: 3, D is TALEN for SEQ ID NO: 4 The activity was measured and analyzed.

3 is a view showing a recombinant expression vector for myostatin gene knockout using TALEN of the present invention.

Figure 4 shows the results of sequencing analysis to determine whether the mutation of the MSTN gene in male pig embryos produced through secondary somatic cell nuclear transfer and embryo transfer of the present invention. Bold G of F1 and 18-2, 164bp of 19-3 indicate that the nucleotide sequence is inserted compared to the native form, and "-ᅳ" indicates that the nucleotide sequence is deleted compared to the native form (de l et i on).

FIG. 5 is a photograph comparing MSTN − / − male pigs and natural pigs produced through secondary somatic cell nuclear transfer and embryo transfer.

Figure 6 is a photograph comparing the analysis of the expression of MSTN protein in MSTN-/-male pigs and natural pigs produced through the secondary somatic cell nuclear transfer and embryo transfer of the present invention by Western blot.

Figure 7 is a photograph of the morphological comparison of muscle tissue through the immunohistochemical method in MSTN-/-male pigs and natural pigs produced through secondary somatic cell nuclear transfer and embryo transfer of the present invention.

FIG. 8 analyzes 400 muscle fibers by measuring the diameter of muscle fibers using Sc i on Image software in MSTN-/-male pigs and natural pigs produced through secondary somatic cell nuclear transfer and embryo transfer according to the present invention, and their average values This is a chart that calculates and compares.

[Specific contents to carry out invention]

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention more specifically, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. . EXAMPLES Example 1 Preparation of a Recombinant Expression Vector for Myostatin Gene Knockout

MSTN by mutating pig MSTN gene using TALEN Recombinant expression vectors were constructed to knock out genes. First of all for this

The specific sequence of the MSTN gene to which the TALE domain will bind was selected. In order for the Fokl cleavage domain linked to the TALE domain to act as a homodimer, the first half-site sequence and the second half-site sequence to which the TALE domain binds are selected. It was. Sequence analysis of pig MSTN gene by bioinformatics method and DNA cleavage ability analysis of TALEN in specific sequence that Tlzen has in database have a length of 42-54 bp in pig MSTN gene and the starting sequence is thymine (T), a specific sequence was selected for the 4 'sequences (SEQ ID NOS: 1 to 4), the last sequence being adenine (A). TALENs were generated for four sequences to measure the activity of TALENs (FIG. 2). As a result of analysis, the first sequence of the sequence list, in which TALENs are active and located within the crab 1 axon of the MSTN gene, was finally selected. The sequence of the first half-site to which the left TALE domain is bound is 5 ^\ -ttcaaatcctcagtaaaactt-3 ^\, and the sequence of the second half-site to which the right TALE domain is bound is 5,-gctcctaacattagcaaaga-. The sequence to be cleaved by the Fokl cleavage domain linked to the TALE domain was cgcctggaaaca.

In order to produce TALENs that will act on specific sequences of selected porcine MSTN genes, the method disclosed in the Korean patent application 'Genome engineering through designed TAL effector nuclease' (Application No. 10-2013-7018743) was used. By combining TALE-repeats that specifically bind to each base in the selected particular sequence, a TALE domain capable of specifically binding to the entire specific sequence was designed, and the cleavage domain of nucleic acid endonuclease ( Fokl) were allowed to connect. The entire amino acid sequence of TALEN to bind to the first half is shown in SEQ ID NO: 5, and the entire amino acid sequence of TALEN to bind to the second half is shown in SEQ ID NO: 6. Consequently, the Pig myostatin TALEN for knockout of the myostatin gene contains 135 ampicillin drug resistance genes, CMV promoter, HA epitope tag, nuclear localization signal, and N-terminal end of AvrBs3. Amino acids, TALE domains that bind to specific sequences of porcine myostatin, and Fokl cleavage domains were arranged in order (FIG. 3). To join in the first half digit. The sequence of the recombinant expression vector for expressing TALEN is shown in SEQ ID NO: 7, the sequence of the recombinant expression vector for expressing TALEN to bind to the second half-digit is shown in SEQ ID NO: 8. Example 2 Construction of Porcine Febroblast Cell Line

