WO2002088381A2 - Method for determining gene expression - Google Patents

Abstract

The invention relates to a method for analyzing gene expression, i.e. for parallel analysis of the expression of a large number of genes. Said method is based on analysis of sequences on a large number of bound chains. Short sequence sections from each of these chains are determined, followed by evaluation and comparison with gene sequences in data banks, providing information about the genes thus expressed and the intensity of said expression.

Description

 Method of determining gene expression

Summary:

The invention describes a method for parallel analysis of the expression of a large number of genes. This method is based on the analysis of sequences on many bound nucleic acid chains. To do this, short sequence sections are determined from each of these chains. The subsequent evaluation and comparison with gene sequences in databases allows statements about the expressed genes and the strength of their expression.

1. Abbreviations and explanations of terms

DNA - deoxyribonucleic acid of different origins and different lengths: (genomic DNA, cDNA, ssDNA, dsDNA) RA - ribonucleic acid (mostly RNA)

Gene products - mRNA transcripts or nucleic acid chains derived from the mRNA (e.g. single-stranded cDNAs, double-stranded cDNAs, RNA derived from cDNA or DNA amplified from cDNA). cDNA - complementary DNA

Polymerases - enzymes that can incorporate complementary nucleotides into a growing DNA or RNA strand (e.g. DNA polymerases, reverse transcriptases, RNA polymerases)

dNTP - 2 'deoxy nucleoside triphosphates, substrates for DNA polymerases and reverse transcriptases

NTP - nucleoside triphosphates, substrates for RNA polymerases NT - natural nucleotide, usually dNTP, unless expressly stated otherwise.

Abbreviation "NT" is also used when specifying the length of a nucleic acid sequence, e.g. NT 1,000. In this case "NT" stands for nucleoside monophosphates.

The majority of abbreviations in the text are formed by using the suffix "s", for example, ^" NT" stands for "nucleotide", "NTs" stands for several nucleotides.

NT ^* - modified nucleotide, usually dNTP, if not explicitly marked otherwise. NTs ^* means: modified nucleotides

Flat surface: surface which preferably has the following features: 1) It allows several individual molecules, preferably more than 100, more preferably more than 1000, to be detected simultaneously with the given objective-surface distance at one objective position. 2) The immobilized or bound individual molecules are in the same focal plane, which can be set reproducibly.

Steric obstacle: Sterically demanding group, whose chemical structure changes the properties of the NTs ^* coupled with this group in such a way that they cannot be successively incorporated into one extension reaction by a polymerase.

Definition of termination: In this application, termination is the reversible stop in the installation of the modified, uncleaved NTs ^* . This term is to be separated from the usual use of the word "termination" by dideoxy-NTP in conventional sequencing.

The termination comes after the installation of a modified NT ^* . The modified built-in NT ^* carries a steric group which is reversibly coupled to the base and which prevents the incorporation of a next complementary NT ^* into the growing strand by a polymerase.

SNP - single nucleotide polymorphism

PBS - primer binding site

Wide-field optical detection system - detection system which can simultaneously detect fluorescence signals from individual molecules distributed over an area, the area being approximately 100 μm ² and larger. An example of wide-field detection optics is the Axiovert 200 or Axioplan 2e (Zeiss) fluorescence microscope with a Planeofluar objective 10Ox NA 1.4 oil immersion (Zeiss), or a planapochromatic objective lOOx NA 1.4 oil immersion (Zeiss); The fluorescence can be excited using a lamp, for example a mercury vapor lamp, or a laser or diode. Both epifluorescence mode and total reflection Fluorescence microscopy mode (total internal reflection fluorescence microscopy, TIRF microscopy) or laser scanning microscopy mode can be used. This wide field detection optics is used in this application.

2. State of the art:

Analysis of the gene expression spectrum has become an important tool in science. The comparison of the gene expression spectra between different cell lines, tissues or developmental stages allows conclusions to be drawn about the specific biological processes taking place in them. So you can e.g. expect the comparison between tumor cells and healthy cells of the same origin to provide information about the genes involved in the tumor process. It is important that the activity of as many or all genes as possible is analyzed at the same time.

The analysis of gene expression is a complex task: the number of genes active in a cell type can be several thousand. However, the analysis should consider all genes contained in the genome of the species in question (approximately 32,000 in humans). In addition, the genes active in the respective cell type are first of all mostly not yet completely known and secondly they are expressed to different extents.

Many methods for gene expression analysis have already been developed, e.g. Differential Display (Nature 1984, v.308 p.149, Science 1992 v.257 p.967), Expressed Sequence Tags (EST)

(Science 1991 v.252, p.1656, Nature Genetics 1992, v.2 p.173),

Northern blotting or RT-PCR (PNAS 1977, v.74, p.5350, Cell

1983 v.34 p.865, "The PCR Technique, RT-PCR" 1998, Ed. Paul

Suebert, Eaton Publishing). All of these methods can only analyze a very limited number of genes per reaction and are sometimes very labor-intensive. The most widespread method for parallel analysis of the gene expression patterns is the hybridization of a mixture of cDNA molecules to be analyzed with oligonucleotides bound to a surface, which are fixed in a certain arrangement, usually as a "microarray"("Microarray Biochip Technology" 2000, Ed M.Schena, Eaton Publishing, Zhao et al. Gene 1995, v. 156, p.207, Schena et al. Science 1995 v.270, p.467, Lockhart et al. US Patent 6,040,138, Wang US Patent 6,004,755, Arlinghaus et al. US Patent 5,821,060, Southern US Patent 5,700,637, Fodor et al. US Patent 5,871,928).

The major disadvantages of the hybridization method include: The production of the oligonucleotides bound to the surface is expensive. The analysis is limited to genes whose sequences are already known. Multiple mismatch controls increase the number of oligonucleotides that need to be immobilized.

The present invention describes a method for the parallel analysis of a large number of nucleic acid chain molecules. It is based on the detection of fluorescence signals from individual molecules. By simultaneous sequencing of individual gene product molecules, the method has several advantages over the prior art:

1) The gene products can bind to the surface in any arrangement. A previous complex synthesis of different oligonucleotides at certain positions (such as in the hybridization method) is therefore not necessary.

2) The material can be analyzed on a standardized surface.

3) The expression of still unknown genes can also be determined because all gene products contained in the mixture are analyzed become. This is not possible with conventional DNA arrays.

4) The large number of molecules analyzed also allows the detection of poorly expressed genes.

5) Smallest amounts of starting material can be used: mRNA from a single cell can be sufficient for the analysis.

6) All steps of the process can be largely automated.

3. Short description:

The invention describes a method for parallel analysis of gene expression, in which

provides single-stranded gene products, one

the gene products are bound to a reaction surface in a random arrangement using one or more different primers in the form of gene product-primer complexes;

perform a cyclic assembly reaction of the complementary strand of the gene products using one or more polymerases by

a) a solution is added to the gene product-primer complexes bound on the surface which contains one or more polymerases and one to four modified nucleotides (NTs ^* ) which are labeled with fluorescent dyes, the simultaneous use of at least two NTs ^* fluorescent dyes on the NTs ^* are selected so that the NTs ^* used differ from one another by measuring different fluorescence signals. differentiate, the NTs ^{* are} structurally modified on the base so that the polymerase after installing such an NT ^* in a growing complementary strand is unable to incorporate another NT ^* in the same strand, whereby the fluorescent dye is cleavable and the structural modification is a cleavable, sterically demanding ligand, one

b) the stationary phase obtained in stage a) is incubated under conditions which are suitable for the extension of the complementary strands, the complementary strands being extended in each case by one NT ^* , man

c) the stationary phase obtained in stage b) is washed under conditions which are not suitable for the removal of NTs * which are not incorporated into a complementary strand

d) the individual NTs * built into complementary strands are detected by measuring the signal characteristic of the respective fluorescent dye, at the same time determining the relative position of the individual fluorescent signals on the reaction surface

e) for the generation of unlabelled (NTs or) gene products the fluorescent dyes and the sterically demanding

Cleaves ligands from the NTs * attached to the complementary strand, man

f) the stationary phase obtained in step e) is washed under conditions which are suitable for removing the fluorescent dyes and the ligands

stages a) to f) are repeated several times, if necessary,

whereby the relative position of individual gene product-primer complexes on the reaction surface and the sequence of these gene products by specific assignment of the in step d) in successive cycles at the respective positions of the detected fluorescence signals to the NTs are determined and the identity of the gene products is determined from the partial sequences determined.

The gene products are the primary gene products of the genes whose expression is to be analyzed. Essentially, these are RNA transcripts of the genes mentioned, which are also referred to as target sequences (or target nucleic acid sequences). In addition to mRNA, these target sequences also include single-stranded and double-stranded cDNA derived therefrom, RNA derived from cDNA or DNA amplified from cDNA.

The gene products or target sequences can either be isolated as mRNAs directly from a biological sample (e.g. cell extract, tissue extract or extract from whole organisms) or obtained as cDNAs by reverse transcription of the mRNAs.

In this context, a highly parallel analysis is understood to mean the simultaneous sequence analysis of many gene product molecules (for example at least approximately 100,000, preferably at least approximately 500,000, but in particular at least approximately 1,000,000 to approximately 10,000,000), these gene product molecules being a complex heterogeneous Represent population, for example corresponds to a complete expression profile or an expression spectrum of a tissue.

According to a particular embodiment of the invention, the process can be carried out by repeating steps a) to f) of the cyclic build-up reaction several times, with

a) only one marked NT ^* in each cycle, b) two differently marked NTs ^* in each cycle or c) four differently marked NTs ^* in each cycle starts.

The method can also be carried out by repeating steps a) to f) of the cyclic build-up reaction several times, alternately using two differently labeled NTs ^* and two unlabeled NTs in the cycles and comparing the identity of the gene products with the reference sequences determined.

The present invention furthermore relates to the nucleotides shown in FIGS. 6e, 6f and 6g and the corresponding labeled nucleotides, which have, for example, fluorescent dyes attached to the terminal amino function, or the labeled nucleotides shown in FIGS. 6h, 6i or 6j.

The present invention furthermore relates to the use of the nucleotides shown in FIGS. 6e, 6f and 6g and the corresponding nucleotides marked with a fluorescent dye for the method according to the invention.

The present invention furthermore relates to the use of the NT * s modified on the base (for examples see FIGS. 6k, 6L and 6m) and the corresponding nucleotides marked with a fluorescent dye for the process according to the invention.

The method is based on several principles:

1. Short nucleotide sequences (10-50 NTs) contain enough information to identify the corresponding gene if the gene sequence itself is already contained in a database. A sequence of, for example, 10 NTs can form more than 10 ⁶ different combinations. This is, for example, for most genes in the human genome, which is currently estimated at 32,000 Contains genes, sufficient. The sequence can be even shorter for organisms with fewer genes.

2. The method is based on a new method for sequencing individual nucleic acid chain molecules.

3. Mixtures of nucleic acid chains can be examined.

4. The sequencing reaction takes place simultaneously on many molecules, the sequence of each individual being bound

Nucleic acid chain is analyzed.

It is known that mRNAs or nucleic acid chains derived from the mRNA (e.g. single-stranded cDNAs, double-stranded cDNAs, cDNA-derived RNA or cDNA-amplified DNA) can be used to investigate gene expression. Regardless of the exact composition, they are referred to below as gene products. Partial sequences of these gene products are also referred to below as gene products.

These gene products are a mixture of different nucleic acid chains.

The synthesis is based on the synthesis of a strand that is complementary to the gene product.

The aim of the preparation is to provide gene product-primer complexes which are bound in a random manner on a flat surface and on which the incorporation of NT * s by the polymerase can take place (gene product-primer complexes which can be extended).

The sequencing reaction is carried out with these bound gene product-primer complexes.

It runs in several cycles. Only one marked NT ^* per cycle is installed in the growing strand. A cycle comprises the following steps: a) adding a solution with labeled nucleotides (NTs ^* ) and polymerase to bound gene product-primer complexes, b) incubation of the bound gene product-primer complexes with this solution under conditions which are suitable for extending the complementary strands by one NT, c) washing, d) detection of the signals from individually modified NTs incorporated into the newly synthesized strands ^* - Molecules, e) removal of the label from the built-in nucleotides, f) washing.

This cycle can be repeated several times, so that preferably 10 to 50 NTs are determined for each gene product-primer complex participating in the sequencing reaction. The nucleic acid sequences are then reconstructed from the detected signals. The determined sequences of the bound gene products are compared with one another to determine the abundances and are assigned to specific genes by comparison with gene sequences in databases.

