DE10120798A1 - Method of determining gene expression - Google Patents

Abstract

The invention relates to a method for analyzing gene expression, i. H. for parallel analysis of the expression of a large number of genes. The method is based on the analysis of sequences on many immobilized nucleic acid chains. To do this, short sequence sections are determined from each of these chains. The subsequent evaluation and comparison with gene sequences in databases allows statements about the expressed genes and the strength of their expression.

Description

Summary

The invention describes a method for parallel analysis of the Expression of a large number of genes. This method is based on the analysis of sequences on many immobilized nu small acid chains. To do this, short sequence sections from each of these chains. The subsequent evaluation and the Comparison with gene sequences in databases allows statements about the genes expressed and the level of their expression.  

1. Abbreviations and explanations of terms

DNA - deoxyribonucleic acid of various origins and of different lengths: (genomic DNA, cDNA, ssDNA, dsDNA)
RNA - ribonucleic acid (mostly mRNA)
Gene products - mRNA transcripts or nucleic acid chains derived from the mRNA (e.g. single-stranded cDNAs, double-stranded cDNAs, RNA derived from cDNA or DNA amplified from cDNA)
cDNA - complementary DNA
Polymerases - Enzymes that can incorporate complementary nucleotides into a growing strand of DNA or RNA (e.g. DNA polymerases, reverse transcriptases, RNA polymerases)
dNTP - 2'-deoxi nucleoside triphosphates for DNA polymerases and reverse transcriptases
NTP - nucleoside triphosphates for RNA polymerases
NT - natural nucleotide, usually dNTP, unless expressly stated otherwise.

Abbreviation "NT" is also used when specifying the length of a nucleic acid resequence used, e.g. B. 1,000 NT. In this case "NT" stands for Nucleoside monophosphate.

The majority of abbreviations in the text are formed by using the suffix "s", for example "NT" stands for "nucleotide", "NTs" stands for several nucleotides.
NT * - modified nucleotide, usually dNTP, unless expressly stated otherwise. NTs * means: modified nucleotides.
Flat surface: surface which preferably has the following features: 1) It allows several individual molecules, preferably more than 100, more preferably more than 1000, to be detected simultaneously with the given objective-surface distance at one objective position. 2) The immobilized individual molecules are in the same focal plane, which can be set reproducibly.
Steric obstacle: Sterically demanding group which, due to its chemical structure, changes the properties of the NTs * coupled with this group in such a way that they cannot be successively incorporated into one extension reaction by a polymerase.
Definition of the termination: In this application, the reversible stop of the installation of the modified uncleaved NTs * is referred to as termination.

This term is from the usual use of the word "termi nation "by dideoxy-NTP in conventional sequencing to separate.

The termination comes after the installation of a modified NT *. The modified built-in NT * carries a steric group which is reversibly coupled to the base and which prevents the incorporation of a next complementary NT * into the growing strand by a polymerase.
SNP - single nucleotide polymorphism
PBS - primer binding site.

2. State of the art

Analysis of the gene expression spectrum has become an important one Become a tool in science. The comparison of the Gene expression spectra between different cell lines, tissues or developmental stages allows conclusions to be drawn about the inside specific biological processes. So you can z. B.  expect the comparison between tumor cells and healthy ones Cells of the same origin provide information about what happens in the tumor involved genes there. It is important that the activity as many or all genes as possible are analyzed simultaneously.

The analysis of gene expression is a complex task: The Number of genes active in a cell type can be several thousand be. However, the analysis should, if possible, all in the genome of genes in question (approximately 32,000 in humans) consider. In addition, that in the respective cell type firstly, active genes are usually not fully known and secondly, expressed to different degrees.

There have been many methods for gene expression analysis developed so z. B. Differential Display (Nature 1984, v. 308, P. 149, Science 1992 v. 257, p. 967), Expressed Sequence Tags (EST) (Science 1991 v. 252, p. 1656, Nature Genetics 1992, v. 2, p. 173), Northern blotting or RT-PCR (PNAS 1977, v. 74, p. 5350, Cell 1983, v. 34, p. 865, "The PCR Technique, RT-PCR" 1998, Ed. Paul Suebert, Eaton Publishing). All of these methods can only be one Analyze limited number of genes per reaction and are for Partly very labor intensive.

The most widely used method for parallel analysis of the Gene expression pattern is to analyze the hybridization of one the mixture of cDNA molecules with bound to a surface Oligonucleotides arranged in a certain order, mostly in miniaturized form are fixed as a "microarray" ("microarray Biochip Technology "2000, Ed. M. Schena, Eaton Publishing, Zhao et al. Gene 1995, v. 156, p. 207, Schena et al. Science 1995, v. 270, p. 467, Lockhart et al. U.S. Patent 6,040,138, Wang U.S. Patent 6,004,755, Arlinghaus et al. U.S. Patent 5,821,060, Southern US Patent 5,700,637, Fodor et al. U.S. Patent 5,871,928).

The major disadvantages of the hybridization method include: Production of the oligonucleotides bound to the surface is expensive. The analysis is limited to genes, their sequences  are already known. Several mismatch controls increase that Number of oligonucleotides that need to be immobilized.

The present invention describes a method for the parallel analysis of a large number of nucleic acid chain molecules. It is based on the detection of fluorescence signals from individual molecules. By simultaneous sequencing of individual gene product molecules, the method has several advantages over the prior art:

• 1. The gene products can be arranged in any order on the Tie surface. A previous elaborate synthesis of different oligonucleotides at specific positions (such as for example in the hybridization method) is therefore not necessary.
• 2. The material can be on a standardized surface to be analyzed.
• 3. The expression of still unknown genes can also be determined are analyzed because all gene products contained in the approach become.
• 4. The large number of molecules analyzed also allows Detection of poorly expressed genes.
• 5. Smallest amounts of starting material can be used: Single cell mRNA may be sufficient for analysis his.
• 6. All steps of the process can be largely automated be settled.

3. Brief description

The invention describes a method for analyzing gene expression, in which one
provides single-stranded gene products, one
the gene products are immobilized on a reaction surface in a density of 10 to 100 gene products per 100 μm ² (stationary phase), one
perform a cyclic build-up reaction of the complementary strand of the gene products using one or more primers and one or more polymerases by

• a) adds a solution to the immobilized gene products, the one or more polymerases and one to four contains modified nucleotides (NTs *) containing Fluores zenz dyes are marked, the at the same time use of at least two NTs * each on the NTs * fluorescent dyes are selected so that the NTs * used are measured by different fluorescent signals from each other let that, structurally modifying the NTs * are that the polymerase after incorporation of such an NT * in a growing complementary strand not in the Is able to insert another NT * in the same strand build, the fluorescent dye is cleavable and the structural modification is a cleavable ste is a demanding ligand, one
• b) the stationary phase obtained in stage a) below Conditions incubated to extend the com complementary strands are suitable, the complemen tary strands are extended by one NT * each, one  
• c) the stationary phase obtained in stage b) below Washing conditions that are not in one for removal complementary strand of built-in NTs * are suitable, you
• d) the individual NTs built into complementary strands * by measuring that for the respective fluorescent color Characteristic signal detected, where one at the same time the relative position of the individual fluo determined resence signals on the reaction surface, you
• e) to produce unlabelled (NTs or) gene products Fluorescent dyes and the sterically sophisticated Ligands from those attached to the complementary strand Split off NTs *, one
• f) the stationary phase obtained in stage e) below Conditions washes to remove the fluorescence dyes and the ligand are suitable, man

stages a) to f) are repeated several times, if necessary,
the relative position of individual gene products on the reaction surface and the sequence of these gene products being determined by specifically assigning the fluorescence signals detected at the respective positions in step d) to the NTs and the identity of the gene products being determined from the partial sequences determined.

The gene products are the primary gene products the genes whose expression is to be analyzed. In essence Chen are RNA transcripts of the genes mentioned, which are also called target sequences (or target nucleic acid sequences). These target sequences close in addition to mRNA, single-stranded and double-stranded ones derived therefrom  cDNA, RNA derived from cDNA or cDNA on inserted DNA.

The gene products or target sequences can either be used as mRNAs directly from a biological sample (e.g. cell extract, tissue ex tract or extract of whole organisms) isolated or as cDNAs can be obtained by reverse transcription of the mRNAs.

According to a particular embodiment of the invention, the process can be carried out by repeating steps a) to f) of the cyclic build-up reaction several times, with

• a) only one marked NT * in each cycle,
• b) two differently marked in each cycle NTs * or
• c) four differently marked in each cycle NTs *

starts.

The process can also be carried out by following the steps a) to f) of the cyclic build-up reaction are repeated several times, whereby one alternates in the cycles two differently marked NTs * and two unmarked NTs and the Identity of the gene products by comparison with the reference sequences zen determined.

The present invention furthermore relates to the nucleotides shown in FIGS . 6e, 6f and 6g and the corresponding labeled nucleotides which, for example, have fluorescent dyes attached to the terminal amino function, or the labeled nucleotides shown in FIGS . 6h, 6i or 6j.

The method is based on several principles:

• 1. Short nucleotide sequences (10-50 NTs) contain enough information to identify the corresponding gene if the gene sequence itself is already contained in a database.
  A sequence of, for example, 10 NTs can form more than 10 ⁶ different combinations. That is e.g. For example, it is sufficient for most genes in the human genome, which according to current estimates contains 32,000 genes. The sequence can be even shorter for organisms with fewer genes.
• 2. The method is the sequencing of individual nucleic acid chains underlying molecules.
• 3. Mixtures of nucleic acid chains can be examined.
• 4. The sequencing reaction is the same on many molecules the sequence of each individual immobilized Nucleic acid chain is analyzed.

It is known that mRNAs or nucleic acid chains derived from the mRNA (e.g. single-stranded cDNAs, double stranded cDNAs, RNA derived from cDNA or from cDNA amplified DNA) can be used. Independent of their exact composition are referred to below as gene products designated. Partial sequences of these gene products are also in the hereinafter referred to as gene products.

