CN107988256B - Recombinant vector for knocking-in human Huntington gene, construction method thereof and application thereof in construction of model pig - Google Patents

Recombinant vector for knocking-in human Huntington gene, construction method thereof and application thereof in construction of model pig Download PDF

Info

Publication number
CN107988256B
CN107988256B CN201711251907.5A CN201711251907A CN107988256B CN 107988256 B CN107988256 B CN 107988256B CN 201711251907 A CN201711251907 A CN 201711251907A CN 107988256 B CN107988256 B CN 107988256B
Authority
CN
China
Prior art keywords
gene
human
pig
sgrna
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201711251907.5A
Other languages
Chinese (zh)
Other versions
CN107988256A (en
Inventor
闫森
李晓江
赖良学
李世华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Institute of Biomedicine and Health of CAS
Jinan University
Original Assignee
Guangzhou Institute of Biomedicine and Health of CAS
Jinan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou Institute of Biomedicine and Health of CAS, Jinan University filed Critical Guangzhou Institute of Biomedicine and Health of CAS
Priority to CN201711251907.5A priority Critical patent/CN107988256B/en
Publication of CN107988256A publication Critical patent/CN107988256A/en
Application granted granted Critical
Publication of CN107988256B publication Critical patent/CN107988256B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
    • A01K67/027—New or modified breeds of vertebrates
    • A01K67/0275—Genetically modified vertebrates, e.g. transgenic
    • A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/873—Techniques for producing new embryos, e.g. nuclear transfer, manipulation of totipotent cells or production of chimeric embryos
    • C12N15/877—Techniques for producing new mammalian cloned embryos
    • C12N15/8778—Swine embryos
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/07—Animals genetically altered by homologous recombination
    • A01K2217/072—Animals genetically altered by homologous recombination maintaining or altering function, i.e. knock in
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/10—Mammal
    • A01K2227/108—Swine
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2267/00—Animals characterised by purpose
    • A01K2267/03—Animal model, e.g. for test or diseases
    • A01K2267/0306—Animal model for genetic diseases
    • A01K2267/0318—Animal model for neurodegenerative disease, e.g. non- Alzheimer's
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2810/00—Vectors comprising a targeting moiety
    • C12N2810/10—Vectors comprising a non-peptidic targeting moiety

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Environmental Sciences (AREA)
  • Developmental Biology & Embryology (AREA)
  • Animal Husbandry (AREA)
  • Biodiversity & Conservation Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Animal Behavior & Ethology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a recombinant vector for knocking-in human Huntington gene, a construction method thereof and application thereof in construction of model pigs. The invention firstly knocks in the mutated Huntington exon gene of human through the site-specific gene, and firstly utilizes the CRISPR/Cas9 technology to knock in the pathogenic gene at a site, optimizes the sgRNA and the donor vector, improves the probability of knocking in the positive clone cell of the gene, improves the probability of directly obtaining the positive gene knocking in the pig by combining with the pig somatic cell nuclear transplantation technology, obtains the miniature pig with the knocked-in gene of human Huntington disease, and proves that the method is used for constructing the high-efficiency feasibility of the genetically modified pig. The Huntington gene knock-in model pig constructed by the invention can generate typical behavioral characteristics of respiratory disorder, dyskinesia and the like similar to human Huntington disease, can perform stable heritable passage, provides a reliable model for human research on the Huntington disease, can ensure the quantity to be used for drug screening, gene therapy stem cell therapy and the like, and can become a good disease model for human.

