CN107130000B

CN107130000B - CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene and application thereof

Info

Publication number: CN107130000B
Application number: CN201710332598.8A
Authority: CN
Inventors: 陈锦阳; 邓兆群
Original assignee: Zhejiang Wei Wei Biological Medicine Technology Co Ltd
Current assignee: Zhejiang Wei Wei Biological Medicine Technology Co Ltd
Priority date: 2017-05-12
Filing date: 2017-05-12
Publication date: 2019-12-17
Anticipated expiration: 2037-05-12
Also published as: CN107130000A

Abstract

The invention discloses a CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene, which comprises sgRNA of a specific target KRAS gene, corresponding DNA sequences of which are shown as SEQ ID No.1 or/and SEQ ID No.2, and sgRNA of a specific target EGFR gene, and corresponding DNA sequences of which are shown as SEQ ID No.11 or/and SEQ ID No. 12. The invention also discloses application of the compound in preparing a medicament for treating cancer. The CRISPR-Cas9 system can simultaneously and efficiently knock out two cancer driving factors KRAS and EGFR which are highly expressed in lung cancer, is simple to operate and high in knocking efficiency, and is expected to be applied to treatment of the lung cancer. The system of the invention is applicable to various cancers with abnormal expression of EGFR and KRAS.

Description

CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene and application thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene and application thereof.

Background

the lung cancer is the malignant tumor with the highest morbidity and mortality in the world at present, and the morbidity and mortality of the lung cancer in the world are in an increasing trend. In China, the cancer burden of lung cancer is increasingly aggravated along with the acceleration of industrialization speed, serious environmental pollution and the aggravation of population aging. Lung cancer can be divided into two major categories based on histopathology: non-small cell lung cancer (NSCLC, 85%) and small cell lung cancer (SCLC, 15%), the treatment of which remains one of the most challenging tasks in the medical community.

tumor cells continue to grow under the action of the driver gene and are highly sensitive to the inhibition of the driver gene, with KRAS and EGFR being common mutant driver genes in lung cancer.

It has been found that one third of NSCLC and KRAS gene mutations are directly related, so targeted therapy against KRAS mutations is a hot spot in lung cancer research in recent years. The KRAS gene is a member of the RAS gene family, encodes the protein P21, is a monomeric G protein in nature, is located on the inner side of cell membrane, and regulates cell growth and differentiation by binding to GTP/GDP. Under normal conditions, p21 and GDP are combined in a static state, when being stimulated by growth factors, p21 is activated to be in a GTP combination state, a signal system is opened, p21 has GTPase activity to hydrolyze GTP into GDP, p21 is inactivated after being combined with GDP again, and the signal system is closed. The normal KRAS gene can inhibit tumor growth, and the mutated KRAS protein p21 has only weak GTP activity and can not rapidly decompose GTP, so that RAS signal transduction protein is locked in a GTP-combined activation state, cells are stimulated by continuous growth signals, proteins required by receptor signal transmission are recruited, extracellular signals are transmitted, processes of proliferation, survival, differentiation and the like of the cells are influenced, the cells are continuously stimulated to grow, growth rules are disturbed, and tumors are caused.

The Epidermal Growth Factor Receptor (EGFR) gene is located in the p 13-q 22 region of chromosome 7, consists of 28 exons and encodes 1186 amino acids. The gene encodes a transmembrane protein receptor, which is one of EGFR family members. EGFR mutation rates vary significantly among different ethnic groups. The mutation hot spot is mainly in the coding region of tyrosine kinase, most of the mutation is concentrated in 18-21 exons, and the most common mutations are deletion mutation at 19 exons (accounting for about 44 percent of EGFR mutation) and L858R point mutation at 21 exons (accounting for about 41 percent of EGFR mutation).

Epidermal Growth Factor (EGF) is the strongest in vitro epidermal cell division-promoting factor, and can competitively bind to EGFR with transforming factor (TGFA) secreted by some cells, and then activate receptor tyrosine protein kinase which phosphorylates various protein substrates in self and cytoplasm, triggers a series of signal transmission, transmits information into cell nucleus, and promotes the synthesis of protein and enzyme and the division and proliferation of cells. EGFR expression is detected by a plurality of human tumors, tumor growth is promoted through autocrine and paracrine actions, and the expression level of EGFR in lung cancer is obviously higher than that of normal tissues, which shows that the EGFR expression has important action in the occurrence and development of lung cancer.