Porcine fetal fibroblasts were constructed by subcultured primary fibroblasts obtained from fetuses isolated from adult female pigs 40 days old, of which the cells from the male fetus were taken as donor cells. The conventional method was applied to the process of establishing the cell line. The following related reagents were all used by Gibco Corporation (USA). The sterile membrane was cut under sterile conditions, the pig embryo was placed in PBS, repeatedly marched 3-5 times until the wash solution became clear, then transferred to Petridish, and the head and organs were cut with ophthalmic scissors. Sufficiently washed and sterilized with alcohol, it was again cut into a 0.5 lmm ³ tissue mass. The cut tissue mass was placed in DMEM medium containing 0.25% trypsin and left for 4 minutes in a C02 incubator at 38.5 ° C., followed by addition of DMEM medium containing fetal bovine serum to stop the trypsin activity, and then 15 mfi. Transfer to the test tube was centrifuged for 10 minutes at a rate of 1,500 pi 叩. Discard the centrifuged supernatant, add 3 m £ of 20% FBS / DMEM preheated to 38.5 ° C to loosen the mass, spread evenly into a sterile cell culture dish and place in a 38.5 ° C C02 incubator Put incubated. Afterwards, the cells were passaged 3-5 times while observing the morphology and growth of the cells every day, and then used for cell transformation experiments. Example 3 Transformation of Porcine Fetal Fibroblasts by Electroporation

½axa4D (Lonza, Switzerland) was used to transform the cells by electroporation, and H-2Kk magnetic reporter was used to select the transformed cells (Kim H. et al., PLoS ONE 8 (2)). _e 54676 (2013). The specific method is as follows:

The pig fetal fibroblasts were 15% fetal bovine blood serum, 1% non-essential amino acid,

In DMEM medium containing 100 mg / m £ penicillin and 100 mg / m streptomycin

1.4 Incubated. The cultured cells were removed by treatment with trypsin, and the cells were washed with HBSS (Wei Gen, South Korea) and centrifuged. Cells. After counting, the cells were finally suspended in the complete solution containing the DNA plasmid to be introduced into the cells, followed by electroporation. The ratio of DNA used was 45:45:10 (plasmid encoding TALEN monomer (DAS): plasmid encoding TALEN monomer (RR): H-2Kk magnetic reporter gene polamide). After electroporation, cells were cultured, sprinkled on culture plates, and incubated in an incubator at 5% C02, 37 ^° C for 2 days. Magnetic Separation and Antibiotics Select ion (Kim H. et al., PLoS ONE 8 (2): e54676 (2013)) was performed to select transformed cells. The transformed cells thus selected were cultured in 15% FBS / DMEM, passaged 4-8 generation, and used as donor cells for somatic cell nuclear transfer. Example 4: Oocyte In Vitro Maturation Culture

The ovaries were obtained from female pigs before puberty, and then follicles of 3-8 mm diameter were sucked out of the ovaries with a follicle suction pump. Cultivated, dense, and homogeneous cumulus cell-oocyte complexes (Cu 隠 Lus-oocyte-complexes, COCs) were selected and washed three times with TALP medium, followed by oocyte in vitro maturation (in vitro maturation media, IVM media). The components of the IVM culture were as follows: 10% pig follicle (pEE) with TCM-199, 0.6 μl iolLl L-cysteine, 10 IU / m. £ Human chorionic gonadotropin (hCG), 10 IU / mf Serum Gonadotropin (PMSG), 10 ng / niC Epidermal Growth Factor (EGF), obtained from pregnant horses. After 22 hours it was replaced with hormone-free IVM culture. Incubate for 38 hours in a 38.5 ^° C, 5% C02 incubator, and then put it in 0.1% hyaluronidase and repeatedly inhale oocytes using an oocyte harvesting needle with a diameter of 170-180 μηΊ. Removed. Among the oocytes from which the oocytes were removed, the oocytes with clear viable perivian infiltrate (Per ivi tell ine space), oocytes intact, and giant U-pole cells were selected and used for somatic cell nuclear transfer. Example 5 Removal of Nuclei Using a Chemically Assisted Enucleation