Description

Recombinant vector for knocking-in human Huntington gene, construction method thereof and application thereof in construction of model pig
Technical Field
The invention relates to the field of genetic engineering, in particular to a recombinant vector for knocking in human Huntington gene, a construction method thereof and application thereof in construction of model pigs.
Background
Huntington's Disease (HD) results from the accumulation of nuclear inclusion bodies and nerve fibers by N-terminal fragments carrying more than 37 polyglutamic acid repeats (Gusella et al, Archives of neurology, 1993; Vonstatel et al, Journal of neuropathology and experimental neurology 1998), an autosomal dominant disease resulting from a mutation in the Huntington gene (Htt) located on the fourth chromosomal short arm, which is mainly manifested by accumulation of a mutated protein in brain neurons and neuronal death. The pathogenesis of huntington disease is well understood, and when the HTT gene contains more than 37 glutamine sequences, the mutant huntingtin protein is misfolded and forms inclusion body aggregates within neurons, resulting in neuronal death, which results in motor and cognitive dysfunction.
Since direct experiments on patients are often limited by experimental materials and ethical aspects, making a model of huntington's disease that is substantially similar to human physiological functions is of great importance in studying human huntington and other neurodegenerative diseases, and helps to reveal the mechanism of inclusion body formation by aggregates and misfolded proteins. At present, the huntington's disease animal model mainly includes small animal models such as drosophila, zebrafish, mouse and rat, and cannot truly reflect the symptoms of human huntington's disease. Compared with these animal models, pigs are evolutionarily closer to humans, e.g., neural, digestive, cutaneous, skeletal development and metabolism are very similar to humans compared to rats, mice, without sulci and gyri; the brain structure of the pig is the sulcus and the gyrus, and the volume and the like are very similar to the brain of the human; and the gene expression and the occurrence and the development of diseases of the pig are more similar to those of the human. Therefore, pigs can be used as an ideal animal model for Huntington's disease.
In the pigs with the transferred variant Huntintin gene, the newborn piglets are often weak and small compared with normal pigs, the weight of the pigs is slowly increased, and the pigs die soon after birth, so that the symptoms of neurodegenerative diseases which occur in middle-aged years cannot be well simulated. This was analyzed by multiple copy integration of the gene or overexpression of the Huntintin variant protein leading to immediate death of the large animal after birth.
The traditional gene knock-in model is usually obtained by a mouse stem cell homologous recombination method, and the probability of gene knock-in obtained by the traditional method for pig fibroblasts is very low and is only 10-6In recent years, the advent of artificial endonuclease (EEN) technology has resulted in an overwhelming change in gene targeting in large animals, artificial nucleases can Repair damaged DNA by creating DNA Double Strand Breaks (DSBs) at the target sites, which can activate the inherent Non-homologous end-joining, NHEJ, or homologous recombination Repair (HDR) at the target sites, thereby achieving site-Directed editing of the genome.However, constructing a long TA L E repeat sequence is a time-consuming and labor-intensive process.
Cas9 endonuclease is derived from a bacterial CRISPR/Cas9 system, RNA-mediated CRISPR-related Cas9 enzyme can be subjected to recognition and shearing through a specific 20 base pair targeting sequence in the early 2013, the Feng Zhang research group of MIT reports that the CRISPR/Cas9 system is used for realizing site-directed mutagenesis of EMX1 and PVA L B genes of human 293T cells and Th genes of mouse Nero2A cells for the first time (Cong et al, Science,2013), the mRNA encoding Cas9 and specific sgRNA are injected into embryos of unicellular zebrafish, 8 of 10 cleavage sites are cleaved (the result is much higher than TA L EN), the Cas9RNA and sgRNA are injected into the embryos without detecting toxicity, therefore, the gene targeting modification by the Cas9 technology is a high-efficiency and convenient means, the gene targeting modification is widely used for transplanting pig cells through a small mouse embryo-targeted knockout technology (the pig-mouse-born Cell knockout technology) and the like, the RNA knockout technology is used for improving the efficiency of mouse-targeted gene transplantation of mouse cells through a pig-mediated CRISPR-mediated mRNA, the pig-mediated CRISPR-mediated excision gene transplantation technology (the Tsu-mediated mRNA) and the pig-mediated mRNA-mediated targeted gene transplantation technology, the pig-mediated mRNA-mediated targeted gene transplantation of mouse-mediated CRISPR 20146 endonuclear-mediated mRNA is obtained through a Cell transplantation method, the pig-mediated targeted mutagenesis, the pig-mediated mutagenesis method of mouse-mediated mutagenesis, the pig-mediated mRNA-mediated targeted mutagenesis, the pig-mediated CRISH, the pig-mediated mRNA-mediated targeted mutagenesis, the pig-mediated mRNA-mediated targeted mutagenesis, the pig-mediated-/-Successful albino model and no chimeric model pigs were obtained by PARK2-/-/PINK1-/-The double knockout pig obtained a model pig of parkinson's disease (Zhou et al, CellMol L ife Sci, 2015). although Cas9 produced high knockout efficiency, the efficiency of directly injecting Cas9, sgRNA, and recombinant vector into fertilized eggs to produce knock-in animals was much lower than the knockout efficiency.
Disclosure of Invention
Accordingly, there is a need for a recombinant vector for human huntingtin gene knock-in, which has high knock-in efficiency and can be stably passaged, a method for constructing the same, and use thereof in constructing model pigs.
A recombinant vector for knocking-in of human Huntington gene, wherein a knock-in fragment is inserted into the recombinant vector, the knock-in fragment comprises a human mutated Huntington gene fragment and homologous arms which are respectively positioned at the upstream and downstream of the human mutated Huntington gene fragment and are homologous with the Huntington gene of a mini pig, and the human mutated Huntington gene fragment is a sequence fragment containing a mutation of CAG repetitive sequence in the first exon of the human Huntington gene.
In one embodiment, the number of CAG repeats in the human mutated huntingtin gene fragment is more than 36, preferably 150, and more preferably the sequence of the human mutated huntingtin gene fragment is shown in SEQ ID No. 13.
A construction method of a recombinant vector comprises the following steps: constructing a knock-in fragment containing a human mutant huntingtin gene fragment, wherein the human mutant huntingtin gene fragment is a sequence fragment containing a mutation of a CAG repeat sequence in a first exon of a human huntingtin gene, and in the knock-in fragment, homology arms homologous to the mini-pig huntingtin gene are respectively connected to the upstream and downstream of the human mutant huntingtin gene fragment, and connecting the knock-in fragment to a vector to obtain the recombinant vector.
In one embodiment, the attaching the knock-in fragment to the vector further comprises the steps of: the DNA fragments with the sequences shown as SEQ ID No.3 and SEQ ID No.4 are used as upstream and downstream primers, the genome DNA of a miniature pig is used as a template to amplify to obtain two homologous arms of the miniature pig and a first exon fragment of the pig Huntington gene positioned between the two homologous arms, the amplified product is cut by EcoRI and KpnI and then is connected to a pBluescriptKS (-) vector prepared by cutting the same incision enzyme to form a pBS-HD plasmid, and then the human mutated Huntington gene fragment is inserted into the middle of the two homologous arms to replace the first exon fragment of the pig Huntington gene, so that the pBS-HD-KI recombinant vector is obtained.
In one embodiment, the insertion of the human mutated huntingtin gene fragment in the middle of the two homology arms to replace the first exon fragment of the porcine huntingtin gene comprises the steps of:
taking the human mutated Huntington gene fragment as a template, designing NcoI and ApaI enzyme cutting sites at two ends of the human mutated Huntington gene fragment, and amplifying the human mutated Huntington gene fragment connected with the enzyme cutting sites by PCR;
carrying out NcoI and ApaI double enzyme digestion on the pBS-HD plasmid and the human mutant Huntington gene fragment connected with the enzyme digestion site respectively;
the pBS-HD-KI recombinant vector was obtained by ligating the human mutated huntingtin gene fragment into the pBS-HD plasmid using T4DNA ligase.
A method for constructing a reconstructed egg of a human Huntington gene knock-in model pig comprises the following steps:
the method comprises the following steps: an intron sequence following the first exon of the huntingtin gene for miniature pigs satisfies G (N)16Two recognition sequences of sgRNA with sequences shown in SEQ ID No.1 and SEQ ID No.2 are respectively designed in the plus chain sequence part of the NGG sequence mode and are respectively marked as a first sgRNA recognition sequence and a second sgRNA recognition sequence, and the first sgRNA recognition sequence and the second sgRNA recognition sequence are respectively matched with a corresponding intron plus chain sequence G (N)16Consistently, N is A, T, C or G, and subscript 16 indicates the number of N;
step two: designing complementary sequences for the first sgRNA recognition sequence and the second sgRNA recognition sequence respectively, wherein the first sgRNA recognition sequence and the complementary sequence thereof form a first double-stranded DNA, and the second sgRNA recognition sequence and the complementary sequence thereof form a second double-stranded DNA;
step three: designing sgRNA transcription vectors according to the first double-stranded DNA and the second double-stranded DNA respectively, and marking as a first sgRNA vector and a second sgRNA vector, wherein the first sgRNA vector contains the first double-stranded DNA, and the second sgRNA vector contains the second double-stranded DNA;
step four: co-transfecting a first sgRNA vector, a second sgRNA vector, a donor vector and a vector containing a Cas9 nickase gene into fibroblasts of a miniature pig, and screening out a positive single-cell clone of a human Huntington gene knock-in, wherein the donor vector is a recombinant vector for the human Huntington gene knock-in described in any one of the embodiments, or the donor vector is constructed by adopting the construction method of the recombinant vector described in any one of the embodiments;