These gene products are a mixture of different nuances small acid chains.

According to the invention, they are on a suitable flat surface fixed in random order. After the fixation you start with all gene products immobilized on the surface Sequencing reaction.

The sequence is based on the synthesis of a strand that is complementary to the immobilized gene product. Labeled NTs * are installed in the newly synthesized strand. The signals of the built-in marked NTs * are detected. The sequencing reaction proceeds in several cycles. Only one marked NT * per cycle is installed in the growing strand. A cycle comprises the following steps:

• a) adding a solution with labeled nucleotides (NTs *) and Polymerase to immobilized nucleic acid chains,
• b) Incubation of the immobilized nucleic acid chains with this solution under conditions necessary to extend the complementary strands around a NT are suitable,
• c) washing,
• d) detection of the signals from individual modified, in the newly synthesized strands of built-in NTs * molecules,
• e) removing the label from the incorporated nucleotides,
• f) washing.

This cycle can be repeated several times, so that from each immobilized gene product preferably determined 10 to 50 NTs become. The nucleic acid sequences are then reconstructed zen from the detected signals. The sequences of the immobilized gene products are used to determine the abundance compared with each other and by comparison with gene sequences in Databases assigned to certain genes.

These general principles of the reaction are explained using an example ( Fig. 1):
A mixture of mRNA molecules serves as the starting material. The material to be analyzed (1) is fixed on a suitable flat surface (2). The surface carries immobilized poly-dT oligonucleotides which serve as primers to start the reaction and as linkers for immobilization (oligo-dT primers). The unbound mRNA molecules are removed by a washing step. The sequencing reaction is then carried out on the entire reaction surface. This reaction is cyclical. In the 1st step of the cycle, a labeled NT * is incorporated into the growing strand: the reaction is controlled so that only one labeled NT * from a polymerase (reverse transcriptase) can be incorporated into the growing strand in each cycle. This is achieved through the use of NTs * which carry a reversibly coupled group leading to termination. This prevents the installation of another marked NT *. The polymerase and the labeled NTs * are used simultaneously in the reaction (3). The reaction mixture is then removed and the surface is washed in a suitable manner (4). A detection step (5) now follows. The surface is scanned with a device suitable for single-molecule detection (consisting, for example, of a light source, microscope, camera, scanning table, computer with control and image recognition or image processing software) and the signals of the individual, built-in marked NTs * are identified , After the detection step, the marker and the group leading to the termination are removed from all installed NTs * (6). The removal can take place chemically, physically or enzymatically. After a subsequent washing step, a new cycle can begin.

4. Detailed description 4.1 Selection of the material

Gene products can come from different biological objects stem from, e.g. B. of individual cells, cell populations, one Tissue or from entire organisms. Also biological liquid Sources such as blood, sputum or cerebrospinal fluid can be the source of Serve gene products. The methods for obtaining the gene products are from the different biological objects, for example the following literature sources can be found: "Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology "1999, v 303," cDNA library protocols "1997, Ed. I.G. Cowell, Humana Press Inc.

It can be both the total of the isolated gene products also a part of it selected by a pre-selection in the Sequencing reaction can be used. By preselection  you can reduce the amount of gene products to be analyzed. The preselection can be carried out, for example, by molecular biological Methods such as B. PCR amplification, gel separation or Hybridization with other nucleic acid chains take place ("Molecu lar cloning "1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v 303, "cDNA library protocols" 1997, Ed. I. G. Cowell, Humana Press Inc.).

Preferably all of the gene products are used as starting material selected.

4.2 Preparation of the material

The aim of the preparation of the material is to form gene products immobilized, single-stranded and hybridized with a primer from the starting material. These then preferably have the structure shown in FIG. 2.

4.2.1 Primer binding site

Each gene product preferably has only one primer binding site. A primer binding site is a sequence section that contains a enable selective binding of the primer to the gene product should.

Sections in the nucleic acid can be used as primer binding sites serve sequence, the natural in the sequences to be analyzed usually occur (e.g. polyA stretches in mRNA). A primer Binding site can also be introduced into the gene product ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v 303, "cDNA library protocols "1997, Ed. I.G. Cowell, Humana Press Inc.).

To simplify the analysis, it may be important that a primer binding site as uniform as possible in all Gene products is present. Then primers with more uniform Structure used in the reaction.

The composition of the primer binding site is not specified limits. Their length is preferably between 10 and 100 NTs. The primer binding site can be a functional group  Wear immobilization of the gene product. This functional group can e.g. B. be a biotin or digoxigenin group.

As an example for the introduction of a primer binding site in the gene products, the nucleotide tailing of antisense cDNA Fragments described.

First, single-stranded cDNA are synthesized from mRNA. The result is a population of cDNA molecules which represent a copy of the mRNA population, so-called antisense cDNA ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory, "Method in Enzymology" 1999, v 303, "cDNA library protocols "1997, Ed. IG Cowell, Humana Press Inc.). A terminal deoxynucleotidyl transferase can be used to attach several (e.g. between 10 and 20) nucleoside monophosphates to the 3 'end of this antisense cDNA, e.g. B. several adenosine monophosphates ((A) called n-tail). The resulting fragment is used to bind the primer, in this example a (T) n primer ("Molecular cloning" 1989, J. Sambrook et al., Cold Spring Harbor Laborotary Press, "Method in Enzymology" 1999, v. 303, pp. 37-38) ( Fig. 3).

4.2.2 Primers for the sequencing reaction

This has the function of starting at a single point on the Enable gene product. It preferably binds to the Primer binding site in the gene product. The composition and the The length of the primer is not restricted. Except for the start radio tion, the primer can also perform other functions, such as. B. to create a connection to the reaction surface. primer should match the length and composition of the primer linkage adjust the primer to start the sequence tion reaction with the respective polymerase.

The length of the primer is preferably between 6 and 100 NTs, ideally between 15 and 30 NTs. The primer can functional group that contribute to the immobilization of the gene serves product, preferably such a functional group  a biotin group (see section Immobilization). She should Do not interfere with sequencing. The synthesis of such a primer can e.g. B. with the DNA synthesizer 380 A Applied Biosystems be carried out or as a custom synthesis at a commercial providers, e.g. B. MWG-Biotech GmbH, Germany, to be created.

The primer can be analyzed prior to hybridization Fragments fixed on the surface using various techniques or synthesized directly on the surface (McGall et al. U.S. Patent 5412087, Barrett et al. US Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology "2000 M. Schena Eaton Publishing," DNA Microarrays " 1999 M. Schena Oxford University Press, Fodor et al. Science 1991, v. 285, p. 767, Timofeev et al. Nucleic Acid Research (NAR) 1996, v. 24, p. 3142, Ghosh et al. NAR 1987, v. 15, p. 5353, Gingeras et al. NAR 1987, v. 15, p. 5373, Maskos et al. NAR 1992, v. 20 P. 1679).

The primer or the primer mixture is covered with gene products Hybridization conditions incubated that selectively to the Let the primer binding site of each gene product bind. This pri mer hybridization can take place before, during or after immobilization gene products. If gene products as double stranded nucleic acids are present, they are in front of the hybridis denaturation by heat ("Molecular cloning" 1989, J. Sambrook et al., Cold Spring Harbor Laborotary Press). The Optimization of the hybridization conditions depends on the exact Structure of the primer binding site and the primer and leaves according to Rychlik et al. (NAR 1990 v. 18, p. 6409). in the The following are these hybridization conditions as standard referred hybridization conditions.

If the starting material has a poly-A stretch or a poly-dA stretch (eg mRNA, sense cDNA or antisense cDNA with (A) _n -Tail), an oligo-dT primer can be used. However, a primer mixture consisting of 12 different primers with the following general structure 5 '(K) _n MN3' is preferably used. Where (n) is between 10 and 50, preferably between 20 and 30. "K" stands for dT or dU, "M" and "N" each stand for dA, dT or dU, dC, dG (e.g. 5th '-dTdTdTdTdTdTdTdTdTdT ₁₀ dTdTdTdTdTdTdTdTdTdT ₂₀ dAdG-3'). Such a primer mixture enables an exact start of the sequencing reaction at the end of the polyA segment or the polyDA segment.

4.2.3 Immobilization

The aim of immobilization is to gene products on a ge to fix your own plan surface in a way that a cyclic enzymatic sequencing reaction is taking place can. Surface and reaction surface are in this application to be understood as equivalent terms, unless explicitly another meaning is pointed out. As a reaction leader surface serves the surface of a solid phase of any Material. This material is preferably enzymatic Reacts to inert and does not cause interference to the Detection. Silicon, glass, ceramics, plastic (e.g. polycarbona te or polystyrene) or any other material that these functional requirements can be used. The surface is preferably not deformable, because otherwise it is with a distortion of the signals in the repeated detection to count.

If a gel-like solid phase is used, this gel can e.g. B. be an agarose or polyacrylamide gel. The gel is preferably freely passable for molecules with a molecular mass below 5000 Da (for example, a 1 to 2% agarose gel or 5 to 15% polyacrylamide gel can be used). Such a gel surface has the advantage over other solid surfaces that, in contrast to free NTs *, the labeled gene products are retained on the surface. The immobilization of the gene products on the surface makes it possible to detect the fluorescence signals from built-in NTs *. The signals from free NTs * are not detected because they do not bind to the material of the gel and are therefore not immobilized. The gel is preferably attached to a solid surface ( Fig. 4). The thickness of the gel is preferably not more than 0.1 mm. However, the gel thickness must be greater than the simple depth of focus of the lens, so that NTs * which are not specifically bound to the solid base do not reach the focus plane and are therefore detected. If the depth of field e.g. B. 0.3 microns, the gel thickness is preferably between 1 micron and 100 microns. The surface can be produced as a continuous surface or as a discontinuous surface composed of individual small components (e.g. agarose beads) ( FIGS. 4a, b). The reaction surface must be large enough to be able to immobilize the necessary number of gene products with the appropriate density. The reaction surface should preferably not be larger than 20 cm ² .

