CN104388560A - Method for marking Y chromosome and application thereof - Google Patents
Method for marking Y chromosome and application thereof Download PDFInfo
- Publication number
- CN104388560A CN104388560A CN201410646040.3A CN201410646040A CN104388560A CN 104388560 A CN104388560 A CN 104388560A CN 201410646040 A CN201410646040 A CN 201410646040A CN 104388560 A CN104388560 A CN 104388560A
- Authority
- CN
- China
- Prior art keywords
- seq
- gene
- chromosome
- albumen
- target sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Abstract
The invention discloses a method for marking a Y chromosome and application thereof. According to the method, the Y chromosome of an isolated animal somatic cell is specifically marked by utilizing a TALEN method. By adopting the method disclosed by the invention, convenient, simple, effective, safe and accurate early identification on the animal gender can be realized, and a basis is laid for selectively culturing animals with a specific gender and improving the breeding efficiency.
Description
Technical field
The present invention relates to a kind of Y chromosome marking method and application thereof, belong to biological technical field.
Background technology
Sex control refers to by intervening artificially or operating the technology making animal reproduction go out the offspring of particular sex.Mammalian sex controls to be the important content in herding research, and its achievement in research is all significant for Animal Genetics, diseases prevention and treatment and husbandry sector: one, greatly can improve the economic benefit of livestock industry.In Animal husbandry production, the domestic animal of different sexes has different purposes, therefore this technology can be used to improve the quantity of a large amount of female individuals as milk cow, hen, and the feed intake of male in breeding year can be saved, contrary male beef cattle, the weightening finish such as sheep and pig wants fast, meat also excellent feature also by the male offspring of this technical controlling fecund.Its two, the sex control realizing animal can eliminate undesirable recessive character, accelerates the genetic progress of domestic animal, accelerates the renewal of drove.
Current sex-controlled common method mainly comprises: X, the methods such as the separation of y sperm, the qualification of embryo gender and environmental Kuznets Curves.
The first, X, the separation of y sperm
Principle: according to X, y sperm is at physics (volume, density, electric charge, mobility) and chemistry (DNA content, surface antigen) etc. the difference of aspect, set up the various methods of sperm being carried out to sorting, comprise settling process, electrophoretic method, centrifuging and Application comparison is many at present fluidic cell partition method, immunology and FISH technical appraisement method.
Fluidic cell partition method: Main Basis is the content difference of X, y sperm DNA.In general, X sperm contains more DNA than y sperm, so when dyeing with dye Hoechst 33342, the dyestuff that X sperm absorbs is many, the fluorescence sent is also strong, X and y sperm can be told at this point, and then the X sperm utilizing computer control to make fluorescence strong becomes positively charged lotus, negative charge on y sperm band, just deflect to different directions when passing through high-voltage electric field, thus reach separation object, resolving power can reach 90%, but during with fluidic cell separator separated sperm, sperm needs to pass through one by one, so just seminal fluid must be diluted, this will cause the motor capacity of sperm to decline, and fluorescence dye is to the toxic effect of sperm, in addition the too low instrument price of efficiency is expensive, in the situation that insemination also has litter size and pregnancy rate to decline afterwards, also cannot for the production of practice.
Immunological method: comprise y sperm along with immunologic development it is found that at male tissue, have H-Y antigen.Male tissue immunization. Female animal produces H-Y antibody, and only has y sperm could express H-Y antigen, thus utilizes H-Y antigen that H-Y antibody test plasmalemmae of sperms exists, then obtains X, y sperm by immunity or separation method.Nineteen eighty-two, investigator Zavos injects female rabbit intravaginal H-Y antiserum(antisera), semen deposition after 15 minutes, and the female rabbit produced accounts for 74.2%.H-Y antiserum(antisera) obtains after utilizing immunization. Female animal, but H-Y antigen self is a kind of poor antigen, in addition animal individual self is to immunoreactive difference, is difficult to play good immune effect, and the decline of separated sperm vigor also can affect conception rate and litter size.At present domestic and international have H-Y clonal antibody study widely, can expect that following immunological method can be applied on sex control.
FISH technical evaluation method: fluorescence in situ hybridization technique (being a kind of technology utilizing inactive fluorescent signal to detect in situ hybridization sample).FISH is directly perceived due to it, and fast, susceptibility is high and be convenient, flexiblely more and more widely used.Ultimate principle is: will marked the single stranded DNA (probe) of fluorescence and the DNA anneal with its complementation, reflects the situation of corresponding gene by observing fluorescent signal position on chromosome.Namely utilize the specific sequence hybridization on Y chromosome specific nucleic acid probe and sperm, then demarcate fluorescent substance, directly observe and distinguish X sperm and y sperm under fluorescent microscope.The method is specially adapted to X sperm and y sperm DNA content difference is very small, and weight analysis can not ensure the situation of accuracy.The result of initial utilization FISH on Niu Jingzi to know the sperm of qualification 79%.But the defect of the method is the length that expends time in, and the price of reagent is higher
Second: the qualification of embryo gender
Principle: in embryonic stage, utilize karyotyping method, Immunological Method and SRY-PCR identification method to detect it is female or male, thus selects object sex embryo to carry out subsequent operations.
Karyotyping method: by finding out that the sex chromosome type of embryonic cell is the sex that embryo identified by XX type and XY type.Operating process is: the embryonic cell taken a morsel is through the fixing dyeing of colchicine process, inspectability karyomit(e), Sex estimation is carried out in the size and form of the different bands of a spectrum of metaphase in cell division and Y chromosome according to karyomit(e), this method accuracy rate almost can reach 100%, but complex operation, is difficult to apply aborning.Be mainly used to the accuracy rate verifying other sex appraisal methods at present.
Immunological Method: first by the embryo of 8 cell morula stages and H-Y antibody response 30min, the Immunoglobulin IgM antibody response marked with isothiocyanate fluorescein (FITC) again, then under fluorescent microscope, check that whether embryo is with fluorescein, if have, be judged to be H-Y+ embryo, not aobvious fluorescence is then H-Y-embryo.Have the female qualification accuracy rate of 89% ox, pig has the qualification accuracy rate of 81%, and sheep has the qualification accuracy rate of 85%.