step five: and cloning and digesting the positive single cell into a single cell, and injecting the single cell into an enucleated oocyte of a miniature pig to form a reconstructed egg.
In one embodiment, in step three, the first sgRNA vector and the second sgRNA vector are both transcription vectors initiated by the U6 promoter.
In one embodiment, in the fourth step, the co-transfection is performed by using a method of electrotransfection, the parameters of electrotransfection being: 1400V, 10ms, 1 pulse.
In one embodiment, in step four, the fibroblasts of the mini-pigs after co-transfection are cultured in a medium supplemented with vitamin C at a concentration of 25. mu.g/ml.
A reconstructed egg constructed by adopting the method for constructing the reconstructed egg of the human Huntington gene knock-in model pig.
A method for constructing a human gene knock-in model pig comprises the following steps:
constructing a reconstructed egg according to the method for constructing the reconstructed egg of the human Huntington gene knock-in model pig;
performing cell fusion and activation on the reconstructed eggs to obtain activated reconstructed eggs;
placing the activated reconstructed eggs into an oviduct of a surrogate sow, or culturing the activated reconstructed eggs in vitro to form reconstructed embryos, and then transplanting the reconstructed embryos into the uterus of the surrogate sow;
feeding the foster sow to generate a human Huntington gene knock-in model pig.
In one embodiment, the cell fusion and activation of the reconstructed egg to obtain an activated reconstructed egg specifically includes the following steps:
transferring the reconstructed eggs from the enucleation operating solution to an embryo culture solution to be fused and activated;
transferring the reconstructed ovum to a fusion liquid activating solution for balancing, transferring the well balanced reconstructed ovum into a fusion container, slightly shifting the reconstructed ovum to enable the contact surface of the oocyte and the injected cell to be parallel to two electrodes, wherein the interval between the two electrodes is 1mm, and then performing electric pulse stimulation, wherein the electric fusion parameters are as follows: 120volts/mm, 30 mus, 2 times;
and (4) transferring the reconstructed eggs into an embryo operating solution after electric pulse stimulation, and screening the reconstructed eggs successfully fused.
According to the recombinant vector for knocking-in the human Huntington gene and the construction method thereof, the reconstructed egg of the model pig and the construction method of the model pig, the first mutant Huntington exon gene (HTT gene) of the human Huntington gene is knocked-in for the first time through the site-specific gene, the pathogenic gene is knocked-in for the first time by using the CRISPR/Cas9 technology, the donor vector is optimized by optimizing the sgRNA, the probability of knocking-in the gene into a positive clone cell is improved, the probability of directly obtaining the positive gene knocking-in pig is improved by combining with the pig somatic cell nucleus transplantation technology, the miniature pig with the knocked-in human Huntington disease gene is obtained, and the high-efficiency feasibility of constructing the genetically modified pig by. Because the Huntington disease is a single-gene autosomal dominant genetic disease, the pathogenic gene is single and typical, and the obtained Huntington knock-in model pig shows typical Huntington pathology and behavioral characteristics, most importantly, the Huntington knock-in model pig can be stably inherited, so that a reliable model can be provided for human research of Huntington disease, and the number of the Huntington disease can be ensured so as to be used for drug screening, gene therapy stem cell therapy and the like, and the Huntington disease can become a good disease model animal for human.
Drawings
FIG. 1 is a schematic diagram showing the principle of a method for constructing a human Huntington gene knock-in model pig according to one embodiment;
FIG. 2 is a PCR identification chart of positive knock-in fibroblasts and the result of pregnancy rate in somatic cell nuclear transfer;
FIG. 3 shows the detection and observation results of the knock-in of the positive gene after the production of the pregnant pig;
FIG. 4 shows the results of the body shape, exercise capacity, survival curve and weight change of KI and WT pigs;
FIG. 5 is a graph showing the results of the expression of the mutated HD gene knock-in pig protein;
FIG. 6 is a graph of the genetic results of a mutant Huntington gene knock-in pig.
Detailed Description
To facilitate an understanding of the invention, the invention will now be described more fully with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items.
As shown in fig. 1, a method for constructing a human huntingtin gene knock-in model pig according to an embodiment includes the steps of:
step S110: an intron sequence after the first Exon (Exon1) of the huntingtin gene for miniature pigs satisfies G (N)16Two different recognition sequences of the sgRNA are respectively designed in the plus chain sequence part of the NGG sequence mode and are respectively marked as a first sgRNA recognition sequence (sgRNA-1) and a second sgRNA (sgRNA-2) recognition sequence, and the first sgRNA recognition sequence and the second sgRNA recognition sequence are respectively matched with a corresponding intron plus chain sequence G (N)16Consistently, N is A, T, C or G, and subscript 16 indicates the number of N.
The miniature pig, namely minipig (Sus scrofa, HTT Gene ID: 397014), can be, but is not limited to, for example, Guangxi Swine in China.
In this embodiment, the first sgRNA recognition sequence (GCACCGACCGTGAGTGC) is shown in SEQ ID No.1 and the second sgRNA recognition sequence (GCGGTGACGTCATGCCT) is shown in SEQ ID No. 2. The positive chain of the intron satisfies G (N)16The sequences of the NGG sequence patterns are shown in SEQ ID No.7(GAGCCGCTGCACCGACCGTGAGTGCGGGCCCCCTGCA) andSEQ ID No.8 (GCGGGGCAGCGGTGACGTCATGCCTCGGGGCGGGGGC).
Step S120: complementary sequences are designed for the first sgRNA recognition sequence and the second sgRNA recognition sequence respectively, the first sgRNA recognition sequence and the complementary sequence thereof form a first double-stranded DNA, and the second sgRNA recognition sequence and the complementary sequence thereof form a second double-stranded DNA.
Specifically, in this embodiment, the process for constructing the first double-stranded DNA and the second double-stranded DNA comprises the following steps:
designing complementary sequences for the first sgRNA recognition sequence and the second sgRNA recognition sequence respectively;
adding ATA at the 5 ' end of the first sgRNA recognition sequence, adding a GT sequence fragment at the 3 ' end to form a sequence fragment (ATA GCACCGACCGTGAGTGC GT) shown in SEQ ID No.9, adding a TAAAAC sequence fragment at the 5 ' end of the complementary sequence of the first sgRNA recognition sequence to form a sequence fragment (TAAAACGCACTCACGGTCGGTGC) shown in SEQ ID No.10, and annealing the first sgRNA recognition sequence added with a sticky end and the complementary sequence added with the sticky end to obtain a first double-strand DNA with the sticky end;
adding ATA to the 5 ' end of the second sgRNA recognition sequence and a GT sequence fragment to the 3 ' end of the second sgRNA recognition sequence to form a sequence fragment shown in SEQ ID No.11 (ATA GCGGTGACGTCATGCCT GT), adding a TAAAAC sequence fragment to the 5 ' end of the complementary sequence of the second sgRNA recognition sequence to form a sequence fragment shown in SEQ ID No.12 (TAAAACAGGCATGACGTCACCGC), and annealing the second sgRNA recognition sequence added with the cohesive end and the complementary sequence thereof added with the cohesive end to obtain a second double-stranded DNA with the cohesive end.
The cohesive ends of the first double-stranded DNA and the second double-stranded DNA formed can be used for connecting to a corresponding transcription vector.
Step S130: sgRNA transcription vectors are designed according to a first double-stranded DNA and a second double-stranded DNA, and are marked as a first sgRNA vector and a second sgRNA vector, wherein the first sgRNA vector contains the first double-stranded DNA, and the second sgRNA vector contains the second double-stranded DNA.
In this step, the first double-stranded DNA and the second double-stranded DNA are correspondingly ligated to a plasmid containing the sgRNA coding sequence, for example, to a plasmid vector containing the U6 promoter, and the process specifically includes the following steps: introducing corresponding enzyme cutting sites, such as BbsI enzyme cutting sites, into a plasmid vector containing a sgRNA coding sequence to obtain an intermediate plasmid, and connecting the first double-stranded DNA and the second double-stranded DNA to corresponding positions of the intermediate plasmid after enzyme cutting through the introduced enzyme cutting sites (namely cohesive ends) to obtain the required plasmid. Wherein, the cleavage site can be but not limited to a BbsI cleavage site, when the cleavage site is the BbsI cleavage site, the first double-stranded DNA and the second double-stranded DNA are both connected with the sticky ends, and the cloning vector is cleaved by BbsI.
Step S140: constructing a knock-in fragment containing a human mutant huntingtin gene fragment, wherein the human mutant huntingtin gene fragment is a sequence fragment containing a mutation of a CAG repeat sequence in the first exon of the human huntingtin gene, and in the knock-in fragment, homology arms homologous to the mini-pig huntingtin gene are respectively connected to the upstream and downstream of the human mutant huntingtin gene fragment, and ligating the knock-in fragment to a vector to obtain a recombinant vector as a donor vector.
In one embodiment, DNA fragments with sequences shown in SEQ ID No.3 and SEQ ID No.4 are used as upstream and downstream primers, the two homologous arms of the miniature pig and the first exon fragment of the pig Huntington gene positioned in the middle of the two homologous arms are obtained by amplification by using the genome DNA of the miniature pig as a template, the amplification product is cut by EcoRI and KpnI and then is connected to a pBluescript KS (-) vector cut by the same endonuclease to form a pBS-HD plasmid, and then the first exon fragment of the pig Huntington gene is replaced by the middle of the two homologous arms by inserting a human mutated Huntington gene fragment to obtain the pBS-HD-KI recombinant vector. In other embodiments, the use of the pBluescript KS (-) vector is not limited.