The different cycle steps require an exchange of the different reaction solutions above the surface. The reaction surface is preferably part of a reaction vessel. The reaction vessel is in turn preferably part of a reaction apparatus with a flow device. The flow device enables the solutions in the reaction vessel to be exchanged. The exchange can take place with a pump device controlled by a computer or manually. It is important that the surface does not dry out. The volume of the reaction vessel is preferably less than 50 μl. Ideally, its volume is less than 1 µl. An example of such a flow system is given in FIG. 5.

The gene products are preferably immobilized on one of the two chain ends. This can be done by appropriate covalent, affine or other bonds can be achieved. There are many examples of immobilization of nucleic acids are known (McGall et al. US Patent 5412087, Nikiforov et al. US Patent 5610287, Barrett et al. U.S. Patent 5482867, Mirzabekov et al. US Patent 5981734, "Microarray biochip technology" 2000 M. Schena  Eaton Publishing, "DNA Microarrays" 1999 M. Schena Oxford University Press, Rasmussen et al. Analytical biochemistry v. 198, p. 138, Allemand et al. Biophysical Journal 1997, v. 73 P. 2064, Trabesinger et al. Analytical Chemistry 1999, v. 71, P. 279, Osborne et al. Analytical Chemistry 2000, v. 72, p. 3678, Timofeev et al. Nucleic Acid Research (NAR) 1996, v. 24, p. 3142, Ghosh et al. NAR 1987 v. 15, p. 5353, Gingeras et al. NAR 1987 v. 15 P. 5373, Maskos et al. NAR 1992, v. 20, p. 1679).

The gene products are immobilized on the surface preferably in a density between 10 and 100 gene products per 100 μm ² . Two methods of immobilization are described in more detail below by way of example: In a preferred embodiment, the gene products are immobilized via biotin-avidin or biotin-streptavidin binding. Avidin or streptavidin is covalently bound to the surface, the 5 'end of the primer is marked with biotin. After the labeled primers have hybridized with the gene products, they are fixed on the surface modified with avidin / streptavidin. The concentration of the hybridization products labeled with biotin and the time of incubation of this solution with the surface is selected so that a density suitable for sequencing is achieved.

In another preferred embodiment, the primers suitable for the sequencing reaction are fixed on the surface using suitable methods before the sequencing reaction (see above). The single-stranded gene products, each with one primer binding site per gene product molecule, are thus incubated under hybridization conditions. They bind to the fixed primers and are thereby immobilized. The concen tration of the single-stranded gene products is chosen so that an immobilization density of 10 to 100 gene products per 100 μm ² suitable for sequencing is achieved. After immobilization, unbound gene products are removed by a washing step. If the surface of a solid phase (e.g. silicone or glass) is used for immobilization, a blocking solution is preferably applied to the surface before step (a) in each cycle in order to avoid non-specific adsorption of NTs * on the surface serves. For example, an albumin solution (BSA) with a pH between 8 and 10 fulfills these conditions for a blocking solution.

4. 3 choice of polymerase

The type of immobilized nucleic acid (RNA or DNA) used plays a decisive role in the choice of polymerase:
If RNA is used as a gene product (e.g. mRNA) in the sequencing reaction, commercially available RNA-dependent DNA polymerases can be used, e.g. B. AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNAse activity. All reverse transcriptases must be largely free of RNAse activity ("Molecular cloning" 1989, Ed. Maniatis, Cold Spring Harbor Laboratory).

If DNA is used as a gene product (e.g. cDNA), are suitable in principle, all DNA-dependent DNA polymerases as polymerases without 3'-5 'exonuclease activity ("DNA Replication" 1992, Ed. A. Kornberg, Freeman and company NY), e.g. B. modified T7 "Sequenase Version 2" type polymerase (Amersham Pharmacia Biotech), Klenow fragment of DNA polymerase I without 3'-5 ' Exonuclease activity (Amersham Pharmacia Biotech), polymerase Beta of various origins ("Animal Cell DNA Polymerases" 1983, Fry M., CRC Press Inc., commercially available from Chimerx), thermostable polymerases such as Taq polymerase (GibcoBRL), proHA- DNA polymerase (Eurogentec).

4.4 Nucleotide structure 4.4.1 General principle

It is important for the sequencing reaction that each built-in NT * is identified. A prerequisite for this is that only a single NT * is incorporated into the nucleic acid chain per cycle. If a polymerase incorporates several NTs * in succession in the same cycle, this leads to an error in the sequence determination. For this reason you have to control the installation of the NTs *. In this context, various options for controlling the enzymatic reaction are conceivable, such as. B.

• 1. Single addition of NT so that the polymerase only one single step and stop (substrate limitation),
• 2. Changes in external conditions (temperature, pH, salt etc.), so that the polymerases perform their function differently (see optimization of reaction conditions),
• 3. through certain competitive and non-competitive inhibito ren (antiviral drugs are an example),
• 4. by certain mutations and other changes to the Polymerase as such,
• 5. through the structure of the NT. These structural changes can be:
  • a) irreversible (such as with dideoxyNTPs),
  • b) reversible.

The control is preferably carried out by a certain structure of the NTs *, with reversible structural changes especially are preferred. The reversible structural changes take place for example by attaching a sterically sophisticated Ligands, i.e. H. of a ligand that prevents the polymerase from incorporation another NT holds. The control due to a steric Blocking of the enzymatic reaction by reversible semi terminators are described in more detail below. According to one preferred embodiment of the invention, the bases by Structurally modified coupling of a fluorescent dye or modified.

There are several basic variants of the NT * structure that are used for Disability or stop of the extension reaction leads to: B.  were reversible 3'-OH modified NTs in the BASS method (Dower U.S. Patent 5,547,839, Canard et al. U.S. Patent 5,798,210, Rasolonjatovo Nucleosides & Nucleotides 1999, v. 18 P. 1021, Metzker et al., NAR 1994, v. 22, p. 4259, Welch et al., Nucleosides & Nucleotides 1999, v. 18, p. 197). The split is supposed to thereby photochemically under mild conditions (Dower US Patent 5,547,839, Welch et al., Nucleosides & Nucleotides 1999, v. 18 P. 197) or chemical (Canard et al. U.S. Patent 5,798,210, Rasolonjatovo Nucleosides & Nucleotides 1999, v. 18, p. 1021) respectively.

The synthesis of the 3'-OH-modified photochemically cleavable NTs * is very complex. The polymerases show a very different affinity for these nucleotide analogs, so that nucleic acid synthesis very unevenly or on some DNA Places does not expire at all (Metzker et al., NAR 1994, v. 22, p. 4259, Welch et al., Nucleosides & Nucleotides 1999, v. 18, p. 197). Out For this reason, these analogs are only of limited use for Sequencing reaction. A cleavable 3'-ester linkage (Canard et al. US Patent 5,798,210) comes as the basis for one reversible termination of the synthesis is also out of the question. The most polymerases cleave when a next one is available complementary NT 3'-OH ester compounds, so that the to the 3'-OH group bound label is released into the solution and can no longer act as a terminator (Rasolonjatovo et al., Nucleosides & Nucleotides 1999, v. 18, p. 1021, Canard et al., PNAS 1995, v. 92, p. 10859). In positions where a polymerase can install several identical NTS * one after the other a faulty signal.

According to the invention for sequencing NTs * with a sterically demanding group used at the base. One on the base coupled sterically demanding group can be used for Impede further synthesis. Biotin, digoxigenin and fluorescent dyes such as fluorescein, tetramethylrhodamine and Cy3 dye are examples of such steric demanding group (Zhu et al., Cytometry 1997, v. 28,  P. 206, Zhu et al., NAR 1994, v. 22, p. 3418, Gebeyehu et al., NAR 1987, v. 15, p. 4513, Wiemann et al., Analytical Biochemistry 1996, v. 234, p. 166, Heer et al., BioTechniques 1994, v. 16 p. 54). The Polymerases can do such NTs * at longer intervals install, however, have difficulties, these NTs * in succession other to install.

In the sequencing reaction in the method according to the invention are labeled NTs * with a polymerase and nucleic acid chains incubated. The NTs * are reversibly attached to the base coupled sterically demanding group. If a reaction mixture containing only modified NTs * in the reaction then the polymerase can only use a single NT * Install. The installation of a next NT * is sterically inhibited. These NTs * thus act as terminators of the synthesis. To removing the sterically demanding group can do that next complementary NT * will be installed. Because these NTs * no represent an absolute obstacle to further synthesis, but only for the installation of another marked NT *, they are considered Termed semiterminators.

4.4.2 General structure of the NT *

The semiterminators can have different structures. Their common features are shown in Fig. 6a. This structure is characterized in that a steric group (D) and the fluorescent marker (F) are bound to the base via a cleavable linker (AE).

Deoxynucleoside triphosphates also serve as the basis for the NTs * Adenosine (A), guanosine (G), cytidine (C) and uridine (U) as Nucleoside residue. Inosine can be used instead of guanosine become.

4.4.3 Markers, fluorophores

Each base is marked with a marker (F) which is characteristic of it ( FIG. 6). The marker is a fluorescent dye. Several factors influence the choice of the fluorescent dye. The choice is not restricted if the dye meets the following requirements:

• a) The detection equipment used must be this marker as only molecule bound to DNA under mild conditions (before can also identify reaction conditions). The color fabrics preferably have great photostability. Your fluo Resence is preferably not or only insignificantly from the DNA quenched.
• b) The dye bound to the NT must not be irreversible Cause disturbance of the enzymatic reaction.
• c) NTs * marked with the dye must be from the polymerase in the nucleic acid chain are installed.
• d) When marking with different dyes these dyes have no significant overlap in theirs Have emission spectra.