In recent years, genome editing tools have been widely used in the biomedical field, and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology has become a hotspot in genome editing. CRISPR is a sequence naturally occurring in bacterial DNA, which in combination with CRISPR-associated nuclease (Cas) has the effect of directing RNAs to protect the bacterial genome from attack by target-specific sequences detected in invasive phage. The CRISPR/Cas9 technology is respectively evaluated as one of star technologies at 10 th before 2013 by the Nature and the Science journal, and is the head of ten findings selected by the Science journal in 2015. The technology becomes a powerful research tool in the fields of functional genomics and system biology.

CRISPR/Cas9 is an RNA-mediated endonuclease that is directed to target sequences in the genome by a single guide RNA (sgRNA) complementary to the target sequence, which must be adjacent to a PAM sequence in the form of NGG or NAG. CRISPR/Cas9, upon binding to a target sequence, creates a double-strand break in a specific genomic region. Thereby activating the body's NHEJ (Non-homologous end joining) DNA mutation repair mechanism. Under the repair mechanism, because no template exists, DNA is only repaired randomly to restore the double-stranded structure, which will inevitably cause the repair result to be different from the original genome sequence to form mutation-gene knockout.

The CRISPR-Cas9 has the characteristics of high mutation rate, simple operation and low cost. Based on the genetic engineering operation of CRISPR-Cas9, the directional modification of disease key genes can be realized, so that the aim of slowing down or curing diseases is fulfilled.

The current treatment methods for lung cancer mainly comprise: surgical treatment, radiotherapy, chemotherapy and molecular targeted therapy. Chemotherapy is a rather broad-spectrum treatment method, but has requirements on the constitution of patients, patients with relatively poor constitution or complications are contraindications of chemotherapy, and chemotherapy has certain side effects. The emergence of molecular targeted therapy in recent years is a great breakthrough, and some molecular targeted drugs have an effect on clinical treatment of lung cancer, but the targeted therapy is different from chemotherapy, so that a specific beneficial population is provided. With the development of the subjects such as tumor molecular biology and tumor immunology, gene diagnosis and targeted therapy for tumors become possible gradually, and the gene therapy is regarded as a novel clinical treatment method with strong specificity and good targeting property and is more and more emphasized by the majority of lung cancer medical practitioners.

Aiming at the targeted inhibition of genes, the currently commonly used siRNA can effectively inhibit the gene expression, but the use of the siRNA has low drug delivery efficiency, continuous drug delivery is required, radical treatment cannot be achieved completely, the drug administration is complex, and the siRNA is not suitable for large-scale popularization. The expression structures of ZFNs and TALEN technologies are complex, and the CRISPR-Cas9 has the advantages of rapidness, simplicity, convenience, high efficiency, multiple sites and specific targeting gene knockout. At present, no report of CRISPR-Cas9 system for knocking out KRAS gene and EGFR gene at the same time is found.

Disclosure of Invention

The invention aims to provide a CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene and application thereof, so as to solve the defects of the prior art.

The invention adopts the following technical scheme:

A CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene comprises sgRNA of a specific target KRAS gene and sgRNA of a specific target EGFR gene; the DNA sequence corresponding to the sgRNA of the specific targeting KRAS gene is shown in SEQ ID No.1 or/and SEQ ID No.2, and the DNA sequence corresponding to the sgRNA of the specific targeting EGFR gene is shown in SEQ ID No.11 or/and SEQ ID No. 12.

Further, the CRISPR-Cas9 system also includes Cas 9.

Further, the sgRNA specifically targeting the KRAS gene or the sgRNA specifically targeting the EGFR gene and Cas9 are present in the same plasmid or in separate plasmids.

Further, the CRISPR-Cas9 system further comprises 2 Cas9 backbone vectors with different resistance markers and fluorescent markers.

Further, the Cas9 backbone vector is a Cas9 backbone vector expressed by a U6 promoter.

The CRISPR-Cas9 system for simultaneously knocking out the KRAS gene and the EGFR gene is applied to preparation of a cell model or an animal model for simultaneously knocking out the KRAS gene and the EGFR gene.

The CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene is applied to preparation of a cancer treatment drug.

Further, the cancer includes lung cancer, liver cancer or pancreatic cancer.

The invention has the beneficial effects that:

1. The CRISPR-Cas9 system can simultaneously and efficiently knock out two cancer driving factors KRAS and EGFR which are highly expressed in lung cancer, is simple to operate and high in knocking efficiency, and is expected to be applied to treatment of the lung cancer. EGFR and KRAS are genes which are abnormally expressed in various cancers such as lung cancer, liver cancer, pancreatic cancer and the like, and participate in the generation and development of tumors.