More specifically, the human mutant huntingtin gene fragment is a mutant sequence fragment with the number of CAG repeats in the first exon of the human huntingtin gene being more than 36, and the insertion of the human mutant huntingtin gene fragment in the middle of the two homology arms replaces the first exon fragment of the porcine huntingtin gene comprising the following steps:
taking the human mutated Huntington gene fragment as a template, designing NcoI and ApaI enzyme cutting sites at two ends of the human mutated Huntington gene fragment, and amplifying the human mutated Huntington gene fragment connected with the enzyme cutting sites by PCR;
carrying out NcoI and ApaI double enzyme digestion on the pBS-HD plasmid and the human mutant Huntington gene fragment connected with the enzyme digestion site respectively;
the human mutated huntingtin gene fragment is ligated into the pBS-HD plasmid using T4DNA ligase or the like to obtain the pBS-HD-KI recombinant vector.
The number of CAG repeats in the human mutated huntingtin gene fragment according to this embodiment is more than 36, preferably 150, and more preferably the sequence of the human mutated huntingtin gene fragment is shown in SEQ ID No. 13.
Step S150: the first sgRNA vector, the second sgRNA vector, the donor vector and the vector containing Cas9 nickase gene were co-transfected into fibroblasts of minipigs, and positive single-cell clones with human huntingtin gene knock-in were selected.
The vector containing the Cas9 nickase gene may be, but is not limited to, a vector containing a CMV-Cas9-neo gene.
In this step, the co-transfection is a method using electrotransfection, the parameters of which are: 1400V, 10ms, 1 pulse.
Further, in this step, the fibroblasts of the miniature pig after the co-transfection were cultured in a medium supplemented with vitamin C at a concentration of 25. mu.g/ml.
Screening positive single cell clones for human huntingtin gene knock-in includes the following steps:
cracking the partially cultured clone cells, and extracting a lysate;
and (3) carrying out PCR treatment on the hydrolysate, wherein the primer sequences of the PCR are respectively shown as SEQ ID No.5 (5'-GGAGAGCTGGGAGAGAATGCCAGTGTGACAGT-3') and SEQ ID No.6 (5'-GCGGCTGAGGCAGCAGCGGCTGTGCCTG-3'), and the PCR conditions are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30 seconds, annealing at 65 ℃ for 30 seconds, and extension at 72 ℃ for 90 seconds for 30 cycles; final extension at 72 ℃ for 2 min;
and (3) carrying out 1% agarose gel electrophoresis detection and/or sequencing analysis on the PCR product, and selecting positive clone cells.
In addition, in this embodiment, before the first sgRNA vector, the second sgRNA vector, the donor vector, and the vector containing the Cas9 nickase gene are co-transfected into fibroblasts, the method further includes the steps of transforming and then expanding the first sgRNA vector, the second sgRNA vector, the donor vector, and the vector containing the Cas9 nickase gene, and then extracting the first sgRNA vector, the second sgRNA vector, the donor vector, and the vector containing the Cas9 nickase gene, respectively.
Step S160: the positive single cell clone is digested into a single cell and injected into an enucleated oocyte of a miniature pig to form a reconstituted egg.
Specifically, in the present embodiment, the following steps may be adopted:
digesting the positive clone cells by using trypsin, then carrying out centrifugal treatment, removing supernatant and re-suspending the cells;
after the oocyte is enucleated in the enucleation operating fluid by a blind suction method, the cell resuspended in the previous step is sucked and directly injected into the perivitelline space of the enucleated oocyte, and the oocyte is slightly squeezed, so that the cell membrane of the oocyte is contacted with the cell membrane of the injected cell.
Step S170: and performing cell fusion and activation on the reconstructed eggs to obtain activated reconstructed eggs.
Specifically, the cell fusion and activation of the reconstructed egg to obtain the activated reconstructed egg specifically comprises the following steps:
transferring the reconstructed eggs from the denucleation operating solution into an embryo culture solution to be fused and activated;
transferring the reconstructed ovum to a fusion liquid activating solution for balancing, transferring the well balanced reconstructed ovum into a fusion container, slightly shifting the reconstructed ovum to enable the contact surface of the oocyte and the injected cell to be parallel to two electrodes, wherein the interval between the two electrodes is 1mm, and then performing electric pulse stimulation, wherein the electric fusion parameters are as follows: 120volts/mm, 30 mus, 2 times;
and (4) transferring the reconstructed eggs into an embryo operating solution after electric pulse stimulation, and screening the reconstructed eggs successfully fused.
Step S180: and (3) placing the activated reconstructed eggs into the oviducts of the surrogate sows, or culturing the activated reconstructed eggs in vitro to form reconstructed embryos, then transplanting the reconstructed embryos into the uterus of the surrogate sows, feeding the surrogate sows, and generating the human Huntington gene knock-in model pigs.
Further, the method can also comprise the following steps of identifying the human Huntington gene knock-in model pig: taking genome DNA obtained from the tissue of a piglet produced by a surrogate sow as a template, taking DNA segments with sequences shown in SEQ ID No.5 and SEQ ID No.6 as upstream and downstream primers for PCR amplification, and carrying out agarose gel electrophoresis detection and/or sequencing detection on an amplification product, wherein the PCR conditions are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30 seconds, annealing at 65 ℃ for 30 seconds, and extension at 72 ℃ for 90 seconds for 30 cycles; final extension at 72 ℃ for 2 min.
According to the construction method of the human Huntington gene knock-in model pig, the human mutated Huntington first exon gene (HTT gene) is knocked in through the site-specific gene for the first time, the pathogenic gene is knocked in through the CRISPR/Cas9 technology for the first time, donor homologous recombinant plasmids are optimized through optimizing the sgRNA sequence, the cell proportion during transfection is optimized, vitamin C is added in the cell screening process, the probability of knocking in positive clone cells is improved, the probability of directly obtaining the positive gene knock-in model pig is improved through the combination of the pig somatic cell nuclear transplantation technology, the Huntington disease gene knock-in miniature pig is obtained, and the feasibility and the high efficiency of the method for constructing the gene modified pig are proved. Because huntington's disease is a single-gene autosomal dominant genetic disease, the causative gene is single and typical, and the obtained HD knock-in model pig exhibits typical huntington's pathological and behavioral characteristics, it is most important that the HD knock-in model pig can be stably passaged, which can provide a reliable model for human research of huntington's disease, ensure the number and can be used for drug screening, gene therapy stem cell therapy, etc., and can be a good disease model animal for human.
The following are specific examples.
Materials: cell: guangxi melt water mini pig primary fibroblasts.
Animals: all experimental animals are operated according to the standards and requirements of Guangzhou biological medicine and health research institute of Chinese academy of sciences, and obey the ethical moral of animals. The small pig adopted in the experiment is smaller in size, is closer to human, and is convenient to operate and conduct ethological determination.
Pig ovary: purchased from slaughter houses.
The strain is as follows: top10 competent cell (Beijing Tiangen Biochemical technology Co., Ltd.)
Other reagents, unless otherwise specified, were purchased from Sigma, parenthesis followed by the corresponding chinese name and/or catalog number.
(1) Construction of CRISPR/Cas9 targeting system:
according to the sequence of the HTT Gene of small and medium-sized pigs in the NCBI database (Gene ID: 397014), according to G (N) with intron sequences16According to the NGG principle, two corresponding recognition sequences of sgRNA are designed for the intron positive strand (partial sequences are shown as SEQ ID No.7 and SEQ ID No. 8) behind the first exon (exon1), and are respectively marked as a first sgRNA recognition sequence (shown as SEQ ID No. 1) and a second sgRNA recognition sequence (shown as SEQ ID No. 2).
Extracting a genome for a cell to be transfected, and designing a pair of primers at two ends of a target sequence identified by a recognition sequence of the sgRNA, wherein the sequence of an upstream primer is as follows: 5'-GGAGAGCTGGGAGAGAATGCCAGTGTGACAGT-3' (shown as SEQ ID No. 5), the sequence of the downstream primer is: 5'-GCGGCTGAGGCAGCAGCGGCTGTGCCTG-3' (shown in SEQ ID No. 6), and PCR amplifying DNA fragment containing target sequence with the fragment size of 388 bp. The PCR amplification conditions were: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30 seconds, annealing at 65 ℃ for 30 seconds, and extension at 72 ℃ for 90 seconds for 30 cycles; final extension at 72 ℃ for 2 min. And (3) comparing the amplified target sequence fragment with a sequence on a GenBank after sequencing to determine that the sequence is correct.
2 BbsI sites were introduced into the sgRNA-GFP-T1 (Addgene, Cat. No. 41819) plasmid to obtain a U6-sgRNA cloning vector. Designing complementary sequences for the first sgRNA recognition sequence and the second sgRNA recognition sequence respectively, adding cohesive ends at two ends of the first sgRNA recognition sequence, the second sgRNA recognition sequence and the corresponding complementary sequences, and annealing to form a first double-stranded DNA and a second double-stranded DNA. Wherein, the sequences of two strands in the first double-stranded DNA are respectively shown as SEQ ID No.9 and SEQ ID No.10, and the sequences of two strands in the second double-stranded DNA are respectively shown as SEQ ID No.11 and SEQ ID No. 12.
And correspondingly connecting the first double-stranded DNA and the second double-stranded DNA to a U6-sgRNA cloning vector digested by BbsI to obtain a first sgRNA vector and a second sgRNA vector, and determining that the sequences are correctly connected through sequencing.
(2) Construction of Donor vectors for genes to be knocked in