Fluorescence that can be used in the context of the present invention dyes are in "Handbook of Fluorescent Probes and Research Chemicals "6th ed. 1996, R. Haugland, Molecular Probes, with Structural formulas compiled. According to the invention preferably the following dye classes are used as markers: Cyanine dyes and their derivatives (e.g. Cy2, Cy3, Cy5, Cy7, Amersham Pharmacia Biotech, Waggoner U.S. Patent 5,268,486), Rhodamine and its descendants (e.g. TAMRA, TRITC, RG6, R110, ROX, Molecular Probes, see Manual), xanthene derivatives (e.g. Alexa 568, Alexa 594, Molecular Probes, Mao et al. US Patent 6130101). These dyes are commercially available.

You can do this depending on the spectral properties and available Select appropriate dyes for the equipment. The dyes  are sent to the linker z. B. via thiocyanate or ester bond coupled ("Handbook of Fluorescent Probes and Research Chemi cals "6th ed. 1996, R. Haugland, Molecular Probes, Jameson et al., Methods in Enzymology 1997, v. 278, p. 363, Waggoner Methods in Enzymology 1995, v. 246, p. 362), p. Examples 1 and 2.

4.4.4 Nature of the sterically demanding group

The group (D) ( Fig. 6) represents an obstacle to the installation of another complementary labeled NT by a polymerase.

Biotin, digoxigenin and fluorescent dyes such as fluorescein, Tetramethylrhodamine and Cy3 dye are examples of one such a sterically demanding group (Zhu et al., Cytome try 1997, v. 28, p. 206, Zhu et al., NAR 1994, v. 22, p. 3418, Gebeyehu et al., NAR 1987, v. 15, p. 4513, Wiemann et al., Analyti cal Biochemistry 1996, v. 234, p. 166, Heer et al., BioTechniques 1994, v. 16, p. 54). The chemical structure of this group is not limited, provided that you are installing the marked NT * to the it is knotted, does not interfere significantly and is not irreversible Causes disturbance of the enzymatic reaction.

This group can appear as an independent part in the linker (6a) occur or with the dye (6b) or the cleavable group (6d) be identical. By splitting the linker this becomes sterically demanding group (D) after detection of Si gnals removed so that the polymerase another labeled NT * can install. With a structure as in 6d the steric Group eliminated by the split.

In a preferred embodiment, the fluorescent dye takes over the function of such a sterically demanding group, so that a labeled nucleotide has a structure shown in FIG. 6b.

In another preferred embodiment, the photolabile cleavable group takes over the function of such a sterically demanding group ( FIG. 6d).

4.4.5 Left

The marker is preferably bound to the base via a spacer of different lengths, a so-called linker. Examples of linkers are given in Fig. 6e, f, g, h, i, j. Examples of coupling a linker to the base can be found in the following sources (Hobbs et al. US Patent 5,047,519, Khan et al. US Patent 5,821,356, Klevan et al. US Patent 4,828,979, Hanna M., Method in Enzymology 1996, v. 274, p. 403, Zhu et al., NAR 1994, v. 22, p. 3418, Herman et al., Methods in Enzymology 1990, v. 184, p. 584).

The total length of the linker can vary. It corresponds to the number of carbon atoms in sections A, C, E and is preferably between 3 and 20. Optimally, it is between 4 and 10 atoms. The chemical composition of the linker (sections A, C, E in FIG. 6a) is not restricted, provided that it remains stable under reaction conditions and does not cause any disturbance in the enzymatic reaction.

4.4.6 Fissile connection, splitting

The linker carries a fissile compound or fissile group (B). This fissile connection enables the removal of the Markers and the steric obstacle at the end of each cycle. Your choice is not restricted, provided it is under the conditions the enzymatic sequencing reaction remains stable, no irreversible polymerase disruption caused and under mild conditions can be split off. Under "mild Conditions "are to be understood as such conditions that the Do not destroy the gene product-primer complex. B. the pH Value is preferably between 3 and 11, the temperature between 0 ° C and a temperature value (x). This temperature value  (x) depends on the Tm of the gene product-primer complex (Tm is "melting point") and is called Tm (gene product-primer complex) minus 5 ° C calculated (e.g. Tm is 47 ° C, then the maximum is Temperature at 42 ° C; are suitable under these conditions especially disulfide compounds and photolabile compounds as fissile compounds).

The compound mentioned preferably belongs to chemically or enzymatically cleavable or photolabile compounds. As examples of chemically cleavable groups, ester and disulfide compounds are preferred (Herman et al., Method in Enzymology 1990, v. 184, p. 584, Lomant et al., J. Mol. Biol. 1976, v. 104, 243, "Chemistry of carboxylic acid and esters" S. Patai 1969, Interscience Publ.). Examples of photolabile compounds can be found in the following references: "Protective groups in organic synthesis" 1991, John Willey & Sons, Inc., V. Pillai, Synthesis 1980, p. 1, V. Pillai, Org. Photochem. 1987, v. 9, p. 225, and the photolabile compounds shown in U.S. Patent 6,136,543 ( Figs. 16-19) are suitable.

The position of the fissile link / group in the linker is preferably no more than 10 atoms from the base, more preferably no more than 3 atoms. Particularly preferred the cleavable compound or group lies directly on the base.

The cleavage and removal step is before each cycle act and must run under mild conditions (see above), so that the nucleic acids are not damaged or modified.

The cleavage is preferably chemical (e.g. mild acidic or basic environment for an ester compound or by Addition of a reducing agent, e.g. B. Dithiothreitol (Sigma) the cleavage of a disulfide compound), see Example 1, or physically (e.g. by illuminating the surface with light a certain wavelength for the cleavage of a photolabile Group).  

After the cleavage, a linker residue (A) remains on the base ( FIG. 6c).

The synthesis of a cleavable linker is shown using examples (see Examples 1 and 2).

4.4.7 Combination of polymerase and NT *

Overall, the size, the charge and the chemical structure of the marker, the length of the cleavable linker and the liner residue as well as the choice of polymerase play an important role. Together they determine whether the labeled NT * is incorporated into the growing nucleic acid chain by the polymerase and whether this prevents the insertion of the next labeled NT *. Two conditions are particularly important:
On the one hand, it is important that the polymerase can further extend the nucleic acid chain with the built-in modified NT * after the linker has been cleaved. It is therefore important that the linker residue "A" ( FIG. 6c) after cleavage does not constitute a significant disturbance for the further synthesis. On the other hand, built-in, non-split NTs * must be an obstacle. Many NTs * suitable for the reaction can be synthesized. In particular, a preliminary test series must be carried out for each combination of polymerase and NTs *, in which the suitability of a specific NT * type for sequencing is tested.

The buffer conditions are according to the polymerase manufacturer lers chosen. The reaction temperature is for non thermosta bile polymerases selected according to the manufacturer's instructions (e.g. 37 ° C for Sequenase Version 2), for thermostable polymerases (e.g. Taq polymerase) the reaction temperature is at most Temperature value (x). This temperature value (x) depends on the Tm of the gene product-primer complex and is called Tm (gene product Primer complex) minus 5 ° C (e.g. Tm is 47 ° C then) the maximum reaction temperature is 42 ° C). These buffer conditions  and reaction temperature are further than "optimal Buffer and temperature conditions ".

The reaction time (corresponds to the duration of the installation step in one cycle) is preferably less than one hour, ideally the reaction time is between 10 sec and 10 min.

The following combinations may be mentioned as examples of suitable combinations between NT * and polymerase:
If DNA (e.g. cDNA) is used as a gene product in the reaction, NT * with a short linker residue (synthesis see Example 2, Fig. 6e, h, i): dNTP-SS-TRITC (L7), dNTP- SS-Cy3 (L11) and / or NT * with a long linker residue (synthesis see Example 1, Fig. 6f, g, j): dNTP-SS-TRITC (L14) in combination with Sequenase Version 2, Taq polymerase (GibcoBRL ), ProHA-DNA polymerase (Eurogentec) or Klenow fragment of DNA polymerase I from E.coli without 3'-5 'exonuclease activity (Amersham Pharmacia Biotech) can be used.

If RNA (e.g. mRNA) is used as a gene product in the reaction, NT * with a short linker residue (synthesis see Example 2, Fig. 6e, h, i): dNTP-SS-TRITC (L7), dNTP- SS-Cy3 (L11) and / or NT * with a long linker residue (synthesis see Example 1, Fig. 6f, g, j): dNTP-SS-TRITC (L14) in combination with AMV reverse transcriptase (Sigma), M -MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNAse activity can be used.

The suitability of a link remnant at base (A) for the reak tion can be checked in a test system. This will split ne NTs * built into a nucleic acid chain one after the other. you uses z. B. dUTP * with the desired split linker residue, poly-dA as a template for DNA polymerases such as B. Sequenase Version 2, Taq polymerase, or poly-A as a template for reverse Transcriptases such as B. AMV reverse transcriptase (Sigma), M-MLV Reverse transcriptase (Sigma), oligo-dT20 primer, the desired one  Polymerase (see above) and leads for the respective polymerase suitable optimal buffer and temperature conditions Reaction by. The NT * concentration is preferably between 5 µM and 200 µM. After the reaction, the number of in the Nucleic acid chain incorporated NTs * analyzed, e.g. B. by the Separation lengthways in a gel. For the conclusions The following information can be used to determine the suitability of the link remnant use: If the polymerase can incorporate more than 20 NTs *, this is the linker residue for a sequencing reaction suitable. When installing less than 20 split NTs * is this combination of NT * and polymerase is not optimal for the Sequencing reaction.

If a suitable link remnant is determined, you have to in one another test system, check whether the marked, not split NTs * work as semiterminators. That is checked by the marked NTs * below optimal ones suitable for the reaction Buffer and temperature conditions with the polymerase and one Incubate the template. The NT * concentration is preferred between 5 µM and 200 µM. The matrix is to be selected that the installation of several NTs * would be expected one after the other, e.g. B. for dUTP * you can use polydA or poly-A, as shown in the above Use example. Ideally, the polymerase just builds in only NT * one.

