WO2000053753A2

WO2000053753A2 - Promotion or inhibition of angiogenesis and cardiovascularization

Info

Publication number: WO2000053753A2
Application number: PCT/US2000/000219
Authority: WO
Inventors: Avi J. Ashkenazi; Kevin P. Baker; Napoleone Ferrara; Hanspeter Gerber; Audrey Goddard; Paul J. Godowski; Austin L. Gurney; Kenneth J. Hillan; Sophia S. Kuo; Melanie R. Mark; Scot A. Marsters; Nicholas F. Paoni; Robert M. Pitti; Colin K. Watanabe; P. Mickey Williams; William I. Wood
Original assignee: Genentech, Inc.
Priority date: 1999-03-08
Filing date: 2000-01-05
Publication date: 2000-09-14
Also published as: AU2600800A; WO2000053753A3

Abstract

Compositions and methods are disclosed for stimulating or inhibiting angiogenesis and/or cardiovascularization in mammals, including humans. Pharmaceutical compositions are based on polypeptides or antagonists thereto that have been identified for one or more of these uses. Disorders that can be diagnosed, prevented, or treated by the compositions herein include trauma such as wounds, various cancers, and disorders of the vessels including atherosclerosis and cardiac hypertrophy. In addition, the present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Description

PROMOTION OR INHIBITION OF ANGIOGENESIS AND CARDIOVASCULARIZATION

Background of the Invention Field of the Invention

The present invention relates to compositions and methods useful for promoting or inhibiting angiogenesis and/or cardiovascularization in mammals in need of such biological effect. This includes the diagnosis and treatment of cardiovascular disorders as well as oncological disorders.

Description of Background

A. Cardiac Disorders and Factors

Heart failure affects approximately five million Americans, and new cases of heart failure number about 400,000 each year. It is the single most frequent cause of hospitalization for people age 65 and older in the United States. Recent advances in the management of acute cardiac diseases, including acute myocardial infarction, are resulting in an expanding patient population that will eventually develop chronic heart failure. From 1979 to 1995, hospitalizations for congestive heart failure (CHF) rose from 377,000 to 872,000 (a 130 percent increase) and CHF deaths increased 116 percent.

CHF is a syndrome characterized by left ventricular dysfunction, reduced exercise tolerance, impaired quality of life, and markedly shortened life expectancy. The sine qua non of heart failure is an inability of the heart to pump blood at a rate sufficient to meet the metabolic needs of the body's tissues (in other words, there is insufficient cardiac output).

At least four major compensatory mechanisms are activated in the setting of heart failure to boost cardiac output, including peripheral vasoconstriction, increased heart rate, increased cardiac contractility, and increased plasma volume. These effects are mediated primarily by the sympathetic nervous system and the renin-angiotensin system. See, Eichhorn, American Journal of Medicine. 104: 163-169 (1998). Increased output from the sympathetic nervous system increases vascular tone, heart rate, and contractility. Angiotensin II elevates blood pressure by 1) directly stimulating vascular smooth muscle contraction, 2) promoting plasma volume expansion by stimulating aldosterone and antidiuretic hormone secretion, 3) stimulating sympathetic-mediated vascular tone, and 4) catalyzing the degradation of bradykinin, which has vasodilatory and natriuretic activity. See, review by Brown and Vaughan. Circulation.97: 141 1-1420(1998). As noted below, angiotensin II may also have directly deleterious effects on the heart by promoting myocyte necrosis (impairing systolic function) and intracardiac fibrosis (impairing diastolic and in some cases systolic function). See, Weber, Circulation. 96: 4065-4082 (1998).

A consistent feature of congestive heart failure (CHF) is cardiac hypertrophy, an enlargement of the heart that is activated by both mechanical and hormonal stimuli and enables the heart to adapt to demands for increased cardiac output. Morgan and Baker. Circulation, 83: 13-25 (1991 ). This hypertrophic response is frequently associated with a variety of distinct pathological conditions such as hypertension, aortic stenosis, myocardial infarction, cardiomyopathy, valvular regurgitation, and intracardiac shunt, all of which result in chronic hemodynamic overload

Hypertrophy is generally defined as an increase in size of an organ or structure independent of natural growth that does not involve tumor formation Hypertrophy of the heart is due either to an increase in the mass of the individual cells (myocytes), or to an increase in the number of cells making up the tissue (hyperplasia), or both While the enlargement of an embryonic heart is largely dependent on an increase in myocyte number (which continues until shortly after birth), post-natal cardiac myocytes lose their prohferative capacity Further growth occurs through hypertrophy of the individual cells Adult myocyte hypertrophy is initially beneficial as a short term response to impaired cardiac function by permitting a decrease in the load on individual muscle fibers With severe, long-standing overload, however, the hypertrophied cells begin to deteriorate and die Katz, "Heart Failure", in Katz A M ed . Physiology of the Heart (New York Raven Press, 1992) pp 638-668 Cardiac hypertrophy is a significant risk factor for both mortality and morbidity in the clinical course of heart failure Katz, Trends Cardiovasc Med , 5 37-44 (1995) For further details of the causes and pathology of cardiac hypertrophy see, e g , Heart Disease. A Textbook of Cardiovasculai

Medicine. Braunwald, E ed (W B Saunders Co , 1988), Chapter 14, "Pathophysiology of Heart Failure "

On a cellular level, the heart is composed of myocytes and surrounding support cells, geneπcally called non-myocytes While non-myocytes are primarily fibroblast/mesenchymal cells, they also include endothehal and smooth muscle cells Indeed, although myocytes make up most of the adult myocardial mass, they represent only about 30% of the total cell numbers present in heart In response to hormonal, physiological, hemodynamic, and pathological stimuli, adult ventricular muscle cells can adapt to increased workloads through the activation of a hypertrophic process This response is characterized by an increase in myocyte cell size and contractile protein content of individual cardiac muscle cells, without concomitant cell division and activation of embryonic genes, including the gene for atπal natπuretic peptide (ANP) Chien etal , FASEB J . 5 3037-3046 (1991 ), Chien et al , Annu Re\ Physiol .55 77-95 (1993) An increment in myocardial mass as a result of an increase in myocyte size that is associated with an accumulation of interstitial collagen within the extracellular matrix and around intramyocardial coronary arteries has been described in left ventricular hypertrophy secondary to pressure overload in humans Caspaπ et al , Cardiovasc Res . ϋ 554-558 (1977), Schwarz et al , Am J Cardiol . 42 895-903 (1978). Hess et al , Circulation. 63 360-371 (1981 ). Pearlman et al . Lab Invest . 46 158-164 (1982) It has also been suggested that paracπne factors produced by non-myocyte supporting cells may additionally be involved in the development of cardiac hypertrophy, and various non-myocyte derived hypertrophic factors, such as, leukocyte inhibitory factor (LIF) and endothe n, have been identified Metcalf, Growth Factoi s. 7 169-173 (1992), Kurzrock et al , Endocrine Reviews 12 208-217 ( 1991 noue et al , Proc Natl Acad Sci USA, 86 2863-2867 (1989), Yanagisawa and Masaki. Trends Pharm Sci . 10 374-378 (1989), U S Patent No 5,573,762 (issued November 12, 1996) Further exemplary factors that have been identified as potential mediators of cardiac hypertrophy include cardιotrophιn-1 (CT-1 ) (Pennica et al , Proc Nat Acad Sci USA. 92 1 142- 1 146 (1995)) catecholamines, adrenocorticosteroids, angiotensin, and piostaglandms

At present, the treatment of cardiac hypertrophy varies depending on the underlying cardiac disease Catecholamines, adrenocorticosteroids, angiotensin, prostaglandins, LIF, endothelin (including endothelin-l , -2, and -3 and big endothelin), and CT-1 are among the factors identified as potential mediators of hypertrophy For example, beta adrenergic receptor blocking drugs (beta-blockers, e g , propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol, carvedilol, etc ) and verapamil have been used extensively in the treatment of hypertrophic cardiomyopathy The beneficial effects of beta-blockers on symptoms

(e g , chest pain) and exercise tolerance are largely due to a decrease in the heart rate with a consequent prolongation of diastole and increased passive ventricular filling Thompson etal , Br Heart J .44 488-98 (1980), Harrison et al , Circulation. 29 84-98 (1964) Verapamil has been described to improve ventricular filling and probably reducing myocardial ischemia Bonow et al , Circulation. 72 853-64 (1985) Nifedipine and diltiazem have also been used occasionally in the treatment of hypertrophic cardiomyopathy Lorell e; al . Circulation.65 499-507 (1982). Betocchi etal , Am J Cardiol , 78 451-457 (1996) However, because of its potent vasodilating properties, nifedipine may be harmful, especially in patients with outflow obstruction Disopyramide has been used to relieve symptoms by virtue of its negative inotropic properties Polhck, N Engl J Med . 307 997-999 (1982) In many patients, however, the initial benefits decrease with time Wigleefα/ . Circulation, 92 1680-1692(1995) Antihypertensive drug therapy has been reported to have beneficial effects on cardiac hypertrophy associated with elevated blood pressure Examples of drugs used in antihypertensive therapy, alone or in combination, are calcium antagonists, e g , nitrendipine, adrenergic receptor blocking agents, e g , those listed above, angiotensin converting enzyme (ACE) inhibitors such as quinapπl, captopπl, enalapπl, ramipπl, benazepπl, fosinopπl, and lisinopπl, diuretics, e g , chlorothiazide, hydrochlorothiazide, hydroflumethazide, methylchlothiazide, benzthiazide, dichlorphenamide, acetazolamide, and indapamide, and calcium channel blockers, e g , diltiazem, nifedipine, verapamil, and mcardipine

For example, treatment of hypertension with diltiazem and captopπl showed a decrease in left ventπculai muscle mass, but the Doppler indices of diasto c function did not normalize Szlachcic et al , Am J Cardiol . 63 198-201 (1989), Shahi et al , Lancet. 336 458-461 (1990) These findings were interpreted to indicate that excessi\ e amounts of interstitial collagen may remain after regression of left ventricular hypertrophy Rossi et al ,

Am Heart J . 124 700-709 (1992) Rossi etal , supia, investigated the effect of captopπl on the prevention and regression of myocardial cell hypertrophy and interstitial fibrosis in pressure overload cardiac hypertrophy, in experimental rats

Agents that increase cardiac contractility directly (lontropic agents) were initially thought to benefit patients with heart failure because they improved cardiac output in the short term However, all positive inotropic agents except digoxigenin have been found to result in increased long-term mortality, m spite of short-term ιmpro\ ements in cardiac performance Massie, Curr Op in Cardiology. 12 209-217 (1997), Reddy et al , Curr Opin Cardiol . 12 233-241 ( 1997) Beta-adrenergic receptor blockers have recently been advocated for use in heart failure Evidence from clinical trials suggests that improvements in cardiac function can be achieved without increased mortality, though documented improvements patient survival have not yet been demonstrated See also,

U S Pat Nos 5,935 924, 5,624,806, 5,661 ,122, and 5,610, 134 and WO 95/28173 regarding the use of cardιotropιn-1 or antagonists thereof or growth hormone and/or insulin like growth factor-I in the treatment of CHF Another treatment modality is heart transplantation, but this is limited by the avaιlabιht\ of donor hearts Endothelin is a vasoconstπcting peptide comprising 21 amino acids, isolated from swine arterial endothehal culture supernatant and structurally determined Yanagisawa et al , Nature. 332 41 1 -415 (1988) Endothelin was later found to exhibit various actions, and endothelin antibodies as endothelin antagonists have proven effective in the treatment of myocardial infarction, renal failure, and other diseases Since endothelin is present m live bodies and exhibits vasoconstπcting action, it is expected to be an endogenous factor involved in the regulation of the circulatory system, and may be associated with hypertension, cardiovascular diseases such as myocardial infarction, and renal diseases such as acute renal failure Endothelin antagonists are described, for example, in U S Pat No 5,773,414, JP Pat Publ 3130299/1991, EP 457,195, EP 460,679, and EP 552,489 A new endothelin B receptor for identifying endothelin receptor antagonists is described in U S Pat No 5,773,223 Current therapy for heart failure is primarily directed to using angiotensin-converting enzyme (ACE) inhibitors, such as captopπl, and diuretics These drugs improve hemodynamic profile and exercise tolerance and reduce the incidence of morbidity and mortality in patients with CHF Kramer et al , Circulation. 67(4) 807-816 (1983), Captopπl Multicenter Research Group, J A C C . 2(4) 755-763 (1983), The CONSENSUS Trial Study Group. N Engl J Med .316(23) 1429-1435 (1987). The SOLVD Investigators. N Engl J Med .325(5) 293-302 (1991 ) Further, they are useful in treating hypertension, left ventricular dysfunction, atherosclerotic vascular disease, and diabetic nephropathy Brown and Vaughan, supra However, despite proven efficacy, response to ACE inhibitors has been limited For example, while prolonging survival in the setting of heart failure, ACE inhibitors appear to slow the progression towards end-stage heart failure, and substantial numbers of patients on ACE inhibitors have functional class III heart failure Moreover, improvement of functional capacity and exercise time is only small and mortality, although reduced, continues to be high The CONSENSUS Trial Study Group, N Engl J Med .316(23) 1429-1453 (1987), The SOLVD Investigators, N Engl J Med . 325(5) 293-302 (1991 ), Cohn et al , N Engl J Med . 325(5) 303-310 ( 1991 ), The Captopπl-Digoxin Multicenter Research Group. JAMA, 259(4) 539 544 (1988) Hence, ACE inhibitors consistently appear unable to relieve symptoms in more than 60% of heart failure patients and reduce mortality of heart failure only by approximately 1 -20% For further adverse effects, see Brown and Vaughan supta

An alternative to ACE inhibitors is represented by specific ATI receptor antagonists Clinical studies are planned to compare the efficacy of these two modalities in the treatment of cardiovascular and renal disease However, animal model data suggests that the ACE/Ang II pathway, while clearly involved in cardiac hypertroph) , is not the only, or even the primary pathway active in this role Mouse genetic "knockout" models have been made to test individual components of the pathway In one such model, the primary cardiac receptor for Ang II, AT sub 1A, has been genetically deleted, these mice do not develop hypertrophy when Ang II is given experimentally (confirming the basic success of the model in eliminating hypertrophy secondary to Ang II) However, when the aorta is constricted in these animals (a model of hypertensive cardiac stress), the hearts still become hypertrophic This suggests that alternative signaling pathways, not depending on this receptor (AT sub 1 A), are activated in hypertension ACE inhibitors would presumably not be able to inhibit these pathways See, Harada et al , Circulation. 97 1952-1959 (1998) See also. Homey, Circulation. 97 1890 1892 ( 1998) regarding the enigma associated with the process and mechanism of cardiac hypertrophy About 750,000 patients suffer from acute myocardial infarction (AMI) annually, and approximately one-fourth of all deaths in the United States are due to AMI In recent years, thrombolytic agents, e g , streptokinase, urokinase, and in particular tissue plasminogen activator (t-PA) have significantly increased the survival of patients who suffered myocardial infarction When administered as a continuous intravenous infusion over 1 5 to 4 hours, t-PA produces coronary patency at 90 minutes in 69% to 90% of the treated patients Topol etal , Am J Cardiol . 61, 723 728 (1988), Neuhaus et al , J Am Coll Cardiol , Y2 581-587 (1988), Neuhaus et al , J Am Coll Cardiol , 14 1566- 1569 ( 1989) The highest patency rates have been reported with high dose or accelerated dosing regimens Topol, J Am Coll Cardiol , J_5 922 924 ( 1990) t-PA may also be administered as a single bolus, although due to its relatively short half-life, it is better suited for infusion therapy Tebbe et al , Am J Cardiol , 64 448-453 (1989) A t-PA variant, specifically designed to have longer half-life and very high fibrin specificity, TNK t-PA (a Tl 03N, Nl 17Q, KHRR(296-299)AAAA t PA vai nt, Keyt et al , Proc Natl Acad Sci USA, 91 3670-3674 (1994)) is particularly suitable for bolus administration However, despite all these advances, the long-term prognosis of patient survival depends greatly on the post infarction monitoring and treatment of the patients, which should include monitoring and treatment of cardiac hypertrophy

B Growth Factors

Various naturally occurring polypeptides reportedly induce the proliferation of endothehal cells Among those polypeptides are the basic and acidic fibroblast growth factors (FGF) (Burgess and Maciag, Annual Rev Biochem .58 575 ( 1989)), platelet derived endothehal cell growth factor (PD-ECGF) (Ishikawa etal , Nature, 338 557 (1989)), and vascular endothehal growth factor (VEGF) Leung et al . Science, 246 1306 (1989), Ferrara and

Henzel, Biochem Biophys Res Commun , 161 851 (1989), Tischer et al . Biochem Biophys Res Commun , 165 1 198 (1989), EP 471.754B granted July 31 , 1996

Media conditioned by cells transfected with the human VEGF (h VEGF) cDNA promoted the proliferation of capillary endothehal cells, whereas control cells did not Leung et al , Science. 246 1306 (1989) Several additional cDNAs were identified in human cDNA libraries that encode 121 189 and 206 amino acid isoforms of hVEGF (also collectively referred to as hVEGF-related proteins) The 121 -amino acid protein differs from hVEGF by virtue of the deletion of the 44 amino acids between residues 1 16 and 159 in hVEGF The 189-ammo acid protein differs from hVEGF by virtue of the insertion ot 24 amino acids at residue 1 16 in hVEGF, and apparently is identical to human vascular permeability factor (hVPF) The 206-amιno acid protein differs from hVEGF by virtue of an insertion of 41 amino acids at residue 1 16 ιn hVEGF Houck etal , Mol Endocrin .5 1806

(1991 ), Ferrara et al , J Cell Biochem 47 21 1 (1991 ). Ferrara et al . Endocrine Reviews, 13 18 (1992), Keck et al , Science. 246 1309 ( 1989), Connolly et al , J Biol Chem . 264 20017 ( 1989), EP 370 989 published May 30, 1990

It is now well established that angiogenesis, which invoKes the formation of new blood vessels from preexisting endothehum, is implicated in the pathogenesis of a variety of disorders These include solid tumors and metastasis, atherosclerosis, retrolental fibroplasia, hemangiomas chronic inflammation, intraocular neovasculai syndromes such as pro ferative retinopathies, e g , diabetic retinopathy, age related macular degeneration (AMD) neovascular glaucoma immune rejection of transplanted corneal tissue and other tissues, rheumatoid arthritis, and psoriasis Folkman e. g/ , J Biol Chem , 267 l093 l -10934 (l992), Klagsbrun e?a/ , Annu Rev Physιol .53 217- 239 (1991 ), and Garner A , "Vascular diseases "Jn Pathobiology of Ocular Disease A Dynamic Approach, Garner A , Khntworth GK, eds , 2nd Edition (Marcel Dekker, NY, 1994), pp 1625-1710

In the case of tumor growth, angiogenesis appears to be crucial for the transition from hyperplasia to neoplasm, and for providing nourishment to the growing solid tumor Folkman e/-^"./ . Natuie, 339 58 (1989) The neovasculaπzation allows the tumor cells to acquire a growth advantage and prohferative autonomy compared to the normal cells Accordingly, a correlation has been observed between density of microvessels in tumor sections and patient survival in breast cancer as well as in several other tumors Weidner et al , N Engl J Med, 324 1 -6 (1991), Horak et al , Lancet, 340 1 120-1 124 (1992), Macchiaπni et al , Lancet, 340 145-146 (1992) The search for positive regulators of angiogenesis has yielded many candidates, including aFGF, bFGF, TGF- α, TGF-β, HGF, TNF-α, angiogemn, IL-8, etc Folkman et al , J B C , supra, and Klagsbrun et al , supra The negative regulators so far identified include thrombospondin (Good et αl , Proc Natl Acad Sci USA . 82 6624- 6628 (1990)), the 16-kιlodalton N-terminal fragment of prolactin (Clapp et αl , Endocrinology, 133 1292-1299 (1993)), angiostatm (O'Reilly et αl , Cell, 79 315-328 (1994)), and endostatin O'Reilly et αl . Cell, 88 277-285 (1996)

Work done over the last several years has established the key role of VEGF, not only in stimulating vascular endothehal cell proliferation, but also in inducing vascular permeability and angiogenesis Ferrara et αl , Endocr Rev . 18 4-25 ( 1997) The finding that the loss of even a single VEGF allele results in embryonic lethality points to an irreplaceable role played by this factor in the development and differentiation of the vascular system Furthermore, VEGF has been shown to be a key mediator of neovasculaπzation associated with tumors and intraocular disorders Ferrara et αl , Endocr Rev . supra The VEGF mRNA is overexpressed by the majority of human tumors examined Berkman et αl , J Chn Invest . 91 153-159 (1993), Brown et αl , Human Pathol 26 86-91 (1995), Brown etαl , Cancer Res , 53 4727-4735 (1993), Mattern era/ , Brit J Cancer, 73 931 -934 (1996) Dvorak et αl , Am j Pathol . 146 1029- 1039 ( 1995) Also, the concentration levels of VEGF in eye fluids are highly correlated to the presence of active proliferation of blood vessels in patients with diabetic and other ischemia-related retinopathies Aiello et αl N_ Engl J Med . 331 1480- 1487 ( 1994) Furthermore, recent studies have demonstrated the localization of VEGF in choroidal neovascular membranes in patients affected by AMD Lopez et αl , Invest Ophthalmol Vis Sci , 37 855-868 (1996) Anti-VEGF neutralizing antibodies suppress the growth of a variety of human tumor cell lines in nude mice

(Kim et αl , Natuie, 362 841 -844 (1993), Warren et αl , J Chn Invest , 95 1789-1797 (1995), Borgstrom et αl Cancer Res . 56 4032-4039 (1996), Melnyk et αl . Cancer Res , 56 921 924 (1996)) and also inhibit intraoculai angiogenesis in models of lschemic retinal disorders Adamis et αl Arch Ophthalmol , 1 14 66 71 (1996) Therefore anti-VEGF monoclonal antibodies or other inhibitors of VEGF action are promising candidates for the treatment of solid tumors and various intraocular neovascular disorders Such antibodies are described foi example in EP 817 648 published January 14, 1998 and in PCT/US 98/06724 filed April 3, 1998

There exist several other growth factors and mitogens. including transtoimmg oncogenes, that are capable of rapidly inducing a complex set of genes to be expressed by certain cells Lau and Nathans, Molecular Aspects of Cellular Regulation, 6 165-202 ( 1991 ) These genes, which have been named immediate-early- or early-response genes, are transcriptionally activated within minutes after contact with a growth factor or mitogen, independent of de novo protein synthesis A group of these intermediate-early genes encodes secreted, extracellular proteins that are needed for coordination of complex biological processes such as differentiation and proliferation, regeneration, and wound healing Ryseck et al , Cell Growth Differ , 2 235-233 (1991 )

Highly-related proteins that belong to this group include ceflO (Simmons etal , Proc Natl Acad Sci USA, 86 1 178-1 182 (1989)), cyr 61, which is rapidly activated by serum- or platelet-derived growth factor (PDGF) (O'Brien et al , Mol Cell Biol . K) 3569-3577 (1990), human connective tissue growth factor (CTGF) (Bradha et al , J Cell Biol , 1 14 1285-1294 (1991 )), which is secreted by human vascular endothehal cells in high levels after activation with transforming growth factor beta (TGF-β), exhibits PDGF- ke biological and immunological activities, and competes with PDGF for a particular cell surface receptor, fiψ-12 (Ryseck et al , Cell Growth Differ , 2 235-233 (1991 )), human vascular IBP-hke growth factor (VIGF) (WO 96/17931 ), and nov, normally arrested in adult kidney cells, which was found to be overexpressed in myeloblastosis-associated- virus-type- 1 - mduced nephroblasto as Joloit et al , Mol Cell Biol . 12 10 21 ( 1992) The expression of these immediate-early genes acts as "third messengers" in the cascade of events triggered by growth factors It is also thought that they are needed to integrate and coordinate complex biological processes, such as differentiation and wound healing in which cell proliferation is a common event

As additional mitogens, insulin-like growth factor binding proteins (IGFBPs) have been shown, in complex with insulin-like growth factor (IGF), to stimulate increased binding of IGF to fibroblast and smooth muscle cell surface receptors Clemmons et al , J Chn Invest , 77 1548 (1986) Inhibitory effects of IGFBP on various IGF actions in vitro include stimulation of glucose transport by adipocytes, sulfate incorporation by chondrocytes, and thymidme incorporation in fibroblast Zapf et al Chn Invest , 63 1077 (1979) In addition, inhibitory effects of IGFBPs on growth factor-mediated mitogen activity in normal cells have been shown

C Need for Further Treatments

In view of the role of vascular endothehal cell growth and angiogenesis in many diseases and disorders, it is desirable to have a means of reducing or inhibiting one or more of the biological effects causing these processes It is also desirable to have a means of assaying for the presence of pathogenic polypeptides in normal and diseased conditions, and especially cancer Further, in a specific aspect, as there is no generally applicable therapy for the treatment of cardiac hypertrophy, the identification of factors that can prevent or reduce cardiac myocyte hypertrophy is of primary importance in the development of new therapeutic strategies to inhibit pathophysiological cardiac growth While there are several treatment modalities for various cardiovascular and oncologic disorders, there is still a need for additional therapeutic approaches

Summary of the Invention

A Embodiments

Accordingly, the present invention concerns compositions and methods for promoting or inhibiting angiogenesis and/or cardiovasculaπzation in mammals The present invention is based on the identification of proteins that test positive in various cardiovascular assays that test promotion or inhibition of certain biological activities Accordingly, the proteins are believed to be useful drugs for the diagnosis and/or treatment (including prevention) of disorders where such effects are desired, such as the promotion or inhibition of angiogenesis, inhibition or stimulation of vascular endothehal cell growth, stimulation of growth or proliferation of vascular endothehal cells, inhibition of tumor growth, inhibition of angiogenesis-dependent tissue growth, stimulation of angiogenesis-dependent tissue growth, inhibition of cardiac hypertrophy and stimulation of cardiac hypertrophy, e g , for the treatment of congestive heart failure

In one embodiment, the present invention provides a composition comprising a PRO polypeptide in admixture with a pharmaceutically acceptable carrier In one aspect, the composition comprises a therapeutically effective amount of the polypeptide In another aspect, the composition comprises a further active ingredient, namely, a cardiovascular, endothehal or angiogenic agent or an angiostatic agent, preferably an angiogenic or angiostatic agent Preferably, the composition is sterile The PRO polypeptide may be administered in the form of a liquid pharmaceutical formulation, which may be preserved to achieve extended storage stability Preserved liquid pharmaceutical formulations might contain multiple doses of PRO polypeptide, and might, therefore, be suitable for repeated use

In a further embodiment, the present invention provides a method for preparing such a composition useful for the treatment of a cardiovascular, endothehal or angiogenic disorder comprising admixing a therapeutically effective amount of a PRO polypeptide with a pharmaceutically acceptable carrier

In another embodiment, the present invention provides a composition comprising an agonist or antagonist of a PRO polypeptide in admixture with a pharmaceutically acceptable carrier In one aspect, the composition comprises a therapeutically effective amount of the agonist or antagonist In another aspect, the composition comprises a further active ingredient, namely, a cardiovascular, endothehal or angiogenic agent or an angiostatic agent, preferably an angiogenic or angiostatic agent Preferably, the composition is sterile The PRO polypeptide agonist or antagonist may be administered in the form of a liquid pharmaceutical formulation, which may be preserved to achieve extended storage stability Preserved liquid pharmaceutical formulations might contain multiple doses of a PRO polypeptide agonist or antagonist, and might, therefore, be suitable for repeated use

In a further embodiment, the present invention provides a method for preparing such a composition useful for the treatment of a cardiovascular, endothehal or angiogenic disorder compπsi ng admixing a therapeutical ly ef ective amount of a PRO polypeptide agonist or antagonist with a pharmaceutically acceptable earner In yet another embodiment, the present invention concerns a composition compπsing an anti-PRO antibody in admixture with a pharmaceutically acceptable carrier In one aspect, the composition comprises a therapeutically effective amount of the antibody In another aspect, the composition comprises a further active ingredient, namely, a cardiovascular, endothehal or angiogenic agent or an angiostatic agent, preferably an angiogenic or angiostatic agent Preferably, the composition is sterile The composition may be administeied in the form of a liquid pharmaceutical formulation, which may be preserved to achieve extended storage stability Preserved liquid pharmaceutical formulations might contain multiple doses of the anti-PRO antibod} . and might, therefore, be suitable for repeated use In preferred embodiments, the antibody is a monoclonal antibody, an antibody fragment, a humanized antibody, or a single-chain antibody In a further embodiment, the present invention provides a method for preparing such a composition useful for the treatment of a cardiovascular, endothehal or angiogenic disorder comprising admixing a therapeutically effective amount of an anti-PRO antibody with a pharmaceutically acceptable earner

In a still further aspect, the present invention provides an article of manufacture comprising (a) a composition of matter compπsing a PRO polypeptide or agonist or antagonist thereof,

(b) a container containing said composition, and

(c) a label affixed to said container, or a package insert included in said container referring to the use of said PRO polypeptide or agonist or antagonist thereof in the treatment of a cardiovascular, endothehal or angiogenic disorder, wherein the agonist or antagonist may be an antibody which binds to the PRO polypeptide The composition may comprise a therapeutically effective amount of the PRO polypeptide or the agonist or antagonist thereof

In another embodiment, the present invention provides a method for identifying an agonist of a PRO polypeptide comprising

(a) contacting cells and a test compound to be screened under conditions suitable for the induction of a cellular response normally induced by a PRO polypeptide, and

(b) determining the induction of said cellular response to determine if the test compound is an effective agonist, wherein the induction of said cellular response is indicative of said test compound being an effective agonist

(a) contacting cells and a test compound to be screened under conditions suitable for the stimulation of cell proliferation by a PRO polypeptide, and

(b) measuring the proliferation of said cells to determine if the test compound is an effective agonist, wherein the stimulation of cell proliferation is indicative of said test compound being an effective agonist In another embodiment, the invention provides a method for identifying a compound that inhibits the activity of a PRO polypeptide comprising contacting a test compound with a PRO polypeptide under conditions and for a time sufficient to allow the test compound and polypeptide to interact and determining whether the activity of the PRO polypeptide is inhibited In a specific preferred aspect, either the test compound or the PRO polypeptide is immobilized on a solid support In another preferred aspect, the non-immobilized component carries a detectable label In a preferred aspect, this method comprises the steps of

(a) contacting cells and a test compound to be screened in the presence of a PRO polypeptide under conditions suitable for the induction of a cellular response normally induced by a PRO polypeptide, and

(b) determining the induction of said cellular response to deteimine if the test compound is an effective antagonist In another preferred aspect, this process comprises the steps of

(a) contacting cells and a test compound to be screened in the presence of a PRO polypeptide under conditions suitable for the stimulation of cell proliferation by a PRO polypeptide, and

(b) measuring the proliferation of the cells to determine if the test compound is an effective antagonist In another embodiment, the invention provides a method for identifying a compound that inhibits the expression of a PRO polypeptide in cells that normally expresses the polypeptide, wherein the method comprises contacting the cells with a test compound and determining whether the expression of the PRO polypeptide is inhibited In a preferred aspect, this method comprises the steps of (a) contacting cells and a test compound to be screened under conditions suitable for allowing expression of the PRO polypeptide, and

(b) determining the inhibition of expression of said polypeptide

In a still further embodiment, the invention provides a compound that inhibits the expression of a PRO polypeptide, such as a compound that is identified by the methods set forth above Another aspect of the present invention is directed to an agonist or an antagonist of a PRO polypeptide which may optionally be identified by the methods described above

One type of antagonist of a PRO polypeptide that inhibits one or more of the functions or activities of the PRO polypeptide is an antibody Hence, in another aspect, the invention provides an isolated antibody that binds a PRO polypeptide In a preferred aspect, the antibody is a monoclonal antibody, which preferably has non-human complementaπty-determining-region (CDR) residues and human framework-region (FR) residues The antibody may be labeled and may be immobilized on a solid support In a further aspect, the antibody is an antibody fragment, a single-chain antibody, or a humanized antibody Preferably, the antibody specifically binds to the polypeptide

In a still further aspect, the present invention provides a method for diagnosing a disease or susceptibility to a disease which is related to a mutation in a PRO polypeptide encoding nucleic acid sequence comprising determining the presence or absence of said mutation in the PRO polypeptide nucleic acid sequence, wherein the presence or absence of said mutation is indicative of the presence of said disease or susceptibility to said disease

In a still further aspect, the invention provides a method of diagnosing a cardiovascular, endothehal or angiogenic disorder in a mammal which comprises analyzing the level of expression of a gene encoding a PRO polypeptide (a) in a test sample of tissue cells obtained from said mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher or lower expression level in the test sample as compared to the control sample is indicative of the presence of a cardiovascular, endothehal or angiogenic disorder in said mammal The expression of a gene encoding a PRO polypeptide may optionally be accomplished by measuring the level of mRNA or the polypeptide in the test sample as compared to the control sample In a still further aspect, the present invention provides a method of diagnosing a cardiovascular endothehal or angiogenic disorder in a mammal which comprises detecting the presence or absence of a PRO polypeptide in a test sample of tissue cells obtained from said mammal, wherein the presence or absence of said PRO polypeptide in said test sample is indicative of the presence of a cardiovascular, endothehal or angiogenic disorder in said mammal In a still further embodiment, the invention provides a method of diagnosing a cardiovascular, endothehal or angiogenic disorder in a mammal comprising (a) contacting an anti-PRO antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the antibody and the PRO polypeptide in the test sample, wherein the formation ot said complex is indicative of the presence of a cardiovascular, endothehal or angiogenic disorder in the mammal The detection may be qualitative or quantitative, and may be performed in comparison with monitoring the complex formation in a control sample of known normal tissue cells of the same cell type A larger or smaller quantity of complexes formed in the test sample indicates the presence of a cardiovascular, endothehal or angiogenic dysfunction in the mammal from which the test tissue cells were obtained The antibody preferably carries a detectable label Complex formation can be monitored, for example, by light microscopy, flow cytometry, fluoπmetry, or other techniques known in the art The test sample is usually obtained from an individual suspected to have a cardiovascular, endothehal or angiogenic disorder

In another embodiment, the invention provides a method for determining the presence of a PRO polypeptide in a sample comprising exposing a sample suspected of containing the PRO polypeptide to an anti-PRO antibody and determining binding of said antibody to a component of said sample In a specific aspect, the sample comprises a cell suspected of containing the PRO polypeptide and the antibody binds to the cell The antibody is preferably detectably labeled and/or bound to a solid support

In further aspects, the invention provides a cardiovascular, endothehal or angiogenic disorder diagnostic kit compπsing an anti-PRO antibody and a carrier in suitable packaging Preferably, such kit further comprises instructions for using said antibody to detect the presence of the PRO polypeptide Preferably, the carrier is a buffer, for example Preferably, the cardiovascular, endothehal or angiogenic disorder is cancer

In yet another embodiment, the present invention provides a method for treating a cardiovascular, endothehal or angiogenic disorder in a mammal comprising administering to the mammal an effective amount of a PRO polypeptide Preferably, the disorder is cardiac hypertrophy, trauma such as wounds or burns, or a type of cancer In a further aspect, the mammal is further exposed to angioplasty or a drug that treats cardiovascular, endothehal or angiogenic disorders such as ACE inhibitors or chemotherapeutic agents if the cardiovascular, endothehal or angiogenic disorder is a type of cancer Preferably, the mammal is human, preferably one who is at risk of developing cardiac hypertrophy and more preferably has suffered myocardial infarction

In another preferred aspect, the cardiac hypertrophy is characterized by the presence of an elevated level of PGF_2α Alternatively, the cardiac hypertrophy may be induced by myocardial infarction, wherein preferably the administration of the PRO polypeptide is initiated within 48 hours, more preferably within 24 hours, following myocardial infarction

In another preferred embodiment, the cardiovascular, endothehal or angiogenic disorder is cardiac h pertrophy and said PRO polypeptide is administered together with a cardiovascular, endothehal or angiogenic agent The preferred cardiovascular, endothehal or angiogenic agent for this purpose is selected from the group consisting of an antihypertensive drug, an ACE inhibitor, an endothelin receptor antagonist and a thrombolytic agent If a thrombolytic agent is administered, preferably the PRO polypeptide is administered following administration of such agent More preferably, the thrombolytic agent is recombinant human tissue plasminogen activator

In another preferred aspect the cardiovascular, endothehal or angiogenic disorder is cardiac hypertrophy and the PRO polypeptide is administered following primary angioplasty for the treatment of acute myocardial infarction, preferably wherein the mammal is further exposed to angioplasty or a cardiovascular, endothehal, or angiogenic agent

In another preferred embodiment, the cardiovascular, endothehal or angiogenic disorder is a cancer and the PRO polypeptide is administered in combination with a chemotherapeutic agent, a growth inhibitory agent or a cytotoxic agent

In a further embodiment, the invention concerns a method for treating a cardiovascular, endothehal or angiogenic disorder in a mammal comprising administering to the mammal an effective amount of an agonist of a PRO polypeptide Preferably, the cardiovascular, endothehal or angiogenic disorder is cardiac hypertrophy, trauma, a cancer, or age-related macular degeneration Also preferred is where the mammal is human, and where an effective amount of an angiogenic or angiostatic agent is administered in conjunction with the agonist

In a further embodiment, the invention concerns a method for treating a cardiovascular, endothehal or angiogenic disorder in a mammal comprising administering to the mammal an effective amount of an antagonist of a PRO polypeptide Preferably, the cardiovascular, endothehal or angiogenic disorder is cardiac hypertrophy, trauma, a cancer, or age-related macular degeneration Also preferred is where the mammal is human, and where an effective amount of an angiogenic or angiostatic agent is administered in conjunction with the antagonist

In a further embodiment, the invention concerns a method for treating a cardiovascular, endothehal or angiogenic disorder in a mammal comprising administering to the mammal an effective amount of an anti-PRO antibody Preferably, the cardiovascular, endothehal or angiogenic disorder is cardiac hypertrophy, trauma, a cancer, or age-related macular degeneration Also preferred is where the mammal is human, and where an effective amount of an angiogenic or angiostatic agent is administered in conjunction with the antibody

In still further embodiments, the invention provides a method for treating a cardiovascular, endothehal or angiogenic disorder in a mammal that suffers therefrom comprising administering to the mammal a nucleic acid molecule that codes for either (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide or (c) an antagonist of a PRO polypeptide, wherein said agonist or antagonist may be an anti-PRO antibody In a preferred embodiment, the mammal is human In another preferred embodiment, the gene is administered via ex vivo gene therapy In a further preferred embodiment, the gene is comprised within a vector, more preferably an adenoviral, adeno-associated viral, lentiviral, or retroviral vector In yet another aspect, the invention provides a recombinant retroviral particle comprising a retroviral vectoi consisting essentially of a promoter nucleic acid encoding (a) a PRO polypeptide, (b) an agonist polypeptide of a PRO polypeptide, or (c) an antagonist polypeptide of a PRO polypeptide, and a signal sequence for cellular secretion of the polypeptide, wherein the retroviral vector is in association with retroviral structural proteins Preferably, the signal sequence is from a mammal, such as from a native PRO polypeptide In a still further embodiment, the invention supplies an ex x tvo producer cell comprising a nucleic acid construct that expresses retroviral structural proteins and also comprises a retroviral vector consisting essentiall) of a promoter, nucleic acid encoding (a) a PRO polypeptide, (b) an agonist polypeptide of a PRO polypeptide or (c) an antagonist polypeptide of a PRO polypeptide, and a signal sequence for cellular secretion of the polypeptide wherein said producer cell packages the retroviral vector in association with the structural proteins to produce recombinant retroviral particles

In yet another embodiment, the invention provides a method tor inhibiting endothehal cell growth in a mammal comprising administering to the mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein endothehal cell growth in said mammal is inhibited and wherein said agonist or antagonist may be an anti PRO antibody Preferably, the mammal is human and the endothehal cell growth is associated with a tumor or a retinal disorder

In yet another embodiment, the invention provides a method for stimulating endothehal cell growth in a mammal comprising administering to the mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein endothehal cell growth in said mammal is stimulated, and wherein said agonist or antagonist may be an anti-PRO antibody Preferably, the mammal is human

In yet another embodiment, the invention provides a method for inhibiting cardiac hypertrophy in a mammal compπsing administering to the mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein cardiac hypertrophy in said mammal is inhibited, and wherein said agonist or antagonist may be an anti-PRO antibody Preferably, the mammal is human and the cardiac hypertrophy has been induced by myocardial infarction

In yet another embodiment, the invention provides a method for stimulating cardiac hypertrophy in a mammal comprising administering to the mammal (a) a PRO polypeptide, (b) an agonist of a PRO polypeptide, or (c) an antagonist of a PRO polypeptide, wherein cardiac hypertrophy in said mammal is stimulated, and wherein said agonist or antagonist may be an anti-PRO antibody Preferably, the mammal is human who suffers from congestive heart failure

In yet another embodiment, the invention provides a method for inhibiting angiogenesis induced by a PRO polypeptide in a mammal comprising administering a therapeutically effective amount of an anti-PRO antibody to the mammal Preferably, the mammal is a human, and more preferably the mammal has a tumor or a retinal disorder

In yet another embodiment, the invention provides a method for stimulating angiogenesis induced by a PRO polypeptide in a mammal comprising administering a therapeutically effective amount of a PRO polypeptide to the mammal Preferably, the mammal is a human, and more preferably angiogeneisis would promote tissue regeneration or wound healing

B Additional Embodiments

In other embodiments of the present invention, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a PRO polypeptide

In one aspect, the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet moi e preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity , yet moi e preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more pi eferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet moie preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to (a) a DNA molecule encoding a PRO polypeptide having a full-length ammo acid sequence as disclosed herein, an amino acid sequence lacking the signal peptide as disclosed herein, an extracellular domain of a transmembrane protein, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of the full length amino acid sequence as disclosed herein, or (b) the complement of the DNA molecule of (a)

In other aspects, the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to (a) a DNA molecule comprising the coding sequence of a full length PRO polypeptide cDNA as disclosed herein, the coding sequence of a PRO polypeptide lacking the signal peptide as disclosed herein, the coding sequence ot an extracellular domain of a transmembrane PRO polypeptide, with or without the signal peptide, as disclosed herein or the coding sequence of any other specifically defined fragment of the full-length amino acid sequence as disclosed herein, or (b) the complement of the DNA molecule of (a)

In a further aspect, the invention concerns an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to (a) a DNA molecule that encodes the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATCC as disclosed herein, or (b) the complement of the DNA molecule of (a) Another aspect of the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide which is either transmembrane domain deleted or transmembrane domain lnactiv ated or is complementary to such encoding nucleotide sequence, wherein the transmembrane domaιn(s) ot such polypeptide aie disclosed herein Therefore soluble extracellular domains of the herein described PRO polypeptides are contemplated

Another embodiment is directed to fragments of a PRO polypeptide coding sequence, or the complement thereof, that may find use as, tor example, hybridization probes, for encoding fragments of a PRO polypeptide that may optionally encode a polypeptide comprising a binding site for an anti-PRO antibody or as antisense oligonucleotide probes Such nucleic acid fragments are usually at least about 20 nucleotides in length, preferably at least about 30 nucleotides in length, more preferably at least about 40 nucleotides in length, yet more preferably at least about 50 nucleotides in length, yet more preferably at least about 60 nucleotides in length, yet more preferably at least about 70 nucleotides in length, yet more preferably at least about 80 nucleotides in length, yet more preferably at least about 90 nucleotides in length, yet more preferably at least about 100 nucleotides in length, yet more preferably at least about 110 nucleotides in length, yet more preferably at least about 120 nucleotides in length, yet more preferably at least about 130 nucleotides in length, yet more preferably at least about 140 nucleotides in length, yet more preferably at least about 150 nucleotides in length, yet more preferably at least about 160 nucleotides in length, yet more preferably at least about 170 nucleotides in length, yet more preferably at least about 180 nucleotides in length, yet more preferably at least about 190 nucleotides in length, yet more preferably at least about 200 nucleotides in length, yet more preferably at least about 250 nucleotides in length, yet more preferably at least about 300 nucleotides in length, yet more preferably at least about 350 nucleotides in length, yet more preferably at least about 400 nucleotides in length, yet more preferably at least about 450 nucleotides in length, yet more preferably at least about 500 nucleotides in length, yet more preferably at least about 600 nucleotides in length, yet more preferably at least about 700 nucleotides in length, yet more preferably at least about 800 nucleotides in length, yet more preferably at least about 900 nucleotides in length and yet more preferably at least about 1000 nucleotides in length, wherein in this context the teπn "about" means the referenced nucleotide sequence length plus or minus 10% of that referenced length It is noted that novel fragments of a PRO polypeptide-encoding nucleotide sequence may be determined in a routine manner by aligning the PRO polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well known sequence alignment programs and determining which PRO polypeptide-encoding nucleotide sequence tragment(s) are novel All of such PRO polypeptide-encoding nucleotide sequences are contemplated herein Also contemplated are the PRO polypeptide fragments encoded by these nucleotide molecule fragments, preferably those PRO polypeptide fragments that comprise a binding site for an anti-PRO antibody

In another embodiment, the invention provides isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences hereinabove identified

In a certain aspect, the invention concerns an isolated PRO polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 81 % sequence identity more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to a PRO polypeptide having a full-length amino acid sequence as disclosed herein, an amino acid sequence lacking the signal peptide as disclosed herein, an extracellular domain of a transmembrane protein, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of the full-length amino acid sequence as disclosed herein

In a further aspect, the invention concerns an isolated PRO polypeptide comprising an ammo acid sequence having at least about 80% sequence identity, preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to an amino acid sequence encoded by any of the human protein cDNAs deposited with the ATCC as disclosed herein In a further aspect, the invention concerns an isolated PRO polypeptide comprising an amino acid sequence scoring at least about 80% positives, preferably at least about 81 % positives, more preferably at least about 82% positives, yet more preferably at least about 83% positives, yet more preferably at least about 84% positives, yet more preferably at least about 85% positives, yet more preferably at least about 86% positives, yet more preferably at least about 87% positives, yet more preferably at least about 88% positives, yet more preferably at least about 89% positives, yet more preferably at least about 90% positives, yet more preferably at least about 91 % positives yet more preferably at least about 92% positives, yet more preferably at least about 93% positives, yet more preferably at least about 94% positives, yet more preferably at least about 95% positives, yet more preferably at least about 96% positives, yet more preferably at least about 97% positives, yet more preferably at least about 98% positives and yet more preferably at least about 99% positives when compared with the amino acid sequence of a PRO polypeptide having a full-length amino acid sequence as disclosed herein, an am o acid sequence lacking the signal peptide as disclosed herein, an extracellular domain of a transmembrane protein, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of the full-length amino acid sequence as disclosed herein

In a specific aspect, the invention provides an isolated PRO polypeptide without the N-terminal signal sequence and/or the initiating methionine and is encoded by a nucleotide sequence that encodes such an amino acid sequence as hereinbefore described Processes for producing the same are also herein described, wherein those processes comprise cultuπng a host cell comprising a vectoi which comprises the appi opπate encoding nucleic acid molecule under conditions suitable tor expression of the PRO polypeptide and recovering the PRO polypeptide from the cell culture