In order to remove nuclei from the oocytes, oocytes selected as receptors were treated for 1 hour in a culture solution containing 0.4 ng / mi demecolcine and 0.05 mol / L sucrose, followed by 5 mg / cytokalacin BCcytochalasin. B) and 0.4 mg / demecolcine were transferred to the solution containing. The micromanipulator (1 × 71, Olympus, Japan) was used to remove M II oocytes, first pole cells, and progenitor cell nuclei with a nucleus removal needle, and then used for somatic cell nuclear transfer. Example 6: Primary Somatic Cell Nuclear Transplantation by Fusion

The oocytes from which the nucleus of Example 5 was removed were equilibrated in a fusion solution (0.28 μL ol / L mannitol, 0.1 μL ol / L MgC12), and then placed in an fusion bath to which the fusion solution was applied. . The donor cells of Example 3 were also placed in the fusion tank, and then the donor cell-receptor oocyte membrane contact surface was parallel to the electrode using a glass needle, and then 2 kV / cm, using a fusion device (LF301, BEX, Japan). Fusion was performed by adding a DC current field of 20 mu ₅ . After fusion, the reconstituted egg was incubated for 1 hour in a culture solution containing 0.4 mg / ηιί demecolcine. Activated by treatment with 1.5 kV / cm, 100 us DC current field in a solution containing activator (0.28 画 ol / L mannitol, 0.1 隱 ol / L MgC12) and 0.1 瞧 ol / L Ca2 +, followed by 2 隱 ol / Incubated for 4 hours in a culture medium containing L 6-DMAP. Example 7: Embryo Transfer and Pregnancy Diagnosis of Surrogate Sows

The embryo reconstituted by fusion in the above manner was placed in NCSU-37 culture medium,

Incubated in 38 ° C, 5% C02 incubator, reconstructed embryos were incubated for 7-8 days with embryonic day 0, and egg split and backpack development at 38 hours and 7 days after incubation, respectively. Was observed and recorded.

For embryo transplantation, Yorkshire pigs with normal estrous cycle and diseased reproductive organs were selected as surrogate sows. 1000 II to surrogate sows] Estrus was induced by injection of serum gonadotropin (PMSG) at the end of gestation and injection of 1000 IU human chorionic gonadotropin (hCG) into the muscle after 72 hours. 48 hours after hCG injection, embryos of 1 to 8 cell stages with normal egg division cultured for 1 to 3 days were surgically implanted into the surrogate tube of surrogate. The embryo was transplanted and examined for pregnancy during 24-26 days after transplantation. After transplantation of the embryos to a surrogate mother three money, a total of 17 states ⁽ ': was &丁, table summarizes them as follows (Table 1).

[Table 1] Fetus obtained through somatic cell nuclear transfer τ embryo transfer

Representative Lim Tae Im transplanted fetal renal number of embryos thinner ^(This Assou

Female quantity (day

Support number)

R-29 196 36 9 Fl, F2, F3

F4, F5, F6

F7, F8, F9

R-18 205 25 3 18-1, 18-2, 18-3

R-19 232 27 5 19-1, 19-2, 19-3

19-4, 19-5 Example 8: Mutation Identification of MSTN Gene in Fetuses

The following experiments were performed to determine whether the MSTN gene was mutated in fetuses obtained through somatic cell nuclear transfer and embryo transfer:

After 36 days of embryo transplantation, the uterus was extracted from surrogate sows whose pregnancy was confirmed by Β-type ultrasound diagnosis. Fetal gDNA was extracted from the fetus using the G—DEX II cDNA Extraction Kit (Intronbio, South Korea). The extracted gDNA was used as a template for nested PCR, and the primer was designed to amplify the target site of TALEN for myostatin knockout: forward C-ctggtcccgtggatctgaatg-S '), reverse direction (5'-gatcgtttccgtcgtagcgtg-3) ')

The primers were used to obtain a 302 bp PCR product, which was Nested PCR was performed as a template and using the following primers: ⁷ ^ ¾ ^" ¾ (5'—gaatgagaacaacacgcgagcaaaagg_3 '), reverse (5' 一 catcttccaaggagccatcac-3 ')