The DNA fragments of the sequences shown in SEQ ID No.3(ACGAATTCTGCATGAAGGCTGGCAT(EcoRI)) and SEQ ID No.4(TTGGTACCCTCCCGCAGCATATGG (Kpn1)) are used as upstream and downstream primers, the two homologous arms of the miniature pig and the target sequence 18Q (18CAG repeat sequence) connected between the two homologous arms are obtained by amplification by using the genome DNA of the miniature pig as a template, the amplification product is connected to a pBluescript KS (-) vector, and then the human mutated Huntington gene with the PolyQ of 150Q on the first exon is inserted into the middle of the homologous arms to replace the target sequence 18Q, so that the pBS-HD-KI plasmid is used as a donor vector.
Specifically, the insertion of the 150Q human mutated huntingtin gene into the middle replacement target sequence of the homology arm comprises the following steps:
using DNA fragments with sequences shown in SEQ ID No.3 and SEQ ID No.4 as upstream and downstream primers, using genome DNA of the miniature pig as a template to amplify to obtain two homologous arms of the miniature pig and a first exon fragment of the pig Huntington gene positioned between the two homologous arms, carrying out enzyme digestion on an amplified product by EcoRI and KpnI, and then connecting the amplified product to a pBluescript KS (-) vector cut by the same endonuclease to form a pBS-HD plasmid;
taking mutated DNA containing 150CAG repetitive sequences as a template, designing NcoI and ApaI enzyme cutting sites at two ends of the template for PCR amplification to amplify an exon 1DNA fragment which is mutated by human and contains 150CAG repetitive sequences, and amplifying about 600bp of the human Huntington exon1 gene containing 150 CAGs;
the pBS-HD plasmid and the PCR recovery product of exon1 containing 150CAG repetitive sequence mutated by human are respectively subjected to NcoI enzyme digestion and ApaI enzyme digestion, and after fragments are recovered, the fragments are connected to the pBS-HD plasmid by utilizing T4DNA ligase, so that the pBS-HD-KI plasmid gene knock-in donor plasmid is obtained.
(3) Cell transfection and selection
The vector containing the Cas9 nickase gene may be, but is not limited to, a vector containing a CMV-Cas9-neo gene.
The first sgRNA vector, the second sgRNA vector, the donor vector and the vector containing the Cas9 nickase gene (such as a vector containing a CMV-Cas9-neo gene, purchased from Addgene company, and having a product catalog number of M L M3613) are subjected to transformation treatment and then are subjected to amplification culture, and then the first sgRNA vector, the second sgRNA vector, the donor vector and the vector containing the Cas9 nickase gene are respectively extracted, wherein the first sgRNA vector and the second sgRNA vector are 2.5 mu g respectively, and the donor vector and the vector containing the Cas9 nickase gene are 10 mu g respectively.
Resuscitating fetal primary fibroblasts of the thawed miniature swine one day before transfection, adding 10ml of 15% FBS DMEM culture medium into a 10cm cell culture dish, and placing the culture dish in a 37 ℃ culture box for culture; after the cells were grown in 90% petri dishes, the resuspended cells were trypsinized, 100. mu.l of the cells were resuspended using buffer R (MPK10096, invitrogen) in the Transfection kit, then 2.5. mu.g of the first sgRNA vector, 2.5. mu.g of the second sgRNA vector, 10. mu.g of the donor vector and 10. mu.g of the vector containing the Cas9 nickase gene were added, and electrotransfection was performed using a Neon Transfection System electrotransfer (MPK5000, invitorgen) to which 3ml of E2buffer, electrotransfer parameters: 1400V, 10ms, 1 pulse. After electrotransfer, diluting the cells into different culture dishes by a dilution method, screening the cells by G418, selecting single cells by using a cloning ring after the single cells grow into a clone shape, and carrying out PCR and agarose gel electrophoresis identification on a small amount of the single cells.
The identification steps are as follows: centrifuging, collecting and identifying monoclonal cells, adding 15 μ l NP40 lysate (containing 0.45% NP-40 and 0.6% proteinase K), sequentially lysing at 56 deg.C for 1h and at 95 deg.C for 10 min, and storing the lysate at-20 deg.C; and (3) carrying out PCR treatment on the hydrolysate, wherein the primer sequences of the PCR are respectively shown as SEQ ID No.5 (5'-GGAGAGCTGGGAGAGAATGCCAGTGTGACAGT-3') and SEQ ID No.6 (5'-GCGGCTGAGGCAGCAGCGGCTGTGCCTG-3'), and the PCR conditions are as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30 seconds, annealing at 65 ℃ for 30 seconds, and extension at 72 ℃ for 90 seconds for 30 cycles; final extension at 72 ℃ for 2 min;
taking the PCR product to carry out 1% agarose gel electrophoresis detection. Single bright one-band PCR products were obtained for sequencing of the cantonese genes with forward primer. The sequencing result is consistent with the sequence comparison of the original donor plasmid pBS-HD-KI, and the human mutated HD gene knock-in positive cell clone is obtained.
The positive monoclonal cells were selected as nuclear transfer donor cells and subjected to somatic cell nuclear transfer.
To improve the efficiency of gene knock-in and the state of cell culture, cells were made to be in an active division-growth state during transfection, and vitamin C was added to the medium at a concentration of 25. mu.g/ml to maintain a good cell state. When the clone is picked up for amplification and passage, a small amount of the clone is taken out for PCR identification. Firstly, cells to be identified are placed in an oven, the temperature is raised to 96 ℃ after 1 hour at 56 ℃ for 10 minutes of denaturation, positive clones are identified by the PCR method, and the positive HD gene containing homologous arms is knocked into fibroblast clones.
(4) Somatic cell nuclear transfer
1) Isolation and maturation of porcine oocytes
Taking an ovary from a slaughterhouse, placing the ovary in physiological saline containing penicillin and streptomycin at 39 ℃, drawing out an extracted follicle from the follicle by using a syringe, standing at 39 ℃ for 30 minutes, removing a supernatant, carrying out heavy suspension precipitation by using T L-HEPES, standing, finally placing a heavy suspension into a 60mm flat dish, selecting a cumulus cell-oocyte wrapping a cumulus by more than 2 layers and having uniform cytoplasm under a stereoscope, washing the cumulus cell-oocyte by using a mature liquid for 3 times, transferring the cumulus cell-oocyte into a culture solution for culture, and after 42 hours, removing a cumulus by using DPBS (double stranded brazilian nucleic acid) containing 0.5% hyaluronidase, and picking out an oocyte containing a polar body for somatic cell nuclear transplantation.
Specifically, the collected pig ovary is placed in 39 deg.C physiological saline containing penicillin and streptomycin, follicular fluid is aspirated out and kept warm in 39 deg.C water bath, after standing for 5 min, supernatant is removed, and ovum-washing solution PVA-T L-HEPES (6.6633 gN is weighed) is addedaCl、0.2386g KCl、0.1680g NaHCO3、0.0408g NaH2PO4、0.1017g MgCl2·6H2O, 2.3830g hepes (4-hydroxyethylpiperazine ethanesulfonic acid, H3784), 0.0650g Penicilin (Penicillin, P3032), 0.0100g pHenol Red (phenol Red, 5530), 0.2940g CaCl2·2H2O, 0.1000g of Polyvinyl alcohol (PVA, Polyvinyl alcohol P8136), 2.1860g of Sorbitol (Sorbitol, S1876), 0.0250g of Gentamicin (Gentamicin), 0.0220g of Sodium pyroltate (Sodium pyruvate, P4562), 998.132ml of Milli Q H2O (ultrapure water) was followed by 1.868ml Na L actate (Sodium lactate, L7900), adjusted pH to 7.2-7.4 after solubilization and osmolality of 295-310mOsm), cumulus oocyte complexes were picked up and transferred to pre-equilibrated maturation medium (TCM-199(Gibco Inc.) plus 3.05mM D-glucose (D-glucose, G7021), 0.91mM Sodium pyruvate (Sodium pyruvate, P4562), 0.1% PVA (Sigma, P8136), 75. mu.g/ml Penicillin (Sigma, P3032), 50. mu.g/ml Streptomyces (Streptomycin, S1277), 0.5. mu.g/ml L utilizin (L H, luteinizing hormone, L5269), 10ng/ml Epidermatomayfan (EGF, epidermal growth factor, S4127), 0.415G/ml Cysteine (EGF), 0.3 mM FSH, 2. mu.5 mM Follicle stimulating hormone, 2) in FSH, 2, 3.5. mu.5. mu.g/ml Follicle stimulating hormone2Culturing under the conditions of saturation humidity and 39 ℃, placing 40-70 cumulus oocyte complexes in each hole of a 12-hole plate, after in vitro maturation culture for 42-44H, transferring the cumulus oocyte complexes into a cumulus removing operation liquid (0.030g Hyaluronidase (Hyaluronidase, H3506), 5.46g Mannitol (Mannitol, M9647), 0.001g BSA (bovine serum albumin, A8022), 5ml PVA-T L-Hepes egg washing liquid, 95ml Milli Q H2O), vortexing and shaking for 5 minutes until cumulus cells are exfoliated. The digested oocytes were transferred to a container containing embryo handling fluid (9.500g TCM-199(Gibco Co.), 0.050g NaHCO)3，0.750g Hepes(H3784)，0.050g Penicillin(P3032)，0.060g Streptomycin(S1277)，1.755g NaCl，3.00g BSA，1000ml Milli Q H2O, adjusting the pH value to 7.2-7.4 after dissolution and the osmotic pressure to 295-310mOsm), and selecting and discharging the oocyte of the first polar body in another embryo operating fluid contained in the oocyte under a body mirrorAnd storing at 39 ℃ in a 35mm culture dish for later use.
2) Somatic cell nuclear transfer
The positive clone cell is digested into a single cell, the mature oocyte is enucleated by a micromanipulation system, then the donor cell is injected into the perivitelline space of the oocyte, the reconstructed embryo is activated by electrofusion, and the culture is continued.
Specifically, cultured positive clonal cells were digested with 0.25% trypsin for 4 minutes, then centrifuged at 1300 rpm for 5 minutes, the supernatant discarded, and the cells suspended in culture medium. The oocytes were enucleated using the blind aspiration method, and one donor cell was injected into the perivitelline space of the enucleated oocytes, and the oocytes were gently contacted with the donor cell. The reconstructed eggs are placed into a balanced embryo culture solution PZM3 and placed in an incubator at 38.5 ℃ to be fused and activated.
Reconstituted eggs were transferred from embryo culture to fusion activator (0.3M Mannitol (M9647), 1.0mM CaCl)2·2H2O，0.1mM MgCl2·6H2O, 0.5mM Hepes (H3784)), transferring the reconstructed egg to a fusion activation solution for balancing before fusion, transferring the balanced reconstructed egg into a fusion tank, slightly shifting the reconstructed embryo by using a capillary glass needle to enable the contact surface of the oocyte and the donor cell to be parallel to two electrodes with the interval of 1mM, and then performing electric pulse stimulation, wherein the electric fusion parameters are as follows: 120volts/mm, 30. mu.s, 2 times. Following electrical pulse stimulation, the reconstructed eggs were transferred to embryo handling fluid (9.500g TCM-199(Gibco Corp.), 0.050g NaHCO3，0.750g Hepes(H3784)，0.050gPenicillin，0.060gStreptomycin(S1277)，1.755g NaCl，3.00g BSA，1000ml Milli QH2O, adjusting the pH value to 7.2-7.4 after dissolution, and adjusting the osmotic pressure to 295-310mOsm), checking whether donor cells are fused after being placed in the solution at 39 ℃ for half an hour, removing unfused reconstructed eggs and counting the fusion rate. After three washes with PZM-3, reconstituted eggs were placed in PZM-3 in 5% CO2Culturing under the conditions of saturated humidity and 39 ℃.