SRY-PCR method: be that one utilizes male specific gene probe and pcr amplification technical evaluation Embryo method for distinguishing, the party's ratio juris: design and synthesize a pair Auele Specific Primer in the both sides of sry gene core sequence, be complementary to two chains of extension increasing sequence respectively, under Taq DNA polymerase and embryonic cell DNA existent condition, through high-temperature denatured, low-temperature annealing and chain extension three steps carry out DNA cloning, by target sequence amplification to more than up to a million times, through electrophoresis detection amplification, what can amplify SRY sequence is male, otherwise is female.Herr etc. first successfully establish the PCR method of beef embryo sex qualification in nineteen ninety.Namely by synthesizing the partial sequence of specific fragment on sry gene or other Y chromosomes as primer, pcr amplification reaction can amplify the embryo of target fragment is under certain condition male embryo, otherwise is female embryo.Greatly sensitivity can be increased by pcr amplification Y chromosome DNA, improve accuracy rate, embryo through living tissue sampling does not have very large damage and the sperm be not easily attached in embryonic surface or zona pellucida pollutes, also be hopeful freezing further, by the viable cell taked through pcr amplification, amplified production is through agarose electrophoresis, and dyeing and observable are with or without specific fragment, can reach more than 90% by the accuracy rate of the Identification of embryo of pcr amplification, be one of ideal so far Embryo sexing method.The method is widely used in domestic animal Just because of this, particularly ox, the sex identification of sheep embryo.But this method has very large damage to embryo, and this analysis needs the long period, and embryo's time in vitro and embryo move into acceptor time and be subject to strict restriction, if in time can not be synchronous, transplanting efficiency will be made to be affected.In order to address this problem, people have to the temporary transient freezen protective of embryo that will carry out pcr analysis, until PCR result out after thaw again, considerably increase the difficulty of operation like this, and further injury produced to embryo.In a word, these current methods can not meet production application, are badly in need of new method.
Animal Transgenic Technology is the study hotspot of biological technical field, and the accurately genome editing technique of the artificial nucleic acid enzyme mediation of particularly recent development at present, its range of application has penetrated into the numerous areas such as fundamental research, agricultural, medicine.1997, the report that the first somatic cell clone sheep " Dolly " is born caused the strong interest of various circles of society, also indicated the successful foundation of a kind of new technology-mammal body-cell neucleus transplanting technology of biological field simultaneously.The birth of the Transgenic Sheep " Polly " that the first reported the same year utilizes somatic cell nuclear transfer technique to cultivate is only the real milestone of Animal Transgenic research field, and it has raised the new page of somatic cell nuclear transfer technique for the production of the large domestic animal of transgenosis.Somatic cell nuclear transfer technique and somatic cell gene transfer techniques are integrated as to be produced transgenic animal and opens an effective way.The maximum feature of this technological line is mainly reflected in and gene transfer procedures is advanceed to the somatic cell culture stage.Cytogene transfer refers to by electroporation, liposome, the transfection method such as calcium phosphate precipitation and microinjection, external source target gene is made to be integrated in cellular genome, and utilize specific selection markers, a large amount of amplification, enrichment transgenic cell, thus obtain transgenosis cell strain.The cloned animal directly utilizing this fixed somatocyte being integrated with goal gene to cultivate for nuclear donor must be all transgenic animal.Produce the advantage of breeding transgenic livestock clearly by somatic cell nuclear transfer technique: first, the method is drawn materials easy, and ovocyte can obtain from slaughterhouse, animal somatic cell source is enriched especially.Secondly, because the produced animal overwhelming majority is transgenic animal, thus have compressed the quantity of foster mother significantly, reduce production cost.That can shorten primary transgenic animal acquires the time forming the transgenic animal group system with throughput; More valuable, utilize this technology can also obtain the large domestic animal of gene site-directed modification.Under the present conditions, this is that other transgenic method is beyond one's reach.Meanwhile, " the artificial nucleic acid zymotechnic " that occur recently comprises ZFN, TALEN and cas9 system, can carry out accurate genetic modification in a lot of clone and species, for transgenic technology provide more effectively, more accurate instrument.
Sry gene is most of mammiferous sex controlled genes, and in mammiferous sex growth course, the existence of Y chromosome determines that it is to patrogenesis.The gene played a decisive role in this course is the Sry of Y linkage, and it is the unique testicular decisive factor of Mammals.This gene is positioned on Mammals Y chromosome, with sex, directly related gene occurs, and the presence or absence of this gene directly determines mammiferous sex phenotype with whether suddenling change.Genotype is that the cognition with sry gene of XX exists with male phenotype, and the sudden change of sry gene also can cause sex-reversal or sexual abnormality to a certain extent, and within 2013, researchist reports that sry gene pounds out mouse, loses male characteristic, becomes female.SRY albumen belong to containing HMG box (High mobility group) and specific combination in a subclass of DNA sequence dna albumen, this subclass comprises multiple transcription factor, the expression of a lot of male genes involved in downstream can be activated, thus control patrogenesis.
Summary of the invention
The object of this invention is to provide a kind of Y chromosome marking method and application thereof.
The invention provides a kind of animal Y chromosome marking method, is utilize TALEN method to carry out specific marker to the Y chromosome of in vitro animal somatic cell;
Described specific marker is the enterprising row labels of sex determining gene SRY at Y chromosome;
Described mark does not produce harm to the somatocyte of the animal at its place and sexual cell;
The gene of described mark is the encoding gene of the albumen of self luminescence or catalytic substrate colour developing;
Described TALEN method utilizes TALE albumen to suddenly change to Y chromosome specific target sequence, simultaneously by marker gene homologous recombination to target sequence location;
The gene of described mark is specially fluorescence protein gene, beta-galactosidase gene, luciferase gene or GRD beta-glucuronidase gene.