As a result of PCR, a 257 bp PCR product was obtained, and the heterologous product was made by re-unfolding the PCR product again for the analysis of T7E1 mismatch for mutation. The heteroduplex DNA was treated with T7E1 enzyme (Jen, Republic of Korea) for 15 minutes and then loaded onto an agarose gel for analysis. As a result, PCR products cleaved by T7E1 enzyme and confirmed mismatch were cloned using T-Blunt PCR Cloning it (SolGent, South Korea). The cloned pollmids were subjected to sequencing analysis using M13 primer (FIG. 4). As a result, there were mutations in the MSTN gene in 10 fetuses, three of which had a bi-allelic null mutation (MSTN— ᅳ) in two alleles of MSTN (Fl, F2, 19-3), 7 Dogs had mutations (Heterozygous knockout, MSTN ^{+ / _} ) in only one allele of MSTN (F3, F5, F9, 18-2, 18-3, 19-1, 19-4). Cell lines were established from the obtained 10 mutant fetuses using the method of Example 2 above. Example 9: Secondary Somatic Cell Nuclear Transplantation and Embryo Transplantation

Second somatic cell nuclear transfer and embryonic transplantation were performed using a cell line established from F2 mutated to two MSTN alleles in the mutant fetus of Example 8 as donor cells. Somatic cell nuclear transfer and embryonic transplantation were carried out in the same manner as the primary somatic cell nuclear transfer and embryo transplantation method of Examples 4 to 7. Transplantation of 8 embryos into 4 surrogate sows yielded 20 piglets (Table 2). The MSTN + cloned pigs produced by this method were pigs of the same age in the control group (2 Month age) showed distinct double muscle characteristics (FIG. 5).

TABLE 2

Rl 222 6 MAl-1 485

MA 1-2 575

MA1-3 545

MA1-4 430

MA1-5 1060

MA1-6 655

R-3 222 4 MA3-1 840

MA3-2 980

MA3-3 515

MA3-4 1075

R-4 232 4 MA4-1 780

MA4-2 700

MA4- 580

3 (the situation)

MA4-4 615

R-28 205 9 MA28-1 700

MA28-2 1295

MA28-3 840

MA28-4 915

MA28- 500

5 (the situation)

MA28-6 1095

MA28-7 630

MA28-8 540

MA28-1235

9 (Situation) Example 10: Confirmation of Myostatin Expression in MSTN Z Clone Pigs

Western blot was performed to confirm the expression of myostatin in MSTN + cloned pigs. RIPS lysis solution (50 niM Tr i s-HCl, _Ρ Η8.0, 150 mM NaCl, 1% from MSTN cloned pig and native pig muscle tissue) Total protein was extracted using NP-40, 0.5% sodium deoxycholate, 0.1% SDS). Proteins were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE), then transferred to PVDF film (GE water & Process Technologies. Trevose, PA. USA) and placed in 5% skim milk powder solution for 1 hour at room temperature. After incubation to inhibit nonspecific binding, the primary antibody (anti-Myostatin, Youngin Frontier, Korea) was added thereto and incubated overnight at 4 ^° C. After washing, HRP labeled secondary antibody (anti-mouse IgG, Santa Cruz, Calif., USA) was added diluted 1: 5000 and incubated for 1 hour at room temperature. After washing, the signals generated by the enhanced chemiluminescence assay (Enhanced chemi luminescence assay, Animal Genetics Inc., Korea) were analyzed. GAPDH (Santa Cruz, CA, USA) was used as an intrinsic control. As a result, myostatin was detected in natural pigs, but myostatin was not detected in MSTN + cloned pigs (FIG. 6), and it was confirmed that myostatin was not expressed in MSTN— ^Λ cloned pigs. . Example 11 Identification of Double-Muscle traits of MSTff ^/ _Clone Pigs by Immunohistochemical and Morphological Observations

