WO2002088381A2 - Procede pour determiner l'expression genique - Google Patents

Procede pour determiner l'expression genique Download PDF

Info

Publication number
WO2002088381A2
WO2002088381A2 PCT/EP2002/004657 EP0204657W WO02088381A2 WO 2002088381 A2 WO2002088381 A2 WO 2002088381A2 EP 0204657 W EP0204657 W EP 0204657W WO 02088381 A2 WO02088381 A2 WO 02088381A2
Authority
WO
WIPO (PCT)
Prior art keywords
nts
polymerase
gene products
reaction
primer
Prior art date
Application number
PCT/EP2002/004657
Other languages
German (de)
English (en)
Other versions
WO2002088381A3 (fr
Inventor
Dmitri Tcherkassov
Original Assignee
Genovoxx Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genovoxx Gmbh filed Critical Genovoxx Gmbh
Priority to AU2002312859A priority Critical patent/AU2002312859A1/en
Publication of WO2002088381A2 publication Critical patent/WO2002088381A2/fr
Publication of WO2002088381A3 publication Critical patent/WO2002088381A3/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B20/00—Methods specially adapted for identifying library members
    • C40B20/02—Identifying library members by their fixed physical location on a support or substrate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6809—Methods for determination or identification of nucleic acids involving differential detection
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B30/00—Methods of screening libraries
    • C40B30/10—Methods of screening libraries by measuring physical properties, e.g. mass
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C40B40/08—Libraries containing RNA or DNA which encodes proteins, e.g. gene libraries