In aforesaid method, the method that the described Y chromosome in vitro animal somatic cell carries out specific marker is: TALE albumen-I and TALE albumen-II are expressed in the in vitro somatocyte of buck A, obtains the somatocyte that target sequence on Y chromosome is undergone mutation; Simultaneously by marker gene homologous recombination to target sequence location, realize the site-directed integration at marker gene target sequence place on the in vitro somatocyte Y chromosome of buck A;
The aminoacid sequence of described TALE albumen-I is as shown in SEQ ID No.3;
The aminoacid sequence of described TALE albumen-II is as shown in SEQ ID No.5;
Described target sequence is as shown in SEQ ID No.1;
Described target sequence is positioned on the sry gene of Y chromosome;
Described TALE albumen-I and TALE albumen-II can respectively with SEQ ID No.1 in from 5 ' end the 4th to the 18th, the 35th to the 48th nucleotide sequence specific combination, Fok I functional domain in TALE albumen-I and TALE albumen-II forms dimer, play non-specific endonuclease activity, make TALE albumen-I and the sequence mutates of TALE albumen-II respectively and between target sequence specific binding site;
The sex determining gene SRY of described marker gene to the Y chromosome of described buck A and offspring thereof marks, and does not namely destroy sry gene, can follow the tracks of again the expression indicating endogenous sry gene.
In above-mentioned arbitrary described method, described in TALE albumen-I and TALE albumen-II are expressed in the in vitro somatocyte of buck A method be: the recombinant expression plasmid respectively containing TALE albumen-I and TALE albumen-II encoding gene is imported in the in vitro somatocyte of described buck A;
The coding gene sequence of described TALE albumen-I is as shown in SEQ ID No.2;
The coding gene sequence of described TALE albumen-II is as shown in SEQ ID No.4;
Described by marker gene homologous recombination to the method for target sequence location for described marker gene is incorporated into described target sequence location by linearizing homologous recombination vector;
Described linearizing homologous recombination vector has the fragment of target sequence homology left arm-marker gene-target sequence homology right arm.
In above-mentioned arbitrary described method, the sequence of described target sequence homology left arm as in SEQ ID No.12 from 5 ' end shown in the 664th to the 1498th Nucleotide;
The sequence of described target sequence homology right arm as in SEQ ID No.12 from 5 ' end shown in the 4068th to the 4991st Nucleotide.
In above-mentioned arbitrary described method, described marker gene is green fluorescence protein gene;
Described green fluorescence protein gene specifically as in SEQ ID No.12 from 5 ' end shown in the 1573rd to the 2271st Nucleotide;
The sequence of the fragment of described target sequence homology left arm-marker gene-target sequence homology right arm as in SEQ ID No.12 from 5 ' end shown in the 664th to the 4991st Nucleotide.
In above-mentioned arbitrary described method, the nucleotide sequence of described homologous recombination vector is as shown in SEQ ID No.12;
Described linearizing is restriction enzyme AhdI linearizing;
Described animal is ox.
Qualification or the system of selection of Animal Sex also belong to a protection scope of the present invention, are to utilize above-mentioned arbitrary described method to mark the Y chromosome in the in vitro somatocyte of buck A, obtain being with markd transgenic cell; Take transgenic cell as nuclear donor cell, obtain somatic cell clone buck B by somatic cell clone technique; In the offspring embryo of somatic cell clone buck B, the markd embryo of tool is male embryo, and the markd embryo of tool is not female embryo;
Described animal is specially ox.
A kind of test kit also belongs to protection scope of the present invention, and this test kit is containing, for example lower 1)-4) at least one material:
1) DNA molecular of the encoding gene containing albumen shown in SEQ ID No.3, recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium;
2) DNA molecular of the encoding gene containing albumen shown in SEQ ID No.5, recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium;
3) DNA molecular shown in SEQ ID No.12 or containing the transgenic cell line of this molecule or recombinant bacterium;
4) containing in SEQ ID No.12 from 5 ' end DNA molecular, recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium shown in the 664th to the 4991st Nucleotide;
The encoding gene of the albumen shown in described SEQ ID No.3 is specifically as shown in SEQ ID No.2;
The encoding gene of the albumen shown in described SEQ ID No.5 is specifically as shown in SEQ ID No.4.
DNA molecular shown in SEQ ID No.12 also belongs to protection scope of the present invention;
And/or,
Containing in SEQ ID No.12 from 5 ' end the DNA molecular shown in the 664th to the 4991st Nucleotide also belong to protection scope of the present invention;
And/or,
DNA molecular shown in SEQ ID No.2 also belongs to protection scope of the present invention;
And/or,
DNA molecular shown in SEQ ID No.4 also belongs to protection scope of the present invention.
Mentioned reagent box or the application of above-mentioned DNA molecular in the product preparing the in vitro somatocyte Y chromosome of marking animals also belong to protection scope of the present invention;
Or,
Mentioned reagent box or above-mentioned DNA molecular also belong to protection scope of the present invention preparing the application in the product with markd buck on Y chromosome;
Or,
Mentioned reagent box or above-mentioned DNA molecular also belong to protection scope of the present invention preparing the application in the product with markd buck cell on Y chromosome;
Described mark is specially labeled with green fluorescent protein gene, is specifically positioned on the sry gene of Y chromosome;
The sequence of described labeled with green fluorescent protein gene specifically as in SEQ ID No.12 from 5 ' end shown in the 1573rd to the 2271st Nucleotide;
Or,
Mentioned reagent box or above-mentioned DNA molecular are also belonging to protection scope of the present invention for the preparation of the application in the qualification of Animal Sex or the product of selection;
Or,
Mentioned reagent box or the application of above-mentioned DNA molecular in animal breeds also belong to protection scope of the present invention;
Described animal is specially ox.
Principle of the present invention is first by carrying out marker gene modification to the sex determining gene SRY of the somatic Y chromosome of buck A, do not destroy sry gene simultaneously, it can be used as nuclear donor cell, then obtain somatic cell clone buck B by somatic cell clone technique; In the offspring embryo of somatic cell clone buck B, the markd embryo of tool is male embryo, and the markd embryo of tool is not female embryo.
Method provided by the invention is a kind of by accurate genetic modification mark boar somatocyte, and then realizes the method for the object identifying and/or select particular sex animal.
Adopt method provided by the invention, the convenience to Animal Sex, simple, efficient, safety, accurately Forepart identification can be realized, for selectivity cultivate particular sex animal, improve breeding efficiency and lay the foundation.
Accompanying drawing explanation
Fig. 1 is pSRY-TALEN-F and pSRY-TALEN-R Vector map.
Fig. 2 is the linearized vector collection of illustrative plates of homologous recombination donor vehicle pSRY2A-EGFP.
Fig. 3 is the PCR qualification result of cell clone.
Fig. 4 is the PCR qualification result of clened cows.
Fig. 5 is the PCR qualification result of embryo's sry gene.