These general principles of the reaction are explained using an example (Fig.l):

A mixture of mRNA molecules (gene products) serves as the starting material. The material to be analyzed (1) is bound (2) on a suitable flat surface. The oligo-dT primers previously bound to the surface mediate the binding of gene products to the surface. The gene products are bound to the primers by hybridization (annealing). The unbound mRNA molecules are removed by a washing step. The sequencing reaction is then carried out on the entire reaction surface, with labeled NT * s being incorporated into the gene product-primer complexes which can be extended. This reaction is cyclical. In the 1st step of the cycle, a labeled NT ^{* is built} into the growing strand: The reaction is controlled so that only one labeled NT ^* from a polymerase in each cycle

(Reverse transcriptase) can be built into the growing strand. This is achieved by using NTs ^* which carry a reversibly coupled group leading to termination. This prevents the installation of another marked NT ^* . The polymerase and the labeled NTs ^* are used simultaneously in the reaction (3). The reaction mixture is then removed and the surface is washed in a suitable manner (4). A detection step (5) now follows. The surface is scanned with a device suitable for single-molecule detection (consisting, for example, of a light source, microscope, camera, scanning table, computer with control and image recognition or image processing software) and the signals of the individual, built-in marked NTs ^{* are} identified. After the detection step, the marker and the group leading to the termination are removed from all installed NTs ^* (6). The removal can take place chemically, physically or enzymatically. After a subsequent washing step, a new cycle can begin.

4. Detailed description

4.1 Selection of the material:

Gene products can come from various biological objects, e.g. of individual cells, cell populations, a tissue or of entire organisms. Biological fluids such as blood, sputum or cerebrospinal fluid can also serve as a source of the gene products. The methods for obtaining the gene products from the various biological objects can be found, for example, in the following literature sources: "Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v303, "cDNA library protocols" 1997, Ed. I. G. Cowell, Humana Press Inc.

Both the entirety of the isolated gene products and a part of them selected by preselection can be included in the

Sequencing reaction can be used. The amount of gene products to be analyzed can be determined by preselection to reduce. The preselection can be carried out, for example, by molecular biological methods such as, for example, PCR amplification, gel separation or hybridization with other nucleic acid chains ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v303, "cDNA library protocols "1997, Ed. IG Cowell, Humana Press Inc.) The entirety of the gene products is preferably chosen as the starting material.

4.2 Preparation of the material:

The aim of the preparation of the material is to form extensible gene product-primer complexes bound to the surface from the starting material. These then preferably have the structure shown in FIG. 2. Whereby only a maximum of one primer should bind per gene product.

4.2.1 Primer binding site (PBS):

Each gene product preferably has only one primer binding site. A primer binding site is a sequence section which is intended to enable selective binding of the primer to the gene product.

Sections in the nucleic acid sequence that naturally occur in the sequences to be analyzed can serve as primer binding sites (e.g. polyA stretches in mRNA). A primer binding site can also be introduced into the gene product (Molecular cloning "1989, Ed. Maniatis, Cold Spring Harbor Laboratory," Method in Enzymology "1999, v303," cDNA library protocols "1997, Ed. IG Cowell, Humana Press Inc. ).

In order to simplify the analysis, it may be important to have a primer binding site that is as uniform as possible in all gene products. Then primers with a uniform structure can be used in the reaction. The composition of the primer binding site is not limits. Their length is preferably between 10 and 100 NTs. The primer binding site can carry a functional group, for example to bind the gene product to the surface. This functional group can be, for example, a biotin or digoxigenin group.

The nucleotide tailing of antisense cDNA fragments is described as an example of the introduction of a primer binding site into the gene products.

First, single-stranded cDNAs are synthesized from mRNAs. The result is a population of cDNA molecules that represent a copy of the mRNA population, so-called antisense cDNA. (Molecular cloning "1989, Ed. Maniatis, Cold Spring Harbor Laboratory," Method in Enzymology "1999, v303," cDNA library protocols "1997, Ed. IG Cowell, Humana Press Inc.). With a terminal deoxynucleotide transferase, one can do several ( for example between 10 and 20) attach nucleoside monophosphates to the 3 'end of this antisense cDNA, for example several adenosine monophosphates (called ((dA) n-tail). The resulting fragment is used to bind the primer, in this example one (dT ) n-primers used ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press, "Method in Enzymology" 1999 v.303, pp. 37-38) (Fig. 3).

4.2.2 Primers for the sequencing reaction

This has the function of making it possible to start at a single point in the gene product. It preferably binds to the primer binding site in the gene product. The composition and the length of the primer are not restricted. In addition to the start function, the primer can also perform other functions, such as creating a connection between the gene product-primer complexes and the reaction surface. Primers should be adapted to the length and composition of the primer binding site so that the primer enables the sequencing reaction to be started with the respective polymerase. The length of the primer is preferably between 6 and 100 NTs, optimally between 15 and 30 NTs. The primer can carry a functional group which is used, for example, to bind the primer to the surface, for example such a functional group is a biotin group (see section Immobilization). It should not interfere with sequencing. The synthesis of such a primer can be carried out, for example, using the 380 A Applied Biosystems DNA synthesizer, or else as a custom synthesis from a commercial supplier, 10 for example MWG-Biotech GmbH, Germany.

Different primers can also be used, a defined primer set, or a primer mixture.

15 Before priming, the primer can be fixed to the fragments to be analyzed on the surface using various techniques or synthesized directly on the surface, for example according to (McGall et al. US Patent 5412087, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734,

20 "Microarray biochip technology" 2000 M. Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Fodor et al. Science 1991 v.285 p.767, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 p.3142, Ghosh et al. NAR 1987 v.15 p.5353, Gingeras et al. NAR 1987 v.15 p.5373, Maskos et al. NAR

25 1992 V.20 p.1679).

The primers are bound on the surface in a density between 10 to 100 per 100 μm ² , 100 to 10,000 per 100 μm, 10,000 to 1,000,000 per 100 μm ² or greater than 1,000,000 per 100 μm ² 30.

The primer or mixture of primers is incubated with gene products under hybridization conditions that selectively bind it to the primer binding site of each gene product. This primer hybridization (annealing) can take place before (1), during (2) or after (3) the binding of the gene products to the surface. If gene products as double-stranded nucleic acids are present, they are denatured by heat before hybridization ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press). The optimization of the hybridization conditions depends on the exact structure of the primer binding site and the primer and can be done according to Rychlik et al. (NAR 1990 v.18 p.6409). In the following, these hybridization conditions are referred to as standardized hybridization conditions.

If the starting material has a poly-A stretch or a poly-dA stretch (for example mRNA, sense cDNA or antisense cDNA with (dA) _n -Tail), an oligo-dT primer can be used. However, a primer mixture consisting of 12 different primers with the following general structure 5 '(K) _n MN3' can also be used. Where (n) is between 10 and 50, preferably between 20 and 30. "K" stands for dT or you, "M" and "N" each stand for dA, dT or du, dC, dG

(eg .5 -dTdTdTdTdTdTdTdTdTdT ₁₀ dTdTdTdTdTdTdTdTdTdT ₂₀ dAdG-3 "). Such a primer mixture enables an exact start of the sequencing reaction at the end of the polyA segment or the poly-dA segment (anchored primer).

4.2.3 Fixation of gene product-primer complexes to the surface (binding or immobilization of gene products).

The aim of the fixation (binding, immobilization) is to fix gene product-primer complexes on a suitable flat surface in such a way that a cyclic enzymatic sequencing reaction can take place. This can be done, for example, by binding the primer (see above) or the gene product to the surface.

The order of the steps in the binding of gene product-primer complexes can be variable: 1) The gene product-primer complexes can first be formed in a solution by hybridization (annealing) and then bound to the surface. 2) Primers can first be bound to a surface and gene products can then be hybridized to the bound primers, producing gene product-primer complexes (gene products indirectly bound to the surface) 3) The gene products can first be bound to the surface (gene products directly the surface bound) and in the subsequent step the primers are hybridized to the bound gene products, producing gene product-primer complexes. The gene products can therefore be immobilized on the surface by direct or indirect binding.

In this application, the surface and the reaction surface are to be understood as equivalent terms, unless explicitly referred to another meaning. The surface of a solid phase of any material serves as the reaction surface. This material is preferably inert towards enzymatic reactions and does not cause any interference with the detection. Silicon, glass, ceramics, plastics (e.g. polycarbonates or polystyrenes), metal (gold, silver, or aluminum) or any other material that meets these functional requirements can be used. The surface is preferably not deformable, since otherwise the signals are likely to be distorted upon repeated detection.

If a gel-like solid phase (surface of a gel) is used, this gel can e.g. be an agarose or polyacrylamide gel. The gel is preferably freely passable for molecules with a molecular mass below 5000 Da

(for example, 1 to 2% agarose gel or 5 to 15%

Polyacrylamide gel can be used). Such a gel surface has the advantage over other solid surfaces that there is a significantly lower non-specific binding of NT * s to the surface. By binding the gene product-primer complexes on the surface, the detection of the fluorescence signals from built-in NTs ^{* is} possible. The signals from Free NTs ^* are not detected because they do not bind to the material of the gel and are therefore not immobilized. The gel is preferably attached to a solid surface (Fig. 4). This solid base can be silicone, glass, ceramic, plastic (for example polycarbonate or polystyrene), metal (gold, silver or aluminum) or any other material.

The thickness of the gel is preferably not more than 0.1 mm. However, the gel thickness is preferably greater than the simple depth of field of the lens, so that NTs ^* bound non-specifically to the solid base do not reach the focal plane and are therefore detected. If the depth of focus is 0.3 μm, for example, the gel thickness is preferably between 1 μm and 100 μm. The surface can be produced as a continuous surface or as a discontinuous surface composed of individual small components (for example agarose balls) (FIG. 4 a, b). The reaction surface must be large enough to be able to bind the necessary number of gene products with the appropriate density. The reaction surface should preferably not be larger than 20 cm ² .

The different cycle steps require an exchange of the different reaction solutions above the surface. The reaction surface is preferably part of a reaction vessel. The reaction vessel is in turn preferably part of a reaction apparatus with a flow device. The flow device enables the solutions in the reaction vessel to be exchanged. The exchange can take place with a pump device controlled by a computer or manually. It is important that the surface does not dry out. The volume of the reaction vessel is preferably less than 50 μl. Ideally, its volume is less than 1 μl. An example of such a flow system is given in FIG. 5.

If the gene product-primer complexes are fixed on the surface via the gene products, this can be done, for example, by binding the gene products to one of the both chain ends. This can be achieved by appropriate covalent, affine or other bonds. Many examples of immobilization of nucleic acids are known (McGall et al. US Patent 5412087, Nikiforov et al. US 5 Patent 5610287, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology" 2000 M Schena Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Rasmussen et al. Analytical Biochemistry v.198, p.138, Allemand et al. Biophysical Journal

10 1997, v.73, p.2064, Trabesinger et al. Analytical Chemistry 1999, v.71, p.279, Osborne et al. Analytical Chemistry 2000, v.72, p.3678, Timofeev et al. Nucleic Acid Research (NAR) 1996, v.24 p.3142, Ghosh et al. NAR 1987 v.15 p.5353, Gingeras et al. NAR 1987 v.15 p.5373, Maskos et al. NAR 1992 v.20 p.1679). The

15 Fixation can also be achieved by non-specific binding, for example by drying out the sample containing gene products on the flat surface. The gene products are on the surface in a density between 10 and 100 per 100 μm ² , 100 to 10,000 per 100 μm ² , 10,000 to 1000,000 per 100 μm ²

20 bound.

The density of extensible gene product-primer complexes required for the detection is approx. 10 to 100 per 100 μm ² . It can be achieved before, during or after the hybridization of primer 5 to the gene products.

Some binding methods are described in more detail below:

In one embodiment, the binding of the gene product 0 primer complexes takes place via biotin-avidin or biotin-streptavidin binding. Avidin or streptavidin is covalently bound on the surface, the 5 'end of the primer is modified with biotin. After the modified primers have hybridized with the gene products (in solution), they are fixed on the surface coated with avidin / streptavidin. The concentration of the gene product-primer complexes labeled with biotin and the time of incubation of this solution with the surface is chosen so that a density suitable for sequencing is achieved.