3) Embryo transfer
The embryo develops to the 2-cell stage. Selecting the Taihu pigs which naturally estruse the same day or estruse 2 days before. The 2-cell embryo is implanted into the oviduct through surgical operation, and the gene knock-in miniature pig can be produced after 114 days.
(5) Method for identifying positive gene knock-in cell and gene knock-in pig
Identifying positive gene knock-in cells and gene knock-in pig primer sequences:
HD S:5’-GGAGAGCTGGGAGAGAATGCCAGTGTGACAGT-3’(SEQ ID No.5)
HD A:5’-GCGGCTGAGGCAGCAGCGGCTGTGCCTG-3’(SEQ ID No.6)
the PCR conditions were: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 30 seconds, annealing at 65 ℃ for 30 seconds, and extension at 72 ℃ for 90 seconds for 30 cycles; final extension at 72 ℃ for 2 min.
1) Identifying the genotype of the cloned pig: after birth, ear tags are punched on newly cloned pigs, small ear tissues are taken down to extract genome for identification, and the specific steps are as follows:
A. cutting ear tissue, adding 200 μ l GA solution and 20 μ l (20mg/ml) proteinase K, and digesting at 56 deg.C for 3 hr;
B. adding 200 mu l of GB solution, and carrying out water bath at 7 ℃ for 10 minutes until the mixture is clear;
C. adding 200 mul ethanol, and mixing;
D. the liquid was transferred to adsorption column CB3 at 12000 rpm and centrifuged for 30-60 seconds.
E. Washing the column with 500. mu.l GD and then twice with 600. mu.l PW;
F. finally, 100. mu.l of TE eluent preheated in a water bath at 65 ℃ is dropped into the middle of the column, and the column is kept stand for 3 minutes at 12000 revolutions and centrifuged for 2 minutes.
And (3) carrying out PCR (polymerase chain reaction) of the commercial tenant by taking the extracted genome as a template, carrying out agarose gel electrophoresis, observing a band, and then carrying out sequencing.
2) Identification of Gene knock-in pig protein expression
The brains of HD KI pigs (hereinafter abbreviated as KI pigs) and WT wild pigs are respectively taken out, and tissues are dehydrated, embedded in paraffin, sliced and the like through the fixation of 4 percent of poly-methanol, and the method comprises the following specific steps:
a. collecting materials, cutting tissue blocks of 2cm × 1.5.5 cm and thickness no more than 3mm, and placing in a soaking box;
b. dehydration (preparation of gradient alcohol in advance): 70% ethanol, 80% ethanol, 90% ethanol, 95% ethanol I, 95% ethanol II each for 2 hours; adding absolute ethyl alcohol I and absolute ethyl alcohol II for 1 hour; adding the mixture of absolute ethyl alcohol and dimethylbenzene (volume ratio is 1: 1) for 30 minutes;
c. and (3) tissue transparency: xylene I, 30 minutes; xylene II for 30 minutes;
d. wax dipping: paraffin wax is at 58 ℃ for 1h, at 59 ℃ for 1h and at 60 ℃ for 1 h;
e. embedding: the oven temperature was raised to 63 ℃ and the tissue was placed in the embedding cassette.
Immunohistochemistry and immunofluorescence staining procedures were as follows: a. melting wax; b. dewaxing; c. hydrating; d. repairing; e. sealing; f. primary antibody incubation; g. cleaning; h. and (5) incubating a secondary antibody.
3) Protein extraction and Western blotting
The membrane was transferred by a bio-rad membrane transfer apparatus at 200mA for 120 minutes using 0.4 μm PVDF membrane. After membrane transfer, washing with TBST (containing 0.05% tween 20), adding 5% skimmed milk, sealing at room temperature for 1h, adding 1C2 antibody at 4 deg.C overnight, washing with TBST for 3 times, adding 2 antibodies, incubating at room temperature for 1h, and washing for 3 times.
(6) The probability of knocking-in pig animal gene obtained after nuclear transplantation by cell level identification of positive clone is greatly improved
The screened positive cell clone is utilized for nuclear transplantation, VC is added into the resuscitated pig fetal fibroblast before nuclear transplantation, the cloning efficiency can be improved, the finally produced positive piglet has the gene knock-in positive rate of 86.7 percent, the economic cost is saved, the time is shortened, and the efficiency of positive animals of a gene knock-in model is improved.
(7) Results and analysis of the experiments
By optimizing the proportion of the donor vector plasmid pBS-HD-KI, the first sgRNA vector, the second sgRNA vector and the CMV-Cas9-neo plasmid: 10 ug, 2.5 ug, 10 ug, the parameters of the electrotransfer instrument were optimized to optimize the probability of gene knock-in for the highest efficiency. According to the optimized optimal proportion of the selected sgRNA sequence, the constructed homologous targeting plasmid and the electrotransformation plasmid, the SgRNA sequence is screened by G418After cell cloning, referring to fig. 2, by detecting two homology arms, the optimized efficiency is 13 positive clones in 15 cell clones, the success rate is up to 87%, which is far higher than 10 of the traditional gene knock-in-6And the probability of knocking-in of genes such as Talen and ZFN.
Continuing with fig. 2, the screened cell clones were used for nuclear transfer to produce HD knock-in pigs with a pregnancy rate of 62.5%.
As shown in fig. 3, the positive gene knock-in pigs identified after production were 6 positive gene knock-in pigs out of 7, with a probability as high as 85.7%. Therefore, the optimized methods for screening the gene knock-in cells and transplanting somatic cell nuclei are utilized to obviously improve the positive rate of the gene knock-in pigs, save the cost and improve the efficiency.
Traditional HD transgenic pigs usually die immediately after birth (Yang et al, 2010), the newborn HD gene knock-in model pigs of the embodiment are all consistent and normal with wild type pigs at birth, obvious dyskinesia, weight reduction and the like begin to appear almost at the time point of the gene knock-in pigs at 5 months, a progressive phenotype is generated, and the traditional transgenic pigs usually die immediately due to over-expression of toxic proteins or have lower inactive expression of randomly inserted sites. As shown in fig. 4, panels a and B, it can be seen that these pigs exhibited abnormal dyskinesia such as hind leg crossing, smooth steps, etc., and particularly No.5 produced a vigorous movement, i.e., a motor spasm. When the pigs are put on the running machine and kept at the speed of 1.5km/h for a period of time, the C diagram in figure 4 shows that the pigs with KI can not run normally and stay behind. Panel D of FIG. 4 shows that KI-2, KI-3, KI-4, KI-6 eventually die from the respiratory disorder. Fig. 4E shows the survival curve and weight change of KI pigs.
The HD gene knock-in model pig provides a good material for detecting the expression of the mutated Htt protein. The appearance of PolyQ repeats was shown by western blot analysis using the 1C2 antibody, and full-length mutant Htt was shown to be expressed in different brain regions (cerebral cortex, striatum) and other peripheral tissues such as liver and muscle, as shown in panel a of figure 5. As expected, degraded mutant Htt proteins were also observed and these degradations were only shown in KI pigs, wild type pigs were not shown, 1C2 staining also revealed accumulation of Htt in neurons and the resulting aggregation of nerve fibers as shown in panel B of fig. 5. These results were consistent with previous mice, indicating that the N-terminal Htt fragment forms aggregates.
As shown in FIG. 6, F1 piglets, which were identified by PCR as positive in 3 pigs bred by natural mating in which pig No.5 was pregnant, all expressed the mutated Htt protein as identified by Western Blot.
The mutant huntingtin knock-in pig was stably inherited to F1 and stably displayed mutant protein expression and behavioral changes, thus indicating a successful model.
The technical features of the embodiments described above may be arbitrarily combined, and for the sake of brevity, all possible combinations of the technical features in the embodiments described above are not described, but should be considered as being within the scope of the present specification as long as there is no contradiction between the combinations of the technical features.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> river-south university
GUANGZHOU INSTITUTES OF BIOMEDICINE AND HEALTH, CHINESE ACADEMY OF SCIENCES
Recombinant vector for knocking-in <120> human Huntington gene, construction method thereof and application thereof in construction of model pig
<160>13
<170>SIPOSequenceListing 1.0
<210>1
<211>17
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
gcaccgaccg tgagtgc 17
<210>2
<211>17
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
gcggtgacgt catgcct 17
<210>3
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
acgaattctg catgaaggct ggcat 25
<210>4
<211>24
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ttggtaccct cccgcagcat atgg 24
<210>5
<211>32
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ggagagctgg gagagaatgc cagtgtgaca gt 32
<210>6
<211>28
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
gcggctgagg cagcagcggc tgtgcctg 28
<210>7
<211>37
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
gagccgctgc accgaccgtg agtgcgggcc ccctgca 37
<210>8
<211>37
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
gcggggcagc ggtgacgtca tgcctcgggg cgggggc 37
<210>9
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
atagcaccga ccgtgagtgc gt 22
<210>10
<211>23
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
taaaacgcac tcacggtcgg tgc 23
<210>11
<211>22
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
atagcggtga cgtcatgcct gt 22
<210>12
<211>25
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
taaaacacag gcatgacgtc accgc 25
<210>13
<211>665
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
ccatggcgac cctggaaaag ctgatgaagg ccttcgagtc cctcaagtcc ttccagcagc 60
agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 120
agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 180
agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 240
agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 300
agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 360
agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 420
agcagcagca gcagcagcag cagcagcagc agcagcagca gcagcagcag cagcagcagc 480
agcagcagca gcagcagcaa cagccgccac cgccgccgcc gccgccgccg cctcctcagc 540
ttcctcagcc gccgccgcag gcacagccgc tgctgcctcagccgcagccg cccccgccgc 600
cgcccccgcc gccacccggc ccggctgtgg ctgaggagcc gctgcaccga ccgtgagttt 660
gggcc 665