Definitions

  • the invention describes a method for parallel analysis of the expression of a large number of genes. This method is based on the analysis of sequences on many bound nucleic acid chains. To do this, short sequence sections are determined from each of these chains. The subsequent evaluation and comparison with gene sequences in databases allows statements about the expressed genes and the strength of their expression.
  • DNA - deoxyribonucleic acid of different origins and different lengths (genomic DNA, cDNA, ssDNA, dsDNA) RA - ribonucleic acid (mostly RNA)
  • Gene products - mRNA transcripts or nucleic acid chains derived from the mRNA e.g. single-stranded cDNAs, double-stranded cDNAs, RNA derived from cDNA or DNA amplified from cDNA).
  • cDNA - complementary DNA e.g. single-stranded cDNAs, double-stranded cDNAs, RNA derived from cDNA or DNA amplified from cDNA.
  • Polymerases - enzymes that can incorporate complementary nucleotides into a growing DNA or RNA strand e.g. DNA polymerases, reverse transcriptases, RNA polymerases
  • dNTP - 2 deoxy nucleoside triphosphates, substrates for DNA polymerases and reverse transcriptases
  • NTP - nucleoside triphosphates substrates for RNA polymerases NT - natural nucleotide, usually dNTP, unless expressly stated otherwise.
  • NT is also used when specifying the length of a nucleic acid sequence, e.g. NT 1,000.
  • NT stands for nucleoside monophosphates.
  • NT stands for “nucleotide”
  • NTs stands for several nucleotides.
  • NT * - modified nucleotide, usually dNTP, if not explicitly marked otherwise.
  • NTs * means: modified nucleotides
  • Flat surface surface which preferably has the following features: 1) It allows several individual molecules, preferably more than 100, more preferably more than 1000, to be detected simultaneously with the given objective-surface distance at one objective position. 2) The immobilized or bound individual molecules are in the same focal plane, which can be set reproducibly.
  • Steric obstacle Sterically demanding group, whose chemical structure changes the properties of the NTs * coupled with this group in such a way that they cannot be successively incorporated into one extension reaction by a polymerase.
  • termination is the reversible stop in the installation of the modified, uncleaved NTs * . This term is to be separated from the usual use of the word "termination" by dideoxy-NTP in conventional sequencing.
  • the termination comes after the installation of a modified NT * .
  • the modified built-in NT * carries a steric group which is reversibly coupled to the base and which prevents the incorporation of a next complementary NT * into the growing strand by a polymerase.
  • Wide-field optical detection system - detection system which can simultaneously detect fluorescence signals from individual molecules distributed over an area, the area being approximately 100 ⁇ m 2 and larger.
  • An example of wide-field detection optics is the Axiovert 200 or Axioplan 2e (Zeiss) fluorescence microscope with a Planeofluar objective 10Ox NA 1.4 oil immersion (Zeiss), or a planapochromatic objective lOOx NA 1.4 oil immersion (Zeiss);
  • the fluorescence can be excited using a lamp, for example a mercury vapor lamp, or a laser or diode. Both epifluorescence mode and total reflection Fluorescence microscopy mode (total internal reflection fluorescence microscopy, TIRF microscopy) or laser scanning microscopy mode can be used. This wide field detection optics is used in this application.
  • the analysis of gene expression is a complex task: the number of genes active in a cell type can be several thousand. However, the analysis should consider all genes contained in the genome of the species in question (approximately 32,000 in humans). In addition, the genes active in the respective cell type are first of all mostly not yet completely known and secondly they are expressed to different extents.
  • the major disadvantages of the hybridization method include: The production of the oligonucleotides bound to the surface is expensive. The analysis is limited to genes whose sequences are already known. Multiple mismatch controls increase the number of oligonucleotides that need to be immobilized.
  • the present invention describes a method for the parallel analysis of a large number of nucleic acid chain molecules. It is based on the detection of fluorescence signals from individual molecules. By simultaneous sequencing of individual gene product molecules, the method has several advantages over the prior art:
  • the gene products can bind to the surface in any arrangement. A previous complex synthesis of different oligonucleotides at certain positions (such as in the hybridization method) is therefore not necessary.
  • the material can be analyzed on a standardized surface.
  • mRNA from a single cell can be sufficient for the analysis.
  • the invention describes a method for parallel analysis of gene expression, in which
  • the gene products are bound to a reaction surface in a random arrangement using one or more different primers in the form of gene product-primer complexes;
  • a solution is added to the gene product-primer complexes bound on the surface which contains one or more polymerases and one to four modified nucleotides (NTs * ) which are labeled with fluorescent dyes, the simultaneous use of at least two NTs * fluorescent dyes on the NTs * are selected so that the NTs * used differ from one another by measuring different fluorescence signals.
  • the NTs * are structurally modified on the base so that the polymerase after installing such an NT * in a growing complementary strand is unable to incorporate another NT * in the same strand, whereby the fluorescent dye is cleavable and the structural modification is a cleavable, sterically demanding ligand, one
  • stage b) the stationary phase obtained in stage a) is incubated under conditions which are suitable for the extension of the complementary strands, the complementary strands being extended in each case by one NT * , man
  • stage b) the stationary phase obtained in stage b) is washed under conditions which are not suitable for the removal of NTs * which are not incorporated into a complementary strand
  • the individual NTs * built into complementary strands are detected by measuring the signal characteristic of the respective fluorescent dye, at the same time determining the relative position of the individual fluorescent signals on the reaction surface
  • step f) the stationary phase obtained in step e) is washed under conditions which are suitable for removing the fluorescent dyes and the ligands
  • stages a) to f) are repeated several times, if necessary,
  • the gene products are the primary gene products of the genes whose expression is to be analyzed. Essentially, these are RNA transcripts of the genes mentioned, which are also referred to as target sequences (or target nucleic acid sequences). In addition to mRNA, these target sequences also include single-stranded and double-stranded cDNA derived therefrom, RNA derived from cDNA or DNA amplified from cDNA.
  • the gene products or target sequences can either be isolated as mRNAs directly from a biological sample (e.g. cell extract, tissue extract or extract from whole organisms) or obtained as cDNAs by reverse transcription of the mRNAs.
  • a highly parallel analysis is understood to mean the simultaneous sequence analysis of many gene product molecules (for example at least approximately 100,000, preferably at least approximately 500,000, but in particular at least approximately 1,000,000 to approximately 10,000,000), these gene product molecules being a complex heterogeneous Represent population, for example corresponds to a complete expression profile or an expression spectrum of a tissue.
  • the process can be carried out by repeating steps a) to f) of the cyclic build-up reaction several times, with
  • the method can also be carried out by repeating steps a) to f) of the cyclic build-up reaction several times, alternately using two differently labeled NTs * and two unlabeled NTs in the cycles and comparing the identity of the gene products with the reference sequences determined.
  • the present invention furthermore relates to the nucleotides shown in FIGS. 6e, 6f and 6g and the corresponding labeled nucleotides, which have, for example, fluorescent dyes attached to the terminal amino function, or the labeled nucleotides shown in FIGS. 6h, 6i or 6j.
  • the present invention furthermore relates to the use of the nucleotides shown in FIGS. 6e, 6f and 6g and the corresponding nucleotides marked with a fluorescent dye for the method according to the invention.
  • the present invention furthermore relates to the use of the NT * s modified on the base (for examples see FIGS. 6k, 6L and 6m) and the corresponding nucleotides marked with a fluorescent dye for the process according to the invention.
  • the method is based on several principles:
  • Short nucleotide sequences (10-50 NTs) contain enough information to identify the corresponding gene if the gene sequence itself is already contained in a database.
  • a sequence of, for example, 10 NTs can form more than 10 6 different combinations. This is, for example, for most genes in the human genome, which is currently estimated at 32,000 Contains genes, sufficient. The sequence can be even shorter for organisms with fewer genes.
  • the method is based on a new method for sequencing individual nucleic acid chain molecules.
  • Nucleic acid chain is analyzed.
  • mRNAs or nucleic acid chains derived from the mRNA can be used to investigate gene expression. Regardless of the exact composition, they are referred to below as gene products. Partial sequences of these gene products are also referred to below as gene products.
  • the synthesis is based on the synthesis of a strand that is complementary to the gene product.
  • the aim of the preparation is to provide gene product-primer complexes which are bound in a random manner on a flat surface and on which the incorporation of NT * s by the polymerase can take place (gene product-primer complexes which can be extended).
  • the sequencing reaction is carried out with these bound gene product-primer complexes.
  • a cycle comprises the following steps: a) adding a solution with labeled nucleotides (NTs * ) and polymerase to bound gene product-primer complexes, b) incubation of the bound gene product-primer complexes with this solution under conditions which are suitable for extending the complementary strands by one NT, c) washing, d) detection of the signals from individually modified NTs incorporated into the newly synthesized strands * - Molecules, e) removal of the label from the built-in nucleotides, f) washing.
  • This cycle can be repeated several times, so that preferably 10 to 50 NTs are determined for each gene product-primer complex participating in the sequencing reaction.
  • the nucleic acid sequences are then reconstructed from the detected signals.
  • the determined sequences of the bound gene products are compared with one another to determine the abundances and are assigned to specific genes by comparison with gene sequences in databases.
  • a mixture of mRNA molecules serves as the starting material.
  • the material to be analyzed (1) is bound (2) on a suitable flat surface.
  • the oligo-dT primers previously bound to the surface mediate the binding of gene products to the surface.
  • the gene products are bound to the primers by hybridization (annealing).
  • the unbound mRNA molecules are removed by a washing step.
  • the sequencing reaction is then carried out on the entire reaction surface, with labeled NT * s being incorporated into the gene product-primer complexes which can be extended. This reaction is cyclical. In the 1st step of the cycle, a labeled NT * is built into the growing strand: The reaction is controlled so that only one labeled NT * from a polymerase in each cycle
  • Reverse transcriptase can be built into the growing strand. This is achieved by using NTs * which carry a reversibly coupled group leading to termination. This prevents the installation of another marked NT * .
  • the polymerase and the labeled NTs * are used simultaneously in the reaction (3).
  • the reaction mixture is then removed and the surface is washed in a suitable manner (4).
  • a detection step (5) now follows. The surface is scanned with a device suitable for single-molecule detection (consisting, for example, of a light source, microscope, camera, scanning table, computer with control and image recognition or image processing software) and the signals of the individual, built-in marked NTs * are identified. After the detection step, the marker and the group leading to the termination are removed from all installed NTs * (6). The removal can take place chemically, physically or enzymatically. After a subsequent washing step, a new cycle can begin.
  • Gene products can come from various biological objects, e.g. of individual cells, cell populations, a tissue or of entire organisms.
  • Biological fluids such as blood, sputum or cerebrospinal fluid can also serve as a source of the gene products.
  • the methods for obtaining the gene products from the various biological objects can be found, for example, in the following literature sources: "Molecular cloning” 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, “Method in Enzymology” 1999, v303, "cDNA library protocols” 1997, Ed. I. G. Cowell, Humana Press Inc.
  • Sequencing reaction can be used.
  • the amount of gene products to be analyzed can be determined by preselection to reduce.
  • the preselection can be carried out, for example, by molecular biological methods such as, for example, PCR amplification, gel separation or hybridization with other nucleic acid chains ("Molecular cloning” 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, “Method in Enzymology” 1999, v303, “cDNA library protocols "1997, Ed. IG Cowell, Humana Press Inc.)
  • the entirety of the gene products is preferably chosen as the starting material.
  • the aim of the preparation of the material is to form extensible gene product-primer complexes bound to the surface from the starting material. These then preferably have the structure shown in FIG. 2. Whereby only a maximum of one primer should bind per gene product.
  • Each gene product preferably has only one primer binding site.
  • a primer binding site is a sequence section which is intended to enable selective binding of the primer to the gene product.
  • Sections in the nucleic acid sequence that naturally occur in the sequences to be analyzed can serve as primer binding sites (e.g. polyA stretches in mRNA).
  • a primer binding site can also be introduced into the gene product (Molecular cloning "1989, Ed. Maniatis, Cold Spring Harbor Laboratory,” Method in Enzymology “1999, v303,” cDNA library protocols "1997, Ed. IG Cowell, Humana Press Inc. ).
  • primer binding site that is as uniform as possible in all gene products. Then primers with a uniform structure can be used in the reaction.
  • the composition of the primer binding site is not limits. Their length is preferably between 10 and 100 NTs.
  • the primer binding site can carry a functional group, for example to bind the gene product to the surface. This functional group can be, for example, a biotin or digoxigenin group.