Another aspect of the invention provides an isolated PRO polypeptide which is either transmembrane domain-deleted or transmembrane domain-inacti vated Processes for producing the same are also herein described, wherein those processes comprise cultuπng a host cell compπsing a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide and recovering the PRO polypeptide from the cell culture

In yet another embodiment, the invention concerns agonists and antagonists of a native PRO polypeptide as defined herein In a particular embodiment, the agonist or antagonist is an anti-PRO antibody or a small molecule

In a further embodiment, the invention concerns a method of identifying agonists or antagonists to a PRO polypeptide which comprise contacting the PRO polypeptide with a candidate molecule and monitoring a biological activity mediated by said PRO polypeptide Preferably, the PRO polypeptide is a native PRO polypeptide

In a still further embodiment, the invention concerns a composition of matter comprising a PRO polypeptide, or an agonist or antagonist of a PRO polypeptide as herein described, or an anti-PRO antibody, in combination with a carrier Optionally, the carrier is a pharmaceutically acceptable carrier Another embodiment of the present invention is directed to the use of a PRO polypeptide, or an agonist or antagonist thereof as hereinbefore described, or an anti-PRO antibody, for the preparation of a medicament useful in the treatment of a condition which is responsive to the PRO polypeptide, an agonist or antagonist thereof or an anti-PRO antibody

In additional embodiments of the present invention, the invention provides vectors comprising DNA encoding any of the herein described polypeptides Host cell comprising any such vector are also provided By way of example, the host cells may be CHO cells, E coh, yeast, or Baculovirus-infected insect cells A process for producing any of the herein described polypeptides is further provided and comprises cultuπng host cells undei conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture In other embodiments, the invention provides chimeric molecules comprising any of the herein described polypeptides fused to a heterologous polypeptide or amino acid sequence Example of such chimeric molecules comprise any of the herein described polypeptides fused to an epitope tag sequence or a Fc region of an immunoglobulin

In yet another embodiment, the invention provides an antibody which specifically binds to any of the above or below described polypeptides Optionally, the antibody is a monoclonal antibody humanized antibody, antibody fragment or single chain antibody

In yet other embodiments, the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or as antisense probes, wheiein those probes may be derived from any of the above or below described nucleotide sequences

Brief Description of the Drawings Figures 1 A through IB show a nucleotide sequence (SEQ ID NO 1 ) of a native sequence PRO 172 cDNA wherein SEQ ID NO 1 is a clone designated herein as ' DNA35916 1 161 " Figure 2 shows the amino acid sequence (SEQ ID NO 2) derived from the coding sequence of SEQ ID NO 1 shown in Figures 1 A through 1 B

Figures 3 A through 3B show a nucleotide sequence (SEQ ID NO 8) of a native sequence PRO 175 cDNA, wherein SEQ ID NO 8 is a clone designated herein as "DNA 19355-1 150" Figure 4 shows the amino acid sequence (SEQ ID NO 9) deπved from the coding sequence of SEQ ID NO 8 shown in Figures 3A through 3B

Figure 5 shows a nucleotide sequence (SEQ ID NO 10) of a native sequence PRO 178 cDNA, wherein SEQ ID NO 10 is a clone designated herein as "DNA23339-1 130"

Figure 6 shows the am o acid sequence (SEQ ID NO 1 1 ) derived from the coding sequence of SEQ ID NO 10 shown in Figure 5

Figures 7A through 7B show a nucleotide sequence (SEQ ID NO 15) of a native sequence PROl 88 cDNA, wherein SEQ ID NO 15 is a clone designated herein as "DNA28497-1 130"

Figure 8 shows the amino acid sequence (SEQ ID NO 16) derived from the coding sequence of SEQ ID NO 15 shown in Figures 7 A through 7B Figures 9A through 9B show a nucleotide sequence (SEQ ID NO 20) of a native sequence PR0356 cDNA, wherein SEQ ID NO 20 is a clone designated herein as "DNA47470-1 130-P1 "

Figure 10 shows the amino acid sequence (SEQ ID NO 21 ) deπved from the coding sequence of SEQ ID NO 20 shown in Figures 9A through 9B

Figures 11 A through 1 IB show a nucleotide sequence (SEQ ID NO 25) of a native sequence PROl 79 cDNA, wherein SEQ ID NO 25 is a clone designated herein as "DNA 16451 -1078"

Figure 12 shows the ammo acid sequence (SEQ ID NO 26) derived from the coding sequence of SEQ ID NO 25 shown in Figures 1 1 A through 1 1 B

Figure 13 shows a nucleotide sequence (SEQ ID NO 30) of a native sequence PRO 197 cDNA, wherein SEQ ID NO 30 is a clone designated herein as "DNA22780-1078" Figure 14 shows the amino acid sequence (SEQ ID NO 31 ) derived from the coding sequence ot SEQ ID

NO 30 shown in Figure 13

Figure 15 shows a nucleotide sequence (SEQ ID NO 35) of a native sequence PR0198 cDNA, wherein SEQ ID NO 35 is a clone designated herein as "DNA33457-1078"

Figure 16 shows the amino acid sequence (SEQ ID NO 36) derived from the coding sequence of SEQ ID NO 35 shown in Figure 15

Figure 17 shows a nucleotide sequence (SEQ ID NO 40) of a native sequence PRO 182 cDNA, wherein SEQ ID NO 40 is a clone designated herein as "DNA27865-1091 '

Figure 18 shows the amino acid sequence (SEQ ID NO 41 ) derived from the coding sequence of SEQ ID NO 40 shown in Figure 17 Figure 19 shows a nucleotide sequence (SEQ ID NO 45) ot a native sequence PRO 195 cDNA, wherein SEQ

ID NO 45 is a clone designated herein as "DNA26847-1395"

Figure 20 shows the amino acid sequence (SEQ ID NO 46) derived from the coding sequence of SEQ ID NO 45 shown in Figure 19 Figures 21 A through 21 B show a nucleotide sequence (SEQ ID NO 50) of a native sequence PRO200 cDNA, wherein SEQ ID NO 50 is a clone designated herein as "DNA29101 -1 122"

Figure 22 shows the amino acid sequence (SEQ ID NO 51 ) derived from the coding sequence of SEQ ID NO 50 shown in Figures 21 A through 21 B Figure 23 shows a nucleotide sequence (SEQ ID NO 56) of a native sequence PR021 1 cDNA, wherein SEQ

ID NO 56 is a clone designated herein as "DNA32292-1 131 "

Figure 24 shows the amino acid sequence (SEQ ID NO 57) derived from the coding sequence of SEQ ID NO 56 shown in Figure 23

Figures 25 A through 25B show a nucleotide sequence (SEQ ID NO 61 ) of a native sequence PR0217 cDNA, wherein SEQ ID NO 61 is a clone designated herein as "DNA33094-1131 "

Figure 26 shows the am o acid sequence (SEQ ID NO 62) derived from the coding sequence of SEQ ID NO 61 shown in Figures 25 A through 25B

Figures 27 A through 27B show a nucleotide sequence (SEQ ID NO 66) of a native sequence PR0219 cDNA, wherein SEQ ID NO 66 is a clone designated herein as "DNA32290-1 164" Figure 28 shows the amino acid sequence (SEQ ID NO 67) derived from the coding sequence of SEQ ID

NO 66 shown in Figures 27A through 27B

Figure 29 shows a nucleotide sequence (SEQ ID NO 71 ) of a native sequence PR0221 cDNA, wherein SEQ ID NO 71 is a clone designated herein as "DNA33089-1132"

Figure 30 shows the amino acid sequence (SEQ ID NO 72) derived from the coding sequence of SEQ ID NO 71 shown in Figure 29

Figure 31 shows a nucleotide sequence (SEQ ID NO 76) of a native sequence PR0224 cDNA, wherein SEQ ID NO 76 is a clone designated herein as "DNA33221-1 133"

Figure 32 shows the amino acid sequence (SEQ ID NO 77) derived from the coding sequence of SEQ ID NO 76 shown Figure 31 Figures 33 A through 33B show a nucleotide sequence (SEQ ID NO 81 ) of a native sequence PR0228 cDNA, wherein SEQ ID NO 81 is a clone designated herein as "DNA33092-1202"

Figure 34 shows the amino acid sequence (SEQ ID NO 82) derived from the coding sequence of SEQ ID NO 81 shown in Figures 33A through 33B

Figure 35 shows a nucleotide sequence (SEQ ID NO 90) of a native sequence PR0245 cDNA, wherein SEQ ID NO 90 is a clone designated herein as "DNA35638-1 141 "

Figure 36 shows the amino acid sequence (SEQ ID NO 91) derived from the coding sequence of SEQ ID NO 90 shown in Figure 35

Figure 37 shows a nucleotide sequence (SEQ ID NO 95) of a native sequence PR0246 cDNA, wherein SEQ ID NO 95 is a clone designated herein as "DNA35639-1 172" Figure 38 shows the ammo acid sequence (SEQ ID NO 96) deπved from the coding sequence of SEQ ID

NO 95 shown in Figure 37

Figure 39 shows a nucleotide sequence (SEQ ID NO 100) of a native sequence PR02 8 cDNA, wherein SEQ ID NO 100 is a clone designated herein as "DNA35918- 1 174" Figure 40 shows the amino acid sequence (SEQ ID NO 101 ) derived from the coding sequence of SEQ ID NO 100 shown in Figure 39

Figure 41 shows a nucleotide sequence (SEQ ID NO 107) of a native sequence PR0261 cDNA, wherein SEQ ID NO 107 is a clone designated herein as "DNA33473-1 176" Figure 42 shows the amino acid sequence (SEQ ID NO 108) derived from the coding sequence of SEQ ID

NO 107 shown in Figure 41

Figure 43 shows a nucleotide sequence (SEQ ID NO 1 12) of a native sequence PR0272 cDNA, wherein SEQ ID NO 1 12 is a clone designated herein as "DNA40620-1 183"

Figure 44 shows the amino acid sequence (SEQ ID NO 1 13) derived from the coding sequence of SEQ ID NO 112 shown in Figure 43

Figure 45 shows a nucleotide sequence (SEQ ID NO 1 18) of a native sequence PRO301 cDNA, wherein SEQ ID NO 1 18 is a clone designated herein as "DNA40628-1216"

Figure 46 shows the amino acid sequence (SEQ ID NO 1 19) derived from the coding sequence of SEQ ID NO 1 18 shown in Figure 45 Figure 47 shows a nucleotide sequence (SEQ ID NO 126) of a native sequence PR0322 cDNA, wherein SEQ

ID NO 126 is a clone designated herein as "DNA48336-1309"

Figure 48 shows the amino acid sequence (SEQ ID NO 127) derived from the coding sequence of SEQ ID NO 126 shown in Figure 47

Figure 49 shows a nucleotide sequence (SEQ ID NO 131 ) of a native sequence PR0328 cDNA, wherein SEQ ID NO 131 is a clone designated herein as "DNA40587- 1231 "

Figure 50 shows the amino acid sequence (SEQ ID NO 132) derived from the coding sequence of SEQ ID NO 131 shown in Figure 49

Figures 51A through 51B show a nucleotide sequence (SEQ ID NO 136) ot a native sequence PR0331 cDNA, wherein SEQ ID NO 136 is a clone designated herein as "DNA40981 -1234" Figure 52 shows the amino acid sequence (SEQ ID NO 137) derived from the coding sequence of SEQ ID

NO 136 shown in Figures 51 A through 5 IB

Figure 53 shows a nucleotide sequence (SEQ ID NO 141 ) of a native sequence PR0364 cDNA, wherein SEQ ID NO 141 is a clone designated herein as "DNA47365-1206"

Figure 54 shows the amino acid sequence (SEQ ID NO 142) derived from the coding sequence of SEQ ID NO 141 shown in Figure 53

Figure 55 shows a nucleotide sequence (SEQ ID NO 151 ) of a native sequence PR0366 cDNA, wherein SEQ ID NO 151 is a clone designated herein as "DNA33085-1 1 10"

Figure 56 shows the amino acid sequence (SEQ ID NO 152) derived from the coding sequence of SEQ ID NO 151 shown in Figure 55 Figure 57 shows a nucleotide sequence (SEQ ID NO 153) ot a native sequence PR0535 cDNA, wherein SEQ

ID NO 153 is a clone designated herein as "DNA49143-1429"

Figure 58 shows the amino acid sequence (SEQ ID NO 154) derived from the coding sequence of SEQ ID NO 153 shown in Figure 57 Figure 59 shows a nucleotide sequence (SEQ ID NO 155) of a native sequence PR0819 cDNA, wherein SEQ ID NO 155 is a clone designated herein as "DNA57695-1340"

Figure 60 shows the amino acid sequence (SEQ ID NO 156) derived from the coding sequence of SEQ ID NO 155 shown in Figure 59 Figure 61 shows a nucleotide sequence (SEQ ID NO 157) of a native sequence PR0826 cDNA, wherein SEQ

ID NO 157 is a clone designated herein as "DN A57694- 1341 "

Figure 62 shows the amino acid sequence (SEQ ID NO 158) derived from the coding sequence of SEQ ID NO 157 shown in Figure 61

Figure 63 shows a nucleotide sequence (SEQ ID NO 159) of a native sequence PROl 160 cDNA, wherein SEQ ID NO 159 is a clone designated herein as "DNA62872- 1509 "

Figure 64 shows the amino acid sequence (SEQ ID NO 160) derived from the coding sequence of SEQ ID NO 159 shown in Figure 63

Figure 65 shows a nucleotide sequence (SEQ ID NO 164) of a native sequence PROl 186 cDNA, wherein SEQ ID NO 164 is a clone designated herein as "DNA60621 -1516" Figure 66 shows the amino acid sequence (SEQ ID NO 165) derived from the coding sequence of SEQ ID

NO 164 shown in Figure 65

Figures 67A through 67B show a nucleotide sequence (SEQ ID NO 166) of a native sequence PRO 1246 cDNA, wherein SEQ ID NO 166 is a clone designated herein as "DNA64885-1529"

Figure 68 shows the amino acid sequence (SEQ ID NO 167) derived from the coding sequence of SEQ ID NO 166 shown in Figures 67A through 67B

Detailed Description of the Invention I Definitions

The phrases "cardiovascular, endothehal and angiogenic disorder", "cardiovascular endothehal and angiogenic dysfunction", "cardiovascular, endothehal or angiogenic disorder and cardiovascular, endothehal or angiogenic disfunction" are used interchangeably and refer in part to systemic disorders that affect vessels, such as diabetes melhtus, as well as diseases of the vessels themselves, such as of the arteries, capillaries, veins, and/oi lymphatics This would include indications that stimulate angiogenesis and/or cardiovasculaπzation, and those that inhibit angiogenesis and/or cardiovasculaπzation Such disordeis include, for example, arterial disease, such as atherosclerosis, hypertension, inflammatory vascuhtides, Reynaud s disease and Reynaud s phenomenon, aneurysms, and arterial restenosis, venous and lymphatic disorders such as thrombophlebitis, lymphangitis, and lymphedema, and other vascular disorders such as peripheral vascular disease, cancel such as vascular tumors, e g , hemangioma (capillary and cavernous), glomus tumois, telangiectasia bacillary angiomatosis, hemangioendothehoma, angiosarcoma, haemangiopericytoma, Kaposi's sarcoma, lymphangioma, and lymphangiosarcoma, tumor angiogenesis, trauma such as wounds, burns, and other injured tissue, implant fixation, scarring, ischemia reperfusion injury rheumatoid arthritis, cerebrovascular disease, ienal diseases such as acute renal failure and osteoporosis This would also include angina, myocardial infarctions such as acute myocardial infarctions, cardiac hypertrophy, and heart failure such as CHF "Hypertrophy", as used herein, is defined as an increase in mass of an organ or structure independent of natural growth that does not involve tumor formation Hypertrophy of an organ or tissue is due either to an increase in the mass of the individual cells (true hypertrophy), or to an increase in the number of cells making up the tissue (hyperplasia), or both Certain organs, such as the heart, lose the ability to divide shortly after birth Accordingly, "cardiac hypertrophy" is defined as an increase in mass of the heart, which, in adults, is characterized by an increase in myocyte cell size and contractile protein content without concomitant cell division The character of the stress responsible for inciting the hypertrophy, (e g , increased preload, increased afterload, loss of myocytes, as in myocardial infarction, or primary depression of contractility), appears to play a critical role in determining the nature of the response The early stage of cardiac hypertrophy is usually characterized morphologically by increases in the size of myofibrils and mitochondria, as well as by enlargement of mitochondria and nuclei At this stage, while muscle cells are larger than normal, cellular organization is largely preserved At a more advanced stage of cardiac hypertrophy, there are preferential increases in the size or number of specific organelles, such as mitochondria, and new contractile elements are added in localized areas of the cells, in an irregular manner Cells subjected to longstanding hypertrophy show more obvious disruptions in cellular organization, including markedly enlarged nuclei with highly lobulated membranes, which displace adjacent myofibrils and cause breakdown of normal Z-band registration The phrase "cardiac hypertrophy" is used to include all stages of the progression of this condition, characterized by various degrees of structural damage of the heart muscle, regardless of the underlying cardiac disorder Hence, the term also includes physiological conditions instrumental in the development of cardiac hypertrophy, such as elevated blood pressure, aortic stenosis, or myocardial infarction "Heart failure" refers to an abnormality of cardiac function where the heart does not pump blood at the rate needed for the requirements of metabolizing tissues The heart failure can be caused by a number of factors, including ischemic, congenital, rheumatic, or ldiopathic forms

"Congestive heart failure" (CHF) is a progressive pathologic state where the heart is increasingly unable to supply adequate cardiac output (the volume of blood pumped by the heart over time) to deliver the oxygenated blood to peripheral tissues As CHF progresses, structural and hemodynamic damages occur While these damages ha\ e a variety of manifestations one characteristic symptom is ventricular hypertrophy CHF is a common end result of a number of various cardiac disorders

"Myocardial infarction' generally results from atherosclerosis of the coronary arteries, often with superimposed coronary thrombosis It may be divided into two major types transmural infarcts, in which myocardial necrosis involves the full thickness of the ventricular wall, and subendocardial (nontransmural) infarcts in which the necrosis involves the subendocardium, the mtramuial myocardium, oi both, without extending all the way through the ventricular wall to the epicardium Myocardial infarction is known to cause both a change in hemodynamic effects and an alteration in structure in the damaged and healthy zones of the heart Thus tor example myocardial infarction reduces the maximum cardiac output and the stroke volume of the heart Also associated with myocardial infarction is a stimulation of the DNA synthesis occurring in the interstice as well as an increase in the formation of collagen in the areas of the heart not affected

As a result of the increased stress or strain placed on the heart in prolonged hypertension due, for example, to the increased total peripheral resistance, cardiac hypertrophy has long been associated with hypertension A characteristic of the ventricle that becomes hypertrophic as a result of chronic pressure overload is an impaired diastohc performance Fouad et al , J Am Coll Cardiol , 4 1500- 1506 ( 1984), Smith et al , J Am Coll Cardiol , 5 869-874 (1985) A prolonged left ventricular relaxation has been detected in early essential hypertension, in spite of normal or supranormal systolic function Hartford et al Hypertension 6 329-338 (1984) However, there is no close parallelism between blood pressure levels and cardiac hypertrophy Although improvement in left ventricular function in response to antihypertensive therapy has been reported in humans, patients variously treated with a diuretic (hydiochlorothiazide), a β-blocker (propranolol), or a calcium channel blocker (diltiazem), have shown reversal of left ventricular hypertrophy, without improvement in diastohc function Inouye et al , Am J Cardiol , 53 1583-7 (1984) Another complex cardiac disease associated with cardiac hypertrophy is "hypertrophic cardiomyopathy" This condition is characterized by a great diversity of morphologic, functional, and clinical features (Maron et al , N Engl J Med .316 780-789 (1987), Spiπto etal , N Engl J Med , 320 749-755 ( 1989), Louie and Edwards, Prog Cardiovasc Pis , 36 275-308 ( 1994), Wigle et al , Circulation.92 1680- 1692 ( 1995)), the heterogeneity of which is accentuated by the fact that it afflicts patients of all ages Spiπto et al , N Engl J Med , 336 775-785 (1997) The causative factors of hypertrophic cardiomyopathy are also diverse and little understood In general, mutations in genes encoding sarcomeπc proteins are associated with hypertrophic cardiomyopathy Recent data suggest that β-myosin heavy chain mutations may account for approximately 30 to 40 percent of cases of familial hypertrophic cardiomyopathy Watkins e?-./ , N Engl J Med , 326 1108-1 114 (1992). Schwartz etal. Circulation, 91 532-540 (1995), Marian and Roberts, Circulation, 92 1336-1347 (1995), Thierfelder et al , Cell, 77 701-712 (1994), Watkins etal , Nat Gen . 1 1 434-437 (1995) Besides β myosin heavy chain, other locations of genetic mutations include cardiac troponin T, alpha topomyosm, cardiac myosin binding protein C, essential myosin light chain, and regulatory myosin light chain See, Malik and Watkins, Curr Opin Cardiol . J_2 295-302 (1997)

Supravalvular "aortic stenosis" is an inherited vascular disorder characterized by narrowing of the ascending aorta, but other arteries, including the pulmonary arteries, may also be affected Untreated aortic stenosis may lead to increased intracardiac pressure resulting in myocardial hypertrophy and eventually heart failure and death The pathogenesis of this disorder is not fully understood, but hypertrophy and possibly hyperplasia of medial smooth muscle are prominent features of this disorder It has been reported that molecular variants of the elastin gene are involved in the development and pathogenesis of aortic stenosis U S Patent No 5,650,282 issued July 22, 1997

"Valvular regurgitation occurs as a result of heart diseases resulting in disorders of the cardiac valves Various diseases, like rheumatic fever, can cause the shrinking or pulling apart of the valve orifice, while other diseases may result in endocarditis, an inflammation of the endocardium or lining membrane ot the atπoventπculai orifices and operation of the heart Defects such as the narrowing of the valve stenosis or the defective closing of the valve result in an accumulation of blood in the heart cavity or regurgitation of blood past the valve If uncorrected, prolonged valvular stenosis oi msufficienc) may result in cardiac hypertrophy and associated damage to the heart muscle, which may eventually necessitate valve replacement

The treatment of all these, and other cardiovasculai , endothehal and angiogenic disordei s which may or ma> not be accompanied by cardiac hypertrophy, is encompassed by the present invention

The terms "cancer", "cancerous", and "malignant' refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth Examples of cancer include but are not limited to, carcinoma including adenocarcinoma, lymphoma, blastoma, melanoma, sarcoma, and leukemia More particular examples of such cancers include squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, Hodgkin's and non-Hodgkin's lymphoma, pancreatic cancer, ghoblastoma, cervical cancer, ovarian cancer, liver cancer such as hepatic carcinoma and hepatoma, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometπal carcinoma, salivary gland carcinoma, kidney cancer such as renal cell carcinoma and Wilms' tumors, basal cell carcinoma, melanoma, prostate cancer, vulval cancer, thyroid cancer, testicular cancer, esophageal cancer, and various types of head and neck cancer The preferred cancers for treatment herein are breast, colon, lung, melanoma, ovarian, and others involving vascular tumors as noted above The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and or causes destruction of cells The term is intended to include radioactive isotopes (e g , ^πιI, ^{I 5}1, ⁹⁰Y, and ¹⁸⁶Re), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant, or animal origin, or fragments thereof

A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer Examples of chemotherapeutic agents include alkylating agents, fohc acid antagonists, anti-metabolites of nucleic acid metabolism, antibiotics, pyπmidine analogs, 5-fluorouracιl, cisplatin, puπne nucleosides, amines, am o acids, tπazol nucleosides, or corticosteroids Specific examples include Adπamycin, Doxorubicin, 5-Fluorouracιl, Cytosine arabinoside ("Ara-C"), Cyclophosphamide, Thiotepa, Busulfan, Cytoxin, Taxol, Toxotere, Methotrexate, Cisplatin, Melphalan, Vinblastine, Bleomycin, Etoposide, Ifosfamide, Mitomycin C, Mitoxantrone, Vincreist e, Vinorelbine, Carboplatm, Te poside, Daunomycin, Carminomycin, Aminopteπn. Dactinomycin, Mitomycms,

Esperamicins (see U S Pat No 4,675, 187), Melphalan, and other related nitrogen mustards Also included in this definition are hormonal agents that act to regulate or inhibit hormone action on tumors, such as tamoxifen and onapπstone

A "growth-inhibitory agent" when used herein refers to a compound or composition that inhibits growth of a cell, such as an Wnt-overexpressing cancer cell, either in vitio or in vι\ o Thus the growth-inhibitory agent is one which significantly reduces the percentage of malignant cells in S phase Examples of growth-inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce Gl arrest and M-phase arrest Classical M-phase blockers include the vincas (vincπstine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, daunorubicin, etoposide, and bleomycin Those agents that arrest Gl also spill over into S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5-fluorouracιl, and ara-C Further information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, eds , Chapter 1 , entitled "Cell cycle regulation, oncogenes, and antineoplastic drugs" by Murakami etal (WB Saunders Philadelphia, ! 995), especially p 13 Additional examples include tumor necrosis factor (TNF) an antibody capable of inhibiting or neutralizing the angiogenic activity of acidic or basic FGF or hepatocyte growth factor (HGF), an antibody capable of inhibiting or neutralizing the coagulant activities of tissue factoi. protein C, or protein S (see, WO 91/01753, published 21 February 1991 ), or an antibody capable of binding to HER2 receptor (WO 89/06692), such as the 4D5 antibody (and functional equivalents thereof) (e g , WO 92/22653) "Treatment" is an intervention performed with the intention of preventing the development or altering the pathology of a cardiovascular, endothehal, and angiogenic disorder The concept of treatment is used in the broadest sense, and specifically includes the prevention (prophylaxis), moderation, reduction, and curing of cardiovascular, endothehal, and angiogenic disorders of any stage Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down

(lessen) a cardiovascular, endothehal, and angiogenic disorder such as hypertrophy Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented The disorder may result from any cause, including ldiopathic, cardiotrophic, or myotrophic causes, or ischemia or lschemic insults, such as myocardial infarction "Chronic" administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial effect, such as an anti-hypertrophic effect, for an extended period of time

"Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, sheep, pigs, etc Preferably, the mammal is human Administration "in combination with" one or more further therapeutic agents includes simultaneous

(concurrent) and consecutive administration in any order

The phrase "cardiovascular, endothehal or angiogenic agents" refeis geneπcally to any drug that acts in treating cardiovascular, endothehal, and angiogenic disorders Examples of cardiovascular agents are those that promote vascular homeostasis by modulating blood pressure, heart rate, heart contractility, and endothehal and smooth muscle biology, all of which factors have a role in cardiovascular disease Specific examples of these include angιotensιn-II receptor antagonists, endothelin receptor antagonists such as, for example, BOSENTAN™ and MOXONODIN™, mterferon gamma (IFN-γ), des-aspartate-angiotensin I, thrombolytic agents, e g , streptokinase, urokinase, t-PA, and a t-PA variant specifically designed to have longer half-life and very high fibrin specificity, TNK t-PA (a Tl 03N, Nl 17Q, KHRR(296-299)AAAA t-PA variant, Keyt et al , Proc Natl Acad Sci USA 91. 3670-3674 (1994)), inotropic or hypertensive agents such as digoxigemn and β-adrenergic receptoi blocking agents, e g , propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol atenolol, metoprolol and carvedilol, angiotensin converting enzyme (ACE) inhibitors, e g , quinapπl, captopπl enalapπl, ramipπl, benazepπl, fosinopπl, and hsinopπl, diuretics, e g , chlorothiazide, hydrochlorothiazide, hydroflumethazide, methylchlothiazide, benzthiazide, dichlorphenamide, acetazolamide, and indapamide, and calcium channel blockers, e g , diltiazem, nifedipine, verapamil, nicardipine One preferred category of this type is a therapeutic agent used for the treatment of cardiac hypertrophy or ot a physiological condition instrumental in the development of cardiac hypertrophy, such as elevated blood pressure, aortic stenosis, or myocardial infarction

"Angiogenic agents' and "endothehal agents" are active agents that promote angiogenesis and/or endothehal cell growth, or, if applicable, vasculogenesis This would include factors that accelerate wound healing, such as growth hormone, suhn-like growth factor-I (IGF-I), VEGF, VIGF, PDGF, epidermal growth factor (EGF), CTGF and members of its family, FGF, and TGF-α and TGF-β

"Angiostatic agents' are active agents that inhibit angiogenesis or vasculogenesis or otherwise inhibit oi prevent growth of cancer cells Examples include antibodies or other antagonists to angiogenic agents as defined above, such as antibodies to VEGF They additionally include cytotherapeutic agents such as cytotoxic agents, chemotherapeutic agents, growth-inhibitory agents, apoptotic agents, and other agents to treat cancer, such as anti HER-2, antι-CD20, and other bioactive and organic chemical agents

In a pharmacological sense, in the context of the present invention, a "therapeutically effective amount" of an active agent such as a PRO polypeptide or agonist or antagonist thereto or an anti-PRO antibody, refers to an amount effective in the treatment of a cardiovascular, endothehal or angiogenic disorder in a mammal and can be determined empirically

As used herein, an "effective amount" of an active agent such as a PRO polypeptide or agonist or antagonist thereto or an anti-PRO antibody, refers to an amount effective for carrying out a stated purpose, wherein such amounts may be determined empirically for the desired effect

The terms "PRO polypeptide" and "PRO" as used herein and when immediately followed by a numerical designation refer to various polypeptides, wherein the complete designation (t e , PRO/number) refers to specific polypeptide sequences as described herein The terms "PRO/number polypeptide" and "PRO/number" wherein the term "number" is provided as an actual numerical designation as used herein encompass native sequence polypeptides and polypeptide variants (which are further defined herein) The PRO polypeptides described herein may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods

A "native sequence PRO polypeptide" comprises a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means The term "native sequence PRO polypeptide" specifically encompasses naturally-occurring truncated or secreted forms of the specific PRO polypeptide (e g , an extracellular domain sequence), naturally-occurring variant forms (e g , alternatively spliced forms) and naturally-occurring allehc variants of the polypeptide In vaπous embodiments of the invention, the native sequence PRO polypeptides disclosed herein are mature or full-length native sequence polypeptides comprising the full length amino acids sequences shown in the accompanying figures Start and stop codons are shov» n in bold font and undei lined in the figures However, while the PRO polypeptide disclosed in the accompanying figures are shown to begin with methionine residues designated herein as amino acid position 1 in the figures, it is conceivable and possible that other methionine residues located either upstream or downstream from the amino acid position 1 in the figures may be employed as the starting amino acid residue for the PRO polypeptides The PRO polypeptide "extracellular domain' or "ECD refers to a form of the PRO polypeptide which is essentially free of the transmembrane and cytoplasmic domains Ordinarily, a PRO polypeptide ECD will have less than 1 % of such transmembrane and/or cytoplasmic domains and preferably, will have less than 0 5% of such domains It will be understood that any transmembrane domains identified for the PRO polypeptides of the present invention aie identified pursuant to criteria routinely employed in the art for identifying that type of hydrophobic domain The exact boundaries of a transmembrane domain may \ aiy but most likely by no more than about 5 amino acids at either end of the domain as initially identified heiein Optionally, therefore, an extracellular domain of a PRO polypeptide may contain from about 5 or fewei amino acids on either side of the transmembrane domain extracellular domain boundary as identified in the Examples or specification and such polypeptides, with or without the associated signal peptide, and nucleic acid encoding them are comtemplated by the present invention The approximate location of the "signal peptides" of the various PRO polypeptides disclosed herein are shown in the present specification and/or the accompanying figures It is noted, however, that the C terminal boundary of a signal peptide may vary but most likely by no more than about 5 amino acids on either side of the signal peptide C terminal boundary as initially identified herein, wherein the C terminal boundary of the signal peptide may be identified pursuant to criteria routinely employed in the art for identifying that type of amino acid sequence element (e g , Nielsen et al , Prot Eng , J_0 1 -6 (1997) and von Heinje et al , Nucl Acids Res , 14 4683-4690 (1986)) Moreover, it is also recognized that, in some cases, cleavage of a signal sequence from a secreted polypeptide is not entirely uniform, resulting in more than one secreted species These mature polypeptides, where the signal peptide is cleaved within no more than about 5 amino acids on either side of the C-terminal boundary of the signal peptide as identified herein, and the polynucleotides encoding them, are contemplated by the present invention

"PRO polypeptide variant" means an active PRO polypeptide as defined above or below having at least about 80% amino acid sequence identity with a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein Such PRO polypeptide variants include, for instance, PRO polypeptides wherein one or more amino acid residues are added, or deleted, at the N- or C-terminus of the full-length native amino acid sequence Ordinarily, a PRO polypeptide variant will have at least about 80% amino acid sequence identity, preferably at least about 81 % amino acid sequence identity, more preferably at least about 82% am o acid sequence identity, more preferably at least about 83% amino acid sequence identity, more preferably at least about 84% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably at least about 86% amino acid sequence identity, more preferably at least about 87% amino acid sequence identity, more preferably at least about 88% ammo acid sequence identity, more preferably at least about 89% ammo acid sequence identity, more preferably at least about 90% amino acid sequence identity, more preferably at least about 91 % ammo acid sequence identity, more preferably at least about 92% amino acid sequence identity, more preferably at least about 93% am o acid sequence identity, more preferably at least about 94% amino acid sequence identity, more preferably at least about 95% amino acid sequence identity, more preferably at least about 96% amino acid sequence identity, more preferably at least about 97% amino acid sequence identity, moie preferably at least about 98% amino acid sequence identity and most preferably at least about 99% amino acid sequence identity with a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of a full length PRO pol) peptide sequence as disclosed herein Ordinarily PRO variant polypeptides ai e at least about 10 amino acids in length often at least about 20 amino acids in length more often at least about 30 amino acids in length more often at least about 40 amino acids in length, more often at least about 50 amino acids in length more often at least about 60 amino acids in length, more often at least about 70 amino acids in length, more often at least about 80 amino acids in length, more often at least about 90 amino acids in length, more often at least about 100 amino acids in length more often at least about 150 amino acids in length, more often at least about 200 amino acids in length, more often at least about 300 amino acids in length, or more

As shown below, Table 1 provides the complete source code for the ALIGN-2 sequence comparison computer program This source code may be routinely compiled for use on a UNIX operating system to provide the ALIGN-2 sequence comparison computer program

In addition, Tables 2A-2D show hypothetical exemplifications for using the below described method to determine % amino acid sequence identity (Tables 2A-2B) and % nucleic acid sequence identity (Tables 2C-2D) using the ALIGN-2 sequence comparison computer program, wherein "PRO" represents the amino acid sequence of a hypothetical PRO polypeptide of interest, "Comparison Protein" represents the amino acid sequence of a polypeptide against which the "PRO" polypeptide of interest is being compared, "PRO-DNA" represents a hypothetical PRO-encoding nucleic acid sequence of interest, "Comparison DNA" represents the nucleotide sequence of a nucleic acid molecule against which the "PRO-DNA" nucleic acid molecule of interest is being compared, "X", "Y", and "Z" each represent different hypothetical amino acid residues and "N", "L" and "V" each represent different hypothetical nucleotides

Table 1

* C-C increased from 12 to 15

* Z is average of EQ

* B is average of ND

* match with stop is _M; stop-stop = 0; J (joker) match = 0

*/

#define M /* value of a match with a stop */ int day [26] [26] = {

/* A B C D E F G H I J K L M N O P Q R S T U V W X Y Z*/

/* A*/ 2, 0,-2, 0, 0,-4, 1,-1,-1, 0,-1,-2,-1, 0,_M, 1, 0,-2, 1, 1, 0, 0,-6, 0,-3, 0},

/* B*/ 0, 3,-4, 3, 2,-5, 0, 1,-2, 0, 0,-3,-2, 2,_M,-1, 1, 0, 0, 0, 0,-2,-5, 0,-3, 1},

/* C*/ -2,-4,15,-5,-5,-4,-3,-3,-2, 0,-5,-6,-5,-4,_M,-3,-5,-4, 0,-2, 0,-2,-8, 0, 0,-5},

/* D*/ 0, 3,-5, 4, 3,-6, 1, 1,-2, 0, 0,-4,-3, 2,_M,-1, 2,-1, 0, 0, 0,-2,-7, 0,-4, 2},

/* E*/ 0, 2,-5, 3, 4,-5, 0, 1,-2, 0, 0,-3,-2, 1,_M,-1, 2,-1, 0, 0, 0,-2,-7, 0,-4, 3},

/* F*/ -4,-5,-4,-6,-5, 9,-5,-2, 1, 0,-5, 2, 0,-4,_M,-5,-5,-4,-3,-3, 0,-1, 0, 0, 7,-5},

/* G*/ 1, 0,-3, 1, 0,-5, 5,-2,-3, 0,-2,-4,-3, 0,_M,-l,-l,-3, 1, 0, 0,-1,-7, 0,-5, 0},

/* H*/ 1-1, 1,-3, 1, 1,-2,-2, 6,-2, 0, 0,-2,-2, 2,_M, 0, 3, 2,-1,-1, 0,-2,-3, 0, 0, 2},

/* I*/ -1,-2,-2,-2,-2, 1,-3,-2, 5, 0,-2, 2, 2,-2,_M,-2,-2,-2,-l, 0, 0, 4,-5, 0,-1,-2},

/* J*/ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,_M, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0},

/* K*/ -1, 0,-5, 0, 0,-5,-2, 0,-2, 0, 5,-3, 0, 1,_M,-1, 1, 3, 0, 0, 0,-2,-3, 0,-4, 0},

/* L*/ -2,-3,-6,-4,-3, 2,-4,-2, 2, 0,-3, 6, 4,-3,_M,-3,-2,-3,-3,-l, 0, 2,-2, 0,-1,-2},

/* M*/ -1,-2,-5,-3,-2, 0,-3,-2, 2, 0, 0, 4, 6,-2,_M,-2,-l, 0,-2,-1, 0, 2,-4, 0,-2,-1},

/* N*/ 0, 2,-4, 2, 1,-4, 0, 2,-2, 0, 1,-3,-2, 2,_M,-1, 1, 0, 1, 0, 0,-2,-4, 0,-2, 1},

/* O*/ M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M, 0,_M,_M,_M,_M,_M,_M,_M,_M,_M,JV[,_M},

/* P*/ 1, -1, -3, -1, ,-1, ,-5, ,-1. , 0, ,-2. , 0, ,-ι. ,-3. ,-2. ,-L , M. ,6. , 0, ,0, 1,0,0,-1,-6,0,-5,0},

/* Q*/ 0, 1, -5, 2, 2, -5, -1, 3, -2, 0, 1, -2, -1, 1, M, 0, 4, 1,-1,-1,0,-2,-5,0,-4,3},

/* R*/ ^■2, 0, -4, -1, -1, -4, ,-3. ,2, X , o, ,3, ,-3, , 0, 0, M, 0, 1, 6,0,-1,0,-2,2,0,-4,0},

/* S*/ 1, 0, 0, 0, 0, -3, 1, -1, -1, 0, o, -3, -2, 1, M, 1, -1, 0, 2, 1,0,-1,-2,0,-3,0},

/* T*/ 1, 0, -2, 0, 0, -3, 0, -1, o, 0, o, -1, -1, 0,^' M, 0, -1-^* -1, 1, 3,0,0,-5,0,-3,0},

/* u*/ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,^' M, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0},

/* v*/ 0, -2, -2, -2, ,-2, ,-1, ,-ι, ,-2. ,4, , 0_: ,-2. , 2. ,2, ,-2^~ M, rl, ,-2, ,-2,-1,0,0,4,-6,0,-2,-2},

/* w*/ ^■6, -5, -8, .-7, ,-7, ,0, rl.. ,-3, ,-5. , 0, ,-3. ,-2 ,-4. ,-4, , M ,-6 ,-5 ,2,-2,-5,0,-6,17,0, 0,-6},

/* x*ι 0, 0, 0, 0, 0, o, 0, 0, 0, 0, 0, 0, 0, 0, M, 0, 0, < 0, 0, 0, 0, 0, 0, 0, 0, 0},

/* Y */ ^■3, -3, 0, -4, ,-4, 7, -5, 0, -1, , 0, -4, ■-1, ,-2, ,-2^~ M, ,-5. ,-4, ,-4,-3,-3, 0.-2,0,0,10,-4},

/* z*/ 0, 1, -5, 2, 3, -5, 0, 2, -2, 0, 0, -2, -1, 1, M, 0, 3, 0, 0, 0, 0,-2,-6, 0,-4, 4}

};

Page 1 of day. h /* */

^include < stdιo.h> ^include < ctype.h >

#define MAXJMP 16 /* max jumps m a diag */

#define MAXGAP 24 /* don't continue to penalize gaps larger than this */

#define JMPS 1024 /* max jmps in an path */

#define MX 4 /* save if there's at least MX-1 bases since last jmp */

#defιne DMAT 3 /* value of matching bases */ ødefine DMIS 0 /* penalty for mismatched bases */

#define DINSO 8 /* penalty for a gap */

#define DINS1 1 /* penalty per base */

#define PINSO 8 /* penalty for a gap */

#define PINS1 4 /* penalty per residue */ struct jmp { short nfMAXJMP]; /* size of jmp (neg for dely) */ unsigned short x[MAXJMP]; /* base no. of jmp in seq x */

}; /* limits seq to 2"16 -1 */ struct diag { int /* score at last jmp */ long offset; /* offset of prev block */ short ljmp, /* current jmp index */ struct jmp JP. /* list of jmps */

}; struct path { int spc, /* number of leading spaces */ short n[JMPS]; /* size of jmp (gap) */ int x[JMPS]; /* loc of jmp (last ele before gap) */

}; char *ofιle, /* output file name */ char *namex[2]; /* seq names: getseqs() */ char *prog, /* prog name for err msgs */ char *seqx[2], /* seqs: getseqs() */ int dmax, /* best diag: nw() */ int dmaxO, /* final diag */ int dna, /* set if dna: mam() */ int endgaps, /* set if penalizing end gaps */ int gapx, gapy, /* total gaps in seqs */ int lenO. lenl , /* seq lens */ int ngapx, ngapy; /* total size of gaps */ int smax, /* max score: nw() */ int *xbm, /* bitmap for matching */ long offset, /* current offset in jmp file */ struct diag *dx, /^•*> holds diagonals *^■/ struct path PP[2], /* holds path for seqs -^***/ char '^■callocO, *malloc(), ^" ndexO, *strcpy(), char *getseq(). *g_calloc(),

Page 1 of nw.h /* Needleman-Wunsch alignment program

* usage, progs filel file2

* where filel and fιle2 are two dna or two protein sequences

* The sequences can be in upper- or lower-case an may contain ambiguity

* Any lines beginning with ' , ' , ' > ' or ' < ' are ignored

* Max file length is 65535 (limited by unsigned short x in the jmp struct)

* A sequence with 1/3 or more of its elements ACGTU is assumed to be DNA

* Output is in the file "align. out" *

* The program may create a tmp file in /tmp to hold info about traceback

* Original version developed under BSD 4.3 on a vax 8650 */

#include "nw.h" #include "day.h" static _dbval[26] = {

1,14,2,13,0,0,4,11,0,0,12.0,3,15,0,0,0,5,6,8,8,7,9,0,10,0

}; static _pbval[26] = {

1,2|(1<<('D'-'A'))|(1<<('N'-'A')), 4, 8, 16,32,64,

128, 256, OxFFFFFFF, 1< < 10, 1< < 11, 1< < 12, 1< < 13, 1< < 14,

1< < 15, 1< < 16, 1< < 17, 1< < 18, 1< < 19, 1< <20, 1< <21, 1< <22,

1<<23, 1<<24, 1<<25|(1<<('E'-'A'))|(K<('Q'-'A'))

}. mam(ac, av) mam int ac, char *av[],

{ prog = av[0], if (ac ' = 3) { fpπntf(stderr usage %s filel file2\n", prog), tpπntf(stderr where filel and file2 are two dna or two protein sequences. \n"), fpπntf(stderr The sequences can be in upper- or Iower-case\n"), fpπntf(stderr Any lines beginning with ',' or ' < ' are ιgnored\n"), fpπntt(stderr, "Output is in the file V'ahgn out\"\n"), exιt(l),

} namexfO] = av[l], namexfl] = av[2], seqx[0] = getseq(namex[0] , &len0), seqx[l] = getseq(namex[l], &lenl), xbm = (dna)? dbval _pbval, endgaps = 0, /* 1 to penalize endgaps */ ofile = "align out" I* output file */ nw(), /* fill in the matrix, get the possible jmps *l readjmps(), /* get the actual jmps */ pπnt(), /* print stats, alignment */ cleanup(O), /-^*>^• unlink any tmp files */

Page 1 of nw.c /* do the alignment, return best score: mam()

* dna: values m Fitch and Smith, PNAS, 80, 1382-1386, 1983

* pro: PAM 250 values

* When scores are equal, we prefer mismatches to any gap, prefer

* a new gap to extending an ongoing gap, and prefer a gap m seqx

* to a gap in seq y */ nw() nw

{ char *px, * py; /* seqs and ptrs */ int *ndely, *dely, /* keep track of dely */ int ndelx, delx; /* keep track of delx */ int *tmp; /^■*■ for swapping rowO, rowl */ int mis; /* score for each type */ int insO, insi ; /* insertion penalties */ register id; /* diagonal index */ register ij; /* jmp index */ register *col0, *coll ; /* score for curr, last row */ register xx, yy ; /* index into seqs */ dx = (struct diag *)g_calloc("to get diags", lenO+lenl + 1, sizeof(struct diag)), ndely = (int *)g_calloc("to get ndely", lenl + 1 , sizeof(int)), dely = (int *)g_calloc("to get dely", lenl + 1 , sizeof(int)); colO = (int *)g_calloc("to get colO" lenl + 1 , sizeof(iπt)); coll = (int *)g_calloc("to get coll " lenl + 1, sizeof(int)), insO = (dna)? DINSO : PINSO; insl = (dna)? DINS 1 : PINS1 , smax = -10000; if (endgaps) { for (col0[0] = dely[0J = -insO, yy = 1; yy < = lenl; yy+ +) { col0[yy] = dely[yy] = coI0[yy-l] - insl ; ndely [yy] = yy,

} col0[0] = 0, /* Waterman Bull Math Biol 84 */

} else for (yy = 1 ; yy < = lenl , yy+ +) delylyy] = -insO,

/* fill in match matrix */ for (px = seqx[0], xx = 1 ; xx < = lenO, px+ + , xx+ +) { /* initialize first entry in col */ if (endgaps) { if (xx = = 1) coll [0] = delx = -(ιns0 + ιnsl), else coll [0] = delx = col0[0] - insl , ndelx = xx,

} else { coll [0] = 0,

ndelx = 0, }

Page 2 of nw.c ...nw seqx[l], yy = 1 , yy < = lenl, py+ + , yy+ +) {

mis + = (xbm[*px Α']&xbm[*py-Α']y DMAT DMIS, else mis + = _day[*px-'A'][*py-'A'],

/* update penalty for del in x seq,

* favor new del over ongong del

* ignore MAXGAP if weighting endgaps */ if (endgaps 1 1 ndelyfyy] < MAXGAP) { if (col0[yy] - insO > = dely[yy]) { dely[yy] = col0[yy] - (msO+insl), ndely[yy] = 1 , } else { delyfyy] -= insl, ndelyfyy] + + ,

} } else { if (col0[yy] - (msO + insl) > = dely[yy]) { dely[yy] = colOfyy] - (msO+insl), ndely[yy] = 1 , } else ndely [yy] + + , }

/* update penalty for del in y seq,

* favor new del over ongong del */ if (endgaps 1 1 ndelx < MAXGAP) { if (coll[yy-l] - insO > = delx) { delx = coll [yy 1] - (msO+ insl), ndelx = 1 ,

ndelx+ + ,

} } else { if (coll[yy-l] - (msO + insl) > = delx) { delx = coll fyy 1] - (msO + insl), ndelx = 1 , } else ndelx+ +, }

/* pick the maximum score, we re favoring

* mis over any del and delx over dely

*/

Page 3 of nw c ...nw id = xx - y> + lenl - 1; if (mis > = delx && mis > = dely[yy]) coll[yy] = mis; else if (delx > = dely[yy]) { coll[yy] = delx, IJ = dx[ιd].ιjmp; if (dx[ιd].jp.n[0] && (!dna | | (ndelx > = MAXJMP && xx > dx[ιd].jp.x[ι_j]+MX) | | mis > dx[ιd]. score +DINS0)) { dx[ιd].ιjmp+ +, if(++ιj >= MAXJMP) { wπtejmps(ιd); ij = dx[ιd].ιjmp =^* 0, dx[ιd]. offset = offset, offset += sizeof(struct jmp) + sizeof(offset);

} } dx[ιd].jp.n[ιj] = ndelx; dx[ιd].jp.x[ιj] = xx, dx[ιd]. score = delx;

} else {

if (dx[ιd].jp.n[0] && (!dna | | (ndelyfyy] > = MAXJMP

&& xx > dx[ιd].jp.x[ιj] + MX) | | mis > dx[ιd]. score +DINS0)) { dx[ιd].ιjmp++, if(++ιj >= MAXJMP) { wπtejmps(ιd); ij = dx[ιd].ιjmp = 0; dx [id], offset = offset, offset += sizeof(struct jmp) + sizeof(offset); } } dx[ιd].jp.n[ιj] = -ndely [yy]; dx[ιd] jp.x[ιj] = xx, dx[ιd]. score = dely[yy],

} if (xx = = lenO && yy < lenl) { /* last col */ if (endgaps) coll[yy] -= ιnsO+ιnsl*(lenl-yy), if (coll [yy] > smax) { smax = coll[yy]; dmax = id, } } } if (endgaps && xx < lenO) coll[yy-l] -= ιnsO + ιnsl*(lenO-xx), if (coll [yy-1] > smax) { smax — coll [yy-1], dmax = id,

} tmp = colO; colO = coll; coll = tmp,

}

(void) free((char *)ndely), (void) rree((char -^dely); (void) free((char *)col0), (void) free((char *)coll).