If given the optimal buffer and temperature conditions several NTs * are installed one after the other by a polymerase, the reaction parameters (e.g. NT * concentration, Reaction temperature) and the respective combination adapt from polymerase and NT *. The most important thing is that the polymerase in the given time (is preferably between 10 sec and 10 min) a second NT * is not installed.

According to the invention, this adaptation takes place in one embodiment by changing the reaction temperature. The other para reaction meters are kept constant.  

If DNA is a gene product (e.g. cDNA) in the sequencing reaction is used, for example, as polymerases Polymerases are used, the DNA polymerases without 3'-5'- Exonuclease activity, preferably consisting of the group from viral DNA polymerases of the sequenase type, bacterial DNA Polymerases I, thermostable DNA polymerases and their modifi cations. Sequenase Version 2, Klenow in particular Fragment of the DNA polymerase I from E. coli without 3'-5 'exonuclease activity, Taq polymerase or ProHA DNA polymerase.

If RNA is a gene product (e.g. mRNA) in the sequencing reaction is used, commercial RNA-dependent DNA polymerases are used, e.g. B. AMV reverse transcript se (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse Transcriptase without RNase activity.

The NT * concentration is usually in these experiments between 5 µM and 200 µM, preferably between 10 and 100 µM. The concentration of the polymerase and the buffer conditions selected according to the manufacturer. The duration of the reaction can vary and is preferably between 10 sec and 10 min, which is the duration of the installation step (b) in one cycle would correspond. With non-thermostable polymerases such. B. Sequenase Version 2 (Amersham Pharmacia Biotech), Klenow- Fragment of DNA polymerase I without 3'-5 'exonuclease activity (Amersham Pharmacia Biotech), AMV reverse transcriptase (Sigma), M-MLV reverse transcriptase (Sigma), HIV reverse transcriptase without RNase activity, the reaction temperature of con conventional 37 ° C preferably reduced to 20 ° C to 30 ° C. at thermostable polymerases such as B. Taq polymerase (GibcoBRL), ProHA DNA polymerase (Eurogentec) becomes the reaction temperature from conventional 70-75 ° C preferably reduced to values, which are between 30 ° C and the temperature value (x). This Temperature value (x) depends on the Tm of the gene product primer Complex and is called Tm (gene product-primer complex) minus 5 ° C  calculated (e.g. Tm is 47 ° C, then the temperature value (x) at 42 ° C).

In another preferred embodiment of the invention he follows the adaptation of the reaction conditions by the mine the NT * concentration below 5 µM, the other parameters the reaction (buffer conditions, temperature conditions) kept constant. The concentration of the NT * s is preferably with this adjustment between 0.5 and 5 µM. The duration of the Response is between 10 sec and 10 min. The most important thing in the choice of the NT * concentration is that the polymerase in the predetermined time (preferably between 10 sec and 10 min) not installing a second NT *.

After optimizing the reaction conditions for the installation of a single NT * you have to react with split NTs * again to fetch. Under correspondingly changed reaction parameters Polymerase can incorporate the cleaved NTs * one after the other.

The optimization reaction correlates with the installation step, Step (b) in one cycle. The one for the optimization reaction determined conditions the temperature, the concentration of NT *, the buffer conditions, the duration of the reaction are for the Reaction on the surface adopted.

NT * is installed under these reaction conditions the gene products preferably so that more than 50% of the others Sequencing reaction involved gene products in one cycle a marked NT * is installed, preferably at more than 90%. This is due to the fact that the on some nucleic acid chains The reaction is very slow. Installation of the NTs * on everyone complementary position in each cycle is sought but not necessary because only the successful installation reak ions are detected and evaluated; a delayed Reation in the subsequent cycle does not lead to a sequence approximately fault.  

The same polymerase is preferably used for all NTs *. But different polymerases can also be used for different NTs * are used.

4.4.8 Color coding scheme, number of dyes

A cycle can be carried out with:

• a) four differently marked NT * s,
• b) two differently marked NT * s,
• c) a marked NT *,
• d) two differently marked NT * s and two unmarked NTs

ie

• a) You can use all 4 NTs with different dyes Mark and use all 4 in the reaction at the same time. The sequencing of a nucleic acid chain is also achieved a minimum number of cycles. This variant of the invention however, places high demands on the detection system: 4 different dyes have to be identified in each cycle become.
• b) To simplify the detection, a marking with two dyes can be selected. 2 pairs of NTs * formed, which are each marked differently, e.g. B. A and G are marked "X", C and U are marked "Y". In the reaction in one cycle (s) will be 2 different marked NTs * used simultaneously, e.g. B. C * in combination with A *, and in the following cycle (n + 1) then U * and G * added.
• c) You can also only a single dye to the Markie Use all 4 NTs * and use only one NT * per cycle.  
• d) In a technically simplified embodiment used two differently marked NT * s per cycle and two unmarked NTs (so-called 2NT * s / 2NTs method).

4.5 detection apparatus

Individual molecules on a surface can be used with different ones Examine methods. Several methods are known: z. B. AtomForce microscopy, electron microscopy, near-field Fluorescence microscopy, wide field fluorescence microscopy, TIR Microscopy, etc. (Science 1999, v. 283, p. 1667, Unger et al., BioTech niques 1999, v. 27, p. 1008, Ishijaima et al., Cell 1998, v. 92, p. 161, Dickson et al., Science 1996, v. 274, p. 966, Xie et al., Science 1994, v. 265, p. 361, Nie et al., Science 1994, v. 266, p. 1018, Betzig et al., Science 1993, v. 262, p. 1422).

According to the invention, fluorescence signals are transmitted individually into the Nucleic acid chain of incorporated NTs * preferably with one Wide-field fluorescence microscope or a laser scanning Microscope or a TIRF microscope (Total Internal Reflection Fluorescence Microscope).

Various variants of the construction of such an apparatus are possible (Weston et al., J. Chem. Phys. 1998, v. 109, p. 7474, Trabesinger et al., Anal. Chem. 1999, v. 71, p. 279 , Adachi et al., Journal of Microscopy 1999, v. 195, p. 125, Unger et al., BioTech niques 1999, v. 27, p. 1008, Ishijaima et al., Cell 1998, v. 92, p. 161, Dickson et al., Science 1996, v. 274, p. 966, Tokunaga et al., Bichem. Biophys. Res. Com. 1997, v. 235, p. 47, "Confocal Laser Scanning Microscopy" 1997, Ed Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991, Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998, 2nd ed. Herman BIOS Scientific Publishers, "Handbook of biological confocal microscopy "1995, J. Pawley Plenum Press). Differences in their concrete structure result from the variation of their individual parts. The device for the excitation light can, for. B. function on the basis of a laser, a lamp or diodes. Both CCD cameras and PMT can be used for the detection device. For other examples of technical details see ("Confocal Laser Scanning Microscopy" 1997, Ed. Sheppard, BIOS Scientific Pu blishers, "New Techniques of optical microscopy and microspectroscopy" 1991, Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy "1998, 2nd ed. Herman BIOS Scientific Publishers," Handbook of biological confocal microscopy "1995, J. Pawley Plenum Press). It is not the object of this invention to list all possible technical variants of a detection device. The basic structure of a suitable apparatus is explained in a diagram in FIG. 7. It consists of the following elements:
Light source to excite fluorescence (1)
Light guiding part (2)
Scan table (3)
Spectra selection device (4)
Detection device (5)
Computers with control and analysis functions (6)

These elements of the apparatus can be purchased commercially (Microscope companies: Zeiss, Leica, Nikon).

In the following, for example, a combination of these elements suitable for the detection of individual molecules is to be presented:
Axioplan 2 (Zeiss) wide-field fluorescence microscope with mercury vapor lamp
Lens Planneofluar 100x, NA 1.4 (Zeiss)
SenSysTM camera (Photometrix)
Computer with software for control and analysis

The procedure for detection is explained below become. Note the general rules of fluorescence microscopy  ("Confocal Laser Scanning Microscopy" 1997, Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy "1991, Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy" 1998, 2nd ed. Herman BIOS Scienti fic Publishers, "Handbook of biological confocal microscopy", 1995, J. Pawley Plenum Press).

The detection comprises the following phases:

• 1. preparation for detection,
• 2. Execution of a detection step in each cycle, each detection step running as a scanning process and comprising the following operations:
  • a) Setting the position of the lens (X, Y axis),
  • b) setting the focal plane (Z axis),
  • c) detection of the signals of individual molecules, assignment of the signal to NT * and assignment of the signal to the respective gene product,
  • d) Shift to the next position on the surface.

The signals from NTs * built into the strands complementary to the gene products are registered by scanning the surface. The scanning process can be carried out in various ways ("Confocal Laser Scanning Microscopy" 1997, Ed. Sheppard, BIOS Scientific Publishers, "New Techniques of optical microscopy and microspectroscopy" 1991, Ed. R. Cherry CRC Press, Inc., "Fluorescence microscopy "1998, 2nd ed. Herman BIOS Scienti fic Publishers," Handbook of biological confocal microscopy ", 1995, J. Pawley Plenum Press). A discontinuous scanning process is preferably selected. The lens is moved step by step over the surface ( FIG. 8a), so that a two-dimensional image (2D image) is created from each surface position ( FIG. 8b, c).

This 2D image can be created using various methods: z. B. by the laser scan of a position of the microscope field (Laser scanning microscopy) or through a camera recording  a position (cf. microscopy manuals). As an an example is the detection of individual molecules with a CCD camera described.