Claims (12)

1. A method for constructing a recombinant vector, comprising the steps of: constructing a knock-in fragment containing a human mutant huntingtin gene fragment, wherein the human mutant huntingtin gene fragment is a sequence fragment containing a mutation of a CAG repeat sequence in a first exon of a human huntingtin gene, and in the knock-in fragment, homology arms homologous to the mini-pig huntingtin gene are respectively connected to the upstream and the downstream of the human mutant huntingtin gene fragment, and connecting the knock-in fragment to a vector to obtain the recombinant vector;
the step of attaching the knock-in fragment to a vector further comprises the steps of: the DNA fragments with the sequences shown as SEQ ID No.3 and SEQ ID No.4 are used as upstream and downstream primers, the genome DNA of the miniature pig is used as a template to amplify to obtain two homologous arms of the miniature pig and a first exon fragment of the pig Huntington gene positioned in the middle of the two homologous arms, the amplified product is cut by EcoRI and KpnI and then is connected to a pBluescript KS (-) vector prepared by cutting the same incision enzyme to form a pBS-HD plasmid, and then the human mutated Huntington gene fragment is inserted into the middle of the two homologous arms to replace the first exon fragment of the pig Huntington gene, so that the pBS-HD-KI recombinant vector is obtained.
2. The method of claim 1, wherein the number of CAG repeats in the human mutated huntingtin gene segment is greater than 36.
3. The method of claim 2, wherein the number of CAG repeats in the human mutated huntingtin gene segment is 150.
4. The method of claim 2, wherein the sequence of the human mutated huntingtin gene fragment is set forth in SEQ ID No. 13.
5. The method of claim 4, wherein the step of inserting the human mutated Huntington gene fragment in the middle of the two homology arms to replace the first exon fragment of the porcine Huntington gene comprises the steps of:
taking the human mutated Huntington gene fragment as a template, designing NcoI and ApaI enzyme cutting sites at two ends of the human mutated Huntington gene fragment, and amplifying the human mutated Huntington gene fragment connected with the enzyme cutting sites by PCR;
carrying out NcoI and ApaI double enzyme digestion on the pBS-HD plasmid and the human mutant Huntington gene fragment connected with the enzyme digestion site respectively;
the pBS-HD-KI recombinant vector was obtained by ligating the human mutated Huntington gene fragment into the pBS-HD plasmid using T4DNA ligase.
6. A method for constructing a reconstructed egg of a human Huntington gene knock-in model pig is characterized by comprising the following steps:
the method comprises the following steps: an intron sequence following the first exon of the huntingtin gene for miniature pigs satisfies G (N)16Two recognition sequences of sgRNA with sequences shown in SEQ ID No.1 and SEQ ID No.2 are respectively designed in the plus chain sequence part of the NGG sequence mode and are respectively marked as a first sgRNA recognition sequence and a second sgRNA recognition sequence, and the first sgRNA recognition sequence and the second sgRNA recognition sequence are respectively matched with a corresponding intron plus chain sequence G (N)16Consistently, N is A, T, C or G, and subscript 16 indicates the number of N;
step two: designing complementary sequences for the first sgRNA recognition sequence and the second sgRNA recognition sequence respectively, wherein the first sgRNA recognition sequence and the complementary sequence thereof form a first double-stranded DNA, and the second sgRNA recognition sequence and the complementary sequence thereof form a second double-stranded DNA;
step three: designing sgRNA transcription vectors according to the first double-stranded DNA and the second double-stranded DNA respectively, and marking as a first sgRNA vector and a second sgRNA vector, wherein the first sgRNA vector contains the first double-stranded DNA, and the second sgRNA vector contains the second double-stranded DNA;
step four: co-transfecting a first sgRNA vector, a second sgRNA vector, a donor vector and a vector containing a Cas9 nickase gene into fibroblasts of a miniature pig, and screening out a positive single-cell clone knocked-in human Huntington gene, wherein the donor vector is constructed by adopting the construction method of the recombinant vector according to any one of claims 1-5;
step five: and cloning and digesting the positive single cell into a single cell, and injecting the single cell into an enucleated oocyte of a miniature pig to form a reconstructed egg.
7. The method of claim 6, wherein in step three, the first sgRNA vector and the second sgRNA vector are both transcription vectors driven by a U6 promoter.
8. The method for constructing reconstituted eggs of a human Huntington gene knock-in model pig as claimed in any one of claims 6 to 7, wherein in the fourth step, the cotransfection is carried out by using the method of electrotransfection, wherein the parameters of the electrotransfection are as follows: 1400V, 10ms, 1 pulse.
9. The method according to any one of claims 6 to 7, wherein in step four, the fibroblasts of the mini-pig after the co-transfection are cultured in a medium supplemented with vitamin C at a concentration of 25 μ g/ml.
10. The reconstructed egg constructed by the method for constructing the reconstructed egg of the human Huntington gene knock-in model pig as claimed in any one of claims 6 to 9.
11. A method for constructing a human gene knock-in model pig is characterized by comprising the following steps:
constructing a reconstructed egg according to the method for constructing the reconstructed egg of the human Huntington gene knock-in model pig as claimed in any one of claims 6 to 9;
performing cell fusion and activation on the reconstructed eggs to obtain activated reconstructed eggs;
placing the activated reconstructed eggs in the oviducts of the surrogate sows, or culturing the activated reconstructed eggs in vitro to form reconstructed embryos, and then transplanting the reconstructed embryos into the uterus of the surrogate sows;
feeding the foster sow to generate a human Huntington gene knock-in model pig.
12. The method according to claim 11, wherein the step of performing cell fusion and activation on the reshaped egg to obtain an activated reshaped egg comprises the steps of:
transferring the reconstructed eggs from the enucleation operating solution to an embryo culture solution to be fused and activated;
transferring the reconstructed ovum to a fusion liquid activating solution for balancing, transferring the well balanced reconstructed ovum into a fusion container, slightly shifting the reconstructed ovum to enable the contact surface of the oocyte and the injected cell to be parallel to two electrodes, wherein the interval between the two electrodes is 1mm, and then performing electric pulse stimulation, wherein the electric fusion parameters are as follows: 120volts/mm, 30 mus, 2 times;
and (4) transferring the reconstructed eggs into an embryo operating solution after electric pulse stimulation, and screening the reconstructed eggs successfully fused.
CN201711251907.5A 2017-12-01 2017-12-01 Recombinant vector for knocking-in human Huntington gene, construction method thereof and application thereof in construction of model pig Active CN107988256B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711251907.5A CN107988256B (en) 2017-12-01 2017-12-01 Recombinant vector for knocking-in human Huntington gene, construction method thereof and application thereof in construction of model pig