To confirm the double muscle characteristics of MSTN ^ -clone pigs, biceps brachii were extracted from MSTN— ^/ clone pigs and native pigs, 25 days after birth, respectively. The muscle tissue was fixed in formaldehyde for 10 hours, then dehydrated using an alcohol gradient, then clarified with chloroform, embedded with paraffin, and then sliced with a microtome to a thickness of 3-5 μπι a day. Cut. The sliced tissue slices were quickly immersed in a 30% aqueous alcohol solution, and then transferred to a 40 ^° C. constant water cooler to completely spread the tissue slices and adhered to the slides. After the tissues were attached to the slide was dried for 30 minutes at 56-60 ^° C, HE (Hematoxyline-Eosin) staining (Fig. 7). The nucleus is blue and the cytoplasm of muscle is red. MSTN ^{"/ _} cloned pigs were found to have larger and denser muscle fibers on muscle sections than native piglets compared to control piglets. Meanwhile, the diameter and number of muscle fibers were measured using Scion Image software. 400 muscle fibers After analyzing 4068

MSTN— ^Λ cloned pigs were found to have an increased diameter of muscle fibers compared to native piglets (FIG. 8).

As described above in detail specific parts of the present invention, it is apparent to those skilled in the art that these specific techniques are merely specific embodiments, and the scope of the present invention is not limited thereto. Thus, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

【Patent Claims】

[Claim 1]

A fusion protein containing the following, which has the activity of binding to and cutting a specific sequence of the myostatin (MSTN) gene:

(a) TALECTranscript ion Activator Like Effector) domain; and

(b) Nucleotide cleavage domain.

【Claim 2】

The fusion protein according to claim 1, wherein the specific sequence is 42 to 54 bp in length, and the starting base sequence is thymine (T) and the last base sequence is adenine (A).

【Claim 3】

The fusion protein according to claim 2, wherein the specific sequence is any one of sequences 1 to 4 in the sequence list.

[Claim 4]

The fusion protein according to claim 2, wherein the specific sequence is the first sequence of the sequence list.

【Claim 5】

The fusion protein according to claim 1, wherein the nucleotide cleavage domain is derived from type lis restriction endonuclease.

【Claim 6】

The fusion protein according to claim 5, wherein the type lis restriction endonuclease is Fokl.

【Claim 7】

(a) a nucleotide sequence encoding the fusion protein of any one of claims 1 to 6; and (b) operably to the nucleotide sequence. A recombinant expression vector for knocking out the myostatin gene containing linked (operativ ely linked) transcriptional regulatory sequences.

[Claim 8]

Method for producing cells in which the myostatin gene has been knocked out, comprising the following steps:

(a) introducing the recombinant expression vector of claim 7 into a cell;

(b) cleaving the myostatin gene by TALEN expressed from the expression vector introduced into the cell; and

(c) A step in which a mutation is induced in the myostatin gene by the cleavage.

【Claim 9】

Cells in which the myostatin gene has been knocked out by the method of claim 8.

[Claim 10]

The cell according to claim 9, wherein the cell is a porcine fetal fibroblast.

【Claim 11】

Method for producing transgenic animals other than humans in which the myostatin gene has been knocked out, comprising the following steps:

(a) preparing transformed cells by introducing the recombinant expression vector for knocking out the myostatin gene of claim 7 into cells of an animal to be transformed;

(b) collecting eggs from the ovaries of the animal to be transformed and then removing the nucleus from the eggs;

(c) a somatic cell nuclear transfer step of transplanting the nucleus of the transformed cell in step (a) into the egg from which the nucleus was removed in step (b); and

(d) Embryonic cells cultured from the somatic cell nuclear transfer cells of step (c) are implanted into the oviduct of the surrogate mother of the animal to be transformed, resulting in pregnancy. step

[Claim 12]

The method of claim 11, further comprising the following steps:

(e) separating the fetus from the surrogate mother whose pregnancy has been confirmed in step (d) of paragraph 11, and checking whether the myostatin gene has been knocked out in the fetus;

(f) a somatic cell nuclear transfer step of transplanting the nucleus of a fetal cell in which the myostatin gene has been knocked out into the egg from which the nucleus has been removed in step (b) of item 11; and

(g) A step of implanting the embryonic cells cultured from the somatic cell nuclear transfer cells of step (f) into the oviduct of a surrogate animal to become pregnant.

【Claim 13】

The method according to claim 11 or 12, wherein the transgenic animal is a transgenic pig.

[Claim 14]

Transgenic animals other than humans in which the myostatin gene has been knocked out by the method of claim 11 or 12.

[Claim 15]

The animal according to claim 14, wherein the transgenic animal is a transgenic pig.