1) Preparation for detection

At the beginning it is determined how many copies of the gene products are to be used Expression analysis are necessary. Play several factors a role in this. The exact number depends e.g. B. from the relative Presence of the gene products in the approach and of the desired one Accuracy of the analysis. The number of genes analyzed products is preferably between 1000 and 10,000,000. For highly expressed genes can be the number of genes analyzed products be low, e.g. B. 1000 to 10,000. When analyzing weakly expressed genes must be increased, e.g. B. on 100,000 or more.

For example, 100,000 individual gene products will be produced at the same time analyzed. Weakly expressed genes (with z. B. about 100 mRNA molecules / cell, which is about 0.02% total mRNA corresponds) in the reaction with an average of 20 identifi represented gene products.

2) Performing a detection step in every cycle

The positions of the gene products must be determined for sequencing to be a basis for assigning the signals Has. Knowing these positions allows a statement whether the signals of individual molecules from built-in NTs * originate or from randomly bound NTs *. These positions can be identified using various methods become.

In a preferred embodiment, the positions are immo bilized gene products identified during sequencing. The fact is used that the signals from the in the Nucleic acid chain built NTs * always the same coordinates to have. This is due to the fixation of the nucleic acid chains guaranteed. The non-specifically bound NTs * bind at random different places on the surface.  

To identify the positions of fixed gene products the signals will match their coordinates checked several successive cycles. That can e.g. B. at the beginning of the sequencing. The matching one Coordinates are evaluated as coordinates of the gene products and saved.

The scan system must be reproducible over several cycles can scan the surface. X, Y and Z axis settings on each Surface position can be controlled by a computer the. Stability and reproducibility of the setting of Ob Lens positions in each scan process determine the quality lity of detection and thus the identification of the Si single molecules.

a) Setting the position of the lens (X, Y axis)

The mechanical instability of the commercially available scan tables and the low reproducibility of repeated inputs Positioning the same X, Y positions make a precise analysis of single molecule signals over multiple cycles difficult. It there are many ways to match the Koor dinaten to improve with repeated settings or poss control deviations. As an example, one Control option mentioned. After a rough mechanical Setting the lens position becomes a control image of a made patterns firmly attached to the surface. Even if the mechanical setting does not have exactly the same coordinates exhibits (deviations up to 10 µm are quite possible), can make a correction using optical control. The The control image from the sample serves as the coordinate system for the image with signals from built-in NTs *. A prerequisite for one such correction is that no further movements of the waiter area between these two shots. signals of individual molecules are placed in relation to the pattern, so that an X, Y deviation in the pattern position is equal to X, Y- Deviation in the position of the signals of individual molecules means.  The control image of the pattern can be before, during or after the Detection of individual molecules can be made. Such a con trollbild must accordingly with each setting on a new one Surface position can be made.

b) Setting the focus plane (Z axis)

The surface is not absolutely flat and has different features Bumps on. This changes the surface object tiv distance when scanning neighboring places. This sub Differences in distance can lead to individual molecules Leave the focal plane and thus avoid detection.

For this reason it is important that when scanning the upper a reproducible setting of the focus level on each Lens position is reached.

There are several ways to reproduce the focus plane bar. For example, the following method can be used det: Because the excitation of individual molecules to extinguish their fluorescence can lead to a surface Markers applied, which is used to adjust the focal plane. The signals of individual molecules are then detected. The Markers can be of any nature (e.g. dye or pattern), but must not affect detection and reaction.

c) detection of the signals of individual molecules, assignment of the Signals to NT * and assignment of the signal to the respective gene product

The two-dimensional image of the reaction surface generated with the aid of the detection system contains the signal information from NT * s built into the gene products. Before further processing, these must be extracted from the total amount of data in the image information using suitable methods. The algorithms required for scaling, transforming and filtering the image information are part of the standard repertoire of digital image processing and pattern recognition (Haberäcker P., "Practice of digital image processing and pattern recognition", Hanser-Verlag, Munich, Vienna, 1995; Galbiati LJ, "Machine vision and digital image processing fundamentals ", Prentice Hall, Englewood Cliffs, New Jersey, 1990). The signal extraction is preferably carried out via a gray value image, which depicts the brightness distribution of the reaction surface for the respective fluorescence channel. If several nucleotides with different fluorescent dyes are used in the sequencing reaction, a separate gray value image can first be generated for each fluorescence-labeled nucleotide (A, T, C, G or U). In principle, two methods can be used for this:

• 1. By using suitable filters (Zeiss filter sets) a gray-scale image is generated for each fluorescence channel.
• 2. The relevant color channels are extracted from a recorded multichannel color image with the aid of a suitable algorithm by an image processing program and individually further processed as a gray value image. A channel-specific color threshold algorithm is used for channel extraction. Individual gray value images 1 to N are thus initially created from a multi-channel color image. These images are defined as follows:
  GB _N = (s (x, y)) single-channel gray-scale image
  N = {1,. , ., Number of fluorescence channels}.
  M = {0, 1,. , ., 255} Gray value set
  S = (s (x, y)) image matrix of the gray scale image
  x = 0, 1,. , ., L-1 image lines
  y = 0, 1,. , ., R-1 image columns
  (x, y) location coordinates of a pixel
  s (x, y) ∈ M gray value of the pixel

The relevant image information is then extracted from this amount of data by a suitable program. Such a program should implement the following steps:
For GB ₁ to GB _N :

• A) preprocessing the image, for example if necessary Reduction of the by digitizing the image information resulting image noise, for example by gray value smoothing.
• B) Checking each pixel (x, y) of the gray value image, whether this Point related to the immediate and surrounding further away neighboring pixels the properties of a Fluorescence point met. These properties depend on other of the detection equipment used and the resolution solution of the gray scale image. For example, you can use a typical distribution pattern of brightness intensity values over a matrix surrounding the pixel. The one Usable methods of image segmentation range from fold threshold method up to the use of neuronal Networks.

If a pixel (x, y) fulfills these requirements, then follows Comparison with the coordinates of previously performed in Sequencing cycles identified gene products. At a According to the assignment of the signal with the to the respective fluorescence channel emerging nucleotide this gene product. Mismatched signals dinates are evaluated as background signals and discarded. The signals can be analyzed in parallel with the scanning process.

In an exemplary implementation, an eight-bit gray scale was used image with a resolution of 1317 × 1035 pixels. To the digital image changes reduce, the whole was preprocessed picture: Each pixel was the mean of the brightness assigned to its 8 neighbors. At the chosen resolution  this creates a pattern typical of a fluorescence spot a central pixel with the greatest brightness value and Neighbor pixels with falling on all sides Brightness. Did a pixel meet these criteria and The centrifugal drop in brightness exceeded a certain one Threshold (to exclude weak fluorescence spots), then this central pixel became the coordinate of one Fluorescence point scored.

d) moving the lens to the next position on the Surface. After the detection of the signals of individual molecules the lens will be over a different position of the surface positioned.

Overall, for example, a sequence of recordings with the Control of the X, Y position, the adjustment of the focus plane and with the detection of individual molecules for each new object active position. These steps can be done by one Computer controlled.

4.6 Timing of the procedural steps

The scanning process and the biochemical reaction take a certain amount of time. If you switch these processes one after the other, you can achieve optimal performance of the equipment. In a preferred embodiment, the reaction is carried out on two separate surfaces ( FIG. 9).

As an example, a surface with immobilized gene products are separated into 2 spatially isolated parts, so that Responses to these two parts independently can expire. In another example, gene products immobilized on two separate surfaces from the outset become.

The reaction is then started. The principle here is that while on part of the surface the reaction and washing steps  expire, the second part is scanned. This can to achieve a continuous flow of analysis and the Increase the speed of sequencing.

The number of surfaces on which the reaction takes place can also be larger than 2. That makes sense if the Reaction occurs as a time-limiting step, d. H. the Detection of signals on the surface faster than the reak tion and washing steps. To the total duration of the reak tion can be adapted to the duration of detection, each individual Step of reaction on a single surface with one time delay compared to the next surface expire.

4.7 Analysis

The data obtained (short sequences) are analyzed using a Program compared with known gene sequences. Such one Program can e.g. B. based on a BLAST or FASTA algorithm ("Introduction to computational Biology" 1995, M. S. Waterman, Chapman & Hall).

By choosing the method of material preparation is under other specified in which sections of the gene products the Sequences are determined and to which strand (sense or antisense) they belong. For example, when using the polyA stretches as a primer binding site in mRNA sequences NTRs (non-translating regions) determined. When using the Method with antisense cDNA as a template, the determined Sequences from the protein coding areas of the Gene products.

In a preferred simple variant of the invention, the Gene expression only determined qualitatively. Only that is Fact of expression of certain genes of importance.  

In another preferred embodiment, a quantita tive determination of the relationships between individual gene products in the approach of interest. It is known that the activity of a Gene in a cell by a population of identical mRNA Molecules is represented. There are many genes in a cell active at the same time and become different strengths expresses what the presence of many different under leads to differently represented mRNA populations.

The quantitative analysis of gene expression is discussed in more detail below:
The abundances (frequencies) of individual gene products in the sequencing reaction are determined for a quantitative analysis of the gene expression. The products of highly expressed genes are more frequently represented in the sequencing reaction than the poorly expressed genes.

After assigning the sequences to certain genes, the Proportion or number of sequences determined for each individual gene or gene product determined. Genes with strong ex pression have a higher share of the total population of Gene products as genes with weak expression.

The number of gene products analyzed is preferably between 1,000 and 10,000,000. The exact number of to analyze Genetic products depend on the task at hand. For strong expressed genes it can be low, e.g. B. 1000 to 10,000. When analyzing poorly expressed genes, it has to be increased, z. B. 100,000 or higher.

For example, 100,000 individual gene products will be used simultaneously analyzed are also poorly expressed genes, such as. B. about 100 mRNA molecules / cell (which corresponds to approximately 0.02% total mRNA), in the reaction with an average of 20 identified gene products represents ten.  