Embodiment
The experimental technique used in following embodiment if no special instructions, is ordinary method.
Material used in following embodiment, reagent etc., if no special instructions, all can obtain from commercial channels.
DMEM/F12+10%FBS substratum is prepared as follows: this substratum is mixed by DMEM/F12 and foetal calf serum (FBS) and forms, and the volume ratio of FBS and DMEM/F12 is 1:9.
PGKloxPneo2 is purchased from addgene company, and catalog number is 13443.
PEGFP-N1 is purchased from Clontech company, and catalog number is 6085-1.
The preparation method of ripe liquid is as follows: M199 substratum and foetal calf serum (FBS) are mixed according to volume ratio 9:1, obtain mixed solution, in mixed solution, add 0.01U/mL bFSH (follicle-stimulating growth hormone), 0.01U/mL bLH (interstitialcellstimulating hormone (ICSH)) and 1 μ g/mL estradiol.
The preparation method of operation liquid is as follows: M199 substratum and foetal calf serum (FBS) are mixed according to volume ratio 9:1, obtain mixed solution, add 7.5 μ g/mL cytochalasin Bs in mixed solution.
Zimmerman liquid is prepared as follows: containing 0.3M N.F,USP MANNITOL, 0.1M MgSO
4, 0.05M CaCl
2, 0.5mM HEPES, 0.05g/100mL BSA the aqueous solution, pH7.2, with 0.22 μm of membrane filtration.
A23187 liquid is purchased from sigma, and article No. is C9275.
CR1aa nutrient solution is prepared as follows: the aqueous solution of 114mM sodium-chlor, 3.1mM Repone K, 26.2mM sodium bicarbonate, 20.4mM Sodium.alpha.-ketopropionate, and pH7.2, uses 0.22um membrane filtration.
The preparation of BO liquid:
(1) A liquid (100ml)
Ultrapure water 100ml constant volume.
(2) B liquid (100ml)
NaHCO
31.1552g
Ultrapure water 100ml constant volume.
A, B liquid is all for subsequent use after high-temperature sterilization.
(3) BO liquid (100ml)
A liquid 80ml
B liquid 20ml
Sodium.alpha.-ketopropionate 0.0138g
Penicillin 3.1mg
Streptomycin sulphate 3.1mg
Heparin sodium 3mg
Embodiment 1, Enhanced green fluorescent protein gene accurately modify the somatic preparation of breeding oxen of Y chromosome sex controlled gene SRY
One, the foundation of breeding oxen fibroblast
Get the ear skin tissue of holstein cow breeding oxen, clean up after ear's lower edge dorsal part unhairing with the aqueous ethanolic solution that volumn concentration is 70%, then to pick from ear's lower edge dorsal part with blade that to get area be 1cm
2the skin of left and right, the DMEM/F12 substratum being placed in 0 DEG C transports laboratory back as early as possible, with PBS and volumn concentration be 70% aqueous ethanolic solution cleaning several all over after shred into 1mm
3the fritter of left and right, DMEM/F12 plants block in the 25cm containing 1mLDMEM/F12+10%FBS in batches after cleaning 2 times
2culturing bottle in, until tissue block adherent firmly after add DMEM/F12+10%FBS to 6mL again, in 37 DEG C, 5%CO
2incubator is cultivated 6-7d, every 2d and is changed liquid 1 time, after Growth of Cells converges, goes down to posterity 2-3 time with 0.25% tryptic digestion, in batches frozen with cells frozen storing liquid.Like this, through original cuiture, Secondary Culture, the vitro culture such as freezing operation, breeding oxen fibroblast is established.
Two, the determination of target sequence
Selected target sequence is inner at sry gene, and sequence is as follows:
5’-ct
TTCTTGTGCTTATTTTCAATATTGACTTCCTT
ACTCTCGCTAACAAag-3’(SEQ ID No.1)
In SEQ ID No.1 from 5 ' end the 4th to the 18th, the 35th to the 48th nucleotides sequence be classified as can by the part of the combined function territory specific combination in TALENs albumen, binding site middle portion is the Fok I endonuclease cutting recognition site of TALENs albumen.
Three, construction effect is in the TALEN of sry gene
The schematic diagram of pSRY-TALEN-F and pSRY-TALEN-R carrier as shown in Figure 1.
In pSRY-TALEN-F, the coding gene sequence of SRY-F is as shown in SEQ ID No.2, and the aminoacid sequence of SRY-F is as shown in SEQ ID No.3, and SRY-F is TALE albumen-I.
In pSRY-TALEN-R, the coding gene sequence of SRY-R is as shown in SEQ ID No.4, and the aminoacid sequence of SRY-R is as shown in SEQ ID No.5, and SRY-R is TALE albumen-II.
TALE albumen-I and TALE albumen-II can respectively with SEQ ID No.1 in from 5 ' end the 4th to the 18th, the 35th to the 48th nucleotide sequence specific combination, FokI functional domain in TALE albumen-I and TALE albumen-II forms dimer, play non-specific endonuclease activity, make TALE albumen-I and the sequence mutates of TALE albumen-II respectively and between target sequence specific binding site; If TALENs protein exhibits cutting action, cell can start own healing mechanism, there will be deletion or the insertion of small segment at cleavage site, and sequencing result peak figure is heterozygosis peak figure.
Four, homologous recombination donor vehicle pSRY2A-EGFP is built
1, take pEGFP-N1 as template, B 195 and B196 is primer, carries out pcr amplification, obtains pcr amplification product,
B195:5’-AAGGATGCAA
GCGGCCGCGGCAGCGGCGAGGGCAGGGGCAGCCTGCTGACCTGCGGCGACGTGGAGGAGAACCCCGGCCCC ATGGTGAGCAAGGGCGAGGAG-3’；(SEQ ID No.6)
B196：5’-ATGCAAGTGC
GCGGCCGCTTACTTGTACAGCTCGTCCAT-3’。(SEQ ID No.7)
(sequence shown in underscore is that NotI enzyme cuts recognition site)
This pcr amplification product is 820bp, is denoted as pcr amplification product 1.
2, NotI single endonuclease digestion pcr amplification product 1, obtains gene fragment; NotI single endonuclease digestion plasmid PGKloxPneo2, obtains the carrier large fragment of 6.3kb; Gene fragment be connected with carrier large fragment, obtain recombinant plasmid, by its called after pPGKloxPneo2-2AEGFP, send order-checking by pPGKloxPneo2-2AEGFP, result is correct.