  • nucleotide tailing of antisense cDNA fragments is described as an example of the introduction of a primer binding site into the gene products.
  • cDNAs are synthesized from mRNAs.
  • the result is a population of cDNA molecules that represent a copy of the mRNA population, so-called antisense cDNA.
  • antisense cDNA Molecular cloning "1989, Ed. Maniatis, Cold Spring Harbor Laboratory,” Method in Enzymology “1999, v303,” cDNA library protocols "1997, Ed. IG Cowell, Humana Press Inc.).
  • a terminal deoxynucleotide transferase one can do several ( for example between 10 and 20) attach nucleoside monophosphates to the 3 'end of this antisense cDNA, for example several adenosine monophosphates (called ((dA) n-tail).
  • the resulting fragment is used to bind the primer, in this example one (dT ) n-primers used ("Molecular cloning” 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press, "Method in Enzymology” 1999 v.303, pp. 37-38) (Fig. 3).
  • the composition and the length of the primer are not restricted. In addition to the start function, the primer can also perform other functions, such as creating a connection between the gene product-primer complexes and the reaction surface. Primers should be adapted to the length and composition of the primer binding site so that the primer enables the sequencing reaction to be started with the respective polymerase.
  • the length of the primer is preferably between 6 and 100 NTs, optimally between 15 and 30 NTs.
  • the primer can carry a functional group which is used, for example, to bind the primer to the surface, for example such a functional group is a biotin group (see section Immobilization).
  • synthesis of such a primer can be carried out, for example, using the 380 A Applied Biosystems DNA synthesizer, or else as a custom synthesis from a commercial supplier, 10 for example MWG-Biotech GmbH, Germany.
  • primers can also be used, a defined primer set, or a primer mixture.
  • the primer Before priming, the primer can be fixed to the fragments to be analyzed on the surface using various techniques or synthesized directly on the surface, for example according to (McGall et al. US Patent 5412087, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734,
  • the primers are bound on the surface in a density between 10 to 100 per 100 ⁇ m 2 , 100 to 10,000 per 100 ⁇ m, 10,000 to 1,000,000 per 100 ⁇ m 2 or greater than 1,000,000 per 100 ⁇ m 2 30.
  • the primer or mixture of primers is incubated with gene products under hybridization conditions that selectively bind it to the primer binding site of each gene product.
  • This primer hybridization (annealing) can take place before (1), during (2) or after (3) the binding of the gene products to the surface. If gene products as double-stranded nucleic acids are present, they are denatured by heat before hybridization ("Molecular cloning" 1989 J. Sambrook et al. Cold Spring Harbor Laborotary Press).
  • the optimization of the hybridization conditions depends on the exact structure of the primer binding site and the primer and can be done according to Rychlik et al. (NAR 1990 v.18 p.6409). In the following, these hybridization conditions are referred to as standardized hybridization conditions.
  • an oligo-dT primer can be used.
  • a primer mixture consisting of 12 different primers with the following general structure 5 '(K) n MN3' can also be used. Where (n) is between 10 and 50, preferably between 20 and 30. "K” stands for dT or you, "M” and “N” each stand for dA, dT or du, dC, dG
  • Such a primer mixture enables an exact start of the sequencing reaction at the end of the polyA segment or the poly-dA segment (anchored primer).
  • the aim of the fixation is to fix gene product-primer complexes on a suitable flat surface in such a way that a cyclic enzymatic sequencing reaction can take place. This can be done, for example, by binding the primer (see above) or the gene product to the surface.
  • the order of the steps in the binding of gene product-primer complexes can be variable: 1) The gene product-primer complexes can first be formed in a solution by hybridization (annealing) and then bound to the surface. 2) Primers can first be bound to a surface and gene products can then be hybridized to the bound primers, producing gene product-primer complexes (gene products indirectly bound to the surface) 3) The gene products can first be bound to the surface (gene products directly the surface bound) and in the subsequent step the primers are hybridized to the bound gene products, producing gene product-primer complexes. The gene products can therefore be immobilized on the surface by direct or indirect binding.
  • the surface and the reaction surface are to be understood as equivalent terms, unless explicitly referred to another meaning.
  • the surface of a solid phase of any material serves as the reaction surface. This material is preferably inert towards enzymatic reactions and does not cause any interference with the detection. Silicon, glass, ceramics, plastics (e.g. polycarbonates or polystyrenes), metal (gold, silver, or aluminum) or any other material that meets these functional requirements can be used.
  • the surface is preferably not deformable, since otherwise the signals are likely to be distorted upon repeated detection.
  • this gel can e.g. be an agarose or polyacrylamide gel.
  • the gel is preferably freely passable for molecules with a molecular mass below 5000 Da
  • Polyacrylamide gel can be used). Such a gel surface has the advantage over other solid surfaces that there is a significantly lower non-specific binding of NT * s to the surface. By binding the gene product-primer complexes on the surface, the detection of the fluorescence signals from built-in NTs * is possible. The signals from Free NTs * are not detected because they do not bind to the material of the gel and are therefore not immobilized.
  • the gel is preferably attached to a solid surface (Fig. 4).
  • This solid base can be silicone, glass, ceramic, plastic (for example polycarbonate or polystyrene), metal (gold, silver or aluminum) or any other material.
  • the thickness of the gel is preferably not more than 0.1 mm. However, the gel thickness is preferably greater than the simple depth of field of the lens, so that NTs * bound non-specifically to the solid base do not reach the focal plane and are therefore detected. If the depth of focus is 0.3 ⁇ m, for example, the gel thickness is preferably between 1 ⁇ m and 100 ⁇ m.
  • the surface can be produced as a continuous surface or as a discontinuous surface composed of individual small components (for example agarose balls) (FIG. 4 a, b). The reaction surface must be large enough to be able to bind the necessary number of gene products with the appropriate density. The reaction surface should preferably not be larger than 20 cm 2 .
  • the different cycle steps require an exchange of the different reaction solutions above the surface.
  • the reaction surface is preferably part of a reaction vessel.
  • the reaction vessel is in turn preferably part of a reaction apparatus with a flow device.
  • the flow device enables the solutions in the reaction vessel to be exchanged.
  • the exchange can take place with a pump device controlled by a computer or manually. It is important that the surface does not dry out.
  • the volume of the reaction vessel is preferably less than 50 ⁇ l. Ideally, its volume is less than 1 ⁇ l. An example of such a flow system is given in FIG. 5.
  • Fixation can also be achieved by non-specific binding, for example by drying out the sample containing gene products on the flat surface.
  • the gene products are on the surface in a density between 10 and 100 per 100 ⁇ m 2 , 100 to 10,000 per 100 ⁇ m 2 , 10,000 to 1000,000 per 100 ⁇ m 2
  • the density of extensible gene product-primer complexes required for the detection is approx. 10 to 100 per 100 ⁇ m 2 . It can be achieved before, during or after the hybridization of primer 5 to the gene products.
  • the binding of the gene product 0 primer complexes takes place via biotin-avidin or biotin-streptavidin binding.
  • Avidin or streptavidin is covalently bound on the surface, the 5 'end of the primer is modified with biotin.
  • the modified primers After the modified primers have hybridized with the gene products (in solution), they are fixed on the surface coated with avidin / streptavidin.
  • the concentration of the gene product-primer complexes labeled with biotin and the time of incubation of this solution with the surface is chosen so that a density suitable for sequencing is achieved.
  • the primers suitable for the sequencing reaction are fixed on the surface using suitable methods before the sequencing reaction (see above).
  • the single-stranded gene products, each with one primer binding site per gene product molecule, are thus incubated under hybridization conditions (annealing). They bind to the fixed primers and are thus bound to the surface (indirect binding).
  • the concentration of the single-stranded gene products and the hybridization parameters eg temperature, time, buffer
  • the concentration of the single-stranded gene products and the hybridization parameters are chosen so that a density of approximately 10 to 100 gene product-primer complexes capable of extension per 100 ⁇ m 2 is achieved, which is suitable for sequencing.
  • unbound gene products are removed by a washing step.
  • a surface with a high primer density is preferred, for example approximately 1,000,000 primers per 100 ⁇ m 2 or even higher, since the desired density of gene product-primer complexes is reached more quickly, the gene products binding only to a part of the primers ,
  • the gene products are bound directly to the surface (see above) and then incubated with primers under hybridization conditions.
  • primers At a density of approx. 10 to 100 gene products per 100 ⁇ m 2 , attempts will be made to provide all available gene products with a primer and to make them available for the sequencing reaction. This can be achieved by high primer concentration, for example 1 to 100 mmol / 1. At a higher density the fixed
  • the density of the gene product-primer complexes required for optical detection can be achieved during the primer hybridization.
  • Hybridization conditions e.g. temperature, time, buffer,
  • Primer concentrate so that the primers are only Bind part of the immobilized gene products, see Example 5.
  • a blocking solution is preferably applied to the surface before step (a) in each cycle, in order to avoid non-specific adsorption of NTs * on the surface serves.
  • RNA or DNA The type of immobilized nucleic acid (RNA or DNA) used plays a decisive role in the choice of polymerase:
  • RNA-dependent DNA polymerases can be used, e.g. AMV reverse transcriptase (Sig a), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNAse activity. All reverse transcriptases must be largely free of RNAse activity ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory).
  • DNA is used as a gene product (eg cDNA), in principle all DNA-dependent DNA polymerases without 3 '-5' exonuclease activity (DNA replication "1992 Ed. A. Kornberg, Freeman and Company NY) are suitable as polymerases, eg modified T7 polymerase of the type "Sequenase Version 2" (Amersham Pharmacia Biotech), Klenow fragment of DNA polymerase I without 3 '-5' exonuclease activity (Amersham Pharmacia Biotech), polymerase beta of various origins (Animal Cell DNA Polymerases "1983, Fry M., CRC Press Inc., commercially available from Chimerx) thermostable polymerases such as Taq polymerase (GibcoBRL), proHA DNA polymerase (Eurogentec). 4.4 Nucleotide structure
  • reversible 3'-OH modified NTs have been described in the BASS method (Dower US Patent 5,547,839, Canard et al. US Patent 5,798,210, Rasolonjatovo Nucleosides & Nucleotides 1999, v.18 p.1021, Metzker et al. NAR 1994, v.22, p.4259, Welch et al. Nucleosides & Nucleotides 1999, v.18, p.197).
  • the cleavage is said to be photochemical under mild conditions (Dower US Patent 5,547,839, Welch et al.
  • nucleotides 1999, v.18 p.1021 With this method, a large number of identical single-stranded DNA pieces are fixed at a defined location on a surface and the signal from all of these many identical DNA pieces is analyzed. A solution with polymerase and nucleotides is added to this fixed DNA so that a complementary strand can be synthesized. The polymerase should work step by step: only one nucleotide is incorporated in each step. This is detected, whereupon the polymerase incorporates the next nucleotide in a next cycle. In this method, modified nukeotides were used on the 3 ⁇ -OH group of the deoxyribose.
  • NTs * with a sterically demanding group on the base are used for sequencing.
  • Biotin, digoxigenin and fluorescent dyes such as fluorescein, tetramethylrhodamine and Cy3 dye
  • labeled NTs * are incubated with a polymerase and nucleic acid chains.
  • the NTs * carry a sterically demanding group that is reversibly coupled to the base. If a reaction mixture containing only modified NTs * is used in the reaction, the polymerase can only incorporate a single NT * .
  • the installation of a next NT * is sterically inhibited. These NTs * thus act as terminators of the synthesis. After removing the sterically demanding group, the next complementary NT * can be installed. Because these NTs * do not represent an absolute obstacle to further synthesis, but only for the installation of another marked NT * , they are called semiterminators.
  • Fig. 6a, b, d This structure is characterized in that a steric group (D) and the fluorescent marker (F) are bound to the base via a cleavable linker (A-E).
  • D steric group
  • F fluorescent marker
  • Deoxynucleoside triphosphates with adenosine (A), guanosine (G), cytidine (C) and uridine (U) serve as the basis for the NTs * .
  • Inosine can be used instead of guanosine.
  • Each base is marked with a marker (F) which is characteristic of it (FIG. 6).
  • the marker is a fluorescent dye. Several factors influence the choice of the fluorescent dye. The choice is not restricted if the dye meets the following requirements:
  • the detection apparatus used must be able to identify this marker as the only molecule bound to DNA under mild conditions (preferably reaction conditions).
  • the dyes preferably have great photostability. Their fluorescence is preferably not quenched by the DNA or only to a minor extent.
  • Fluorescent dyes which can be used in the context of the present invention are compiled with structural formulas in "Handbook of Fluorescent Probes and Research Chemicals" 6th ed. 1996, R.Haugland, Molecular Probes.
  • the following dye classes are preferably used as markers: cyanine dyes and their derivatives (for example Cy2, Cy3, Cy5, Cy7 Amersham Pharmacia Biotech, Waggoner US Pat. No. 5,268,486), rhodamines and their derivatives (for example TAMRA, TRITC, RG6, R110 , ROX, Molecular Probes), xanthene derivatives (e.g. Alexa 568, Alexa 594, Molecular Probes, Mao et al. US Pat.
  • cyanine dyes and their derivatives for example Cy2, Cy3, Cy5, Cy7 Amersham Pharmacia Biotech, Waggoner US Pat. No. 5,268,486)
  • rhodamines and their derivatives for example TAMRA, TRITC
  • dyes are commercially available. Depending on the spectral properties and the equipment available, appropriate dyes can be selected.