As an internal control of hybridization, immobilization and The following method can be used for the sequencing reaction: One or more nucleic acid chains with known ones can be used Sequences are used as a control (quantitative Marker). The composition of these control sequences is not restricted provided they identify the gene products do not bother. Sequence analysis of the mRNA samples Control samples, when analyzing the cDNA samples accordingly DNA control samples used. These samples are preferred carried along in all steps. You can e.g. B. after the mRNA Isolation can be added. In general, the control samples prepared for sequence analysis in the same way as the gene products to be analyzed.

The control sequences are set in known, fixed ones (predetermined) concentrations to the gene to be analyzed products added. Concentrations of the control samples can be different, these concentrations are preferably (i.e. the total concentration of the control sequences) between 0.01% and 10% of the total concentration of the analyzed Sample (100%). For example, the concentration of the mRNA 10 ng / µl, then the concentrations of control samples are between 1 pg / µl and 1 ng / µl.

In the quantitative analysis of gene expression, the general metabolic activity of the cells is taken into account are, especially if a comparison of the expression determines genes under different external conditions. The change in the expression level of a particular gene can as a result of the change in the transcription rate of this gene or as a result of a global change in gene expression in the cell occur. For monitoring the metabolic states in the cell you can see the expression of the so-called "House keeping genes ". If there are no important metabolites is, for example, the general level of expression in the cell low, so that constitutively expressed genes are low Have expression level.  

In principle, all constitutively expressed genes can be called "House keeping genes ". Examples include transferrin Called receptor gene or the beta actin gene.

The expression of these housekeeping genes thus serves as Reference value for the analysis of the expression of other genes. The Sequence determination and quantification of the expression of the house keeping genes are preferably part of the analysis Program for gene expression.

The invention is illustrated below using examples light.

Examples example 1

Modified dUTP with a long cleavable linker ( Fig. 6f-1) 5- (3-aminoallyl) -2'-deoxyuri din-5'-triphosphate, AAdUTP, (Sigma), 3,3'-dithio-bis are used as starting substances (per pionic acid-N-hydroxysuccinimide ester), DTBP-NHS, (Sigma), 2-mercaproethanolamine, MEA, (Sigma). 3 equivalents of DTBP-NHS in DMF (25 µl 0.4M solution) are added to 100 µl 50 mM solution of AA dUTP in 100 mM borate buffer pH 8.5. The reaction mixture is 4 hours at RT. incubated. Then conc. Ammonium acetate solution (pH 9) is added until the total concentration of CH ₃ COONH ₄ in the reaction solution is 100 mM, and the reaction is incubated for a further hour. Then 200 μl of 1M MEA solution, pH 9, are added to this mixture and incubated for one hour at RT. A saturated solution of I ₂ in 0.3M KI solution is then added dropwise to this mixture until the iodine color remains. The modified nucleotides are separated from other reaction products on a DEAE cellulose column in an ammonium carbonate gradient (pH 8.5). The nucleotide with the cleavable linker is isolated on RP-HPLC. Dyes can now be coupled to this linker using various methods ("Handbook of Fluorescent Probes and Research Chemicals", 6th ed. 1996, R. Haugland, Molecular Probes, Waggoner Method in Enzymology 1995, v. 246, p. 362, Jameson et al., Method in Enzymology 1997, v. 278, p. 363).

Other nucleotide analogs (e.g. according to Hobbs et al. US Patent 5,047,519, Khan et al. US Patent 5,821,356) can also be used in the reaction, so that nucleotide analogs with structures in FIGS . 6f-2,3,4 and 6g -1.2 can be generated.

The coupling of TRITC (tetramethylrhodamine-5-isothiocyanate, Molecular Probes) is given as an example of the coupling of a dye to the linker (NT * structure, FIG. 6j):
The dNTP (300 nmol) modified with the cleavable linker is dissolved in 30 ul 100 mM sodium borate buffer pH 9 (10 mM NT *). For this purpose, 10 μl of 10 mM TRITC are added to DMF and incubated at RT for 4 h. The NT * modified with the dye is cleaned using RP-HPLC in a methanol-water gradient. Similarly, other dyes can be coupled to the amino group of the linker.

Example of the cleavage of disulphide compound in the modified NT *. The cleavage is carried out by adding 20 to 50 mM DTT (Sigma) pH 8 solution on the reaction surface. The surface is 10 min. incubated with this solution, then the solution removed and the surface with a buffer solution for removal of DTT residues.

Example 2

Modified dUTP (dUTP-SS-CH ₂ CH ₂ NH ₂ ) with a short cleavable linker ( Fig. 6e-1). The starting substances are: bis-dUTP, synthesized according to Hanna (Method in Enzymology 1989, v. 180, p. 383), 2-mercaptoethanolamine, MEA, (Sigma).

100 μl of 100 mM MEA solution pH 8.5 in H ₂ O are added to 400 μl of 100 mM bis-dUTP in 40 mM borate buffer pH 8.5 and incubated for 1 hour at RT. A saturated solution of I ₂ in 0.3 M KI solution is then added dropwise to this mixture until the iodine color remains. The nucleotides (bis-dUTP and dUTP-SS-CH ₂ CH ₂ NH ₂ ) can e.g. B. by ethanol precipitation or on a DEAE cellulose column in an ammonium carbonate gradient (pH 8.5) separated from other reaction products. Bis-dUTP does not interfere with the subsequent coupling of a dye to the amino group of the linker, so that the dUTP-SS-CH ₂ CH ₂ NH _{2 can be separated} from bis-dUTP in the final cleaning step.

DCTP ( FIG. 6-e2) can also be modified in a similar manner, bis-dCTP serving as the starting substance (synthesized according to Hanna et al., Nucleic Acid Research 1993, v. 21, p. 2073).

Further N * (dUTP * and dCTP *) with a short linker residue can be synthesized in a similar way, NT * having the following structures ( Fig. 6e):
dUTP-SS- (CH ₂ ) _n -NH ₂ , Fig. 6e-1,
dCTP-SS- (CH ₂ ) _n -NH ₂ , Fig. 6e-2,
where n is between 2 and 6, preferably between 2 and 4,
dUTP-SS- (CH ₂ ) _n -X-CO- (CH ₂ ) _m -Z, Fig. 6e-3,
dUTP-SS- (CH ₂ ) _n -X-CO-Y- (CH ₂ ) _m -Z, Fig. 6e-4,
dCTP-SS- (CH ₂ ) _n -X-CO- (CH ₂ ) _m -Z, Fig. 6e-5,
dCTP-SS- (CH ₂ ) _n -X-CO-Y- (CH ₂ ) _m -Z, Fig. 6e-6,
X = NH, O, S,
Y = NH, O, S,
Z = NH ₂ , OH, dye,
where (n + m) is between 4 and 10, preferably between 4 and 6.

Dyes can now be attached to the linker using various methods be coupled ("Handbook of Fluorescent Probes and Research Chemicals "6th ed. 1996, R. Haugland, Molecular Probes, Waggoner Method in Enzymology 1995, v. 246, p. 362, Jameson et al., Method in Enzymology 1997, v. 278, p. 363).  

The coupling of the FluoroLinkTM Cy3 monofunctional dye (Amersham Pharmacia biotech) (NT * structure Fig. 6i) is given as an example of coupling a dye to the linker. It is a monofunctional NHS ester fluorescent dye. The reaction is carried out according to the manufacturer:
The dNTP (300 nmol) modified with the cleavable linker is dissolved in 300 ul 100 mM sodium borate buffer pH 8.5. For this, dye (300 nmol) is added and incubated for 1 h at RT. The NT * modified with the dye is cleaned by RP-HPLC in a methanol-water gradient.

Another example of the coupling of a dye to the linker is the coupling of TRITC (tetramethylrhodamine-5-isothiocyanate, Molecular Probes) (dUTP-SS-TRITC Fig. 6h).

The dNTP (300 nmol) modified with the cleavable linker becomes dissolved in 30 ul 100 mM sodium borate buffer pH 9 (10 mM NT *). 10 µl of 10 mM TRITC are added to DMF and 4 h at RT incubated. Cleaning the NT * modified with the dye takes place via RP-HPLC in a methanol-water gradient.  

Example 3 Sequence analysis with 4 marked NTs *

In a preferred embodiment of the invention, all four NTs * used in the reaction with fluorescent dyes marked.

One of the color coding mentioned above is used schemes. The number of NTs determined for each sequence A gene product is between 5 and 100, ideally between 20 and 50. These sequences are determined using a Program compared with known sequences in gene databases and associated genes. Such a program can z. B. are based on the BLAST or FASTA algorithm ("In production to computational biology "1995, M.S. Waterman, Chapman & Hall).

A cycle has the following steps:

• a) Add 03954 00070 552 001000280000000200012000285910384300040 0002010120798 00004 03835 a solution with labeled nucleotides (NTs *) and Polymerase to immobilized nucleic acid chains,
• b) Incubation of the immobilized nucleic acid chains with this solution under conditions necessary to extend the complementary strands around a NT are suitable,
• c) washing,
• d) detection of signals from individual molecules,
• e) removing the label from the incorporated nucleotides,
• f) washing.

Example 4

Sequence analysis with 2 marked NTs * and 2 unmarked NTs (2NTs * / 2NTs method).

In another embodiment, the analysis of the Sequences 2 modified NTs * and 2 unmodified NTs inserted puts.

This embodiment is based on the principle that a sequence of 2 signals (marked NT * s) can contain enough information to identify a sequence. The determined sequence is compared with the reference sequence and assigned to a specific position, e.g. B .:
ACCAAAACACCC - determined sequence (dCTP * and dATP * are marked),
ATCATCGTTCGAAATATCGATCGCCTGATGCC - reference sequence,
AC --- C-AAA-ACAC-CC (assigned determined sequence),
ATCATCGTTCGAAATATCGATCGCCTGATGCC (reference sequence).

The sequences determined are preferably determined using a Program assigned to the reference sequence. Such a program can e.g. B. are based on the BLAST or FASTA algorithm ("Introduction to computational Biology" 1995, M. S. Waterman, Chapman & Hall).