3, the fibroblastic genomic dna of the breeding oxen of extraction step one, with it for template, with primer B202 and B203 for primer, carries out pcr amplification, obtains pcr amplification product.
B202：5’-ATGCAA ccaccgcggtgg GCGGAGAAATAAATATTTCAC-3’；(SEQ ID No.8)
B203：5’-AAGTGCccaccgcggtgg AG ATATTGAAAATAAGCACAAGA-3’。(SEQ ID No.9)
(sequence shown in underscore is that BstxI enzyme cuts recognition site)
This pcr amplification product is 858bp, is denoted as pcr amplification product 2.
Pcr amplification product 2 is as homology arm sequence.
4, with BstxI single endonuclease digestion pcr amplification product 2, gene fragment is obtained; With BstxI single endonuclease digestion carrier pPGKloxPneo2-2AEGFP, obtain the carrier large fragment of 7.1kb; Gene fragment be connected with carrier large fragment, obtain recombinant plasmid, by its called after pPGKloxPneo2-2AEGFP-5HR, send order-checking by pPGKloxPneo2-2AEGFP-5HR, result is correct.
5, the fibroblastic genomic dna of the breeding oxen of extraction step one, with it for template, with primer B171 and B172 for primer, carries out pcr amplification, obtains pcr amplification product.
B171：5’-AAGGATGCAA
GCTAGCCTTCCTTACTCTCGCTAACAA-3’；(SEQ ID No.10)
(sequence shown in underscore is that NheI enzyme cuts recognition site)
B172：5’-ATGCAAGTGC
GTCGACATCAGATTAATCAGACAGGAT-3’。(SEQ ID No.11)
(sequence shown in underscore is that SalI enzyme cuts recognition site)
This pcr amplification product is 943bp, is denoted as pcr amplification product 3.
Pcr amplification product 3 is as homology arm sequence.
6, with NheI and SalI double digestion pcr amplification product 3, gene fragment is obtained; With NheI and SalI double digestion pPGKloxPneo2-2AEGFP-5HR, obtain the carrier large fragment of 7944bp; Gene fragment be connected with carrier large fragment, obtain recombinant plasmid, by its called after pSRY2A-EGFP, send order-checking by pSRY2A-EGFP, result is correct.
The sequence of pSRY2A-EGFP is as shown in SEQ ID No.12.
In SEQ ID No.12 from 5 ' end the 664th to the 1498th be target sequence homology left arm, the 1573rd to the 2271st be EGFP gene order, the 4068th to the 4991st for target sequence homology right arm.
Five, pSRY2A-EGFP vector linearization
With AhdI single endonuclease digestion pSRY2A-EGFP carrier, obtain linearized fragment, and with dehydrated alcohol method purify reclaim linearized fragment, for transfection breeding oxen fibroblast.
Linearized vector structure as shown in Figure 2.
In Fig. 2,5HR and 3HR represents the position of homologous recombination, and T2A represents the shearing peptide that foot and mouth disease virus is originated, and EGFP is Green fluorescent protein fusion vector, and PGK is phosphoglycerokinase strong promoter, Neo
rrepresent neomycin resistance gene, polyA represents transcription termination signal.
Neomycin resistance gene is set by the screening for the ease of follow-up transgenic cell.
Six, gene transfection
The cell cotransfection of pSRY2A-EGFP and TALENs plasmid: (cell count is about 1x10 to the breeding oxen inoblast of pSRY2A-EGFP and 3ug TALENs plasmid (pSRY-TALEN-F and pSRY-TALEN-R) each 1.5ug cotransfection step one of 3ug AhdI linearization for enzyme restriction being prepared
6) obtain transgenic cell.
The TALE albumen-I that pSRY-TALEN-F and pSRY-TALEN-R encodes respectively and TALE albumen-II can respectively with the SEQ ID No.1 on breeding oxen inoblast genome in from 5 ' end the 4th to the 18th, the 35th to the 48th nucleotide sequence specific combination, Fok I functional domain in TALE albumen-I and TALE albumen-II forms dimer, play non-specific endonuclease activity, make TALE albumen-I and the sequence mutates of TALE albumen-II respectively and between target sequence specific binding site; After the linearizing pSRY2A-EGFP simultaneously cut by the AhdI enzyme with foreign gene imports, donor vehicle is incorporated into target sequence location by homologous recombination, and the Y chromosome sex controlled gene SRY realized in breeding oxen inoblast is enhanced green fluorescence protein gene EGFP and accurately modifies.
Seven, PCR identifies that green fluorescent protein knocks in successful positive transgenic cell
With the genomic dna of transgenic cell for template, with KOD2-F and KOD2-R for primer, carry out pcr amplification, obtain pcr amplification product, if pcr amplification product is the fragment of 2kb, show that transgenic cell is positive transgenic cell, simultaneously with ddH
2o is template, carries out above-mentioned experiment, in contrast.
KOD2-F：5’-tgctcctgccgagaaagtat-3’；(SEQ ID No.13)
KOD2-R：5’-AAACAGTCTGTGAAGTTACCT-3’。(SEQ ID No.14)
Result as shown in Figure 3.
Fig. 3 shows, label be 3,12 transgenic cell clone identification be positive transgenic cell clone, and check order to pcr amplification product, result is correct.Using positive transgenic cell as somatic cell clone nuclear donor cell, the transgenic cell in following embodiment is positive transgenic cell.
Embodiment 2, Enhanced green fluorescent protein gene is utilized accurately to modify the breeding oxen somatocyte nurture body cell clone breeding oxen of Y chromosome sex controlled gene SRY
One, the maturation culture of ovocyte
The ovary of Adult Bovine is collected from slaughterhouse, be placed in the physiological saline of 30 DEG C, laboratory is delivered in 4h, after ovary is cleaned three times in the PBS liquid of 37 DEG C, take diameter as 0.7mm syringe needle to extract diameter be 2-8mm ovarian follicle, reclaim form evenly, the cumulus oocytes complesxes (COCs) of compact structure, with ripe liquid washing twice, then cumulus oocytes complesxes is put into 4 orifice plates containing ripe liquid, at 38.5 DEG C, 5%CO with 50-60 piece/hole
2in incubator after maturation culture 18-20h, obtain ripe cell, the cell of maturation being put into the pipe filled containing the Unidasa of volumn concentration 0.1% vibrates after 2-3min, blow and beat gently with Glass tubing again, cumulus cell and ovocyte are departed from completely, selection form is complete, and tenuigenin is even and ovocyte with first polar body is nuclear receptor cell.
Two, the acquisition of somatic cell clone breeding oxen
1, the ovocyte with first polar body is moved in operation liquid, under 200 power microscopes, above polar body, zona pellucida is cut an osculum with glass needle, be that the karyomit(e) in first polar body and the ovocyte below it is absorbed by the Glass tubing of 20 μm in the lump again with internal diameter, after the M199 solution put into again containing volumn concentration 20%FBS washes three times, obtain non-nucleus egg mother cell, be placed in incubator for subsequent use.
2, transgenic cell (nuclear donor cell) 0.25% trypsin trypsin prepared by the embodiment 1 of serum starvation 2-4d) digest 2-4min, move in the zona pellucida of non-nucleus egg mother cell prepared by step 1 with the transgenic cell that diameter is 10-12 μm by 20 μm of diameter glass pipes, then put it in Zimmerman liquid balance (matching while using) put into after 3-5 minute integration slot rotation ovum nuclear donor cell is contacted with non-nucleus egg mother cell and and E-field normal, be simultaneously in the DC pulse field of 2.5kV/cm in field intensity, be 10 μ s in the burst length, pulse number is 2 times, recurrent interval is after merging (fusion instrument is the ECM-2001 of BTX company) under the condition of 1s, obtain reconstructed embryo, it is moved into rapidly after cultivating a few hours in the M199 containing volumn concentration 10%FBS, select and merge embryo (specifically selecting the reconstructed embryo that donorcells and ovocyte merge completely) and carry out activations and process.Fusion embryo is put into 5mM A23187 liquid and changes to Embryo activation liquid (the M199 nutrient solution containing 5ug/ml cytochalasin B, 10ug/ml cycloheximide) after 5 minutes 5 hours, indusium to be fused changes in the CR1aa of the FBS containing volumn concentration 5%, at 38.5 DEG C, 5%CO after activating
2cultivate in nutrient solution in incubator and observe the blastocyst rate merging embryo afterwards in 7 days, result shows that cloned blastocysts developmental rate is 20%-60%.
3, embryo transfer and gestation detect
The cloned blastocysts of 7d excellent for form is moved in the horn of uterus of the recipient cattle of estrus synchronization.30d after the transfer carries out B ultrasonic to receptor cow and detects to determine the situation of being impregnated, and 60d after the transfer and 90d carries out rectum and detects to determine pregnancy rate respectively, and pregnancy rate is 40%.
4, to cow in calf routinely method for breeding raise, through 280 days, cow in calf normal labor, obtained somatic cell clone breeding oxen.
Three, the qualification of breeding oxen
Acquisition volume cell clone breeding oxen otic tissues sample, extracting its genomic dna, take genomic dna as template, with KOD2-F and KOD2-R for primer, carries out pcr amplification, obtains pcr amplification product, simultaneously with ddH
2o is template, carries out above-mentioned experiment, in contrast.
PCR response procedures: 94 DEG C of 5min; 94 DEG C of 30sec, 62 DEG C of 30sec, 72 DEG C of 120sec, 30 circulations; 72 DEG C of 7min.
If pcr amplification product is the fragment of 2kb, show gene knock-in success.
Result shows to have 6 individualities, and PCR amplifies the positive fragment of 2kb, as shown in Figure 4.Checked order by pcr amplification product further, result is correct.Confirmation step two successfully obtains somatic cell clone breeding oxen, and the Y chromosome sex controlled gene SRY of this somatic cell clone breeding oxen is enhanced green fluorescence protein gene and accurately modifies.
Embodiment 3, by green fluorescent label sorting embryo
One, sorting after internal fertilization
1, cow Y chromosome sex controlled gene SRY being enhanced somatic cell clone breeding oxen that green fluorescence protein gene accurately modifies and estrus synchronization carries out mating, after four to seven days, the embryo in cow body is reclaimed, observe under being placed in fluorescent microscope, have the embryo of green fluorescence by sending out and do not have the embryo of green fluorescence to choose respectively.
2, with the genomic dna of embryo for template, the PCR primer SRY-F special with sry gene and SRY-R is primer, carries out pcr amplification, obtains pcr amplification product, simultaneously with ddH
2o is template, carries out above-mentioned experiment, in contrast.
Primer sequence is as follows:
SRY-F:5’-AACGACGATGTTTACAGTCCA-3’；(SEQ ID No.15)
SRY-R:5’-GCCCGGGTATTTGTCTCGGT-3’。(SEQ ID No.16)
PCR response procedures: 94 DEG C of 5min; 94 DEG C of 30sec, 62 DEG C of 30sec, 72 DEG C of 120sec, 30 circulations; 72 DEG C of 7min.
If pcr amplification product is 340bp fragment, then embryo is male.
Result as shown in Figure 5.
In Fig. 5, label be 1,2,3,4,5 embryo be the embryo not having green fluorescence, the embryo of label to be 6,7,8,9,10 be fluoresced green.
Fig. 5 shows, label be 1,2,3,4,5 embryo there is no object band, be that sry gene is negative; Label be 6,7,8,9,10 embryo have object band, be that sry gene is positive.
Result proves, the embryo of all green fluorescences is male embryo, otherwise is then female embryo.
Two, rear sorting in vitro fertilization
Get the seminal fluid of somatic cell clone breeding oxen, join containing heparin (50ug/ml), caffeine (0.01nmol/ml), washing is diluted twice (with 1800 revs/min in the BO liquid of BSA (3.0mg/ml), centrifugal 8 minutes), add again after removing supernatant 1ml identical containing heparin (50ug/ml), caffeine (0.01nmol/ml), after the BO liquid of BSA (3.0mg/ml) mixes, get 50ul be added to 50ul containing 20-30 piece of bovine oocyte by seminal fluid (containing 10mg/ml BSA, the not BO liquid of fatty acids) in Dual culture after 5 hours, obtain zygote, be transferred in vitro culture liquid CR1aa and continued cultivation 5 to 7 days, treat that development of fertilized ova was observed with fluorescent microscope to mulberry fruit to blastula stage, embryo containing green fluorescence shows that this embryo contains Y chromosome, it is male embryo, otherwise be female embryo.