2. According to the invention, through plasmid transformation, 2 cas9 skeleton vectors with different resistance markers and fluorescence markers are respectively selected, and double genes are knocked out simultaneously through a co-transformation mode, so that the process of gene knock-out research is accelerated.

3. the CRISPR-Cas9 system is simple to operate, more target site selections are realized, the target is accurate, the off-target rate is low, and the knockout efficiency can reach over 90 percent. Compared with the traditional targeting system, the CRISPR-Cas9 system is selected, so that the method is simple and convenient to operate and high in targeting efficiency.

Drawings

FIG. 1: position of CRISPR-Cas9 target sequence in KRAS gene.

FIG. 2: position of CRISPR-Cas9 target sequence in EGFR gene.

FIG. 3: t7EN1 enzyme cutting electrophoresis picture

Wherein, lanes 1 and 3 are untreated group DNA; lanes 2 and 4 are treatment group DNA; m represents Marker, and the bands from top to bottom are respectively 600bp, 500bp, 400bp, 300bp, 200bp and 100 bp.

FIG. 4: relative expression level of KRAS protein.

FIG. 5: relative expression amount of EGFR protein.

Detailed Description

The invention is explained in more detail below with reference to exemplary embodiments and the accompanying drawings. The following examples are provided only for illustrating the present invention and are not intended to limit the scope of the present invention.

Example 1

sgRNA design

10 sgRNAs (corresponding DNA sequences shown in SEQ ID Nos. 1-10 and 11-20) were designed based on the human KRAS gene Sequence (Sequence ID: NM-033360.3) and EGFR gene Sequence (Sequence ID: NM-201282.1) given in GeneBank. Sgrnas of both genes are targeted on their outer display regions, and aligned with blast in UCSC or NCBI to ensure the uniqueness of their target sequences. Only 2 of 10 sgRNAs which are respectively designed can effectively knock out KRAS and EGFR, and a first KRAS-sg1 (the corresponding DNA sequence is shown in SEQ ID NO. 1) and EGFR-sg1 (the corresponding DNA sequence is shown in SEQ ID NO. 11) are selected for detailed explanation, as shown in FIG. 1 and FIG. 2.

2. Construction of oligonucleotide double strands of sgRNA

Adding CACC at the 5 'end of the determined KRAS target sequence upstream primer and AAAC at the 5' end of the downstream primer, so that the cohesive end of the double-stranded DNA formed after annealing is complementary with the cohesive end formed after the pX458-neo-GFP framework vector is subjected to Bbs I enzyme digestion, and the construction and connection of the vector at the later stage are facilitated. The vector pX458-neo-GFP has neomycin resistance and a GFP fluorescent marker. Notably, the first base of the target sequence needs to be G, which is easily recognized by the U6 promoter on the vector.

Forwarc oigo→5′-CACCNNNNNNNNNNNNNNNNNNNN-3′

3′-NNNNNNNNNNNNNNNNNNNNNCAAA-5′←Reverse oligo

Adding CACCG at the 5 ' end of the upstream primer, adding AAAC at the 5 ' end and adding C at the 3 ' end of the downstream primer of the determined EGFR target sequence, thus the cohesive end of the double-stranded DNA formed after annealing is complementary with the cohesive end formed after the pX260-puro-RFP framework vector is subjected to Bbs I enzyme digestion, and the construction and connection of the vector at the later stage are facilitated. The vector pX260-puro-RFP has puromycin resistance and an RFP fluorescent marker. Notably, the first base of the target sequence needs to be G, which is easily recognized by the U6 promoter on the vector.

Forward oligo→5′-CACCGNNNNNNNNNNNNNNNNNNNN-3′

3′-CNNNNNNNNNNNNNNNNNNNNNCAAA-5′←Reverse oligo

The Forward oligo and Reverse oligo of the synthesized sgRNA oligonucleotide were denatured in pairs, annealed, and annealed to form a double strand that could be ligated into the U6 eukaryotic expression vector. The synthesized upstream and downstream primers were dissolved in 1 XAnneal buffer to a concentration of 100. mu.M, 2.5. mu.l of the upstream and downstream primers were mixed, 1. mu.l of NEB buffer and 4. mu.l of sterile water were added, annealing was performed according to the touchdown procedure as follows to form double-stranded DNA, and the double-stranded DNA was stored at-20 ℃ for future use.

And (3) annealing procedure:

CRISPR vector construction

The vector was cleaved with the restriction enzyme Bbs I as shown in Table 1:

TABLE 1

The resulting mixture was sequentially put into a 200. mu.L PCR tube, incubated at 37 ℃ for 6 hours, and then subjected to agarose gel electrophoresis at a concentration of 0.8% to recover the objective vector fragment.