The gene products are used for sequencing as described above prepared and sequenced using the 2NTs * / 2NTs method. You get Sequence sections from gene products, each sequence having a Sequence of 2NTs * represents. Known gene sequences serve as Reference sequences. To clearly identify the determined To allow sequence to a known reference sequence must this sequence should be long enough. The length is preferably of the sequences determined more than 20 NT * s. Since 2 marked NTs * represent only part of the sequence is the total length of the  synthesized complementary strand about twice as long as the sequence of the detected NTs * (with 20 detected NTs * the total length is z. B. 40 NTs on average).

4 nucleotides are used to synthesize a complementary strand needed. Since the NTs marked with a fluorescent dye * appear as semiterminators in the present invention, d. H. the termination is only modifiable when available ornamental NTs * must occur, unmodified NTs in one too added additional step in each cycle in the reaction become. The exact position of this step in the cycle can vary. It is important that the marked NTs * and the unmodified NTs can be used separately.

A cycle in this embodiment may look like this, for example:

• a) Add a solution with modified NTs * and polymerases on the surface with the gene products provided,
• b) Incubation of the immobilized nucleic acid chains with this solution under conditions necessary to extend the complementary strands around a NT are suitable,
• c) washing,
• d) detection of signals from individual, modified and in that newly synthesized complementary to the gene products Strands of built-in NTs * molecules,
• e) removal of the marker and the terminating group at the built-in nucleotides,
• f) washing,
• g) addition of 2 unmodified NTs and polymerases,
• h) washing.

The concentration of the NTs is preferably below 1 mM, ideally below 10 µM.  

SEQUENCE LISTING

Claims (44)

1. Method for analyzing gene expression, in which one
provides single-stranded gene products, one
the gene products are immobilized on a reaction surface in a density of 10 to 100 gene products per 100 μm ² (stationary phase), one
perform a cyclic build-up reaction of the complementary strand of the gene products using one or more primers and one or more polymerases by

• a) a solution is added to the immobilized gene products which contains one or more polymerases and one to four modified nucleotides (NTs *) which are labeled with fluorescent dyes, the fluorescent dyes present on the NTs * in each case with the simultaneous use of at least two NTs * are selected so that the NTs * used can be distinguished from one another by measuring different fluorescence signals, the NTs * being structurally modified such that the polymerase is incapable of incorporating such an NT * into a growing complementary strand, another Incorporation of NT * into the same strand, the fluorescent dye being cleavable and the structural modification being a cleavable, sterically demanding ligand
• b) the stationary phase obtained in stage a) is incubated under conditions which are suitable for the extension of the complementary strands, the complementary strands being extended by one NT * each, one
• c) the stationary phase obtained in stage b) is washed under conditions which are not suitable for the removal of NTs * which are not incorporated into a complementary strand
• d) the individual NTs * built into complementary strands are detected by measuring the signal characteristic of the respective fluorescent dye, and at the same time determining the relative position of the individual fluorescent signals on the reaction surface
• e) to generate unlabelled (NTs or) gene products, the fluorescent dyes and the sterically demanding ligands are split off from the NTs * attached to the complementary strand, one
• f) the stationary phase obtained in step e) is washed under conditions which are suitable for removing the fluorescent dyes and the ligands, one

stages a) to f) are repeated several times, if necessary,
the relative position of individual gene products on the reaction surface and the sequence of these gene products being determined by specific assignment of the fluorescence signals detected in stages d) in successive cycles at the respective positions to the NTs, and the identity of the gene products being determined from the partial sequences determined. 2. The method according to claim 1, characterized in that one stages a) to f) of the cyclic build-up reaction several times  repeated, with only one in each cycle marked NT *. 3. The method according to claim 1, characterized in that one stages a) to f) of the cyclic build-up reaction several times repeated, with two under each cycle uses differently marked NTs *. 4. The method according to claim 1, characterized in that stages a) to f) of the cyclic build-up reaction several times repeated, with four under each cycle uses differently marked NTs *. 5. The method according to claim 1, characterized in that already known genes serve as reference sequences and one stages a) to f) of the cyclic build-up reaction several times repeated, alternating in the cycles two differently marked NTs * and two unmarked NTs and the identity of the gene products Comparison of the sequences obtained with those of the reference sequences determined. 6. The method according to claims 1 to 5, characterized records that one in each of the gene products a primer binding site (PBS) introduces, the primer binding represent the same or ver for all gene products have different sequences. 7. The method according to claims 1 to 6, characterized records that the gene products with primers under Bedin in contact with the hybridization of the primers to the primer binding sites (PBSs) of the gene products are suitable, the primers being the same as or have different sequences and the gene products then immobilized on the reaction surface.   8. The method according to claims 1 to 6, characterized records that the gene products are initially on the Reak immobilized surface and only then with Contacting primers under conditions leading to Hybridization of the primers to the primer binding sites (PBSs) of the gene products are suitable, the primers mutually identical or different sequences point. 9. The method according to claims 1 to 6, characterized records that the primer is first on the reaction immobilized surface and only then with gene brings products into contact under conditions that lead to Hybridization of the primers to the primer binding sites (PBSs) of the gene products are suitable, the primers mutually identical or different sequences point. 10. The method according to claims 1 to 9, characterized records that the one used for structural modification sterically demanding ligand ver applied fluorescent dye. 11. The method according to claims 1 to 10, characterized records that the reaction surface from the group consisting of silicone, glass, ceramics, plastics, gels is selected. 12. The method according to claim 11, characterized in that the Plastics are polycarbonates or polystyrenes. 13. The method according to claim 11, characterized in that the Gels are agarose or polyacrylamide gels. 14. The method according to claim 13, characterized in that the Gels 1 to 2% agarose gels or 5 to 15% polyacrylamide Gels are.   15. The method according to claims 1 to 14, characterized indicates that the polymerase is a polymerase without 3'-5'- Exonuclease activity is. 16. The method according to claim 15, characterized in that the Polymerase from the group consisting of viral DNA polymer Sequenase-type lawns, bacterial DNA polymerases, Reverse transcriptases, thermostable DNA polymerases or their modifications is selected. 17. The method according to claim 16, characterized in that the Polymerase Sequenase Version 2 is. 18. The method according to claim 16, characterized in that the Polymerase is Taq polymerase. 19. The method according to claim 16, characterized in that the Polymerase is ProHa DNA polymerase. 20. The method according to claim 16, characterized in that the Polymerase Klenow Fragment of DNA polymerase I from E. coli without 3'-5 'exonuclease activity. 21. The method according to claim 16, characterized in that the Polymerase AMV reverse transcriptase without RNase activity is. 22. The method according to claim 16, characterized in that the Polymerase M-MLV is reverse transcriptase. 23. The method according to claim 16, characterized in that the Polymerase HIV reverse transcriptase with no RNase activity is. 24. The method according to claims 1 to 23, characterized records that the fluorescent dyes from the group  consisting of cyanine dyes, rhodamine, xanthene and whose derivatives are selected. 25. Method for quantitative analysis of gene expression, characterized in that the method according to the An Proceeds 1 to 24 and then the Number of sequences determined for each gene product certainly. 26. The method according to claim 25, characterized in that one in addition to the gene products, one or more Control sequences used in known concentrations, the total concentration of the control sequences between between 0.01 and 10% of the total concentration of the analysis sample. 27. Kit for performing the method according to claims 1 to 26, characterized in that it is a reaction upper surface (a solid support) for carrying out the procedure rens required reaction solutions, one or more Contains polymerases, and nucleotides (NTs), one of which to four are marked with fluorescent dyes, where the marked NTs are also structurally modified in this way (NT * or NTs *) that the polymerase after incorporation of a sol Chen NT * not in a growing complementary strand is able to insert another NT * into the same strand build, the fluorescent dye is cleavable and the structural modification is a cleavable steric is a demanding ligand. 28. Kit according to claim 27, characterized in that the for structural modification used sterically demanding full ligand of the fluorescent color used for labeling is fabric. 29. Kit according to claim 27 or 28, characterized in that it further contains components:

• a) oligonucleotide primers,
• b) reagents required for cleaving off the fluorescent dyes and bulky ligands,

and or

• a) Wash solutions.

30. Kit according to claims 27 to 29, characterized in that that the reaction surface from the group consisting of Silicon, glass, ceramics, plastics, gels is selected. 31. Kit according to claim 30, characterized in that the Plastics are polycarbonates or polystyrenes. 32. Kit according to claim 30, characterized in that the gels Are agarose or polyacrylamide gels. 33. Kit according to claim 32, characterized in that the gels 1 to 2% agarose gels or 5 to 15% polyacrylamide gels are. 34. Kit according to claims 27 to 33, characterized in that the DNA polymerase is a DNA polymerase without 3'-5'- Exonuclease activity is. 35. Kit according to claim 34, characterized in that the poly merase from the group consisting of viral DNA polymerases of the sequenase type, bacterial DNA polymerases, reverses Transcriptases and thermostable DNA polymerases chooses. 36. Kit according to claim 35, characterized in that the poly merase Sequenase Version 2, Klenow fragment of the DNA polymer rase I from E. coli without 3'-5 'exonuclease activity, AMV- Reverse transcriptase without RNase activity, M-MLV reverse Transcriptase, HIV reverse transcriptase without RNase activi act, Taq polymerase or ProHa DNA polymerase.   37. Kit according to claims 27 to 36, characterized in that the fluorescent dyes from the group consisting of Cyanine dyes, rhodamines, xanthenes and their derivatives are selected. 38. Nucleotides of the formula
39. Nucleotides of the formula
40. Nucleotides of the formula
41. Nucleotide according to claim 38 to 40, characterized in that at the terminal amino group a fluorescent dye is pinned. 42. Nucleotide of the formula
43. Nucleotide of the formula
44. Nucleotide of the formula