Page 4 of nw.c * print() - only routine visible outside this module

*

* static

* getmat() — trace back best path, count matches pπnt()

* pr_ahgn() — print alignment of described in array p[] pπnt()

* dumpblockO — dump a block of lines with numbers, stars pr_ahgn()

* nums() — put out a number line. dumpblockO

* puthneO — put out a line (name, [num], seq, [num]). dumpblockO

* stars() - -put a line of stars. dumpblockO

* stπpnameO — strip any path and prefix from a seqname */

#include "nw.h'

^define SPC 3

#define P LINE 256 /* maximum output line */

#define P SPC 3 /* space between name or num and seq */ extern day [26] [26], int olen, /* set output line length */

FILE *fx, /* output file */ pπnto print

{ int lx, ly, firstgap, lastgap, /* overlap */ if ((fx = fopen(ofile, "w")) = = 0) { fpπntf(stderr, " ^*%s can't write %s\n", prog, ofile), cleanup(l),

} fpπntf(fx, ' < first sequence %s (length = %d)\n", namex[0], lenO), fpπntf(fx, " < second sequence %s (length = %d)\n' , namexfl], lenl), olen = 60, lx = lenO, h = lenl , firstgap = lastgap = 0, if (dmax < lenl - 1) { /* leading gap in x */ pp[0] spc = firstgap — lenl - dmax - 1 , ly -= pp[0] spc,

} else if (dmax > lenl - 1) { /* leading gap in y */ pp[l] spc = firstgap = dmax - (lenl - 1), lx -= pp[l] spc,

} if (dmaxO < lenO - 1) { /* trailing gap in x */ lastgap = lenO - dmaxO -1 , lx - = lastgap,

} else if (dmaxO > lenO - 1) { /* trailing gap in y */ lastgap = dmaxO (lenO - 1), ly -= lastgap,

} getmat(lx, ly, firstgap, lastgap), pr_ahgn(),

Page 1 of nwprint.c * trace back the best path, count matches

*/ static getmat(lx, ly, firstgap, last gap) getmat int lx, ly, /* core" (minus endgaps) */ int firstgap, lastgap, //** leading trailing overlap */

{ int nm , ι0, ii , sizO, sizl , char outx[32], double pet, register nO, nl , register char *pO, *pl,

/* get total matches, score */

pO = seqx[0] + pp[l] spc, pi = seqx[l] + pp[0] spc, nO = pp[l] spc + 1, nl = pp[0] spc + 1 , nm = 0, while ( *p0 && *pl ) {

if (xbm[*p0 'A']&xbm[*pl-'A']) nm+ + ,

}

/* pet homology

* if penalizing endgaps, base is the shorter seq

* else, knock off overhangs and take shorter core */ if (endgaps) lx = (lenO < lenl)^*? lenO lenl , else lx = (lx < ly)^1? lx ly, pet = 100 *(double)nm/(double)lx, fpπntf(fx, ' \n' ), fpπntf(fx, < %d match%s in an overlap of %d % 2f percent sιmιlaπty\n nm, (nm = = l) " ' es , lx, pet),

Page 2 of nwpπnt.c fpπntf(fx, " < gaps in first sequence %d", gapx), .getmat if (gapx) {

(void) spπntf(outx, " (%d %s%s)", ngapx, (dna)? "base". "residue", (ngapx 1) ? " " : "s"), fpπntf(fx, " %s", outx); fpπntf(fx, ", gaps in second sequence: d", gapy); if (gapy) {

(void) spπntf(outx, " (%d %s%s)", ngapy, (dna)? "base" : "resιdue", (ngapy = = l)⁹ " ": "s"), fρπntf(fx, " %s", outx);

} if (dna) fpπntf(fx,

"\n < score: %d (match = %ά, mismatch = %d, gap penalty = %d + %d per base)\n" smax, DMAT, DMIS, DINSO, DINS1); else

^*fpπntf(fx,

"\n < score: %d (Dayhoff PAM 250 matrix, gap penalty = %d + %d per resιdue)\n", smax, PINSO, PINS1); if (endgaps) fpπntf(fx,

" < endgaps penalized, left endgap: %d %s%s, right endgap %d %s%s\n", firstgap, (dna)⁹ "base" : "residue", (firstgap = = 1)? " " : "s", lastgap, (dna)? "base" : "residue", (lastgap = = l)⁹ " " : "s"), else fpπntf(fx, " < endgaps not penahzed\n");

static nm, /* matches in core — for checking */ static lmax; /* lengths of stripped file names */ static ιj[2], /* jmp index for a path */ static nc[2]; /* number at start of current line */ static m[2] , /* current elem number — for gapping */ static sιz[2]; static char *ps[2]; /* ptr to current element */ static char *po[2]; /* ptr to next output char slot */ static char out[2][P LINE] /* output line */ static char star[P LINE], /* set by stars() */

* print alignment of described in struct path pp[] */ static pr i dιgn() pr align { int nn, /* char count */ int more; register I; for (I = 0, lmax = 0, I < 2; ι + +) { nn = stπpname(namex[ι]), if (nn > lmax) lmax = nn,

sιz[ι] = lj[l] = 0, ps[ι] = seqx[ι], po[ι] = out[ι],

Page 3 of nwprint.c for (nn = nm = 0, more = 1 , more, ) { ...pr align for (l = more = 0, 1 < 2, ι + +) {

* do we have more of this sequence⁹ */ if C*ps[ι]) υii iiut:, more+ + , if (pp[ι] spc) { /* leading space */

*po[ι] + + = ' ', pp[ι] spc-,

} else if (sιz[ι]) { /* in a gap */

*po[ι] + + = ' ', sιz[ι]-,

} else { /* we're putting a seq element */ *po[ι] = *ps[ι], if (ιslower(*ps[ι]))

*ps[ι] = toupper(*ps[ι]), po[ι] + + , ps[ι] + + ,

* are we at next gap for this seq⁹

*/ if (m[ι] = = pp[ι] x[ιj[ι]]) {

/=*.

* we need to merge all gaps

* at this location */ sιz[ι] = pp[ι] n[ιj[ι] + +], while (nι[ι] = = ppfi] x[ιj[ι]]) sιz[ι] + = pp[ι] n[ιj[ι] + +],

} m[ι] + + ,

} if ( + +nn = = olen | | 'more && nn) { dumpblockO, for (ι = 0, l < 2, ι + +) po[ι] = out[ι], nn = 0, }

/*

* dump a block of lines, including numbers, stars pr_ahgn()

*/ static dumpblockO dumpblock

{ register i, for (l = 0, l < 2, ι + +) *po[ι] - = \0

Page 4 of nwpπnt.c .dumpblock

(void) putc('\n', fx); for(ι = 0; l < 2; ι + +) { if (*out[ι] && (*out[ι] ' = ' ' || *(po[ι]) ')){ if(ι ==0) nums(ι), if (l == 0&& *out[l]) stars(); puthne(ι); if (I = = 0 && *out[l]) fpπntf(fx, star), if(ι == 1) nums(ι);

}

* put out a number line: dumpblockO

*/ static nums(ιx) nunis int lx, /* index in out[] holding seq 1 ine */

{ char nlιne[P_LINE]; register i, J. register char *ρn, *px, *py; for (pn = nhne, l ^: = 0; l < lmax+P SPC: ; ι + + , pn++)

*pn = ' '; for (I = nc[ιx], py = out[ιx]; *py; py++, pn++){ if (*py = = ' ' II *py == ^'-^')

*pn = ' '; else { if (i % 10 == 0 || (ι == 1 &&nc[ D){ j = (l < 0)? -l : l, for (px = pn; j; j /= 10, px-) *px = j%10 + '0', if (l < 0)

*px = '-'.

} else

*pn ι + + ;

}

*pn = '\0'; nc[ιx] = l, for (pn = nhne; *pn; pn+ +)

(void) putc(*pn, fx); (void) putc('\n', fx),

}

/* * put out a line (name, [num], seq, [num]). dumpblockO

*/ static puthne(ιx) putline int iλ, {

Page 5 of nwprint.c .put line int l, register char px, for (px = namex[ιx], 1 = 0, *px && -*^*px '= '.'; px++,ι + +)

(void) putc(*px, fx), for (; l < lmax+P SPC, ι + +)

(void) putc(' ', fx),

/* these count from 1

* nι[] is current element (from 1)

* nc[] is number at start of current line */ for (px = ou x], *px; px++) (void) putc(*px&0x7F, fx), (void) putc('\n', fx),

/*

* put a line of stars (seqs always in out[0], out[l])- dumpblockO

*/ static stars

{ int I; register char *p0, *pl, ex, *px, if (!*out[0] I I (*out[0] == ' '&& *(po[0]) == ' ') 11 >*out[l] I I (*out[l] == ' '&& *(po[l]) == ' ')) return, px = star, for (I = Imax + P SPC, I, ι~)

*px+ + for(p0 = out[0], pi = out[l], *p0 && *pl, p0+ +, pi + +) { if (ιsalpha(*p0) && ιsalpha(*pl)) { if (xbm[*pO-'A']&xbm[*pl-'A']) { ex nm + + , else if (!dna && _day[*pO-'A'][*pl-'A'] > 0) ex = ' ', else

} else ex = *px++ = ex,

}

*px++ = '\n', *px = O',

Page 6 of nwprint.c /*

* strip path or prefix from pn, return len: pr_ahgn()

*/ static stπpname(pn) stripname char *pn; /* file name (may be path) */

{

py = 0; for (px = pn; *px; px+ +) if (*px = = V) py = px + 1 ; if (py)

(void) strcpy(pn, py); return(strlen(pn));

Page 7 of nwprint.c /*

* cleanupO — cleanup any tmp file

* getseq() — read in seq, set dna len, maxlen

* g_calloc() - calloc() with error checkin

* readjmpsO — get the good jmps, from tmp file if necessary

* writejmpsO — write a filled array of jmps to a tmp file. nw() */

^include ' nw h" #include < sys/file h > char *jname = "/tmp/homgXXXXXX", /* tmp file for jmps */

FILE *fj, int cleanupO, /* cleanup tmp file */ long lseek(),

/*

* remove any tmp file if we blow

*/ cieanup(ι) cleanup int l, { if (fj)

(void) unhnk(jname), exιt(ι), }

/*

* read, return ptr to seq, set dna, len, maxlen

* skip lines starting with ' , ' , ' < ' , or ' > '

* seq in upper or lower case */ char * getseq(file, len) g^βtSβq char *fιle, /* file name */ int *len, /* seq len */

{ char hne[1024], *pseq, register char *px, *py, int natgc, tlen,

FILE *fp if ((fp = fopen(file, ' r")) = = 0) { fprmtf(stderr, " %s can t read s\n' , prog, file), exιt(l),

} tlen = natgc = 0, while (fgets(hne, 1024, fp)) { if (*hne = = ' , ' | | ine = = ' < | | *lme = = > ) continue, for (px = line, *px ' = \n' , px + +) if (ιsupper(*pxj | | ιslower(*px)) tlen+ + ,

} if ((pseq = malloc((unsigned)(tlen + 6))) = = 0) { fpπntf(stderr, " %s malloc() failed to get %d bytes tor %s\n , piog, tlen + 6, file), exιt(l),

} pseq[0] = pseq[l] = pseq[2] = pseq[31 = '\0',

Page 1 of nwsubr.c ...getseq py = pseq + 4; *len = tlen; rewιnd(fp); while (tgets(hne, 1024, fp)) { if (*hne == ';' 11 *lme == '<' | | *hne == '>') continue; for (px = line; *px != '\n'; px++) { if (ιsupper(*px))

*py++ = *px; else if (ιslower(*px))

*py++ = touρper(*px); if (ιndex("ATGCU",*(py-l))) natgc + + ; } }

*py++ = '\0'; *py = '\0'; (void) fclose(fp); dna = natgc > (tlen/3); return(pseq+4);

} char * g_calloc(msg, nx, sz) g_callθC char *msg; /* program, calling routine */ int nx, sz; /* number and size of elements */

{ char *px, *calloc(); if ((px = calloc((unsigned)nx, (unsigned)sz)) = = 0) { if (*msg) { fpπntf(stderr. "%s: g_calloc() failed %s (n=%d, sz= d)\n", prog, msg, nx, sz); exιt(l); } } return(px);

}

/* * get final jmps from dx[] or tmp file, set pρ[], reset dmax: maιn()

*/ readjmpsO readjmps

{ int fd = -1;

register I, j, xx; if (Ij) {

(void) fclose(fj); if ((fd = openOname, O RDONLY, 0)) < 0) { fpπntf(stderr, "%s: can't open() %s\n", prog, jname); cleanup(l); } } for (I = iO = ii = 0, dmaxO = dmax, xx = lenO; ; ι++) { while (1) { for (j = dx[dmax].ιjmp; j > = 0 && dx[dmax].jp.x[]] > = xx; j— )

Page 2 of nwsubr.c ...readjmps if 0 < 0 && dx [dmax]. offset && fj) {

(void) lseek(fd, dxfdmax]. offset, 0),

(void) read(fd, (char *)&dx[dmax].jp, sizeof(struct jmp)),

(void) read(fd, (char *)&dx[dmax]. offset, sizeof (dxfdmax]. offset)); dx[dmax].ιjmp = MAXJMP- 1;

} else break;

} if (I > JMPS) { fpπntf(stderr, "%s: too many gaps in ahgnment\n", prog); cleanup(l),

} if 0 >=0){ siz = dxfdmax] .jp.nfj]; xx = dxfdmax] .jp.xf)];

if (siz < 0) { /* gap in second seq */

/* id = xx - yy + lenl - 1

*/ pp[l].x[ιl] = xx - dmax + lenl - 1, gapy+ + , ngapy - = siz; /* ignore MAXGAP when doing endgaps */ siz = (-siz < MAXGAP | | endgaps)? -siz : MAXGAP, ιl + +;

} else if (siz > 0) { /* gap in first seq */

gapx + + , ngapx + = siz, /* ignore MAXGAP when doing endgaps */ siz = (siz < MAXGAP | | endgaps)? siz : MAXGAP, ι0+ + , } } else break, }

/* reverse the order of jmps */ for 0 =0, ι0~; j < iO, j + + , ι0~) { i = pp[0].n[]]; pp[0].n[j] = pp[0].n[ι0], pp[0].n[ι0] = i, i = PP[θ].^χDJ; pp[0].^χ[)l = PP[0] ^χ[ιθ], _PP[0] ^χ[ιθ] = ■,

} for 0 = 0, ιl-;j < ιl,j + + , ιl--) { i = ppm n[|], pp[l].nD] = pp[l] n[ιl|; pp[l] n[ιl] = i, i = PP[i].^χQl; PP[i] [|] = pp[i].^χ[ιi], PPIU ^χ[ιi] = i,

} if (fd > = 0)

(void) close(fd), if(fj){

(void) unhnk(jname); fj = 0;offset = o,}} Page 3 of nwsubr.c /*

* write a filled jmp struct offset of the prev one (if any). nw() */ wπtejmps(ιχ) writejmps int IX,

{ char *mktemp(), if (!fj) { if (mktemp(jname) < 0) { fpπntf(stderr, " %s can't mktempO %s\n", prog, jname), cleanup(l ),

} if ((fj = fopen(jname, "w")) = = 0) { fpπntf(stderr, " %s can't write %s\n", prog, jname), exιt(l), } }

(void) fwπte((char *)&dx[ιx].jp, sizeof(struct jmp), 1 , fj), (void) fwπte((char *)&dx[ιx] offset, sizeof(dx[ιx] offset), 1 , fj),

Page 4 ofnwsubr.c Table 2A

PRO XXXXXXXXXXXXXXX (Length = 15 ammo acids)

Comparison Protein XXXXXYYYYYYY (Length = 12 ammo acids)

% ammo acid sequence identity =

(the number of identically matching ammo acid residues between the two polypeptide sequences as determined by ALIGN-2) divided by (the total number of ammo acid residues of the PRO polypeptide) =

5 divided by 15 = 33.3%

Table 2B

PRO XXXXXXXXXX (Length = 10 ammo acids)

Comparison Protein XXXXXYYYYYYZZYZ (Length = 15 ammo acids)

% amino acid sequence identity =

(the number of identically matching ammo acid residues between the two polypeptide sequences as determined by ALIGN-2) divided by (the total number of amino acid residues of the PRO polypeptide) =

5 divided by 10 = 50%

Table 2C

PRO-DNA NNNNNNNNNNNNNN (Length = 14 nucleotides)

Comparison DNA NNNNNNLLLLLLLLLL (Length = 16 nucleotides)

% nucleic acid sequence identity =

(the number of identically matching nucleotides between the two nucleic acid sequences as determined by ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic acid sequence) =

6 divided by 14 = 42.9%

Table 2D

PRO-DNA NNNNNNNNNNNN (Length = 12 nucleotides) Comparison DNA NNNNLLLVV (Length = 9 nucleotides)

% nucleic acid sequence identity =

4 divided by 12 = 33.3 %

"Percent (%) amino acid sequence identity" with respect to the PRO polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in a PRO sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megahgn (DNASTAR) software Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared For purposes herein, however, % amino acid sequence identity values are obtained as described below by using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1 The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc , and the source code shown in Table 1 has been filed with user documentation in the U S Copyright Office, Washington D C , 20559, where it is registered under U S Copyright Registration No TXU510087 The ALIGN-2 program is publicly available through Genentech, Inc , South San Francisco, California or may be compiled from the source code provided in Table 1 The ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4 0D All sequence comparison parameters are set by the ALIGN-2 program and do not vary

For purposes herein, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given ammo acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows

100 times the fraction X/Y

where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A As examples of % amino acid sequence identity calculations, Tables 2A-2B demonstrate how to calculate the % amino acid sequence identity of the amino acid sequence designated "Comparison Protein to the amino acid sequence designated "PRO' Unless specifically stated otherwise, all % amino acid sequence identity values used herein are obtained as described above using the ALIGN-2 sequence comparison computer program However, % amino acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul etal , Nucleic Acids Res . 25 3389-3402 ( 1997)) The NCBI-BLAST2 sequence comparison program may be downloaded from http //www ncbi nlm nih gov NCBI-BLAST2 uses several search parameters, wherein all of those search parameters are set to default values including, for example, unmask ^*= yes, strand = all, expected occurrences = 10 minimum low complexity length = 15/5, multi-pass e-value = 0 01 , constant for multi-pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62

In situations where NCBI-BLAST2 is employed for amino acid sequence comparisons, the % amino acid sequence identity of a given am o acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows

100 times the fraction X/Y

where X is the number of amino acid residues scored as identical matches by the sequence alignment program NCBI-BLAST2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A

In addition, % amino acid sequence identity may also be determined using the WU-BLAST-2 computer program (Altschul et al , Methods in Enzvmology, 266 460-480 (1996)) Most of the WU-BLAST-2 search parameters are set to the default values Those not set to default values ( e , the adjustable parameters, are set with the following values overlap span = 1, overlap fraction = 0 125, word threshold (T) = 1 1, and scoring matrix = BLOSUM62 For purposes herein, a % amino acid sequence identity value is determined by dividing (a) the number of matching identical amino acids residues between the amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide and the comparison amino acid sequence of interest (/ e , the sequence against which the PRO polypeptide of interest is being compared which may be a PRO variant polypeptide) as determined by WU-BLAST-2 by (b) the total number of amino acid iesidues of the PRO polypeptide of interest For example, in the statement "a polypeptide comprising an amino acid sequence A which has or having at least 80% amino acid sequence identity to the amino acid sequence B the amino acid sequence A is the comparison amino acid sequence of interest and the amino acid sequence B is the amino acid sequence of the PRO polypeptide of interest

"PRO variant polynucleotide ' or "PRO variant nucleic acid sequence means a nucleic acid molecule which encodes an active PRO polypeptide as defined below and which has at least about 80% nucleic acid sequence identity with a nucleic acid sequence encoding a full-length native sequence PRO polypeptide sequence as disclosed herein, a full-length native sequence PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide with or without the signal peptide, as disclosed heiein or any othei fragment of a full-length PRO polypeptide sequence as disclosed herein Ordinarily, a PRO variant polynucleotide will have at least about 80% nucleic acid sequence identity, more preferably at least about 81 % nucleic acid sequence identity, more prelerably at least about 82% nucleic acid sequence identity, more preferably at least about 83% nucleic acid sequence identity more preferably at least about 84% nucleic acid sequence identity, more preferably at least about 85% nucleic acid sequence identity, more preferably at least about 86% nucleic acid sequence identity, more preferably at least about 87% nucleic acid sequence identity, more preferably at least about 88% nucleic acid sequence identity, more preferably at least about 89% nucleic acid sequence identity, more preferably at least about 90% nucleic acid sequence identity, more preferably at least about 91 % nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, more preferably at least about 93% nucleic acid sequence identity, more preferably at least about 94% nucleic acid sequence identity, more preferably at least about 95% nucleic acid sequence identity, more preferably at least about 96% nucleic acid sequence identity, more preferably at least about 97% nucleic acid sequence identity, more preferably at least about 98% nucleic acid sequence identity and yet more preferably at least about 99% nucleic acid sequence identity with a nucleic acid sequence encoding a full-length native sequence PRO polypeptide sequence as disclosed herein, a full-length native sequence PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal sequence, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein Variants do not encompass the native nucleotide sequence

Ordinarily, PRO variant polynucleotides are at least about 30 nucleotides in length, often at least about 60 nucleotides in length, more often at least about 90 nucleotides in length, more often at least about 120 nucleotides in length, more often at least about 150 nucleotides in length, more often at least about 180 nucleotides in length, more often at least about 210 nucleotides in length, more often at least about 240 nucleotides in length, more often at least about 270 nucleotides in length, more often at least about 300 nucleotides in length, more often at least about 450 nucleotides in length, more often at least about 600 nucleotides in length, more often at least about 900 nucleotides in length, or more

"Percent (%) nucleic acid sequence identity" with respect to the PRO polypeptide-encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in a PRO polypeptide-encoding nucleic acid sequence, aftei aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity Alignment for purposes of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2. ALIGN, ALIGN-2 or Megahgn (DNASTAR) software Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared For purposes herein, however, % nucleic acid sequence identity values are obtained as described below by using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1 The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc , and the source code shown in Table 1 has been filed with user documentation in the U S Copyright Office, Washington D C , 20559, where it is registered under U S Copyright Registration No TXU510087 The ALIGN-2 program is publicly available through Genentech, Inc , South San Francisco California or may be compiled from the source code provided in Table 1 The ALIGN-2 program should be compiled lor use on a UNIX operating system, preferably digital UNIX V4 0D All sequence comparison parameters are set by the ALIGN-2 program and do not vary For purposes herein, the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) is calculated as follows

100 times the fraction W/Z

where W is the number of nucleotides scored as identical matches by the sequence alignment program ALIGN-2 in that program' s alignment of C and D, and where Z is the total number of nucleotides in D It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C As examples of % nucleic acid sequence identity calculations, Tables 2C-2D demonstrate how to calculate the % nucleic acid sequence identity of the nucleic acid sequence designated "Comparison DNA" to the nucleic acid sequence designated "PRO- DNA"

Unless specifically stated otherwise, all % nucleic acid sequence identity values used herein are obtained as described above using the ALIGN-2 sequence comparison computer program However, % nucleic acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al , Nucleic Acids Res . 25 3389-3402 (1997)) The NCBI-BLAST2 sequence comparison program may be downloaded from http //www ncbi nlm nih gov NCBI-BLAST2 uses several search parameters, wherein all of those search parameters are set to default values including, for example, unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0 01 , constant for multi-pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62

In situations where NCBI-BLAST2 is employed for sequence comparisons, the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has oi comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) is calculated as follows

100 times the fraction W/Z

where W is the number of nucleotides scored as identical matches by the sequence alignment program NCBI- BLAST2 in that program's alignment of C and D, and where Z is the total number of nucleotides in D It will be appreciated that where the length of nucleic acid sequence C is not equal to the length ot nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C In addition, % nucleic acid sequence identity values may also be generated using the WU-BLAST-2 computer program (Altschul et al , Methods in Enzymology, 266 460-480 ( 1996)) Most ot the WU-BLAST-2 search parameters are set to the default values Those not set to default values, t e , the adjustable parameters are set with the following values overlap span - 1 , overlap fraction = 0 125. word threshold (T) = 1 1 , and sconng matrix ^*= BLOSUM62 For purposes herein, a % nucleic acid sequence identity value is determined by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest having a sequence derived from the native sequence PRO polypeptide-encoding nucleic acid and the comparison nucleic acid molecule of interest (t e , the sequence against which the PRO polypeptide-encoding nucleic acid molecule of interest is being compared which may be a variant PRO polynucleotide) as determined by WU-BLAST 2 by (b) the total number of nucleotides of the PRO polypeptide encoding nucleic acid molecule of interest For example, in the statement ' an isolated nucleic acid molecule comprising a nucleic acid sequence A which has or having at least 80% nucleic acid sequence identity to the nucleic acid sequence B", the nucleic acid sequence A is the comparison nucleic acid molecule of interest and the nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest

In other embodiments, PRO variant polynucleotides are nucleic acid molecules that encode an active PRO polypeptide and which are capable of hybridizing, preferably under stringent hybridization and wash conditions, to nucleotide sequences encoding the full-length PRO polypeptide shown in Figure 2 (SEQ ID NO 2), Figure 4

(SEQ ID NO 9), Figure 6 (SEQ ID NO 1 1 ), Figure 8 (SEQ ID NO 16) , Figure 10 (SEQ ID NO 21), Figure 12 (SEQ ID NO 26), Figure 14 (SEQ ID NO 31 ), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO 41 ), Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51), Figure 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67), Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 77), Figure 34 (SEQ ID NO 82), Figure 36 (SEQ ID NO 91), Figure 38 (SEQ ID NO 96), Figure 40 (SEQ ID NO 101), Figure 42 (SEQ ID NO 108), Figure 44 (SEQ ID NO 113), Figure 46 (SEQ ID NO 119), Figure 48 (SEQ ID NO 127), Figure 50 (SEQ ID NO 132), Figure 52 (SEQ ID NO 137), Figure 54 (SEQ ID NO 142), Figure 56 (SEQ ID NO 152), Figure 58 (SEQ ID NO 154), Figure 60 (SEQ ID NO 156), Figure 62 (SEQ ID NO 158), Figure 64 (SEQ ID NO 160), Figure 66 (SEQ ID NO 165), and Figure 68 (SEQ ID NO 167), respectively PRO variant polypeptides may be those that are encoded by a PRO variant polynucleotide

The term ' positives", in the context of the amino acid sequence identity comparisons performed as described above, includes amino acid residues in the sequences compared that are not only identical but also those that have similar properties Amino acid residues that score a positive value to an ammo acid residue of interest are those that are either identical to the amino acid residue of interest or are a preferred substitution (as defined in Table 3 below) of the amino acid residue of interest

For purposes herein, the % value ot positives of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % positives to, with or against a given amino acid sequence B) is calculated as follows

100 times the ti action X/Y

where X is the number of amino acid residues scoring a positn e value by the sequence alignment piogram ALIGN 2 in that program s alignment ot A and B, and wheie Y is the total number of ammo acid residues in B It will be appreciated that where the length ot amino acid sequence A is not equal to the length ot amino acid sequence B, the % positives of A to B will not equal the % positives of B to A

"Isolated", when used to describe the various polypeptides disclosed herein, means a polypeptide that has been identified and separated and/or recovered from a component of its natural environment Preferably, the isolated polypeptide is free of association with all components with which it is naturally associated Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other protemaceous or non-proteinaceous solutes In preferred embodiments, the polypeptide will be purified (1 ) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the PRO natural environment will not be present Ordinarily, however, isolated polypeptide will be prepared by at least one purification step

An "isolated" nucleic acid molecule encoding a PRO polypeptide or an "isolated" nucleic acid molecule encoding an anti-PRO antibody is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the PRO-encoding nucleic acid or the natural source of the anti-PRO-encoding nucleic acid Preferably, the isolated nucleic acid is free of association with all components with which it is naturally associated An isolated PRO-encoding nucleic acid molecule or an isolated anti-PRO-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature Isolated nucleic acid molecules therefore are distinguished from the PRO-encoding nucleic acid molecule or from the anti-PRO-encoding nucleic acid molecule as it exists in natural cells However, an isolated nucleic acid molecule encoding a PRO polypeptide or an isolated nucleic acid molecule encoding an anti- PRO antibody includes PRO-nucleic acid molecules or anti-PRO-nucleic acid molecules contained in cells that ordinarily express PRO polypeptides or anti PRO antibodies where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells The term ' control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a πbosome binding site Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers

Nucleic acid is ' operably linked" when it is placed into a functional relationship with another nucleic acid sequence For example, DNA for a presequence or secretory leader is operably linked to DNA for a PRO polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide, a promoter oi enhancer is operably linked to a coding sequence if it affects the transcription ot the sequence or a πbosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leadei , contiguous and in leading phase However, enhancers do not have to be contiguous Linking is accomplished b) hgation at convenient restriction sites If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice "Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature The higher the degree of desired homology between the probe and hybπdizable sequence, the higher the relative temperature that can be used As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so For additional details and explanation of stringency of hybridization reactions, see, Ausubel et al , Current Protocols in Molecular Biology (Wiley Interscience Publishers, 1995) "Stringent conditions" or "high-stringency conditions", as defined herein, may be identified by those that (1 ) employ low ionic strength and high temperature for washing, for example, 0 015 M sodium chloπde/0 0015 M sodium cιtrate/0 1% sodium dodecyl sulfate at 50°C, (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0 1 % bovine serum albumιn/0 1 % Fιcoll/0 1 % polyvιnylpyrrohdone/50mM sodium phosphate buffer at pH 6 5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C, or (3) employ 50% formamide, 5 x SSC (0 75 M NaCl, 0 075 M sodium citrate), 50 mM sodium phosphate (pH 6 8), 0 1 % sodium pyrophosphate, 5 x Denhardt s solution, sonicated salmon sperm DNA (50 μg/ml), 0 1 % SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0 2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55 °C, followed by a high-stringency wash consisting of 0 1 x SSC containing EDTA at 55°C "Moderately-stringent conditions" may be identified as described by Sambrook et al , Molecular Cloning A

Laboratory Manual (New York Cold Spring Harbor Press, 1989), and include the use of washing solution and hybridization conditions (e g , temperature, ionic strength, and % SDS) less stringent than those described above An example ot moderately stringent conditions is overnight incubation at 37 °C in a solution compπsing 20% formamide, 5 x SSC (150 mM NaCl, 15 mM tπsodium citrate), 50 mM sodium phosphate (pH 7 6), 5 x Denhardt' solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C The skilled artisan will recognize how to adjust the temperature, ionic strength, etc as necessary to accommodate factors such as probe length and the like

The modifier "epitope-tagged" when used herein refers to a chimeric polypeptide compπsing a PRO polypeptide fused to a "tag polypeptide" The tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not inteitere with activity of the polypeptide to which it is fused The tag polypeptide preferably also is fairly unique so that the antibody does not substantially cross-react with other epitopes Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 ammo acid residues (preferably, between about 10 and 20 amino acid residues)

"Active' or "activity" in the context of PRO variants refers to torm(s) of PRO proteins that retain the biologic and/or lmmunologic activities ot a native or naturally-occurring PRO polypeptide

"Biological activity^" in the context of a molecule that antagonizes a PRO polypeptide that can be identified by the screening assays disclosed herein (e g , an organic or inorganic small molecule, peptide, etc ) is used to refei to the ability of such molecules to bind or complex with the PRO polypeptide identified herein, or otherwise interfere with the interaction of the PRO polypeptides with other cellular proteins or otherwise inhibits the transcription or translation of the PRO polypeptide Particularly preferred biological activity includes cardiac hypertrophy, activity that acts on systemic disorders that affect vessels, such as diabetes melhtus, as well as diseases of the arteries, capillaries, veins, and/or lymphatics, and cancer

The term "antagonist" is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes one or more of the biological activities of a native PRO polypeptide disclosed herein, for example, if applicable, its mitogenic or angiogenic activity Antagonists of a PRO polypeptide may act by interfering with the binding of a PRO polypeptide to a cellular receptor, by incapacitating or killing cells that have been activated by a PRO polypeptide, or by interfering with vascular endothehal cell activation after binding of a PRO polypeptide to a cellular receptor All such points of intervention by a PRO polypeptide antagonist shall be considered equivalent for purposes of this invention The antagonists inhibit the mitogenic, angiogenic, or other biological activity of PRO polypeptides, and thus are useful for the treatment of diseases or disorders characterized by undesirable excessive neovasculaπzation, including by way of example tumors, and especially solid malignant tumors, rheumatoid arthritis, psoriasis, atherosclerosis, diabetic and other retinopathies, retrolental fibroplasia, age- related macular degeneration, neovascular glaucoma, hemangiomas, thyroid hyperplasias (including Grave's disease), corneal and other tissue transplantation, and chronic inflammation The antagonists also are useful foi the treatment of diseases or disorders characterized by undesirable excessive vascular permeability, such as edema associated with brain tumors, ascites associated with malignancies, Meigs' syndrome, lung inflammation, nephrotic syndrome, pencardial effusion (such as that associated with pericarditis), and pleural effusion In a similar manner, the term "agonist" is used in the broadest sense and includes any molecule that mimics a biological activity of a native PRO polypeptide disclosed herein Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibody fragments, fragments, or amino acid sequence variants of native PRO polypeptides, peptides, small organic molecules, etc A "small molecule" is defined herein to have a moleculai weight below about 500 daltons

The term "PRO polypeptide receptor" as used herein refers to a cellular receptor for a PRO polypeptide ordinarily a cell-surface receptor found on vascular endothehal cells, as well as variants thereof that retain the ability to bind a PRO polypeptide

"Antibodies" (Abs) and "immunoglobulins" (Igs) are glycoproteins having the same structural characteristics While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules that lack antigen specificity Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas The term "antibody" is used in the broadest sense and specifically covers, without limitation, intact monoclonal antibodies, polyclonal antibodies multispecific antibodies (e g , bispecific antibodies) formed from at least two intact antibodies, and antibody fragments, so long as they exhibit the desired biological activity

"Native antibodies" and "native immunoglobulins" are usually heterotetrameπc glycoproteins of about 150.000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes Each heavy and light chain also has regularly spaced intrachain disulfide bridges Each heavy chain has at one end a variable domain (V_H) followed by a number of constant domains Each light chain has a variable domain at one end (V_L) and a constant domain at its other end, the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light-chain variable domain is aligned with the variable domain of the heavy chain Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains

The term "variable" refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody to and for its particular antigen However, the variability is not evenly distributed throughout the variable domains of antibodies It is concentrated in three segments called complementarity-determining regions (CDRs) or hypervaπable regions both in the light-chain and the heavy-chain variable domains The more highly conserved portions of variable domains are called the framework regions (FR) The variable domains of native heavy and light chains each comprise four FR regions, largely adopting a β-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the β-sheet structure The CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies See, Kabat et al , NIH Publ No 91 -3242. Vol I. pages 647-669 ( 1991 ) The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity "Antibody fragments" comprise a portion of an intact antibody, preferably the antigen-binding or variable region of the intact antibody Examples of antibody fragments include Fab, Fab', F(ab')₂, and Fv fragments, diabodies, linear antibodies (Zapata etal , Protein En , 8(10) 1057- 1062 (1995)), single-chain antibody molecules, and multispecific antibodies formed from antibody fragments

Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab" fragments, each with a single antigen-binding site, and a residual "Fc" fragment, whose name reflects its ability to crystallize readily Pepsin treatment yields an F(ab'), fragment that has two antigen-combining sites and is still capable of cross-linking antigen

"Fv" is the minimum antibody fragment that contains a complete antigen-recognition and -binding site This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the V„-V_L dimer Collectively, the six CDRs confer antigen-binding specificity to the antibody However, even a single variable domain (or half ot an Fv compπsing only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site

The Fab fragment also contains the constant domain ot the light chain and the first constant domain (CH 1 ) of the heavy chain Fab' fragments differ from Fab fragments by the addition ot a few residues at the carboxy terminus of the heavy chain CH 1 domain including one or more cysteines from the antibody hinge region Fab'-SH is the designation herein for Fab' in which the cysteine resιdue(s) ot the constant domains bear a free thiol group F(ab'), antibody fragments originally were produced as pairs of Fab' fragments that have hinge cysteines between them Other chemical couplings of antibody fragments are also known

The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda (λ), based on the amino acid sequences of their constant domains Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes There are five major classes of immunoglobulins IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e g , IgGl , IgG2, IgG3, IgG4, IgA, and IgA2 The heavy-chain constant domains that correspond to the different classes of immunoglobulins are called a, δ, e, γ, and μ, respectively The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known

The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, ( e , the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts Monoclonal antibodies are highly specific, being directed against a single antigenic site Furthermore, in contrast to conventional (polyclonal) antibody preparations that typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybridoma culture, uncontaminated by other immunoglobulins The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler et al , Nature, 256 495 ( 1975), or may be made by recombinant DNA methods (see, e g , U S PatentNo 4,816,567) The "monoclonal antibodies" may also be isolated from phage antibody libraries using the techniques described in Clackson et al , Nature, 352 624-628 (1991 ) and Marks et al , J Mol Biol . 222 581 -597 (1991 ), for example The monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the cham(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity U S Patent No 4,816,567, Morrison et al . Proc Natl Acad Sci USA, 81 6851 -6855 (1984)

"Humanized" forms of non-human (e g , muπne) antibodies are chimeric immunoglobulins immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')₂ or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin For the most part, humanized antibodies aie human immunoglobulins (recipient antibody) in which residues from a CDR of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat oi iabbit hav ing the desired specificity, affinity, and capacity In some instances, Fv FR residues of the human immunoglobulin are replaced by corresponding non-human residues Furthermore, humanized antibodies may comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences These modifications are made to further refine and maximize antibody performance In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence The humanized antibody preferably also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin For further details, see Jones et al , Nature, 321 522-525 (1986), Reichmann et al , Nature, 332 323-329 (1988), and Presta, Curr Op Struct Biol . 2 593-596 (1992) The humanized antibody includes a PRIMAΗZED™ antibody wherein the antigen-binding region of the antibody is deπved from an antibody produced by immunizing macaque monkeys with the antigen of interest

"Single-chain Fv" or "sFv" antibody fragments comprise the V_H and V_L domains of an antibody, wherein these domains are present in a single polypeptide chain Preferably, the Fv polypeptide further comprises a polypeptide linker between the V_H and V_L domains that enables the sFv to form the desired structure for antigen binding For a review of sFv see, Pluckthun in The Pharmacology of Monoclonal Antibodies, Vol 113, Rosenburg and Moore, eds (Spnnger-Verlag New York, 1994), pp 269-315

The term "diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (V_H) connected to a light-chain variable domain (V_L) in the same polypeptide chain (V_H - V_L) By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites Diabodies are described more fully in, for example, EP 404,097, WO 93/1 1 161 , and Hollinger et al , Proc Natl Acad Sci USA, 90 6444-6448 (1993)

An "isolated" antibody is one that has been identified and separated and/or recovered from a component of its natural environment Contaminant components of its natural environment are materials that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes In preferred embodiments, the antibody will be purified (1 ) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain Isolated antibody includes the antibody in situ within recombinant cells, since at least one component of the antibody's natural environment will not be present Ordinarily, however, isolated antibody will be prepared by at least one purification step

The word "label" when used herein refers to a detectable compound or other composition that is conjugated directly or indirectly to the antibody so as to generate a "labeled" antibody The label may be detectable by itself (e g , radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition that is detectable Radionuclides that can serve as detectable labels include, for example, I- 131 , 1-123, 1- 125, Y-90, Re- 188, At-21 1 , Cu-67, Bι-212, and Pd- 109 The label may also be a non- detectable entity such as a toxin.

By "solid phase" is meant a non-aqueous matrix to which an antibody of the present invention can adhere. Examples of solid phases encompassed herein include those formed partially or entirely of glass (e.g., controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones. In certain embodiments, depending on the context, the solid phase can comprise the well of an assay plate; in others it is a purification column (e.g.. an affinity chromatography column). This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S. Patent No. 4,275,149.

A "liposome" is a small vesicle composed of various types of lipids, phospholipids and/or surfactant that is useful for delivery of a drug (such as the PRO polypeptide or antibodies thereto disclosed herein) to a mammal. The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes.

As used herein, the term "immunoadhesin" designates antibody-like molecules that combine the binding specificity of a heterologous protein (an "adhesin") with the effector functions of immunoglobulin constant domains. Structurally, the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity that is other than the antigen recognition and binding site of an antibody (i.e., is "heterologous"), and an immunoglobulin constant domain sequence. The adhesin part of an immunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand. The immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG-1 , IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD, or IgM.

II. Compositions and Methods of the Invention

A. PRQ172, PRQ175, PRQ178, PRQ188, PRQ356. PRQ179. PRQ197. PRQ198. PRQ182. PRQ195. PRO200, PRQ21 1 , PRQ217, PRQ219, PRQ221. PRQ224. PRQ228, PRQ245. PRQ246, PRQ258. PRQ261 , PRQ272. PRO301. PRQ322. PRQ328. PRQ331. PRQ364. PRQ366. PRQ535. PRQ819. PRQ826. PROl 160. PROl 186 and PROl 246 Variants In addition to the full-length native sequence PROl 72. PRO 175, PRO 178, PROl 88, PR0356, PRO 179,

PR0197, PR0198, PR0182. PR0195, PRO200, PR021 1 , PR0217, PR0219. PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 and PRO 1246 polypeptides described herein, it is contemplated that PRO 172, PRO! 75, PRO 178, PROl 88, PR0356, PR0179. PR0197, PROl 98, PROl 82, PROl 95, PRO200, PR021 1, PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PROl 186 and PRO 1246 variants can be prepared. PRO 172, PRO 175, PRO 178, PRO 188. PR0356. PRO 179, PRO 197, PRO 198, PR0182, PR0195. PRO200, PR021 1 , PR0217, PR0219. PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PRO.328. PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PRO l 186 and PR01246 variants can be prepared by introducing appropriate nucleotide changes into the PR0172, PRO l 75, PROl 78, PROl 88, PR0356. PR0179, PRO! 97, PR0198, PROl 82, PR0195, PRO200, PR0211 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322. PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 1 6 or PROl 246 DNA, and/or by synthesis of the desired PR0172, PROl 75, PROl 78, PRO 188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322. PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide. Those skilled in the art will appreciate that amino acid changes may alter post-translational processes of the PR0172, PR0175, PROl 78, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211, PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301, PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics.

Variations in the native full-length sequence PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1, PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 or in various domains of the PRO 172, PROl 75, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 described herein, can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U.S. Patent No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding the PRO 172, PRO 175, PRO 178, PROl 88, PR0356, PRO 179, PRO 197, PR0198, PR0182, PR0195, PRO200, PR021 1. PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 that results in a change in the amino acid sequence of the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195. PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272. PRO301, PR0322. PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160. PROl 186 or PR01246 as compared with the native sequence PR0172, PR0175, PR0178, PR0188, PR0356, PR0179. PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224. PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364. PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246. Optionally the variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains of the PROl 72, PROl 75, PROl 78, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182. PR0195, PRO200, PR021 1 , PR0217. PR0219, PR0221. PR0224, PR0228, PR0245, PR0246. PR0258, PR0261. PR0272, PRO301 , PR0322, PR0328. PR0331. PR0364, PR0366, PR0535, PR0819. PR0826, PROl 160, PROl 186 or PR01246. Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the PRO 172, PRO 175, PROl 78, PROl 88, PR0356. PROl 79, PRO 197, PROl 98, PRO 182, PRO 195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 with that of homologous known protein molecules and minimizing the number of amino acid sequence changes made in regions of high homology. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e., conservative amino acid replacements. Insertions or deletions may optionally be in the range of about 1 to 5 amino acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity exhibited by the full-length or mature native sequence. In particular embodiments, conservative substitutions of interest are shown in Table 3 under the heading of preferred substitutions. If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 3, or as further described below in reference to amino acid classes, are introduced and the products screened.