In another embodiment, the primers suitable for the sequencing reaction are fixed on the surface using suitable methods before the sequencing reaction (see above). The single-stranded gene products, each with one primer binding site per gene product molecule, are thus incubated under hybridization conditions (annealing). They bind to the fixed primers and are thus bound to the surface (indirect binding). The concentration of the single-stranded gene products and the hybridization parameters (eg temperature, time, buffer) are chosen so that a density of approximately 10 to 100 gene product-primer complexes capable of extension per 100 μm ^{2 is} achieved, which is suitable for sequencing. After hybridization, unbound gene products are removed by a washing step. In this embodiment, a surface with a high primer density is preferred, for example approximately 1,000,000 primers per 100 μm ² or even higher, since the desired density of gene product-primer complexes is reached more quickly, the gene products binding only to a part of the primers ,

In another embodiment, the gene products are bound directly to the surface (see above) and then incubated with primers under hybridization conditions. At a density of approx. 10 to 100 gene products per 100 μm ² , attempts will be made to provide all available gene products with a primer and to make them available for the sequencing reaction. This can be achieved by high primer concentration, for example 1 to 100 mmol / 1. At a higher density the fixed

Gene products on the surface, for example 10,000 to

1,000,000 per 100 μm ² , the density of the gene product-primer complexes required for optical detection can be achieved during the primer hybridization. Here are the

Hybridization conditions (e.g. temperature, time, buffer,

Primer concentrate) so that the primers are only Bind part of the immobilized gene products, see Example 5. If the surface of a solid phase (eg silicone or glass) is used for immobilization, a blocking solution is preferably applied to the surface before step (a) in each cycle, in order to avoid non-specific adsorption of NTs ^* on the surface serves. An albumin solution (BSA) with a pH between 8 and 10, for example, fulfills these conditions for a blocking solution.

4.3 Choice of polymerase

The type of immobilized nucleic acid (RNA or DNA) used plays a decisive role in the choice of polymerase:

If RNA is used as a gene product (e.g. mRNA) in the sequencing reaction, commercially available RNA-dependent DNA polymerases can be used, e.g. AMV reverse transcriptase (Sig a), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNAse activity. All reverse transcriptases must be largely free of RNAse activity ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory).

If DNA is used as a gene product (eg cDNA), in principle all DNA-dependent DNA polymerases without 3 '-5' exonuclease activity (DNA replication "1992 Ed. A. Kornberg, Freeman and Company NY) are suitable as polymerases, eg modified T7 polymerase of the type "Sequenase Version 2" (Amersham Pharmacia Biotech), Klenow fragment of DNA polymerase I without 3 '-5' exonuclease activity (Amersham Pharmacia Biotech), polymerase beta of various origins (Animal Cell DNA Polymerases "1983, Fry M., CRC Press Inc., commercially available from Chimerx) thermostable polymerases such as Taq polymerase (GibcoBRL), proHA DNA polymerase (Eurogentec). 4.4 Nucleotide structure

4.4.1 General principle

For highly parallel gene expression analysis with individual molecules (parallel sequence analysis of up to 10,000,000 gene product molecules), it is important that each NT ^* that is incorporated is identified during the sequencing reaction. A prerequisite for this is that only one NT ^{* is integrated} into the nucleic acid chain per cycle. If a polymerase incorporates several NTs ^{* in} succession in the same cycle, this leads to an error in the sequence determination. For this reason you have to control the installation of the NTs ^* .

For example, reversible 3'-OH modified NTs have been described in the BASS method (Dower US Patent 5,547,839, Canard et al. US Patent 5,798,210, Rasolonjatovo Nucleosides & Nucleotides 1999, v.18 p.1021, Metzker et al. NAR 1994, v.22, p.4259, Welch et al. Nucleosides & Nucleotides 1999, v.18, p.197). The cleavage is said to be photochemical under mild conditions (Dower US Patent 5,547,839, Welch et al.

Nucleosides & Nucleotides 1999, v.18, p.197) or chemically

(Canard et al. U.S. Patent 5,798,210, Rasolonjatovo Nucleosides &

Nucleotides 1999, v.18 p.1021). With this method, a large number of identical single-stranded DNA pieces are fixed at a defined location on a surface and the signal from all of these many identical DNA pieces is analyzed. A solution with polymerase and nucleotides is added to this fixed DNA so that a complementary strand can be synthesized. The polymerase should work step by step: only one nucleotide is incorporated in each step. This is detected, whereupon the polymerase incorporates the next nucleotide in a next cycle. In this method, modified nukeotides were used on the 3 ^{^} -OH group of the deoxyribose.

Despite the success of some of the steps in this method it was not developed into a functional process. This can be based, for example, on the following facts: When the complementary strands are built up, the synthesis is desynchronized very quickly, so that the errors accumulate with each step. Therefore only very short fragments can be sequenced. It should be emphasized that all BASS methods described are not based on the detection of individual molecules. Instead, the signal is registered by a large number of identical molecules immobilized at a defined location. The customary use of the terms “individual molecules” and “molecules” in these methods does not aim at individual, separate molecules, but at a population consisting of many identical molecules. In this case, identical means that the molecules have the same sequence.

Another problem is the modified nucleotides at the 3 "position.

The synthesis of the 3 'OH-modified photochemically cleavable NTs ^* is very complex. The polymerases have a very different affinity for these nucleotide analogs, so that nucleic acid synthesis is very uneven or does not take place at many DNA sites (Metzker et al. NAR 1994 v.22 p.4259, Welch et al. Nucleosides & Nucleotides 1999, v.18 p.197). For this reason, these analogs are not suitable for the sequencing reaction or only to a very limited extent. A cleavable 3 'ester linkage (Canard et al. US Patent 5,798,210) is also not considered as the basis for a reversible termination of the synthesis. Most polymerases cleave when a next complementary NT 3 'OH ester compound is available, so that the label bound to the 3' OH group is released into the solution and can no longer act as a terminator (Rasolonjatovo et al. Nucleosides & Nucleotides 1999, v.18 p.1021, Canard et al. PNAS 1995 v.92 p.10859). In positions where a polymerase can insert several identical NTs ^* one after the other, this leads to an incorrect signal. In the final report of the BMBF joint project "Sequencing with Multiplex Dyes and Capillary electrophoresis "G. Sagner, 1999, reported that modifications to the 3 'position of nucleotides led to the abolition of their substrate properties for polymerases.

5 The difficulties in developing suitable NT analogues for the process are based on the following general conditions: l) The reaction must be controlled in such a way that the polymerase incorporates NT * s individually (stop further installation). 2) NT * s must wear a dye that meets the requirements of detection. 3) The dye must be cleavable under mild conditions, so that neither the gene product-primer complexes nor individual

Components of the system are damaged. 4) The spin-off must take place as quickly and quantitatively. 5.) 5The stop of the installation must be reversible and under mild

Conditions can be lifted.

So far, no practical solution to these problems has been presented in the relevant literature.

20

The problems known in the prior art are now solved for the first time by the present invention. According to the invention, NTs ^* with a sterically demanding group on the base are used for sequencing.

25

A sterically demanding group coupled to the base can lead to the hindrance of further synthesis, this hindrance in the specialist literature as an undesirable property of modified NTs in the labeling of nucleic acids

30 was viewed. Biotin, digoxigenin and fluorescent dyes such as fluorescein, tetramethylrhodamine and Cy3 dye

Examples of such a sterically demanding group

(Zhu et al. Cytometry 1997, v.28, p.206, Zhu et al. NAR 1994, v.22, p.3418, Gebeyehu et al., NAR 1987, v.15, p.4513, Wiemann

35 et al. Analytical Biochemistry 1996, v.234, p.166, Heer et al. BioTechniques 1994 v.16 p.54). In the sequencing reaction in the method according to the invention, labeled NTs ^{* are} incubated with a polymerase and nucleic acid chains. The NTs ^* carry a sterically demanding group that is reversibly coupled to the base. If a reaction mixture containing only modified NTs ^{* is used} in the reaction, the polymerase can only incorporate a single NT ^* . The installation of a next NT ^* is sterically inhibited. These NTs ^* thus act as terminators of the synthesis. After removing the sterically demanding group, the next complementary NT ^{* can be} installed. Because these NTs ^* do not represent an absolute obstacle to further synthesis, but only for the installation of another marked NT ^* , they are called semiterminators.

4.4.2 General structure of the NT ^*

Their common features are shown in Fig. 6a, b, d. This structure is characterized in that a steric group (D) and the fluorescent marker (F) are bound to the base via a cleavable linker (A-E).

Deoxynucleoside triphosphates with adenosine (A), guanosine (G), cytidine (C) and uridine (U) serve as the basis for the NTs ^* . Inosine can be used instead of guanosine.

4.4.3 Markers, fluorophores

Each base is marked with a marker (F) which is characteristic of it (FIG. 6). The marker is a fluorescent dye. Several factors influence the choice of the fluorescent dye. The choice is not restricted if the dye meets the following requirements:

a) The detection apparatus used must be able to identify this marker as the only molecule bound to DNA under mild conditions (preferably reaction conditions). The dyes preferably have great photostability. Their fluorescence is preferably not quenched by the DNA or only to a minor extent.

b) The dye bound to the NT must not cause an irreversible disturbance of the enzymatic reaction.

c) NTs ^* marked with the dye must be incorporated into the nucleic acid chain by the polymerase.

d) When labeled with different dyes, these dyes should not have any significant overlaps in their emission spectra.

Fluorescent dyes which can be used in the context of the present invention are compiled with structural formulas in "Handbook of Fluorescent Probes and Research Chemicals" 6th ed. 1996, R.Haugland, Molecular Probes. According to the invention, the following dye classes are preferably used as markers: cyanine dyes and their derivatives (for example Cy2, Cy3, Cy5, Cy7 Amersham Pharmacia Biotech, Waggoner US Pat. No. 5,268,486), rhodamines and their derivatives (for example TAMRA, TRITC, RG6, R110 , ROX, Molecular Probes), xanthene derivatives (e.g. Alexa 568, Alexa 594, Molecular Probes, Mao et al. US Pat. No. 6,130,101). These dyes are commercially available. Depending on the spectral properties and the equipment available, appropriate dyes can be selected. The dyes are coupled to the linker, for example via a thiocyanate or ester bond ("Handbook of Fluorescent Probes and Research Chemicals" 6th ed. 1996, R.Haugland, Molecular Probes, Jameson et al. Methods in Enzymology 1997 v.278 P.363, Waggoner Methods in Enzymology 1995 v.246 p.362), p. Examples 1 and 2.

4.4.4 Nature of the sterically demanding group

Group (D) (FIGS. 6a, b, d) represents an obstacle to the incorporation of a further complementary labeled NT ^* by a polymerase.

Biotin, digoxigenin and fluorescent dyes such as fluorescein, tetramethylrhodamine and Cy3 dye are examples of such a sterically demanding group (Zhu et al. Cytometry 1997, v.28, p.206, Zhu et al. NAR 1994, v.22, P.3418, Gebeyehu et al., NAR 1987, v.15, p.4513, Wiemann et al. Analytical Biochemistry 1996, v.234, p.166, Heer et al. BioTechniques 1994 v.16 p.54). The chemical structure of this group is not restricted provided that it does not significantly interfere with the incorporation of the labeled NT ^* to which it is attached and does not cause an irreversible disturbance in the enzymatic reaction.

This . Group can appear as an independent part in the linker (6a) or can be identical to the dye (6b) or the cleavable group (6d). By cleaving the linker, this sterically demanding group (D) is removed after detection of the signal, so that the polymerase can incorporate another labeled NT ^* . With a structure as in 6d, the steric group is removed by the cleavage.

In a preferred embodiment, the fluorescent dye takes over the function of such a sterically demanding group, so that a labeled nucleotide is one in FIG. 6b, k, l structure shown.

In another preferred embodiment, the photolabile cleavable group takes over the function of such a sterically demanding group (FIG. 6d).

4.4.5 Left

The marker (fluorescent dye) is preferably attached to the base via a spacer of different lengths, a so-called linker. Examples of linkers are given in Fig. 6e, f, g, h, i, j, k, l, m. Examples of coupling a linker to the base can be found in the following sources (Hobbs et al. US Patent 5,047,519, Khan et al. US Patent 5,821,356, Klevan et al. US Patent 4,828,979, Hanna M. Method in Enzymology 1996 v.274, p.403, Zhu et al. NAR 1994 v.22 p.3418, Herman et al. Methods in Enzymology 1990 v.184 p.584, JLRuth et al. Molecular Pharmacology 1981 v.20 p .415, L. Ötvös et al. NAR 1987 v.15 p.1763, GEWright et al. Pharmac Ther. 1990 v.47, p.447, "Nucleotide Analogs; Synthesis and Biological Function" KH Scheit 1980, Wiley- Interscience Publication, "Nucleic acid chemistry" Ed. LBTownsend, v.1-4, Wiley-Interscience Publication, "Chemistry of Nucleosides and Nucleotides" Ed. LBTownsend, v.1-3, Plenum Press).

The total length of the linker can vary. It corresponds to the number of carbon atoms in sections A, C, E (FIGS. 6a, b, d) and is preferably between 3 and 20. Optimally, it is between 4 and 10 atoms. The chemical composition of the linker (sections A, C, E in FIGS. 6a, b, d) is not restricted, provided that it remains stable under reaction conditions and does not cause any disturbance in the enzymatic reaction.