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711251907.5A CN107988256B (en) 2017-12-01 2017-12-01 Recombinant vector for knocking-in human Huntington gene, construction method thereof and application thereof in construction of model pig

Publications (2)

Publication Number Publication Date
CN107988256A CN107988256A (en) 2018-05-04
CN107988256B true CN107988256B (en) 2020-07-28

Family

ID=62035265

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711251907.5A Active CN107988256B (en) 2017-12-01 2017-12-01 Recombinant vector for knocking-in human Huntington gene, construction method thereof and application thereof in construction of model pig

Country Status (1)

Country Link
CN (1) CN107988256B (en)

Families Citing this family (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10323236B2 (en) 2011-07-22 2019-06-18 President And Fellows Of Harvard College Evaluation and improvement of nuclease cleavage specificity
US20150044192A1 (en) 2013-08-09 2015-02-12 President And Fellows Of Harvard College Methods for identifying a target site of a cas9 nuclease
US9359599B2 (en) 2013-08-22 2016-06-07 President And Fellows Of Harvard College Engineered transcription activator-like effector (TALE) domains and uses thereof
US9388430B2 (en) 2013-09-06 2016-07-12 President And Fellows Of Harvard College Cas9-recombinase fusion proteins and uses thereof
US9340799B2 (en) 2013-09-06 2016-05-17 President And Fellows Of Harvard College MRNA-sensing switchable gRNAs
US9526784B2 (en) 2013-09-06 2016-12-27 President And Fellows Of Harvard College Delivery system for functional nucleases
US9840699B2 (en) 2013-12-12 2017-12-12 President And Fellows Of Harvard College Methods for nucleic acid editing
EP3177718B1 (en) 2014-07-30 2022-03-16 President and Fellows of Harvard College Cas9 proteins including ligand-dependent inteins
EP3365356B1 (en) 2015-10-23 2023-06-28 President and Fellows of Harvard College Nucleobase editors and uses thereof
GB2568182A (en) 2016-08-03 2019-05-08 Harvard College Adenosine nucleobase editors and uses thereof
AU2017308889B2 (en) 2016-08-09 2023-11-09 President And Fellows Of Harvard College Programmable Cas9-recombinase fusion proteins and uses thereof
US11542509B2 (en) 2016-08-24 2023-01-03 President And Fellows Of Harvard College Incorporation of unnatural amino acids into proteins using base editing
KR102622411B1 (en) 2016-10-14 2024-01-10 프레지던트 앤드 펠로우즈 오브 하바드 칼리지 AAV delivery of nucleobase editor
WO2018119359A1 (en) 2016-12-23 2018-06-28 President And Fellows Of Harvard College Editing of ccr5 receptor gene to protect against hiv infection
US11898179B2 (en) 2017-03-09 2024-02-13 President And Fellows Of Harvard College Suppression of pain by gene editing
WO2018165629A1 (en) 2017-03-10 2018-09-13 President And Fellows Of Harvard College Cytosine to guanine base editor
EP3601562A1 (en) 2017-03-23 2020-02-05 President and Fellows of Harvard College Nucleobase editors comprising nucleic acid programmable dna binding proteins
WO2018209320A1 (en) 2017-05-12 2018-11-15 President And Fellows Of Harvard College Aptazyme-embedded guide rnas for use with crispr-cas9 in genome editing and transcriptional activation
US11732274B2 (en) 2017-07-28 2023-08-22 President And Fellows Of Harvard College Methods and compositions for evolving base editors using phage-assisted continuous evolution (PACE)
EP3676376A2 (en) 2017-08-30 2020-07-08 President and Fellows of Harvard College High efficiency base editors comprising gam
KR20200121782A (en) 2017-10-16 2020-10-26 더 브로드 인스티튜트, 인코퍼레이티드 Uses of adenosine base editor
CN108690844B (en) * 2018-05-25 2021-10-15 西南大学 CRISPR/Cas9-gRNA targeting sequence pair of HTT, plasmid and HD cell model
WO2019237373A1 (en) * 2018-06-16 2019-12-19 深圳市博奥康生物科技有限公司 Method for constructing 293t cell strain with site-directed insertion of btdc gene and use thereof
WO2019237370A1 (en) * 2018-06-16 2019-12-19 深圳市博奥康生物科技有限公司 Method for constructing 293t cell strain with site-directed insertion of tnfsf9 gene and use thereof
CN108998452B (en) * 2018-07-11 2019-11-19 暨南大学 A kind of method that substantia nigra gene knockout quickly establishes animal model for parkinsonism
CN109097333B (en) * 2018-07-17 2019-07-23 杭州观梓健康科技有限公司 It resists cell ageing and extends the mescenchymal stem cell and its preparation method and application of blood glucose-control effect time-histories
CN109112162B (en) * 2018-08-30 2021-10-15 西南大学 Huntington's disease in-situ knock-in mouse model constructed by CRISPR/Cas9 technology and construction method
BR112021018606A2 (en) 2019-03-19 2021-11-23 Harvard College Methods and compositions for editing nucleotide sequences
CN110468154A (en) * 2019-07-05 2019-11-19 南京医科大学 A kind of reconstructed eggs and its construction method of deafness swine model, deaf swine model, construction method and its application
DE112021002672T5 (en) 2020-05-08 2023-04-13 President And Fellows Of Harvard College METHODS AND COMPOSITIONS FOR EDIT BOTH STRANDS SIMULTANEOUSLY OF A DOUBLE STRANDED NUCLEOTIDE TARGET SEQUENCE
CN112582024B (en) * 2020-12-23 2021-11-02 广州赛业百沐生物科技有限公司 Construction method, system and platform of gene site-specific knock-in vector
CN114480457A (en) * 2021-12-21 2022-05-13 浙江大学 Efficient and stable site-directed integration gene knock-in method based on pCAG-flox-neo vector
CN115487315B (en) * 2022-04-20 2023-08-04 暨南大学 Medicine for treating huntington's disease

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2488932A1 (en) * 2002-06-11 2003-12-18 Baylor College Of Medicine Transgenic mammals expressing polyglutamine
WO2004076661A1 (en) * 2003-02-27 2004-09-10 Renascience Co., Ltd. Establishment of disease nerve cells by combining method of highly efficiently inducing nerve differentiation with disease mutation knockin es cells
CN104263754A (en) * 2014-08-29 2015-01-07 中国科学院广州生物医药与健康研究院 Reconstructed ovum of albinism model pig and construction method thereof, and construction method of model pig

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2488932A1 (en) * 2002-06-11 2003-12-18 Baylor College Of Medicine Transgenic mammals expressing polyglutamine
WO2004076661A1 (en) * 2003-02-27 2004-09-10 Renascience Co., Ltd. Establishment of disease nerve cells by combining method of highly efficiently inducing nerve differentiation with disease mutation knockin es cells
CN104263754A (en) * 2014-08-29 2015-01-07 中国科学院广州生物医药与健康研究院 Reconstructed ovum of albinism model pig and construction method thereof, and construction method of model pig

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
A Huntingtin Knockin Pig Model Recapitulates Features of Selective Neurodegeneration in Huntington"s Disease;Yan S等;《Cell》;20180329;第173卷(第4期);第989-1002页 *
Crispr/cas9: a powerful genetic engineering tool for establishing large animal models of neurodegenerative diseases, Zhuchi Tu, Molecular neurodegeneration;Zhuchi Tu等;《Mol Neurodegener》;20150804;第1-8页 *
CRISPR/Cas9-mediated gene editing ameliorates neurotoxicity in mouse model of Huntington"s disease;Yang S等;《J Clin Invest》;20170630;第127卷(第7期);第2719-2724页 *
CRISPR/Cas9基因编辑技术在脑科学中的应用策略;张骑鹏等;《科学通报》;20171110;第62卷(第31期);第3583-3593页 *
Time course of early motor and neuropathological anomalies in a knock-in mouse model of huntington’s disease with 140 CAG repeats;Menalled LB等;《Journal of Comparative Neurology》;20031006;第465卷(第1期);第12页左列第4段-右列第1段，图1 *

Also Published As

Publication number Publication date
CN107988256A (en) 2018-05-04

Similar Documents

Publication Publication Date Title
CN107988256B (en) Recombinant vector for knocking-in human Huntington gene, construction method thereof and application thereof in construction of model pig
JP6878482B2 (en) Targeted genome editing in large livestock conjugations
CN105101787B (en) Animal of genetic modification and preparation method thereof
JP2021121220A (en) Genetically modified non-human mammals by multi-cycle electroporation of cas9 protein
Honda et al. Single-step generation of rabbits carrying a targeted allele of the tyrosinase gene using CRISPR/Cas9
JP2022113700A (en) Fel d1 knockouts and associated compositions and methods based on crispr-cas genomic editing
JP2022512792A (en) IGF-1 gene mutation dwarfism animal model and its manufacturing method
US20170142942A1 (en) Nanos knock-out that ablates germline cells
EP3950942A1 (en) Method for producing knock-in cell
KR101890978B1 (en) Transgenic cloned porcine Models for alzheimer&#39;s disease and the Use thereof
KR20170133380A (en) How to produce non-human large mammals or fish producing spouses from this individual
KR101068479B1 (en) alpha 1,3-galactosyltransferase gene targeting vector and uses thereof
US20200008405A1 (en) Methods for producing hypo-allergenic cats using gene editing technology
US11732273B2 (en) Methods and compositions for in situ germline genome engineering
KR102270151B1 (en) Pig Knocked Out of the PKD2 Gene and the uses thereof
WO2015163711A1 (en) Talen targeting myostatin gene and method for making animal with knockout myostatin gene using same
JP2001103867A (en) Preparation of reconstructed fertilized egg and preparation of transgenic embryo using the egg
CN106062196A (en) CMP-acetylneuraminic acid hydroxylase targeting vector, vector-transduced transgenic animal for xenotransplantation, and method for producing same
JP4903392B2 (en) Gene homo-modified mammalian cells, gene homo-modified non-human mammals, and methods for establishing and producing them.
CN114686438B (en) Construction method and application of ACE2 humanized pig
KR100502480B1 (en) Method of producing porcine clonal somatic cell line expressing green fluorescent protein
CN116179543A (en) CRISPR-specific targeting pig Cavin-1 gene-based sgRNA and application thereof
KR20220098613A (en) A method and composition for sorting out of cell comprising a modified gene
JPH11192036A (en) Creation of transgenic animal

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant