CN108690844B

CN108690844B - CRISPR/Cas9-gRNA targeting sequence pair of HTT, plasmid and HD cell model

Info

Publication number: CN108690844B
Application number: CN201810513348.9A
Authority: CN
Inventors: 付彬; 徐兴然; 彭怡; 王柏彬; 杨春丽; 吴惠; 杨丹
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2018-05-25
Filing date: 2018-05-25
Publication date: 2021-10-15
Anticipated expiration: 2038-05-25
Also published as: CN108690844A

Abstract

The invention discloses a CRISPR/Cas9-gRNA targeting sequence pair of HTT, a plasmid and an HD cell model, and relates to the technical field of biology. The targeting sequence pair comprises an L sequence and an R sequence, wherein the base sequence of the L sequence is shown as SEQ ID NO.1, and the base sequence pair of the R sequence is shown as SEQ ID NO. 2. The targeting plasmid of the invention comprises a first vector plasmid and the targeting sequence pair, and the targeting sequence pair is constructed into the first vector plasmid. The HD cell model of the invention is obtained by cotransfecting cells by the PolyQ Donor plasmid and the targeting plasmid. The invention constructs the HD cell model by taking the differentiated neuron cell as a carrier, and provides a research platform for researching the research of mHtt protein on influencing or changing the internal environment of the differentiated neuron cell and the change of various signal paths, metabolic paths and intracellular homeostasis caused by the mHtt protein in the differentiated neuron cell.

Description

CRISPR/Cas9-gRNA targeting sequence pair of HTT, plasmid and HD cell model

Technical Field

The invention relates to the technical field of biology, in particular to a CRISPR/Cas9-gRNA targeting sequence pair of HTT, a plasmid and an HD cell model.

Background

Huntington's Disease (HD) is an autosomal dominant genetic disease whose primary focus is in the brain and whose precise pathogenesis is unclear. HD is clinically manifested as progressive motor, cognitive and mental disorders, but most of the causes of death in patients are complications. At present, no effective medicament and method for treating HD exist, and the treatment for HD mainly aims at relieving the symptoms. In the early stages of the disease, when the condition is insufficient to affect the patient's daily life, no pharmaceutical intervention is usually required. When a patient falls, drug intervention treatment is considered, and consumption drugs of dopamine are preferred: tetrabenazine, while it may completely inhibit hyperkinesia and may effectively inhibit choreoid movements of HD, has the side effect of exacerbating depression in patients with HD. On the other hand, citalopram, an antidepressant selective 5-hydroxytryptamine reuptake inhibitor, is usually preferred when patients develop severe depression. Drug selection for patients with HD is constantly adjusted to the current symptoms of the patient. In light of the current progress in HD research, researchers are trying to explore different treatment modalities. The search can be roughly divided into two directions from the latest technical field of molecular biology: firstly, the correction of in-situ pathological genomic DNA of lesion site tissues is attempted by using the latest gene editing tools; second, attempts to re-transfuse lesion-derived tissue cells to the lesion site of a patient after in vitro gene correction are expected to improve or cure the lesion with reinfused normal cells.

The CRISPR-Cas9(Clustered modulated short palindromic repeats CRISPR-associated Cas9) system is a third-generation artificial endonuclease, and can be used for site-directed editing of various complex genomes, together with Zinc finger endonucleases (ZFNs) and Transcription activator-like effector nucleases (TALENs). The CRISPR/Cas9 vector after being modified is formed by combining a gRNA serving as a guide sequence with edited DNA in a base complementary pairing mode, so that the off-target probability is greatly reduced, and then Cas9 protein carried by a hairpin structure of the gRNA recognizes a corresponding base sequence under the action of PAM, so that double-stranded or single-stranded DNA is cut. Based on the principle, compared with the earlier RNAi, Cre/LoxP, ZFN and TALEN systems, the CRISPR/Cas9 gene editing system has the advantages of simplicity and convenience in operation, high efficiency, low cost, simultaneous silencing/knocking-out/mutation of any number of genes and the like.

Based on the development of the CRISPR/Cas9 technology, researchers have completed the construction of HEK293 and 293F HD models of vector cells by using the CRISPR/Cas9 technology. Researchers also successfully realize the silencing of mHTT gene expression in a YAC128 transgenic HD mouse model by using CRISPR/Cas9 and successfully down-regulate the expression quantity of mHtt in mouse striatal cells by applying CRISPR/Cas9 technology based on an HD 140Q-KI mouse model. The CRISPR/Cas9 has a better prospect in model construction aiming at HD and intervention of disease development. Currently, research on HD cell models based on iPSCs and ESCs is more, but no experimental report for establishing HD cell models based on differentiated nerve cells exists. The main purpose of the research on HD cell models based on iPSCs and ESCs is to try to introduce the tissue cells derived from the focus into the focus position of a patient after in vitro gene correction so as to expect that the normal cells can improve or cure the focus after being introduced again (no relevant report of experimental success exists at present). The HD cell models of iPSCs and ESCs cannot completely reflect the pathogenesis of HD and the internal environment change condition of differentiated (functional) neuron cells in the pathogenesis. Moreover, because HD is a serious symptom of neurological disease that occurs after a large amount of chronic mutant proteins accumulate, the onset of HD requires a long time for the accumulation of mutant proteins and the patients generally have a 15-20 year life span after onset, the practical application of HD cell models of iPSCs and ESCs is limited.

Disclosure of Invention

The first invention of the invention is that: aiming at the existing problems, the CRISPR/Cas9-gRNA targeting sequence pair of the HTT is provided, has the shearing activity on the HTT in vitro and in cells, and provides a further basis for the editing of the HTT and the research of the gene therapy of the HD.

It is a second object of the present invention to provide a targeting plasmid containing the above-mentioned targeting sequence pair, which exerts a gene editing activity by transfecting the targeting sequence pair into a cell.

The third invention of the present invention is to provide a cell model of HD, which is based on differentiated neuron cells, can clearly track the development process of in vitro cell HD and the change of the intracellular environment, and provides an excellent screening platform for improving and treating HD disease drugs or treatment modes.

The technical scheme adopted by the invention is as follows:

a CRISPR/Cas9-gRNA targeting sequence pair of HTT comprises an L sequence and an R sequence, wherein the base sequence of the L sequence is shown as SEQ ID NO.1, and the base sequence pair of the R sequence is shown as SEQ ID NO. 2.

The CRISPR/Cas9-gRNA targeting plasmid of the HTT comprises a first vector plasmid and the CRISPR/Cas9-gRNA targeting sequence pair of the HTT, wherein the CRISPR/Cas9-gRNA targeting sequence pair of the HTT is constructed into the first vector plasmid.

The CRISPR/Cas9-gRNA targeting plasmid of HTT is characterized in that the vector plasmid is VK 001-05.

An HD cell model, which is obtained by cotransfecting cells with a PolyQ Donor plasmid and the above targeting plasmid.

The invention relates to an HD cell model, wherein a PolyQ Donor plasmid is formed by constructing a Donor skeleton plasmid from a PolyQ gene segment.

The invention relates to an HD cell model, wherein the polyQ gene segment is selected from one of Htt150Q, Htt90Q, Htt50Q or Htt20Q, the base sequence of Htt150Q is shown in SEQ ID No.3, the base sequence of Htt90Q is shown in SEQ ID No.4, the base sequence of Htt50Q is shown in SEQ ID No.5, and the base sequence of Htt20Q is shown in SEQ ID No. 6.

According to the HD cell model, the front end and the rear end of the PolyQ gene fragment are respectively provided with EcoRI enzyme cutting sites and XmaI enzyme cutting sites.

In the HD cell model, the PolyQ Donor plasmid is digested into linear plasmid by using Not1 restriction enzyme, and the linear plasmid and the targeting plasmid transfect cells together.

In the HD cell model, during transfection, the PolyQ Donor plasmid and the targeting plasmid are wrapped by a transfection reagent, the ratio of the total mass of the PolyQ Donor plasmid and the targeting plasmid to the transfection reagent is 1:2-5 (mu g: mu L), and the mass ratio of the PolyQ Donor plasmid to the targeting plasmid is 0.5-2: 1.

The HD cell model is characterized in that the cells are CATH-a cells.

In summary, due to the adoption of the technical scheme, the invention has the beneficial effects that:

according to the invention, a series of CRISPR/Cas9-gRNA targeting sequences are designed according to HTT genes, Htt-L9 and Htt-R9 sequences with the enzyme digestion activities in vitro higher than 95% are screened out after in vitro activity detection, and are paired to construct a Htt 001-05 vector to obtain Htt9 targeting plasmid, wherein the targeting plasmid has good gene editing activity in cells.

The invention also designs and synthesizes and constructs four lengths of Poly Q gene segments according to the relative positions on Htt-L9 and Htt-R9 genomes and the surrounding basic group characteristics, wherein the Poly Q gene segments have EcoR1 and Xma1 double enzyme cutting sites so as to construct the segments into Donor framework plasmid to obtain the NQ Donor plasmid. Meanwhile, the Poly Q gene fragment contains double Not1 cleavage sites to linearize the NQ Donor plasmid.

Cells are cotransfected by Htt9 targeting plasmid and linear NQ Donor plasmid, NQ is knocked into cell genome successfully, then monoclonal cell screening experiment is carried out, and finally, the knocked-in monoclonal cells with different lengths are obtained, and the HD cell model is constructed successfully.

The invention constructs the HD cell model by taking the differentiated neuron cells as cell carriers, and makes up the defects of the HD cell model in the prior art. The in-situ knock-in of four different lengths of Poly Q provides a model basis for exploring the relationship between the length of Poly Q and the onset of HD (onset time and onset severity). The cells adopted by the invention are highly differentiated neuron cells, and a platform is provided for researching the research of mHtt protein on influencing or changing the internal environment of the differentiated neuron cells. Meanwhile, the cell model can more approximately simulate the process that mHtt protein in differentiated neuron cells slowly accumulates and finally leads to cell death, and provides a research platform for exploring more changes of various signal paths, metabolic paths and intracellular homeostasis caused by the mHtt protein in the differentiated neuron cells.

Drawings

The invention will now be described, by way of example, with reference to the accompanying drawings, in which:

FIG. 1 is a schematic diagram showing the procedure of the bridge PCR in example 1 of the present invention;

FIG. 2 is an agarose gel electrophoresis analysis diagram of the in vitro cleavage efficiency of a CRISPR/Cas9-gRNA targeting sequence;

FIG. 3 is a schematic diagram of the construction of the Donor plasmid design;

FIG. 4 is a Donor backbone plasmid map;

FIGS. 5 to 6 are plasmid maps of NQ Donor plasmids;

FIG. 7 is an agarose gel electrophoresis analysis of a cleavage product of NQ Donor plasmid Not 1;

FIG. 8 is a diagram of genomic agarose gel electrophoresis analysis of mixed cells after cell transfection;

FIG. 9 is an agarose gel electrophoresis analysis of TA clone-colony PCR products, which are single clone genomic PCR products with correct knockins of NQ;

FIG. 10 is a partial sequencing peak of the Poly Q knock-in region in the genome of a monoclonal cell with correct knock-in of NQ.

Detailed Description

All of the features disclosed in this specification, or all of the steps in any method or process so disclosed, may be combined in any combination, except combinations of features and/or steps that are mutually exclusive.

Any feature disclosed in this specification (including any accompanying claims, abstract) may be replaced by alternative features serving equivalent or similar purposes, unless expressly stated otherwise. That is, unless expressly stated otherwise, each feature is only an example of a generic series of equivalent or similar features.

Example 1

The HTT gene information of mice (C57BL/6J) was recorded according to GenBank:

Description：huntingtin[Source:MGI Symbol；Acc:MGI:96067]

Synonyms：IT15,C430023I11Rik,Hdh,HD,htt,huntingtin

Location：Chromosome 5:34,761,740-34,912,534forward strand.

Gene ID：15194

and comprehensively analyzing HTT genome structure and protein function conserved regions, and designing CRISPR target spots (gRNAs), wherein the sequences of the target spots are as follows:

HTT-L7：tccgccggcatgacgtcacggg；

HTT-L8：ccgcgagggttgccgggacgg；

HTT-L9：caagatggctgagcgccttgg；

HTT-L10：cattgccttgctgctaagtgg；

HTT-R7：ttggccatgcccagcacgcagg；

reverse complementation: cctgcgtgctgggcatggccaa, respectively;

HTT-R8：taccgcgaccctctggacaggg；

reverse complementation: ccctgtccagagggtcgcggta, respectively;

HTT-R9：cgggaaagcctggcctcaggg；

reverse complementation: ccctgaggccaggctttcccg, respectively;

HTT-R10：cggctctgtctcctctgaggg；

reverse complementation: ccctcagaggagacagagccg are provided.

Among the sequences, the last three bits of "ngg (n is any base in a/t/c/g)" in HTT-L7-10 and HTT-R8-10 are PAM sequences.

In vitro transcription of gRNAs

First, an F-end primer gRNA-F L/Rn and an R-end primer gRNA-RP were designed and synthesized based on a gRNA target sequence and a gRNA template plasmid (G1, supplied by Beijing Weishanglide Biotechnology Co., Ltd.), and the primer sequences are shown in Table 1. Then, PCR was carried out using G1 as a template with reference to the reaction system and reaction conditions shown in Table 2, and the PCR product was purified by a method provided in the specification using an EP101-01 purification column (TransGen Biotech, Inc.) according to about 120bp of the PCR product (note that DEPC H was used)₂O eluted DNA) were measured and named: gRNA-R7, gRNA-R8, gRNA-R9 and gRNA-R10. The purified product was saved as a DNA template for subsequent in vitro transcription.

Meanwhile, PCR products of the standards were prepared. The standard products are gRNA1(g1) and standard gRNA2(g2) in a VK007-10-VK007-22 kit (Beijing Weishanglide Biotechnology Co., Ltd.), wherein a gRNA1(g1) primer pair respectively comprises g1-FP provided by the kit and gRNA-RP provided by the invention, a standard gRNA2(g2) primer pair respectively comprises g2-FP provided by the kit and gRNA-RP provided by the invention, a standard gRNA fragment is used as a template for carrying out PCR, and the PCR reaction system refers to a PCR reaction system shown in Table 2. After the reaction was completed, the concentration was determined after purifying the PCR product (note that DNA was eluted using DEPC H2O) according to the method provided in the specification using an EP101-01 purification column (TransGen Biotech Co., Ltd.) and designated as standard gRNA1 and standard gRNA2 and stored for use.

TABLE 1 primers required for in vitro transcription of gRNA templates

Note: SSSS represents TAATACGACTCACTATAG; GGG stands for GTTTTAGAGCTAGAAATAGC, red font: VVVVVVVVV and KKKKKKKKKKKKK represent base sequences without gRNA target sequence and PAM as negative blank control.

TABLE 2PCR reaction System and conditions (50. mu.L System)

CRISPR/Cas9-gRNA in vitro enzyme digestion reaction

First, a gRNA targeting sequence (including a PAM sequence) was constructed into a PCR product by means of bridge PCR. As shown in fig. 1. In fig. 1, F1 and R4 are primer pairs, g2 and g3 are the paired gRNA targeting sequences and their antisense strands, respectively, and F1, R4, g2, and g3 are all provided by beijing weinshengde biotechnology limited. The sequences of gRNA targets are respectively synthesized into primers required by the bypass PCR as shown in table 3.

Using the above DNA S as a template, and (F1 and g 2-L7); (g3-L7 and R4) two primer pairs for segmented PCR, reaction system and PCR conditions are referred to Table 4, and the PCR products are respectively named as: g2-L7C, g 3-L7C. Then, the same amount (25 μ L) of the PCR product is taken, mixed evenly and pre-denatured for 3min at 93 ℃; 93 ℃, 20sec, 58-47 ℃ (Tm for different targets), 30sec, 20-15 cycles. The bridging PCR was completed and named: g2-g 3-L7. Using g2-g3-L7 as template, and finally F1 and R4 primer set, see Table 5 for reaction conditions andreaction System, effective bridged PCR product was amplified, and the PCR product was purified according to the method provided in the specification of EP101-01 purification column (TransGen Biotech Co., Ltd.) by using DEPC H₂O eluted DNA) was determined and designated L7, so far the L1 target enzyme digested dsDNA was ready for completion. Preparing the dsDNA by sequentially carrying out enzyme digestion on L8-10 and R7-10 targets according to the method, and respectively naming the targets as: l8, L9, L10, R7, R8, R9, R10.

And (3) adding samples of the prepared target in-vitro transcription gRNA template and the corresponding enzyme-cleaved dsDNA according to the system sequence in the table 6, and preparing for enzyme cleavage reaction. Meanwhile, the standard gRNA1 and the standard gRNA2 of the standard sample are subjected to enzyme digestion reaction, the positive control NC-1 and NC-2 are subjected to enzyme digestion reaction, and the negative control enzyme digestion reaction is performed. The conditions of the enzyme digestion reaction are as follows: after all the reactants are fully mixed, the mixture is reacted for 0.5h at 37 ℃, boiled for 5min at 65 ℃, and the enzyme digestion result is analyzed by agarose gel electrophoresis detection.

TABLE 3 primer pairs for bypass PCR

Note: when the primer is used, F1 is paired with g2, R4 is paired with g3, wherein: nnnn stands for g2 primer, mmmm stands for g3 primer, and the tail ends of the primers are inlaid and synthesized with corresponding target sequences and complementary sequences.

TABLE 4 segmented PCR reaction System and conditions

TABLE 5 PCR reaction System for amplification of bridged PCR products

TABLE 6 Cas9/gRNA in vitro enzyme digestion activity reaction system

According to the design length of enzyme-digested dsDNA, when the gRNA target is active, dsDNA (740bp) is cut into two bands of 280bp and 460bp by Cas9 enzyme, the higher the gRNA target activity is, the higher the proportion of dsDNA cut into two segments is, otherwise, the gRNA target is lower. The cleavage electrophoresis is shown in FIG. 2.

Standard gRNA1(g1) and standard gRNA2(g2) were assayed for activity via SSA luciferase, and the SSA activities were:

standard gRNA1(g1) ═ 3, and standard gRNA2(g2) ═ 10.

Accordingly, the enzyme digestion activity of the gRNA of the sample adopts the following standard:

if the enzyme digestion efficiency of the gRNA of the sample is less than that of the standard gRNA1(g1), indicating that the activity ratio of the gRNA target of the sample is poor, and marking the gRNA target as unqualified activity;

if the enzyme digestion efficiency of the standard gRNA1(g1) is less than or equal to 40-50% of the gRNA of the sample, marking the sample as qualified in activity;

if the standard gRNA has the enzyme digestion efficiency of 40-50% to less than or equal to that of gRNA2(g2), marking the sample as good activity;

if the enzyme digestion efficiency of the sample gRNA is more than or equal to that of the standard gRNA2(g2), the marker is marked as high activity.

The cleavage efficiency of the sample gRNA was converted from the gradation of the cleavage band. Specifically, if NC-1 and NC-2 both showed a band only at about 750kb, it indicates that the experiment is authentic, and then the enzyme digestion efficiency with this as a negative control is zero, the enzyme digestion efficiency represented by the gray scale value of 750kb band for standard gRNA1 is 30%, and the enzyme digestion efficiency represented by the gray scale value of 750kb band for gRNA2 is 100%, and the enzyme digestion efficiencies of L7-10 and R7-10 are converted, and the conversion results are shown in table 7.

TABLE 7 in vitro cleavage efficiency of gRNA

As shown in Table 7, the in vitro enzyme digestion activity of Htt-L8, Htt-L9, Htt-L10, Htt-R7, Htt-R8, Htt-R9 and Htt-R10 was found to be acceptable as compared with the standard samples.

Example 2

The embodiment provides a CRISPR/Cas9-gRNA targeting plasmid of HTT and a construction method thereof, wherein the targeting plasmid is obtained by constructing a pair of targeting sequences to a vector plasmid. The targeting sequence pair consists of an L sequence and an R sequence, so that the sense strand and the antisense strand of the target gene (dsDNA) can be cut off simultaneously, and the target gene can be knocked into a target by using HR. According to the in vitro activity detection result in example 1, the activity of Htt-L9 and Htt-R9 targets is about 95%, which shows that the targeting plasmid formed by matching Htt-L9 and Htt-R9 targets has high in vivo gene editing activity, so that Htt-L9 and Htt-R9 are selected to form a targeting sequence pair in the example, and the targeting sequence pair is constructed into a vector plasmid. The vector plasmid is a vector plasmid suitable for use in mammalian and/or mammalian cells, and preferably does not carry any selectable marker to facilitate detection of a knock-in gene phenotype.

In the embodiment, a VK001-05 plasmid is purchased from Beijing Weishanglide Biotechnology GmbH, and a kit Cat VK001-05 is quickly constructed by using CRISPR/Cas9 corresponding to the plasmid to construct a targeting plasmid. A targeting plasmid was successfully constructed in this example and designated as Htt 9.

After the successful construction of the Htt9 targeting plasmid, transformation, preservation, activation, amplification and extraction of the endotoxin-free Htt9 plasmid are required, the competent cell used in transformation is DH5 alpha, the specific operations are conventional technical means in the field, and are not described herein again.

Example 3

In this example, NQ (150Q, 90Q, 50Q, 20Q) Donor plasmids were designed and constructed by Gibson cloning based on the nucleotide sequences of the L target and the R target of the Htt9 plasmid and their relative positions. A schematic diagram of the construction of the Donor plasmid is shown in FIG. 3. In FIG. 3, the cleavage sites between PCR fragment 4 and PCR fragments 1 and 3 are Not1 cleavage sites (represented by yellow in the figure), EcoR1 and Xma1 cleavage sites (represented by red in the figure) between PCR fragment 1 and PCR fragment 2, and FRT (directed recombinase recognition site) sites (represented by blue in the figure) between PCR fragment 2 and PCR fragment 3.

1. Extraction of CATH-a cell genome DNA

CATH-a (ATCC CRL-11179) was purchased from Beijing Bina institute of Biotechnology, and was cryopreserved in the experiment. And (3) recovering the frozen cells, digesting when the intersection degree reaches 90%, carrying out passage according to a ratio of 1:3 until the intersection degree of the passage cells reaches 90%, and respectively extracting the genome DNA of the cells for later use according to a cell genome extraction kit (DP304, Tiangen Biochemical technology Co., Ltd.). The recovery and subculturing of cells are conventional technical means in the art and are not described in detail herein.

Segmented amplification of Donor plasmid

(1) Donor plasmid homologous arm forepart amplification (PCR fragment 1 amplification)

Template: CATH-a cell genomic DNA

Primer:

htt9-FP 1: gcggccgcagagctgctttgggtttcggg (the series contains Not1 restriction enzyme sites);

Htt9-RP1：

gcgcggggcccgggaaggcaatgaattcggggctctgcgcggcaggcagaagcggaaggaaggcgctcagccatc；

htt9-RP1 reverse complement:

catggctgagcgccttccttccgcttctgcctgccgcgcagagccccgaattcattgccttcccgggccccgcgc (EcoR 1& Xma1 site is included in the sequence).

The reaction system and conditions for amplifying the PCR fragment 1 are shown in Table 8.

TABLE 8 PCR fragment 1 amplification reaction systems and conditions

(2) Donor plasmid cell selection for drug resistance (Puro) and GFP fluorescent marker amplification (PCR fragment 2 amplification)

Htt9-FP2-1：

ccgaattcattgccttcccgggccccgcgcccctggcctgcgtgctgggcatggccaacactgttccctgtccagagggt (EcoR 1& Xma1 site is included in the sequence);

Htt9-FP2-2：

ctgttccctgtccagagggtcgcggtacctggctgagaagttcctattctctagaaagtataggaacttctatacgcgcccccagctgg (containing directional recombinase recognition sites FRT in the sequence);

Htt9-RP2：

gggcccggccgggaaagcctggccgaagttcctatactttctagagaataggaacttcagttatacgcgccc；

htt9-RP2 reverse complement:

gggcgcgtataactgaagttcctattctctagaaagtataggaacttcggccaggctttcccggccgggccc (containing FRT in the sequence).

First, PCR was carried out using the plasmid FRT-pGK-PURO-T2A-GFP-FRT-floxp-DTA (purchased from Beijing Vital bioscience Co., Ltd.) as a template and Htt9-FP2-2+ Htt9-RP2 as primers, with reference to the reaction system and conditions shown in Table 9, and the PCR product was named as PCR fragment 2-1.

Then, PCR was performed using the PCR fragment 2-1 as a template and Htt9-FP2-1+ Htt9-RP2 as primers, referring to the reaction system and conditions in Table 9, and the PCR product was PCR fragment 2 (Puro and GFP cell selection marker in Donor plasmid).

TABLE 9 PCR fragment 2 amplification reaction systems and conditions

(3) Donor plasmid homology arm postamplification (PCR fragment 3 amplification)

Template: CATH-a cell genomic DNA;

primer:

htt9-FP 3: ggaacttcggccaggctttcccggccgggccctcgtc (containing FRT in sequence);

htt9-RP 3: gcggccgctagtaaaattcattccccggtg (Not 1 site in the sequence)

The reaction system and conditions for amplifying the PCR fragment 3 are shown in Table 10.

TABLE 10 homologous arm rear PCR fragment 3 amplification reaction System and conditions

(4) Vector plasmid backbone amplification (PCR fragment 4)

Template: plasmid pMV (offered by Wuxi blue Biotechnology Co., Ltd.)

Primer:

pMV-FP: gctcagttttcaccggggaatgaattttactagcggccgcagatctacggaccactagtttag (the sequence contains Not1 site);

pMV-RP：ggagctcggaacccgaaacccaaagcagctctgcggccgcgcccaattcgcccagagacgc；

pMV-RP reverse complementation:

gcgtctctgggcgaattgggcgcggccgcagagctgctttgggtttcgggttccgagctcc (the sequence contains the Not1 site).

The reaction system and conditions for amplifying PCR fragment 4 are shown in Table 11.

TABLE 11 vector plasmid backbone PCR fragment 4 amplification reaction System and conditions

PCR products of the PCR fragments 1, 2, 3 and 4 were subjected to agarose gel electrophoresis and then recovered according to the instructions of the kit (DP209-03, Kyoto Biochemical technology, Beijing) Ltd.).

3. Construction of Donor framework plasmid

And (3) carrying out Gibson assembly on the purified and recovered PCR fragment 1+ PCR fragment 2+ PCR fragment 3+ PCR fragment 4. A Donor skeleton plasmid was constructed and named pMV-HttnQ-L9R 9. The Donor backbone plasmid map constructed by Gibson cloning is shown in figure 4.

Design of pMV-HttnQ Gene fragment plasmid

(1) Synthesis of NQ and construction of pMV-HttNQ plasmid

The gene sequences of synthetic NQ (Htt150Q, Htt90Q, Htt50Q and Htt20Q), Htt150Q, Htt90Q, Htt50Q and Htt20Q are shown as SEQ ID NO.3-6 respectively. The front end and the rear end of the NQ respectively contain EcoRI (GAATTC) -XmaI (CCCGGGG) DNA fragments, and the synthesized NQ fragments are constructed on a pMV plasmid to obtain the pMV-HttNQ plasmid for convenient storage.

(2) Construction of pMV-HttNQ-L9R9Donor plasmid

pMV-HttNQ plasmid is transformed and stored according to the conventional technical means in the field, endotoxin-free plasmid is extracted, restriction enzyme digestion is carried out by EcoRI + XmaI restriction enzyme, the reaction system and conditions are shown in Table 12, the product after restriction enzyme digestion is subjected to agarose electrophoresis, and the product is recovered according to the instruction of a kit (DP209-03, Kyoto Biochemical technology, Beijing, Ltd.). The 150Q target product is about 745bp, the 90Q target product is about 565bp, the 50Q target product is about 445bp, and the 20Q target product is about 355 bp. Meanwhile, EcoRI + XmaI enzyme digestion products of the Donor skeleton plasmid are prepared according to the conditions, purified and recycled for later use.

The enzyme-digested products of pMV-HttNQ were cloned into the enzyme-digested products of Donor backbone plasmids, respectively, and the reaction system and reaction conditions are shown in Table 13, thereby obtaining NQ Donor plasmids, respectively named: pMV-Htt150Q-L9R9, pMV-Htt90Q-L9R9, pMV-Htt50Q-L9R9 and pMV-Htt20Q-L9R9, and the plasmid maps thereof are shown in FIGS. 5 to 6. In FIG. 5, A, B are plasmid maps for pMV-Htt150Q-L9R9, pMV-Htt90Q-L9R9, respectively; in FIG. 6, C, D are plasmid maps of pMV-Htt50Q-L9R9 and pMV-Htt20Q-L9R9, respectively, the red part is a knock-in PolyQ fragment, two Not1 sites cleave the Donor plasmid into linear DNA fragments containing a GFP fluorescent marker and a Puro drug resistance marker, so as to screen knock-in cell monoclones.

The pMV-HttNQ-L9R9Donor plasmid was transformed, stored and endotoxin plasmid was extracted according to the conventional technique in the art, and then the NQ Donor plasmid was verified with Not1 restriction enzyme. After the NQ Donor plasmid which is correctly constructed is completely digested, two bands (about 4000bp +2000 bp) are generated by agarose electrophoresis. The reaction system and conditions shown in Table 14 were used for digestion, and the digestion products were analyzed by agarose gel electrophoresis.

TABLE 12 pMV-HttNQ restriction enzyme digestion verification reaction system and reaction conditions

TABLE 13 pMV-HttNQ-L9R9 cloning reaction System and reaction conditions

TABLE 14 digestion reaction systems and conditions

The agarose gel electrophoresis results of the cleavage products of NQ Donor plasmid Not1 are shown in FIG. 7. In FIG. 7, NQ, 150Q, 90Q, 50Q, and 0Q represent pMV-HttNQ-L9R9, pMV-Htt150Q-L9R9, pMV-Htt90Q-L9R9, pMV-Htt50Q-L9R9, and pMV-Htt20Q-L9R9 plasmids, respectively, and it can be seen that the NQ Donor plasmid is cut into two segments after Not1 is digested, thereby proving the success in the construction of pMV-HttNQ-L9R9, pMV-Htt150Q-L9R9, pMV-Htt90Q-L9R9, pMV-Htt50Q-L9R9, and pMV-Htt20Q-L9R 9.

Example 4

Amplification and extraction of Htt9 targeting plasmid

The endotoxin-free plasmid of the Htt9 targeting plasmid was amplified and extracted according to the conventional technique in the art, and stored for further use.

2. Cell transfection

(1) Taking CATH-a cells, resuscitating, culturing and passaging according to the conventional technical means in the field, inoculating the cells into a six-well plate, culturing the cells by using a complete culture medium until the degree of intersection is about 80 percent, and replacing the cells by DMEM-H (DMEM high-glucose medium) without serum and antibiotics.

(2) Taking Via-Fect^TMTransfection Reagent (Via-Fect, Promega corporation), Htt9 plasmid and 4 kinds of pMV-HttNQ-L9R9 plasmid which is linearly digested, Htt9 plasmid and 4 kinds of linear pMV-HttNQ-L9R9 plasmid are respectively mixed according to the proportion of 1:0.5-2 to obtain Transfection plasmid, the Transfection plasmid and Transfection Reagent are mixed according to the proportion of 1:3 (mg: muL), and the total volume is kept to be 300 muL. Via-Fect was performed according to the system in Table 15Packaging with CRISPR/Cas9 plasmid, uniformly mixing, incubating at room temperature for 15-20min, adding into a six-well plate:

TABLE 15 Via-Fect transfection reagent Encapsulated CRISR/Cas9 and nDonor plasmid System

Note: when the Via-Fect transfection reagent is mixed with the plasmid, a serum-free and antibiotic-free DMEN-H culture medium is used, and pMV-HttnQ is the target Donor for enzyme digestion linearity.

(3) After transfection for 48h, FBS was added to the medium to a concentration of about 10%. And after the transfection time reaches 72H, replacing a new DMEM-H complete culture medium, adding Puro into the DMEM-H complete culture medium to enable the concentration of the Puro to reach 2.5 mu g/mL, carrying out drug screening for 48-72H, removing the culture medium, observing the number and the state of cells successfully transfected, and replacing the new complete culture medium containing the Puro 2.0 mu g/mL to continue drug screening culture.

(4) When the number of cells was sufficient for extraction of genomic DNA, the DNAs were extracted separately according to a cell genome extraction kit (DP304, Tiangen Biochemical technology Co., Ltd.). The extracted DNA was analyzed by gel electrophoresis.

The results of gel electrophoresis are shown in FIG. 8. In FIG. 8, lanes A and B show Htt9@150Q Donor plasmids, lanes B show Htt9@90Q Donor, lanes C show Htt9@50Q Donor, lanes D show Htt9@20Q Donor, and lanes E show normal cell DNA. A. B, C, D the theoretical length of correct knock-in is 1668bp, 1488bp, 1368bp, 1268bp, respectively. In FIG. 8, lanes A, B, C, D each show one or two broad modular bands, where each lane has a band at the correct tap size for screening single cell clones.

Screening of NQ monoclonal cells

(1) Observing with fluorescent inverted microscope, selecting cell unit co-transfected with Htt9 and pMV-Htt150Q, named as F0 generation, culturing for 10-15 days, digesting according to common operation in the art, inoculating single cell to 90mm²The cell density in the cell culture dish is controlled to be about 10-20%.

(2) After overnight culture of the cells and adherence, Puro was added to maintain the concentration at 2.0. mu.g/mL, and the cells were named F1A (A: 150Q; B, C, D is 90Q, 50Q, 20Q, respectively). F1A cells were cultured for 7-15 days, the growth state of the cells was observed every day, the cell culture medium was changed, and a monoclonal cell population was selected when 20-30 cells had formed.

(3) Selecting 3-5 monoclonal colonies, determining the absence of cells without fluorescence from the monoclonal colonies under a fluorescence microscope, labeling the approximate location of the monoclonal cell colonies, and confirming the determined location of the selected cell colonies under fluorescence. The monoclonal population of all cells was selected as described above.

(4) The marked F1A cells were washed twice with PBS, the sterilized cloning rings (6X 8mm) were applied with vaseline, the periphery of the marked cell population was applied with vaseline, the marked cell population was then attached to a petri dish with the cloning rings, about 50. mu.L of trypsin digestion solution was added to the cloning rings, and the incubator was placed for 3-5 min.

(5) Inoculating the digested cells to 60mm²The culture dish is named as F2A, F2A is inoculated in a single cell state, 3mL of complete culture medium is maintained for culture, Puro is added after 8 hours of adherence, the concentration is maintained at 2.0 mu g/mL, drug screening culture is continued, the growth state of cells needs to be observed every day, the cell culture medium is replaced every 2-3 days, and a monoclonal cell colony is selected when 20-30 cell colonies are generated.

(6) Repeating the steps (3) - (4).

(7) The digested cells were inoculated into 24-well plates and cultured, designated as F3A, for 5-7 days, trypsinized and inoculated into 6-well plates, and when the number of cells was sufficient to extract genomic DNA, the genomic DNA of the cells was extracted.

Identification of genomic DNA of NQ monoclonal cells

The upstream and downstream primers were designed, and the primer sets are shown in Table 16. The genomic DNA of the selected monoclonal cells is used as a template, the primers in the table 16 are used for carrying out PCR reaction according to the reaction system and the reaction conditions shown in the table 17, the PCR product is subjected to agarose gel electrophoresis and then is subjected to gel imaging, the size of a band is analyzed, the PCR product of the monoclonal cells with the band size close to a theoretical value is selected for purification and recovery, TA cloning is carried out, and the colony of the monoclonal cells is selected for PCR identification and sequencing.

TABLE 16 NQ monoclonal cell DNA identification primers

TABLE 17 NQ monoclonal cell DNA identification reaction System and conditions

Using the PCR reaction system and reaction conditions shown in Table 17, the PCR reaction was carried out using the genomic DNA of the monoclonal cells obtained by screening as a template using the primer set (yzd-4F @ yzd-2R), and the PCR products were subjected to agarose gel electrophoresis, respectively. According to the gel electrophoresis result and the theoretical length of NQ: theoretical length of A (150Q) 1738 bp; b (90Q) is 1557bp in theoretical length; c (50Q) theoretical length 1436 bp; d (20Q) has a theoretical length of 1346bp, and correctly knocked-in monoclonal cells are selected (gel electrophoresis picture not shown).

Among the NQ-knocked-in monoclonal cells, A3104D (A represents 150Q Donor knock-in, D represents genomic DNA as a template, 3104 represents the number of the selected cell), four genomic DNAs of B3622D, C2426D and D3431D as templates were selected, PCR was carried out using a primer set (yzd-4F @ yzd-2R) with reference to the PCR reaction system and conditions shown in Table 17, the PCR reaction products were subjected to agarose gel electrophoresis, gel cutting, purification and recovery, TA cloning, blue and white spot screening, white monoclonal transformants were selected at 220rpm in LB liquid medium (1.5ml in EP tube) containing 60. mu.g/ml, cultured at 37 ℃ for 4 hours, and colony PCR was carried out with reference to the PCR reaction system and conditions shown in Table 17 (primer: yzd-4F @ yzd-2R).

The colony PCR products were subjected to agarose gel electrophoresis as shown in FIG. 9. In FIG. 9, panel A shows the result of PCR identification of genomic DNA PCR product of A3104D cells by TA clone-monoclonal transformant colony PCR, theoretical length 1738 bp; b picture is PCR identification electrophoresis result of B3622D cell genome DNA PCR product through TA clone-monoclonal transformant colony, theoretical length is 1557 bp; the C picture is the electrophoresis result of PCR identification of the C2426D cell genome DNA PCR product through TA clone-monoclonal transformant colony, the theoretical length is 1436 bp; the D picture is the PCR result of the PCR product of the genomic DNA of the D3431D cell, which is identified by TA clone-monoclonal transformant colony PCR, and the theoretical length is 1346 bp. As can be seen from fig. 9, the size of the electrophoretic band completely fits the theoretical length of the HD NQ correct tap-in.