Table 3

Original Exemplary Preferred

Residue Substitutions Substitutions

Ala (A) val, leu, lie val Arg (R) lys, gin, asn lys Asn (N) gin, his, lys, arg gin Asp (D) glu glu Cys (C) ser ser Gin (Q) asn asn Glu (E) asp asp Gly (G) pro, ala ala His (H) asn, gin, lys, arg arg He (I) leu, val, met, ala, phe, norleucine leu Leu (L) norleucine, e, val,

Phe (F) leu, val, e, ala, tyr leu Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp (W) tyr, phe tyr Tyr (Y) tip, phe, thr, ser phe Val (V) lie, leu, met, phe, ala, norleucine leu

Substantial modifications in function or immunological identity of the PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826 PRO 1 160, PRO 1 186 or PRO 1246 polypeptide are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain Naturally occurring residues are divided into groups based on common side chain properties (1 ) hydrophobic norleucine, met, ala valJeu, e,

(2) neutral hydrophilic cys, ser, thr,

(3) acidic asp, glu,

(4) basic asn, gin, his, lys, arg,

(5) residues that influence chain orientation gly, pro, and (6) aromatic trp, tyr, phe

Non-conservative substitutions will entail exchanging a member of one ot these classes for another class Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non conserved) sites

The variations can be made using methods known in the art such as oligonucleotide mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller etal., Nucl. Acids Res.. K):6487 (1987)], cassette mutagenesis [Wells etal., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells et al, Philos. Trans. R. Soc. London SerA. 317:415 (1986)] or other known techniques can be performed on the cloned DNA to produce the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 variant DNA.

Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence. Among the preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant [Cunningham and Wells, Science. 244: 1081 -1085 ( 1989)]. Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 150: 1 (1976)]. If alanine substitution does not yield adequate amounts of variant, an isoteric amino acid can be used.

B. Modifications of PRQ172. PRQ175, PRQ178, PRQ188, PRQ356, PRQ179, PRQ197, PRQ198, PRQ182. PRQ195. PRO200. PRQ211, PRQ217. PRQ219. PRQ221. PRQ224. PRQ228. PRQ245. PRQ246, PRQ258, PRQ261 , PRQ272, PRO301. PRQ322, PRQ328, PRQ331. PRQ364. PRQ366. PRQ535. PRQ819. PRQ826. PRO 1 160. PRO 1186 and PRO 1246 Covalent modifications of PR0172, PR0175, PR0178, PROl 88, PR0356, PR0179, PR0197, PR0198,

PR0182, PR0195, PRO200, PR021 1, PR0217, PR0219. PR0221 , PR0224, PR0228, PR0245, PR0246. PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 and PRO 1246 are included within the scope of this invention. One type of covalent modification includes reacting targeted amino acid residues of a PROl 72, PROl 75, PROl 78, PROl 88, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364. PR0366, PR0535, PR0819, PR0826, PRO 1160, PRO 1 186 or PRO 1246 polypeptide with an organic deri vatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PRO 172, PRO 175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224. PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322. PR0328, PR0331 , PR0364, PR0366, PR0535. PR0819. PR0826, PROl 160, PRO l 186 or PR01246. Derivatization with bifunctional agents is useful, for instance, for crosslinking PRO 172. PROl 75, PRO 178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258. PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 to a water-insoluble support matrix or surface for use in the method for purifying anti-PRO 172, anti-PRO 175. anti-PRO 178, anti- PRO 188, antι-PR0356, anti-PRO 179, antι-PR0197, anti-PROl 98, anti PROl 82, antι-PR0195, antι-PRO200, anti PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221 , antι-PR0224, antι-PR0228, antι-PR0245, antι-PR0246, anti- PR0258, antι-PR0261 , antι-PR0272, antι-PRO301 , antι-PR0322, anti PR0328, antι-PR0331 , antι-PR0364, anti- PR0366, antι-PR0535, antι-PR0819, antι-PR0826, anti-PROl 160, anti-PROl 186 or antι-PR01246 antibodies, and vice-versa Commonly used crosshnking agents include, e g , l ,l -bιs(dιazoacetyl)-2-phenylethane, glutaraldehyde, N-hydroxysuccimmide esters, for example, esters with 4-azιdosalιcyhc acid, homobifunctional lmidoesters, including disuccimmidyl esters such as 3J'-dιthιobιs(succιnιmιdylpropιonate), bifunctional malei ides such as bιs-N-maleιmιdo-l ,8-octane and agents such as methyl-3-[(p-azιdophenyl)dιthιo]propιoιmιdate

Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the α-amino groups of lysine, arginine, and histidine side chains [T E Creighton, Proteins Structure and Molecular Properties, W H Freeman & Co , San Francisco, pp 79-86 (1983)], acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group

Another type of covalent modification of the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PROl 82, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328 PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219 PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 In addition, the phrase includes qualitative changes in the glycosylation ot the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present Addition of glycosylation sites to the PROl 72, PROl 75, PROl 78, PROl 88, PR0356, PROl 79, PR0197,

PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide may be accomplished by altering the amino acid sequence The alteration may be made, for example, by the addition of, or substitution by, one or more serine or threomne residues to the native sequence PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198 PR0182, PR0195, PRO200 PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PRQ535, PR0819, PR0826, PRO 1160, PRO 1 186 or PRO 1246 (for O-linked glycosylation sites). The PRO 172, PRO 175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids.

Another means of increasing the number of carbohydrate moieties on the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g., in WO

87/05330 published 1 1 September 1987. and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).

Removal of carbohydrate moieties present on the PROl 72, PR0175, PROl 78, PROl 88, PR0356, PR0179,

PR0197, PR0198, PR0182, PR0195, PRO200, PR0211, PR0217, PR0219, PR0221 , PR0224, PR0228,

PR0245, PR0246, PR0258, PR0261, PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddin, et al., Arch. Biochem. Biophys., 259:52 ( 1987) and by Edge et al, Anal. Biochem., 1 18: 131 (1981 ). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al, Meth. Enzvmol., 138:350 (1987).

Another type of covalent modification of PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PRO 179, PRO 197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 comprises linking the PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PR0179, PR0197. PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide to one of a variety of nonproteinaceous polymers, e.g.. polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301 ,144; 4,670,417; 4,791 , 192 or 4, 179,337. The PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198. PR0182, PR0195,

PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364. PR0366, PR0535, PR08 I9, PR0826, PROl 160, PROl 186 or PROl 246 of the present invention may also be modified in a way to form a chimeric molecule comprising PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 fused to another, heterologous polypeptide or amino acid sequence.

In one embodiment, such a chimeric molecule comprises a fusion of the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PRO 1 186 or PRO 1246 with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the amino- or carboxyl- terminus of the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1186 or PRO 1246. The presence of such epitope-tagged forms of the PRO 172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-His) or poly-histidine-glycine (poly-His-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field etal.. Mol. Cell. Biol.. 8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E 10 antibodies thereto [Evan et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky etal.. Protein Engineering, 3(6):547-553 (1990)]. Other tag polypeptides include the Flag-peptide [Hopp et al., BioTechnology, 6: 1204-1210 (1988)]; the KT3 epitope peptide [Martin et al.. Science, 255: 192-194 (1992)]; an α-tubulin epitope peptide [Skinner et l., Biol. Chem., 266: 15163- 15166 ( 1991 )]; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth etal., Proc. Natl. Acad. Sci. USA. 87:6393-6397 (1990)].

In an alternative embodiment, the chimeric molecule may comprise a fusion of the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195. PRO200, PR021 1 , PR0217. PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160. PROl 186 or PRO 1246 with an immunoglobulin or a particular region of an immunoglobulin. For a bivalent form of the chimeric molecule (also referred to as an "immunoadhesin"). such a fusion could be to the Fc region of an IgG molecule. The Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a PRO 172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1, PR0217, PR0219, PR0221. PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide in place of at least one variable region within an Ig molecule. In a particularly preferred embodiment, the immunoglobulin fusion includes the hinge, CH2 and CH3 , or the hinge, CH 1 , CH2 and CH3 regions of an IgG 1 molecule. For the production of immunoglobulin fusions see also, US PatentNo. 5,428,130 issued June 27, 1995.

C. PreparationofthePRO172. PRO175. PR0178. PR0188. PR0356.PR0179,PRO197. PRQ198. PR0182. PRQ195. PRO200. PRQ211. PRQ217. PRQ219. PRQ221. PRQ224. PRQ228. PRQ245. PRQ246. PRQ258, PRQ261. PRQ272, PRO301 , PRQ322. PRQ328, PRQ331 , PRQ364, PRQ366, PRQ535, PRQ819, PRQ826, PROl 160, PROl 186 and PRQ1246

The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211, PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301, PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROU60, PROl 186 or PR01246. In particular, cDNAs encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211, PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptides have been identified and isolated, as disclosed in further detail in the Examples below. It is noted that proteins produced in separate expression rounds may be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed. However, for sake of simplicity, in the present specification the protein encoded by DNA35916-1 161 , DNA19355-1 150, DNA23339-1 130, DNA28497-1130, DNA47470-1 130-P1 , DNA16451 -1078, DNA22780-1078, DNA33457-1078, DNA27865-1091 , DNA26847-1395, DNA29101-1122, DNA32292-1131, DNA33094-1 131 , DNA32290-1 164, DNA33089-1132, DNA33221 -1 133, DNA33092-1202, DNA35638-1141, DNA35639- 1 172, DNA35918-1 174, DNA33473-1 176, DNA40620-1183, DNA40628-1216, DNA48336-1309, DNA40587- 1231 , DNA40981 -1234, DNA47365-1206, DNA33085-1 1 10, DNA49143- 1429, DNA57695-1340, DNA57694-1341 , DNA62872-1509, DNA60621 -1516 or DNA64885-1549, as well as all further native homologues and variants included in the foregoing definition of PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819. PR0826, PROl 160, PROl 186 or PR01246, will be referred to as "PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246", respectively, regardless of their origin or mode of preparation. The description below relates primarily to production of PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptides by culturing cells transformed or transfected with a vector containing nucleic acid encoding PRO 172, PROl 75, PROl 78, PROl 88, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 polypeptides. It is, of course, contemplated that alternative methods that are well known in the art may be employed to prepare PRO 172, PRO 175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1, PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301, PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246. For instance, the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide sequence, or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques. See, e.g., Stewart et al, Solid-Phase Peptide Synthesis (W.H. Freeman Co.: San Francisco, CA, 1969); Merrifield, J. Am. Chem. Soc, 85: 2149-2154 (1963). In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, with an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions. Various portions of PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258. PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826. PROl 160, PROl 186 or PRO 1246 may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PRO 172, PRO 175, PRO 178, PROl 88, PR0356, PR0179, PR0197. PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245. PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide.

i. Isolation of DNA Encoding PRQ172, PRQ175, PRQ178, PRQ188, PRQ356, PRQ179, PRQ197, PRQ198, PRQ182. PRQ195. PRO200. PRQ21 1. PRQ217. PRQ219. PRQ221. PRQ224. PRQ228. PRQ245. PRQ246. PRQ258. PRQ261 , PRQ272, PRO301. PRQ322. PRQ328. PRQ331. PRQ364. PRQ366. PRQ535, PRQ819, PRQ826. PR01 160. PRO 1 186 or PRO 1246

DNA encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182,

PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221. PR0224, PR0228, PR0245, PR0246. PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331. PR0364, PR0366, PR0535, PR0819. PR0826,

PRO 1 160, PRO 1 186 or PRO 1246 polypeptide may be obtained from a cDNA library prepared from tissue believed to possess the mRNA encoding PR0172, PR0175, PR0178, PROI 88, PR0356, PR0179, PR0197, PR0198, PROl 82, PRO 195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 and to express it at a detectable level. Accordingly, DNAs encoding human PRO172, PRO175, PRO178,PRO188, PRO356, PRO179, PRO197, PRO198, PRO182, PRO195, PRO200, PR0211, PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301, PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 can be conveniently obtained from cDNA libraries prepared from human tissues, such as described in the Examples. The gene encoding PROl 72, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211, PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide may also be obtained from a genomic library or by oligonucleotide synthesis.

Libraries can be screened with probes (such as antibodies to the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1, PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1186 or PRO 1246 polypeptide or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook etal. , supra. An alternative means to isolate the gene encoding PROl 72, PRO 175, PRO 178, PROl 88, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 is to use PCR methodology. Sambrook et al, supra; Dieffenbach et al, PCR Primer: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1995).

The Examples below describe techniques for screening a cDNA library. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like ²P-labeled ATP, biotinylation, or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided in Sambrook et al., supra.

Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) within defined regions of the molecule or across the full-length sequence can be determined through sequence alignment using computer software programs such as ALIGN, DNAstar, and INHERIT, which employ various algorithms to measure homology.

Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al., supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.

ii. Selection and Transformation of Host Cells Host cells are transfected or transformed with expression or cloning vectors described herein for PROl 72,

PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246. PR0258, PR0261, PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. The culture conditions, such as media, temperature, pH, and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: A Practical Approach, M. Butler, ed. (IRL Press, 1991 ) and Sambrook et al., supra. Methods of transfection are known to the ordinarily skilled artisan, for example, CaP0₄ treatment and electroporation. Depending on the host cell used, transformation is performed using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described in Sambrook et al., supra, or electroporation is generally used for prokaryotes or other cells that contain substantial cell-wall barriers. Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et al, Gene. 23: 315 (1983) and WO 89/05859 published 29 June 1989. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52:456-457 ( 1978) can be employed. General aspects of mammalian cell host system transformations have been described in U.S. Patent No. 4,399,216. Transformations into yeast are typically carried out according to the method of Van Solingen et al, Bact., 130: 946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76: 3829 (1979). However, other methods for introducing DNA into cells, such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g., polybrene or polyornithine, may also be used. For various techniques for transforming mammalian cells, see, Keown et al., Methods in Enzvmology, 185: 527-537 (1990) and Mansour et al, Nature. 336: 348-352 (1988).

Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include, but are not limited to, eubacteria, such as Gram-negative or Gram- positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains are publicly available, such as E. coli K\2 strain MM294 (ATCC 31 ,446); E. coli XI 776 (ATCC 31 ,537); E. coli strain W31 10 (ATCC 27,325); and K5 772 (ATCC 53,635). Other suitable prokaryotic host cells include Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia arcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis (e.g., B. licheniformis 41 P disclosed in DD 266,710 published 12 April 1989), Pseudomonas such as P. aeruginosa, and Streptomyces. These examples are illustrative rather than limiting. Strain W31 10 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations. Preferably, the host cell secretes minimal amounts of proteolytic enzymes. For example, strain W31 10 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W31 10 strain 1 A2, which has the complete genotype tonA ; E. coli W31 10 strain 9E4, which has the complete genotype tonA ptr3; E. coli W31 10 strain 27C7 (ATCC 55,244), which has the complete genotype tonA ptr3 phoA El 5 (argF-lac)169 degP ompTkan'; E. coli W31 10 strain 37D6, which has the complete genotype tonA ptr3 phoA El 5 (argF-lac)169 degP ompT rbs7 ilvG kan^r; E. coli W31 10 strain 40B4, which is strain 37D6 with a non- kanamycin resistant degP deletion mutation; and an E. coli strain having mutant periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August 1990. Alternatively, in vitro methods of cloning, e.g., PCR or other nucleic acid polymerase reactions, are suitable.

In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for vectors encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211, PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomyces pombe (Beach and Nurse, Nature, 290: 140 [1981]; EP 139,383 published 2 May 1985); Kluyveromyces hosts (U.S. Patent No. 4,943,529; Fleer et al, Bio/Technology. 9: 968-975 (1991)) such as, e.g., K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al, J. BacterioL, 737 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906; Van den Berg et al. Bio/Technology, 8: 135 (1990)), K. thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia past oήs (EP 183,070; Sreekrishna et al, J. Basic Microbiol. 28: 265-278 [ 1988]); Candida; Trichoderma reesia (EP 244,234); Neuwspora crassa (Case et al, Proc. Natl. Acad. Sci. USA, 76: 5259-5263 [1979]); Schwanniomyces such as Schwanniomyces occidentalis (EP 394,538 published 31 October 1990); and filamentous fungi such as, e.g., Neuwspora, Penicillium, Tolypocladium (WO 91 /00357 published 10 January 1991 ), and Aspergillus hosts such as A. nidulans (Ballance et al, Biochem. Biophys. Res. Commun., 1 12: 284-289 [19831; Tilburn et al. Gene, 26: 205-221 [1983]; Yelton et al, Proc. Natl. Acad. Sci. USA, 81_: 1470-1474 [ 1984]) and A. niger (Kelly and Hynes, EMBO J., 4: 475-479 [1985]). Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hansenula, Candida, Kloeckera, Pichia, Saccharomyces. Torulopsis, and Rhodotorula. A list of specific species that are exemplary of this class of yeasts may be found in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).

Suitable host cells for the expression of nucleic acid encoding glycosylated PRO 172, PRO 175, PROl 78, PR0188, PR0356. PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219. PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells More specific examples include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651 ), human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al , J Gen Virol , 36 59 (1977)), Chinese hamster ovary cellsADHFR (CHO, Urlaub and Chasm, Proc Natl Acad Sci USA. 77 4216 (1980)), mouse serto cells (TM4, Mather, Biol Reprod , 23 243 251 (1980)), human lung cells (W138, ATCC CCL 75), human liver cells (Hep G2, HB 8065), and mouse mammary tumor (MMT 060562, ATCC CCL51 ) The selection of the appropriate host cell is deemed to be within the skill in the art

in Selection and Use of a Rephcable Vector The nucleic acid (e g , cDNA or genomic DNA) encoding PRO 172, PROl 75, PRO 178, PRO 188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 may be inserted into a rephcable vector for cloning (amplification of the DNA) or for expression Various vectors are publicly available The vector may, for example, be in the form of a plasmid, cosmid, viral particle or phage The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures In general, DNA is inserted into an appropriate restriction endonuclease sιte(s) using techniques known in the art Vector components generally include, but are not limited to, one or more of a signal sequence if the sequence is to be secreted, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence Construction of suitable vectors containing one or more of these components employs standard hgation techniques that are known to the skilled artisan

The PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245 PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 may be produced recombmantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide In general, the signal sequence may be a component of the vector, or it may be a part of the DNA encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 that is inserted into the vector The signal sequence may be a prokaryotic signal sequence selected, for example, from the group ot the alkaline phosphatase, penicilhnase, lpp, or heat-stable enterotoxin II leaders For yeast secretion the signal sequence may be, e g , the yeast invertase leader, alpha factor leader (including Sacchaioimces and

a factor leaders, the latter described in U S Patent No 5,010,182), or acid phosphatase leader, the C albicans glucoamylase leader (EP 362,179 published 4 April 1990), or the signal desciibed in WO 90/13646 published 15 November 1990 In mammalian cell expression, mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders.

Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV, or BPV) are useful for cloning vectors in mammalian cells.

Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.

An example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the nucleic acid encoding PROl 72, PROl 75, PRO 178, PRO 188, PR0356, PRO 179, PROl 97, PR0198, PR0182, PR0195, PRO200, PR0211 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301, PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246, such as DHFR or thymidine kinase. An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al, Proc. Natl. Acad. Sci. USA, 77: 4216 (1980). A suitable selection gene for use in yeast is the trpl gene present in the yeast plasmid YRp7. Stinchcomb etal. Nature, 282: 39 (1979); Kingsman et al. Gene, 7: 141 (1979); Tschemper et al. Gene, 10: 157 (1980). Υhe trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No.44076 or PEP4-1. Jones, Genetics. 85: 12 (1977).

Expression and cloning vectors usually contain a promoter operably linked to the nucleic acid sequence encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the β-lactamase and lactose promoter systems (Chang etal , Nature, 275: 615 (1978); Goeddel etal , Nature, 281 : 544 (1979)), alkaline phosphatase, a tryptophan (tip) promoter system (Goeddel, Nucleic Acids Res., 8: 4057 (1980); EP 36,776), and hybrid promoters such as the tac promoter. deBoer ef al. Proc. Natl. Acad. Sci. USA, 80: 21 -25 (1983). Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331. PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246. Examples of suitable promoting sequences for use with yeast hosts include the promoters for 3- phosphoglycerate kinase (Hitzeman et al, J. Biol. Chem.. 255: 2073 ( 1980)) or other glycolytic enzymes (Hess et al. . Adv. Enzyme Reg..7: 149 ( 1968); Holland, Biochemistry, 17: 4900 (1978)), such as enolase, glyceraldehyde- 3 phosphate dehydiogenase hexokinase, pyi uvate decarboxylase phosphofructokinase, glucose 6-phosphate isomerase, 3 phosphoglycerate mutase, pyi uvate kinase, tπosephosphate isomerase, phosphoglucose isomerase and glucokmase

Other yeast promoters that are inducible promoters having the additional advantage of transcription controlled by growth conditions are the promoter regions for alcohol dehydiogenase 2 isocytochrome C, acid phosphatase degradative enzymes associated with nitrogen metabolism metallothionein, glyceraldehyde-3 phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization Suitable vectors and promoters toi use in yeast expression are further described in EP 73,657

PROl 72, PR0175, PRO! 78, PROl 88, PR0356, PROl 79 PROJ97, PR0198, PROl 82, PR0195, PRO200 PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272 PRO301 , PR0322, PR0328, PR0331 PR0364, PR0366, PR0535, PROS 19, PR0826, PROl 160, PROl 186 oi PROl 246 nucleic acid transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,21 1 ,504 published 5 July 1989) adeno irus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus a retiovirus hepatitis B virus and Simian Virus 40 (SV40), by heterologous mammalian promoters e g , the actin promoter or an immunoglobulin promoter, and by heat-shock promoters, provided such promoters are compatible with the host cell systems

Transcription of a DNA encoding the PR0172, PRO! 75, PRO 178, PRO 188, PR0356, PRO 179, PRO 197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245 PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535 PR0819 PR0826 PROl 160, PROl 186 or PR01246 by higher eukai votes may be increased by inserting an enhancei sequence into the vector Enhancers are cis acting elements of DNA, usually about from 10 to 300 bp that act on a piomoter to increase its ti nscπption Many enhancer sequences are now known from mammalian genes (globin elastase albumin, α-fetoprotein, and insulin) Typically however one will use an enhancer from a eukaryotic cell vn us Examples include the S V40 enhancer on the late side of the replication origin (bp 100 270) the cytomegalovirus early promoter enhancer the polyoma enhancer on the late side of the replication origin and adeno u us enhancers The enhancer may be spliced into the vectoi at a posιtιon or 3 to the sequence coding toi PR0172 PR0175, PR0178, PR0188, PR0356, PR0179 PRO 197, PRO 198, PRO 182 PR019 PRO200 PR021 1 PR0217, PR0219, PR0221 PR0224 PR0228, PR024 PR0246, PR0258 PR0261 PR0272 PRO301 PR0322 PR0328, PR0331 PR0364 PR0366 PR0535, PR0819 PR0826 PRO l 160 PROH 8601 PRO 1246 but is preferably located at a site fiom the promoter

Expression vectors used in eukai y otic host cells (yeast, fungi insect, plant animal human or nucleated cells from other multicellular organisms) will also contain sequences necessaiy for the termination ot transcription and for stabilizing the mRNA Such sequences are commonlv available from the 5 and occasionallv 3 untranslated regions of eukaryotic or viral DNAs 01 cDNAs These iegions contain nucleotide segments transcπbed as polyadeny lated f 1 agments in the untranslated portion ot the mRNA encoding PRO 172, PRO 17 PRO 178 PRO 188 PR0356 PR0179 PRO 197, PRO 198 PR0182 PR0195 PRO200, PR021 1 PR0217 PR0219 PR0221 PR0224, PR0228, PR0245. PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535. PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246

Still other methods, vectors, and host cells suitable for adaptation to the synthesis of PROl 72, PROl 75, PR0178, PR0188, PR0356, PR0179, PR0197. PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224. PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364. PR0366, PR0535, PR0819, PR0826, PROl 160. PROl 186 or PR01246 in recombinant vertebrate cell culture are described in Gething et al , Nature, 293. 620-625 (1981 ), Mantei et al , Nature. 281. 40-46 ( 1979), EP 1 17,060, and EP 1 17,058

lv. Detecting Gene Amplification/Expression Gene amplification and/or expression may be measured in a sample directly, for example, by conventional

Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc Natl Acad Sci USA, 77:5201-5205 (1980)), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence ot antibody bound to the duplex can be detected

Gene expression, alternatively, may be measured by immunological methods, such as lmmunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product Antibodies useful for lmmunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal Conveniently, the antibodies may be prepared against a native-sequence PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PRO 179, PRO 197. PRO 198, PRO 182. PR0195, PRO200. PR021 1. PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245 PR0246, PR0258 PR0261 , PR0272, PRO301 , PR0322, PR0328. PR0331 , PR0364, PR0366, PR0535. PR0819, PR0826. PRO 1 160. PRO 1 186 or PRO 1246 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to DNA encoding PRO 172, PRO 175. PRO 178. PRO 188, PR0356 PRO 179, PRO 197. PRO 198, PROl 82, PROl 95. PRO200. PR021 1 , PR0217. PR021 . PR0221 , PR0224. PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322. PR0328, PR0331. PR0364. PR0366, PR0535. PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 and encoding a specific antibody epitope

v. Purification of Polypeptide Forms of PRO 172, PRO 175, PRO 178, PROl 88. PR0356, PRO 179, PRO 197. PRO 198. PRO 182, PRO 195,

PRO200, PR021 1 , PR0217, PR0219, PR022 I , PR0224. PR0228, PR0245, PR0246 PR0258, PR0261 , PR0272. PRO301 , PR0322. PR0328, PR03 1 , PR0364, PR0366, PR0535, PR0819. PR0826, PRO l 160 PRO 1 186 or PRO 1246 polypeptides may be recovered from cultui e medium oi from host cell ly sates It membrane- bound, it can be released from the membrane using a suitable detergent solution (e g , TRITON-X™ 100) or by enzymatic cleavage Cells employed in expiession ot nucleic acid encoding the PRO 172. PRO 175, PRO 178, PR0188, PR0356, PR0179, PR0197 PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide can be disrupted by various physical or chemical means, such as fieeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents

It may be desired to purify the PRO 172, PRO 175, PROl 78, PRO 188, PR0356, PRO 179, PRO 197 PRO 198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide from recombinant cell proteins or polypeptides The following procedures are exemplary of suitable purification procedures by tractionation on an ion-exchange column, ethanol precipitation, reverse phase HPLC, chromatography on silica or on a cation-exchange resin such as DEAE, chromatofocusmg, SDS-PAGE, ammonium sulfate precipitation, gel filtration using, for example, Sephadex G-75, protein A Sepharose columns to remove contaminants such as IgG, and metal chelat g columns to bind epitope-tagged forms ot the PRO 172, PRO 175 PROl 78, PR0188, PR0356, PROl 79, PRO 197 PROl 98, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224 PR0228, PR0245, PR0246 PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PRO-366, PR0535, PR0819 PR0826, PR01 160, PROl 186 or PRO 1246 polypeptide Various methods of protein purification may be employed and such methods are known in the art and described, for example, in Deutscher, Methods in Enzvmology. 182 (1990), Scopes, Protein Purification Principles and Practice (Springer- Veriag New York, 1982) The purification steρ(s) selected will depend, for example, on the nature of the production process used and the particular PROl 72, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228 PR0245, PR0246 PR02 8 PR0261 , PR0272, PRO301 PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PROS 19 PR0826 PRO 1 160, PRO 1 186 or PROl 246 produced

D Uses of the PRQ172, PRQ175, PRQ178, PRQ188, PRQ3 6, PRQ179 PRQ197 PRQ198, PRQ182

PRQ195, PRO200, PRQ21 1 , PRQ217, PRQ219 PRQ221 PRQ224 PRQ228 PRQ245 PRQ246 PRQ258 PRQ261 , PRQ272, PRO301 , PRQ322 PRQ328 PRQ331. PRQ364 PRQ366 PRO^*535 PRQ819. PRQ826 PROl 160. PRO 1 186 oi PRO 1246 polypeptides l Assays foi Caidiovascular Endothehal and Angiogenic Activ ity Various assays can be used to test the polypeptide herein for cardiovasculai endothehal, and angiogenic activity Such assays include those provided in the Examples below

Assay fortestιngforendothelιn antagonιstdctιvιty, as dιsclosed ιn U S Pat No 773 414, ιnclude a rat heaι t ventricle binding assay wheie the polypeptide is tested fonts ability to inhibit lodinized endothelin- 1 binding in a receptor assay, an endothelin l eceptor binding assay testing f oi intact cell binding ot i adiolabeled endothelin- 1 using rabbit renal artery vascular smooth muscle cells, an inositol phosphate accumulation assay wheie functional activity is determined in Rat 1 cells by measuring intra-cellular levels of second messengers an arachidonic acid release assay that measures the ability of added compounds to reduce endothehn-stimulated arachido c acid release in cultured vascular smooth muscles, m vttio (isolated vessel) studies using endothehum from male New Zealand rabbits, and in \ ι\ o studies using male Sprague-Dawley rats

Assays for tissue generation activity include, without limitation, those described in WO 95/16035 (bone, cartilage, tendon), WO 95/05846 (nerve, neuronal), and WO 91/07491 (skin, endothehum)

Assays for wound-healing activity include, for example, those described in Winter, Epidermal Wound Healing, Maibach, HI and Rovee, DT, eds (Year Book Medical Publishers, Inc , Chicago), pp 71 - 1 12, as modified by the article of Eaglstein and Mertz, J Invest Dermatol , l± 382-384 (1978)

An assay to screen for a test molecule relating to a PRO polypeptide that binds an endothelin B, (ETBi) receptor polypeptide and modulates signal transduction activity involves providing a host cell transformed with a DNA encoding endothelin B , receptor polypeptide, exposing the cells to the test candidate, and measuring endothelin B, receptor signal transduction activity, as described, e g , in U S Pat No 5,773,223

There are several cardiac hypertrophy assays In vttto assays include induction of spreading of adult rat cardiac myocytes In this assay, ventricular myocytes are isolated from a single (male Sprague-Dawley) rat, essentially following a modification of the procedure described in detail by Piper etal , "Adult ventricular rat heart muscle cells^' in Cell Culture Techniques in Heart and Vessel Research, H M Piper, ed (Berlin Springer Veriag 1990), pp 36-60 This procedure permits the isolation of adult ventricular myocytes and the long-term culture of these cells in the rod shaped phenotype Phenylephπne and Prostaglandin F_2α (PGF_2α) have been shown to induce a spreading response in these adult cells The inhibition of myocyte spreading induced by PGF,_α or PGF,₀ analogs (e g fluprostenol) and phenylephπne by various potential inhibitors ot cardiac hypertrophy is then tested

One example of an ;/; vivo assay is a test for inhibiting cardiac hypertrophy induced by fluprostenol in vι\ o This pharmacological model tests the ability of the PRO polypeptide to inhibit cardiac hypertrophy induced in rats (e g , male Wistar or Sprague-Dawley) by subcutaneous injection of fluprostenol (an agonist analog of PGF,_α) It is known that rats with pathologic cardiac hypertrophy induced by myocardial infarction have chronically elevated levels of extractable PGF,_H in their myocardium Lai et al Am I Physiol (Heart Circ Physiol ), 271 H2197 H2208 (1996) Accordingly, tactors that can inhibit the effects of fluprostenol on myocardial growth ;/; i π o aie potentially useful tor treating cardiac hypertrophy The effects of the PRO polypeptide on cardiac hypertrophy ai e determined by measuring the weight of heart, ventricles, and left ventricle (normalized by body weight) relative to fluprostenol -treated rats not receiving the PRO polypeptide Anothei example of an in \ ι\ o assay is the pressuie overload cardiac hypertrophy assay For in \ n o testing it is common to induce pressure overload cardiac hypertrophy bv constriction of the abdominal aorta of test animals In a typical protocol rats (e g male Wistar or Sprague Dawle ) aie treated under anesthesia, and the abdominal aorta ot each rat is narrowed down just below the diaphragm Beznak M , Can I Biochem Physiol 33 985 94 ( 1955) The aorta is exposed thiough a surgical incision and a blunted needle is placed next to the vessel The aorta is consti icted with a ligature of silk thread around the needle which is immediately lemoved and which reduces the lumen ot the aorta to the diameter of the needle This approach is desciibed, for example, in Rossi ct al Am Heart J , 124 700 709 ( 1992) and O'Rourke and Reibel P S E M B , 200 95 100 ( 1992) In yet anothei in wvσ assay , the effect on cardiac hypertrophy following experimentally induced myocardial infarction (MI) is measured Acute MI is induced in rats by left coronary artery hgation and confirmed by electrocardiographic examination A sham operated group of animals is also prepared as control animals Earlier data have shown that cardiac hypertrophy is present in the group of animals with MI, as ev idenced by an 18% increase in heart weight-to-body weight ratio Lai etal supia Treatment of these animals with candidate blockers of cardiac hypertrophy, e g , PRO polypeptide, provides valuable information about the therapeutic potential of the candidates tested One further such assay test for induction of cardiac hypertrophy is disclosed in U S Pat No 5,773,415, using Sprague-Dawley rats

For cancer, a variety of well-known animal models can be used to further understand the role of the genes identified herein in the development and pathogenesis of tumors, and to test the efficacy of candidate therapeutic agents, including antibodies and other antagonists of the native PRO polypeptides, such as small-molecule antagonists The in vivo nature of such models makes them particularly predictive of responses in human patients Animal models of tumors and cancers (e g , breast cancer, colon cancer, prostate cancer, lung cancel , etc ) include both non recombinant and recombinant (transgemc) animals Non-recombinant animal models include, for example rodent, e g , muπne models Such models can be generated by intioducing tumorcells into syngeneic mice using standard techniques, e g subcutaneous injection, tail vein injection, spleen implantation, lntrapeπtoneal implantation, implantation under the renal capsule, or orthopin implantation, e g colon cancer cells implanted in colonic tissue See, e g , PCT publication No WO 97/33551 , published September 18, 1997 Probably the most often used animal species in oncological studies are immunodeficient mice and, in particular nude mice The observation that the nude mouse with thymic hypo/aplasia could successfully act as a host for human tumor xenografts has lead to its widespread use for this purpose The autosomal recessive nu gene has been introduced into a very large number of distinct congemc strains of nude mouse, including, for example ASW, A/He, AKR BALB/c, B 10 LP, C17, C3H, C57BL, C 7, CBA, DBA DDD, I/st, NC NFR, NFS NFS/N NZB, NZC, NZW, P, RIII, and SJL In addition, a wide variety ot other animals with inherited immunological defects other than the nude mouse have been bred and used as recipients of tumor xenografts For tui ther details see e g The Nude Mouse in Oncology Research, E Boven and B Winogiad eds (CRC PressJnc 1991 )

The cells introduced into such animals can be deπv ed from known tumoi/cancer cell lines such as any of the abov e listed tumor cell lines, and, for example, the B 104 1 1 cell line (stable NIH 3T3 cell line tiansfected with the nett protooncogene), /αs-transfected NIH-3T3 cells, Caco 2 (ATCC HTB 37) oi a moderately well differentiated grade II human colon adenocarcinoma cell line, HT 29 (ATCC HTB 38) or from tumoi s and cancers Samples ot tumor oi cancer cells can be obtained from patients undergoing surgeiy using standard conditions involv ing freezing and storing in liquid nitrogen Karmali et al Br J Cancer, 48 689 696 ( 1983)

Tumor cells can be introduced into animals such as nude mice bv a variety ot proceduies The subcutaneous (s c ) space in mice is very suitable for tumor implantation Tumois can be transplanted s L as solid blocks as needle biopsies by use of a trochar, or as cell suspensions For solid block oi trochar implantation, tumor tissue fragments of suitable size are introduced into the s c space Cell suspensions are freshly piepaied tioin pπmaiy tumors or stable tumoi cell lines and injected subcutaneously Tumoi cells can also be li ected as subdermal implants In this location the inoculum is deposited between the lower part of the dermal connective tissue and the s c tissue

Animal models ot breast cancer can be generated, for example by implanting rat neuroblastoma cells (from which the neu oncogene was initially isolated), or new-transformed NIH 3T3 cells into nude mice, essentially as described by Drebin et al Proc Nat Acad Sci USA, 83 9129-91 3 ( 1986)

Similarly, animal models of colon cancer can be generated by passaging colon cancer cells in animals, e g , nude mice, leading to the appearance of tumors in these animals An orthotopic transplant model of human colon cancer in nude mice has been described, for example, by Wang et al Cancer Research, 54 4726-4728 ( 1994) and Too et al , Cancer Research, 55 681 -684 (1995) This model is based on the so called "METAMOUSE"™ sold by AntiCancer, Inc , (San Diego, California)

Tumors that arise in animals can be removed and cultured m x itio Cells from the in \ ιtιo cultures can then be passaged to animals Such tumors can serve as targets for further testing or drug screening Alternatively, the tumors resulting from the passage can be isolated and RNA from pre -passage cells and cells isolated after one or more rounds of passage analyzed for differential expression of genes of interest Such passaging techniques can be performed with any known tumor or cancel cell lines

For example, Meth A, CMS4, CMS5, CMS21 , and WEHI-164 are chemically induced fibrosarcomas of BALB/c female mice (DeLeo et al J Exp Med , 146 720 ( 1977)), which provide a highly controllable model system for studying the anti tumor activities of various agents Palladino et al , J Immunol , 138 4023 4032 (1987) Briefly, tumor cells are propagated in vitw in cell culture Prior to injection into the animals, the cell lines are washed and suspended in buffer, at a cell density of about 10x 10^f to 10x 10 cells/ml The animals are then infected subcutaneously with 10 to 100 μl of the cell suspension, allowing one to three weeks foi a tumor to appear

In addition the Lewis lung (3LL) carcinoma of mice, which is one of the most thoroughly studied experimental tumoi s, can be used as an investigational tumor model Efficacy in this tumor model has been correlated with beneficial effects in the treatment of human patients diagnosed with small cell carcinoma of the lung (SCCL) This tumor can be introduced in normal mice upon injection of tumor fragments from an affected mouse or of cells maintained in culture

etal Br J Cancer 41 suppl 4 30 ( 1980) Evidence indicates that tumors can be started from injection of even a single cell and that a very high piopoition of infected tumoi cells survive For further information about this tumor model see, Zacharski, Haemostasis, 16 300 320 ( 1986)

One way of evaluating the efficacy of a test compound in an animal model with an implanted tumoi is to measure the size of the tumor before and after treatment Traditionally, the size of implanted tumors has been measured with a slide cahper in two or three dimensions The measure limited to two dimensions does not accurately reflect the size of the tumor, therefore, it is usually converted into the coi responding volume by using a mathematical formula However the measurement ot tumoi size is v ery inaccurate The therapeutic effects of a drug candidate can be better described as treatment-induced growth delay and specific grow th delay Another important variable in the description ot tumor growth is the tumoi volume doubling time C omputer programs foi the calculation and description ot tumoi growth are also available, such as the piogi am reported by Rygaard and Spang Thomsen. Pioc 6th Int Workshop on Immune Def icient Animals Wu nd Sheng eds ( Basel 1989), p 301 It is noted, however, that necrosis and inflammatory responses following treatment may actually result in an increa^se in tumoi size, at least initially Therefore, these changes need to be carefully monitored, by a combination of a morphometπc method and flow cytometπc analysis

Furthei, recombinant (transge c) animal models can be engineered by introducing the coding portion of the PRO gene identified herein into the genome of animals of interest, using standard techniques for producing transgemc animals Animals that can serve as a target for transgemc manipulation include, without limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e g , baboons, chimpanzees and monkeys Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (U S Patent No 4,873, 191 ), retrovirus-mediated gene transfer into germ lines (e g , Van der Putten et al , Proc Natl Acad Sci USA, 82 6148-615 (1985)). gene targeting in embryonic stem cells (Thompson etal , Cell, 56 313-321 ( 1989)), electroporation of embryos (Lo, Mol Cell Biol , 3 1803- 1814 ( 1983)), and sperm-mediated gene transfer Lavitrano et al Cell, 57 717-73 (1989) For a review, see for example, U S Patent No 4,736,866

For the purpose of the present invention, transge c animals include those that carry the transgene only in part of their cells ("mosaic animals") The transgene can be integrated either as a single transgene, or in concatamers, e g , head-to-head or head-to-tail tandems Selective introduction of a transgene into a particular cell type is also possible by following, for example, the technique of Lasko et al Proc Natl Acad Sci USA 89 6232-636 ( 1992)

The expression of the transgene in transgemc animals can be monitored by standard techniques For example,

Southern blot analysis or PCR amplification can be used to verify the integration of the transgene The level of mRNA expression can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR, or lmmunocytochemistry The animals are further examined for signs of tumor or cancer development

Alternatively, "knock-out ' animals can be constructed that have a defective or altered gene encoding a PRO polypeptide identified herein, as a result of homologous recombination between the endogenous gene encoding the PRO polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal For example, cDNA encoding a particular PRO polypeptide can be used to clone genomic DNA encoding that polypeptide in accordance with established techniques A portion of the genomic DNA encoding a particular PRO polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable maiker that can be used to monitor integration Typically, several kilobases ot unaltered flanking DNA (both at the 5 and 3 ends) are included in the vector See, e g , Thomas and Capecchi, Cell 51 503 ( 1987) for a description of homologous recombination vectoi s The vector is introduced into an embryonic stem cell line (e g , by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA aie selected See, e g . Li et al , Cell 69 915 ( 1992) The selected cells are then injected into a blastocyst of an animal (e g , a mouse or rat) to form aggregation chimeras See, e e. , Bradley, in Teiatocarcinomas and Embryonic Stem Cells A Practical Approach E J Robertson, ed (IRL Oxfoid 1987), pp 1 13 1 52 A chimeric embiyo can then be implanted into a suitable pseudopregnant female foster animal and the embryo bi ught to teim to create a "knock-out animal Progeny harboring the homologously recombined DNA in then gei m cells can be identified by standard techniques and used to breed animals in which all cells ot the animal contain the homologously recombined DNA Knockout animals can be characterized, for instance, by then ability to defend against certain pathological conditions and by their development of pathological conditions due to absence of the PRO polypeptide

The efficacy ot antibodies specifically binding the PRO polypeptides identified herein, and other drug candidates, can be tested also in the treatment of spontaneous animal tumors A suitable target for such studies is the feline oral squamous cell carcinoma (SCC) Feline oral SCC is a highly invasive, malignant tumor that is the most common oral malignancy of cats, accounting for over 60% of the oral tumors reported in this species It rarely metastasizes to distant sites, although this low incidence of metastasis may merely be a reflection of the short survival times for cats with this tumor These tumors are usually not amenable to surgery, primarily because ot the anatomy of the feline oral cavity At present, there is no effective treatment for this tumor Prior to entry into the study, each cat undergoes complete clinical examination and biopsy, and is scanned by computed tomography (CT) Cats diagnosed with sublingual oral squamous cell tumors are excluded from the study The tongue can become paralyzed as a result of such tumor, and even if the treatment kills the tumor, the animals may not be able to feed themselves Each cat is treated repeatedly, over a longer period of time Photographs of the tumors will be taken daily during the treatment period, and at each subsequent recheck After treatment, each cat undergoes another CT scan CT scans and thoracic radiograms are evaluated every 8 weeks thereafter The data are evaluated for differences in survival, response, and toxicity as compared to control groups Positive response may require evidence of tumor regression, preferably with improvement of quality of life and/or increased life span

In addition, other spontaneous animal tumors, such as fibrosarcoma, adenocarcinoma, lymphoma, chondroma, or leiomyosarcoma of dogs, cats, and baboons can also be tested Of these, mammary adenocarcinoma in dogs and cats is a preferred model as its appearance and behavior are very similar to those in humans However, the use of this model is limited by the rare occurrence of this type of tumor in animals

Other in vitro and in vivo cardiovascular, endothehal, and angiogenic tests known in the art are also suitable herein

ii Tissue Distribution

The results of the cardiovascular endothehal, and angiogenic assay s heiein can be vei ied by further studies such as by determining mRNA expiession in various human tissues

As noted before, gene amplification and/or gene expression in various tissues may be measured by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc Natl Acad Sci USA, 77 5201 -5205 ( 1980)) dot blotting (DNA analysis) or in situ hybridization, using an appropriately labeled probe based on the sequences provided herein Alternatively antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes and DNA-RNA hybrid duplexes oi DNA-protein duplexes

Gene expiession in various tissues alternatively, may be measuied by immunological methods, such as lmmunohistochemical staining of tissue sections and assay ot cell cultuie or body fluids, to quantitate direct the expression of gene product Antibodies useful toi lmmunohistochemical staining and/or assav of sample fluids may be either monoclonal oi polyclonal, and may be prepared in any mammal Conveniently, the antibodies may be prepared against a native-sequence PRO polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to PRO DNA and encoding a specific antibody epitope General techniques for generating antibodies, and special protocols for in situ hybridization are provided hereinbelow

in Antibody Binding Studies The results of the cardiovascular, endothehal, and angiogenic study can be further verified by antibody binding studies, in which the ability of anti-PRO antibodies to inhibit the effect of the PRO polypeptides on endothehal cells or other cells used in the cardiovascular, endothehal, and angiogenic assays is tested Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies, the preparation of which will be described hereinbelow Antibody binding studies may be carried out in any known assay method, such as competitiv e binding assays, direct and indirect sandwich assays, and immunoprecipitation assays Zola, Monoclonal Antibodies A Manual of Techniques (CRC Press, Inc , 1987), pp 147-158

Competitive binding assays rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody The amount of target protein in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies To facilitate determining the amount of standard that becomes bound the antibodies preferably are insolubilized before or after the competition so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte that remain unbound

Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected In a sandwich assay, the test sample analyte is bound by a first antibody that is immobilized on a solid support, and thereafter a second antibody binds to the analyte thus forming an insoluble three part complex See, e g , US Pat No 4,376, 1 10 The second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay ) For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme

For lmmunohistochemistry, the tissue sample may be fresh or f i ozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example

ιv Cell-Based Tumor Assays

Cell based assays and animal models for cardiovascular, endothehal, and angiogenic disoi ders such as tumoi s can be used to verify the findings ot a cardiovasculai endothehal and angiogenic assay herein, and further to understand the relationship between the genes identified heiein and the development and pathogenesis ot undesirable cardiovascular, endothehal, and angiogenic cell growth The role of gene products identified herein in the dev elopment and pathology of undesirable cardiov ascular, endothehal, and angiogenic cell growth c e tumoi cells can be tested by using cells or cells lines that have been identified as being stimulated oi inhibited bv the PRO polypeptide herein Such cells include, tor example those set forth in the Examples below In a diffeient approach cells of a cell type known to be involved in a particular cardiovascular, endothehal and angiogenic disorder are transfected with the cDNAs herein, and the ability of these cDNAs to induce excessive growth or inhibit growth is analyzed If the cardiovascular, endothehal, and angiogenic disorder is cancer, suitable tumor cells include, tor example, stable tumor cells lines such as the B 104- 1 1 cell line (stable NIH-3T3 cell line transfected with the neu protooncogene) and /-κ-transfected NIH 3T3 cells which can be transfected with the desired gene and monitored for tumoπgenic growth Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit tumoπgenic cell growth by exerting cytostatic or cytotoxic activity on the growth of the transformed cells, or by mediating antibody dependent cellular cytotoxicity (ADCC) Cells transfected with the coding sequences of the genes identified herein can further be used to identify drug candidates for the treatment ot cardiovascular, endothehal, and angiogenic disorders such as cancer

In addition, primary cultures derived from tumors in transgemc animals (as described above) can be used in the cell based assays herein although stable cell lines are preferred Techniques to derive continuous cell lines from transgemc animals are well known in the art See, e g , Small et al Mol Cell Biol . 5 642-648 (1985)

v Gene Therapy The PR0172, PR0175 PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195,