Claims (10)
1. an animal Y chromosome marking method utilizes TALEN method to carry out specific marker to the Y chromosome of in vitro animal somatic cell;
Described specific marker is the enterprising row labels of sex determining gene SRY at Y chromosome;
Described mark does not produce harm to the somatocyte of the animal at its place and sexual cell;
The gene of described mark is the encoding gene of the albumen of self luminescence or catalytic substrate colour developing.
2. method according to claim 1, it is characterized in that: the method that the described Y chromosome in vitro animal somatic cell carries out specific marker is: TALE albumen-I and TALE albumen-II are expressed in the in vitro somatocyte of buck A, obtains the somatocyte that target sequence on Y chromosome is undergone mutation; Simultaneously by marker gene homologous recombination to target sequence location, realize the site-directed integration at marker gene target sequence place on the in vitro somatocyte Y chromosome of buck A;
The aminoacid sequence of described TALE albumen-I is as shown in SEQ ID No.3;
The aminoacid sequence of described TALE albumen-II is as shown in SEQ ID No.5;
Described target sequence is as shown in SEQ ID No.1.
3. method according to claim 1 and 2, is characterized in that: described in TALE albumen-I and TALE albumen-II are expressed in the in vitro somatocyte of buck A method be: the recombinant expression plasmid respectively containing TALE albumen-I and TALE albumen-II encoding gene is imported in the in vitro somatocyte of described buck A;
The coding gene sequence of described TALE albumen-I is as shown in SEQ ID No.2;
The coding gene sequence of described TALE albumen-II is as shown in SEQ ID No.4;
Described by marker gene homologous recombination to the method for target sequence location for described marker gene is incorporated into described target sequence location by linearizing homologous recombination vector;
Described linearizing homologous recombination vector has the fragment of target sequence homology left arm-marker gene-target sequence homology right arm.
4., according to the arbitrary described method of claim 1-3, it is characterized in that: the sequence of described target sequence homology left arm as in SEQ ID No.12 from 5 ' end shown in the 664th to the 1498th Nucleotide;
The sequence of described target sequence homology right arm as in SEQ ID No.12 from 5 ' end shown in the 4068th to the 4991st Nucleotide.
5., according to the arbitrary described method of claim 1-4, it is characterized in that: described marker gene is green fluorescence protein gene;
Described green fluorescence protein gene specifically as in SEQ ID No.12 from 5 ' end shown in the 1573rd to the 2271st Nucleotide;
The sequence of the fragment of described target sequence homology left arm-marker gene-target sequence homology right arm as in SEQ ID No.12 from 5 ' end shown in the 664th to the 4991st Nucleotide.
6., according to the arbitrary described method of claim 1-5, it is characterized in that: the nucleotide sequence of described homologous recombination vector is as shown in SEQ ID No.12;
Described linearizing is restriction enzyme AhdI linearizing.
7. the qualification of Animal Sex or a system of selection, is utilize the arbitrary described method of claim 1-6 to mark the Y chromosome in the in vitro somatocyte of buck A, obtains being with markd transgenic cell; Take transgenic cell as nuclear donor cell, obtain somatic cell clone buck B by somatic cell clone technique; In the offspring embryo of somatic cell clone buck B, the markd embryo of tool is male embryo, and the markd embryo of tool is not female embryo.
8. a test kit, this test kit is containing, for example lower 1)-4) at least one material:
1) DNA molecular of the encoding gene containing albumen shown in SEQ ID No.3, recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium;
2) DNA molecular of the encoding gene containing albumen shown in SEQ ID No.5, recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium;
3) DNA molecular shown in SEQ ID No.12 or containing the transgenic cell line of this molecule or recombinant bacterium;
4) containing in SEQ ID No.12 from 5 ' end DNA molecular, recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium shown in the 664th to the 4991st Nucleotide;
The encoding gene of the albumen shown in described SEQ ID No.3 is specifically as shown in SEQ ID No.2;
The encoding gene of the albumen shown in described SEQ ID No.5 is specifically as shown in SEQ ID No.4.
DNA molecular shown in 9.SEQ ID No.12;
And/or,
Containing in SEQ ID No.12 from 5 ' end the DNA molecular shown in the 664th to the 4991st Nucleotide;
And/or,
DNA molecular shown in SEQ ID No.2;
And/or,
DNA molecular shown in SEQ ID No.4.