  • the dyes are coupled to the linker, for example via a thiocyanate or ester bond ("Handbook of Fluorescent Probes and Research Chemicals" 6th ed. 1996, R.Haugland, Molecular Probes, Jameson et al. Methods in Enzymology 1997 v.278 P.363, Waggoner Methods in Enzymology 1995 v.246 p.362), p. Examples 1 and 2.
  • Biotin, digoxigenin and fluorescent dyes such as fluorescein, tetramethylrhodamine and Cy3 dye are examples of such a sterically demanding group (Zhu et al. Cytometry 1997, v.28, p.206, Zhu et al. NAR 1994, v.22, P.3418, Gebeyehu et al., NAR 1987, v.15, p.4513, Wiemann et al. Analytical Biochemistry 1996, v.234, p.166, Heer et al. BioTechniques 1994 v.16 p.54).
  • the chemical structure of this group is not restricted provided that it does not significantly interfere with the incorporation of the labeled NT * to which it is attached and does not cause an irreversible disturbance in the enzymatic reaction.
  • This . Group can appear as an independent part in the linker (6a) or can be identical to the dye (6b) or the cleavable group (6d).
  • this sterically demanding group (D) is removed after detection of the signal, so that the polymerase can incorporate another labeled NT * .
  • the steric group is removed by the cleavage.
  • the fluorescent dye takes over the function of such a sterically demanding group, so that a labeled nucleotide is one in FIG. 6b, k, l structure shown.
  • the photolabile cleavable group takes over the function of such a sterically demanding group (FIG. 6d).
  • the marker (fluorescent dye) is preferably attached to the base via a spacer of different lengths, a so-called linker.
  • linkers are given in Fig. 6e, f, g, h, i, j, k, l, m.
  • Examples of coupling a linker to the base can be found in the following sources (Hobbs et al. US Patent 5,047,519, Khan et al. US Patent 5,821,356, Klevan et al. US Patent 4,828,979, Hanna M. Method in Enzymology 1996 v.274, p.403, Zhu et al. NAR 1994 v.22 p.3418, Herman et al.
  • the total length of the linker can vary. It corresponds to the number of carbon atoms in sections A, C, E (FIGS. 6a, b, d) and is preferably between 3 and 20. Optimally, it is between 4 and 10 atoms.
  • the chemical composition of the linker (sections A, C, E in FIGS. 6a, b, d) is not restricted, provided that it remains stable under reaction conditions and does not cause any disturbance in the enzymatic reaction.
  • the linker carries a fissile connection or fissile Group (section (B) in Fig. 6a, b, d and section (C) in Fig. 6k, 1).
  • This fissile connection enables the marker and steric obstacle to be removed at the end of each cycle.
  • Your choice is not restricted as long as it remains stable under the conditions of the enzymatic sequencing reaction, does not cause an irreversible disturbance of the polymerase and can be split off under mild conditions.
  • “Mild conditions” are understood to mean those conditions which do not destroy the gene product-primer complex, the pH value, for example, preferably being between 3 and 11 and the temperature between 0 ° C. and a temperature value (x).
  • This temperature value (x) depends on the Tm of the gene product-primer complex (Tm is "melting point”) and is calculated, for example, as Tm (gene product-primer complex) minus 5 ° C (eg Tm is 47 ° C, then lies the maximum temperature at 42 ° C; under these conditions, ester, thioester, disulfide compounds and photolabile compounds are particularly suitable as cleavable compounds).
  • the compound mentioned preferably belongs to chemically or enzymatically cleavable or photolabile compounds.
  • chemically cleavable groups ester, thioester and disulfide compounds are preferred (Fig. 6k, 1) ("Chemistry of protein conjugation and crosslinking" Shan S. Wong 1993 CRC Press Inc., Herman et al. Method in Enzymology 1990 v.184 p.584, Lomant et al. J. Mol.Biol. 1976 v.104 243, "Chemistry of carboxylic acid and esters" S.Patai 1969 Interscience Publ.).
  • photolabile compounds Fig.
  • the position of the fissile link / group in the linker is preferably no more than 10 atoms from the base, more preferably no more than 3 atoms.
  • the cleavable compound or group is particularly preferably located directly on the base.
  • the cleavage and removal step is present in every cycle and must be carried out under mild conditions (see above) so that the nucleic acids are not damaged or modified.
  • the cleavage preferably takes place chemically (for example in a mild acidic or basic environment for an ester compound or by adding a reducing agent, for example dithiothreitol or mercaptoethanol (Sigma) when cleaving a disulfide compound), see Example 1, or physically (for example by lighting the surface with light of a certain wavelength for the cleavage of a photolabile group, thesis "New photolabile protective groups for light-controlled oligonucleotide synthesis" H. Giegrich, 1996, Constance).
  • a reducing agent for example dithiothreitol or mercaptoethanol (Sigma)
  • the size, the charge and the chemical structure of the marker, the length of the cleavable linker and the linker residue and also the choice of polymerase play an important role. Together they determine whether the labeled NT * is incorporated into the growing nucleic acid chain by the polymerase and whether this prevents the incorporation of the next labeled NT * becomes. Two conditions are particularly important:
  • the polymerase can further extend the nucleic acid chain with the built-in modified NT * after the linker has been cleaved. It is therefore important that the linker residue "A" (FIG. 6c) after cleavage does not represent a significant disturbance for the further synthesis.
  • built-in, non-split NTs * must be an obstacle. Many NTs * suitable for the reaction can be synthesized. In particular, a preliminary test series must be carried out for each combination of polymerase and NTs * , in which the suitability of a particular NT * type for sequencing is tested.
  • the buffer conditions are chosen according to the polymerase manufacturer.
  • the reaction temperature is selected for non-thermostable polymerases according to the manufacturer (e.g. 37 ° C for Sequenase version 2), for thermostable polymerases (e.g. Taq polymerase) the reaction temperature is at most the temperature value (x).
  • This temperature value (x) depends on the Tm of the gene product-primer complex and is e.g. calculated as Tm (gene product primer complex) minus 5 ° C (e.g. Tm is 47 ° C, then the maximum is
  • the reaction time (corresponds to the duration of the installation step in one cycle) is preferably less than one hour, ideally the reaction time is between 10 seconds and 10 minutes.
  • DNA eg cDNA
  • NT * with a short linker residue synthesis see Example 2, Fig. 6e, h, i: dNTP-SS-TRITC (L7), dNTP-SS-Cy3 (Lll) and / or NT * with a long linker residue
  • Fig. 6f, g, j dNTP-SS-TRITC (L14) in combination with Sequenase Version 2, Taq polymerase (GibcoBRL), ProHA-DNA- 5 polymerase (Eurogentec) or Klenow fragment of DNA polymerase I from E. coli without 3 '- 5 'exonuclease activity (Amersham Pharmacia Biotech) can be used.
  • RNA eg mRNA
  • NT * with a short linker residue synthesis see Example 2, Fig. 6e, h, i): dNTP-SS-TRITC (L7), dNTP-SS- Cy3 (III) and / or NT * with a long linker residue
  • dUTP * with the desired cleaved linker residue poly-dA as a template for DNA polymerases such as Sequenase version 2, Taq polymerase, or poly-A as a template for reverse transcriptases such as AMV reverse
  • NT * concentration is preferably between 5 ⁇ mol / l and
  • the number of NTs * incorporated into the nucleic acid chain is analyzed, for example by lengthwise separation in a gel. The following information can be used to draw conclusions about the suitability of the linker residue: If the polymerase can incorporate more than 20 NTs * ,
  • this linker residue is suitable for a sequencing reaction.
  • this combination of NT * and polymerase is not optimal for them Sequencing reaction.
  • NT * function as semiterminators. This is checked by incubating the labeled NTs * with the polymerase and a template under optimal buffer and temperature conditions suitable for the reaction.
  • the NT * concentration is preferably between 5 ⁇ mol / l and 200 ⁇ mol / l.
  • the matrix must be selected so that the installation of several NTs * would be expected one after the other, e.g. for dUTP * you can use polydA or poly-A, as in the example shown above.
  • the polymerase incorporates only a single NT * .
  • NT * concentration, reaction temperature e.g. 10 * concentration, reaction temperature
  • this adaptation takes place in one embodiment by changing the reaction temperature.
  • the other parameters of the reaction are kept constant.
  • polymerases can be used as polymerases, for example, polymerases which are DNA polymerases without 3 '-5' exonuclease activity, preferably from the group consisting of viral DNA polymerases from sequenase -Type, bacterial DNA polymerases I, thermostable DNA polymerases and their modifications. Sequenase version 2, Klenow fragment of DNA polymerase I from E. coli without 3 '-5' exonuclease activity, Taq polymerase or ProHA DNA polymerase are particularly suitable. If RNA is included as a gene product (e.g.
  • RNA-dependent DNA polymerases can be used, for example AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNase activity.
  • the NT * concentration is usually between 5 ⁇ mol / l and 200 ⁇ mol / l, preferably between 10 ⁇ mol / l and 100 ⁇ mol / l.
  • the concentration of the polymerase and the buffer conditions are selected according to the manufacturer.
  • the duration of the reaction can vary and is preferably between 10 sec and 10 min, which is the duration of the
  • Installation step (b) would correspond to one cycle.
  • non-thermostable polymerases such as Sequenase version 2
  • reaction temperature is reduced from conventional 37 ° C, preferably to 20 ° C to 30 ° C.
  • thermostable polymerases such as Taq polymerase (GibcoBRL), ProHA DNA
  • the reaction temperature from conventional 70-75 ° C is preferably reduced to values between 30 ° C and the temperature value (x).
  • This temperature value (x) depends on the Tm of the gene product primer complex and is calculated as Tm (gene product primer complex) minus 5 ° C (eg Tm is 47 ° C, then the temperature value (x) is 42 ° C ).
  • the reaction conditions are adjusted by reducing the NT * concentration to below 5 ⁇ mol / l, the other parameters of the reaction (buffer conditions, temperature conditions) are kept constant.
  • the concentration of the NT * s is preferably between 0.5 and 5 ⁇ mol / l.
  • the duration of the reaction is between 10 sec and 10 min. The most important thing when choosing the NT * - Concentration is that the polymerase does not incorporate a second NT * in the specified time (preferably between 10 sec and 10 min).
  • the reaction After optimizing the reaction conditions for the installation of a single NT * , the reaction must be repeated with split NTs * . If the reaction parameters are changed accordingly, the polymerase must be able to incorporate the cleaved NTs * one after the other.
  • the optimization reaction correlates with the installation step, step (b), in one cycle.
  • the conditions determined for the optimization reaction, the temperature, the concentration of NT * , the buffer conditions and the duration of the reaction are adopted for the reaction on the surface.
  • the incorporation of NT * into the strands complementary to gene products preferably takes place in such a way that a labeled NT * is preferably incorporated in more than 50% of the gene products involved in the sequencing reaction (gene product-primer complexes which can be extended) in one cycle more than 90%. This is due to the fact that the reaction on some nucleic acid chains is very slow. An installation of the NTs * at every complementary position in each cycle is aimed for, but is not necessary because only the successful installation reactions are detected and evaluated; a delayed reaction in the subsequent cycle does not lead to a sequencing error.
  • the same polymerase is preferably used for all NTs * .
  • different polymerases can also be used for different NTs * . 4.4.8 Color coding scheme, number of dyes
  • a cycle can be carried out with:
  • a label with two dyes can be selected. Two pairs of NTs * are formed, each marked differently, eg A and G are marked "X”, C and U are marked "Y”. Two differently labeled NTs * are used simultaneously in the reaction in one cycle (s), for example C * in combination with A * , and U * and G * are then added in the subsequent cycle (n + 1).
  • fluorescence signals of individual NTs * built into the nucleic acid chain are preferably measured using a wide-field fluorescence microscope (epifluorescence) or a laser scanning microscope or a TIRF microscope (Total Internal Reflection Fluorescence Microscope) (wide-field optical detection system).
  • the device for the excitation light can function, for example, on the basis of a laser, a lamp or diodes. Both CCD cameras and PMT can be used for the detection device.
  • Light source for exciting fluorescence (1) Light-guiding part (2) Scanning table (3)
  • the detection comprises the following phases:
  • each detection step running as a scanning process and comprising the following operations: a) adjusting the position of the lens (X, Y axis), b) adjusting the focal plane (Z axis), c) detecting the Signals of individual molecules, assignment of the signal to NT * and assignment of the signal to the respective gene product, d) shift to the next position on the surface.
  • the signals from NTs * built into the strands complementary to the gene products are registered by scanning the surface.
  • the scanning process can be carried out in various ways ("Confocal Laser Scanning Microscopy” 1997 Ed. Sheppard, BIOS Scientific Publishers, “New Techniques of optical microscopy and microspectroscopy” 1991 Ed. R.Cherry CRC Press, Inc., "Fluorescence microscopy” 1998 2. ed. Herman BIOS Scientific Publishers, “Handbook of biological confocal microscopy” 1995 J. Pavley Plenum Press).
  • a discontinuous scanning process is selected.
  • the objective is moved step by step over the surface (FIG. 8a), so that a two-dimensional image (2D image) is created from each surface position (FIG. 8b, c), for experimental arrangement see FIG. Example 5.
  • This 2D image can be created using various methods: for example, by laser scanning a position of the microscope field (laser scanning microscopy) or by taking a camera image at a position (cf. microscopy manuals).
  • laser scanning microscopy or by taking a camera image at a position
  • camera image at a position
  • microscopy manuals One example is the detection of individual molecules with a CCD camera described.
  • the exact number depends e.g. on the relative presence of the gene products in the approach and on the desired accuracy of the analysis.
  • the number of gene products analyzed is preferably between 1000 and 10,000,000. For highly expressed genes, the number of gene products analyzed can be low, e.g. 1000 to 10,000. When analyzing poorly expressed genes, it must be increased, e.g. to 100,000 or even further. For example, 100,000 individual gene products are analyzed at the same time.
  • Weakly expressed genes e.g. with approx. 100 mRNA molecules / cell, which corresponds to approx. 0.02% total mRNA are also represented in the reaction with an average of 20 identified gene products.
  • the positions of the gene product-primer complexes must be determined for sequencing, so that one has a basis for the assignment of the signals. Knowing these positions allows a statement to be made as to whether the signals of individual molecules come from built-in NTs * or from randomly bound NTs * . These positions can be identified using various methods.
  • the positions of immobilized gene products are identified during sequencing. This makes use of the fact that the signals from the NTs * built into the nucleic acid chain always have the same coordinates. This is ensured by fixing the nucleic acid chains. The non-specifically bound NTs * bind randomly at different points on the surface.
  • the signals are checked for their coordinates from several successive cycles. This can be done, for example, at the beginning of the sequencing.
  • the matching coordinates are evaluated and stored as coordinates of the gene products.
  • the scan system must be able to scan the surface reproducibly over several cycles.
  • X, Y and Z axis settings at each surface position can be controlled by a computer.
  • the stability and reproducibility of the setting of lens positions in each scanning process determine the quality of the detection and thus the identification of the signals of individual molecules.
  • Signals from individual molecules are placed in relation to the pattern, so that an X, Y deviation in the pattern position means the same X, Y deviation in the position of the signals of individual molecules.
  • the A control picture of the pattern can be taken before, during or after the detection of individual molecules. Such a control picture must be made accordingly with each setting on a new surface position.
  • the surface is not absolutely flat and has various bumps. This changes the surface-lens distance when scanning neighboring locations. These differences in distance can lead to individual molecules leaving the focal plane and thus avoiding detection.
  • the following method can be used: Since the excitation of individual molecules can lead to the extinction of their fluorescence, a marker is applied to the surface, which serves to adjust the focal plane. The signals of individual molecules are then detected.
  • the marker can be of any nature (e.g. dye or pattern), but must not interfere with the detection and the reaction.
  • the two-dimensional image of the reaction surface generated with the aid of the detection system contains the signal information from NT * s built into the gene products. Before further processing, these must be extracted from the total amount of image information using suitable methods.
  • the necessary algorithms for scaling, transformation and Filtering of image information is part of the standard repertoire of digital image processing and pattern recognition (Haberburger P. "Practice of digital image processing and pattern recognition”. Hanser-Verlag, Kunststoff, Vienna, 1995; Galbiati LJ "Machine vision and digital image processing fundamentals”. Prentice Hall, Englewood Cliffs, New Jersey, 1990).
  • the signal extraction is preferably carried out via a gray value image, which depicts the brightness distribution of the reaction surface for the respective fluorescence channel.
  • a separate gray value image can first be generated for each fluorescence-labeled nucleotide (A, T, C, G or U).
  • A, T, C, G or U fluorescence-labeled nucleotide
  • a gray value image is generated for each fluorescence channel by using suitable filters (Zeiss filter sets).
  • Image processing program extracts the relevant color channels and processes them individually as gray-scale images.
  • a channel-specific coloring threshold algorithm is used for channel extraction.
  • Individual gray value images 1 to N are thus initially created from a multi-channel color image. These images are defined as follows:
  • Preprocessing of the image for example, if necessary, reducing the image noise caused by the digitization of the image information, for example by gray value smoothing.
  • an image point (x, y) fulfills these requirements, then a comparison with the coordinates of gene products identified in previous sequencing cycles follows. If there is a match, the signal is associated with the nucleotide emerging from the respective fluorescence channel to this gene product. Signals with mismatched coordinates are evaluated as background signals and rejected. The signals can be analyzed in parallel with the scanning process.
  • an eight-bit gray-scale image with a resolution of 1317 x 1035 pixels was used.
  • the overall image was first preprocessed: the average value of the brightness of its 8 neighbors was assigned to each pixel. With the selected resolution, this creates one for a fluorescence point typical pattern of a central pixel with the greatest brightness value and neighboring pixels with brightness falling towards all sides. If a pixel met these criteria and the centrifugal drop in brightness exceeded a certain threshold value (to exclude fluorescence spots that were too weak), this central pixel was evaluated as the coordinate of a fluorescence spot.
  • a sequence of recordings can be made with the control of the X, Y position, the adjustment of the focal plane and with the detection of individual molecules at each new lens position. These steps can be controlled by a computer.
  • the scanning process and the biochemical reaction take a certain amount of time. If you switch these processes one after the other, you can achieve an optimal performance of the equipment. In a preferred embodiment, the reaction is carried out on two separate surfaces (FIG. 9).
  • a surface with bound gene products can be separated into two spatially isolated parts, so that reactions on these two parts can take place independently of one another.
  • gene products can also be immobilized on two separate surfaces from the outset.
  • the reaction is then started.
  • the principle is that while the reaction and washing steps take place on part of the surface, the second part is scanned. Thereby you can achieve a continuous flow of analysis and increase the speed of sequencing.
  • the number of surfaces on which the reaction takes place can also be greater than 2. This makes sense if the reaction occurs as a time-limiting step, i.e. the detection of the signals on the surface is faster than the reaction and washing steps. In order to adapt the total duration of the reaction to the detection duration, each individual step of the reaction can take place on a single surface with a time delay compared to the next surface.
  • the data obtained are compared using a program with known gene sequences.
  • a program can e.g. based on a BLAST or FASTA algorithm ("Introduction to computational Biology” 1995 M.S. Waterman Chapman & Hall).
  • the choice of the method for material preparation determines, among other things, in which sections of the gene products the sequences are determined and to which strand (sense or antisense) they belong. For example, are determined when using the polyA stretches as primer binding sites in mRNA sequences from NTRs (non-translating regions). When using the method with antisense cDNA as a template, the sequences determined come, inter alia, from the protein-coding regions of the gene products.
  • the gene expression is only determined qualitatively. Only the fact that certain genes are expressed is important.
  • one is quantitative determination of the relationships between individual gene products in the approach of interest. It is known that the activity of a gene in a cell is represented by a population of identical mRNA molecules. Many genes are active in a cell at the same time and are expressed to different extents, which leads to the presence of many different mRNA populations with different strengths.
  • the abundances (frequencies) of individual gene products in the sequencing reaction are determined for a quantitative analysis of the gene expression.
  • the products of highly expressed genes are more frequently represented in the sequencing reaction than the poorly expressed genes.
  • the proportion or number of sequences determined for each individual gene or gene product is determined. Genes with strong expression have a higher proportion of the total population of gene products than genes with weak expression.
  • the number of gene products analyzed is preferably between 1000 and 10,000,000.
  • the exact number of gene products to be analyzed depends on the task. It can be low for highly expressed genes, e.g. 1000 to 10,000. When analyzing poorly expressed genes, it must be increased, e.g. to 100,000 or higher.
  • RNA control samples are used in the sequence analysis of the mRNA samples, and corresponding DNA control samples are used in the analysis of the cDNA samples. These samples are preferably carried along in all steps. You can e.g. added after mRNA isolation. In general, the control samples are prepared for sequence analysis in the same way as the gene products to be analyzed.
  • control sequences are added to the gene products to be analyzed in known, fixed (predetermined) concentrations.
  • Concentrations of the control samples can be different, preferably these concentrations (i.e. the total concentration of the control sequences) are between 0.01% and 10% of the total concentration of the sample to be analyzed (100%). For example, if the concentration of the mRNA is 10ng / ⁇ l, the concentrations of control samples are between 1pg / ⁇ l and 1ng / ⁇ l.
  • the change in the level of expression of a particular gene can occur as a result of the change in the transcription rate of that gene or as a result of a global change in gene expression in the cell.
  • the expression of the so-called "house keeping genes" If there is a lack of important metabolites, for example, the general level of expression in the cell is low, so that constitutively expressed genes also have a low level of expression.
  • all constitutively expressed genes can serve as "house-keeping genes". Examples include the transferrin receptor gene or the beta actin gene. The expression of these house-keeping genes thus serves as a reference for the analysis of the expression of other genes.
  • the sequence determination and quantification of the expression of the house keeping genes is preferably a component of the analysis program for gene expression.
  • Modified dUTP with a long cleavable linker (Fig. 6f-1) 5- (3-aminoallyl) -2 'deoxyuridine-5' triphosphate, AA-dUTP, (Sigma), 3, 3 '- serve as starting substances Dithio-bis (propionic acid-N-hydroxysuccinimide ester), DTBP-NHS, (Sigma), 2-mercaptoethylamine, MEA, (Sigma).
  • DTBP-NHS 2-mercaptoethylamine
  • MEA 2-mercaptoethylamine
  • Dyes can now be coupled to this linker using various methods ("Handbook of Fluorescent Probes and Research Chemicals” 6th ed. 1996, R.Haugland, Molecular Probes, Waggoner Method in Enzymology 1995 v.246, p.362, Jameson et al. Method in Enzymology 1997, v.278, p.363).
  • nucleotide analogs for example according to Hobbs et al. US Patent 5,047,519, Khan et al. US Patent 5,821,356 can also be used in the reaction, so that nucleotide analogs with structures in FIGS. 6f-2,3,4 and 6g-1,2 can be generated.
  • TRITC tetramethylrhodamine-5-isothiocyanate, Molecular Probes
  • the dNTP (300 nmol) modified with the cleavable linker is dissolved in 30 ⁇ l 100 mmol / l sodium borate buffer, pH 9
  • the NT * produced in this way fulfills the requirements for incorporation into the DNA strand, fluorescence detection and chain termination after the incorporation and removal of the inhibition, which are necessary for the success of the method according to the invention.
  • Example of cleavage of disulfide compound in modified NT * The cleavage is carried out by adding 20 to 50 mmol / l DTT or mercaptoethanol (Sigma) solution pH 8 to the Reaction surface. The surface is 10 min. incubated with this solution, then the solution is removed and the surface is washed with a buffer solution to remove DTT or mercaptoethanol residues.
  • dUTP-SS-CH 2 CH 2 NH 2 Modified dUTP
  • Fig. 6e-l Modified dUTP
  • the starting substances are: bis-dUTP, synthesized according to Hanna (Method in Enzymology 1989, v.180, p.383), 2-mercaptoethylamine, MEA, (Sigma).
  • DCTP (Fig. 6-e2) can be modified in a similar way, bis-dCTP serving as the starting substance (synthesized according to Hanna et al. Nucleic Acid Research 1993, v.21, p.2073).
  • NT * (dUTP * and dCTP * ) with a short linker residue can be synthesized in a similar manner, NT * for example having the following structures (FIG. 6e): dUTP-SS- (CH 2 ) n -NH 2 , FIG .6e-1, dCTP-SS- (CH 2 ) n -NH 2 , Fig. 6e-2, where n is between 2 and 6, preferably between 2 and 4, dUTP-SS- (CH 2 ) n -X-CO- (CH 2 ) m -Z, Fig.
  • Z NH 2 , OH, dye where (n + m) is between 4 and 10, preferably between 4 and
  • the coupling of the FluoroLinkTM Cy3 monofunctional dye (Amersham Pharmacia biotech) (NT * structure Fig. 6i) is given as an example of coupling a dye to the linker. It is a monofunctional NHS ester fluorescent dye.
  • the reaction is carried out according to the manufacturer's instructions: The dNTP (300 nmol) modified with the cleavable linker is dissolved in 300 ⁇ l 100 mmol / l sodium borate buffer pH 8.5. For this, dye (300 nmol) is added and incubated for 1 h at RT. The NT * modified with the dye is cleaned by RP-HPLC in a methanol-water gradient.
  • TRITC tetramethylrhodamine-5-isothiocyanate, Molecular Probes
  • the dNTP (300 nmol) modified with the cleavable linker is dissolved in 30 ⁇ l 100 mmol / l sodium borate buffer pH 9 (10 mmol / l NT * ). 10 ⁇ l of 10 mmol / l of TRITC are added to DMF and incubated at RT for 4 h.
  • the NT * modified with the dye is cleaned by RP-HPLC in a methanol water Gradient.
  • the NT * produced in this way fulfills the requirements for incorporation into the DNA strand, fluorescence detection and chain termination after the incorporation and removal of the inhibition, which are necessary for the success of the method according to the invention.
  • Example of cleavage of the disulfide compound in the modified NT * The cleavage is carried out by adding 20 to 50 mmol / l dithiothreitol solution (DTT) or mercaptoethanol solution (Sigma), pH 8, to the reaction surface. The surface is 10 min. incubated with this solution, then the solution is removed and the surface is washed with a buffer solution to remove DTT or mercaptoethanol residues.
  • DTT dithiothreitol solution
  • Sigma mercaptoethanol solution
  • FIGS. 6k, 1, m Further examples of NT structures that can be used in the method according to the invention are shown in FIGS. 6k, 1, m.
  • FIGS. 6k, 1, m For the individual synthesis steps, see for example J.L. Ruth et al. Molecular Pharmacology 1981 v.20 p.415, L. ⁇ tvös et al. NAR 1987 v.15 p.1763, G.E.right et al. Pharmac Ther. 1990 v.47, p.447, "Nucleotide Analogs; Synthesis and Biological Function "KH Scheit 1980, Wiley-Interscience Publication," Nucleic acid chemistry "Ed. LBTownsend, v.1-4, Wiley-Interscience Publication," Chemistry of Nucleosides and Nucleotides "Ed. LBTownsend, v.1 -3, Plenum Press.
  • all four NTs * used in the reaction are labeled with fluorescent dyes.
  • the number of NTs found for each Sequence from a gene product is between 5 and 100, ideally between 20 and 50. These sequences are compared with a known program in gene databases using a program and assigned to appropriate genes. Such a program can be based, for example, on the BLAST or FASTA algorithm ("Introduction to Computational Biology” 1995 MS Waterman Chapman & Hall).
  • a cycle has the following steps: a) adding a solution with labeled nucleotides (NTs * ) and polymerase to immobilized nucleic acid chains, b) incubating the immobilized nucleic acid chains with this solution under conditions which are suitable for extending the complementary strands by one NT, c) Washing d) detection of signals from individual molecules, e) removal of the label from the built-in nucleotides, f) washing.
  • NTs * labeled nucleotides
  • 2 modified NTs * and 2 unmodified NTs are used for the analysis of the sequences.
  • This embodiment is based on the principle that a sequence of 2 signals (marked NT * s) can contain enough information to identify a sequence.
  • the determined sequence is compared with the reference sequence and assigned to a specific position, for example:
  • A-C C-AAA-A-C-A-C-CC (assigned determined sequence) ATCATCGTTCGAAATATCGATCGCCTGATGCC (reference sequence)
  • sequences determined are preferably assigned to the reference sequence with the aid of a program.
  • a program can e.g. based on the BLAST or FASTA algorithm ("Introduction to computational Biology” 1995 M.S. Waterman Chapman & Hall).
  • the gene products are prepared for sequencing as described above and sequenced using the 2NTs * / 2NTs method. Sequence sections are obtained from gene products, each sequence representing a sequence of 2NTs * .
  • Known gene sequences serve as reference sequences. In order to enable the determined sequence to be clearly assigned to a known reference sequence, this sequence must be long enough.
  • the length of the sequences determined is preferably more than 20 NT * s. Since 2 marked NTs * represent only part of the sequence, the total length of the complementary strand synthesized is approximately twice as long as the sequence of the detected NTs * (with 20 detected NTs * , the total length is, for example, an average of 40 NTs).
  • NTs * marked with a fluorescent dye appear as semiterminators in the present invention, ie the termination occurs only when modified NTs * are available , unmodified NTs must be added to the reaction in an additional step in each cycle. The exact position of this step in the cycle can vary. It is important that the marked NTs * and the unmodified NTs are used separately.
  • a cycle in this embodiment may look as follows, for example: a) adding a solution with modified NTs * and polymerases to the surface with the gene products provided b) incubating the immobilized nucleic acid chains with this solution under conditions which are suitable for extending the complementary strands by one NT, c) washing d) detecting the signals from individual, modified NTs * molecules built into the newly synthesized strands complementary to the gene products e) removal of the label and the terminating group in the built-in nucleotides f) washing g) addition of 2 unmodified NTs and polymerases h) washing.
  • the polyacrylamide gel for the analysis of reactions with individual molecules is prepared according to general rules of gel preparation for electrophoretic separation ("Electrophoresis” A.T. Andrews, Oxford science publications 1995).
  • the polymerization reaction can e.g. be carried out by UV light or by radical formers.
  • ammonium persulfate (APS) and TEMED (tetramethylethylene diamine) are used for the radical reaction, e.g. TEMED 0.01% v / v and APS 0.04% w / v.
  • the component composition can vary widely, the concentrations of individual components are in the following ranges (calculated for the ready-to-use aqueous AA to AA solution):
  • Acrylamide monomer (AA) from 3 to 30%, ideally between 10 and 20% Bis-acrylamide (bis-AA) in relation to the acrylamide monomer 1:10 to 1:50, preferably 1:20.
  • a glass plate (PI) is preferably pretreated with a water-repellent reagent, e.g. Repelsilane, dimethyldichlorosilane solution, Amersham Pharmacia-Biotech.
  • P2 serves as a solid carrier for the gel and can be used with yellow-binding reagents e.g. Bind silane, methacryloxypropyltrimethoxysilane, Amersham Pharmacia-Biotech, are pretreated so that there is a covalent bond between the gel and the glass surface.
  • P2 pretreatment with yellowing reagents is useful when several reactions with immobilized molecules have to be carried out. With a smaller number of reactions, such pretreatment is not necessary. In these cases, a clean glass surface is sufficient for P2 so that the gel adheres to the glass surface solely by adhesive forces.
  • the finished polymerization solution (AA / bisAA solution with radical formers) is poured between P1 and P2, so that a layer with a thickness of approx. 5 to 30 ⁇ m results.
  • the thickness of the gel can e.g. be checked by spacers. After hardening, Pl is removed. The gel sticks to P2. It is washed with deionized water.
  • the gel can be used directly or can be dried and stored at various stages of manufacture. Before a reaction with labeled molecules, the gel is usually swollen in the reaction buffer solution for a few minutes and only then used for the reaction.
  • Nucleic acid chains are immobilized on a gel surface prepared in this way by drying out.
  • a solution (approximately 1 ⁇ l) of a plasmid DNA (linearized with Hind III) was converted into single-stranded by heat Form converted pMOS blue plasmid DNA about 3400 NT long, concentration O.l ⁇ g / ⁇ l) was dropped on about 10mm 2 of the gel surface and brought to dryness at 90.degree.
  • the calculated density of the immobilized plasmid molecules was approximately 1000 per 1 ⁇ m 2 .
  • the oligonucleotide 5 '-AGTGAATTCGAGCTCGGTAC-3' was used as primer.
  • the primer binding site (hereinafter bold) together with the extension relevant for the analysis has the following sequence: 5 '-ATCCCCGGGTACCGAGCTCGAATTCACT-3'
  • a flow cell (microfluidic channel, MFK) with the reaction surface as a lid was assembled.
  • MFK microfluidic channel
  • the primer (calculated Tm 45.3 ° C, 0.1 ⁇ mol / l in 50mmol / l Tris-HCl pH 8.7) was hybridized at 45 ° C for 10 minutes with the plasmid DNA on the surface (annealing). After a washing step, the density of the plasmid-primer complexes was checked. The control was carried out by incorporating dCTP-Cy3 (Amersham Pharmacia Biotech) using Klenow fragment (2 units per 50 ⁇ l in 20 mmol / l Tris-HCl buffer, pH 8.5, with 5 mmol / l MgCl 2 for 15 minutes 30 ° C). Only a single dCMP-Cy3 is built into the growing strand.
  • the signal density of the individual built-in dCMP-Cy3 molecules corresponds to the density of the plasmid-primer complexes which can be extended. Under the conditions mentioned, the density of the plasmid-primer complexes averaged approximately 15 per 100 ⁇ m 2 and was thus of the desired order (FIGS. 8a-c).
  • a cyclic sequencing reaction is carried out on a second surface prepared in the same way (pMOS blue plasmid DNA linearized with Hind III and converted into single-stranded form by heat for about 3400 NT, Concentration O.l ⁇ g / ⁇ l with hybridized primers), a cyclic sequencing reaction is carried out.
  • dUTP-SS-CH 2 CH 2 NH-R-Cy3 dUTP *
  • dCTP-SS-CH 2 CH 2 NH-R-Cy3 (see Example 2) are used as reversible terminators.
  • the detection apparatus is the same as in the preliminary test.
  • the installation reactions with marked NT * s were carried out at 30 ° C. for 15 minutes.
  • a reaction solution with dCTP * was added.
  • a detection step was carried out, single-molecule signals with the assigned x, y coordinates being registered on the surface (a total of approximately 11,200 signals).
  • the marker was then removed from the built-in NT * s (room temperature, 10 minutes) and the surface was washed.
  • Cycles 1 to 3 were repeated three times, with a total of approximately 9900 CCU target sequences being determined. These sequences can be clearly assigned to the primer.
  • the analysis is based on the sequencing of short sections of mRNA.
  • each gene product has one uniform primer binding site (PBS) at its 3 'end, so that a uniform primer can bind to this PBS.
  • PBS uniform primer binding site
  • PBS uniform primer binding site
  • NTs are coupled to the 3 'end of the single-stranded gene products (a so-called 5 "tailing").
  • Using a uniform NT results in a uniform PBS.
  • a gel layer (2) adheres to a solid base (1), e.g. a polyacrylamide gel (Fig. 4a), or many gel beads (5), e.g. Agarose beads (Fig. 4b).
  • Gene products (4) are bound to the surface of the gel.
  • the gene products carry a functional group, e.g. Biotin, and are bound to the gel via streptavidin or avidin (3).
  • Example of a flow device A gel-like reaction surface (1) is on one for the
  • Detection apparatus (6) detected.
  • FIG. 6 structures of 2'-deoxynucleoside triphosphates which can be used in the process.
  • Fig. 6a Schematic representation of the NT structure, in which the cleavable group and the sterically demanding group leading to the termination form parts of the linker.
  • the linker is the connection between nucleobase and fluorescent dye.
  • Fig. 6b Schematic representation of the NT structure, the cleavable group being part of the linker and the fluorescent dye simultaneously representing the sterically demanding group leading to the termination.
  • A, B, C - linker A - the linker residue after cleavage, B - cleavable group, D - sterically demanding group leading to termination, F - fluorescent dye.
  • Fig. 6c Schematic representation of the structure of installed NT * s after the cleavage step. Two NT * s are shown with the remaining link remainder (A).
  • Fig. 6d Schematic representation of the NT structure, wherein the cleavable group, which is also the sterically demanding group leading to termination, is part of the linker.
  • A, B, C, D - linker A - the linker residue after cleavage, B - cleavable group, D - sterically demanding group leading to termination, F - fluorescent dye.
  • Fig. 6e representation of preferred NT structures in which the linker is coupled to the 5-position in the pyrimidine ring.
  • Fig. 6g representation of preferred NT structures, in which the linker is coupled to the 7-position in the purine ring.
  • the linker is coupled to the 5-position of the pyrimidine ring.
  • the substituents R ⁇ , 2,3, can be selected and can occur independently of one another.
  • the Z group represents the connection between the linker and the base. It can be selected and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.
  • the E group represents one internal part of the linker. In another embodiment (6k-2) it represents the connection between the linker and the base. This group is selectable and can be a straight-chain alkyl or alkenyl chain with a number of carbon atoms, preferably between 1 and 5 , his.
  • the E group can also be an alkyl or alkenyl chain with an internal amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino bond.
  • the C group is a chemically cleavable group.
  • 6k-1,2) it represents an internal part of the linker.
  • 6k-3) it represents the connection between the linker and the base.
  • This group is selectable and can be an ester, Be thioester and disulfide compound.
  • the Y group represents an internal part of the linker, which creates the connection between the cleavable group (C) and the fluorescent dye (F).
  • This group is selectable and can be a branched or unbranched alkyl or
  • the X group is the connection between the fluorescent dye and the linker, and this connection can be derived from both the linker and the fluorescent dye (F). It is selectable and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.
  • the Z group represents the connection between the linker and the base. It is selectable and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.
  • the E group represents an internal part of the linker. In another embodiment (6L-2) it represents the connection between the linker and the base.
  • This group is selectable and can be a straight-chain alkyl - Or alkenyl chain with a number of carbon atoms, preferably between 1 and 5.
  • the E group can also be an alkyl or alkenyl chain with an internal amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino bond.
  • the C group is a chemically cleavable group.
  • 6L-1,2) it represents an internal part of the linker.
  • 6L-3) it represents the connection between the linker and the base.
  • This group is selectable and can be an ester, Be thioester and disulfide compound.
  • the Y group represents an internal part of the linker, which creates the connection between the cleavable group (C) and the fluorescent dye (F).
  • This group can be selected and can be a branched or unbranched alkyl or alkenyl chain or else a substituted or unsubstituted aryl group.
  • Another possible alternative is an alkyl or alkenyl chain with an internal amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino bond.
  • the X group is the connection between the fluorescent dye and the linker, this connection being formed by both the linker and the fluorescent dye (F) can be derived. It is selectable and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.
  • the linker is coupled to the 5-position of the pyrimidine ring.
  • the substituents R 1 # 2,3,4 can be selected and can occur independently of one another.
  • the Y group represents an internal part of the linker, which is the connection between the cleavable group (C) and the
  • Fluorescent dye (F) produces.
  • This group is selectable and can be a branched or unbranched alkyl or
  • the X group is the connection between the fluorescent dye and the linker, and this connection can be derived from both the linker and the fluorescent dye (F). It is selectable and can be an amide, carbalcoxy (ester), sulfoxy, ether, thioether or amino group.
  • a wide-field optical detection system is shown. After the installation of marked NT * s, the surface (7) is scanned, the fluorescence signals from individual to the NTs coupled dye molecules can be detected.
  • Fig. 8a Schematic representation of a portion of the reaction surface (gray) that is scanned.
  • the circles each correspond to the recording of a 2D image and represent the areas from which the fluorescence signals are detected. There are several signals per recording
  • reaction surface (e.g. 100 to 10,000) of individual molecules registered simultaneously.
  • the reaction surface is scanned in each cycle, several images being taken from different locations on the surface during the scanning process. Up to several million signals can be recorded by built-in NT * s.
  • the high degree of parallelism is the basis for the speed of the process.
  • Fig. 8b A recording (a 2D image) with signals from individual, built-in NT * s. See example 5 for a description of the experiment.
  • Fig. 8c detail from Figure 8b.
  • the section shows signals from four built-in NTs. Each signal has characteristic properties of the individual molecule signals (see description) and can be identified on the basis of these (preferably with the aid of a computer program). The corresponding X, Y coordinates are assigned to each of the identified signals.
  • the throughput is determined by using two separate flow cells (microfluidic channels, MFK) increased. While biochemical and chemical reactions take place in one flow cell, detection is carried out in the other. The flow cells then swap positions.
  • MFK microfluidic channels

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé pour analyser l'expression génique, c'est-à-dire pour analyser parallèlement l'expression d'un grand nombre de gènes. Ce procédé est fondé sur l'analyse de séquences sur de nombreuses chaînes d'acides aminés liées. A cet effet, des segments de séquences courts sont déterminés à partir de chacune de ces chaînes. Ensuite, l'interprétation et la comparaison avec des séquences de gènes conservées dans des bases de données permettent d'obtenir des informations sur les gènes exprimés et l'intensité de leur expression.
PCT/EP2002/004657 2001-04-27 2002-04-26 Procede pour determiner l'expression genique WO2002088381A2 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
AU2002312859A AU2002312859A1 (en) 2001-04-27 2002-04-26 Method for determining gene expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE10120798.0 2001-04-27
DE10120798A DE10120798B4 (de) 2001-04-27 2001-04-27 Verfahren zur Bestimmung der Genexpression

Publications (2)

Publication Number Publication Date
WO2002088381A2 true WO2002088381A2 (fr) 2002-11-07
WO2002088381A3 WO2002088381A3 (fr) 2003-11-27

Family

ID=7683015

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2002/004657 WO2002088381A2 (fr) 2001-04-27 2002-04-26 Procede pour determiner l'expression genique

Country Status (3)

Country Link
AU (1) AU2002312859A1 (fr)
DE (1) DE10120798B4 (fr)
WO (1) WO2002088381A2 (fr)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2003031947A2 (fr) * 2001-10-04 2003-04-17 Genovoxx Gmbh Appareil de sequençage de molecules d'acides nucleiques
WO2003072820A3 (fr) * 2002-02-27 2004-04-08 Epigenomics Ag Methode et acides nucleiques permettant d'analyser les troubles associes a la proliferation des cellules du colon
US7427673B2 (en) 2001-12-04 2008-09-23 Illumina Cambridge Limited Labelled nucleotides
WO2009124255A2 (fr) * 2008-04-04 2009-10-08 Helicos Biosciences Corporation Procédés pour l'analyse de produit de transcription
US7645596B2 (en) 1998-05-01 2010-01-12 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
US7897345B2 (en) 2003-11-12 2011-03-01 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
US7981604B2 (en) 2004-02-19 2011-07-19 California Institute Of Technology Methods and kits for analyzing polynucleotide sequences
US9051612B2 (en) 2006-09-28 2015-06-09 Illumina, Inc. Compositions and methods for nucleotide sequencing
US9096898B2 (en) 1998-05-01 2015-08-04 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
WO2016020691A1 (fr) * 2014-08-08 2016-02-11 Illumina Cambridge Limited Lieurs nucléotidiques modifiées
US9605310B2 (en) 2001-12-04 2017-03-28 Illumina Cambridge Limited Labelled nucleotides
US9670539B2 (en) 2007-10-19 2017-06-06 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US20170166961A1 (en) 2013-03-15 2017-06-15 Illumina Cambridge Limited Modified nucleosides or nucleotides
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9719139B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10260094B2 (en) 2007-10-19 2019-04-16 The Trustees Of Columbia University In The City Of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US10487102B2 (en) 2002-08-23 2019-11-26 Illumina Cambridge Limited Labelled nucleotides
US10513731B2 (en) 2002-08-23 2019-12-24 Illumina Cambridge Limited Modified nucleotides
US10648026B2 (en) 2013-03-15 2020-05-12 The Trustees Of Columbia University In The City Of New York Raman cluster tagged molecules for biological imaging
US10995111B2 (en) 2003-08-22 2021-05-04 Illumina Cambridge Limited Labelled nucleotides
US11098353B2 (en) 2006-12-01 2021-08-24 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4772691A (en) * 1985-06-05 1988-09-20 The Medical College Of Wisconsin, Inc. Chemically cleavable nucleotides
WO1996017957A1 (fr) * 1994-12-09 1996-06-13 Hyseq, Inc. Procedes et appareil de sequencage et d'identification d'adn
US5547839A (en) * 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
US5614617A (en) * 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
WO1998051699A1 (fr) * 1997-05-12 1998-11-19 Life Technologies, Inc. Procedes permettant de produire et de purifier les molecules d'acide nucleique
WO2000070073A1 (fr) * 1999-05-19 2000-11-23 Cornell Research Foundation, Inc. Procede de mise en sequences de molecules d'acide nucleique
WO2001016375A2 (fr) * 1999-08-30 2001-03-08 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Sequençage de molecules d'acide nucleique a grande vitesseen parallele

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE60045917D1 (de) * 1999-02-23 2011-06-16 Caliper Life Sciences Inc Sequenzierung durch inkorporation
US6309836B1 (en) * 1999-10-05 2001-10-30 Marek Kwiatkowski Compounds for protecting hydroxyls and methods for their use

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4772691A (en) * 1985-06-05 1988-09-20 The Medical College Of Wisconsin, Inc. Chemically cleavable nucleotides
US5547839A (en) * 1989-06-07 1996-08-20 Affymax Technologies N.V. Sequencing of surface immobilized polymers utilizing microflourescence detection
US5614617A (en) * 1990-07-27 1997-03-25 Isis Pharmaceuticals, Inc. Nuclease resistant, pyrimidine modified oligonucleotides that detect and modulate gene expression
WO1996017957A1 (fr) * 1994-12-09 1996-06-13 Hyseq, Inc. Procedes et appareil de sequencage et d'identification d'adn
WO1998051699A1 (fr) * 1997-05-12 1998-11-19 Life Technologies, Inc. Procedes permettant de produire et de purifier les molecules d'acide nucleique
WO2000070073A1 (fr) * 1999-05-19 2000-11-23 Cornell Research Foundation, Inc. Procede de mise en sequences de molecules d'acide nucleique
WO2001016375A2 (fr) * 1999-08-30 2001-03-08 The Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Sequençage de molecules d'acide nucleique a grande vitesseen parallele

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
AHMADIAN MOHAMMAD ET AL: "A comparative study of the thermal stability of oligodeoxyribonucleotides containing 5-substituted 2'-deoxyuridines." NUCLEIC ACIDS RESEARCH, vol. 26, no. 13, 1 July 1998 (1998-07-01), pages 3127-3135, XP002246216 ISSN: 0305-1048 *
HERMAN T M ET AL: "CHEMICALLY CLEAVABLE BIOTIN-LABELED NUCLEOTIDE ANALOGS" METHODS IN ENZYMOLOGY, 1990, pages 584-588, XP001152912 ISSN: 0076-6879 cited in the application *
LANGER P R ET AL: "ENZYMATIC SYNTHESIS OF BIOTIN-LABELED POLYNUCLEOTIDES: NOVEL NUCLEID ACID AFFINITY PROBES" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC, US, vol. 78, no. 11, November 1981 (1981-11), pages 6633-6637, XP000892770 ISSN: 0027-8424 *
LOMANT A J ET AL: "Chemical probes of extended biological structures: synthesis and properties of the cleavable protein cross-linking reagent [35SÜdithiobis(succinimidyl propionate)." JOURNAL OF MOLECULAR BIOLOGY. ENGLAND 14 JUN 1976, vol. 104, no. 1, 14 June 1976 (1976-06-14), pages 243-261, XP009012241 ISSN: 0022-2836 cited in the application *
SHIMKUS M ET AL: "A chemically cleavable biotinylated nucleotide: usefulness in the recovery of protein-DNA complexes from avidin affinity columns." PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA. UNITED STATES MAY 1985, vol. 82, no. 9, May 1985 (1985-05), pages 2593-2597, XP009012256 ISSN: 0027-8424 *
SHIMKUS M L ET AL: "SYNTHESIS AND CHARACTERIZATION OF BIOTIN-LABELED NUCLEOTIDE ANALOGS" DNA (NEW YORK), vol. 5, no. 3, 1986, pages 247-256, XP009012255 ISSN: 0198-0238 *
SOUKUP G A ET AL: "Preparation of oligonucleotide-biotin conjugates with cleavable linkers." BIOCONJUGATE CHEMISTRY. UNITED STATES 1995 JAN-FEB, vol. 6, no. 1, January 1995 (1995-01), pages 135-138, XP002246344 ISSN: 1043-1802 *
UENO Y ET AL: "NUCLEOSIDES AND NUCLEOTIDES. 165. CHEMICAL LIGATION OF OLIGODEOXYNUCLEOTIDES HAVING A MERCAPTO GROUP AT THE 5-POSITION OF 2'-DEOXYURIDINE VIA A DISULFIDE BOND" NUCLEOSIDES & NUCLEOTIDES, MARCEL DEKKER, INC, US, vol. 17, no. 1-3, 1998, pages 283-289, XP001149079 ISSN: 0732-8311 *

Cited By (74)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9096898B2 (en) 1998-05-01 2015-08-04 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US10214774B2 (en) 1998-05-01 2019-02-26 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US10208341B2 (en) 1998-05-01 2019-02-19 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9957561B2 (en) 1998-05-01 2018-05-01 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9725764B2 (en) 1998-05-01 2017-08-08 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US7645596B2 (en) 1998-05-01 2010-01-12 Arizona Board Of Regents Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9458500B2 (en) 1998-05-01 2016-10-04 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9212393B2 (en) 1998-05-01 2015-12-15 Life Technologies Corporation Method of determining the nucleotide sequence of oligonucleotides and DNA molecules
US9725480B2 (en) 2000-10-06 2017-08-08 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10435742B2 (en) 2000-10-06 2019-10-08 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10407458B2 (en) 2000-10-06 2019-09-10 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10648028B2 (en) 2000-10-06 2020-05-12 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10633700B2 (en) 2000-10-06 2020-04-28 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10577652B2 (en) 2000-10-06 2020-03-03 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10570446B2 (en) 2000-10-06 2020-02-25 The Trustee Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9868985B2 (en) 2000-10-06 2018-01-16 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10669582B2 (en) 2000-10-06 2020-06-02 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10407459B2 (en) 2000-10-06 2019-09-10 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10457984B2 (en) 2000-10-06 2019-10-29 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10662472B2 (en) 2000-10-06 2020-05-26 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10428380B2 (en) 2000-10-06 2019-10-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US10669577B2 (en) 2000-10-06 2020-06-02 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9708358B2 (en) 2000-10-06 2017-07-18 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9719139B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
US9718852B2 (en) 2000-10-06 2017-08-01 The Trustees Of Columbia University In The City Of New York Massive parallel method for decoding DNA and RNA
WO2003031947A3 (fr) * 2001-10-04 2003-12-04 Genovoxx Gmbh Appareil de sequençage de molecules d'acides nucleiques
WO2003031947A2 (fr) * 2001-10-04 2003-04-17 Genovoxx Gmbh Appareil de sequençage de molecules d'acides nucleiques
US10480025B2 (en) 2001-12-04 2019-11-19 Illumina Cambridge Limited Labelled nucleotides
US9605310B2 (en) 2001-12-04 2017-03-28 Illumina Cambridge Limited Labelled nucleotides
US10519496B2 (en) 2001-12-04 2019-12-31 Illumina Cambridge Limited Labelled nucleotides
US7427673B2 (en) 2001-12-04 2008-09-23 Illumina Cambridge Limited Labelled nucleotides
US9988683B2 (en) 2002-02-27 2018-06-05 Epigenomics Ag Method and nucleic acids for the analysis of colon cell proliferative disorders
WO2003072820A3 (fr) * 2002-02-27 2004-04-08 Epigenomics Ag Methode et acides nucleiques permettant d'analyser les troubles associes a la proliferation des cellules du colon
US10487102B2 (en) 2002-08-23 2019-11-26 Illumina Cambridge Limited Labelled nucleotides
US10513731B2 (en) 2002-08-23 2019-12-24 Illumina Cambridge Limited Modified nucleotides
US11008359B2 (en) 2002-08-23 2021-05-18 Illumina Cambridge Limited Labelled nucleotides
US10995111B2 (en) 2003-08-22 2021-05-04 Illumina Cambridge Limited Labelled nucleotides
US11028115B2 (en) 2003-08-22 2021-06-08 Illumina Cambridge Limited Labelled nucleotides
US11028116B2 (en) 2003-08-22 2021-06-08 Illumina Cambridge Limited Labelled nucleotides
US9012144B2 (en) 2003-11-12 2015-04-21 Fluidigm Corporation Short cycle methods for sequencing polynucleotides
US7897345B2 (en) 2003-11-12 2011-03-01 Helicos Biosciences Corporation Short cycle methods for sequencing polynucleotides
US9657344B2 (en) 2003-11-12 2017-05-23 Fluidigm Corporation Short cycle methods for sequencing polynucleotides
US7981604B2 (en) 2004-02-19 2011-07-19 California Institute Of Technology Methods and kits for analyzing polynucleotide sequences
US9868978B2 (en) 2005-08-26 2018-01-16 Fluidigm Corporation Single molecule sequencing of captured nucleic acids
US7666593B2 (en) 2005-08-26 2010-02-23 Helicos Biosciences Corporation Single molecule sequencing of captured nucleic acids
US9051612B2 (en) 2006-09-28 2015-06-09 Illumina, Inc. Compositions and methods for nucleotide sequencing
US11098353B2 (en) 2006-12-01 2021-08-24 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US11939631B2 (en) 2006-12-01 2024-03-26 The Trustees Of Columbia University In The City Of New York Four-color DNA sequencing by synthesis using cleavable fluorescent nucleotide reversible terminators
US11242561B2 (en) 2007-10-19 2022-02-08 The Trustees Of Columbia University In The City Of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
US11208691B2 (en) 2007-10-19 2021-12-28 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US9670539B2 (en) 2007-10-19 2017-06-06 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US10144961B2 (en) 2007-10-19 2018-12-04 The Trustees Of Columbia University In The City Of New York Synthesis of cleavable fluorescent nucleotides as reversible terminators for DNA sequencing by synthesis
US10260094B2 (en) 2007-10-19 2019-04-16 The Trustees Of Columbia University In The City Of New York DNA sequencing with non-fluorescent nucleotide reversible terminators and cleavable label modified nucleotide terminators
WO2009124255A3 (fr) * 2008-04-04 2010-01-14 Helicos Biosciences Corporation Procédés pour l'analyse de produit de transcription
WO2009124255A2 (fr) * 2008-04-04 2009-10-08 Helicos Biosciences Corporation Procédés pour l'analyse de produit de transcription
US10648026B2 (en) 2013-03-15 2020-05-12 The Trustees Of Columbia University In The City Of New York Raman cluster tagged molecules for biological imaging
US10982277B2 (en) 2013-03-15 2021-04-20 Illumina Cambridge Limited Modified nucleosides or nucleotides
US20170166961A1 (en) 2013-03-15 2017-06-15 Illumina Cambridge Limited Modified nucleosides or nucleotides
US10407721B2 (en) 2013-03-15 2019-09-10 Illumina Cambridge Limited Modified nucleosides or nucleotides
JP2017525695A (ja) * 2014-08-08 2017-09-07 イルミナ ケンブリッジ リミテッド 修飾ヌクレオチドリンカー
KR20210100205A (ko) * 2014-08-08 2021-08-13 일루미나 케임브리지 리미티드 변형된 뉴클레오타이드 링커
AU2018278843B2 (en) * 2014-08-08 2019-07-18 Illumina Cambridge Limited Modified Nucleotide Linkers
US10190157B2 (en) 2014-08-08 2019-01-29 Illumina Cambridge Limited Modified nucleotide linkers
AU2015298469B2 (en) * 2014-08-08 2018-12-06 Illumina Cambridge Limited Modified nucleotide linkers
CN106604926B (zh) * 2014-08-08 2020-05-15 伊卢米纳剑桥有限公司 修饰的核苷酸连接基
KR102287718B1 (ko) * 2014-08-08 2021-08-09 일루미나 케임브리지 리미티드 변형된 뉴클레오타이드 링커
CN111704643A (zh) * 2014-08-08 2020-09-25 伊卢米纳剑桥有限公司 修饰的核苷酸连接基
RU2699993C2 (ru) * 2014-08-08 2019-09-12 Иллумина Кембридж Лимитед Модифицированные нуклеотидные линкеры
CN106604926A (zh) * 2014-08-08 2017-04-26 伊卢米纳剑桥有限公司 修饰的核苷酸连接基
JP2022000435A (ja) * 2014-08-08 2022-01-04 イルミナ ケンブリッジ リミテッド 修飾ヌクレオチドリンカー
US11230734B2 (en) 2014-08-08 2022-01-25 Illumina Cambridge Limited Modified nucleotide linkers
KR20170039743A (ko) * 2014-08-08 2017-04-11 일루미나 케임브리지 리미티드 변형된 뉴클레오타이드 링커
US11773438B2 (en) 2014-08-08 2023-10-03 Illumina Cambridge Limited Modified nucleotide linkers
WO2016020691A1 (fr) * 2014-08-08 2016-02-11 Illumina Cambridge Limited Lieurs nucléotidiques modifiées

Also Published As

Publication number Publication date
AU2002312859A1 (en) 2002-11-11
DE10120798A1 (de) 2002-12-19
DE10120798B4 (de) 2005-12-29
WO2002088381A3 (fr) 2003-11-27

Similar Documents

Publication Publication Date Title
DE10120797B4 (de) Verfahren zur Analyse von Nukleinsäureketten
WO2003020968A2 (fr) Procede d'analyse de sequences d'acides nucleiques et de l'expression de genes
WO2002088381A2 (fr) Procede pour determiner l'expression genique
DE10246005A1 (de) Gerät zur Sequenzierung von Nukleinsäuremolekülen
DE69233458T2 (de) Nukleinsäuretypisierung durch polymeraseverlängerung von oligonukleotiden unter verwendung von terminator-mischungen
DE112007002932B4 (de) Vierfarben DNA-Sequenzierung mittels Synthese unter Verwendung von abspaltbaren, reversiblen, fluoreszierenden Nucleotidterminatoren
DE69928683T2 (de) Verfahren zur amplifikation und zur sequenzierung von nukleinsäuren
DE60208278T2 (de) System und Verfahren zum Testen von Nukleinsäuremolekülen
DE69634696T2 (de) Verfahren und testsystem zur hybridisierungsanalyse unter verwendung von peptidnukleinsäure-sonden
DE10214395A1 (de) Verfahren zur Analyse von Einzelnukleotidpolymorphismen
DE10149786B4 (de) Oberfläche für Untersuchungen aus Populationen von Einzelmolekülen
WO2002038806A2 (fr) Identification de polymorphismes d'acide nucleique
DE102004025696A1 (de) Verfahren, Oberfläche und Substrate zu hochparallelen Analysen von Nukleinsäureketten
DE102004025744A1 (de) Oberfläche für die Analysen an einzelnen Nukleinsäuremolekülen
DE102004025695A1 (de) Verfahren und Oberfläche zur parallelen Sequenzierung von Nukleinsäureketten
DE102004025694A1 (de) Verfahren und Oberfläche zu hochparallelen Analysen von Nukleinsäureketten
DE102004025745A1 (de) Oberfläche für die Analysen an einzelnen Molekülen
EP2074133A2 (fr) Constituants et procédés de synthèse enzymatique d'acides nucléiques
DE69924140T2 (de) Bestimmung der länge von repetitiven nukleinsäure-sequenzen durch eine diskontinuierliche primerverlängerung
DE102004025746A1 (de) Verfahren, Oberfläche und Substrate zur hochparallelen Sequenzierung von Nukleinsäureketten
DE102006014879B4 (de) RNA-Markierungsverfahren
DE60038109T2 (de) Verfahren zur Analyse von AFLP Reaktionsmischungen unter Verwendung von Primer Verlängerungstechniken
WO2008080629A2 (fr) Installation améliorée de traitement biologique moléculaire
DE60213002T2 (de) Normalisierung von microanordnung-daten auf der basis von hybridisierung mit internem standard
EP1458892B1 (fr) Procede de sequen age multiplex base sur le principe de l'evanescence

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ OM PH PL PT RO RU SD SE SG SI SK SL TJ TM TN TR TT TZ UA UG US UZ VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase

Ref country code: JP

WWW Wipo information: withdrawn in national office

Country of ref document: JP