4.4.6 Fissile connection, splitting

The linker carries a fissile connection or fissile Group (section (B) in Fig. 6a, b, d and section (C) in Fig. 6k, 1). This fissile connection enables the marker and steric obstacle to be removed at the end of each cycle. Your choice is not restricted as long as it remains stable under the conditions of the enzymatic sequencing reaction, does not cause an irreversible disturbance of the polymerase and can be split off under mild conditions. “Mild conditions” are understood to mean those conditions which do not destroy the gene product-primer complex, the pH value, for example, preferably being between 3 and 11 and the temperature between 0 ° C. and a temperature value (x). This temperature value (x) depends on the Tm of the gene product-primer complex (Tm is "melting point") and is calculated, for example, as Tm (gene product-primer complex) minus 5 ° C (eg Tm is 47 ° C, then lies the maximum temperature at 42 ° C; under these conditions, ester, thioester, disulfide compounds and photolabile compounds are particularly suitable as cleavable compounds).

The compound mentioned preferably belongs to chemically or enzymatically cleavable or photolabile compounds. As examples of chemically cleavable groups, ester, thioester and disulfide compounds are preferred (Fig. 6k, 1) ("Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993 CRC Press Inc., Herman et al. Method in Enzymology 1990 v.184 p.584, Lomant et al. J. Mol.Biol. 1976 v.104 243, "Chemistry of carboxylic acid and esters" S.Patai 1969 Interscience Publ.). Examples of photolabile compounds (Fig. 6m) can be found in the following references: "Protective groups in organic synthesis" 1991 John Willey & Sons, Inc., V. Pillai Synthesis 1980 Sl, V. Pillai Org. Photochem. 1987 v.9 p.225, dissertation "Neue photolabile Schutzgruppen for light-controlled oligonucleotide synthesis "H. Giegrich, 1996, Konstanz, dissertation" New photolabile protective groups for light-controlled oligonucleotide synthesis "SMBühler, 1999, Konstanz).

The position of the fissile link / group in the linker is preferably no more than 10 atoms from the base, more preferably no more than 3 atoms. The cleavable compound or group is particularly preferably located directly on the base.

The cleavage and removal step is present in every cycle and must be carried out under mild conditions (see above) so that the nucleic acids are not damaged or modified.

The cleavage preferably takes place chemically (for example in a mild acidic or basic environment for an ester compound or by adding a reducing agent, for example dithiothreitol or mercaptoethanol (Sigma) when cleaving a disulfide compound), see Example 1, or physically (for example by lighting the surface with light of a certain wavelength for the cleavage of a photolabile group, dissertation "New photolabile protective groups for light-controlled oligonucleotide synthesis" H. Giegrich, 1996, Constance).

After cleavage, a linker residue remains on the base (A)

(6C). If the mercapto group released after the cleavage at the linker residue interferes with further reactions, it can be chemically modified with known means (such as, for example, using disulfide or iodoacetate compounds).

The synthesis of a cleavable linker is shown using examples (cf. Examples 1 and 2).

4.4.7 Combination of polymerase and NT ^*

Overall, the size, the charge and the chemical structure of the marker, the length of the cleavable linker and the linker residue and also the choice of polymerase play an important role. Together they determine whether the labeled NT ^* is incorporated into the growing nucleic acid chain by the polymerase and whether this prevents the incorporation of the next labeled NT ^* becomes. Two conditions are particularly important:

On the one hand, it is important that the polymerase can further extend the nucleic acid chain with the built-in modified NT ^* after the linker has been cleaved. It is therefore important that the linker residue "A" (FIG. 6c) after cleavage does not represent a significant disturbance for the further synthesis. On the other hand, built-in, non-split NTs ^* must be an obstacle. Many NTs ^* suitable for the reaction can be synthesized. In particular, a preliminary test series must be carried out for each combination of polymerase and NTs ^* , in which the suitability of a particular NT ^* type for sequencing is tested.

The buffer conditions are chosen according to the polymerase manufacturer. The reaction temperature is selected for non-thermostable polymerases according to the manufacturer (e.g. 37 ° C for Sequenase version 2), for thermostable polymerases (e.g. Taq polymerase) the reaction temperature is at most the temperature value (x). This temperature value (x) depends on the Tm of the gene product-primer complex and is e.g. calculated as Tm (gene product primer complex) minus 5 ° C (e.g. Tm is 47 ° C, then the maximum is

Reaction temperature at 42 ° C). These buffer conditions and reaction temperature are further referred to as "optimal buffer and temperature conditions".

The reaction time (corresponds to the duration of the installation step in one cycle) is preferably less than one hour, ideally the reaction time is between 10 seconds and 10 minutes.

The following combinations may be mentioned as examples of suitable combinations between NT ^* and polymerase:

If DNA (eg cDNA) is used as a gene product in the reaction, NT ^* with a short linker residue (synthesis see Example 2, Fig. 6e, h, i): dNTP-SS-TRITC (L7), dNTP-SS-Cy3 (Lll) and / or NT ^* with a long linker residue (synthesis see Example 1, Fig. 6f, g, j): dNTP-SS-TRITC (L14) in combination with Sequenase Version 2, Taq polymerase (GibcoBRL), ProHA-DNA- 5 polymerase (Eurogentec) or Klenow fragment of DNA polymerase I from E. coli without 3 '- 5 'exonuclease activity (Amersham Pharmacia Biotech) can be used.

If RNA (eg mRNA) is used as a gene product in the reaction, NT ^* with a short linker residue (synthesis see Example 2, Fig. 6e, h, i): dNTP-SS-TRITC (L7), dNTP-SS- Cy3 (III) and / or NT ^* with a long linker residue (synthesis see Example 1, Fig. 6f, g, j): dNTP-SS-TRITC (L14) in combination with AMV reverse transcriptase (Sigma), M-MLV Reverse 15 transcriptase (Sigma), HIV reverse transcriptase without RNAse activity can be used.

The suitability of a Lihker residue at base (A) for the reaction is checked in a test system. In doing so

20 cleaved NTs ^{* built} into a nucleic acid chain one after the other. One uses, for example, dUTP ^* with the desired cleaved linker residue, poly-dA as a template for DNA polymerases such as Sequenase version 2, Taq polymerase, or poly-A as a template for reverse transcriptases such as AMV reverse

25 transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), 01igo-dT20 primer, the desired polymerase (see above) and carries out a reaction under optimal buffer and temperature conditions suitable for the respective polymerase. The NT ^* concentration is preferably between 5 μmol / l and

30 200μmol / l. After the reaction, the number of NTs ^* incorporated into the nucleic acid chain is analyzed, for example by lengthwise separation in a gel. The following information can be used to draw conclusions about the suitability of the linker residue: If the polymerase can incorporate more than 20 NTs ^* ,

35 this linker residue is suitable for a sequencing reaction. When installing fewer than 20 split NTs ^* , this combination of NT ^* and polymerase is not optimal for them Sequencing reaction.

If a suitable link remnant has been determined, another test system checks whether the marked, non-split NTs ^* function as semiterminators. This is checked by incubating the labeled NTs ^* with the polymerase and a template under optimal buffer and temperature conditions suitable for the reaction. The NT ^* concentration is preferably between 5 μmol / l and 200 μmol / l. The matrix must be selected so that the installation of several NTs ^* would be expected one after the other, e.g. for dUTP ^* you can use polydA or poly-A, as in the example shown above. Ideally, the polymerase incorporates only a single NT ^* .

If several NTs ^* are installed one after the other under given optimal buffer and temperature conditions, one can change the reaction parameters (eg NT ^* concentration, reaction temperature) and adapt them to the respective combination of polymerase and NT ^* . The most important thing is that the polymerase does not incorporate a second NT ^* in the specified time (preferably between 10 sec and 10 min). According to the invention, this adaptation takes place in one embodiment by changing the reaction temperature. The other parameters of the reaction are kept constant.

If DNA is used as a gene product (eg cDNA) in the sequencing reaction, polymerases can be used as polymerases, for example, polymerases which are DNA polymerases without 3 '-5' exonuclease activity, preferably from the group consisting of viral DNA polymerases from sequenase -Type, bacterial DNA polymerases I, thermostable DNA polymerases and their modifications. Sequenase version 2, Klenow fragment of DNA polymerase I from E. coli without 3 '-5' exonuclease activity, Taq polymerase or ProHA DNA polymerase are particularly suitable. If RNA is included as a gene product (e.g. mRNA) in the sequencing reaction is used, commercially available RNA-dependent DNA polymerases can be used, for example AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNase activity.

In these experiments, the NT ^* concentration is usually between 5 μmol / l and 200 μmol / l, preferably between 10 μmol / l and 100 μmol / l. The concentration of the polymerase and the buffer conditions are selected according to the manufacturer. The duration of the reaction can vary and is preferably between 10 sec and 10 min, which is the duration of the

Installation step (b) would correspond to one cycle. In the case of non-thermostable polymerases such as Sequenase version 2

(Amersham Pharmacia Biotech), Klenow fragment of DNA polymerase I without 3 '-5' exonuclease activity (Amersham Pharmacia Biotech), AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNase activity, the reaction temperature is reduced from conventional 37 ° C, preferably to 20 ° C to 30 ° C. With thermostable polymerases such as Taq polymerase (GibcoBRL), ProHA DNA

Polymerase (Eurogentec) the reaction temperature from conventional 70-75 ° C is preferably reduced to values between 30 ° C and the temperature value (x). This temperature value (x) depends on the Tm of the gene product primer complex and is calculated as Tm (gene product primer complex) minus 5 ° C (eg Tm is 47 ° C, then the temperature value (x) is 42 ° C ).

In another preferred embodiment of the invention, the reaction conditions are adjusted by reducing the NT ^* concentration to below 5 μmol / l, the other parameters of the reaction (buffer conditions, temperature conditions) are kept constant. With this adaptation, the concentration of the NT ^* s is preferably between 0.5 and 5 μmol / l. The duration of the reaction is between 10 sec and 10 min. The most important thing when choosing the NT ^* - Concentration is that the polymerase does not incorporate a second NT ^* in the specified time (preferably between 10 sec and 10 min).

After optimizing the reaction conditions for the installation of a single NT ^* , the reaction must be repeated with split NTs ^* . If the reaction parameters are changed accordingly, the polymerase must be able to incorporate the cleaved NTs ^* one after the other.

The optimization reaction correlates with the installation step, step (b), in one cycle. The conditions determined for the optimization reaction, the temperature, the concentration of NT ^* , the buffer conditions and the duration of the reaction are adopted for the reaction on the surface.

Under these reaction conditions, the incorporation of NT ^* into the strands complementary to gene products preferably takes place in such a way that a labeled NT ^* is preferably incorporated in more than 50% of the gene products involved in the sequencing reaction (gene product-primer complexes which can be extended) in one cycle more than 90%. This is due to the fact that the reaction on some nucleic acid chains is very slow. An installation of the NTs ^* at every complementary position in each cycle is aimed for, but is not necessary because only the successful installation reactions are detected and evaluated; a delayed reaction in the subsequent cycle does not lead to a sequencing error.

The same polymerase is preferably used for all NTs ^* . However, different polymerases can also be used for different NTs ^* . 4.4.8 Color coding scheme, number of dyes

A cycle can be carried out with:

a) four differently marked NT * s b) two differently marked NT * s c) one marked NT * d) two differently marked NT * s and two unmarked NTs,

i.e.

a) You can mark all 4 NTs with different dyes and use all 4 at the same time in the reaction. The sequencing of a nucleic acid chain is achieved with a minimal number of cycles. However, this variant of the invention places high demands on the detection system: 4 different dyes have to be identified in each cycle.

b) To simplify the detection, a label with two dyes can be selected. Two pairs of NTs ^{* are} formed, each marked differently, eg A and G are marked "X", C and U are marked "Y". Two differently labeled NTs ^* are used simultaneously in the reaction in one cycle (s), for example C ^* in combination with A ^* , and U ^* and G ^* are then added in the subsequent cycle (n + 1).

c) You can also use only a single dye to mark all 4 NTs ^* and use only one NT ^* per cycle.

d) In a technically simplified embodiment, two differently marked NT ^* s are used per cycle and two unmarked NTs (so-called 2NT * s / 2NTs method). 4.5 detection apparatus

Individual molecules on a surface can be examined using various methods. Several methods are known: e.g. AtomForce microscopy, electron microscopy, near-field fluorescence microscopy, wide-field fluorescence microscopy, TIR microscopy etc. (Science 1999 v.283 1667, Unger et al. BioTechniques 1999 v.27 p.1008, Ishijaima et al. Cell 1998 v.92 p.161, Dickson et al. Science 1996 v.274 p.966, Xie et al. Science 1994 v.265 p.361, Nie et al. Science 1994 v.266 p.1018, Betzig et al. Science 1993 v.262 p. 1422).

According to the invention, fluorescence signals of individual NTs ^* built into the nucleic acid chain are preferably measured using a wide-field fluorescence microscope (epifluorescence) or a laser scanning microscope or a TIRF microscope (Total Internal Reflection Fluorescence Microscope) (wide-field optical detection system).

Various variants of the construction of such an apparatus are possible (Weston et al. J. Chem. Phys. 1998 v.109 p.7474, Trabesinger et al. Anal. Chem. 1999 v.71 p.279, Adachi et al. Journal of Microscopy 1999 v.195 p.125, Unger et al. BioTechniques 1999 v.27 p.1008, Ishijaima et al. Cell 1998 v.92 p.161, Dickson et al. Science 1996 v.274 p.966, Tokunaga et al. Bichem.Biophys.Res.Com. 1997 v.235 p.47, "Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R.Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2nd ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pavley Plenum Press). Differences in their concrete structure result from the variation of their individual parts. The device for the excitation light can function, for example, on the basis of a laser, a lamp or diodes. Both CCD cameras and PMT can be used for the detection device. Other For examples of technical details see ("Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R.Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2nd ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pavley Plenum Press). It is not the object of this invention to list all possible technical variants of a detection device. The basic structure of a suitable apparatus is explained in a diagram in FIG. 7. It consists of the following elements:

Light source for exciting fluorescence (1) Light-guiding part (2) Scanning table (3)

Spectra selection device (4)

Detection device (5)

Computers with control and analysis functions (6)

These elements of the apparatus can be purchased commercially (microscope companies: Zeiss, Leica, Nikon, Olympus).

In the following, for example, a combination of these elements suitable for the detection of individual molecules will be presented:

Axioplan 2 (Zeiss) wide-field fluorescence microscope with mercury vapor lamp

Objective Planneofluar lOOx, NA 1.4 (Zeiss) Camera SenSysTM (Photometrix) or AxioCam (Zeiss) Computer with software for control and analysis

The procedure for detection will be explained below. Note the general rules of fluorescence microscopy ("Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R.Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2nd ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pavley Plenum Press).

The detection comprises the following phases:

1) Preparation for detection

2) Execution of a detection step in each cycle, each detection step running as a scanning process and comprising the following operations: a) adjusting the position of the lens (X, Y axis), b) adjusting the focal plane (Z axis), c) detecting the Signals of individual molecules, assignment of the signal to NT ^* and assignment of the signal to the respective gene product, d) shift to the next position on the surface.

The signals from NTs ^* built into the strands complementary to the gene products are registered by scanning the surface. The scanning process can be carried out in various ways ("Confocal Laser Scanning Microscopy" 1997 Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991 Ed. R.Cherry CRC Press, Inc., "Fluorescence microscopy" 1998 2. ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy" 1995 J. Pavley Plenum Press). For example, a discontinuous scanning process is selected. The objective is moved step by step over the surface (FIG. 8a), so that a two-dimensional image (2D image) is created from each surface position (FIG. 8b, c), for experimental arrangement see FIG. Example 5.

This 2D image can be created using various methods: for example, by laser scanning a position of the microscope field (laser scanning microscopy) or by taking a camera image at a position (cf. microscopy manuals). One example is the detection of individual molecules with a CCD camera described.

1) Preparation for detection:

At the beginning it is determined how many copies of the gene products are necessary for the expression analysis. Several factors play a role in this. The exact number depends e.g. on the relative presence of the gene products in the approach and on the desired accuracy of the analysis. The number of gene products analyzed is preferably between 1000 and 10,000,000. For highly expressed genes, the number of gene products analyzed can be low, e.g. 1000 to 10,000. When analyzing poorly expressed genes, it must be increased, e.g. to 100,000 or even further. For example, 100,000 individual gene products are analyzed at the same time. Weakly expressed genes (e.g. with approx. 100 mRNA molecules / cell, which corresponds to approx. 0.02% total mRNA) are also represented in the reaction with an average of 20 identified gene products.

2) Performing a detection step in every cycle

The positions of the gene product-primer complexes must be determined for sequencing, so that one has a basis for the assignment of the signals. Knowing these positions allows a statement to be made as to whether the signals of individual molecules come from built-in NTs ^* or from randomly bound NTs ^* . These positions can be identified using various methods.

In a preferred embodiment, the positions of immobilized gene products are identified during sequencing. This makes use of the fact that the signals from the NTs ^* built into the nucleic acid chain always have the same coordinates. This is ensured by fixing the nucleic acid chains. The non-specifically bound NTs ^* bind randomly at different points on the surface.

To identify the positions of fixed gene products the signals are checked for their coordinates from several successive cycles. This can be done, for example, at the beginning of the sequencing. The matching coordinates are evaluated and stored as coordinates of the gene products.

The scan system must be able to scan the surface reproducibly over several cycles. X, Y and Z axis settings at each surface position can be controlled by a computer. The stability and reproducibility of the setting of lens positions in each scanning process determine the quality of the detection and thus the identification of the signals of individual molecules.

a) Setting the position of the lens (X, Y axis)

The mechanical instability of the commercially available scanning tables and the low reproducibility of repeated adjustment of the same X, Y positions make it difficult to precisely analyze the signals of individual molecules over several cycles. There are many ways to improve the coincidence of the coordinates with repeated settings or to check possible deviations. A control option is given as an example. After a rough mechanical adjustment of the lens position, a control image is made of a pattern firmly attached to the surface. Even if the mechanical setting does not have exactly the same coordinates (deviations of up to 10 μm are quite possible), you can make a correction using an optical control. The control image from the sample serves as a coordinate system for the image with signals from built-in NTs ^* . A prerequisite for such a correction is that no further surface movements are made between these two images. Signals from individual molecules are placed in relation to the pattern, so that an X, Y deviation in the pattern position means the same X, Y deviation in the position of the signals of individual molecules. The A control picture of the pattern can be taken before, during or after the detection of individual molecules. Such a control picture must be made accordingly with each setting on a new surface position.

b) Setting the focus plane (Z axis)

The surface is not absolutely flat and has various bumps. This changes the surface-lens distance when scanning neighboring locations. These differences in distance can lead to individual molecules leaving the focal plane and thus avoiding detection.

For this reason it is important that when scanning the surface a reproducible setting of the focal plane is achieved at every lens position.

There are various ways to reproducibly adjust the focus level. For example, the following method can be used: Since the excitation of individual molecules can lead to the extinction of their fluorescence, a marker is applied to the surface, which serves to adjust the focal plane. The signals of individual molecules are then detected. The marker can be of any nature (e.g. dye or pattern), but must not interfere with the detection and the reaction.

c) Detection of the signals of individual molecules, assignment of the signal to NT ^* and assignment of the signal to the respective gene product.

The two-dimensional image of the reaction surface generated with the aid of the detection system contains the signal information from NT ^* s built into the gene products. Before further processing, these must be extracted from the total amount of image information using suitable methods. The necessary algorithms for scaling, transformation and Filtering of image information is part of the standard repertoire of digital image processing and pattern recognition (Haberäcker P. "Practice of digital image processing and pattern recognition". Hanser-Verlag, Munich, Vienna, 1995; Galbiati LJ "Machine vision and digital image processing fundamentals". Prentice Hall, Englewood Cliffs, New Jersey, 1990). The signal extraction is preferably carried out via a gray value image, which depicts the brightness distribution of the reaction surface for the respective fluorescence channel. If several nucleotides with different fluorescent dyes are used in the sequencing reaction, a separate gray value image can first be generated for each fluorescence-labeled nucleotide (A, T, C, G or U). In principle, two methods can be used for this:

1. A gray value image is generated for each fluorescence channel by using suitable filters (Zeiss filter sets).

2. From a recorded multichannel color image are made using a suitable algorithm by

Image processing program extracts the relevant color channels and processes them individually as gray-scale images. A channel-specific coloring threshold algorithm is used for channel extraction. Individual gray value images 1 to N are thus initially created from a multi-channel color image. These images are defined as follows:

GB _N = (s (x, y)) single-channel gray value image N = {l, ..., number of fluorescence channels}. M = {0, 1, ..., 255} gray value set

S = (s (x, y)) image matrix of the gray value image x = 0, 1, ..., L-1 image lines y = 0, l, ..., R-1 image columns (x, y) location coordinates of a pixel s (x, y) e M Gray value of the pixel.

A suitable program is now used to convert this amount of data the relevant image information is extracted. Such a program should implement the following steps:

For GB _! up to GB _N :

I. Preprocessing of the image, for example, if necessary, reducing the image noise caused by the digitization of the image information, for example by gray value smoothing.

II. Checking each pixel (x, y) of the gray-scale image as to whether this point fulfills the properties of a fluorescence point in connection with the immediate and further distant neighboring pixels surrounding it. These properties depend, among other things, on the detection equipment used and the resolution of the gray-scale image. For example, you can display a typical distribution pattern of brightness intensity values over a matrix surrounding the pixel. The image segmentation methods that can be used for this range from simple threshold value methods to the use of neural networks.

If an image point (x, y) fulfills these requirements, then a comparison with the coordinates of gene products identified in previous sequencing cycles follows. If there is a match, the signal is associated with the nucleotide emerging from the respective fluorescence channel to this gene product. Signals with mismatched coordinates are evaluated as background signals and rejected. The signals can be analyzed in parallel with the scanning process.

In an exemplary embodiment, an eight-bit gray-scale image with a resolution of 1317 x 1035 pixels was used. In order to reduce the changes in the image caused by digitization, the overall image was first preprocessed: the average value of the brightness of its 8 neighbors was assigned to each pixel. With the selected resolution, this creates one for a fluorescence point typical pattern of a central pixel with the greatest brightness value and neighboring pixels with brightness falling towards all sides. If a pixel met these criteria and the centrifugal drop in brightness exceeded a certain threshold value (to exclude fluorescence spots that were too weak), this central pixel was evaluated as the coordinate of a fluorescence spot.

d) Moving the lens to the next position on the surface. After detecting the signals of individual molecules, the lens is positioned over another position on the surface.

Overall, for example, a sequence of recordings can be made with the control of the X, Y position, the adjustment of the focal plane and with the detection of individual molecules at each new lens position. These steps can be controlled by a computer.

4.6 Timing of the procedural steps

The scanning process and the biochemical reaction take a certain amount of time. If you switch these processes one after the other, you can achieve an optimal performance of the equipment. In a preferred embodiment, the reaction is carried out on two separate surfaces (FIG. 9).

As an example, a surface with bound gene products can be separated into two spatially isolated parts, so that reactions on these two parts can take place independently of one another. In another example, gene products can also be immobilized on two separate surfaces from the outset.

The reaction is then started. The principle is that while the reaction and washing steps take place on part of the surface, the second part is scanned. Thereby you can achieve a continuous flow of analysis and increase the speed of sequencing.

The number of surfaces on which the reaction takes place can also be greater than 2. This makes sense if the reaction occurs as a time-limiting step, i.e. the detection of the signals on the surface is faster than the reaction and washing steps. In order to adapt the total duration of the reaction to the detection duration, each individual step of the reaction can take place on a single surface with a time delay compared to the next surface.

4.7 Analysis

The data obtained (short sequences) are compared using a program with known gene sequences. Such a program can e.g. based on a BLAST or FASTA algorithm ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall).

The choice of the method for material preparation determines, among other things, in which sections of the gene products the sequences are determined and to which strand (sense or antisense) they belong. For example, are determined when using the polyA stretches as primer binding sites in mRNA sequences from NTRs (non-translating regions). When using the method with antisense cDNA as a template, the sequences determined come, inter alia, from the protein-coding regions of the gene products.

In a preferred simple variant of the invention, the gene expression is only determined qualitatively. Only the fact that certain genes are expressed is important.

In another preferred embodiment, one is quantitative determination of the relationships between individual gene products in the approach of interest. It is known that the activity of a gene in a cell is represented by a population of identical mRNA molecules. Many genes are active in a cell at the same time and are expressed to different extents, which leads to the presence of many different mRNA populations with different strengths.

The quantitative analysis of gene expression is discussed in more detail below:

The abundances (frequencies) of individual gene products in the sequencing reaction are determined for a quantitative analysis of the gene expression. The products of highly expressed genes are more frequently represented in the sequencing reaction than the poorly expressed genes.

After assigning the sequences to specific genes, the proportion or number of sequences determined for each individual gene or gene product is determined. Genes with strong expression have a higher proportion of the total population of gene products than genes with weak expression.

The number of gene products analyzed is preferably between 1000 and 10,000,000. The exact number of gene products to be analyzed depends on the task. It can be low for highly expressed genes, e.g. 1000 to 10,000. When analyzing poorly expressed genes, it must be increased, e.g. to 100,000 or higher.

If, for example, 100,000 individual gene products are analyzed at the same time, weakly expressed genes, such as approx. 100 mRNA molecules / cell (which corresponds to approx. 0.02% total mRNA), are also represented in the reaction with an average of 20 identified gene products. The following method can be used as internal control of the hybridization, the immobilization and the sequencing reaction:

One or more nucleic acid chains with known sequences can be used as a control (quantitative marker). The composition of these control sequences is not restricted provided that they do not interfere with the identification of the gene products. RNA control samples are used in the sequence analysis of the mRNA samples, and corresponding DNA control samples are used in the analysis of the cDNA samples. These samples are preferably carried along in all steps. You can e.g. added after mRNA isolation. In general, the control samples are prepared for sequence analysis in the same way as the gene products to be analyzed.

The control sequences are added to the gene products to be analyzed in known, fixed (predetermined) concentrations. Concentrations of the control samples can be different, preferably these concentrations (i.e. the total concentration of the control sequences) are between 0.01% and 10% of the total concentration of the sample to be analyzed (100%). For example, if the concentration of the mRNA is 10ng / μl, the concentrations of control samples are between 1pg / μl and 1ng / μl.

In the quantitative analysis of gene expression, the general metabolic activity of the cells must also be taken into account, in particular when a comparison of the expression of certain genes under different external conditions is sought.

The change in the level of expression of a particular gene can occur as a result of the change in the transcription rate of that gene or as a result of a global change in gene expression in the cell. To observe the metabolic states in the cell, the expression of the so-called "house keeping genes ". If there is a lack of important metabolites, for example, the general level of expression in the cell is low, so that constitutively expressed genes also have a low level of expression.

In principle, all constitutively expressed genes can serve as "house-keeping genes". Examples include the transferrin receptor gene or the beta actin gene. The expression of these house-keeping genes thus serves as a reference for the analysis of the expression of other genes. The sequence determination and quantification of the expression of the house keeping genes is preferably a component of the analysis program for gene expression.

The invention is illustrated below using examples.

Examples

Example 1:

Modified dUTP with a long cleavable linker (Fig. 6f-1) 5- (3-aminoallyl) -2 'deoxyuridine-5' triphosphate, AA-dUTP, (Sigma), 3, 3 '- serve as starting substances Dithio-bis (propionic acid-N-hydroxysuccinimide ester), DTBP-NHS, (Sigma), 2-mercaptoethylamine, MEA, (Sigma). To 100 ul 50mmol / l solution of AA-dUTP in 100mmol / l borate buffer pH 8.5, 3 equivalents of DTBP-NHS in DMF (25 ul 0.4mol / l solution) are added. The reaction mixture is 4 hours at RT. incubated. Then conc. Ammonium acetate solution (pH 9) is added until the total concentration of CH ₃ COONH ₄ in the reaction solution is 100 mmol / l, and the reaction is incubated for a further hour. Then 200 μl imol / 1 MEA solution, pH 9, are added and incubated at RT for one hour. A saturated solution of I ₂ in 0.3M KI solution is then added dropwise to this mixture until the iodine color remains. The modified nucleotides are separated from other reaction products on a DEAE cellulose column in an ammonium carbonate gradient (pH 8.5). The nucleotide with the cleavable linker is isolated on RP-HPLC. Dyes can now be coupled to this linker using various methods ("Handbook of Fluorescent Probes and Research Chemicals" 6th ed. 1996, R.Haugland, Molecular Probes, Waggoner Method in Enzymology 1995 v.246, p.362, Jameson et al. Method in Enzymology 1997, v.278, p.363).

Other nucleotide analogs (for example according to Hobbs et al. US Patent 5,047,519, Khan et al. US Patent 5,821,356) can also be used in the reaction, so that nucleotide analogs with structures in FIGS. 6f-2,3,4 and 6g-1,2 can be generated.

The coupling of TRITC (tetramethylrhodamine-5-isothiocyanate, Molecular Probes) is given as an example of the coupling of a dye to the linker (NT ^* structure, FIG. 6j):

The dNTP (300 nmol) modified with the cleavable linker is dissolved in 30 μl 100 mmol / l sodium borate buffer, pH 9

(10mmol / l NT ^* ). 10 μl of 10 mmol / l of TRITC are added to DMF and incubated at RT for 4 h. The NT ^* modified with the dye is cleaned using RP-HPLC in a methanol-water gradient. Similarly, other dyes can be coupled to the amino group of the linker.

The NT * produced in this way fulfills the requirements for incorporation into the DNA strand, fluorescence detection and chain termination after the incorporation and removal of the inhibition, which are necessary for the success of the method according to the invention.

Example of cleavage of disulfide compound in modified NT ^* . The cleavage is carried out by adding 20 to 50 mmol / l DTT or mercaptoethanol (Sigma) solution pH 8 to the Reaction surface. The surface is 10 min. incubated with this solution, then the solution is removed and the surface is washed with a buffer solution to remove DTT or mercaptoethanol residues.

Example 2:

Modified dUTP (dUTP-SS-CH ₂ CH ₂ NH ₂ ) with a short cleavable linker (Fig. 6e-l). The starting substances are: bis-dUTP, synthesized according to Hanna (Method in Enzymology 1989, v.180, p.383), 2-mercaptoethylamine, MEA, (Sigma).

100 μl 100 mmol / l MEA solution, pH 8.5, in H ₂ 0 are added to 400 μl 100 mmol / l bis-dUTP in 40 mmol / l borate buffer pH 8.5 and incubated at RT for 1 hour. A saturated solution of I ₂ in 0.3 mol / l KI solution is then added dropwise to this mixture until the iodine color remains. The nucleotides (Bis-dUTP and dUTP-SS-CH ₂ CH ₂ NH ₂ ) can be separated from other reaction products, for example by ethanol precipitation or on a DEAE cellulose column in an ammonium carbonate gradient (pH 8.5). Bis-dUTP does not interfere with the subsequent coupling of a dye to the amino group of the linker, so that the dUTP-SS-CH ₂ CH ₂ NH _{2 can be separated} from bis-dUTP in the final cleaning step.

DCTP (Fig. 6-e2) can be modified in a similar way, bis-dCTP serving as the starting substance (synthesized according to Hanna et al. Nucleic Acid Research 1993, v.21, p.2073).

Other NT ^* (dUTP ^* and dCTP ^* ) with a short linker residue can be synthesized in a similar manner, NT ^* for example having the following structures (FIG. 6e): dUTP-SS- (CH ₂ ) _n -NH ₂ , FIG .6e-1, dCTP-SS- (CH ₂ ) _n -NH ₂ , Fig. 6e-2, where n is between 2 and 6, preferably between 2 and 4, dUTP-SS- (CH ₂ ) _n -X-CO- (CH ₂ ) _m -Z, Fig. 6e-3, dUTP-SS- (CH ₂ ) _n -X-CO-Y- (CH ₂ ) _m - Z, Fig. 6e-4, dCTP-SS- (CH ₂ ) _n -X-CO- (CH ₂ ) _m -Z, Fig. 6e-5, dCTP-SS- (CH ₂ ) _n -X-CO- Y- (CH ₂ ) _m -Z, Fig. 6e-6, X = NH, O, S

Y = NH, 0, S

Z = NH ₂ , OH, dye where (n + m) is between 4 and 10, preferably between 4 and

6th

Dyes can now be coupled to the linker using various methods ("Handbook of Fluorescent Probes and Research

Chemicals "6th ed. 1996, R.Haugland, Molecular Probes, Waggoner

Method in Enzymology 1995 v.246, p.362, Jameson et al. Method in Enzymology 1997, v.278, p.363).

The coupling of the FluoroLinkTM Cy3 monofunctional dye (Amersham Pharmacia biotech) (NT ^* structure Fig. 6i) is given as an example of coupling a dye to the linker. It is a monofunctional NHS ester fluorescent dye. The reaction is carried out according to the manufacturer's instructions: The dNTP (300 nmol) modified with the cleavable linker is dissolved in 300 μl 100 mmol / l sodium borate buffer pH 8.5. For this, dye (300 nmol) is added and incubated for 1 h at RT. The NT ^* modified with the dye is cleaned by RP-HPLC in a methanol-water gradient.

Another example of the coupling of a dye to the linker is the coupling of TRITC (tetramethylrhodamine-5-isothiocyanate, Molecular Probes) (dUTP-SS-TRITC Fig. 6h).

The dNTP (300 nmol) modified with the cleavable linker is dissolved in 30 μl 100 mmol / l sodium borate buffer pH 9 (10 mmol / l NT ^* ). 10 μl of 10 mmol / l of TRITC are added to DMF and incubated at RT for 4 h. The NT ^* modified with the dye is cleaned by RP-HPLC in a methanol water Gradient.

The NT * produced in this way fulfills the requirements for incorporation into the DNA strand, fluorescence detection and chain termination after the incorporation and removal of the inhibition, which are necessary for the success of the method according to the invention.

Example of cleavage of the disulfide compound in the modified NT ^* . The cleavage is carried out by adding 20 to 50 mmol / l dithiothreitol solution (DTT) or mercaptoethanol solution (Sigma), pH 8, to the reaction surface. The surface is 10 min. incubated with this solution, then the solution is removed and the surface is washed with a buffer solution to remove DTT or mercaptoethanol residues.

Further examples of NT structures that can be used in the method according to the invention are shown in FIGS. 6k, 1, m. For the individual synthesis steps, see for example J.L. Ruth et al. Molecular Pharmacology 1981 v.20 p.415, L. Ötvös et al. NAR 1987 v.15 p.1763, G.E.right et al. Pharmac Ther. 1990 v.47, p.447, "Nucleotide Analogs; Synthesis and Biological Function "KH Scheit 1980, Wiley-Interscience Publication," Nucleic acid chemistry "Ed. LBTownsend, v.1-4, Wiley-Interscience Publication," Chemistry of Nucleosides and Nucleotides "Ed. LBTownsend, v.1 -3, Plenum Press.

Example 3:

Sequence analysis with 4 marked NTs ^*

In a preferred embodiment of the invention, all four NTs ^* used in the reaction are labeled with fluorescent dyes.

One of the color coding schemes mentioned above is used. The number of NTs found for each Sequence from a gene product is between 5 and 100, ideally between 20 and 50. These sequences are compared with a known program in gene databases using a program and assigned to appropriate genes. Such a program can be based, for example, on the BLAST or FASTA algorithm ("Introduction to Computational Biology" 1995 MS Waterman Chapman & Hall).

A cycle has the following steps: a) adding a solution with labeled nucleotides (NTs ^* ) and polymerase to immobilized nucleic acid chains, b) incubating the immobilized nucleic acid chains with this solution under conditions which are suitable for extending the complementary strands by one NT, c) Washing d) detection of signals from individual molecules, e) removal of the label from the built-in nucleotides, f) washing.

Example 4:

Sequence analysis with 2 marked NTs ^* and 2 unmarked NTs (2NTs ^* / 2NTs method).

In another embodiment, 2 modified NTs ^* and 2 unmodified NTs are used for the analysis of the sequences.

This embodiment is based on the principle that a sequence of 2 signals (marked NT ^* s) can contain enough information to identify a sequence. The determined sequence is compared with the reference sequence and assigned to a specific position, for example:

ACCAAAACACCC - determined sequence (dCTP ^* and dATP ^* are marked) ATCATCGTTCGAAATATCGATCGCCTGATGCC - reference sequence

A-C C-AAA-A-C-A-C-CC (assigned determined sequence) ATCATCGTTCGAAATATCGATCGCCTGATGCC (reference sequence)

The sequences determined are preferably assigned to the reference sequence with the aid of a program. Such a program can e.g. based on the BLAST or FASTA algorithm ("Introduction to computational Biology" 1995 M.S. Waterman Chapman & Hall).

The gene products are prepared for sequencing as described above and sequenced using the 2NTs ^* / 2NTs method. Sequence sections are obtained from gene products, each sequence representing a sequence of 2NTs ^* . Known gene sequences serve as reference sequences. In order to enable the determined sequence to be clearly assigned to a known reference sequence, this sequence must be long enough. The length of the sequences determined is preferably more than 20 NT ^* s. Since 2 marked NTs ^{* represent} only part of the sequence, the total length of the complementary strand synthesized is approximately twice as long as the sequence of the detected NTs ^* (with 20 detected NTs ^* , the total length is, for example, an average of 40 NTs).

4 nucleotides are required to synthesize a complementary strand. Since the NTs ^* marked with a fluorescent dye appear as semiterminators in the present invention, ie the termination occurs only when modified NTs ^{* are available} , unmodified NTs must be added to the reaction in an additional step in each cycle. The exact position of this step in the cycle can vary. It is important that the marked NTs ^* and the unmodified NTs are used separately.

A cycle in this embodiment may look as follows, for example: a) adding a solution with modified NTs ^* and polymerases to the surface with the gene products provided b) incubating the immobilized nucleic acid chains with this solution under conditions which are suitable for extending the complementary strands by one NT, c) washing d) detecting the signals from individual, modified NTs ^* molecules built into the newly synthesized strands complementary to the gene products e) removal of the label and the terminating group in the built-in nucleotides f) washing g) addition of 2 unmodified NTs and polymerases h) washing.

Example 5:

The preparation and implementation of the

sequencing reaction

The preparation of the gel surface:

The polyacrylamide gel for the analysis of reactions with individual molecules is prepared according to general rules of gel preparation for electrophoretic separation ("Electrophoresis" A.T. Andrews, Oxford science publications 1995).

The polymerization reaction can e.g. be carried out by UV light or by radical formers. In this example ammonium persulfate (APS) and TEMED (tetramethylethylene diamine) are used for the radical reaction, e.g. TEMED 0.01% v / v and APS 0.04% w / v. The component composition can vary widely, the concentrations of individual components are in the following ranges (calculated for the ready-to-use aqueous AA to AA solution):

Acrylamide monomer (AA) from 3 to 30%, ideally between 10 and 20% Bis-acrylamide (bis-AA) in relation to the acrylamide monomer 1:10 to 1:50, preferably 1:20.

2 clean glass plates are used for the production (washed with acetone and then water). A glass plate (PI) is preferably pretreated with a water-repellent reagent, e.g. Repelsilane, dimethyldichlorosilane solution, Amersham Pharmacia-Biotech. P2 serves as a solid carrier for the gel and can be used with yellow-binding reagents e.g. Bind silane, methacryloxypropyltrimethoxysilane, Amersham Pharmacia-Biotech, are pretreated so that there is a covalent bond between the gel and the glass surface. P2 pretreatment with yellowing reagents is useful when several reactions with immobilized molecules have to be carried out. With a smaller number of reactions, such pretreatment is not necessary. In these cases, a clean glass surface is sufficient for P2 so that the gel adheres to the glass surface solely by adhesive forces.

The finished polymerization solution (AA / bisAA solution with radical formers) is poured between P1 and P2, so that a layer with a thickness of approx. 5 to 30 μm results. The thickness of the gel can e.g. be checked by spacers. After hardening, Pl is removed. The gel sticks to P2. It is washed with deionized water.

The gel can be used directly or can be dried and stored at various stages of manufacture. Before a reaction with labeled molecules, the gel is usually swollen in the reaction buffer solution for a few minutes and only then used for the reaction.

Nucleic acid chains are immobilized on a gel surface prepared in this way by drying out.

For example, a solution (approximately 1 μl) of a plasmid DNA (linearized with Hind III) was converted into single-stranded by heat Form converted pMOS blue plasmid DNA about 3400 NT long, concentration O.lμg / μl) was dropped on about 10mm ^{2 of} the gel surface and brought to dryness at 90.degree. The calculated density of the immobilized plasmid molecules was approximately 1000 per 1 μm ² .

The oligonucleotide 5 '-AGTGAATTCGAGCTCGGTAC-3' was used as primer. The primer binding site (hereinafter bold) together with the extension relevant for the analysis has the following sequence: 5 '-ATCCCCGGGTACCGAGCTCGAATTCACT-3'

A flow cell (microfluidic channel, MFK) with the reaction surface as a lid was assembled. Such an MFK allows a rapid exchange of liquid under the gel surface.

As a preliminary test, the primer (calculated Tm 45.3 ° C, 0.1μmol / l in 50mmol / l Tris-HCl pH 8.7) was hybridized at 45 ° C for 10 minutes with the plasmid DNA on the surface (annealing). After a washing step, the density of the plasmid-primer complexes was checked. The control was carried out by incorporating dCTP-Cy3 (Amersham Pharmacia Biotech) using Klenow fragment (2 units per 50 μl in 20 mmol / l Tris-HCl buffer, pH 8.5, with 5 mmol / l MgCl ₂ for 15 minutes 30 ° C). Only a single dCMP-Cy3 is built into the growing strand.

Axioplan 2e (Zeiss) with the CCD camera AxioCam (Zeiss), Fig. 7, 8, served as the detection apparatus. The signal density of the individual built-in dCMP-Cy3 molecules corresponds to the density of the plasmid-primer complexes which can be extended. Under the conditions mentioned, the density of the plasmid-primer complexes averaged approximately 15 per 100 μm ² and was thus of the desired order (FIGS. 8a-c). On a second surface prepared in the same way (pMOS blue plasmid DNA linearized with Hind III and converted into single-stranded form by heat for about 3400 NT, Concentration O.lμg / μl with hybridized primers), a cyclic sequencing reaction is carried out. In this case, dUTP-SS-CH ₂ CH ₂ NH-R-Cy3 (dUTP *) and dCTP-SS-CH ₂ CH ₂ NH-R-Cy3 (dCTP *) (see Example 2) are used as reversible terminators. The detection apparatus is the same as in the preliminary test.

The solutions used for the cyclic sequencing reaction are composed as follows:

a) Reaction solution for the installation reaction: 20 mmol / 1 Tris-HCl buffer, pH 8.5, 5 mmol / l MgCl ₂ , 10% glycerol, Klenow fragment

(Amersham Pharmacia-Biotech) 2U per 50μl, dUTP * or dCTP *, or dATP and dGTP each 10 μmol / 1. b) Wash solution: 20 mmol / 1 Tris-HCl pH 8.5, 0.01% Na-Azide c) Reaction solution for the cleavage reaction: 20 mmol / 1 Tris-HCl, pH 8.5, 50mmol / l mercaptoethanol.

The installation reactions with marked NT * s were carried out at 30 ° C. for 15 minutes.

In the first cycle of the sequencing reaction, a reaction solution with dCTP * was added. After a washing step, a detection step was carried out, single-molecule signals with the assigned x, y coordinates being registered on the surface (a total of approximately 11,200 signals). The marker was then removed from the built-in NT * s (room temperature, 10 minutes) and the surface was washed.

In the second cycle, a reaction solution with dUTP * was added and incubated for 15 minutes at 30 ° C. After a subsequent washing step, the single-molecule signals were detected on the surface (a total of approximately 200 signals).

This corresponds to the background signal that arises from an unspecific binding of the NT * s to the surface. The marker from the NT * s was split off (room temperature, 10

Minutes) and the surface washed with the washing solution.

In the third cycle, a reaction solution with dATP and dGTP added and incubated for 15 minutes at 30 ° C. The surface was then washed.

Cycles 1 to 3 were repeated three times, with a total of approximately 9900 CCU target sequences being determined. These sequences can be clearly assigned to the primer.

Legends for Figures 1 to 9

Legend to Fig. 1

Schematic representation of the analysis of mRNA population

The analysis is based on the sequencing of short sections of mRNA.

1) mRNA - the mRNA population to be analyzed, in this example consisting of two different mRNA

Molecular populations (thin and thick stripes represent mRNA molecules)

2) Immobilized mRNA - mRNA-primer complexes bound to the flat surface, in this example the binding is carried out by the oligo-dT primer

3) Add a solution with polymerases and NT * s - the first step in a cycle of the sequencing reaction

4) Washing step - after the installation step, the surface is washed

5) Detection - the signals from individual built-in NT * s are detected

6) Removal of the label and the group leading to the termination - the label and the steric obstacle are removed in order to continue the sequencing reaction

Legend for Fig. 2

Example of the general structure of gene product-primer complexes

Fig. 2 In this embodiment, each gene product has one uniform primer binding site (PBS) at its 3 'end, so that a uniform primer can bind to this PBS.

1) primer

25} primer binding site

3) Single-stranded part of the gene product that is analyzed

Legend for Fig. 3

0 An example of the creation of a uniform primer binding site (PBS).

3a) In this case, NTs are coupled to the 3 'end of the single-stranded gene products (a so-called 5 "tailing"). Using a uniform NT results in a uniform PBS.

3b) After hybridization of primers, gene product-primer complexes 0 are formed

Legend for Fig. 4

Example of the binding of gene products to a gel-like reaction surface.

A gel layer (2) adheres to a solid base (1), e.g. a polyacrylamide gel (Fig. 4a), or many gel beads (5), e.g. Agarose beads (Fig. 4b). Gene products (4) are bound to the surface of the gel. The gene products carry a functional group, e.g. Biotin, and are bound to the gel via streptavidin or avidin (3).

5 legend to FIG. 5

Example of a flow device A gel-like reaction surface (1) is on one for the

Excitation and fluorescent light permeable solid base

(2) attached. Together they form the lid of the flow cell. The liquids in the flow cell can be exchanged in a controlled manner, the flow cell together with

Storage container (3), pump (4) and valve (5) one

Form flow device. Are on the reaction surface

Gene product-primer complexes bound (not shown here). The signals of the installed NT * s are with the

Detection apparatus (6) detected.

Legend for FIG. 6 structures of 2'-deoxynucleoside triphosphates which can be used in the process.

Fig. 6a - Schematic representation of the NT structure, in which the cleavable group and the sterically demanding group leading to the termination form parts of the linker. The linker is the connection between nucleobase and fluorescent dye.

A, B, C, D, E - linker, A - the linker residue after cleavage, B - cleavable group, D - sterically demanding group leading to termination, F - fluorescent dye.

Fig. 6b - Schematic representation of the NT structure, the cleavable group being part of the linker and the fluorescent dye simultaneously representing the sterically demanding group leading to the termination.

A, B, C - linker, A - the linker residue after cleavage, B - cleavable group, D - sterically demanding group leading to termination, F - fluorescent dye.

Fig. 6c - Schematic representation of the structure of installed NT * s after the cleavage step. Two NT * s are shown with the remaining link remainder (A). Fig. 6d - Schematic representation of the NT structure, wherein the cleavable group, which is also the sterically demanding group leading to termination, is part of the linker.

A, B, C, D - linker, A - the linker residue after cleavage, B - cleavable group, D - sterically demanding group leading to termination, F - fluorescent dye.

Fig. 6e - representation of preferred NT structures in which the linker is coupled to the 5-position in the pyrimidine ring.

6f - representation of other preferred NT structures in which the linker is coupled to the 5-position in the pyrimidine ring.

Fig. 6g - representation of preferred NT structures, in which the linker is coupled to the 7-position in the purine ring.

6h, i, j - examples for the coupling of dyes to the linker

6k structures of further 2'-deoxynucleoside triphosphates which can be used in the process. The linker is coupled to the 5-position of the pyrimidine ring.

The substituents R _{ι, 2,3,} can be selected and can occur independently of one another.

In one embodiment (6k-1), the Z group represents the connection between the linker and the base. It can be selected and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.

In one embodiment (6k-1) the E group represents one internal part of the linker. In another embodiment (6k-2) it represents the connection between the linker and the base. This group is selectable and can be a straight-chain alkyl or alkenyl chain with a number of carbon atoms, preferably between 1 and 5 , his.

The E group can also be an alkyl or alkenyl chain with an internal amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino bond.

In this example, the C group is a chemically cleavable group. In the embodiments (6k-1,2) it represents an internal part of the linker. In another embodiment (6k-3) it represents the connection between the linker and the base. This group is selectable and can be an ester, Be thioester and disulfide compound.

The Y group represents an internal part of the linker, which creates the connection between the cleavable group (C) and the fluorescent dye (F). This group is selectable and can be a branched or unbranched alkyl or

Alkenyl chain or a substituted or unsubstituted

Be an aryl group. Another possible alternative is one

Alkyl or alkenyl chain with an internal amide carbalcoxy

(Ester), sulfoxy, ether, thioether or amino bond.

The X group is the connection between the fluorescent dye and the linker, and this connection can be derived from both the linker and the fluorescent dye (F). It is selectable and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.

Fig. 6L

Structures of further 2'-deoxynucleoside triphosphates that can be used in the process. The linker is coupled to the 7-position of the purine ring. The substituents R _{1 # 2,3,4} can be selected and can occur independently of one another.

In one embodiment (6L-1), the Z group represents the connection between the linker and the base. It is selectable and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.

In one embodiment (6L-1) the E group represents an internal part of the linker. In another embodiment (6L-2) it represents the connection between the linker and the base. This group is selectable and can be a straight-chain alkyl - Or alkenyl chain with a number of carbon atoms, preferably between 1 and 5. The E group can also be an alkyl or alkenyl chain with an internal amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino bond.

In this example, the C group is a chemically cleavable group. In the embodiments (6L-1,2) it represents an internal part of the linker. In another embodiment (6L-3) it represents the connection between the linker and the base. This group is selectable and can be an ester, Be thioester and disulfide compound.

The Y group represents an internal part of the linker, which creates the connection between the cleavable group (C) and the fluorescent dye (F). This group can be selected and can be a branched or unbranched alkyl or alkenyl chain or else a substituted or unsubstituted aryl group. Another possible alternative is an alkyl or alkenyl chain with an internal amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino bond.