PRO200, PR021 1 , PR0217 PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 polypeptide herein and polypeptidyl agonists and antagonists may be employed in accordance with the present inv ention by expression of such polypeptides in vι\ o which is often referred to as gene therapy

There are two major approaches to getting the nucleic acid (optionally contained in a vector) into the patient s cells in vivo and ex vivo For in vivo delivery the nucleic acid is injected directly into the patient usually at the sites where the PR0172, PR0175 PR0178, PR0188, PR0356 PR0179 PR0197 PRO I 98 PROl 82, PRO 195 PRO200 PR021 1 PR0217 PR0219 PR0221 PR0224 PR0228 PR0245 PR0246 PR0258 PR0261 PR0272, PRO301 , PR0322 PR0328, PR0331 , PR0364, PR0366 PR0535, PR0819 PR0826, PROl 160 PROl 186 or PROl 246 polypeptide is lequired, i e , the site of synthesis of the PRO 172 PRO 175 PRO 178 PR0188 PR0356 PR0179 PR0197 PR0198 PR0182 PR0195 PRO200 PR02 I 1 PR0217, PR0219 PR0221 , PR0224, PR0228 PR0245, PR0246, PR0258, PR0261 , PR0272 PRO301 PR0322, PR0328, PR0331 , PR0364, PR0366 PR0535 PROS 19, PR0826 PRO l 160 PROl 186 or PRO 1246 polypeptide if known, and the site (e g , wound) wheie biological activity ot PRO 172 PRO 175 PRO 178 PROl 88, PR0356 PRO 179, PRO 197, PRO 198 PR0182 PR019 PRO200 PR021 1 PR0217 PR0219 PR0221 PR0224 PR0228, PR0245, PR0246 PR0258 PR0261 PR0272 PRO301 PR0322 PR0328 PR03 1 PR0364 PR0366 PR0535 PR0819 PROS26 PRO ! 160 PROl 186 or PRO 1246 polypeptide is needed Foi ex \ ιvo treatment the patient s cells are removed the nucleic acid is lntioduced into these isolated cells and the modified cells ai e administered to the patient either directly or for example encapsulated within poi ous membi anes that ai e implanted into the patient (see, e ? , U S Pat Nos 4,892,538 and 5 283 187) There are a v nety ot techniques available for intioducing nucleic acids into viable cells The techniques vary depending upon whether the nucleic acid is transferred into cultured cells in vttio, or transfeπed in vivo in the cells of the intended host Techniques suitable for the transfer ot nucleic acid into mammalian cells m vitro include the use of liposomes, electroporation, microinjection, transduction, cell fusion, DEAE-dextran, the calcium phosphate precipitation method, etc Transduction involves the association of a replication-detective, recombinant viral (preferably retroviral) particle with a cellular receptor, followed by introduction of the nucleic acids contained by the particle into the cell A commonly used vector for ex vivo delivery of the gene is a retrovirus

The currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non-viral vectors (such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV)) and lipid based systems (useful hpids for hpid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Choi, see, e g , Tonk son et al , Cancer Investigation, 14(1 ) 54-65 (1996)) The most preferred vectors for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses A viral vector such as a retroviral vector includes at least one transcriptional promoter/enhancer or locus-defining element(s), or othei elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post translational modification of messenger In addition a viral vector such as a retroviral vector includes a nucleic acid molecule that, when transcribed in the presence of a gene encoding PR0172, PR0175 PR0178, PR0188, PR0356, PR0179, PRO 1^*97, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217 PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322 PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide, is operably linked thereto and acts as a translation initiation sequence Such vector constructs also include a packaging signal long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used (if these are not already present in the viral vector) In addition, such vector typically includes a signal sequence for secretion of the PRO 172, PRO 175, PRO 178, PRO 188 PR0356, PRO 179 PRO 197, PRO 198 PR0182, PR0195 PRO200, PR021 1 , PR0217, PR0219, PR0221 PR0224 PR0228 PR0245, PR0246 PR0258, PR0261 PR0272, PRO301 , PR0322, PR0328 PR0331 PR0364 PR0366 PR0535 PROS 19 PR0826 PRO 1 160, PRO 1 186 or PRO 1246 polypeptide from a host cell in which it is placed Preferably the signal sequence for this purpose is a mammalian signal sequence most pretei ably the native signal sequence for the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197 PR0198 PR0182 PR0195, PRO200 PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228 PR0245 PR0246 PR0258 PR0261 , PR0272 PRO301 PR0322, PR0328, PR0331 , PR0364 PR0366, PR0535 PROS 19 PR0826, PRO l 160, PRO l 186 or PRO 1246 polypeptide Optionally the vector construct may also include a signal that directs polyadenylation as well as one or more iestπction sites and a translation termination sequence By way ot example such vectoi s will typically include a 5 LTR a tRNA binding site, a packaging signal an origin of second strand DNA synthesis and a 3' LTR oι a portion theieof Other vectors can be used that are non v n al such as cationic hpids, polylysine and dendπmei s

In some situations it is desirable to provide the nucleic acid source with an agent that taigets the target cells such as an antibody specific tor a cell surface membrane protein oi the target cell a ligand tor a receptor on the target cell, etc Where liposomes are employed, proteins that bind to a cell surface membrane protein associated with endocytosis may be used for targeting and/or to facilitate uptake, e g , capsid proteins or fragments thereof tropic for a particular cell type, antibodies for proteins that undergo internalization in cycling, and proteins that target inti acellular localization and enhance intracellular half-life The technique of receptor-mediated endocytosis is described, for example, by Wu effl/ J Biol Chem , 262 4429-4432 ( 1987), and Wagner etal . Proc Natl Acad Sci USA, 87 3410 3414 ( 1990) For a review of the currently known gene marking and gene therapy protocols, see, Anderson et al , Science, 256 808 813 (1992) See also WO 93/25673 and the references cited therein

Suitable gene therapy and methods for making retroviral particles and structural proteins can be found in, e g , U S Pat No 5,681 ,746

vi Use of Gene as Diagnostic

This invention is also related to the use of the gene encoding the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide as a diagnostic Detection of a mutated form of the PRO 172, PRO 175, PRO 178, PROl 88, PR0356, PROl 79, PROl 97, PROl 98 PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide will allow a diagnosis ot a cardiovascular, endothehal, and angiogenic disease or a susceptibility to a cardiovascular, endothehal, and angiogenic disease, such as a tumor since mutations in the PRO 172, PRO 175 PR0178, PR0188, PR0356, PR0179 PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 PR0224, PR0228 PR0245, PR0246, PR0258 PR0261 , PR0272 PRO301 , PR0322 PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide may cause tumors

Individuals carrying mutations in the genes encoding a human PRO 172 PRO 175 PROl 78, PRO 188 PR0356, PRO 179, PRO 197, PRO 198, PRO 182, PRO 195 PRO200, PR021 1 , PR0217 PR0219, PR0221 PR0224, PR0228 PR0245, PR0246, PR0258, PR0261 PR0272 PRO301 PR0322 PR0328, PR0331 PR0364, PR0366, PR0535, PROS 19, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide may be detected at the DNA level by a vai lety ot techniques Nucleic acids for diagnosis may be obtained from a patient s cells such as from blood, urine, saliva, tissue biopsy and autopsy material The genomic DNA may be used directly tor detection or may be amplified enzymatically by using PCR (Saiki et al , Nature, 324 163- 166 (1986)) pnor to analysis RNA or cDNA may also be used tor the same purpose As an example PCR primers complementary to the nucleic acid encoding the PRO 172 PR0175, PR0178 PRO I SS, PR0356 PR0179 PRO 197, PRO 198 PR0182, PR0195 PRO200, PR021 1 , PR0217, PR0219 PR0221 , PR0224, PR0228 PR0245, PR0246 PR0258, PR0261 PR0272, PRO301 , PR0322, PR0328, PR03 1 PR0364 PR0366 PR0535, PR0819 PR0826, PROl 160 PRO l 186 or PRO 1246 polypeptide can be used to identity and analyze PRO 172, PRO 175 PR0178, PROI SS PR0356, PR0179, PR0197 PRO 198, PRO 182, PRO 195, PRO200 PR021 1 , PR0217 PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 PR0322, PR0328, PR0331 , PR0364 PR0366, PR0535, PR0819, PR0826, PR01 160, PRO l 186 or PRO 1246 polypeptide mutations For example, deletions and insertions can be detected by a change in size of the amplified product in compaiison to the normal genotype Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA encoding the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179 PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366 PR0535, PR0819, PR0826, PROl 160, PRO 1 186 or PROl 246 polypeptide, or alternatively, radiolabeled antisense DNA sequences encoding the PRO 172, PRO 175, PRO 178, PROl 88, PR0356, PRO 179, PRO 197, PROl 98, PROl 82, PROl 95, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO1 160, PROl 186 or PROl 246 polypeptide Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures

Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis DNA fragments of different sequences may be distinguished on denaturing formamidine gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures See, e g , Myers et al . Science, 230 1242 (1985) Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method, for example, Cotton et al , Proc Natl Acad Sci USA, 85 4397-4401 (1985)

Thus, the detection ot a specific DNA sequence may be achiev ed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, e i; restriction fragment length polymorphisms (RFLP), and Southern blotting of genomic DNA

vn Use to Detect PRO Polypeptide Levels In addition to more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by m situ analysis

Expression of nucleic acid encoding the PRO polypeptide may be linked lo v ascular disease oi neov ascularizdtion associated with tumor formation If the PRO polypeptide has a signal sequence and the mRNA is highly expressed in endothehal cells and to a lesser extent in smooth muscle cells this indicates that the PRO polypeptide is present in serum Accordingly, an anti-PRO polypeptide antibody could be used to diagnose vasculdi disease or neovdsculaπzdtion associated with tumor formation since an altered level of this PRO polypeptide ma\ be indicative of such disorders A competition assay may be employed wherein antibodies specific to the PRO polypeptide are attached to a solid support and the labeled PRO polypeptide and a sample derived from the host aie passed ov er the solid support and the amount ot label detected attached to the solid support can be correlated to a quantity ot the PRO polypeptide in the sample

viii Chromosome Mapping The sequences ot the present invention are also valuable for chromosome identification The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome Moreover, there is a current need for identifying particular sites on the chromosome Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 1 -25 bp) from the cDNA Computer analysis for the 3'- untranslated region is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome Using the present invention with the same oligonucleotide primers, sublocahzation can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes, and preselection by hybridization to construct chromosome- specific cDNA libraries

Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step This technique can be used with cDNA as short as 500 or 600 bases, however, clones larger than 2,000 bp have a highei likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection FISH requires use ot the clones from which the gene encoding the PR0172, PR0175, PR0178 PR0188, PR0356, PR0179 PR0197 PR0198 PR0182, PR0195 PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228 PR0245 PR0246 PR0258, PR0261 PR0272, PRO30 I , PR0322, PR0328, PR0331 PR0364 PR0366, PR0535 PROS I 9 PROS26 PRO l 160 PROl 186 or PROl 246 polypeptide was deπved, and the longer the bettei Foi example, 2 000 bp is good, 4,000 bp is bettei and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time For a review of this technique, see, Verma et al , Human Chromosomes a Manual of Basic Techniques (Pergamon Press New York, 1988)

Once a sequence has been mapped to a piecise chiomosomal location the physical position of the sequence on the chromosome can be con elated with genetic map data Such data are found tor example, in V McKusick Mendehan Inheritance in Man (available online through Johns Hopkins Univeisity Welch Medical Libiaiy) The relationship between genes and diseases that have been mapped to the same chiomosomal legion is then identified through linkage analysis (coinheπtance ot physically adjacent genes) Next it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals If a mutation is observed in some or all of the affected individuals but not in any normal individuals then the mutation is likely to be the causative agent of the disease

With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes (This assumes 1 megabase mapping resolution and one gene per 20 kb)

lx Screening Assays for Drug Candidates

This invention encompasses methods of screening compounds to identify those that mimic the PRO 172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219 PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322 PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826 PR01 160, PRO 1 186 or PRO 1246 polypeptide (agonists) or prevent the etfect of the PROl 72, PRO 175, PROl 78, PROl 88, PR0356, PRO 179 PRO 197, PRO 198, PRO 182, PRO 195 PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364 PR0366 PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 polypeptide (antagonists) Screening assays for antagonist drug candidates are designed to identify compounds that bind oi complex with the PRO 172, PRO 175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PROS26, PR01 160 PROl 186or PROl 246 polypeptide encoded by the genes identitied herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins Such screening assays will include assays amenable to high-throughput scieening of chemical libraries, making them particularly suitable toi identifying small molecule drug candidates

The assays can be performed in a variety of formats, including protein protein binding assays, biochemical screening assays, immunoassays and cell-based assays which aie well characterized in the art All assays for antagonists are common in that they call for contacting the diug candidate with a PR0172

PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR019S, PR0182, PR0195 PRO200 PR021 1 , PR02 I 7, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246 PR0258 PR0261 PR0272 PRO301 PR0322, PR0328, PR0 31 , PR0364, PR0366, PR0535, PROS 19 PR0S26 PRO 1 160, PRO 1 186 or PRO 1246 polypeptide encoded by a nucleic acid identified herein under conditions and foi a time sufficient to allow these two components to interact

In binding assays, the interaction is binding and the complex toi med can be isolated or detected in the reaction mixture In a particular embodiment, the PR0172, PR0175 PR0178 PRO I SS, PR0356 PR0179 PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217 PR0219 PR0221 PR0224 PR0228 PR0245 PR0246, PR0258, PR0261 , PR0272, PRO301 PR0322, PR032S, PR0331 , PR0364 PR0366 PR0535, PROS 19 PROS26, PR01 160, PROl 186 or PRO 1246 polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e q , on a mιcιotιteι plate, by covalent or non-covalent attachments Non covalent attachment generally is accomplished by coating the solid surface with a solution of the PROl 72, PRO 175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224 PR0228 PR0245, PR0246, PR0258 PR0261 , PR0272, PRO301 , PR0322, PR0328, PR03 1 , PR0364. PR0366, PR0535. PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide and drying Alternatively, an immobilized antibody, e g , a monoclonal antibody, specific for the PROl 72, PR0175, PR0178, PR0188, PR0356 PR0179. PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR02I 7, PR0219, PR0221 , PR0224. PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide to be immobilized can be used to anchor it to a solid surface The assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e g , the coated surface containing the anchored component When the reaction is complete, the non-reacted components are removed, e g , by washing, and complexes anchored on the solid surface are detected When the originally non- lmmobihzed component carries a detectable label the detection of label immobilized on the surface indicates that complexing occurred Where the originally non-immobilized component does not carry a label, complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex

If the candidate compound interacts with but does not bind to a particular PROl 72, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PROδ 19, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide encoded by a gene identified herein, its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions Such assays include traditional approaches, such as, e g , cross-linking, co- lmmunoprecipitation, and co-purification through gradients oi chromatographic columns In addition, protein- protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workei s (Fields and Song Nature (London), 340 245-246 ( 1989), Chien etal . Proc Natl Acad Sci USA, 88 9578-9582 (1991 )) as disclosed by Cheviay and Nathans, Proc Natl Acad Sci USA 89 5789-5793 ( 1991 ) Many transcriptional activatois, such as yeast GAL4 consist ot two physically discrete modular domains, one acting as the DNA-binding domain, the other one functioning as the transcription-activation domain The yeast expression system described in the foregoing publications (generally referred to as the two-hybrid system' ) takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another in which candidate activating pioteins aie fused to the activation domain The expiession of a GAL1 -lacZ reporter gene under control ot a GAL4-actιvated promoter depends on reconstitution of GAL4 activity via protein-protein interaction Colonies containing interacting polypeptides are detected with a chromogenic substrate foi β-galactosidase A complete kit (MATCHMAKER™) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech This system can also be extended to map protein domains inv olved in specific protein mtei actions as well as to pinpoint amino acid lesidues that aie crucial tor these interactions

Compounds that interfere with the interaction of a gene encoding a PRO 172, PRO 175, PRO 178 PRO 188 PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535 PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide identified herein and other intra- or extiacellular components can be tested as follows usually a leaction mixture is prepared containing the product of the gene and the intia- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products To test the ability of a candidate compound to inhibit binding the reaction is run in the absence and in the presence of the test compound In addition, a placebo may be added to a third reaction mixture, to serve as positive control The binding (complex formation) between the test compound and the intra or extracellular component present in the mixture is monitored as described hereinabove The formation of a complex in the control reactιon(s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner

If the PRO polypeptide has the ability to stimulate the proliferation of endothehal cells in the presence of the co-mitogen ConA, then one example of a screening method takes advantage of this ability Specifically, in the proliferation assay, human umbilical vein endothehal cells are obtained and cultured in 96 well flat bottomed culture plates (Costar, Cambridge, MA) and supplemented with a reaction mixture appropriate for facilitating proliferation of the cells, the mixture containing Con-A (Calbiochem, La Jolla, CA) Con A and the compound to be screened are added and after incubation at 37°C, cultures are pulsed with ^λ H-thymidine and harvested onto glass fiber filters (phD, Cambridge Technology, Watertown, MA) Mean ^λ H- thymidine incorporation (cpm) ot triplicate cultures is determined using a liquid scintillation counter (Beckman Instruments, Irvine CA) Significant ^ (H) thymidine incorporation indicates stimulation of endothehal cell proliferation

To assay for antagonists, the assay described above is performed, however, in this assay the PRO polypeptide is added along with the compound to be screened and the ability of the compound to inhibit (H)thymιdιne incorporation in the presence of the PRO polypeptide indicates that the compound is an antagonist to the PRO polypeptide Alternatively, antagonists may be detected by combining the PRO polypeptide and a potential antagonist with membrane-bound PRO polypeptide receptors or recombinant receptors under appropriate conditions for a competitive inhibition assay The PRO polypeptide can be labeled such as by radιoactιvιt\ such that the number of PRO polypeptide molecules bound to the receptoi can be used to determine the effectiv eness of the potential antagonist The gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting Cohgan et al , Current Protocols in Immun , 1 (2) Chapter 5 ( 1991 ) Preferably, expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the PRO polypeptide and a cDNA library, cieated from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the PRO polypeptide Transfected cells that aie grown on glass slides are exposed to the labeled PRO polypeptide The PRO polypeptide can be labeled bv a variety of means including lodination or inclusion of a recognition site for a site specific protein kinase Follo ing fixation and incubation, the slides are subjected to autoradiographic analysis Positive pools are identified and sub-pools are prepaied and re-transfected using an interactive sub pooling and re scieening process eventually y ielding a single clone that encodes the putativ e receptor As an alternative approach foi receptor identification, the labeled PRO polypeptide can be photoaffimty- hnked with cell membrane or extract preparations that express the receptor molecule Cross-linked material is resolved by PAGE and exposed to X-ray film The labeled complex containing the receptor can be excised resolved into peptide fragments, and subjected to protein micro-sequencing The am o acid sequence obtained from micro-sequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor

In another assay for antagonists, mammalian cells or a membrane preparation expressing the receptor would be incubated with the labeled PRO polypeptide in the presence of the candidate compound The ability of the compound to enhance or block this interaction could then be measured The compositions useful in the treatment of cardiovascular, endothehal, and angiogenic disorders include without limitation, antibodies, small organic and inorganic molecules, peptides, phosphopeptides, antisense and πbozyme molecules, tπple-hehx molecules, etc , that inhibit the expression and/or activity of the target gene product

More specific examples of potential antagonists include an oligonucleotide that binds to the fusions of immunoglobulin with a PRO polypeptide, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments Alternatively, a potential antagonist may be a closely related protein, for example, a mutated form of the PRO polypeptide that recognizes the receptor but imparts no effect, thereby competitively inhibiting the action of the PRO polypeptide

Another potential PRO polypeptide antagonist or agonist is an antisense RNA or DNA construct prepared using antisense technology where, e g , an antisense RNA or DNA molecule acts to block directly the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation Antisense technology can be used to control gene expression through tπple-hehx formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA For example the 5 coding portion of the polynucleotide sequence, which encodes the mature PRO polypeptides herein, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al , Nucl Acids Res , 6 3073 ( 1979), Cooney et al , Science. 241 456 ( 1988), Dervan et al , Science, 251 1360 ( 1991 )), thereby preventing transcription and the production of the PRO polypeptide The antisense RNA oligonucleotide hybi idizes to the mRNA in \ ivo and blocks translation of the mRNA molecule into the PRO polypeptide (antisense - Okano, Neurochem , 56 560 (1991 ), Ohgodeoxynucleotides as Antisense Inhibitoi s of Gene Expression (CRC Press Boca Raton, FL, 1988) The oligonucleotides described above can also be dehvei ed to cells such that the antisense RNA oi DNA may be expressed in \ n o to inhibit pioduction ot the PRO polypeptide When antisense DNA is used oligodeoxyribonucleotides derived from the tianslation-initiation site, e t> , between about - 10 and +10 positions ot the target gene nucleotide sequence, are preteπed

Antisense RNA or DNA molecules aie generally at least about 5 bases in length, about 10 bases in length, about 15 bases in length, about 20 bases in length, about 25 bases in length, about 30 bases in length, about 35 bases in length, about 40 bases in length, about 45 bases in length, about 50 bases in length, about 55 bases in length, about 60 bases in length, about 65 bases in length, about 70 bases in length, about 75 bases in length, about 80 bases in length, about 85 bases in length, about 90 bases in length, about 95 bases in length, about 100 bases in length, or more

Potential antagonists include small molecules that bind to the active site, the receptor binding site, or growth factor or other relevant binding site of the PRO polypeptide, thereby blocking the normal biological activity of the PRO polypeptide Examples of small molecules include, but are not limited to, small peptides or peptide-hke molecules, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage Specific πbozyme cleavage sites within a potential RNA target can be identified by known techniques For further details see, e g , Rossi, Current Biology, 4 469-471 (1994), and PCT publication No WO 97/33551 (published September 18. 1997) Nucleic acid molecules in tπple-hehx formation used to inhibit transcription should be single-stranded and composed of deoxynucleotides The base composition of these oligonucleotides is designed such that it promotes tπple-hehx formation via Hoogsteen base-pairing rules, which generally requne sizeable stretches of purines oi pyπmidines on one strand of a duplex For further details see, e g , PCT publication No WO 97/33551 , supia

These small molecules can be identified by any one or more of the screening assays discussed hereinabove and/or by any other screening techniques well known for those skilled in the art

x Types of Cardiovascular, Endothehal, and Angiogenic Disorders to be Tieated

The PRO polypeptides, or agonists or antagonists thereto, that have activity in the cardiovascular, angiogenic and endothehal assays described herein, and/or whose gene product has been found to be localized to the cardiovascular system, are likely to have therapeutic uses in a variety of cardiovascular endothehal, and angiogenic disordeis, including systemic disorders that affect vessels, such as diabetes melhtus Their therapeutic utility could include diseases of the arteries, capillaries, veins, and/or lymphatics Examples ot treatments hereunder include treating muscle wasting disease, treating osteoporosis, aiding in implant fixation to stimulate the growth of cells around the implant and therefore facilitate its attachment to its intended site, increasing IGF stability in tissues oi in serum, it applicable, and increasing binding to the IGF receptor (since IGF has been shown //; \ ιtιo to enhance human marrow erythroid and granulocytic progenitor cell growth)

The PRO polypeptides or agonists or antagonists thereto may also be employed to stimulate erythropoiesis or gianulopoiesis, to stimulate wound healing oi tissue regeneration and associated therapies concerned with re growth of tissue, such as connective tissue, skin, bone, cartilage, muscle, lung or kidney, to promote angiogenesis to stimulate or inhibit migration of endothehal cells, and to piohferate the growth ot vasculai smooth muscle and endothehal cell production The increase in angiogenesis mediated by the PRO polypeptide or antagonist would be beneficial to lschemic tissues and to collateral coronary development in the heart subsequent to coronary stenosis Antagonists are used to inhibit the action ot such polypeptides, for example, to limit the production ot excess connective tissue during wound healing or pulmonary fibrosis if the PRO polypeptide promotes such production This would include tieatment ot acute myocardial infarction and heart failure

Moreover, the present invention concerns the treatment of cardiac hypertrophy, regardless of the underlying cause, by administering a therapeutically effective dose of the PRO polypeptide, or agonist or antagonist thereto If the objective is the treatment of human patients, the PRO polypeptide preferably is recombinant human PRO polypeptide (rhPRO polypeptide) The tieatment for cardiac hypertrophy can be performed at any of its various stages, which may result from a variety of diverse pathologic conditions, including myocardial infarction, hypertension, hypertrophic cardiomyopathy and valvular regurgitation The treatment extends to all stages of the progression of cardiac hypertrophy, with or without structural damage of the heart muscle, regardless of the underlying cardiac disorder

The decision of whether to use the molecule itself or an agonist thereof for any particular indication, as opposed to an antagonist to the molecule, would depend mainly on whether the molecule herein promotes cardiovasculaπzation, genesis of endothehal cells, or angiogenesis or inhibits these conditions For example, if the molecule promotes angiogenesis, an antagonist thereof would be useful for treatment of disorders where it is desired to limit or prevent angiogenesis Examples of such disorders include vascular tumors such as haemangioma, tumor angiogenesis, neov asculaπzation in the retina, choroid, or cornea, associated with diabetic retinopathy or premature infant retinopathy or macular degeneration and prohferative vitreoretinopathy. rheumatoid arthritis, Crohn's disease, atherosclerosis, ovarian hyperstimulation, psoriasis, endometπosis associated with neovasculaπzation, restenosis subsequent to balloon angioplasty, scar tissue overproduction for example, that seen in a keloid that forms after surgery, fibrosis after myocardial infarction, or fibrotic lesions associated with pulmonary fibrosis

If, however the molecule inhibits angiogenesis, it would be expected to be used directly for treatment of the above conditions

On the other hand, if the molecule stimulates angiogenesis it would be used itself (or an agonist thereof) tor indications where angiogenesis is desired such as peripheral vasculai disease, hypertension inflammatory vascuhtides, Reynaud's disease and Reynaud's phenomenon aneurysms, arterial iestenosis, thrombophlebitis, lymphangitis, lymphedema, wound healing and tissue lepair, ischemia reperfusion injury angina, myocardial infarctions such as acute myocardial infarctions, chronic heart conditions, heart failure such as congestive heart failure, and osteoporosis If, however the molecule inhibits angiogenesis an antagonist thereof would be used for treatment of those conditions where angiogenesis is desired

Specific types of diseases are described below, where the PRO polypeptide herein or antagonists thereof may serve as useful tor vascular related drug targeting oi as therapeutic taigets toi the treatment or prevention ot the disordei s Atherosclerosis is a disease characterized by accumulation of plaques of lntimal thickening in arteries due to accumulation of hpids, proliteiation of smooth muscle cells and toinidtion of fibrous tissue within the arterial wall The disease can affect large, medium, and small artenes in any organ Changes in endothehal and vasculai smooth muscle cell function are known to play an important role in modulating the accumulation and regression of these plaques

Hypertension is characterized by raised vascular pressure in the systemic arterial, pulmonary arterial, or portal venous systems Elevated pressure may result from or result in impaired endothehal function and/or vascular disease Inflammatory vascuhtides include giant cell arteπtis, Takayasu's arteπtis, polyarteπtis nodosa (including the microangiopathic form), Kawasaki's disease, microscopic polyangutis, Wegener's granulomatosis and a variety of infectious-related vascular disorders (including Henoch Schonlein prupura) Altered endothehal cell function has been shown to be important in these diseases

Reynaud's disease and Reynaud's phenomenon are characterized by intermittent abnormal impairment of the circulation through the extremities on exposure to cold Altered endothehal cell function has been shown to be important in this disease

Aneurysms are saccular or fusiform dilatations of the arterial oi venous tree that are associated with altered endothehal cell and/or vascular smooth muscle cells

Arterial restenosis (restenosis of the arterial wall) may occur following angioplasty as a result of alteration in the function and proliferation of endothehal and vascular smooth muscle cells

Thrombophlebitis and lymphangitis are inflammatory disordei s of veins and lymphatics respectively , that may result from, and/or in, altered endothehal cell function Similarly, lymphedema is a condition involving impaired lymphatic vessels resulting from endothehal cell function

The family of benign and malignant vascular tumors are characterized by abnormal proliferation and growth of cellulai elements of the vascular system For example, lymphangiomas are benign tumors of the lymphatic system that are congenital, often cystic, malformations of the lymphatics that usually occur in newborns Cystic tumors tend to grow into the adjacent tissue Cystic tumors usually occur in the cervical and axillary region They can also occur in the soft tissue of the extremities The main symptoms are dilated, sometimes reticular structured lymphatics and lymphocysts surrounded by connective tissue Lymphangiomas are assumed to be caused by improperly connected embryonic lymphatics or their deficiency The result is impaired local lymph drainage Gπener et al , Lvmphology 4 140-144 (1971)

Another use for the PRO polypeptides herein or antagonists thereto is in the prevention ot tumor angiogenesis which involves vasculaπzation of a tumor to enable it to growth and/or metastasize This piocess is dependent on the growth of new blood vessels Examples of neoplasms and related conditions that in volv e tumor angiogenesis include breast carcinomas, lung carcinomas, gastric carcinomas, esophageal carcinomas, coloiectal carcinomas hv ei carcinomas, ovarian carcinomas, thecomas, ai rhenoblastomas, cervical carcinomas, endometπal carcinoma endometπal hypeiplasia, endometπosis fibrosarcomas choiiocdrcinoma head and neck cancer nasopharyngeal cdrcinoma, laryngeal carcinomas, hepatoblastoma, Kaposi s saicoma meldnotru skin caicinomas hemangioma cavernous hemangioma, hemangioblastoma, pancreas carcinomas retinobldstoma, astiocvtoma, ghoblastoma Schw annoma, o godendroglioma, medulloblastoma neuroblastomas i habdomyosarcoma osteogemc saicoma leiomyosarcomds, urinary tract carcinomas, thyroid carcinomas, Wilm s tumor, rendl cell caicinoma prostate carcinoma, abnormal vascular proliferation associated w ith phakomatoses, edema (such as that associated with bi am tumors), and Meigs syndiome

Age-related macular degeneration (AMD) is a leading cause of severe visual loss in the elderly population The exudative form of AMD is characterized by choroidal neovasculaπzation and retinal pigment epithelial cell detachment Because choroidal neovasculaπzation is associated with a dramatic worsening in prognosis, the PRO polypeptide or antagonist thereto is expected to be useful in reducing the severity of AMD

Healing of trauma such as wound healing and tissue repair is also a targeted use for the PRO polypeptides herein or their antagonists Formation and regression of new blood vessels is essential for tissue healing and repau This category includes bone, cartilage, tendon, ligament, and/or nerve tissue growth or regeneration, as well as wound healing and tissue repair and replacement, and in the treatment of burns, incisions and ulcers A PRO polypeptide or antagonist thereof that induces cartilage and/or bone growth in circumstances where bone is not normally formed has application in the healing of bone fractures and cartilage damage or detects in humans and other animals Such a preparation employing a PRO polypeptide or antagonist thereof may have prophylactic use in closed as well as open fracture reduction and also in the improved fixation of artificial joints De novo bone formation induced by an osteogenic agent contributes to the repair of congenital trauma-induced, or oncologic resection induced cramofacial defects, and also is useful in cosmetic plastic surgery

PRO polypeptides or antagonists thereto may also be useful to promote better or faster closure of non healing wounds, including without limitation pressure ulcers, ulcers associated with vascular insufficiency, surgical and traumatic wounds, and the like

It is expected that a PRO polypeptide or antagonist thereto may also exhibit activ ity for generation or regeneration of other tissues, such as organs (including, for example, pancreas liver intestine, kidney, skin, or endothehum), muscle (smooth, skeletal, or cardiac), and vascular (including vascular endothehum) tissue or for promoting the growth of cells compπsing such tissues Part of the desired effects mav be by inhibition oi modulation of fibrotic scarring to allow normal tissue to regenerate

A PRO polypeptide herein or antagonist thereto may also be useful for gut protection or regeneration and treatment of lung or liver fibrosis reperfusion injury in various tissues and conditions resulting from systemic cytokine damage Also, the PRO polypeptide or antagonist thereto may be useful toi piomot g or inhibiting differentiation of tissues described above from precursor tissues or cells, oi toi inhibiting the growth of tissues described above

A PRO polypeptide or antagonist thereto may also be used in the treatment ot peπodontal diseases and in other tooth-repair processes Such agents may provide an environment to attract bone forming cells, stimulate growth of bone-forming cells or induce differentiation ot progenitors of bone forming cells A PRO polypeptide herein or an antagonist thereto may also be useful in the treatment of osteoporosis or osteoarthntis such as through stimulation ot bone and/oi cartilage repair or by blocking inflammation oi piocesses ot tissue destruction (collagenase activity, osteoclast activity, etc ) mediated by inflammatory processes since blood vessels play an important iole in the iegulation of bone turnover and growth

Anothei category of tissue regeneration activity that may be attributable to the PRO polypeptide herein or antagonist thereto is tendon/ligament formation A protein that induces tendon/ligament like tissue oi other tissue formation in circumstances where such tissue is not normally formed has application in the healing of tendon or ligament tears, deformities, and other tendon or ligament defects in humans and other animals Such a preparation may have prophylactic use in preventing damage to tendon or ligament tissue, as well as use in the improved fixation of tendon or ligament to bone or other tissues, and in repairing defects to tendon or ligament tissue De novo tendon/ligament-hke tissue formation induced by a composition of the PRO polypeptide herein or antagonist thereto contributes to the repair of congenital, trauma-induced, or other tendon or ligament defects of other origin, and is also useful in cosmetic plastic surgery for attachment or repair of tendons or ligaments The compositions herein may provide an environment to attract tendon- or ligament-forming cells, stimulate growth of tendon- or ligament-forming cells, induce differentiation of progenitors of tendon- or ligament-forming cells, or induce growth of tendon/ligament cells or progenitors ex vivo for return in vivo to effect tissue repair The compositions herein may also be useful in the treatment of tendinitis, carpal tunnel syndrome, and other tendon or ligament defects The compositions may also include an appropriate matrix and/or sequestering agent as a carrier as is well known in the art

The PRO polypeptide or its antagonist may also be useful for proliferation of neural cells and for regeneration of nerve and brain tissue, i e , for the treatment of central and peripheral nervous system disease and neuropathies, as well as mechanical and traumatic disorders, that involve degeneration, death, or trauma to neural cells or nerve tissue More specifically, a PRO polypeptide or its antagonist may be used in the treatment of diseases of the peripheral nervous system, such as peripheral nerve injuries, peripheral neuropathy and localized neuropathies, and central nervous system diseases, such as Alzheimer's, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome Further conditions that may be treated in accordance with the present invention include mechanical and traumatic disorders, such as spinal cord disorders, head trauma, and cerebrovascular diseases such as stroke Peripheral neuropathies resulting from chemotherapy or other medical therapies may also be treatable using a PRO polypeptide herein or antagonist thereto

Ischemia-reperfusion injury is another indication Endothehal cell dysfunction may be important in both the initiation ot, and in regulation of the sequelae of events that occur following lschemia-reperf usion injury

Rheumatoid arthritis is a further indication Blood vessel growth and targeting ot inflammatory cells through the vasculature is an important component in the pathogenesis of rheumatoid and sero-negative forms of arthritis

A PRO polypeptide or its antagonist may also be administered piophylactically to patients with cardiac hypertrophy, to prevent the progression of the condition, and avoid sudden death, including death of asymptomatic patients Such preventative therapy is particularly warranted in the case ot patients diagnosed with massive left ventricular cardiac hypertrophy (a maximal wall thickness of 35 mm or more in adults, or a comparable value in children), or in instances when the hemodynamic burden on the heart is particularly strong

A PRO polypeptide or its antagonist may also be useful in the management of atnal fibrillation, which develops in a substantial portion ot patients diagnosed with hypertrophic cardiomyopathy Further indications include angina, myocardial infarctions such as acute myocardial intaictions, and heart failuie such as congestive heart failuie Additional non-neoplastic conditions include psoriasis, diabetic and othei prohferative retinopathies including retinopathy ot prematurity. letrolentdl fibroplasia neovasculai glaucoma. thyroid hyperplasias (including Grave s disease) corneal and other tissue transplantation, chronic inflammation lung inflammation, nephrotic syndrome preeclampsia, ascites, pencardial effusion (such as that associated with pericarditis), and pleural effusion

In view of the above, the PRO polypeptides or agonists 01 antagonists thereof described herein, which are shown to alter or impact endothehal cell function, proliferation, and/or form, are likely to play an important role in the etiology and pathogenesis of many or all of the disorders noted above and as such can serve as therapeutic targets to augment or inhibit these processes or for vascular related drug targeting in these disorders

xi Administration Protocols. Schedules. Doses, and Formulations

The molecules herein and agonists and antagonists thereto aie pharmaceutically useful as a prophylactic and therapeutic agent for various disorders and diseases as set forth above

Therapeutic compositions of the PRO polypeptides or agonists or antagonists are prepared for storage by mixing the desired molecule having the appropriate degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences, 16th edition, Osol A ed (1980)), in the form of lyophihzed formulations or aqueous solutions Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate citrate, and other organic acids, antioxidants including ascorbic acid and methionine, preservatives (such as octadecyldimethylbenzyl ammonium chloride, hexamethonium chloride, benzalko um chloride, benzetho um chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcmol, cyclohexanol, 3 pentanol, and m cresol), low molecular weight (less than about 10 residues) polypeptides, proteins, such as serum albumin gelatin, or immunoglobulins, hydrophilic polymers such as polyvinylpyrrohdone, amino acids such as glycine glutamine, asparagine, histidine, arginine, or lysine monosacchaπdes disacchaπdes, and other carbohydrates including glucose, mannose, ordextπns, chelating agents such as EDTA, sugars such as sucrose, mannitol trehalose or sorbitol, salt forming counter ions such as sodium, metal complexes (<? g Zn protein complexes), and/or non ionic surfactants such as TWEEN™ PLURONICS™ or polyeth lene glycol (PEG) Additional examples of such carπei s include ion exchangers alumina aluminum stearateJecithin serum proteins such as human serum albumin buffer substances such as phosphates, glycine, sorbic acid, potassium soi bate, partial glyceπde mixtures of saturated vegetable fatty acids water, salts, oi electrolytes such as protamme sulfate, disodium hydrogen phosphate potassium hydrogen phosphate sodium chloride, zinc salts, colloidal silica magnesium tπsilicate, polyvinyl pyrrohdone cellulose-based substances and polyethylene glycol Carriers toi topical or gel-based forms of antagonist include polysacchaπdes such as sodium carboxymethylcellulose oi methylcellulose polyvinylpyrrohdone polyacrylates polvoxyethylene polyoxypiopylene block polymei s polyethylene glycol and wood wax alcohols For all administi αtions conventional depot forms are suitably used Such forms include tor example microcapsules nano capsules liposomes plasters inhalation forms, nose spray s sublingual tablets and sustained release preparations The PRO polypeptides oi agonists oi antagonists w ill typically be formulated in such vehicles at a concentration of about 0 1 mg/ml to 100 mg/ml

Another formulation comprises incorporating a PRO polypeptide or antagonist thereoi into formed articles Such articles can be used in modulating endothehal cell growth and angiogenesis In addition tumor invasion and metastasis may be modulated with these articles

PRO polypeptide or antagonist to be used for in o administration must be sterile This is readily accomplished by filtration through sterile filtration membranes, prior to or following lyophihzation and reconstitution PRO polypeptide ordinarily will be stored in lyophilized form or in solution if administered systemically It in lyophilized form, PRO polypeptide or antagonist thereto is typically formulated in combination with other ingredients for reconstitution with an appropriate diluent at the time for use An example of a liquid formulation of PRO polypeptide or antagonist is a sterile, clear, colorless unpreserved solution filled in a single dose vial for subcutaneous injection Preserved pharmaceutical compositions suitable for repeated use may contain, for example, depending mainly on the indication and type of polypeptide a) PRO polypeptide or agonist or antagonist thereto, b) a buffer capable of maintaining the pH in a range of maximum stability of the polypeptide or othei molecule in solution, preferably about 4 8, c) a detergent surfactant primarily to stabilize the polypeptide or molecule against agitation induced aggregation, d) an isotonifier, e) a preservative selected from the group of phenol, benzyl alcohol and a benzethomum halide, e g , chloride and f) water If the detergent employed is non-ionic, it may , for example, be polysorbates (e g POLYSORBATE^{1 M}

(TWEEN™) 20, 80, etc ) or poloxamers (e g , POLOXAMER™ 188) The use ot non ionic suitactants permits the formulation to be exposed to sheai surface stresses without causing denaturation of the polypeptide Furthei such surfactant-containing formulations may be employed in aerosol devices such as those used in a pulmonary dosing, and needleless jet injector guns (see, e g , EP 257,956) An isotonifier may be present to ensure isotonicity of a liquid composition of the PRO polypeptide or antagonist thereto, and includes polyhydπc sugar alcohols, preferably tπhydπc or higher sugai alcohols such as glycerin erythπtol, arabitol, xyhtol, sorbitol, and mannitol These sugar alcohols can be used alone or in combination Alternatively, sodium chloride oi other appropriate inorganic salts may be used to render the solutions isotonic The buffer may, for example, be an acetate, citrate, succinate oi phosphate butfei depending on the pH desired The pH of one type of liquid formulation ot this invention is buttered in the lange of about 4 to 8 preferably about physiological pH

The pieservatives phenol, benzyl alcohol and benzethomum halides, e c , chloride aie know n antimicrobial agents that may be employed Therapeutic PRO polypeptide compositions geneially aie placed into a container having a sterile access port tor example an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle The formulations are pi eferably administered as repeated intiavenous d v ), subcutaneous (s c ) oi intramusculdi (l m ) injections, or as aerosol formulations suitable for intranasal or mtrapulmonary dehv ery (for intrapulmonai y deli vei y see, e g , ΕP 257,956)

PRO polypeptide can also be administered in the form ot sustained-released preparations Suitable examples of sustained release preparations include semipermeable matrices of solid hydrophobic polymers containing the protein, which matrices are in the form of shaped articles, e g , films, or microcapsules Examples of sustained release matrices include polyesters, hydrogels (e g , poly(2 hydroxyethyl-methacrylate) as described by Langer et al , J Biomed Mater Res . J_ 167-277 ( 1981 ) and Langer, Chem Tech , 12 98- 105 ( 1982) or poly(vιnylalcohol)), polylactides (U S Patent No 3 773,919, EP 58,481 ), copolymers ofL glutamic acid and gamma ethyl-L-glutamate (Sidman et al , Biopolymers. 22 547-556 (1983)), non-degradable ethylene- vinyl acetate (Langer et al , supra), degradable lactic acid-glycohc acid copolymers such as the Lupron Depot™ (mjectable microspheres composed of lactic acid-glycohc acid copolymei and leuprohde acetate), and po!y-D ( ) 3 hydroxybutyπc acid (EP 133,988)

While polymers such as ethylene-vinyl acetate and lactic acid-glycohc acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods When encapsulated proteins remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37 °C, resulting in a loss of biological activity and possible changes in immunogemcity Rational stiategies can be devised for protein stabilization depending on the mechanism involved For example, if the aggregation mechanism is discovered to be lntermolecular S S bond formation through thio disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophihzing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions Sustained release PRO polypeptide compositions also include hposomally entrapped PRO polypeptides

Liposomes containing the PRO polypeptide are prepared by methods known pet se DE 3,218, 121 , Epstein et al , Proc Natl Acdd Sci USA. 82 3688 3692 (1985), Hwang et al Proc Natl Acad Sci USA, 77 4030-4034 (1980), EP 52,322 EP 36,676 EP 88 046, EP 143,949, EP 142,641 Japanese patent application 83 1 18008, U S Patent Nos 4,485,045 and 4,544 545, and EP 102,324 Ordinarily the liposomes are ot the small (about 200 800 Angstroms) unilamellar type in which the lipid content is greatei than about 30 mol % cholesterol the selected proportion being adjusted for the optimal therapy

The therapeutically effective dose of PRO polypeptide or antagonist thereto will of course vary depending on such factors as the pathological condition to be treated (including prevention) the method ot administration the type of compound being used tor treatment, any co therapy involved, the patient s age, weight, general medical condition, medical history etc and its determination is well within the skill ofapiacticing phv sician Accordingly it will be necessaiy for the therapist to titer the dosage and modify the route of ad inistiation as lequired to obtain the maximal therapeutic effect If the PRO polypeptide has a nan ow host range foi the treatment of human patients formulations comprising human PRO polypeptide more prefeiably native-sequence human PRO polypeptide ai e preferred The clinician will administei PRO polypeptide until a dosage is reached that achiev es the desired effect for treatment of the condition in question For example if the objective is the treatment of CHF the amount would be one that inhibits the progressive cardiac hypertrophy associated with this condition The pi ogress of this therapy is easily monitored by echo caidiography Similaily , in patients with hypertiophic cardiomyopathy , PRO polypeptide can be administered on an empirical basis

With the above guidelines, the effective dose generally is within the range of fiom about 0 001 to about 1 0 mg/kg, more preferably about 0 01 1 0 mg/kg, most preferably about 0 01 -0 1 mg/kg

For non-oral use in treating human adult hypertension, it is advantageous to administer PRO polypeptide in the form of an injection at about 0 01 to 50 mg, preferably about 0 05 to 20 mg most preferably 1 to 20 mg, per kg body weight, 1 to 3 times daily by intravenous injection For oral administration, a molecule based on the PRO polypeptide is preferably administered at about 5 mg to 1 g, preferably about 10 to 100 mg, per kg body weight, 1 to 3 times daily It should be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less than 0 5 ng/mg protein Moreover, for human administration, the formulations preferably meet sterility, pyrogenicity, general safety, and purity as required by FDA Office and Biologies standards

The dosage regimen of a pharmaceutical composition containing PRO polypeptide to be used in tissue regeneration will be determined by the attending physician considering various factors that modify the action of the polypeptides, e g , amount of tissue weight desired to be formed, the site of damage, the condition of the damaged tissue, the size of a wound, type of damaged tissue (e g , bone), the patient s age, sex, and diet, the severity of any infection, time of administration, and other clinical factors The dosage may vary with the type of matrix used in the reconstitution and with inclusion of othei proteins in the pharmaceutical composition For example, the addition of other known growth factors, such as IGF-I, to the final composition may also affect the dosage Progress can be monitored by periodic assessment of tissue/bone growth and/or repair, for example, X-rays, histomorphometπc determinations, and tetracychne labeling The route of PRO polypeptide or antagonist or agonist administration is in accord with known methods, e g , by injection oi infusion by intravenous, intramuscular, intracerebral, intraperitoneal, intracerobrospinal, subcutaneous, intraocular, intraarticular, intrasynovial, intrathecal oral, topical or inhalation routes, or by sustained-release systems as noted below The PRO polypeptide or antagonists theieof also are suitably administered by intratumoral, peπtumoral intralesional, or peπlesional routes, to exert local as well as systemic therapeutic effects The intraperitoneal route is expected to be particularly useful toi example, in the treatment ot ovarian tumors

If a peptide or small molecule is employed as an antagonist oi agonist it is preferably admmisteied orally or non-orally in the form of a liquid or solid to mammals