The correct knockin NQ was identified by determining whether mutation (including nonsense mutation, stop mutation, etc.) occurred, and the results are shown in fig. 10. Fig. 10 is a partial peak pattern diagram of the knock-in CAG repeat region, A, B, C, D is a sequencing peak pattern diagram of a3104D, B3622D, C2426D and D3431D respectively (mainly showing partial peak pattern diagrams of the PolyQ knock-in region), the peak pattern is single, no hetero-peak exists, the PolyQ (CAG, CAA) knock-in of the selected monoclonal cell is correct, and the HD cell model is successfully constructed.

The invention is not limited to the foregoing embodiments. The invention extends to any novel feature or any novel combination of features disclosed in this specification and any novel method or process steps or any novel combination of features disclosed.

SEQUENCE LISTING

<110> university of southwest

<120> CRISPR/Cas9-gRNA targeting sequence pair of HTT, plasmid and HD cell model

<160> 6

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence

<400> 1

caagatggct gagcgccttg g 21

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence

<400> 2

cgggaaagcc tggcctcagg g 21

<210> 3

<211> 450

<212> DNA

<213> Artificial sequence

<400> 3

cagcagcaac agcagcagca gcaacagcag cagcaacagc agcagcaaca gcagcagcag 60

caacagcagc agcaacagca gcagcagcag cagcaacagc agcagcagca acagcagcag 120

cagcagcagc aacagcagca gcagcagcaa cagcaacagc agcagcagca gcagcaacag 180

cagcagcagc aacagcagca gcaacagcag cagcagcaac agcagcagca acagcagcag 240

caacagcagc agcagcagca gcaacagcag cagcagcagc aacagcagca gcagcaacag 300

cagcagcagc agcaacagca gcagcagcaa cagcagcagc agcaacagca gcagcaacag 360

cagcaacagc agcagcagca gcagcagcaa cagcagcagc agcagcaaca gcagcagcaa 420

cagcagcaac agcagcagca acagcagcag 450

<210> 4

<211> 270

<212> DNA

<213> Artificial sequence

<400> 4

cagcagcaac agcagcagca gcaacagcag cagcaacagc agcagcaaca gcagcagcag 60

caacagcagc agcaacagca gcagcagcag cagcaacagc agcagcagca acagcagcag 120

cagcagcagc aacagcagca gcagcagcaa cagcaacagc agcagcagca gcagcaacag 180

cagcagcagc aacagcagca gcaacagcag cagcagcaac agcagcagca acagcagcag 240

caacagcagc agcagcagca gcaacagcag 270

<210> 5

<211> 150

<212> DNA

<213> Artificial sequence

<400> 5

cagcagcaac agcagcagca gcaacagcag cagcaacagc agcagcaaca gcagcagcag 60

caacagcagc agcaacagca gcagcagcag cagcaacagc agcagcagca acagcagcag 120

cagcagcagc aacagcagca gcagcagcaa 150

<210> 6

<211> 60

<212> DNA

<213> Artificial sequence

<400> 6

cagcagcaac agcagcagca gcaacagcag cagcaacagc agcagcaaca gcagcagcag 60

Claims

1. The CRISPR/Cas9-gRNA targeting sequence pair of the HTT is characterized by comprising an L sequence and an R sequence, wherein the base sequence of the L sequence is shown as SEQ ID NO.1, and the base sequence pair of the R sequence is shown as SEQ ID NO. 2.

2. An HTT CRISPR/Cas9-gRNA targeting plasmid, which comprises a first vector plasmid and the HTT CRISPR/Cas9-gRNA targeting sequence pair of claim 1, wherein the HTT CRISPR/Cas9-gRNA targeting sequence pair is constructed into the first vector plasmid.

3. The CRISPR/Cas9-gRNA targeting plasmid of HTT according to claim 2, characterized in that the vector plasmid is VK 001-05.

4. An HD cell model obtained by co-transfecting a cell, which is a CATH-a cell, with a polyQDonor plasmid constructed from a polyQ gene fragment selected from one of Htt150Q, Htt90Q, Htt50Q and Htt20Q, wherein the base sequence of Htt150Q is represented by SEQ ID NO.3, the base sequence of Htt90Q is represented by SEQ ID NO.4, the base sequence of Htt50Q is represented by SEQ ID NO.5, and the base sequence of Htt20Q is represented by SEQ ID NO.6, and the targeting plasmid of claim 2 or 3.

5. The HD cell model of claim 4, wherein the front end and the back end of the PolyQ gene fragment carry EcoRI and-XmaI cleavage sites, respectively.

6. The HD cell model of claim 5, wherein the PolyQDonor plasmid is cleaved with Not1 restriction enzyme into a linear plasmid, which is co-transfected with the targeting plasmid of claim 2 or 3.

7. The HD cell model of claim 6, wherein, during transfection, the PolyQDonor plasmids and the targeting plasmids are wrapped with a transfection reagent, the mass-to-volume ratio of the total mass of the PolyQDonor plasmids and the targeting plasmids to the transfection reagent is 1:2-5 μ L, and the mass ratio of the PolyQDonor plasmids to the targeting plasmids is 0.5-2: 1.