The purified linearized plasmid was religated with the annealed double-stranded target site oligonucleotides to form the specific targeting vectors pX458-neo-GFP-Kras-sg1 and pX260-puro-RFP-egfr-sg 1. The linking system is as follows: 0.2pmol of double-stranded oligonucleotide, 20ng of linearized plasmid, 1. mu.L of 10 XT 4 ligase buffer, 1. mu.L of T4 ligase, 10. mu.L of water, and ligation at 22 ℃ for 1.5 hours.

The enzyme-linked product was transformed into 100. mu.L of DH 5. alpha. competent cells, plated with the corresponding resistant antibiotic, and cultured overnight at 37 ℃. Single colonies were picked and positive clones verified by sequencing using the universal U6 primer.

U6：ATGGACTATCATATGCTTACCGTA

The positive clones were picked and cultured overnight at 37 ℃ with shaking, and plasmids pX458-neo-GFP-Kras-sg1 and pX260-puro-RFP-egfr-sg1 were extracted with the kit, respectively.

4. Plasmid transfection of lung cancer cells

A549 cells were inoculated in a 6-well plate, and after the cell density was 70%, 3. mu.g of pX458-neo-GFP-Kras-sg1 and 3. mu.g of pX260-puro-RFP-egfr-sg1 recombinant plasmid were co-transfected according to the manual of Lipofectamine TM2000Transfection Reagent (Invitrogen,11668-019), and after 6.5 hours, the solution was changed, and neomycin and puromycin were added for selection and culture for 48 hours, viable cells were collected.

5. Screening an A549 stable cell strain simultaneously knocking out KRAS gene and EGFR gene.

Flow cytometry screening:

And (3) carrying out sterile flow sorting on the surviving cells, screening out cells emitting green fluorescence and red fluorescence at the same time, and collecting.

In this embodiment, the vector used may be replaced with cas9 backbone vector expressed by U6 promoter, such as PX 330; the neomycin used, puromycin, can be replaced by other antibiotics except ampicillin; and GFP and RFP can be replaced with other different fluorescence.

Example 2

Enzyme digestion experiment of T7EN 1:

The cells collected in example 1 were lysed, and genomic DNA was extracted using the kit and finally dissolved in 50. mu.L of deionized water.

Specific primers were designed using Primer 5.0 software based on KRAS and EGFR gene sequences published in GenBank as shown in table 2:

TABLE 2

Extracting partial cell genome DNA by using the kit, and amplifying a target fragment by using the extracted cell genome DNA as a template and using a specific primer designed in the table 2. An amplification system: 2 XPCR Mix 10 uL, genomic DNA 1uL, upstream and downstream primers 1uL each, add dd H₂O to 20. mu.L. Reaction procedure: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30 seconds, annealing at 60 ℃ for 30 seconds, and extension at 72 ℃ for 35 seconds for 30 cycles; extension at 72 ℃ for 10 min; storing at 4 ℃.

100ng of the purified PCR product was denatured and renatured in NEB Buffer 2, incubated with T7 endonuclease (NEB, M0302L) at 37 ℃ for 40min, and separated by electrophoresis on a 2% agarose gel. The T7 endonuclease is able to recognize and cleave double-stranded DNA that is not perfectly paired, and if the CRISPR-Cas9 mutates the target, it will be able to recognize and break the double-stranded DNA. Thus, the presence of a mutation in the target DNA is indicated by the presence of a band other than PCR after electrophoresis. As shown in FIG. 3, 2 new bands appeared in all the treatment groups after digestion, indicating that the treatment groups did introduce mutations. And (3) performing TA cloning on the PCR purified and recovered product obtained in the step, wherein the step is as follows: connecting 1ul of product with pMD19-T vector, transforming competent cell DH5 alpha, selecting single clone, sequencing with universal primer U6 sequence atggactatcatatgcttaccgta, and obtaining A549 mutant strain with KRAS and EGFR stably knocked out.