Examples of pharmacologically acceptable salts of molecules that form salts and are useful hereunder include alkali metal salts (e g , sodium salt potassium salt), alkaline earth metal salts (e ι> calcium salt magnesium salt) ammonium salts, organic base salts (e g , pyridine salt, tiiethylamine salt), inoiganic acid salts (e g , hydrochloride, sulfate, nitrate), and salts ot organic acid (e g , acetate, oxalate, p-toluenesulfonate)

For compositions herein that aie useful foi bone, cartilage, tendon oi ligament regeneration, the therapeutic method includes administering the composition topically, systemically, or locally as an implant or device When administered, the therapeutic composition for use is in a pyiogen-fiee, physiologically acceptable form Furthei , the composition may desirably be encapsulated or injected in a viscous form toi delivery to the site of bone, cartilage, or tissue damage Topical administration may be suitable foi wound healing and tissue I epair Preferably , for bone and/or cartilage formation, the composition would include a matrix capable of delivering the protein- containmg composition to the site of bone and/or cartilage damage, providing a structure for the developing bone and cartilage and preferably capable of being resorbed into the body Such matrices may be formed of materials presently in use for other implanted medical applications The choice of matrix material is based on biocompatibihty, biodegradabihty, mechanical properties, cosmetic appearance, and interface properties The particular application ot the compositions will define the appropriate formulation Potential matrices for the compositions may be biodegradable and chemically defined calcium sulfate, tπcalcium phosphate, hydroxyapatite, polylactic acid, polyglycohc acid, and polyanhydπdes Other potential materials are biodegradable and biologically well-defined, such as bone or dermal collagen Further matrices are comprised of pure proteins or extracellular matrix components Other potential matrices are nonbiodegradable and chemically defined, such as sintered hydroxyapatite, bioglass, aluminates, or other ceramics Matrices may be comprised of combinations of any ot the above-mentioned types of material, such as polylactic acid and hydroxyapatite or collagen and tπcalcium phosphate The bioceramics may be altered in composition, such as in calcium-aluminate-phosphate and processing to alter pore size, particle size, particle shape, and biodegradabihty One specific embodiment is a 50 50 (mole weight) copolymei of lactic acid and glycohc acid in the form of porous particles having diameters iangmg from 150 to 800 microns In some applications, it will be usetul to utilize a sequestering agent, such as carboxymethyi cellulose or autologous blood clot, to prevent the polypeptide compositions from disassociating from the matrix

One suitable family of sequestering agents is cellulosic materials such as alkylcelluloses (including hydroxyalkylcelluloses), includingmethylcellulose, ethylcellulose. hydoxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose and carboxymethylcellulose, one preferred being cationic salts of carboxymethylcellulose (CMC) Other preferred sequesteπng agents include hyaluro c acid, sodium alginate, poly(ethylene glycol), polyoxyethylene oxide, carboxyvinyl polymei . and poly( vinyl alcohol) The amount of sequestering agent useful herein is 0 5-20 wt%, preferably 1 - 10 wt%, based on total formulation weight, which represents the amount necessary to prevent desorption of the polypeptide (or its antagonist) from the polymer matrix and to provide appropriate handling of the composition, yet not so much that the progenitor cells are prevented f i om infiltrating the matrix, thereby providing the polypeptide (or its antagonist) the opportunity to assist the osteogenic activity of the progenitor cells

xu Combination Therapies The effectiveness of the PRO 172, PROl 75, PRO 178 PRO 188, PR0356, PROl 79, PRO 197, PRO 198

PRO 182, PRO 195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246 PR0258, PR0261. PR0272, PRO301 , PR0322. PR0328, PR033 I , PR0364, PR0366, PR0535. PROS 19 PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide or an agonist or antagonist thei eof in preventing or treating the disorder in question may be improved by administering the activ e agent seπally oi in combination with anothei agent that is effective for those purposes, eithei in the same composition or as separate compositions

For example foi tieatment ot cardiac hypertrophy . PRO polypeptide therapy can be combined with the administration of inhibitors of known cardiac myocyte hypertrophy factors, e g , inhibitors of α-adrenergic agonists such as phenylephπne, endothelin- 1 inhibitors such as BOSENTAN™ and MOXONODIN™, inhibitors to CT- 1 (US Pat No 5,679,545) inhibitors to LIF, ACE inhibitors, des aspartate angiotensin I inhibitors (U S Pat No 5,773,415), and angiotensin II inhibitors For treatment ot cardiac hypertrophy associated with hypertension, the PRO polypeptide can be administered in combination with β adrenergic receptor blocking agents, e g , propranolol, timolol, tertalolol carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol, or carvedilol, ACE inhibitors, e g quinapπl, captopπl, enalapπl, ramipπl, benazepπl, fosinopπl, or lisinopπl, diuretics, e g , chlorothiazide, hydrochlorothiazide, hydroflumethazide, methylchlothiazide, benzthiazide, dichlorphenamide, acetazolamide, or indapamide, and/or calcium channel blockers, e g , diltiazem, nifedipine, verapamil, or nicardipine Pharmaceutical compositions compπsing the therapeutic agents identified herein by their generic names are commercially available, and are to be administered following the manufacturers' instructions for dosage, administration adverse effects, contraindications, etc See, e g , Physicians' Desk Reference (Medical Economics Data Production Co Montvale, N J , 1997), 51 th Edition Preferred candidates for combination therapy in the treatment of hypertrophic cardiomyopathy are β adrenergic-blocking drugs (e g , propranolol, timolol, tertalolol, carteolol, nadolol, betaxolol, penbutolol, acetobutolol, atenolol, metoprolol, or carvedilol) verapamil, difedipine, or diltiazem Treatment ot hypertrophy associated with high blood pressure may require the use of antihypertensive drug therapy using calcium channel blockers, e g , diltiazem, nifedipine, verapamil, or nicardipine, β adrenergic blocking agents, diuretics, e g , chlorothiazide, hydrochlorothiazide, hydroflumethazide, methylchlothiazide, benzthiazide dichlorphenamide acetazolamide, or indapamide, and/or ACE inhibitors, e g , quinapπl, captopπl, enalapπl ramipπl, benazepπl fosinopπl, or hsinopπl

For other indications, PRO polypeptides or their antagonists may be combined with other agents beneficial to the treatment of the bone and/or cartilage defect, wound, oi tissue in question These agents include various growth factors such as EGF, PDGF, TGF oi TGF-β IGF FGF and CTGF

In addition, PRO polypeptides or their antagonists used to treat cancer may be combined with cytotoxic chemotherapeutic, or growth inhibitory agents as identified abov e Also for cancer treatment the PRO polypeptide or antagonist thereof is suitably administered serially or in combination with diological treatments, whethei involving irradiation or administration of radioactive substances The effective amounts of the therapeutic agents administered in combination with the PRO polypeptide oi antagonist thereof will be at the physician's or veteπnai ian s discretion Dosage administiation and adjustment is done to achieve maximal management of the conditions to be treated For example, for treating hypertension, these amounts ideally take into account use of diuretics oi digitalis and conditions such as hypei or hypotension, ienal impairment etc The dose will additionally depend on such factors as the type ot the theiapeutic agent to be used and the specific patient being treated Typically the amount employed will be the same dose as that used, if the given therapeutic agent is administered without the PRO polypeptide xm Articles of Manufacture

An article of manufacture such as a kit containing PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PRO 179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR022S. PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO l 160, PROl 186 or PR01246 polypeptide or agonists or antagonists thereof useful for the diagnosis or treatment of the disorders described above comprises at least a container and a label Suitable containers include, for example, bottles, vials, syringes, and test tubes The containers may be formed from a variety of materials such as glass or plastic The container holds a composition that is effective for diagnosing or treating the condition and may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle) The active agent in the composition is the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228 PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366. PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide or an agonist or antagonist thereto The label on, or associated with the container indicates that the composition is used for diagnosing or treating the condition of choice The article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate buffered saline, Ringer's solution, and dextrose solution It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use The article of manufacture may also comprise a second or third containei with another active agent as described above

E Antibodies

Some of the most promising drug candidates according to the present invention are antibodies and antibody fragments that may inhibit the production or the gene product of the genes identified herein and/or reduce the activity of the gene products

i Polyclonal Antibodies

Methods of preparing polyclonal antibodies aie known to the skilled artisan Polyclonal antibodies can be raised in a mammal, tor example by one or moie injections of an immunizing agent and, if desired an adjuvant Typically, the immunizing agent and/or adjuv ant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections The immunizing agent may include the PRO 172, PRO 175 PRO 178 PR0188, PR0356 PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 PR0217, PR0219 PR0221 , PR0224 PR0228, PR0245, PR0246, PR0258 PR0261 PR0272 PRO301 PR0322 PR0328 PR0331 , PR0364 PR0366, PR0535, PR0819 PR0826 PRO l 160 PRO l 186 or PRO 1246 polypeptide or a fusion protein thereol It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized Examples of such immunogenic pioteins include, but aie not limited to, keyhole limpet hemocyanm serum albumin, bovine thyroglobulin and soybean trypsin inhibitoi Examples ot adjuvants that may be employed include Freund's complete ad_juvant and MPL-TDM adjuvant (monophosphoryl Lipid A or synthetic trehalose dicorynomycolate) The immunization protocol may be selected by one skilled in the art without undue experimentation

u Monoclonal Antibodies The anti-PRO 172, anti-PRO 175, anti-PRO 178, anti-PROl 88, antι-PR0356, anti-PRO 179, anti-PRO 197. anti-

PRO 198, anti-PRO 182, anti-PRO 195, antι-PRO200, antι-PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221 , anti- PR0224, antι-PR0228, antι-PR0245, antι-PR0246, antι-PR0258, antι-PR0261 , antι-PR0272, antι-PRO301 , anti- PR0322, antι-PR0328, antι-PR0331 , antι-PR0364, antι-PR0366, antι-PR0535, antι-PR0819, antι-PR0826, anti- PRO 1 160, anti-PROl 186 or anti-PRO 1246 antibodies may, alternatively, be monoclonal antibodies Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256 495 ( 1975) In a hybridoma method, a mouse, hamster, or other appropriate host animal is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent Alternatively, the lymphocytes may be immunized in vitio

The immunizing agent will typically include the PROl 72, PRO 175, PRO 178, PROl 88, PR0356, PRO 179 PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366 PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide or a fusion protein thereof Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell Goding, Monoclonal Antibodies Principles and Practice (New Yoi k Academic Press, 1986), pp 59-103 Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine, and human origin Usually, rat or mouse myeloma cell lines are employed The hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused immortalized cells For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT). the culture medium foi the hybπdomas typically will include hypoxanthine aminopteπn, and thymidine ("HAT medium"), which substances pievent the growth of HGPRT-deficient cells

Preferred immortalized cell lines aie those that fuse efficiently, support stable high-level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium More preferred immortalized cell lines aie muπne myeloma lines which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection. Manassas Virginia Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies Kozboi , J Immunol , 133 3001 ( 1984), Brodeur et al , Monoclonal Antibody Production Techniques and Applications (Mai eel Dekker, Inc New Yoik, 1987) pp 51 -63 The culture medium in which the hybridoma cells are cultured can then be assayed for the presence ol monoclonal antibodies directed against the PR0172, PRO I 75. PR0178. PRO I SS, PR0356. PR0179, PR0197 PR0198, PR0182, PR0195. PRO200 PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272 PRO301 , PRO-322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PROS26, PRO l 160, PROl 186 or PR01246 polypeptide Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vttio binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA) Such techniques and assays are known in the art The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal Biochem , 107 220 (1980)

After the desired hybridoma cells are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods Goding, supia Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI- 1640 medium Alternatively, the hybridoma cells may be grown in vno as ascites in a mammal

The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U S

Patent No 4,816,567 DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e g , by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of muπne antibodies) The hybridoma cells of the invention serve as a preferred source of such DNA Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis ot monoclonal antibodies in the recombinant host cells The DNA also may be modified for example, by substituting the coding sequence for human heavy- and light-chain constant domains in place of the homologous murine sequences (U S Patent No 4,816,567, Morrison et al , supia) or by covalently _joining to the immunoglobulin coding sequence all or part of the coding sequence for a non immunoglobulin polypeptide Such a non-immunoglobulin polypeptide can be substituted tor the constant domains of an antibody of the invention, oi can be substituted for the variable domains ot one antigen-combining site of an antibody of the invention to create a chimenc bivalent antibody

The antibodies may be monovalent antibodies Methods for preparing monovalent antibodies are well known in the art For example, one method involv es recombinant expression of immunoglobulin light chain and modified heavy chain The heavy chain is truncated generally at any point in the Fc legion so as to prevent heavy-chain crosslinking Alternatively, the relevant cysteine residues are substituted with another ammo acid residue or are deleted so as to prevent crosslinking

//; i itio methods are also suitable tor preparing monovalent antibodies Digestion of antibodies to produce fragments thereof, particularly Fab fragments, can be accomplished using loutine techniques known in the art

in Human and Humanized Antibodies

The anti-PRO 172, anti-PRO 175, a i PRO 178, anti-PRO 188 antι-PR0356, anti-PRO 179 anti-PRO 197, anti PRO 198 anti PRO 182, anti PROl 95, antι-PRO200, anti PR021 l , antι-PR0217, antι PR0219, antι-PR0221 , antι PR0224, antι-PR0228, antι-PR0245, anti PR0246, antι-PR0258, antι-PR0261 , antι-PR0272, antι-PRO301 , anti PR0322, antι PR0328, antι-PR0331 , antι-PR0364, anti PR0366 anti PR0535, antι-PR0819 anti PR0826, anti- PRO 1 160 anti-PROl 186 or anti-PRO 1246 antibodies may further comprise humanized antibodies or human antibodies Humanized forms of non human (e g , muπne) antibodies are chimeric immunoglobulins immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab , F(ab ), or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non human immunoglobulin Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a CDR of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non human residues Humanized antibodies may also comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences In general, the humanized antibody will comprise substantially all of at least one and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those ot a non human immunoglobulin, and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence The humanized antibody preferably also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that ot a human immunoglobulin Jones etal . Nature, 321 522 525 ( 1986), Riechmann etal . Nature, 332 323-329 (1988), Presta, Curr Op Struct Biol , 2 593-596 (1992)

Methods for humanizing non-human antibodies are well known in the art Generally, a humanized antibody has one or more amino acid residues introduced into it from a souice that is non-human These non-human ammo acid residues are often referred to as "import' residues, which are typically taken from an import variable domain Humanization can be essentially performed following the method of Winter and co workers (Jones et al Nature 321 522-525 (1986), Riechmann et al , Nature. 332 323 327 ( 1988) Verhoeyen et al Science, 239 1534 1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody Accordingly, such humanized antibodies are chimeric antibodies (U S Patent No 4 816 567) wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR tesidues are substituted by residues from analogous sites in rodent antibodies

Human antibodies can also be produced using various techniques known in the art, including phage display libraries Hoogenboom and Winter, J Mol Biol , 227 381 ( 1991 ) Marks et al J Mol Biol 222 581 ( 1991 ) The techniques of Cole et al and Boerner et al aie also available for the preparation of human monoclonal antibodies Cole et al , Monoclonal Antibodies and Cancel Therapy Alan R Lιss, p 77 ( 1985) and Boernei et al J Immunol 147( 1 ) 86 95 ( 1991 ) Similarly human antibodies can be made bv introducing human immunoglobulin loci into transge c animals, e t> mice in which the endogenous immunoglobulin genes hav e been partially or completely inactivated Upon challenge human antibody production is observed that closelv lesembles that seen in humans in all respects including gene rearrangement assembly , and antibody i epei toire This approach is described, toi example, in U S Patent Nos 5 545 807 5 545,806, 5,569,825 5 625 126 5 633,425 and 5,661.016, and in the following scientific publications Marks et al , Bio Technology, JO 779-783 ( 1992), Lonberg etal , Nature, 368 856-859 (1994), Morrison, Nature, 368 812-813 (1994). Fishwild etal . Nature Biotechnology, J4 845-851 ( 1996), Neuberger, Nature Biotechnology. 14 826 (1996). Lonberg and Huszar, Intern Rev Immunol , J3 65-93 (1995)

iv Bispecific Antibodies

Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens In the present case, one of the binding specificities is for the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182. PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258. PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO l 160, PROl 186 or PROl 246 polypeptide, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit

Methods for making bispecific antibodies are known in the art Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-cham pairs, where the two heavy chains have ditterent speciticities Milstem and Cuello. Nature, 305 537-539 ( 1983) Because of the random assortment of immunoglobulin heavy and light chains, these hybπdomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure The purification of the correct molecule is usually accomplished by affinity chromatography steps Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker et al . EMBO J , JO 3655-3659 ( 1991 ) Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant-domain sequences The fusion preferably is with an immunoglobulin heavy- chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions It is preferred to have the first heavy-chain constant region (CH I ) containing the site necessary tor light-chain binding piesent in at least one of the fusions DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expi ession vectoi s, and are co-transfected into a suitable host organism For furthei details of generating bispecific antibodies, see, for example, Suiesh et al , Methods in Enzvmology , 121 210 ( 1986)

v Heteroconiugate Antibodies

Heteroconjugate antibodies are composed of two covalently joined antibodies Such antibodies have for example been proposed to target immune-system cells to unwanted cells (U S Patent No 4 676,980), and for treatment ot HIV infection WO 91/00360, WO 92/200373, EP 030S9 It is contemplated that the antibodies may be piepared in \ ttio using known methods in synthetic protein chemistry, including those inv olving crosslinking agents For example, lmmunotoxins may be consti ucted using a disulfide-exchange leaction oi by forming a thioethei bond Examples ot suitable reagents for this purpose include lmmothiolate and methyl-4- mercdptobutyrimidate and those disclosed, foi example, in U S Patent No 4.676 980 vi Effector Function Engineering

It may be desirable to modify the antibody of the invention with respect to effector function, so as to enhance, e g , the effectiveness of the antibody in treating cancer For example, cysteine resιdue(s) may be introduced into the Fc region, thereby allowing interchain disulfide bond formation in this region The homodimeπc antibody thus generated may have improved internahzation capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC) See, Caron et al , J Exp Med , J76 1 191-1 195 (1992) and

Shopes, J Immunol , J48 2918-2922 ( 1992) Homodimeπc antibodies with enhanced anti-tumor activity may also be prepared using heterobitunctional cross-linkers as described in Wolff et al , Cancer Research. 53 2560-2565

(1993) Alternatively, an antibody can be engineered that has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities See, Stevenson et al , Anti-Cancer Drug Design, 3 219-230 (1989)

vn Immunocon i u gates

The invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e g , an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i e , a radioconjugate) Chemotherapeutic agents useful in the generation of such immunoconjugates have been described above

Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbindmg active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeruginosa), πcin A chain, abπn A chain, modeccin A chain, alpha-sarcin, Aleut ites foi u proteins, dianthin proteins, Plntolaca ameucana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitoi , curcin, crotin, sapaonaπa officinahs inhibitor, gelomn, mitogellin, restnctocin, phenomycin, enomycin, and the tncothecenes A variety of radionuchdes are available for the production of radioconjugated antibodies Examples include ^2l2Bι, ^πιI, ' 'In. ⁹⁰Y, and ^{I 6}Re

Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein-coupling agents such as N-succιmmιdyI-3-(2-pyπdyldιthιol) propionate (SPDP), lininothiolane (IT), bifunctional derivatives of lmidoesters (such as dimethyl adipimidate HCl), active esters (such as disuccmimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazomum derivatives (such as bιs-(p-dιazonιumbenzoyl)-ethylenedιamιne), dnsocyanates (such as tolyene 2,6-dusocyanate), and bis- active fluorine compounds (such as l ,5-dιfluoro-2,4-dιmtrobenzene) Foi example, a πcin lmmunotoxin can be prepared as described in Vitetta e al Science, 238 1098 ( 1987) Carbon- 14-labeled l -ιsothιocyanatobenzyl-3- methyldiethylene tπaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody See, W094/1 1026

In another embodiment, the antibody may be conjugated to a "receptoi ' (such as streptavidin) for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administeied to the patient, followed by remov al of unbound conjugate fiom the cuculation using a clearing agent and then administration of a "ligand" (e g , avidin) that is conjugated to a cytotoxic agent (e g , a radionucleotide) viu Immunohposomes

The antibodies disclosed herein may also be formulated as immunohposomes Liposomes containing the antibody are prepared by methods known in the ait, such as described in Epstein etal , Proc Natl Acad Sci USA 82 3688 (1985) Hwang et al Proc Natl Acad Sci USA 72 4030 ( 1980), and U S Pat Nos 4,485,045 and 4,544,545 Liposomes with enhanced circulation time are disclosed in U S Patent No 5,013,556

Particularly useful liposomes can be generated by the reverse-phase evaporation method with a lipid composition comprising phosphatidylchohne, cholesterol, and PEG-deπvatized phosphatidylethanolamine (PEG- PE) Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin etal J Biol Chem , 257 286 288 (1982) via a disulfide-interchange reaction A chemotherapeutic agent (such as Doxorubicin) is optionally contained within the liposome See, Gabizon et al , J National Cancer Inst , 81 (19) 1484 (1989)

iλ Pharmaceutical Compositions of Antibodies

Antibodies specifically binding a PR0172, PR0175 PR0178 PR0188, PR0356, PR0179, PR0197 PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245 PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322 PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PRO l 186 or PRO 1246 polypeptide identified herein, as well as other molecules identified by the screening assays disclosed hereinbefore, can be administered for the treatment of various disorders as noted above and below in the form of pharmaceutical compositions If the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195

PRO200, PR021 1 , PR0217 PR0219 PR0221 , PR0224 PR0228, PR0245, PR0246, PR0258, PR0261 PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364 PR0366, PR0535, PR0819, PR0826. PRO l 160 PROl 186 or PR01246 polypeptide is intracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred However, hpofections oi liposomes can also be used to deliver the antibody, or an antibody fragment into cells Where antibody fragments are used the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred Foi example, based upon the variable region sequences of an antibody, peptide molecules can be designed that retain the ability to bind the target protein sequence Such peptides can be synthesized chemically and/or pioduced by recombinant DNA technology See e g Marasco ef α/ Proc Natl Acad Sci USA 90 7889 7893 ( 1993) The formulation herein may also contain moie than one active compound as necessary foi the particulai indication being treated, preferably those with complementaiy activities that do not adversely affect each othei Alternatively, oi in addition, the composition may compπse an agent that enhances its function such as toi example a cytotoxic agent, cytokine, chemotherapeutic agent or growth inhibitoi y agent Such molecules aie suitably present in combination in amounts that are effectiv e toi the pui pose intended The activ e ingredients may also be entrapped in miciocapsules prepared, foi example, by coacervation techniques or by intertdcial polymerization, toi example hydioxymethylcelluloseorgelatin-microcdpsules dndpolv

1 1 (methylmethacylate) microcapsules respectively, in colloidal diug delivery sy stems (tor example, liposomes albumin microspheres, microemulsions, nano-particles, and nanocapsules) or in macroemulsions Such techniques are disclosed in Remington s Pharmaceutical Sciences, supia

The formulations to be used for in vivo administration must be sterile This is readily accomplished by filtration through sterile filtration membranes

Sustained release preparations may be prepared Suitable examples of sustained release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form ot shaped articles, e g films, or microcapsules Examples of sustained-release matrices include polyesters, hydrogels (for example, ρoly(2-hydroxyethyl-methacrylate), or ρoly(vmylalcohol)), polylactides (U S Pat No 3,773,919) copolymers of L-glutamic acid and γ ethyl-L glutamate, non-degradable ethylene-vinyl acetate degradable lactic acid-glycohc acid copolymers such as the LUPRON DEPOT ™ (mjectable microspheres composed of lactic acid- glycohc acid copolymer and leuprohde acetate), and poly-D (-)-3-hydroxybutyπc acid While polymers such as ethylene vinyl acetate and lactic acid glycohc acid enable release ot molecules for over 100 days certam hydrogels release proteins for shorter time periods When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result ot exposure to moisture at 37°C iesult g in a loss of biological activity and possible changes in immunogemcity Rational strategies can be devised for stabilization depending on the mechanism involved For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophihzing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions

x Methods of Treatment using the Antibody

It is contemplated that the antibodies to a PRO 172 PRO 175, PRO 178, PROl 88, PR0356 PRO 179 PRO 197 PR0198, PR0182, PR0195 PRO200, PR021 1 , PR0217 PR0219 PR0221 , PR0224 PR0228, PR0245, PR0246, PR0258 PR0261 PR0272 PRO301 PR0322 PR0328 PR0331 PR0364 PR0366 PR0535 PROS 19, PR0826, PROl 160 PROl 186 or PRO 1246 polypeptide may be used to treat various cardiovasculai endothehal, and angiogenic conditions as noted above

The antibodies are administered to a mammal, preteiably a human in accord with kno n methods, such as intravenous administration as a bolus or by continuous intusion ovei a period of time by intramuscular intraperitoneal intracerobrospinal, subcutaneous, intra articulai mtrasynovial intrathecal oral topical oi inhalation routes Intravenous administration of the antibody is preferred

Other therapeutic regimens may be combined with the administration ot the antibodies ot the instant invention as noted above For example if the antibodies aie to treat cancel the patient to be treated with such antibodies may also receive radiation therapy Alternatively or in addition a chemotherapeutic agent may be administered to the patient Preparation and dosing schedules foi such chemotherapeutic agents may be used according to manufacturers instructions or as determined empirically by the skilled piactitionei Pieparation and dosing schedules tor such chemotherapy ai e also described in Chemotherapy Sei v ice Ed M C Peπy (Williams &. Wilkins Baltimoie, MD, 1992) The chemotherapeutic agent may precede, or follow administration of the antibody, or may be given simultaneously therewith The antibody may be combined with an anti-estrogen compound such as tamoxifen or EVISTA™ or an anti-piogesteione such as onapπstone (see, EP 616812) in dosages known for such molecules If the antibodies are used for treating cancer, it may be desirable also to administer antibodies against other tumor-associated antigens, such as antibodies that bind to one or more of the ErbB2, EGFR, ErbB3, ErbB4, or VEGF receptor(s) These also include the agents set forth above Also, the antibody is suitably administered serially or in combination with radiological treatments, whether involving irradiation oi administration of radioactive substances Alternatively, or in addition, two or more antibodies binding the same or two or more different antigens disclosed herein may be co-administered to the patient Sometimes, it may be beneficial also to administei one or more cytokines to the patient In a preferred embodiment, the antibodies herein are co- admimstered with a growth-inhibitory agent For example, the growth-inhibitory agent may be administered first, followed by an antibody of the present invention However, simultaneous administration or administration of the antibody of the present invention first is also contemplated Suitable dosages for the growth-inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth-inhibitory agent and the antibody herein

In one embodiment, vasculaπzation of tumors is attacked in combination therapy The anti-PRO polypeptide antibody and another antibody (e g , anti-VEGF) are administered to tumor-bearing patients at therapeutically effective doses as determined, for example, by observing necrosis of the tumoi or its metastatic foci, if any This therapy is continued until such time as no furthei beneficial effect is observed or clinical examination shows no trace of the tumor or any metastatic foci Then TNF is administered alone or m combination with an auxiliary agent such as alpha-, beta-, or gamma-interferon. antι-HER2 antibody, hereguhn, anti-hereguhn antibody D-factoi , ιnterleukιn-1 (IL-1 ), ιnterleukιn-2 (IL-2), granulocyte-macrophage colony stimulating tactoi (GM-CSF), or agents that promote microvascular coagulation in tumors, such as anti-pi otein C antibody, anti-piotein S antibody, or C4b binding protein (see, WO 91/01753, published 21 February 1991 ) or heat or radiation

Since the auxiliary agents will vary in their effectiveness it is desirable to compare their impact on the tumoi by matrix screening in conventional fashion The administration of anti-PRO polypeptide antibody and TNF is repeated until the desired clinical effect is achieved Alternatively, the anti-PRO polypeptide antibody is administered together with TNF and, optionally, auxiliary agent(s) In instances where solid tumors are found in the limbs or in othei locations susceptible to isolation from the genei al circulation, the therapeutic agents described herein are administered to the isolated tumor or organ In other embodiments, a FGF oi PDGF antagonist such as an anti-FGF or an anti-PDGF neutralizing antibody, is administered to the patient in conjunction with the anti-PRO polypeptide antibody Treatment w ith anti-PRO polypeptide antibodies preferably may be suspended during periods of wound healing or desirable neovasculaπzation For the prevention or treatment ot cardiovascular endothehal, and angiogenic disoidei the appropriate dosage of an antibody herein will depend on the type of disordei to be treated, as defined above, the severity and coui se of the disease, whether the antibody is administered for preventive or theiapeutic puiposes pievious therapy, the patient s clinical history and response to the antibody, and the discretion of the attending physician The antibody is suitably administered to the patient at one time or over a series of treatments

For example, depending on the type and severity of the disordei , about 1 μg/kg to 50 mg/kg (e g , 0 1 -20 mg/kg) of antibody is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion A typical daily or weekly dosage might l ange from about 1 μg/kg to 100 mg/kg or more, depending on the factors mentioned above For repeated administrations over several days or longer, depending on the condition, the treatment is repeated or sustained until a desired suppression of disorder symptoms occurs However, other dosage regimens may be useful The progress of this therapy is easily monitored by conventional techniques and assays, including, for example, radiographic tumor imaging

xi Articles of Manufacture with Antibodies

An article of manufacture containing a container with the antibody and a label is also provided Such articles are described above, wherein the active agent is an anti-PROl 72, anti-PROl 75. anti-PRO 178, anti-PROl 88, anti- PR0356, anti-PROl 79, anti-PROl 97, anti-PRO 198, anti-PRO 182, anti-PRO 195, antι-PRO200, antι-PR021 1 , anti- PR0217, antι-PR0219, antι-PR0221 , antι-PR0224, antι-PR0228, antι-PR0245, antι-PR0246, antι-PR0258, anti- PR0261 , antι-PR0272, antι-PRO301 , antι-PR0322, antι-PR0328, antι-PR0331 , antι-PR0364. antι-PR0366, anti- PR0535, antι-PR0819, antι-PR0826, anti-PROl 160 anti-PRO l 186 or antι-PR01246 antibody

xn Diagnosis and Prognosis of Tumors using Antibodies

If the indication for which the antibodies are used is cancel , while cell-surface proteins, such as growth receptors over expiessed in certain tumors, are excellent taigets for diug candidates or tumor (e g , cancel ) treatment, the same proteins along with PRO polypeptides find additional use in the diagnosis and prognosis ot tumors For example, antibodies directed against the PRO polypeptides may be used as tumor diagnostics or prognostics

For example, antibodies, including antibody fragments can be used qualitatively or quantitatively to detect the expression of genes including the gene encoding the PRO polypeptide The antibody preferably is equipped with a detectable, e g , fluorescent label, and binding can be monitored by light microscopy , flow cytometry fiuoπmetry oi other techniques known in the art Such binding assays aie performed essentially as described above

In situ detection of antibody binding to the marker gene products can be performed, for example, by immunofluorescence or immunoelectron microscopy For this purpose, a histological specimen is removed from the patient, and a labeled antibody is applied to it, prefeiably by overlaying the antibody on a biological sample This procedure also allows toi determining the distribution of the mai kei gene pioduct in the tissue examined It will be apparent to those skilled in the art that a wide variety of histological methods are readily available tor in situ detection The following Examples aie offeied toi illustrative purposes only, and die not intended to limit the scope ot the present invention in any way The disclosures of all patent and hteratui e references cited in the present specification are hereby incorporated by reference in their entirety

EXAMPLES Commercially available reagents referred to in the Examples were used according to manufacturer's instructions unless otherwise indicated The source of those cells identified in the following Examples, and throughout the specification, by ATCC accession numbers is the American Type Culture Collection, Manassas, VA Unless otherwise noted, the present invention uses standard procedures of recombinant DNA technology, such as those described hereinabove and in the following textbooks Sambrook et al , supra, Ausubel et al , Current Protocols in Molecular Biology (Green Publishing Associates and Wiley Interscience, N Y , 1989), Inms efa/ , PCR Protocols A Guide to Methods and Applications (Academic Press. Inc N Y , 1990), Harlow et al Antibodies A Laboratory Manual (Cold Spring Harbor Press Cold Spring Harbor, 1988). Gait, Oligonucleotide Synthesis (IRL Press Oxford, 1984), Freshney, Animal Cell Culture, 1987, Cohgan etal , Current Protocols in Immunology, 1991

EXAMPLE 1 Extracellular Domain Homology Screening to Identify Novel Polypeptides and cDNA Encoding Therefor The extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases The EST databases included public databases (e g , GenBank), and proprietary databases (e g , LIFESEQ^®, Incyte Pharmaceuticals, Palo Alto, CA) The search was performed using the computer program BLAST or BLAST-2 [Altschul et al , Methods in Enzymology. 266 460-480 ( 1996)] as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences Those compaiisons with a BLAST score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University ot Washington, Seattle Washington)

Using this extracellular domain homology screen consensus DNA sequences were assembled relative to other identified EST sequences using phrap In addition, the consensus DNA sequences obtained were often (but not always) extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above

Based upon the consensus sequences obtained as described above, oligonucleotides were then synthesized and used to identity by PCR a cDNA libiary that contained the sequence of interest and for use as probes to isolate a clone ot the full-length coding sequence foi a PRO polypeptide Forward and reverse PCR pπmei s genei ally range from 20 to 30 nucleotides and are often designed to give a PCR pioduct of about 100- 1000 bp in length The piobe sequences are typically 40-55 bp in length In some cases additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp In ordei to screen seveial libraries toi a full-length clone DNA. from the libraπes was screened by PCR amplification as pei Ausubel et al , Cun ent Protocols in Moleculai Biology supia with the PCR primer pair A positive hbraiy was then used to isolate clones encoding the gene of inteiest using the piobe oligonucleotide and one of the primer pan s The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors cleaved with Notl sized appropriately by gel electrophoresis, and cloned in a defined onentation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site see, Holmes et al , Science, 253 1278-1280 (1991 )) in the unique Xhol and Notl sites

EXAMPLE 2 Isolation of cDNA clones by Amylase Screening

1 Preparation of ohgo dT primed cDNA library mRNA was isolated from a human tissue of interest using reagents and protocols from Invitrogen, San Diego,

CA (Fast Track 2) This RNA was used to generate an ohgo dT primed cDNA library in the vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System) In this procedure, the double stranded cDNA was sized to greater than 1000 bp and the Sall/Notl hnkered cDNA was cloned into Xhol/Notl cleaved vector pRK5D is a cloning vector that has an sρ6 transcription initiation site followed by an Sfil restriction enzyme site preceding the Xhol/Notl cDNA cloning sites

2 Preparation of random primed cDNA library

A secondary cDNA library was generated in order to preferentially represent the 5 ends of the primary cDNA clones Sp6 RNA was generated from the primary library (described above), and this RNA was used to generate a random primed cDNA library in the vector pSST AMY 0 using reagents and protocols tiom Life Technologies (Super Script Plasmid System, referenced above) In this procedure the double stranded cDNA was sized to 500 l OOO bp hnkered with blunt to Notl adaptors cleaved with Sfil and cloned into Sfil/Notl cleaved vector pSST AMY 0 is a cloning vector that has a yeast alcohol dehydrogenase promoter preceding the cDNA cloning sites and the mouse amylase sequence (the mature sequence without the secretion signal) followed by the yeast alcohol dehydrogenase terminator, after the cloning sites Thus cDNAs cloned into this vector that aie fused in frame with amylase sequence will lead to the secretion of amylase from appropriately transfected yeast colonies

3 Tiansformation and Detection

DNA from the library described in paragraph 2 above was chilled on ice to which was added electrocompetent DH 10B bacteria (Life Technologies, 20 ml) The bacteπa and vector mixture was then electi operated as recommended by the manufacturer Subsequently , SOC media (Life Technologies 1 ml ) was added and the mixture was incubated at 37 °C foi 30 minutes The transformants were then plated onto 20 standaid 150 mm LB plate containing ampicilhn and incubated for 16 hours (37 °C) Positive colonies were scraped oft the plates and the DNA was isolated tiom the bacterial pellet using standaid piotocols, e t> CsCl gradient The purified DNA was then caiπed on to the yeast protocols below

The yeast methods were divided into three categories ( 1 ) Transformation of yeast w ith the plasmid/cDNA combined vector, (2) Detection and isolation of yeast clones secreting amylase, and (3) PCR amplification of the insert directly from the yeast colony and purification of the DNA for sequencing and further analysis

The yeast strain used was HD56-5A (ATCC-90785) This stiain has the following genotype MAT alpha, ura3-52, leu2-3, leu2-l 12, hιs3- l 1 , hιs3-15, MAL⁺, SUC⁺, GAL⁺ Preferably, yeast mutants can be employed that have deficient post-translational pathways Such mutants may have translocation deficient alleles in seel 1 , ec!2, sec62. with truncated sec 71 being most pi ef erred Alternatively, antagonists (including antisense nucleotides and/or hgands) which interfere with the normal operation of these genes, other proteins implicated in this post translation pathway (e g , SECόl p, SEC72p, SEC62p, SEC63p, TDJlp or SSAl p-4p) or the complex formation of these proteins may also be preferably employed in combination with the amylase-expressing yeast Transformation was performed based on the protocol outlined by Gietz et al , Nucl Acid Res , 20 1425

(1992) Transformed cells were then inoculated from agar into YEPD complex media broth (100 ml) and grown overnight at 30°C The YEPD broth was prepared as described in Kaiser et al . Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p 207 ( 1994) The overnight culture was then diluted to about 2 x 10⁶ cells/ml (approx OD_6πn=0 1 ) into fresh YEPD broth (500 ml) and regrown to 1 x 10^" cells/ml (approx OD«_X,=0 4-0 5)

The cells were then harvested and prepared for transformation by transfer into GS3 rotor bottles in a Sorval GS3 rotor at 5,000 rpm for 5 minutes, the supernatant discarded, and then resuspended into sterile water, and centπfuged again in 50 ml falcon tubes at 3,500 rpm in a Beckman GS-6KR centrifuge The supernatant was discarded and the cells were subsequently washed with LiAc/TE ( 10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7 5, 100 mM LijOOCCH,), and resuspended into LiAc/TE (2 5 ml)

Transformation took place by mixing the prepared cells ( 100 1) with freshly denatured single stranded salmon testes DNA (Lofstrand Labs, Gaithersbuig, MD) and transforming DNA ( 1 μg, vol < 10 «1) in microfuge tubes The mixture was mixed briefly by voi texing, then 40% PEG/TE (600 l, 40% polyethylene glycol-4000, 10 mM Tris-HCl, 1 mM EDTA, 100 mM L OOCCH,, pH 7 5) was added This mixture was gently mixed and incubated at 30°C while agitating for 30 minutes The cells were then heat shocked at 42 °C for 15 minutes, and the reaction vessel centπfuged in a microfuge at 12,000 rpm for 5- 10 seconds, decanted and iesuspended into TE (500 ul, 10 mM Tris-HCl, 1 mM EDTA pH 7 5) followed by recentπfugation The cells were then diluted into TE ( 1 ml) and aliquots (200 μl) were spread onto the selective media previously piepaied in 150 mm giow th plates (VWR)

Alternatively, instead of multiple small reactions, the transformation was performed using a single, large scale reaction, wherein reagent amounts weie scaled up accordingly

The selective media used was a synthetic complete dextiose agar lacking uracil (SCD-Ura) prepared as described in Kaiser et al , Methods in Yeast Genetics. Cold Spring Harbor Pi ess Cold Spi g Harbor, NY, p 208- 210 ( 1994) Transformants were giown at 30°C for 2-3 days

The detection of colonies seciet g amylase was perfoi ed by including led starch in the selective growth media Starch was coupled to the ied dye (Reactive Red- 120, Sigma) as pei the pioceduie described by Biely et al , Anal Biochem . 172 176- 179 ( 1988) The coupled starch was incorporated into the SCD-Uia agar plates at a final concentration of 0 15% (w/v ). and was buffered with potassium phosphate to a pH of 7 0 (50- 100 mM final concentration)

The positive colonies were picked and streaked across fiesh selective media (onto 150 mm plates) in order to obtain well isolated and identifiable single colonies Well isolated single colonies positive for amylase secretion were detected by direct incorporation of red starch into buff ei ed SCD-Ura agai Positive colonies were determined by their ability to break down starch resulting in a clear halo around the positive colony visualized directly

4 Isolation of DNA by PCR Amplification

When a positive colony was isolated, a portion of it was picked by a toothpick and diluted into sterile watei (30 μl) in a 96 well plate At this time, the positive colonies were either frozen and stored for subsequent analysis or immediately amplified An aliquot of cells (5 μl) was used as a template for the PCR reaction in a 25 μl volume containing 0 5 μl Klentaq (Clontech, Palo Alto, CA), 4 Oμl lO mM dNTP's (Perkin Elmer-Cetus), 2 5 μl Klentaq buffer (Clontech), 0 25 μl forward ohgo 1 , 0 25 μl reverse ohgo 2, 12 5 μl distilled water The sequence of the forward oligonucleotide 1 was

5'-TGTAAAACGACGGCCAGTTAAATAGACCTGCAATTATTAATCT-3' (SEQ ID NO 3)

The sequence of the ieverse oligonucleotide 2 was 5'-CAGGAAACAGCTATGACCACCTGCACACCTGCAAATCCATT-3' (SEQ ID NO 4)

PCR was then performed as follows a Denature 92 °C, 5 minutes b 3 cycles of Denature 92 °C, 30 seconds

Anneal 59°C, 30 seconds

Extend 72°C, 60 seconds c 3 cycles of Denature 92 °C, 30 seconds

Anneal 57°C, 30 seconds

Extend 72°C, 60 seconds d 25 cycles of Denature 92 °C, 30 seconds

Anneal 55 °C, 30 seconds

Extend 72°C, 60 seconds e Hold 4°C

The underlined regions of the oligonucleotides annealed to the ADH promotei region and the amylase region respectively, and amplified a 307 bp region from vector pSST-AMY 0 when no insert was piesent Typically, the first 18 nucleotides of the 5 end of these oligonucleotides contained annealing sites for the sequencing pπmei s

Thus the total product ot the PCR reaction fiom an empty vector was 343 bp However, signal sequence-fused cDNA resulted in considerably longer nucleotide sequences

Following the PCR. an aliquot of the reaction (5 til) was examined by agaiose gel electrophoresis in a 1 % agarose gel using a Tns-Borate EDTA (TBE) buffering system as described bv Sambrook et al , supia Clones resulting in a single strong PCR product largei than 400 bp were furthei analyzed by DNA sequencing attei purification with a 96 Qiaquick PCR clean-up column (Qiagen Inc , Chatswoi th, CA) EXAMPLE 3 Isolation ot cDNA Clones Using Signal Algorithm Analysis Various polypeptide-encoding nucleic acid sequences were identified by applying a proprietary signal sequence finding algorithm developed by Genentech, Inc , (South San Francisco, CA) upon ESTs as well as clustered and assembled EST fragments from public (e g , GenBank) and/or private (LIFESEQ^®, Incyte Pharmaceuticals, Inc , Palo Alto, CA) databases The signal sequence algorithm computes a secretion signal score based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codon(s) (ATG) at the 5'-end of the sequence or sequence fragment under consideration The nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codons If the first ATG has the required amino acids, the second is not examined If neither meets the requirement, the candidate sequence is not scored In order to determine whether the EST sequence contains an authentic signal sequence, the DNA and corresponding amino acid sequences surrounding the ATG codon are scored using a set of seven sensors (evaluation parameters) known to be associated with secretion signals Use of this algorithm resulted in the identification of numerous polypeptide-encoding nucleic acid sequences

EXAMPLE 4

Isolation of cDNA clones Encoding PR0172 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in

Example 1 above This consensus sequence is herein designated DNA28765 Based on the DNA28765 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2 ) for use as probes to isolate a clone of the full-length coding sequence f or PRO 172 PCR primers

(forward and reverse) were synthesized based upon the DNA28765 sequence Additionally a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28765 sequence

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was scieened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology supia, with the PCR pπmei pair A positive hbi dry was then used to isolate clones encoding the PRO 172 gene using the probe oligonucleotide and one of the PCR pπmei s

The oligonucleotide sequences used in the above proceduie wei e the following

28765 p

5'-AAATCTGTGAATTGAGTGCCATGGACCTGTTGCGGACGGCCCTTGCTT-3' (SEQ ID NO 5)

28765 f

5 -GGATCTCGAGAACAGCTACTCC-3 (SEQ ID NO 6)

28765 r

5'-TCGTCCACGTTGTCGTCACATG-3' (SEQ ID NO 7) RNA toi construction of the cDNA hbi anes was isolated ti om human fetal kidney tissue The cDNA hbrai les used to isolate the cDNA clones were constructed by standard methods using commeicially dvdilable reagents such as those from Inv itrogen. San Diego, CA The cDNA was pπmed with Notl site linked with blunt to Sail hemikinased adaptoi s, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site see, Holmes et al , Science, 253 1278-1280 ( 1991 )) in the unique Xhol and Notl sites

DNA sequencing of the clones isolated as described above gave the full length DNA sequence foi PRO 172 [herein designated as DNA35916 1 161 ] (Figures 1A-1B, SEQ ID NO 1 ) and the derived protein sequence foi PROl 72

The entire nucleotide sequence of DNA35916 1 161 is shown in Figures 1A IB (SEQ ID NO 1 ) Clone DNA35916-1 161 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 38-40 and ending at the stop codon at nucleotide positions 2207-2209 (Figures 1 A- IB) The predicted polypeptide precursor is 723 amino acids long (Figure 2, SEQ ID NO 2)

Analysis of the full-length PROl 72 sequence shown in Figure 2 (SEQ ID NO 2) evidenced the presence of a variety of important polypeptide domains as shown in Figure 2 wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full length PROl 72 sequence (Figure 2, SEQ ID NO 2) evidences the presence ot the following a signal peptide from about amino acid 1 to about amino acid 19, a transmembrane domain from about amino acid 544 to about amino acid 565, an N-glycosylation site from about amino acid 475 to about amino acid 479, a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 658 to about amino aacid 662, tyrosine kinase phosphorylation sites from about amino acid 174 to about amino acid 183 and from about ammo acid 250 to about amino acid 259, N-myπstoylation sites from about amino acid 35 to about amino acid 41 , from about amino acid 38 to about amino acid 44 from about am o acid 96 to about amino acid 102, from about amino acid 97 to about amino acid 103, from about amino acid 260 to about amino acid 266, from about amino acid 279 to about am o acid 285 from about amino acid 280 to about amino acid 286 from about amino acid 299 to about amino acid 305 from about ammo acid 308 to about amino acid 314, from about amino acid 326 to about amino acid 332, tiom about amino acid 338 to about amino acid 344 from about amino acid 376 to about amino acid 382, from about amino acid 385 to about amino acid 391 from about amino acid 510 to about amino acid 516 from about amino acid 674 to about amino acid 680 from about amino acid 681 to about amino acid 687, and from about amino acid 693 to about amino acid 699 aspartic acid and asparagine hydroxylation sites from about ammo acid 314 to about amino acid 353 from about amino acid 418 to about amino acid 430, and from about am o acid 456 to about amino acid 468, a prokaryotic membrane lipoprotein lipid attachment site from about amino acid 550 to about amino acid 561 , and EGF like domain cysteine pattern signatures from about amino acid 241 to about am o acid 25 from about am o acid 272 to about amino acid 284 from about ammo acid 312 to about amino acid 324, from about ammo acid 350 to about amino acid 362 fiom about am o acid 389 to about amino acid 401 , from about amino acid 427 to about amino acid 439 tiom about amino acid 465 to about amino acid 477, and tiom about amino acid 503 to about amino acid 515 Clone DNA35916-1 161 has been deposited with ATCC on Octobei 28 1997 and is assigned ATCC deposit no 209419 An analysis of the Dayhoff database (veision 35 45 SwissProt 35) using the ALIGN 2 sequence alignment analysis ot the full-length sequence shown in Figure 2 (SEQ ID NO 2), evidenced 897r amino acid sequence identity between the PRO 172 amino acid sequence and the delta 1 mouse protein EXAMPLE 5 Isolation of cDNA clones encoding PRO 175 A cDNA clone (DNA 19355 1 150) encoding a native human PROl 75 polypeptide was identified using a yeast screen, in a human umbilical vein endothehum cell cDNA library that preferentially represents the 5 ends of the primary cDNA clones

A full length clone was identified that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 21 23, and a stop signal at nucleotide positions 552-554 (Figures 3 A-3B, SEQ ID NO 8) The predicted polypeptide precursor is 177 amino acids long, and has a calculated molecular weight of approximately 20 308 daltons Analysis of the full-length PRO 175 sequence shown in Figure 4 (SEQ ID NO 9) evidenced the presence of a variety of important polypeptide domains as shown in Figure 4, wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PR0175 sequence (Figuie 4, SEQ ID NO 9) evidences a type II transmembrane protein typology and the presence of the following a signal peptide from about ammo acid 1 to about amino acid 25, a transmembrane domain from about amino acid 26 to about am o acid 51 , an extracellular domain from about amino acid 52 to about amino acid 177, potential N linked glycosylation sites from about amino acid 129 to about ammo acid 133 and from about am o acid 161 to about amino acid 165, and an N-myπstoylation site from about amino acid 18 to about amino acid 24 Clone DNA 19355 1 150 has been deposited with ATCC on November 18, 1997 and is assigned ATCC deposit no 209466

An analysis of the Dayhoff database (veision 35 45 SwissProt 35), using the ALIGN 2 sequence alignment analysis of the full length sequence shown m Figure 4 (SEQ ID NO 9), evidenced significant identity between the PRO 175 amino acid sequence and several members of the TNF cytokine family and particularly, to human Apo-2L (19 8%) Fas/Apo l ligand ( 19 0%) TNF-alpha (20 6%) and Lymphotoxin-α ( 17 5%) Most of the ammo acid sequence identity is found in the regions corresponding to the beta strands in the crystal structui e of TNF a [Bannei etal Cell, 73 431 -435 (1993). Eck ef-7/ . J Biol Chem , 264 17595 605 ( 1989) Lewit Bentley efα/ J Mol Biol 199 389 92 ( 1988)] The sequence of strand C is especially conserv ed in all members ot the family The sequence between the putative transmembiane domain and the first beta strand ot the DNA 19355 polypeptide is ielatively short, including 5 residues as compared to about 30 to about 80 residues in TNF CD95L or Apo 2 ligand

EXAMPLE 6 Isolation of cDNA clones encoding PRO 178 An expressed sequence tag (EST) DNA database (LIFESEQ , Incyte Pharmaceuticals Palo Alto CA) was searched and an EST was identified that had homology to PRO 179 [identified in EXAMPLE 9 below and designated DNA 16451 -1078 (Figures 1 1 A 1 I B, SEQ ID NO 25)] To clone PR0178 a human fetal lung hbi ai prepared from mRNA purchased from Clontech, Inc (Palo Alto CA) catalog # 6528 1 w as used following the manufacturer s instructions The cDNA librai les used to isolate the cDNA clones encoding human PRO 178 weie constructed by standaid methods using commeicially av ailable leagents such as those fiom Invitiogen San Diego CA The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al , Science. 253: 1278- 1280 ( 1991 )) in the unique Xhol and Notl. Oligonucleotide probes based upon the above described EST sequence were then synthesized: 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO 178. Forward and reverse PCR primers generally range from 20-30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe sequences are typically 40-55 bp in length. In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al. Current Protocols in Molecular Biology, supra, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs. The oligonucleotide probes used were as follows:

5'-ACGTAGTTCCAGTATGGTGTGAGCAGCAACTGGA-3' (SEQ ID NO: 12)

5'-AGTCCAGCCTCCACCCTCCAGTTGCT-3' (SEQ ID NO: 13) 5'-CCCCAGTCCTCCAGGAGAACCAGCA-3' (SEQ ID NO: 14)

A cDNA clone was identified and sequenced in entirety. The entire nucleotide sequence of DNA23339- 1 130 is shown in Figure 5 (SEQ ID NO: 10). Clone DNA23339-1 130 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 1 18-120, and a stop codon at nucleotide positions 1528- 1530 (Figure 5; SEQ ID NO: 10). The predicted polypeptide precursor is 470 amino acids long. The full-length PRO 178 protein is shown in Figure 6 (SEQ ID NO: 1 1 ).