10. test kit according to claim 8 or the application of DNA molecular according to claim 9 in the product preparing the in vitro somatocyte Y chromosome of marking animals;
Or,
Test kit according to claim 8 or DNA molecular according to claim 9 are preparing the application in the product with markd buck on Y chromosome;
Or,
Test kit according to claim 8 or DNA molecular according to claim 9 are preparing the application in the product with markd buck cell on Y chromosome;
Or,
Test kit according to claim 8 or DNA molecular according to claim 9 are for the preparation of the application in the qualification of Animal Sex or the product of selection;
Or,
Test kit according to claim 8 or the application of DNA molecular according to claim 9 in animal breeds.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410646040.3A CN104388560B (en) | 2014-11-14 | 2014-11-14 | Method for marking Y chromosome and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410646040.3A CN104388560B (en) | 2014-11-14 | 2014-11-14 | Method for marking Y chromosome and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104388560A true CN104388560A (en) | 2015-03-04 |
| CN104388560B CN104388560B (en) | 2017-04-12 |
Family
ID=52606517
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410646040.3A Active CN104388560B (en) | 2014-11-14 | 2014-11-14 | Method for marking Y chromosome and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104388560B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861554A (en) * | 2016-05-10 | 2016-08-17 | 华南农业大学 | Animal sex control method based on Rbmy gene editing and application |
| CN114015705A (en) * | 2021-11-28 | 2022-02-08 | 华中科技大学同济医学院附属协和医院 | Sex selection method for mouse in-vitro fertilization breeding |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1745626A (en) * | 2004-09-06 | 2006-03-15 | 戴蕴平 | Modified cell line of male mammal, its production and use thereof |
| CN103865897A (en) * | 2014-04-15 | 2014-06-18 | 西南大学 | Site-directed mutagenesis system of mustard genome and application of site-directed mutagenesis system |
| CN103882061A (en) * | 2014-02-23 | 2014-06-25 | 浙江大学 | Transcription activator-like effector nuclease (TALEN) target gene editing and optimizing method taking IDLV as template |
| CN103930550A (en) * | 2011-02-25 | 2014-07-16 | 重组股份有限公司 | Genetically modified animals and methods for making the same |
| WO2014172470A2 (en) * | 2013-04-16 | 2014-10-23 | Whitehead Institute For Biomedical Research | Methods of mutating, modifying or modulating nucleic acid in a cell or nonhuman mammal |
-
2014
- 2014-11-14 CN CN201410646040.3A patent/CN104388560B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1745626A (en) * | 2004-09-06 | 2006-03-15 | 戴蕴平 | Modified cell line of male mammal, its production and use thereof |
| CN103930550A (en) * | 2011-02-25 | 2014-07-16 | 重组股份有限公司 | Genetically modified animals and methods for making the same |
| WO2014172470A2 (en) * | 2013-04-16 | 2014-10-23 | Whitehead Institute For Biomedical Research | Methods of mutating, modifying or modulating nucleic acid in a cell or nonhuman mammal |
| CN103882061A (en) * | 2014-02-23 | 2014-06-25 | 浙江大学 | Transcription activator-like effector nuclease (TALEN) target gene editing and optimizing method taking IDLV as template |
| CN103865897A (en) * | 2014-04-15 | 2014-06-18 | 西南大学 | Site-directed mutagenesis system of mustard genome and application of site-directed mutagenesis system |
Non-Patent Citations (1)
| Title |
|---|
| WANG H, ET AL: "TALEN-mediated editing of the mouse Y chromosome", 《NAT BIOTECHNOL.》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105861554A (en) * | 2016-05-10 | 2016-08-17 | 华南农业大学 | Animal sex control method based on Rbmy gene editing and application |
| CN105861554B (en) * | 2016-05-10 | 2020-01-31 | 华南农业大学 | method for realizing animal sex control based on editing Rbmy gene and application |
| CN114015705A (en) * | 2021-11-28 | 2022-02-08 | 华中科技大学同济医学院附属协和医院 | Sex selection method for mouse in-vitro fertilization breeding |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104388560B (en) | 2017-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Schellander et al. | Artificial insemination in cattle with DNA‐treated sperm | |
| Honaramooz et al. | Recent advances in application of male germ cell transplantation in farm animals | |
| Woolliams et al. | Embryo manipulation in cattle breeding and production | |
| Hagemann et al. | In vitro and early in vivo development of sheep gynogenones and putative androgenones | |
| CN110184301A (en) | Efficiently accurate targeted integration is realized by Tild-CRISPR | |
| US11419320B2 (en) | Cold-resistant and lean-type transgenic pig and preparation method therefor | |
| Plante et al. | Restriction fragment length polymorphism in the mitochondrial DNA of cloned cattle | |
| KR100807644B1 (en) | Piglet production method by simultaneous transfer of embryos formed by in vitro fertilization and nuclear transfer | |
| US8119785B2 (en) | Nucleic acid sequences and homologous recombination vectors for distruption of a Fel D I gene | |
| CN104388560B (en) | Method for marking Y chromosome and application thereof | |
| Womack | Genetic engineering in agriculture: animal genetics and development | |
| WO1995034636A1 (en) | Ungulate eg cell | |
| CN102747102A (en) | HSA (Human Serum Albumin) mammary gland specific expression vector and reconstitution cell constructed by HSA mammary gland specific expression vector | |
| JPWO2016163386A1 (en) | Method for producing non-human large mammals or fish producing gametes derived from different individuals | |
| CN104450673B (en) | A kind of Y chromosome method of modifying and its application | |
| US10626417B2 (en) | Method of genetically altering and producing allergy free cats | |
| CN1745626B (en) | Modified cell line of male mammal, its production and use thereof | |
| WO2015163711A1 (en) | Talen targeting myostatin gene and method for making animal with knockout myostatin gene using same | |
| Kogasaka et al. | Generation of germ cell-deficient pigs by NANOS3 knockout | |
| JP2023516767A (en) | animal production method | |
| Pisani et al. | Characterization of maternal antigen that embryos require (MATER/NLRP5) gene and protein in pig somatic tissues and germ cells | |
| Walker et al. | In vitro assessment of the viability of sheep zygotes after pronuclear microinjection | |
| KR20230130639A (en) | Transgenic animals with modified myostatin gene | |
| Zhang | Investigating the role of a lncRNA (4833427F10Rik) in mouse placental development and function | |
| Singh et al. | Biotechnology in livestock reproduction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information |
Inventor after: Dai Yunping Inventor after: Sun Zhaolin Inventor after: Wang Ming Inventor after: Ding Fangrong Inventor after: Wang Haiping Inventor after: Li Ling Inventor before: Dai Yunping Inventor before: Sun Zhaolin Inventor before: Ding Fangrong Inventor before: Wang Haiping Inventor before: Li Jing Inventor before: Li Ling |
|
| COR | Change of bibliographic data | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20201231 Address after: 101318 no.3fc-56, 3rd floor, 101, No.2 building, No.3 courtyard, Anping street, Houshayu Town, Shunyi District, Beijing Patentee after: Beijing Shunxin Xinyuan Cattle Breeding Research Institute Co.,Ltd. Address before: 100193 No. 2 Old Summer Palace West Road, Beijing, Haidian District Patentee before: CHINA AGRICULTURAL University |
|
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20211125 Address after: 101318 no.3fc-56, 3rd floor, 101, No.2 building, No.3 courtyard, Anping street, Houshayu Town, Shunyi District, Beijing Patentee after: Beijing Shunxin Xinyuan Cattle Breeding Research Institute Co.,Ltd. Patentee after: Inner Mongolia Shunxin Xinyuan animal husbandry Co., Ltd Address before: 101318 no.3fc-56, 3rd floor, 101, No.2 building, No.3 courtyard, Anping street, Houshayu Town, Shunyi District, Beijing Patentee before: Beijing Shunxin Xinyuan Cattle Breeding Research Institute Co.,Ltd. |
|
| TR01 | Transfer of patent right |