Example 3

Immunoblotting experiments:

1x10 is respectively selected from the cells before and after KRAS and EGFR knockout of lung cancer cells⁶The cells were harvested and 20. mu.L of lysate (50mM HEPES, pH7.0, 1% NP-40, 5mM EDTA, 450mM NaCl, 10mM Na pyrophosphate and 50mM Na F) was added, and various fresh inhibitors (1mM Na orthovanadate, 1mM PMSF, 10. mu.g/ml aprotinin, Leuteptin, pepstatin) were added to the lysate. Ultrasonic treating at room temperature, adding 1% mercaptoethanol, boiling at 100 deg.C for 5min for denaturation, and loading 10 μ L per well in SDS-PAGE gel. After electrophoresis, the protein sample was transferred to a nitrocellulose membrane. After the membrane transfer is finished, the membrane is washed once by TBST, blocked by 5 percent skim milk powder for 1 hour, washed once by TBST, and the diluted primary antibody is hybridized with the membrane at room temperature for 2 hours or at 4 ℃ overnight. Washing with TTBS for three times, hybridizing the diluted secondary antibody with the membrane at room temperature for 1 hour, washing the membrane with TBST for 3 times, adding ECL developing reagent for color development, and analyzing the result with protein gray scale analysis software.

The results of the quantitative analysis of FIGS. 4 and 5 show that the relative protein expression levels of KRAS and EGFR were 0.081. + -. 0.023 in the treated group and 0.107. + -. 0.025 and 0.081. + -. 0.023, respectively, compared to the untreated group, indicating that both EGFR and KRAS protein expression were effectively inhibited.

Example 4

Proliferation experiments:

KR (lung cancer cell)Cells before and after AS and EGFR knockout were inoculated in 96-well plates, and a blank group with only culture medium was additionally provided, with 6 replicates per group. And after 24h, 48h and 72h of culture, adding 20 mu L of MTT solution into each hole, incubating for 2h at 37 ℃, reading the absorbance value of 460nm of each hole on a microplate reader, and calculating the cell growth inhibition rate. Data toIt shows that SPSS16.0 statistical software is used for statistical analysis, T test is used for comparison of the two, and P is less than 0.05, which is the difference and has statistical significance. The results are shown in Table 3:

TABLE 3

Note: p < 0.05 compared to A549-con

The experimental result of the MTT method for measuring the cell proliferation shows that: the cell proliferation is inhibited by inhibiting the expression of KRAS (A549-KRAS group) or EGFR (A549-EGFR group) alone; after KRAS and EGFR were silenced simultaneously (group A549-double), cell proliferation of A549 was significantly inhibited.

SEQUENCE LISTING

<110> Zhejiang Wei Biomedicine science and technology Limited

<120> CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene and application thereof

<130>

<160> 20

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

ggactctgaa gatgtaccta 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

ggaggatgct ttttatacat 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

caggacttag caagaagtta 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

agtagacaca aaacaggctc 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

gatgtaccta tggtcctagt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

tagaacagta gacacaaaac 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

atgcttttta tacattggtg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

tttttaattt tcacacagcc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence

<400> 9

ttatttccta ctaggaccat 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence

<400> 10

tttgctgatg tttcaataaa 20

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<400> 11

tgaaccgcac ggcgccatgc 20

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<400> 12

gaattcgctc cactgtgttg 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<400> 13

tgcaaataaa accggactga 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

cacagtggag cgaattcctt 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<400> 15

aattcgctcc actgtgttga 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

tgaaccgcac ggcgccatgc 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<400> 17

tgctgactat gtcccgccac 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

ggatgctctc cacgttgcac 20

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

agggttgttg ctgaaccgca 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

ctttctcagc aacatgtcga 20

Claims

1. a CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene is characterized by comprising Cas9, sgRNA specifically targeting KRAS gene and sgRNA specifically targeting EGFR gene; the DNA sequence corresponding to the sgRNA of the specific targeting KRAS gene is shown in SEQ ID No.1 or/and SEQ ID No.2, and the DNA sequence corresponding to the sgRNA of the specific targeting EGFR gene is shown in SEQ ID No.11 or/and SEQ ID No. 12.

2. the CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene according to claim 1, wherein sgRNA and Cas9 specifically targeting KRAS gene exist in one plasmid, and sgRNA and Cas9 specifically targeting EGFR gene exist in the other plasmid.

3. The CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene according to claim 1, wherein the CRISPR-Cas9 system further comprises 2 Cas9 skeleton vectors with different resistance markers and fluorescent markers.

4. The CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene according to claim 3, wherein the Cas9 backbone vector is a Cas9 backbone vector expressed by U6 promoter.

5. use of the CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene according to any one of claims 1-4 in the preparation of cell models or animal models for simultaneously knocking out KRAS gene and EGFR gene.

6. Use of the CRISPR-Cas9 system for simultaneously knocking out KRAS gene and EGFR gene according to any one of claims 1-4 in the preparation of a medicament for treating cancer.

7. The use of claim 6, wherein the cancer comprises lung cancer, liver cancer or pancreatic cancer.