Analysis of the full-length PRO 178 sequence shown in Figure 6 (SEQ ID NO: 1 1 ) evidences the presence of important polypeptide domains as shown in Figure 6, wherein the locations given for those important polypeptide domains are approximate as described above. Analysis of the full-length PRO 178 sequence (Figure 6; SEQ ID NO: 1 1 ) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 20; N-glycosylation sites from about amino acid 58 to about amino acid 62 and from about amino acid 145 to about amino acid 149; a cAMP- and cGMP-dependent protein kinase phosphhorylation site from about amino acid 97 to about amino acid 101 ; a tyrosine kinase phosphorylation site from about amino acid 441 to about amino acid 448^*. N-myristoylation sites from about amino acid 16 to about amino acid 22, from about amino acid 23 to about amino acid 29, from about amino acid 87 to about amino acid 93, from about amino acid 108 to about amino acid 1 14. from about amino acid 121 to about amino acid 127, from about amino acid 125 to about amino acid 131 , from about amino acid 129 to about amino acid 135, from about amino acid 187 to about amino acid 193, from about amino acid 293 to about amino acid 299, from about amino acid 353 to about amino acid 359, from about amino acid 378 to about amino acid 384, from about amino acid 445 to about amino acid 451 , and from about amino acid 453 to about amino acid 459; a cell attachment sequence from about amino acid 340 to about amino acid 343; and a fibrinogen beta and gamma chains C-terminal domain signature from about amino acid 418 to about amino acid 431.

Clone DNA23339- 1 130 has been deposited with ATCC on September 18, 1997 and is assigned ATCC deposit no 209282 It is understood that the deposited clone has the actual correct sequence rather than the representations provided herein

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence show n in Figure 6 (SEQ ID NO 1 1 ), shows a 23% sequence identity between the PROl 78 amino acid sequence and both ligand 1 and ligand 2 of the TIE-2 receptoi The abbreviation "TIE' is an acronym which stands tor "tyrosine kinase containing Ig and EGF homology domains" and was coined to designate a new family of receptor tyrosine kinases The fibπnogen domains of ligand 1 and ligand 2 of the TIE-2 receptor are 64% identical and 40-43% identical to PROl 78, respectively

EXAMPLE 7 Isolation of cDNA clones encoding PRO 188

An expressed sequence tag (EST) DNA database (LIFESEQ^®, Incyte Pharmaceuticals, Palo Alto, CA) was searched and an EST was identified that had homology to PRO 179 [identified in EXAMPLE 9 below and designated DNA 16451 -1078 (Figures 1 1 A-1 IB, SEQ ID NO 25)] To clone PROl 88, a human fetal lung library prepared from mRNA purchased from Clontech, Inc , (Palo Alto CA) catalog # 6528- 1 was used, following the manufacturer's instructions

The cDNA libraries used to isolate the cDNA clones encoding human PROl 88 wei e constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis. and cloned in a defined orientation into a suitable cloning vector (such as pRKB orpRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes etal , Science, 253 1278 1280 ( 1991 )) in the unique Xhol and Notl

Oligonucleotide probes based upon the above described EST sequence were then synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest and 2) foi use as probes to isolate a clone of the full-length coding sequence foi PRO 188 Foi ward and rev erse PCR primers generally range from 20-30 nucleotides and aie often designed to give a PCR product of about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In order to screen several libraries toi a full-length clone DNA from the hbi anes was screened by PCR amplification, as pei Ausubel el al , Current Piotocols in Molecular Biology, supia with the PCR pπmei pair A positive library was then used to isolate clones encoding the gene of interest using the pi obe oligonucleotide and one of the primer pairs The oligonucleotide sequences used were as follows

5 -CAGGTTATCCCAGAGATTTAATGCCACCA-3 (SEQ ID NO 17)

5'-TTGGTGGGAGAAGTTGCCAGATCAGGTGGTGGCA 3 (SEQ ID NO 18)

5'-TTCACACCATAACTGCATTGGTCCA-3' (SEQ ID NO 19)

A cDNA clone was identified and sequenced in entirety The entire nucleotide sequence of DNA28497- 1 1 30 is shown in Figures 7A-7B (SEQ ID NO 15) Clone DNA28497 1 130 contains a single open leading fiame with an appaient translational initiation site at nucleotide positions 449-451 , and a stop codon at nucleotide positions 1922 1924 (Figures 7A 7B, SEQ ID NO 1 ) The predicted polypeptide precursoi is 491 amino acids long The full length PRO 188 protein is shown in Figure 8 (SEQ ID NO 16)

Analysis of the full length PRO 188 sequence shown in Figure 8 (SEQ ID NO 16) evidences the presence of important polypeptide domains as shown in Figure 8, wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full length PRO! 88 sequence (Figure 8, SEQ ID NO 16) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 23, N-glycosylation sites from about ammo acid 160 to about amino acid 164 and from about amino acid 188 to about amino acid 192, a cAMP- and cGMP dependent protein kinase phosphorylation site from about am o acid 120 to about ammo acid 124, tyrosine kinase phosphorylation sites from about amino acid 173 to about amino acid 180 and from about amino acid 387 to about amino acid 396, N-myπstoylation sites from about amino acid 70 to about amino acid 76, from about amino acid 1 10 to about amino acid 1 16, from about amino acid 232 to about ammo acid 238, from about amino acid 343 to about amino acid 349, from about amino acid 400 to about amino acid 406 from about amino acid 467 to about ammo acid 473, and from about amino acid 475 to about amino acid 481 , and a fibπnogen beta and gamma chains C terminal domain signature from about amino acid 440 to about amino acid 453 Clone DNA28497 1 130 has been deposited with ATCC on September 18, 1997 and is assigned ATCC deposit no 209279 It is understood that the deposited clone has the actual correct sequence rather than the representations provided herein

An analysis of the Dayhoff database (version 35 45 SwιssProt 35), using the ALIGN 2 sequence alignment analysis of the full-length sequence shown in Figure 8 (SEQ ID NO 16), shows a 24% sequence identity between the PROl 88 amino acid sequence and both ligand 1 and ligand 2 of the TIE-2 receptor The abbreviation "ΗE is an acronym which stands for "tyrosine kinase containing Ig and EGF homology domains and was coined to designate a new family of receptor tyrosine kinases The fibnnogen domains of ligand 1 and ligand 2 of the TIE 2 receptoi are 64% identical and 40-43% identical to PROl 88 respectively

EXAMPLE 8 Isolation of cDNA clones encoding PRQ356

An expiessed sequence tag (EST) DNA database (LIFESEQ* Incyte Pharmaceuticals Palo Alto CA) was searched and an EST (#2939340) was identified that had homology to PRO 179 [identified in EXAMPLE 9 below and designated DNA16451 1078 (Figures 1 1 A 1 IB, SEQ ID NO 25)] To clone PR0356 a human fetal lung library prepared from mRNA purchased from Clontech Inc (Palo Alto CA) catalog#6528 1 w as used follow ing the manufacturer s instructions

The cDNA libraries used to isolate the cDNA clones encoding human PR0356 were consti ucted by standaid methods using commercially available reagents such as those horn Invitiogen San Diego CA The cDNA was primed with ohgo dT containing a Notl site linked w ith blunt to Sail hemikinased adaptois cleaved with Notl sized appropi lately by gel electrophoresis and cloned in a defined orientation into a suitable cloning v ectoi (such as pRKB oi pRKD, pRK5B is a precui soi ot pRK5D that does not contain the Stil site see Holmes et l , Science 253 1278 1280 ( 1991 )) the unique Xhol and Notl

[24 Oligonucleotide probes based upon the above described EST sequence were then synthesized 1 ) to identity bv PCR a cDNA library that contained the sequence of interest and 2) for use as probes to isolate a clone of the full length coding sequence tor PR0356 Forward and reverse PCR primers generally range from 20 30 nucleotides and aie often designed to give a PCR product of about 100 1000 bp in length The probe sequences are typically 40 55 bp in length In ordei to screen several libraries for a full length clone, DNA from the libraries was screened by PCR amplification as per Ausubel et al , Current Protocols in Molecular Biology supia with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pan The oligonucleotide sequences used were as follows 5 -TTCAGCACCAAGGACAAGGACAATGACAACT-3 (SEQ ID NO 22)

5 TGTGCACACTTGTCCAAGCAGTTGTCATTGTC 3 (SEQ ID NO 23)

5 GTAGTACACTCCATTGAGGTTGG-3 (SEQ ID NO 24)

A cDNA clone was identified and sequenced in entirety The entire nucleotide sequence of DNA47470 1 130 P 1 is shown Figures 9A-9B (SEQ ID NO 20) Clone DNA47470 1 130 P 1 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 215 217, and a stop codon at nucleotide positions 1253 1255 (Figures 9A 9B, SEQ ID NO 20) The piedicted polypeptide precursor is 346 amino acids long The full length PR0356 protein is shown in Figure 10 (SEQ ID NO 21 )

Analysis of the full-length PR0356 sequence shown in Figure 10 (SEQ ID NO 21 ) evidences the presence of important polypeptide domains as shown in Figure 10 wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PR0356 sequence (Figure 10, SEQ ID NO 21 ) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 26 N-glycosylation sites from about amino acid 58 to about amino acid 62 from about amino acid 253 to about amino acid 257 and from about amino acid 267 to about amino acid 271 a glycosaminoglycan attachment site from about amino acid 167 to about amino acid 171 a cAMP- and cGMP-dependent protein kinase phosphorylation site from about ammo acid 176 to about amino acid 180 N my l istoylation sites from about amino acid 168 to about amino acid 174 from about ammo acid 196 to about ammo acid 202, from about ammo acid 241 to about amino acid 247 from about amino acid 252 to about amino acid 258 from about amino acid 256 to about amino acid 262 and from about amino acid 327 to about amino acid 333 and a cell attachment sequence from about amino acid 199 to about ammo acid 202 Clone DNA47470 1 130-P 1 has been deposited with ATCC on October 28 1997 and is assigned ATCC deposit no 209422 It is undei stood that the deposited clone has the actual coirect sequence rather than the representations prov ided herein

An analysis of the Dayhoff database (version 35 45 SwissPiot 35) using the ALIGN 2 sequence alignment analysis ot the full-length sequence shown in Figure 10 (SEQ ID NO 21 ) shows amino acid sequence identity between the PR0356 amino acid sequence and both TIE 2L1 (32% ) and TIE 2L2 (34%) The abbiev iation ΗE is an acronym which stands toi tviosine kinase containing Ig and EGr homology domains and w as coined to designate a new family of receptoi tyrosine kinases EXAMPLE 9 Isolation of cDNA clones encoding PRO 179 A cDNA clone (DNA 16451 - 1078) encoding a native human PROl 79 polypeptide was identified using a yeast screen, in a human fetal liver library that preferentially represents the 5'ends of the primary cDNA clones Clone DNA 16451 - 1078 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 37-39, and a stop codon at nucleotide positions 1417-1419 (Figures 1 1 A- 1 1 B , SEQ ID NO 25 ) The predicted polypeptide precursor is 460 ammo acids long The full-length PRO 179 protein is shown in Figure 12 (SEQ ID NO 26)

Analysis of the full-length PRO 179 sequence shown in Figure 12 (SEQ ID NO 26) evidences the presence of important polypeptide domains as shown in Figure 12, wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PROl 79 sequence (Figure

12, SEQ ID NO 26) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 16, N-glycosylation sites from about ammo acid 23 to about amino acid 27, from about amino acid 1 15 to about ammo acid 1 19, from about amino acid 296 to about amino acid 300, and from about amino acid 357 to about ammo acid 361 , cAMP- and cGMP-dependent protein kinase phosphorylation sites from about amino acid

100 to about amino acid 104 and from about amino acid 204 to about amino acid 208, a tyrosine kinase phosphhorylation site from about amino acid 342 to about amino acid 348, N-myπstoylation sites from about amino acid 279 to about amino acid 285, from about am o acid 352 to about amino acid 358 and from about am o acid

367 to about amino acid 373, and leucine zipper patterns from about amino acid 120 to about amino acid 142 and from about amino acid 127 to about amino acid 149

Clone DNA16451 -1078 has been deposited with ATCC on September 18, 1997 and is assigned ATCC deposit no 209281 It is understood that the deposited clone has the actual correct sequence rather than the representations provided herein

An analysis of the Dayhoff database (version 35 45 SwissProt 35) using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 12 (SEQ ID NO 26) ev idenced the presence of a fibrmogen like domain exhibiting a high degree of sequence homology with the two known human ligands of the TIE 2 receptor (h-TIE-2Ll and h-TIE-2L2) The abbreviation "TIE ' is an acronym which stands tor "tyrosine kinase containing Ig and EGF homology domains' and was coined to designate a new family of receptor tyrosine kinases Accordingly, PRO 179 has been identified as a novel member of the TIE ligand family

EXAMPLE 10

Isolation of cDNA clones encoding PRO 197

PRO I 97 was identified by screening the GenBank database using the computer progiam BLAST (Altschul et al , Methods in Enzymology. 266 460-480 ( 1996)) The PRO 197 sequence w as shown to have homology with known EST sequences T08223 AA 122061 , and M62290 None of the know n EST sequences have been identified as full-length sequences, or described as ligands associated with ΗE ieceptoi s Following identification PRO 197 was cloned from a human fetal lung library prepared from mRNA pui chased tiom Clontech. Inc , (Palo Alto, CA) catalog # 6528- 1. following the manufacturer's instructions The library was screened by hybridization with synthetic oligonucleotide probes

The oligonucleotide sequences used were as follows

5'-ATGAGGTGGCCAAGCCTGCCCGAAGAAAGAGGC-3' (SEQ ID NO 32) 5'-CAACTGGCTGGGCCATCTCGGGCAGCCTCTTTCTTCGGG-3' (SEQ ID NO 33)

5'-CCCAGCCAGAACTCGCCGTGGGGA-3' (SEQ ID NO 34)

A cDNA clone was identified and sequenced in entirety The entire nucleotide sequence of DNA22780- 1078 is shown in Figure 13 (SEQ ID NO 30) Clone DNA22780-1078 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 23-25, and a stop codon at nucleotide positions 1382- 1384 (Figure 13, SEQ ID NO 30) The predicted polypeptide precursor is 453 amino acids long The full-length PRO 197 protein is shown in Figure 14 (SEQ ID NO 31 )

Analysis of the full-length PRO 197 sequence shown in Figure 14 (SEQ ID NO 31 ) evidences the presence of important polypeptide domains as shown in Figure 14, wherein the locations given for those important polypeptide domains are approximate as described above Analysis ot the full-length PROl 97 sequence (Figure 14, SEQ ID NO 31 ) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 13, a transmembrane domain from about amino acid 53 to about amino acid 70, an N-glycosylation site from about amino acid 224 to about amino acid 228, cAMP- and cGMP-dependent protein kinase phosphorylation sites from about amino acid 46 to about amino acid 50 and from about amino acid 1 18 to about amino acid 122, N- myπstoylation sites from about amino acid 50 to about amino acid 56, from about amino acid 129 to about ammo acid 135, from about amino acid 341 to about amino acid 347, and from about amino acid 357 to about amino acid 363, and a fibπnogen beta and gamma chains C-terminal domain signature from about amino acid 396 to about amino acid 409

Clone DNA22780-1078 has been deposited with ATCC on September 18, 1997 and is assigned ATCC deposit no 209284 It is understood that the deposited clone has the actual correct sequence rather than the representations provided herein

An analysis of the Dayhoff database (version 35 45 S wissPi ot 35). using the ALIGN-2 sequence alignment analy sis of the full-length sequence shown in Figure 14 (SEQ ID NO 1 ), evidenced homology between the

PRO 197 amino acid sequence and ligands associated with ΗE receptoi s The abbreviation "TIE" is an acronym which stands for "tyrosine kinase containing Ig and EGF homology domains" and was coined to designate a new family of receptor tyrosine kinases

EXAMPLE 1 1

Isolation ot cDNA clones encoding PRO 198

PRO 198 was identified by screening the GenBank database using the computer program BLAST (Altschul et al . Methods in Enzymology. 266 460-480 ( 1996)) The PRO 198 sequence was shown to have homology w ith known EST sequences T57280 and T50719 None ot the known EST sequences have been identified as full-length sequences, or described as ligands associated with TIE receptors Following identification, PRO 198 was cloned from a human fetal lung library prepared from mRNA purchased from Clontech, Inc , (Palo Alto CA) catalog # 6528 1 , following the manufacturei s instructions The library was screened by hybridization with synthetic oligonucleotide probes

The oligonucleotide sequences used were as follows 5 -TGGTTGGCAAAGGCAAGGTGGCTGACGATCCGG 3 (SEQ ID NO 37)

5 GTGGCCCTTATCTCTCCTGTACAGCTTCCGGATCGTCAGCCAC-3 (SEQ ID NO 38)

5 -TCCATTCCCACCTATGACGCTGACCCA-3 (SEQ ID NO 39)

A cDNA clone was identified and sequenced in entirety The entire nucleotide sequence of DNA33457 1078 is shown in Figure 15 (SEQ ID NO 35) Clone DNA33457 1078 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 33 35, and a stop codon at nucleotide positions 897 899 (Figure 15, SEQ ID NO 35) The predicted polypeptide precursor is 288 amino acids long The full-length PRO 198 protein is shown in Figure 16 (SEQ ID NO 36)

Analysis of the full-length PRO 198 sequence shown in Figure 16 (SEQ ID NO 36) evidences the presence of important polypeptide domains as shown in Figure 16 wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PR0198 sequence (Figure 16, SEQ ID NO 36) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 16, an N-glycosylation site from about amino acid 178 to about amino acid 182 a glycosaminoglycan attachment site from about ammo acid 272 to about amino acid 276, a tyrosine kinase phosphorylation site from about amino acid 188 to about amino acid 197, N myπstoylation sites from about ammo acid 16 to about amino acid 22, from about ammo acid 89 to about amino acid 95 from about amino acid 144 to about am o acid 150 and from about ammo acid 267 to about amino acid 273, and a fibπnogen beta and gamma chains C terminal domain signature from about amino acid 242 to about amino acid 255

Clone DNA33457 1078 has been deposited with ATCC on September 18 1997 and is assigned ATCC deposit no 209283 It is understood that the deposited clone has the actual correct sequence rathei than the representations provided herein

An analysis of the Dayhoff database (version 35 45 SwissPiot 35) using the ALIGN 2 sequence alignment analysis of the full-length sequence shown in Figure 16 (SEQ ID NO 36) evidenced homology between the

PRO 198 amino acid sequence and ligands associated with TIE receptois The abbieviation TIE is an acronym which stands for ' tyrosine kinase containing Ig and EGF homology domains and was coined to designate a new family of receptor tyrosine kinases

EXAMPLE 12

Isolation of cDNA clones encoding PRO 182

An expiessed sequence tag (EST) DNA database (LIFESEQ^ Incyte Pharmaceuticals Palo Alto CA) was searched and two Incyte EST sequences (Incyte EST no INC2328985 and Incyte EST no INC778319) wei e identitied that had appioximately 40% homology to a iegion ot the human relaxin nucleic acid sequence and represent sequences within a gene ot an insulin-like polypeptide To clone PRO 182 a human utei us hbi aiy piepared from mRNA purchased from Clontech, Inc , (Palo Alto, CA), catalog # 65237-1 was used, following the manufactuier s instructions The cDNA libraries used to isolate the cDNA clones encoding human PROl 82 were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precui sor of pRK5D that does not contain the Sfil site, see Holmes et al , Science, 253 1278-1280 (1991)) in the unique Xhol and Notl

Oligonucleotide probes based upon the above described EST sequences were then synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO 182 Forward and reverse PCR primers generally range from 20-30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology, supia, with the PCR pπmei pair A positive library was then used to isolate clones encoding the gene of interest The library was screened by hybridization with synthetic oligonucleotide probes based on the ESTs found in the database

The oligonucleotide sequences used were as follows

5'-CACATTCAGTCCTCAGCAAAATGAA-3' (SEQ ID NO 42)

5'-GAGAATAAAAACAGAGTGAAAATGGAGCCCTTCATTTTGC-3 (SEQ ID NO 43)

5'-CTCAGCTTGCTGAGCTTGAGGGA-3' (SEQ ID NO 44) A cDNA clone was identified and sequenced in entirety The entire nucleotide sequence of DNA27865- 1091 is shown in Figure 17 (SEQ ID NO 40) Clone DNA27865-1091 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 39-41 and a stop codon at nucleotide positions 444-446 (Figure 17, SEQ ID NO 40) The predicted polypeptide precursor is 135 amino acids long The full-length PRO 182 protein is shown m Figure 18 (SEQ ID NO 41 ) Analysis ot the full-length PROl 82 sequence shown in Figure 18 (SEQ ID NO 41 ) evidences the piesence ot important polypeptide domains as shown in Figure 18, wherein the locations given for those important polypeptide domains are approximate as described abov e Analysis of the full-length PRO 182 sequence (Figuie 18, SEQ ID NO 41 ) evidences the presence of the follow ing a signal peptide from about amino acid 1 to about amino acid 18 a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 107 to about amino acid 1 1 1 , N-myπstoylation sites fiom about amino acid 3 to about ammo acid 9 from about amino acid 52 to about amino acid 58, from about amino acid 96 to about amino acid 102 and from about ammo acid 125 to about amino acid 1 1 , and an insulin family signature from about amino acid 121 to about amino acid 136

Clone DNA27865- 1091 has been deposited with ATCC on Septembei 23 1997 and is assigned ATCC deposit no 209296 It is undeistood that the deposited clone has the actual coπect sequence rather than the representations provided herein

Based on an ALIGN-2 sequence alignment analysis of the f ull-length sequence shown in Figure 18 (SEQ ID NO 41 ), PROl 82 was homologous to but clearly diffeient (no exact matches) from any known member of the insulin family of proteins, and therefore PRO 182 constitutes a novel member of the insulin family of proteins

A phylogenetic analysis shows that PROl 82 is closely related to other well characterized human insulin and insulin-like polypeptides The insulin-like molecules share several characteristics They are each secreted proteins and each possesses a similar arrangement of six conserved cysteine residues Numerous additional amino acids are also generally conserved between members of the family indicating an evolutionary relationship

EXAMPLE 13 Isolation of cDNA clones encoding PROl 95 A clone designated herein as DNA13199_ABI2 was isolated as described in Example 2 above The DNA13199_ABI2 sequence was then compared to a variety of expressed sequence tag (EST) databases which included public EST databases (e g , GenBank) to identify existing homologies The homology search was performed using the computei program BLAST or BLAST2 (Altshul et al , Methods in Enzymolgy , 266 460-480 (1996)) Those comparisons resulting in a BLAST score of 70 (oi in some cases, 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington) The consensus sequence is herein designated DNA22778

Oligonucleotide probes were then generated from the DNA22778 molecule and used to screen a human placenta tissue library (LIB89) prepared as described in paragraph 1 ot Example 2 above The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-

1280 ( 1991 )) in the unique Xhol and Notl sites, and the cDNA size cut was less than 2800 bp The oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence tor PRO 195 Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100- 1000 bp in length The probe sequences are typically 40-55 bp in length In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology supia, with the PCR primer pair A positive hbi ary was then used to isolate clones encoding the gene of interest using the piobe oligonucleotide and one of the primer pan

A pair of PCR primers (foi ward and reverse) were synthesized forward PCR primer (22778 f ) 5'-ACAAGCTGAGCTGCTGTGACAG-3' (SEQ ID NO 47) reverse PCR primer (22778 r)

5'-TGATTCTGGCAACCAAGATGGC-3' (SEQ ID NO 48)

Additionally, a synthetic oligonucleotide hybridization probe was consti ucted from the consensus DNA22778 sequence which had the following nucleotide sequence hybridization probe (22778 p) 5^,-ATGGCCTTGGCCGGAGGTTCGGGGACCGCTTCGGCTGAAG-3 (SEQ ID NO 49)

DNA sequencing of the clones isolated as described abov e gav e the full-length DNA sequence foi PRO 195 and the derived protein sequence for PRO 195 The entne nucleotide sequence of DNA26847- 1395 is shown in Figure 19 (SEQ ID NO 45) Clone DNA26847-1395 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 70-72 and ending at the stop codon at nucleotide positions 1039- 1041 (Figure 19) The predicted polypeptide precursor is 323 amino acids long (Figure 20, SEQ ID NO 46) The full-length PRO 195 protein shown in Figure 20 has an estimated molecular weight of about 36,223 daltons and a pi of about 5 06

Analysis of the full-length PRO 195 sequence shown in Figure 20 (SEQ ID NO 46) evidences the presence of a variety of important polypeptide domains as shown in Figure 20, wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PRO 195 sequence (Figure 20, SEQ ID NO 46), evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 31 , a transmembrane domain from about amino acid 241 to about ammo acid 260, N- myπstoylation sites from about amino acid 28 to about amino acid 34, from about amino acid 29 to about amino acid 35, from about am o acid 31 to about amino acid 37, and from about amino acid 86 to about amino acid 92, and a potential N-glycosylation site from about amino acid 90 to about amino acid 94 The corresponding nucleotides can be routinely determined given the sequences provided herein Clone DNA26847- 1395 has been deposited with the ATCC on April 14, 1998 and is assigned ATCC deposit no 209772 Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 20 (SEQ ID NO 46), evidenced some degree ot sequence identity between the PRO 195 amino acid sequence and the following Dayhoff sequences PJP91380, AF0351 18_ 1 , HUMTROPCS , NUOD_SALTY and E70002

EXAMPLE 14 Isolation of cDNA clones encoding PRO200 An expressed sequence tag (EST) DNA database (LIFESEQ^rk), Incyte Pharmaceuticals. Palo Alto. CA) was searched and Incyte EST clone "INC 1302516" was identified that had homology to VEGF Probes based on the Incyte EST clone "INC 1302516" were used to screen a cDN A library derived from the human glioma cell line G61 In paiticulai. Incyte clone "INC 1302516' was used to generate the following toui probes

5'-ACTTCTCAGTGTCCATAAGGG-3' (SEQ ID NO 52)

5'-GAACTAAAGAGAACCGATACCATTTTCTGGCCAGGTTGTC-3' (SEQ ID NO 53) 5'-CACCACAGCGTTTAACCAGG-3 (SEQ ID NO 54)

5'-ACAACAGGCACAGTTCCCAC-3' (SEQ ID NO 55)

The cDN A hbrai les used to isolate the cDN A clones encoding human PRO200 were constructed by standard methods using commercially available reagents such as those fiom Invitrogen, San Diego. CA The cDNA was primed with ohgo dT containing a Notl site, linked w ith blunt to Sail hemikindsed dddptois, cleaved with Notl sized appiopnately by gel electrophoresis, and cloned in a defined orientation into d suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contdin the Sfil site, see. Holmes et al , Science 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl

A cDNA clone was identified and sequenced in entirety The entire nucleotide sequence of DNA29101 - 1 122 is shown in Figures 21 A-21 B (SEQ ID NO 50) Clone DNA29101 - 1 122 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 285-287, and a stop codon at nucleotide positions 1320- 1322 (Figures 21 A-2 IB, SEQ ID NO 50) The predicted polypeptide precursor is 345 amino acids long The full-length PRO200 protein is shown in Figure 22 (SEQ ID NO 51 )

Analysis of the full-length PRO200 sequence shown in Figure 22 (SEQ ID NO 51 ) evidences the presence of important polypeptide domains as shown in Figure 22, wherein the location given for those important polypeptide domains are appioximate as described above Analysis of the full-length PRO200 sequence (Figure 22, SEQ ID NO 51 ) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 14, N-glycosylation sites from about amino acid 25 to about amino acid 29, from about amino acid 55 to about amino acid 59, and from about amino acid 254 to about amino acid 258, N-myπstoylation sites from about amino acid 15 to about amino acid 21 , from about amino acid 1 17 to about amino acid 123, from about ammo acid 127 to about amino acid 133, from about amino acid 281 to about amino acid 287, from about amino acid 282 to about amino acid 288, and from about am o acid 319 to about amino acid 325, and an amidation site from about amino acid 229 to about amino acid 233

Clone DNA29101 -1 122 has been deposited with ATCC on March 5, 1998 and is assigned ATCC deposit no 209653 It is understood that the deposited clone has the actual correct sequence rather than the representations provided herein An analysis of the Dayhoff database (version 35 45 S wissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 22 (SEQ ID NO 51 ), evidenced some degree ot sequence identity between the PRO200 amino acid sequence and the vasculai endothehal cell growth factor (VEGF) and the bone morphogenetic protein (VEGF-E polypeptide)

EXAMPLE 1 Isolation of cDNA clones encoding PRQ21 1

A consensus DNA sequence was assembled relative to other EST sequences using phiap as described in Example 1 above This consensus sequence is herein designated DN A28730 Based on the DN A28730 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence ot interest, and 2) for use as probes to isolate a clone ot the full-length coding sequence for PR021 1 PCR primers (forward and ieverse) were synthesized based upon the DNA28730 sequence Additionally a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28730 sequence

In order to scieen several libraries for a souice of a full-length clone, DNA tiom the hbranes was scieened by PCR amplification with the PCR primer pan identified above A positive library was then used to isolate clones encoding the PR021 1 gene using the piobe oligonucleotide and one of the PCR pπmets The oligonucleotide sequences used in the abov e procedure were the following hybridization probe (28730 p)

5 - AGGG AGC ACGGAC AGTGTGC AGATGTGG ACGAGTGCTC ACTAGC A-3 ' (SEQ ID NO 58) forward PCR primer (28730 f ) 5'-AGAGTGTATCTCTGGCTACGC-3' (SEQ ID NO 59) reverse PCR primer (28730 r)

5'-TAAGTCCGGCACATTACAGGTC-3' (SEQ ID NO 60)

RNA for construction of the cDNA libraries was isolated from human fetal lung tissue The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-1280 ( 1991 )) in the unique Xhol and Notl sites

DNA sequencing of the clones isolated as described above gave the full length DNA sequence for PR021 1 [hei em designated as DNA32292- 1 131 ] (Figure 23, SEQ ID NO 56) and the derived pi otem sequence for PR021 1

The entire nucleotide sequence of DNA32292-1 131 is shown in Figure 23 (SEQ ID NO 56) Clone

DNA32292-1 131 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 65-67 and ending at the stop codon at nucleotide positions 1 124-1 126 (Figure 23) The predicted polypeptide precursor is 353 amino acids long (Figure 24, SEQ ID NO 57) The full-length PR021 1 protein shown in Figure 24 has an estimated molecular weight of about 38,190 daltons

Analysis of the full length PR021 1 sequence shown in Figure 24 (SEQ ID NO 57) ev idences the presence of important polypeptide domains as shown in Figure 24, wherein the locations given tor those important polypeptide domains are approximate as described above Analysis ot the full length PR021 1 sequence (Figure 24, SEQ ID NO 57) evidences the presence of the following a signal peptide fiom about ammo acid 1 to about ammo acid 24 N glycosylation sites from about ammo acid 190 to about amino acid 194 and from about amino a id 251 to about amino acid 255, glycosaminoglycan attachment sites from about amino acid 149 to about amino acid 153 and from about amino acid 155 to about amino acid 1 9, a cAMP- and cGMP dependent protein kinase phosphoiylation site from about amino acid 26 to about amino acid 30 a tyrosine kinase phosphorylation site from about amino acid 303 to about amino acid 310, N-myπstoylation sites from about amino acid 44 to about ammo acid 50, from about amino acid 54 to about amino acid 60 from about amino acid 55 to about amino acid 61 from about amino acid 81 to about amino acid 87, from about amino acid 150 to about amino acid 1 6, from about ammo acid 158 to about amino acid 164 from about amino acid 164 to about ammo acid 170 from about amino acid 252 to about amino acid 258 and from about am o acid 313 to about amino acid 319 an aspartic acid and aspai agine hydroxylation site fiom about amino acid 308 to about ammo acid 320, an EGF like domain cysteine pattern signature from about amino acid 166 to about amino acid 178 and a leucine zipper pattern fiom about amino acid 94 to about amino acid 1 16

Clone DNA32292 1 131 has been deposited with ATCC on Septembei 16, 1997 and is assigned ATCC deposit no. 209258.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 24 (SEQ ID NO:57), evidenced amino acid sequence identity between the PR021 1 amino acid sequence and the EGF-like polypeptides.

EXAMPLE 16 Isolation of cDNA clones encoding PRQ217 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above. This consensus sequence is herein designated DNA28760. Based on the DNA28760 consensus sequence, oligonucleotides were synthesized: 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0217. PCR primers (forward and reverse) were synthesized based upon the DNA28760 sequence. Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28760 sequence.

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0217 gene using the probe oligonucleotide and one of the PCR primers.

The oligonucleotide sequences used in the above procedure were the following: hybridization probe (28760. p)

5'-CCCACGATGTATGAATGGTGGACTTTGTGTGACTCCTGGTTTCTGCATC-3' (SEQ ID NO:63) forward PCR primer (28760.f)

5'-AAAGACGCATCTGCGAGTGTCC-3' (SEQ ID NO:64) reverse PCR primer (28760. r)

5'-TGCTGATTTCACACTGCTCTCCC-3' (SEQ ID NO:65) RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al, Science, 253: 1278-1280 ( 1991 )) in the unique Xhol and Notl sites.

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0217 [herein designated as DNA33094-1 131 ] (Figures 25A-25B, SEQ ID NO:61 ) and the derived protein sequence for PR0217.

The entire nucleotide sequence of DNA33094- 1 131 is shown in Figures 25A-25B (SEQ ID NO:61 ). Clone DNA33094-1 131 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 146-148 and ending at the stop codon at nucleotide positions 1283- 1285 (Figures 25A-25B). The predicted polypeptide precursor is 379 amino acids long (Figure 26; SEQ ID NO:62). The full-length PR0217 protein show n m Figure 26 has an estimated molecular weight ot about 41 ,520 daltons

Analysis of the full-length PR0217 sequence shown in Figure 26 (SEQ ID NO 62) evidences the presence of important polypeptide domains as shown in Figure 26, wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PR0217 sequence (Figure 26, SEQ ID NO 62) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 28, N-glycosylation sites from about amino acid 88 to about amino acid 92 and from about amino acid 245 to about ammo acid 249, a tyrosine kinase phosphorylation site from about amino acid 370 to about amino acid 378, N-myπstoylation sites from about amino acid 184 to about amino acid 190, from about amino acid 185 to about amino acid 191 , from about amino acid 189 to about amino acid 195, and from about amino acid 315 to about amino acid 321 , an ATP/GTP-binding site motif A (P-loop) from about amino acid 285 to about amino acid 293 , and EGF- hke domain cysteine pattern signatures from about amino acid 198 to about amino acid 210, from about amino acid 230 to about amino acid 242, from about amino acid 262 to about amino acid 274, from about amino acid 294 to about amino acid 306, and from about amino acid 326 to about ammo acid 338

Clone DNA33094-1 131 has been deposited with ATCC on September 16, 1997 and is assigned ATCC deposit no 209256

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 26 (SEQ ID NO 62), evidenced amino acid sequence identity between the PR0217 ammo acid sequence and the EGF-hke polypeptides

EXAMPLE 17 Isolation ot cDNA clones encoding PRQ219

A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above This consensus sequence is herein designated DNA28729 Based on the DNA28729 consensus sequence, oligonucleotides were synthesized 1 ) to identif by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone ot the full-length coding sequence for PR0219 PCR pπmei s (forward and reverse) were synthesized based upon the DNA28729 sequence Additionally , a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28729 sequence

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was scieened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0219 gene using the probe oligonucleotide and one of the PCR pπmei s The oligonucleotide sequences used in the above procedure were the following

toward PCR pπmer (28729 f )

5'-GTGACCCTGGTTGTGAATACTCC-3 (SEQ ID NO 68) reveise PCR primer (28730 r)

5'-ACAGCCATGGTCTATAGCTTGG-3' (SEQ ID NO 69) hybridization probe (28730 p)

5'-GCCTGTCAGTGTCCTGAGGGACACGTGCTCCGCAGCGATGGGAAG-3' (SEQ ID NO 70)

RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-1280 (1991 )) in the unique Xhol and Notl sites DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0219

[herein designated as DNA32290-1 164] (Figures 27A-27B, SEQ ID NO 66) and the derived protein sequence tor PR0219

The entire nucleotide sequence of DNA32290 1 164 is shown m Figures 27A-27B (SEQ ID NO 66) Clone DNA32290-1 164 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 204-206 and ending at the stop codon at nucleotide positions 2949-2951 (Figures 27A-27B) The predicted polypeptide precursor is 915 ammo acids long (Figure 28, SEQ ID NO 67)

Analysis of the full length PR0219 sequence shown in Figure 28 (SEQ ID NO 67) ev idences the presence of important polypeptide domains as shown in Figure 28, wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PR0219 sequence (Figure 28, SEQ ID NO 67) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 23, an N glycosylation site from about amino acid 221 to about ammo acid 225 cAMP- and cGMP dependent protein kinase phosphorylation sites from about amino acid 1 15 to about amino acid 1 19, from about amino acid 606 to about amino acid 610, and from about amino acid 892 to about amino acid 896, N myπstoylation sites from about amino acid 133 to about amino acid 139, fiom about am o acid 258 to about amino acid 291 from about amino acid 299 to about amino acid 305 from about amino acid 340 to about amino acid 346, fiom about amino acid 453 to about amino acid 459, from about amino acid 494 to about amino acid 500, from about amino acid 639 to about amino acid 645, from about ammo acid 690 to about amino acid 696, from about ammo acid 752 to about amino acid 758, and from about amino acid 792 to about amino acid 798, amidation sites from about amino acid 314 to about amino aacid 318, from about amino acid 560 to about amino acid 564 and from about amino acid 601 to about amino acid 605 and aspaitic acid and dsparagine hydroxylation sites from about dm o acid 253 to about amino acid 265, from about amino acid 294 to about amino acid 306, from about amino acid 335 to dbout amino acid 347, from about amino acid 376 to about amino dcid 388, from about amino acid 417 to about amino acid 429 from about amino acid 458 to about amino acid 470, from about dmino acid 540 to about dimno dcid 552 and from about ammo acid 581 to about amino acid 593 Clone DNA32290 1 164 has been deposited with ATCC on October 16, 1997 and is assigned ATCC deposit no 209384

An analysis ot the Dayhoff database (vei sion 35 45 SwissPiot 35), using the ALIGN 2 sequence alignment

.36 analysis ot the full-length sequence shown in Figure 28 (SEQ ID NO 67), evidenced amino acid sequence identity between the PR0219 amino acid sequence and the mouse and human matπlιn-2 precursor polypeptides

EXAMPLE 18

Isolation of cDNA clones encoding PRQ221 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in

Example 1 above This consensus sequence is herein designated DNA28756 Based on the DNA28756 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0221 PCR primers

(forward and reverse) were synthesized based upon the DNA28756 sequence Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28756 sequence

In order to screen seveial libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0221 gene using the probe oligonucleotide and one of the PCR primers The oligonucleotide sequences used in the above procedure were the following forward PCR primer (28756 f)

5'-CCATGTGTCTCCTCCTACAAAG-3' (SEQ ID NO 73) reverse PCR primer (28756 r)

5'-GGGAATAGATGTGATCTGATTGG-3' (SEQ ID NO 74) hybridization probe (28756 p) 5'-CACCTGTAGCAATGCAAATCTCAAGGAAATACCTAGAGATCTTCCTCCTG-3' (SEQ ID NO 75) RNA for construction of the cDNA libraries was isolated from human fetal lung tissue The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego. CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a piecursoi ot pRK5D that does not contain the Stil site, see, Holmes et al , Science. 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites

DNA sequencing of the clones isolated as desciibed above gave the full-length DNA sequence foi PR0221 [herein designated as DNA33089- 1 132] (Figure 29. SEQ ID NO 71 ) and the dei I ved pi otein sequence for PR0221 The entire nucleotide sequence of DNA33089- 1 132 is shown in Figuie 29 (SEQ ID NO 71 ) Clone DNA33089- 1 132 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 179- 181 and ending at the stop codon at nucleotide positions 956-958 (Figure 29) The predicted polypeptide precursor is 259 amino acids long (Figuie 30, SEQ ID NO 72) Clone DNA33089-1 132 has been deposited with ATCC on September 16, 1997 and is assigned ATCC deposit no 209262

Analysis of the full-length PR0221 sequence shown in Figure 30 (SEQ ID NO 72) ev idences the presence ot important polypeptide domains as shown in Figuie 30, wheiein the locations given toi those important polypeptide domains are appioxnnate as described above Analysis of the full-length PR0221 sequence (Figuie 30, SEQ ID NO 72), evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 33, a transmembrane domain from about amino acid 206 to about amino acid 225, N-glycosylation sites from about amino acid 47 to about am o acid 51 and from about amino acid 94 to about amino acid 98, a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 199 to about ammo acid 203, and N-myπstoylation sites from about amino acid 37 to about amino acid 43, from about amino acid 45 to about ammo acid 51 and from about amino acid 1 10 to about ammo acid 1 16

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 30 (SEQ ID NO 72), evidenced am o acid sequence identity between the PR0221 amino acid sequence and a member of the leucine rich repeat protein superfamily, including the SLIT protein

EXAMPLE 19 Isolation of cDNA clones encoding PRQ224 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above This consensus sequence is herein designated DNA30845 Based on the DNA30845 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA libiary that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0224 PCR primers (forward and reverse) were synthesized based upon the DNA30845 sequence Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30845 sequence

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0224 gene using the probe oligonucleotide and one of the PCR primers

The oligonucleotide sequences used in the above procedure were the following forward PCR primer

5'-AAGTTCCAGTGCCGCACCAGTGGC-3' (SEQ ID NO 78) reverse PCR pπmei

5'-TTGGTTCCACAGCCGAGCTCGTCG-3' (SEQ ID NO 79) hybridization probe

5^*-GAGGAGGAGTGCAGGATTGAGCCATGTACCCAGAAAGGGCAATGCCCACC-3 (SEQ ID NO 80) RNA tor construction ot the cDNA libraries was isolated from human fetal liver tissue The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially avdildble reagents such as those from Invitrogen, San Diego, CA The cDNA w as primed w ith Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursoi of pRK5D that does not contain the Sfil site, see, Holmes et al , Science. 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites

DNA sequencing ot the clones isolated as desciibed abov e gave the full-length DNA sequence for PR0224 [herein designated as DNA33221 - 1 133] (Figure 31 , SEQ ID NO 76) and the deπved protein sequence for PR0224