The X group is the connection between the fluorescent dye and the linker, this connection being formed by both the linker and the fluorescent dye (F) can be derived. It is selectable and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.

6m

More examples of structures from

2'-deoxynucleoside triphosphates that can be used in the process. The linker is coupled to the 5-position of the pyrimidine ring.

The substituents R _{1 # 2,3,4} can be selected and can occur independently of one another.

The Y group represents an internal part of the linker, which is the connection between the cleavable group (C) and the

Fluorescent dye (F) produces. This group is selectable and can be a branched or unbranched alkyl or

Alkenyl chain or a substituted or unsubstituted

Be an aryl group. Another possible alternative is an alkyl or alkenyl chain with an internal amide, carbalcoxy

(Ester), sulfoxy, ether, thioether or amino bond.

The X group is the connection between the fluorescent dye and the linker, and this connection can be derived from both the linker and the fluorescent dye (F). It is selectable and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.

Legend for Fig. 7

Example of a detection system

A wide-field optical detection system is shown. After the installation of marked NT * s, the surface (7) is scanned, the fluorescence signals from individual to the NTs coupled dye molecules can be detected.

Legend for Fig. 8

Schematic representation of the scanning process

Fig. 8a Schematic representation of a portion of the reaction surface (gray) that is scanned. The circles each correspond to the recording of a 2D image and represent the areas from which the fluorescence signals are detected. There are several signals per recording

(e.g. 100 to 10,000) of individual molecules registered simultaneously. The reaction surface is scanned in each cycle, several images being taken from different locations on the surface during the scanning process. Up to several million signals can be recorded by built-in NT * s. The high degree of parallelism is the basis for the speed of the process.

Fig. 8b A recording (a 2D image) with signals from individual, built-in NT * s. See example 5 for a description of the experiment.

Fig. 8c detail from Figure 8b. The section shows signals from four built-in NTs. Each signal has characteristic properties of the individual molecule signals (see description) and can be identified on the basis of these (preferably with the aid of a computer program). The corresponding X, Y coordinates are assigned to each of the identified signals.

Legend for Fig. 9

Example of an advantageous arrangement of reaction surfaces. The throughput is determined by using two separate flow cells (microfluidic channels, MFK) increased. While biochemical and chemical reactions take place in one flow cell, detection is carried out in the other. The flow cells then swap positions.

Claims

claims:

1. Method for parallel analysis of gene expression in which one

provides single-stranded gene products, one

the gene products are bound to a reaction surface in a random arrangement using one or more different primers in the form of gene product-primer complexes;

perform a cyclic assembly reaction of the complementary strand of the gene products using one or more polymerases by

a) a solution is added to the gene product-primer complexes bound to the surface which contains one or more polymerases and one to four modified nucleotides (NTs ^* ) which are labeled with fluorescent dyes, the simultaneous use of at least two NTs ^* fluorescent dyes located on the NTs ^* are selected so that the NTs ^{* used} can be distinguished from one another by measuring different fluorescence signals, the NTs ^{* being} structurally modified on the base in such a way that the polymerase after incorporating such an NT ^* into a growing complementary one Strand is unable to incorporate another NT ^* into the same strand, the fluorescent dye being cleavable and the structural modification being a cleavable, sterically demanding ligand

b) the stationary phase obtained in stage a) below Incubated conditions that are suitable for extending the complementary strands, the complementary strands are each extended by an NT ^* , man

c) the stationary phase obtained in stage b) is washed under conditions which are not suitable for the removal of NTs ^* which are not incorporated into a complementary strand

d) the individual NTs ^* built into complementary strands are detected by measuring the signal characteristic of the respective fluorescent dye, at the same time determining the relative position of the individual fluorescent signals on the reaction surface, man

e) to generate unlabelled (NTs or) gene products, the fluorescent dyes and the sterically demanding ligands are split off from the NTs ^* attached to the complementary strand, one

f) the stationary phase obtained in step e) is washed under conditions which are suitable for removing the fluorescent dyes and the ligands

stages a) to f) are repeated several times, if necessary,

whereby the relative position of individual gene product-primer complexes on the reaction surface and the sequence of these gene products are determined by specific assignment of the fluorescence signals detected in step d) in successive cycles at the respective positions to the NTs and the identity of the gene products is determined from the partial sequences determined certainly.

A method according to claim 1, characterized in that stages a) to f) of the cyclic reaction are repeated several times, only one marked NT ^* being used in each cycle.

3. The method according to claim 1, characterized in that the steps a) to f) of the cyclic reaction are repeated several times, using two differently labeled NTs ^* in each cycle.

4. The method according to claim 1, characterized in that steps a) to f) of the cyclic reaction are repeated several times, using four differently marked NTs ^* in each cycle.

5. The method according to claim 1, characterized in that already known genes serve as reference sequences and steps a) to f) of the cyclic reaction are repeated several times, alternately using two differently labeled NTs ^* and two unlabeled NTs in the cycles and the identity of the gene products is determined by comparing the sequences obtained with those of the reference sequences.

6. The method according to claims 1 to 5, characterized in that in each case a primer binding site (PBS) is introduced into the gene products, the primer binding sites each having the same or different sequences for all gene products.

7. The method according to claims 1 to 6, characterized in that the gene products are brought into contact with primers in a solution under conditions which are suitable for hybridizing the primers to the primer binding sites (PBSs) of the gene products, the primers being identical to one another or have different sequences, and one then binds the gene product-primer complexes formed on the reaction surface.

8. The method according to claims 1 to 6, characterized in that the gene products are first immobilized on the reaction surface and only then brought into contact with primers under conditions which are suitable for hybridizing the primers to the primer binding sites (PBSs) of the gene products, wherein Gene product-primer complexes are formed, the primers having the same or different sequences.

9. The method according to claims 1 to 6, characterized in that the primers are first immobilized on the reaction surface and only then brought into contact with gene products under conditions which are suitable for hybridizing the primers to the primer binding sites (PBSs) of the gene products , whereby gene products are bound to the surface and gene product-primer complexes are formed, the primers having identical or different sequences to one another.

10. The method according to claims 1 to 9, characterized in that the density of the extensible gene product-primer complexes is between about 10 and 100 per lOOμm ² .

11. The method according to claims 1 to 10, characterized in that the sterically demanding ligand used for structural modification is the fluorescent dye used for labeling.

12. The method according to claims 1 to 11, characterized in that the reaction surface is selected from the group consisting of silicone, glass, ceramic, plastics, gels.

13. The method according to claim 12, characterized in that the plastics are polycarbonates or polystyrenes or derivatives thereof.

14. The method according to claim 12, characterized in that the gels are agarose or polyacrylamide gels or derivatives thereof.

15. The method according to claim 14, characterized in that the gels are 1 to 2% agarose gels or 5 to 15% polyacrylamide gels.

16. The method according to claims 1 to 15, characterized in that the polymerase is a polymerase without 3'-5'-exonuclease activity.

17. The method according to claim 16, characterized in that the polymerase is selected from the group consisting of thermolabile viral, bacterial DNA polymerases, thermolabile or thermostable viral reverse transcriptases, thermostable DNA polymerases or their modifications.

18. The method according to claim 17, characterized in that the polymerase is Sequenase version 2.

19. The method according to claim 17, characterized in that the polymerase is Taq polymerase.

20. The method according to claim 17, characterized in that the polymerase is ProHa DNA polymerase.

21. The method according to claim 17, characterized in that the polymerase Klenow fragment of DNA polymerase I from E. coli is without 3 '-5' exonuclease activity.

22. The method according to claim 17, characterized in that the polymerase AMV reverse transcriptase without RNase Activity is.

23. The method according to claim 17, characterized in that the polymerase is M-MLV reverse transcriptase.

24. The method according to claim 17, characterized in that the polymerase is HIV reverse transcriptase without RNase activity.

25. The method according to claims 1 to 24, characterized in that the fluorescent dyes are selected from the group consisting of cyanine dyes, rhodamines, xanthenes and their derivatives.

26. A method for the quantitative analysis of gene expression, characterized in that one carries out the method according to claims 1 to 25 and then determines the number of sequences determined for each gene product.

27. The method according to claim 26, characterized in that, in addition to the gene products, one or more control sequences are used in known concentrations, the total concentration of the control sequences being between 0.01 and 10% of the total concentration of the sample to be analyzed.

28. The method according to claims 1 to 27, characterized in that one carries out a sequence analysis of at least about 100,000 to about 10,000,000 gene product molecules.

29. Carrier for performing the method according to claims 1 to 28, characterized in that the gene products are bound in a random arrangement on its surface, the density of the bound gene product molecules being between 10 and 100 per 100 μm ² .

30. Carrier for performing the method according to claims 1 to 28, characterized in that the gene products are bound in a random arrangement on its surface, the density of the bound gene product molecules being between 100 and 1,000,000 per 100 μm ² .

31. Carrier for carrying out the method according to claims 1 to 28, characterized in that the primers are bound in a random arrangement on its surface, the density of the bound primer molecules being between 10 and 100 per 100 μm ² .

32. Carrier for carrying out the method according to claims 1 to 28, characterized in that the primers are bound in a random arrangement on its surface, the density of the bound primer molecules being between 100 and 10,000 per 100 μm ² .

33. Carrier for carrying out the method according to claims 1 to 28, characterized in that the primers are bound in a random arrangement on its surface, the density of the bound primer molecules being between 10,000 and 1,000,000 per 100 μm ² .

34. Kit for carrying out the method according to claims 1 to 28, characterized in that it contains a reaction surface (a solid support), reaction solutions required for carrying out the method, one or more polymerases, and nucleotides (NTs), one of which is four are labeled with fluorescent dyes, the labeled NTs also being structurally modified (NT ^* or NTs ^* ) in such a way that the polymerase, after incorporating such an NT ^* into a growing complementary strand, is unable to to install another NT ^* in the same strand, the fluorescent dye being cleavable and the structural modification being a cleavable, sterically demanding ligand.

35. Kit according to claim 34, characterized in that the sterically demanding ligand used for structural modification is the fluorescent dye used for labeling.

36. Kit according to claim 34 or 35, characterized in that it further contains components:

a) oligonucleotide primers, b) reagents required for cleaving off the fluorescent dyes and bulky ligands, and / or c) washing solutions.

37. Kit according to claims 34 to 36, characterized in that the reaction surface is selected from the group consisting of silicone, glass, ceramic, plastics, gels.

38. Kit according to claim 37, characterized in that the plastics are polycarbonates or polystyrenes or derivatives thereof.

39. Kit according to claim 37, characterized in that the gels are agarose or polyacrylamide gels or derivatives thereof.

40. Kit according to claim 39, characterized in that the gels are 1 to 2% agarose gels or 5 to 15% polyacrylamide gels.

41. Kit according to claims 34 to 40, characterized in that the reaction surface is a carrier according to claims 29 to 33.

42. Kit according to claims 34 to 41, characterized in that the DNA polymerase is a DNA polymerase without 3 '-5' exonuclease activity.

43. Kit according to claim 42, characterized in that the polymerase is selected from the group consisting of viral DNA polymerases of the sequenase type, bacterial DNA polymerases, reverse transcriptases and thermostable DNA polymerases.

44. Kit according to claim 43, characterized in that the polymerase Sequenase version 2, Klenow fragment of DNA polymerase I from E. coli without 3 '-5' exonuclease activity, AMV reverse transcriptase without RNase activity, M-MLV reverse transcriptase , HIV reverse transcriptase without RNase activity, Taq polymerase or ProHa DNA polymerase.

45. Kit according to claims 34 to 44, characterized in that the fluorescent dyes are selected from the group consisting of cyanine dyes, rhodamines, xanthenes and their derivatives.

46. Nucleotides of the formula

6e-l)

e-2)

e-3)

X = NH, O, S

Z = NH ₂ , OH, dye

e-4)

X = NH, O, SY = NH, O, SZ = NH ₂ , OH

e-5)

X = NH, O, S

Z = NH ₂ , OH, dye 6e-6)

X = NH, O, SX = NH, O, SZ = NH ₂ , OH

47. Nucleotides of the formula

6f-l)

6f-2)

6f-3)

6f-4)

48. nucleotides of formula 6g-l)

6g-2)

49. Nucleotide according to claim 46 to 48, characterized in that a fluorescent dye is attached to the terminal amino group.

50th nucleotide of the formula

6h)

left

51. Nucleotide of the formula

left

52. Nucleotide of the formula

6j) dNTP-SS-TRTTC (L 14)

left

53. Use of a nucleotide according to claims 46 to 52 as NT ^* in a method according to claims 1 to 28.

54. Use of a nucleotide corresponding to FIG. 6k, 6L, 6m, as NT ^* in a method according to claims 1 to 28.