The entire nucleotide sequence of DNA33221 -1 133 is shown in Figure 31 (SEQ ID NO 76) Clone DNA33221 - 1 133 contains a single open reading frame with an appaient translational initiation site at nucleotide positions 33-35 and ending at the stop codon at nucleotide positions 879-881 (Figure 31 ) The predicted polypeptide precursor is 282 amino acids long (Figure 32, SEQ ID NO 77)

Analysis of the full-length PR0224 sequence shown in Figure 32 (SEQ ID NO 77) evidences the presence of important polypeptide domains as shown in Figure 32, wherein the locations given for those important polypeptide domains aie approximate as described above Analysis of the full-length PR0224 sequence (Figure 32, SEQ ID NO 77) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 30, a transmembrane domain from about amino acid 231 to about amino acid 248, N-glycosylation sites from about ammo acid 126 to about ammo acid 130, from about amino acid 195 to about amino acid 199 and from about amino acid 213 to about amino acid 217, N-myπstoylation sites from about amino acid 3 to about amino acid 9, from about amino acid 10 to about amino acid 16, from about amino acid 26 to about amino acid 32, from about amino acid 30 to about amino acid 36, from about amino acid 1 12 to about amino acid 1 18, from about amino acid 166 to about amino acid 172. from about amino acid 212 to about amino acid 218, from about amino acid 224 to about amino acid 230, from about am o acid 230 to about ammo acid 236, and from about amino acid 263 to about amino acid 269, a prokaryotic membrane lipoprotein lipid attachment site from about amino acid 44 to about amino acid 55, and a leucine zipper pattern from about amino acid 17 to about amino acid 39

Clone DNA33221 -1 133 has been deposited with ATCC on September 16, 1997 and is assigned ATCC deposit no 209263

An analysis of the Dayhoft database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis ot the full-length sequence shown in Figure 32 (SEQ ID NO 77), evidenced sequence identity of the

PR0224 am o acid sequence to very low-density lipoprotein receptors, apohpoprotein E receptor and chicken oocyte receptors P95 PR0224 has amino acid sequence identity to portions of these proteins in the range from 28% to 45%. and overall identity with these proteins in the iange from 33% to 39%

EXAMPLE 20 Isolation of cDNA clones encoding PRQ228 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 abov e This consensus sequence is herein designated DNA28758 An EST propπetaiy to Genentech, Inc , was employed in the consensus assembly, herein designated DNA21 51 Based on the DNA28758 consensus sequence, oligonucleotides were synthesized 1 ) to identity by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the f ull-length coding sequence for PR0228 Thiee PCR pπmers (forward and leverse) were synthesized based upon the DNA28758 sequence Additionally a synthetic oligonucleotide hybridization probe was constructed trom the consensus DNA28758 sequence In order to screen several libraπes tor a source ot a full-length clone, DNA from the libraries w as scieened by PCR amplification with the PCR primers identitied abov e A positive library was then used to isolate clones encoding the PR0228 gene using the probe oligonucleotide and one of the PCR primers

The oligonucleotide sequences used in the above procedure were the following forward PCR primer 1

5 GGTAATGAGCTCCATTACAG-3' (SEQ ID NO 83) forward PCR primer 2

5 -GGAGTAGAAAGCGCATGG-3 (SEQ ID NO 84) forward PCR primer 3

5 -CACCTGATACCATGAATGGCAG-3 (SEQ ID NO 85) reverse PCR primer 1 5 -CGAGCTCGAATTAATTCG 3' (SEQ ID NO 86) reverse PCR primer 2

5'-GGATCTCCTGAGCTCAGG-3 (SEQ ID NO 87) reverse PCR primer 3

5'-CCTAGTTGAGTGATCCTTGTAAG-3 (SEQ ID NO 88) hybridization probe

5 -ATGAGACCCACACCTCATGCCGCTGTAATCACCTGACACATTTTGCAATT 3 (SEQ ID NO 89)

RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue The cDNA libraπes used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis and cloned in a defined orientation into a suitable cloning vector (such as pRKB oi pRKD ρRK5B is a precursoi of pRK5D that does not contain the Sfil site, see. Holmes et al . Science, 253 1278-1280 ( 1991 )) in the unique Xhol and Notl sites

DNA sequencing of the clones isolated as described above gave the full length DNA sequence for PR0228 [herein designated as DNA33092-1202] (Figures 33A 33B SEQ ID NO 81 ) and the deπved protein sequence toi PR0228

The entire nucleotide sequence of DNA33092-1202 is shown in Figures 33 A 33B (SEQ ID NO 81 ) Clone DNA33092-1202 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 24 26 and ending at the stop codon at nucleotide positions 2094-2096 (Figuies 33 A 33B) The piedicted polypeptide pi ecursor is 690 amino acids long (Figure 34 SEQ ID NO 82)

Analysis of the full-length PR0228 sequence shown in Figure (SEQ ID NO 82) ev idences the presence ot important polypeptide domains as show n in Figure 34 wherein the locations giv en toi those important polypeptide domains are approximate as described above Analysis of the full length PR0228 sequence (Figuie 34, SEQ ID NO 82) evidences the presence of the following a signal peptide from about ammo acid 1 to about amino acid 19 transmembrane domains from about ammo acid 431 to about amino acid 450 tiom about ammo acid 494 to about amino acid 515, trom about amino acid 573 to about amino acid 594, tiom about ammo aicd 619 to about amino acid 636 and from about amino acid 646 to about amino acid 664, N-glycosv lation sites tiom about amino acid 15 to about amino acid 19, from about amino acid 21 to about amino acid 25, from about amino acid 64 to about am o acid 68, from about amino acid 74 to about amino acid 78, from about amino acid 127 to about amino acid 131 , from about amino acid 177 to about am o acid 181 , from about amino acid 188 to about amino acid 192, from about amino acid 249 to about amino acid 253, from about amino acid 381 to about ammo acid 385, and from about amino acid 395 to about amino acid 399, a glycosaminoglycan attachment site from about amino acid 49 to about ammo acid 53, a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 360 to about amino acid 364, tyrosine kinase phosphorylation sites from about amino acid 36 to about am o acid 44 and from about amino acid 670 to about amino acid 677, N-myπstoylation sites from about am o acid 38 to about amino acid 44, from about amino acid 50 to about amino acid 56, from about amino acid 52 to about am o acid 58, from about ammo acid 80 to about amino acid 86, from about amino acid 382 to about amino acid 388, trom about amino acid 388 to about amino acid 394, from about amino acid 434 to about amino acid 440, from about amino acid 480 to about amino acid 486, and from about amino acid 521 to about amino acid 527, and an aspartic acid and asparagine hydroxylation site from about ammo acid 75 to about amino acid 87

Clone DNA33092-1202 has been deposited with ATCC on October 28. 1997 and is assigned ATCC deposit no 209420

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 34 (SEQ ID NO 82), evidenced sequence identity of the PR0228 amino acid sequence to the secretin related proteins CD97 and EMR1 as well as the secretin member, latrophilm, thereby indicating that PR0228 may be a new member of the secretin related proteins

EXAMPLE 21

Isolation of cDNA clones encoding PRQ245 A consensus DNA sequence was assembled relative to other EST sequences using phrap as desci ibed in Example 1 above This consensus sequence is herein designated DNA30954 Based on the DNA30954 consensus sequence, oligonucleotides were synthesized 1 ) to identity by PCR a cDN A library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence foi PR0245 PCR primers (forward and reverse) weie synthesized based upon the DNA30954 sequence Additionally, a synthetic oligonucleotide hybridization piobe was consti ucted from the consensus DNA30954 sequence

In order to screen several libraries for a source ot a full-length clone. DNA from the libraries was scieened by PCR amplification with the PCR pi l er pair identified above A positive library was then used to isolate clones encoding the PR0245 gene using the probe oligonucleotide and one ot the PCR pπmei s The oligonucleotide sequences used in the above procedure were the following forward PCR primer

5'-ATCGTTGTGAAGTTAGTGCCCC-3' (SEQ ID NO 92) reverse PCR pπmei 5'-ACCTGCGATATCCA CAGAATTG-3' (SEQ ID NO 93) hybridization probe

5 -GGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCC-3' (SEQ ID NO 94)

RNA for construction of the cDNA libraries was isolated from human fetal liver tissue The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278 1280 (1991 )) in the unique Xhol and Notl sites DNA sequencing of the clones isolated as described above gave the full length DNA sequence for PR0245

[herein designated as DNA35638-1 141 ] (Figure 35, SEQ ID NO 90) and the derived protein sequence for PR0245 The entire nucleotide sequence of DNA35638 1 141 is shown in Figure 35 (SEQ ID NO 90) Clone DNA35638 1 141 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 89-91 and ending at the stop codon at nucleotide positions 1025 1027 (Figure 35) The predicted polypeptide precursor is 312 amino acids long (Figure 36, SEQ ID NO 91 )

Analysis of the full-length PR0245 sequence shown in Figure 36 (SEQ ID NO 91 ) evidences the presence of important polypeptide domains as shown in Figure 36 wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PR0245 sequence (Figuie

36, SEQ ID NO 91 ) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 20, a tiansmembrane domain from about amino acid 235 to about ammo acid 254 N-glycosylation sites from about am o acid 98 to about amino acid 102, from about amino acid 187 to about amino acid 191 Jrom about ammo acid 236 to about amino acid 240, and from about amino acid 277 to about amino acid 281 , N myπstoylation sites from about amino acid 182 to about amino acid 188, from about amino acid 239 to about amino acid 245 from about amino acid 255 to about amino acid 261 , from about amino acid 257 to about ammo acid 263, and from about ammo acid 305 to about amino acid 31 1 , and an amidation site trom about amino acid 226 to about amino acid 230

Clone DNA35638 1 141 has been deposited with ATCC on Septe bei 16 1997 and is assigned ATCC deposit no 209265

An analysis of the Dayhoff database (version 35 45 SwissPiot 35), using the ALIGN 2 sequence alignment analysis ot the full-length sequence shown in Figure 36 (SEQ ID NO 91 ) evidenced 60% sequence identity ot the PR0245 ammo acid sequence with the human c-myb protein and therefore PR0245 may be a new membei ot the transmembrane protein receptor tyrosine kinase family

EXAMPLE 22 Isolation of cDNA clones encoding PRQ246 A consensus DNA sequence was assembled relative to othei EST sequences using phiap as desci ibed in Example 1 above This consensus sequence is herein designated DNA30955 Based on the DNA30955 consensus sequence, oligonucleotides weie synthesized 1 ) to identify by PCR a cDNA libiaiy that contained the sequence of interest, and 2) for use as pi obes to isolate a clone of the full-length coding sequence tor PR0246 PCR primers (forward and reverse) were synthesized based upon the DNA30955 sequence Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30955 sequence

In order to screen several libraries for a source of a full-length clone, DNA trom the libraπes was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0246 gene using the probe oligonucleotide and one of the PCR primers

5'-AGGGTCTCCAGGAGAAAGACTC-3' (SEQ ID NO 97) reverse PCR primer

5'-ATTGTGGGCCTTGCAGACATAGAC-3' (SEQ ID NO 98) hybridization probe

5'-GGCCACAGCATCAAAACCTTAGAACTCAATGTACTGGTTCCTCCAGCTCC-3' (SEQ ID NO 99) RNA toi construction of the cDNA libraries was isolated from human fetal liver tissue The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278- 1280 (1991 )) in the unique Xhol and Notl sites

DNA sequencing of the clones isolated as described above gave the full-length DN sequence for PR0246 [herein designated as DNA35639- 1 172] (Figure 37. SEQ ID NO 95) and the derived protein sequence for PR0246

The entire nucleotide sequence of DNA35639- 1 172 is shown in Figure 37 (SEQ ID NO 95) Clone DNA35639-1 172 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 126- 128 and ending at the stop codon at nucleotide positions 1296-1298 (Figure 37) The predicted polypeptide precursor is 390 am o acids long (Figure 38, SEQ ID NO 96)

Analysis of the full-length PR0246 sequence shown in Figure 38 (SEQ ID NO 96) evidences the presence of important polypeptide domains as shown in Figuie 38, wherein the locations given tor those important polypeptide domains are approximate as described above Analysis of the full-length PR0246 sequence (Figuie 38, SEQ ID NO 96) evidences the presence of the following a signal peptide from about amino acid 1 to about am o acid 29. a transmembrane domain from about amino acid 244 to about amino acid 265, N-glycosylation sites from about amino acid 108 to about amino acid 1 12, from about amino acid 169 to about amino acid 173. tiom about amino acid 213 to about am o acid 217, trom about amino acid 236 to about amino acid 240. and trom about ammo acid 307 to about amino acid 31 1 , N-myi istoylation sites from about ammo acid 90 to about amino acid 96, from about amino acid 167 to about amino acid 173. trom about ammo acid 220 to about ammo acid 226 tiom about amino acid 231 to about amino acid 237, trom about amino acid 252 to about amino acid 258. tiom about amino acid 256 to about amino acid 262, from about amino acid 262 to about amino acid 268, trom about amino acid 308 to about am o acid 314, from about amino acid 363 to about amino acid 369. and from about amino acid 364 to about amino acid 370. and a prokaryotic membrane lipoprotein hpid attachment site trom about amino acid 164 to about amino acid 175

Clone DNA35639-1 172 has been deposited with ATCC on October 17, 1997 and is assigned ATCC deposit no 209396

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 38 (SEQ ID NO 96), evidenced sequence identity of the PR0246 amino acid sequence to the human cell surface protein HCAR, thereby indicating that PR0246 may be a novel cell surface virus receptor

EXAMPLE 23

Isolation of cDNA clones encoding PRQ258 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above This consensus sequence is herein designated DNA28746 Based on the DNA28746 consensus sequence, oligonucleotides were synthesized 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence foi PR0258 One forward PCR primer and two reverse PCR primers were synthesized based upon the DNA28746 sequence Additionally, two synthetic oligonucleotide hybridization probes were constructed from the consensus DNA28746 sequence

In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0258 gene using the probe oligonucleotide and one of the PCR pπmers The oligonucleotide sequences used in the above piocedure were the following forward PCR primer

5'-GCTAGGAATTCCACAGAAGCCC-3' (SEQ ID NO 102) reverse PCR primer 1 5'-AACCTGGAATGTCACCGAGCTG-3' (SEQ ID NO 103) reverse PCR primer 2

5'-CCTAGCACAGTGACGAGGGACTTGGC-3' (SEQ ID NO 104) hybridization probe 1

5 '- AAG ACAC AGCC ACCCTA A ACTGTC AGTCTTCTGGGAGC A AGCCTGC AGCC- 3 (SEQ ID NO 105) hybridization probe 2

5'-GCCCTGGCAGACGAGGGCGAGTACACCTGCTCAATCTTCACTATGCCTGT-3 (SEQ ID NO 106)

RNA for construction of the cDNA hbraπes was isolated trom human fetal lung tissue The cDNA hbi anes used to isolate the cDNA clones were consti ucted by standard methods using commeicially av ailable leagents such as those from Invitiogen. San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropi lately by gel electrophoresis, and cloned in a detined orientation into a suitable cloning vector (such as pRKB or pRKD. pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-1280 ( 1991 )) in the unique Xhol and Notl sites

DNA sequencing ot the clones isolated as described above gave the full-length DNA sequence for PR0258 [herein designated as DNA35918-1 174] (Figure 39, SEQ ID NO 100) and the derived protein sequence for PR0258

The entire nucleotide sequence of DNA35918-1 174 is shown in Figure 39 (SEQ ID NO 100) Clone DNA35918-1 174 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 147-149 and ending at the stop codon at nucleotide positions 1341 -1343 (Figure 39) The predicted polypeptide precursor is 398 amino acids long (Figure 40, SEQ ID NO 101 )

Analysis of the full-length PR0258 sequence shown in Figure 40 (SEQ ID NO 101 ) evidences the presence of important polypeptide domains as shown in Figure 40. wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PR0258 sequence (Figure 40, SEQ ID NO 101 ) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 20, a transmembrane domain from about amino acid 331 to about amino acid 352, N-glycosylation sites from about am o acid 25 to about amino acid 29 and from about amino acid 290 to about amino acid 294, N- myπstoylation sites from about amino acid 2 to about amino acid 8, from about amino acid 23 to about amino acid 29, from about amino acid 156 to about amino acid 162, from about amino acid 218 to about amino acid 224, trom about amino acid 295 to about amino acid 301 , from about ammo acid 298 to about amino acid 304, from about amino acid 306 to about am o acid 312, from about acid 334 to about amino acid 340, from about ammo acid 360 to about amino acid 366, from about amino acid 385 to about ammo acid 391 , and from about amino acid 386 to about amino acid 392, and a prokaryotic membrane lipoprotein hpid attachment site from about amino acid 7 to about amino acid 18

Clone DNA35918-1 174 has been deposited with ATCC on October 17, 1997 and is assigned ATCC deposit no 209402

An analysis of the Dayhoff database (version 35 45 SwissPi ot 35). using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 40 (SEQ ID NO 101 ) evidenced sequence identity of the PR0258 amino acid sequence to the CRTAM and the pohovirus receptoi and contains an Ig domain, thereby indicating that PR0258 is a new member of the Ig superfamily

EXAMPLE 24

Isolation ot cDNA clones encoding PRQ261

A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in

Example 1 above This consensus sequence is herein designated DNA30843 Based on the DNA30843 consensus sequence, oligonucleotides weie synthesized 1 ) to identify by PCR a cDNA hbiai that contained the sequence ot interest, and 2) tor use as pi obes to isolate a clone of the full-length coding sequence for PR0261 PCR pπmei s

(foi waid and reverse) were synthesized based upon the DNA30843 sequence Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30843 sequence

In order to screen several libraries tor a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0261 gene using the probe oligonucleotide and one ot the PCR primers The oligonucleotide sequences used in the above procedure were the following forward PCR primer

5'-AAAGGTGCGTACCCAGCTGTGCC-3' (SEQ ID NO 109) reverse PCR primer

5'-TCCAGTCGGCAGAAGCGGTTCTGG-3' (SEQ ID NO 1 10) hybridization probe

5'-CCTGGTGCTGGATGGCTGTGGCTGCTGCCGGGTATGTGCACGGCGGCTGGG-3' (SEQ ID NO 1 1 1 )

RNA for construction of the cDNA libraries was isolated from human fetal lung tissue The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278 1280 (1991 )) in the unique Xhol and Notl sites

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0261 [herein designated as DNA33473-1 176] (Figure 41 , SEQ ID NO 107) and the derived protein sequence tor PR0261

The entire nucleotide sequence of DNA33473-1 176 is shown in Figure 41 (SEQ ID NO 107) Clone DNA3 473 1 176 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 10 12 and ending at the stop codon at nucleotide positions 760 762 (Figure 41 ) The predicted polypeptide precursoi is 250 amino acids long (Figure 42 SEQ ID NO 108)

Analysis of the full-length PR0261 sequence shown in Figure 42 (SEQ ID NO 108) evidences the pi esence of important polypeptide domains as shown in Figure 42 whei ein the location giv en for those important polypeptide domains are approximate as described above Analysis of the full length PR0261 sequence (Figure 42 SEQ ID NO 108) evidences the presence ot the following a signal peptide from about amino acid 1 to about amino acid 23 N-myπstoylation sites from about amino acid 3 to about amino acid 9, from about amino acid 49 to about ammo acid 55, trom about amino acid 81 to about amino acid 87 fiom about amino acid 85 to about amino acid 91 , fiom about amino acid 126 to about amino acid 132 from about amino acid 164 to about amino acid 170 from about ammo acid 166 to about amino acid 172, trom about amino acid 167 to about amino acid 173, from about amino acid 183 to about amino acid 189, and from about amino acid 209 to about ammo acid 215, an insulin-like giow th factor binding proteins signature from about amino acid 49 to about amino acid 65 a von Willebi and C l domain from about amino acid 107 to about amino acid 124, a thiombospondin 1 site tiom about amino acid 201 to about amino acid 216, and an IGF binding protein site from about amino acid 49 to about ammo acid 58 Clone DNA33473- 1 176 has been deposited with ATCC on Octoberl 7, 1997 and is assigned ATCC deposit no 209391

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 42 (SEQ ID NO 108), evidenced sequence identity of the PR0261 am o acid sequence to the CTGF, thereby indicating that PR0261 is a novel growth tactoi

EXAMPLE 25 Isolation of cDNA clones encoding PRQ272 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above This consensus sequence is herein designated DNA36460 Based on the DNA36460 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0272 PCR pπmei (forward and reverse) were synthesized based upon the DNA36460 sequence Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA36460 sequence

In order to screen several libraπes for a souice of a full-length clone, DNA fiom the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0272 gene using the probe oligonucleotide and one of the PCR primers

The oligonucleotide sequences used in the above procedure were the following forward PCR primer (f 1 )

5'-CGCAGGCCCTCATGGCCAGG-3' (SEQ ID NO 1 14) forward PCR pπmei (f 2)

5'-GAAATCCTGGGTAATTGG-3' (SEQ ID NO 1 15) reverse PCR primer

5'-GTGCGCGGTGCTCACAGCTCATC-3' (SEQ ID NO 1 16) hybridization probe 5 -CCCCCCTGAGCGACGCTCCCCCATGATGACGCCCACGGGAACTTC-3

(SEQ ID NO 1 17)

RNA for construction of the cDNA libraries was isolated from human tetal lung tissue The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available ieagents such as those from Inv itrogen, San Diego CA The cDNA was primed with Notl site linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appiopnately by gel electrophoresis, and cloned in a detined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor ot ρRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278 1280 ( 1991 )) in the unique Xhol and Notl sites

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence tor PR0272 [herein designated as DNA40620- 1 183] (Figure 43 SEQ ID NO 1 12) and the denved protein sequence foi PR0272

The entire nucleotide sequence of DNA40620- 1 183 is shown in Figure 43 (SEQ ID NO 1 12) Clone DNA40620-1 183 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 35-37 and ending at the stop codon at nucleotide positions 1019-1021 (Figuie 43) The predicted polypeptide precursor is 328 amino acids long (Figure 44, SEQ ID NO 1 13)

Analysis of the full-length PR0272 sequence shown in Figure 44 (SEQ ID NO 1 13) evidences the presence of important polypeptide domains as shown in Figure 44, wherein the location given for those important polypeptide domains are approximate as described above Analysis ot the full-length PR0272 sequence (Figure 44, SEQ ID NO 1 13) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 20, an N-glycosylation site from about amino acid 140 to about amino acid 144, N-myπstoylation sites from about amino acid 263 to about ammo acid 269 and from about amino acid 31 1 to about amino acid 317, and an endoplasmic reticulum targeting sequence from about amino acid 325 to about amino acid 330

Clone DNA40620-1 183 has been deposited with ATCC on October 17, 1997 and is assigned ATCC deposit no 209388

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 44 (SEQ ID NO 1 13), evidenced sequence identity of the PR0272 ammo acid sequence to the human and mouse reticulocalbin proteins, thereby indicating that PR0272 may be a novel reticulocalbin protein

EXAMPLE 26 Isolation of cDNA clones encoding PRO301 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above This consensus sequence is herein designated DNA35936 Based on the DNA35936 consensus sequence oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence tor PRO301 PCR pπmei s (forward and reverse) were synthesized based upon the DNA35936 sequence Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA35936 sequence In order to screen several libraries for a source of a full-length clone, DNA trom the libraπes was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PRO301 gene using the probe oligonucleotide and one of the PCR pi imei

The oligonucleotide sequences used in the above procedure were the following forward PCR primer (35936 f 1 ) 5'-TCGCGGAGCTGTGTTCTGTTTCCC-3 (SEQ ID NO 120) forward PCR primer (35936 f2)

5'-ACACCTGGTTCAAAGATGGG-3 (SEQ ID NO 121 ) forward PCR primer (35936 f3)

5'-TTGCCTTACTCAGGTGCTAC-3' (SEQ ID NO 122) reveise PCR pnmer (35936 rl )

5'-TAGGAAGAGTTGCTGAAGGCACGG-3 (SEQ ID NO 123) reverse PCR primer (35936 r2)

5 -ACTCAGCAGTGGTAGGAAAG 3 (SEQ ID NO 124) hybridization probe (35936 p i )

5 TGATCGCGATGGGGACAAAGGCGCAAGCTCGAGAGGAAACTGTTGTGCCT 3 (SEQ ID NO 125)

RNA for construction ot the cDNA libraries was isolated from human fetal kidney tissue The cDNA libraπes used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen San Diego CA The cDNA was primed with Notl site linked with blunt to Sail hemikinased adaptors cleaved with Notl, sized appropriately by gel electrophoresis and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of ρRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278 1280 (1991 )) in the unique Xhol and Notl sites

DNA sequencing of the clones isolated as described above gave the full length DNA sequence for PRO301 [herein designated as DNA40628 1216] (Figure 45, SEQ ID NO 1 18) and the derived protein sequence for PRO301 The entire nucleotide sequence of DNA40628 1216 is shown in Figuie 45 (SEQ ID NO 1 18) Clone

DNA40628 1216 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 52 54 and ending at the stop codon at nucleotide positions 949 951 (Figure 45) The predicted polypeptide precursor is 299 amino acids long with a predicted molecular weight of approximately 32 583 daltons and a pi of about 8 29 (Figure 46 SEQ ID NO 1 19) Analysis of the full length PRO301 sequence shown in Figure 46 (SEQ ID NO 1 19) evidences the presence of important polypeptide domains as shown in Figure 46 wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full length PRO301 sequence (Figuie 46 SEQ ID NO 1 19) evidences the presence of the following a signal peptide trom about amino acid 1 to about amino acid 27 a transmembrane domain from about amino acid 235 to about amino acid 256 an N glycosylation site from about amino acid 185 to about amino acid 189 a cAMP and cGMP dependent protein kinase phosphorylation site from about amino acid 270 to about amino acid 274 and N myi istoylation sites fiom about amino acid 105 to about amino acid 1 1 1 from about amino acid 1 16 to about amino acid 122 from about amino acid 158 to about amino acid 164 from about amino acid 219 to about ammo acid 225 trom about ammo acid 237 to about ammo acid 243 and from about amino acid 256 to about amino acid 262 Clone DNA40628 1216 has been deposited with ATCC on Novembei 7 1997 and is assigned ATCC deposit no 209432

An analysis of the Dayhoff database (version 35 45 SwissProt 35) using the ALIGN 2 sequence alignment analysis of the full-length sequence shown in Figuie 46 (SEQ ID NO 1 19) ev idenced sequence identity of the PRO301 am o acid sequence to A33 antigen precursor (30%) and coxsackie and adenovnus receptoi protein (29%) EXAMPLE 27 Isolation of cDNA clones encoding PRQ322 A consensus DNA sequence was assembled relative to two EST sequences using phrap as described in Example 1 above The two EST sequences used were ' 2604309' and "1968970 , both from Incyte Pharamceuticals The assembled consensus sequence is herein designated "<consen01> ' Based on the "<consen()l>" consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence foi PR0322 PCR primers (forward and reverse) were synthesized based upon the "<consen01 >" consensus sequence Additionally, a synthetic oligonucleotide hybridization probe was constructed from the "<consen01 >" consensus sequence

In order to screen several libraries for a source of a full-length clone, DNA from the libraπes was screened by PCR amplification with the PCR primer pair identified abov e A positive library was then used to isolate clones encoding the PR0322 gene using the probe oligonucleotide and one of the PCR primers The oligonucleotide sequences used in the above procedure were the following forward PCR pπmei (f 1 )

5 -CAGCCTACAGAATAAAGATGGCCC-3 (SEQ ID NO 128) reveise PCR primer (r 1)

5'-GGTGCAATGATCTGCCAGGCTGAT-3 (SEQ ID NO 129) hybridization probe 5 -AGAAATACCTGTGGTTCAGTCCATCCCAAACCCCTGCTACAACAGCAG 3

(SEQ ID NO 130)

RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227) The cDNA libraries used to isolate the cDNA clones were consti ucted by standard methods using commercially available reagents such as those from Invitrogen San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor ot pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278 1280 ( 1991 )) in the unique Xhol and Notl sites

DNA sequencing ot the clones isolated as described above gave the lull-length DNA sequence for PR0322 [herein designated as DNA48336 1309] (Figure 47, SEQ ID NO 126) and the deπved piotein sequence foi PR0322

The entire nucleotide sequence of DNA48336-1309 is shown in Figuie 47 (SEQ ID NO 126) Clone DNA48336-1309 contains a single open reading fiame with an apparent translational initiation site at nucleotide positions 166 168 and ending at the stop codon at nucleotide positions 946 948 (Figuie 47) The piedicted polypeptide precursor is 260 amino acids long (Figuie 48 SEQ ID NO 127) The full length PR0322 piotein shown in Figure 48 has a calculated molecular weight ot appioximately 28 028 daltons and an estimated pi of approximately 7 87 Analysis ot the full-length PR0322 sequence shown in Figure 48 (SEQ ID NO 127) evidences the presence of important polypeptide domains as shown in Figure 48, wherein the locations given for those important polypeptide domains aie approximate as described above Analysis of the full length PR0322 sequence (Figure 48, SEQ ID NO 127), evidences the presence of the following a putative signal peptide from about am o acid 1 to about amino acid 23, a transmembrane domain fiom about amino acid 51 to about amino acid 71 , a glycosaminoglycan attachment site from about amino acid 155 to about amino acid 159, a tyrosine kinase phosphorylation site from about amino acid 182 to about amino acid 189, N-myπstoylation sites from about amino acid 19 to about amino acid 25, from about ammo acid 20 to about amino acid 26, from about amino acid 35 to about am o acid 41 , from about amino acid 60 to about amino acid 66, from about amino acid 149 to about amino acid 155, from about amino acid 195 to about amino acid 201 , from about amino acid 200 to about amino acid 206, from about ammo acid 204 to about amino acid 210, from about amino acid 220 to about amino acid 226, from about am o acid 229 to about am o acid 235, and from about amino acid 240 to about amino acid 246, a potential N-glycosylation site from about amino acid 1 10 to about amino acid 1 14, a serine proteases, trypsin family and histidine active site from about amino acid 69 to about amino acid 75, a consensus sequence from about amino acid 207 to about amino acid 217, and a kringle domain protein motif from about amino acid 205 to about amino acid 217

Clone DNA48336-1309 has been deposited with ATCC on March 1 1 , 1998 and is assigned ATCC deposit no 209669

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 48 (SEQ ID NO 127), evidenced sequence identity of the PR0322 amino acid sequence to neuropsin and other serine proteases, thereby indicating that PR0322 is a novel serine protease related to neuropsin

EXAMPLE 28

Isolation of cDNA clones encoding PRQ328 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in

Example ] abov e This consensus sequence is herein designated DNA35615 Based on the DNA35615 consensus sequence oligonucleotides were synthesized 1 ) to identity by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full length coding sequence for PR0328 PCR pπmeis

(forward and reverse) were synthesized based upon the DNA35615 sequence Additionally a synthetic oligonucleotide hybridization probe was consti ucted from the consensus DNA35615 sequence

In order to scieen several libraries for a source of a full length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0328 gene using the probe oligonucleotide and one ot the PCR pπmei s The oligonucleotide sequences used in the abov e procedure were the following forw aid PCR pπmei

5 -TCCTGCAGTTTCCTGATGC-3 (SEQ ID NO 1 3) reverse PCR primer

5'-CTCATATTGCACACCAGTAATTCG-3' (SEQ ID NO: 134) hybridization probe

5'-ATGAGGAGAAACGTTTGATGGTGGAGCTGCACAACCTCTACCGGG-3' (SEQ ID NO: 135)

RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al. Science, 253: 1278-1280 (1991 )) in the unique Xhol and Notl sites.

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0328 [herein designated as DNA40587-1231 ] (Figure 49, SEQ ID NO: 131 ) and the derived protein sequence for PR0328. The entire nucleotide sequence of DNA40587-1231 is shown in Figure 49 (SEQ ID NO: 131 ). Clone

DNA40587-1231 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 15-17 and ending at the stop codon at nucleotide positions 1404-1406 (Figure 49). The predicted polypeptide precursor is 463 amino acids long (Figure 50; SEQ ID NO: 132).

Analysis of the full-length PR0328 sequence shown in Figure 50 (SEQ ID NO: 132) evidences the presence of important polypeptide domains as shown in Figure 50, wherein the locations given for those important polypeptide domains are approximate as described above. Analysis of the full-length PR0328 sequence (Figure

50; SEQ ID NO: 132) evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 22; N-glycosylation sites from about amino acid 1 14 to about amino acid 1 18, from about amino acid

403 to about amino acid 407 and from about amino acid 409 to about amino acid 413; a glycosaminoglycan attachment site from about amino acid 439 to about amino acid 443; N-myristoylation sites from about amino acid

123 to about amino acid 129, from about amino acid 143 to about amino acid 149. from about amino acid 152 to about amino acid 158, from about amino acid 169 to about amino acid 175, from about amino acid 180 to about amino acid 186, from about amino acid 231 to about amino acid 237, and from about amino acid 250 to about amino acid 256; amidation sites from about amino acid 82 to about amino acid 86 and from about amino acid 172 to about amino acid 176; a peroxidase proximal heme-ligand signature from about amino acid 287 to about amino acid 298; an extracellular protein SCP/Tpx-l/Ag5/PR- l/Sc7 signature 1 from about amino acid 127 to about amino acid 138; and an extracellular protein SCP/Tpx- l/Ag5/PR-l/ScJ signature 2 from about amino acid 160 to about amino acid

172.

Clone DNA40587- 1231 has been deposited with ATCC on November 7, 1997 and is assigned ATCC deposit no. 209438.

An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 50 (SEQ ID NO: 132), evidenced sequence identity of the PR0328 amino acid sequence to the human ghoblastoma protein and to the cysteine rich secretory protein, thereby indicating that PR0328 may be a novel ghoblastoma protein or cysteine rich secretory protein

EXAMPLE 29 Isolation of cDNA clones encoding PR0331

A consensus DNA sequence was assembled relative to othei EST sequences using phrap as described in Example 1 above Based on the consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0331 PCR primers (forward and reverse) were synthesized based upon the consensus sequence Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus sequence

In order to screen several libraries for a source ot a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0331 gene using the piobe oligonucleotide and one of the PCR primers

5'-GCCTTTGACAACCTTCAGTCACTAGTGG-3' (SEQ ID NO 138) reverse PCR primer

5'-CCCCATGTGTCCATGACTGTTCCC-3' (SEQ ID NO 139) hybridization probe 5'-TACTGCCTCATGACCTCTTCACTCCCTTGCATCATCTTAGAGCGG-3'

(SEQ ID NO 140)

RNA for construction of the cDNA libraries was isolated from human fetal brain tissue The cDNA libranes used to isolate the cDNA clones weie constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a piecursor of pRK5D that does not contain the Stil site, see, Holmes et al , Science, 253 1278-1280 ( 1991 )) in the unique Xhol and Notl sites

DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0331 [herein designated as DNA40981 - 1234] (Figures 51 A-5 I B, SEQ ID NO 136) and the derived protein sequence for PR0331

The entire nucleotide sequence of DN A40981 - 1234 is shown in Figures 51 A-51 B (SEQ ID NO 1 36) Clone DNA40981 1234 contains a single open leading frame with an apparent translational initiation site at nucleotide positions 812-814 and ending at the stop codon at nucleotide positions 2732 2734 (Figures 51 A-51 B) The predicted polypeptide precursoi is 640 amino acids long (Figuie 52 SEQ ID NO 1 7) Analysis of the full-length PR0331 sequence shown in Figure 52 (SEQ ID NO 137) ev idences the presence ot important polypeptide domains as shown in Figure 52, wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PR0331 sequence (Figure 52, SEQ ID NO 137) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 44, a transmembrane domain from about amino acid 525 to about amino acid 545, N-glycosylation sites from about amino acid 278 to about amino acid 282 from about amino acid 364 to about amino acid 368 from about amino acid 390 to about amino acid 394, from about amino acid 412 to about amino acid 416, fiom about am o acid 415 to about amino acid 419 from about amino acid 434 to about amino acid 438, from about amino acid 442 to about amino acid 446, from about amino acid 488 to about amino acid 492, and from about amino acid 606 to about amino acid 610, a cAMP and cGMP dependent protein kinase phosphorylation site from about amino acid 183 to about amino acid 187, and N myπstoylation sites from about amino acid 40 to about amino acid 46 from about amino acid 73 to about amino acid 79, from about amino acid 1 18 to about amino acid 124 from about amino acid 191 to about amino acid 197, from about amino acid 228 to about amino acid 234, from about amino acid 237 to about amino acid 243, from about amino acid 391 to about amino acid 397, from about amino acid 422 to about amino acid 428, from about amino acid 433 to about amino acid 439, and from about amino acid 531 to about ammo acid 537 Clone DNA40981 1234 has been deposited with ATCC on November 21 1997 and is assigned ATCC deposit no 209489

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN 2 sequence alignment analysis of the full-length sequence shown in Figure 52 (SEQ ID NO 137), evidenced sequence identity of the PR0331 amino acid sequence to the LIG 1 protein, thereby indicating that PR0331 may be a novel LIG 1 related protein

EXAMPLE 30 Isolation of cDNA clones encoding PRQ364 An expressed sequence tag (EST) DNA database (LIFESEQ* Incyte Pharmaceuticals Palo Alto CA) w as searched and an Incyte EST sequence (Incyte EST no 3003460) was identified that had homology to membei s ot the tumor necrosis factor receptor (TNFR) family of polypeptides A consensus DNA sequence was then assembled relative to Incyte EST no 3003460 and other EST sequences and is herein designated as DNA44825

Oligonucleotide probes based upon the above described EST sequence were then synthesized 1 ) to identity by PCR a cDNA libiary that contained the sequence of interest and 2) tor use as probes to isolate a clone ot the full length coding sequence for PR0364 Forward and rev ei se PCR pnmei s generally lange from 20 to 30 nucleotides and are often designed to give a PCR product of about 1 0 1000 bp in length The probe sequences are typically 40-50 bp in length In order to screen libraries tor a full-length clone DNA tiom the libraπes w eie screened by PCR amplification as per Ausubel et l , Cui rent Piotocols in Molecular Biology supia w ith the PCR primer pan A positiv e libiary was then used to isolate clones encoding the gene of interest using the piobe oligonucleotide and one ot the pnmei pairs Pairs of PCR pi imers (foi ward and reveise) weie synthesized forward PCR primer (44825 f 1 )

5'-CACAGCACGGGGCGATGGG-3' (SEQ ID NO 143) forward PCR primer (44825 f2)

5'-GCTCTGCGTTCTGCTCTG-3' (SEQ ID NO 144) forward PCR primer (44825 GITR f )

5'-GGCACAGCACGGGGCGATGGGCGCGTTT-3' (SEQ ID NO 145) reverse PCR primer (44825 rl )

5'-CTGGTCACTGCCACCTTCCTGCAC-3' (SEQ ID NO 146) reverse PCR primer (44825 r2) 5'-CGCTGACCCAGGCTGAG-3' (SEQ ID NO 147) reverse PCR primer (44825 GITR r)

5'-GAAGGTCCCCGAGGCACAGTCGATACA-3' (SEQ ID NO 148)

Additionally, synthetic oligonucleotide hybridization probes were constructed from the DNA44825 consensus sequence hybridization probe (44825 pi )

5'-GAGGAGTGCTGTTCCGAGTGGGACTGCATGTGTGTCCAGC-3' (SEQ ID NO 149) hybridization probe (44825 GITR p)

5'-AGCCTGGGTCAGCGCCCCACCGGGGGTCCCGGGTGCGGCC-3' (SEQ ID NO 150)

RNA for construction of the cDNA libraries was isolated from human small intestine tissue (LIB231 ) The cDNA libraries used to isolate the cDNA clones w ere constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector tsuch as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al Science, 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites

A cDN A clone was identitied and sequenced in entirety The entire nucleotide sequence of DNA47365 1206 is shown in Figure 53 (SEQ ID NO 141 ) Clone DN 47365- 1206 contains a single open leading frame with an apparent translational initiation site at nucleotide positions 121 123, and a stop codon at nucleotide positions 844

846 (Figure 53, SEQ ID NO 141 ) The predicted polypeptide precursor is 241 ammo acids long The full-length PR0364 protein shown in Figure 54 has an estimated molecular weight of 26 000 daltons and a pi ot about 6 34

Analysis of the full-length PR0364 sequence shown in Figure 54 (SEQ ID NO 142) evidences the presence of a variety of important polypeptide domains as shown in Figure 54 wherein the locations given tor those important polypeptide domains are approximate as described abov e Analysis ot the full-length PR0364 sequence

(Figure 54, SEQ ID NO 142) evidences the presence ot the following a putative signal peptide tiom about amino acid 1 to about amino acid 25, a potential transmemhiane domain trom about amino acid 162 to about amino acid

180, a potential N-hnked glycosylation site trom about amino acid 146 to about amino acid 150 N-myπstoylation sites from about amino acid 5 to about amino acid 1 1 trom about ammo acid 8 to about amino acid 14, tiom about amino acid 25 to about amino acid 31 from about amino acid 30 to about am o acid 36 from about amino acid 33 to about amino acid 39 trom about amino acid 1 18 to about amino acid 124, fiom about amino acid 122 to about ammo acid 128, and trom about ammo acid 156 to about ammo acid 162, a prokaryotic membrane lipoprotein hpid attachment site from about ammo acid 166 to about ammo acid 177, and a leucine zipper pattern from about ammo acid 171 to about ammo acid 193

Clone DNA47365 1206 has been deposited with ATCC on November 7, 1997 and is assigned ATCC deposit no 209436 It is understood that the deposited clone has the actual coi rect sequence rather than the representations provided herein

Analysis of the amino acid sequence of the full length PR0364 polypeptide suggests that portions of it possess significant homology to members of the tumor necrosis factor receptor family, thereby indicating that PR0364 may be a novel member of the tumor necrosis factor receptor family Based on an ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 54 (SEQ ID NO 142) PR0364 evidences amino acid sequence homology with the mouse GITR protein reported by Nocentmi etal , Proc Natl Acad Sci USA 94 6216 6221 ( 1997) It is possible, therefore, that PR0364 represents the human counterpart to the mouse GITR protein reported by Nocentmi et al

EXAMPLE 31 Isolation of cDNA clones encoding PRQ366 A clone designated herein as DNA21705 was isolated as described in Example 2 and was found to have certain amino acid sequence similarity or homology with human TNFR1 Based on the DNA21705 sequence probes were generated and used to screen a human fetal lung library ("LIB25 ) Oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) tor use as probes to isolate a clone of the full length coding sequence for PR0366 Forward and rev erse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100 1000 bp in length The piobe sequences are typically 40 55 bp in length In order to screen several libraries tor a full length clone DNA from the libraries was screened by PCR amplification as per Ausubel et al Current Protocols in Molecular Biology supia, with the PCR primer pair A positive library was then used to isolate clones encoding the gene ot interest using the probe oligonucleotide and one of the primer pairs

DNA sequencing of the clones isolated as described above gave the f ull length DNA sequence for PR0366 and the derived protein sequence for PR0366 The entire nucleotide sequence of DNA33085-1 1 10 is shown in Figuie 55 (SEQ ID NO 151 ) Clone

DNA33085-1 1 10 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 193 195 and ending at the stop codon at nucleotide positions 970 972 (Figuie 55) The piedicted polypeptide precursor is 259 amino acids long (Figure 56 SEQ ID NO 152) and has a calculated molecular weight ot approximately 27,400 daltons Applicants have shown that the apparent translational initiation site may alternatively be assigned at nucleotide positions 73-75 (identified as amino acid residue -40) The nucleic acid sequences and encoding amino acid sequences comprising the apparent tianslational intitiation site at nucleotide positions 73-75 and ending at the stop codon at nucleotide positions 970-972 as well as variants thereof as detined above, are also contemplated to be within the scope of this invention

Sequence analysis indicated an N-terminal signal peptide from about am o acid 1 to about amino acid 29 a transmembrane domain from about amino acid 240 to about amino acid 259, N-glycosylation sites from about amino acid 77 to about amino acid 81 , from about amino acid 140 to about amino acid 144, and from about amino acid 156 to about amino acid 160, a cAMP- and cGMP-dependent piotein kinase phosphorylation site from about amino acid 126 to about amino acid 130, N-myπstoylation sites from about amino acid 56 to about amino acid 62, from about amino acid 72 to about amino acid 78, from about amino acid 1 14 to about amino acid 120, from about amino acid 154 to about amino acid 160, and from about amino acid 233 to about am o acid 239, two cysteine-rich domains, a sequence that contains four nearly identical 15 amino acid tandem repeats, and a hydrophobic C-terminal region The hydrophobic C-terminal region is preceded by a pair of small amino acids (Ala223 and Ala224), this structure and the absence of an apparent cytoplasmic domain suggests that PR0366 may be a glycosylphosphatidyhnositol (GPI) anchored protein [see, Moran, J Biol Chem . 266 1250-1257 ( 1991 ]

TNF receptor family proteins are typically characterized by the presence of multiple (usually four) cysteine rich domains in their extracellular regions - each cysteine-rich domain being approximately 45 amino acids long and containing appioximately 6, regularly spaced, cysteine residues Based on the crystal structure of the type 1 TNF receptor, the cysteines in each domain typically form thiee disulfide bonds in which usually cysteines 1 and 2, 3 and 5, and 4 and 6 are paired together Like DR4 and Apo-2 (described below), PR0366 contains two extracellular cysteine-rich pseudorepeats, whereas other identified mammalian TNFR family members contain three or more such domains [Smith et al , CeH, 76 959 ( 1994)]

Clone DNA33085-1 1 10 has been deposited with the ATCC on May 30, 1997 and is assigned an ATCC deposit no 209087 Regarding the sequence, it is understood that the deposited clone contains the correct sequence and the sequences provided herein are based on known sequencing techniques

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 56 (SEQ ID NO 152), evidenced sequence identity between the PR0366 amino acid sequence and the following PR0366 shows more sequence identity to DR4 (60%) and Apo-2 (50%) than to other apoptosis-lmked receptors, such as Apo-3, TNFR1 , or Fas/Apo- 1

EXAMPLE 32

Isolation of cDNA clones encoding PRQ535 Use ot the signal sequence algonthm described in Example 3 above allowed identification of an EST clustei sequence from the Incyte database, designated herein as ss clu 12694 mit This ss clu 12694 mit EST clustei sequence was then compaied to a variety of expressed sequence tag (EST) databases which included public EST databases (e g GenBank) and a propπetaiy EST DNA database (LIFESEQ*, Incyte Pharmaceuticals, Palo Alto,

CA) to identify existing homologies The homology search was performed using the computer piogram BLAST or BLAST2 (Altshul et al , Methods in Enzymology, 266 460-480 ( 1996)) Those compai isons resulting in a

BLAST score of 70 (or in some cases 90) or greater that did not encode know n pioteins were clustered and assembled into a consensus DNA sequence with the progiam phrap" (Phil Green, University of Washington Seattle, Washington) The consensus sequence obtained therefrom is herein designated DNA48352

In light of an observed sequence homology between the DNA48352 consensus sequence and an EST sequence encompassed within clone no H86994, from the Merck database clone H86994 was purchased and the cDNA insert was obtained and sequenced It was found herein that that insert encoded a full-length protein The sequence of this cDNA insert is shown in Figure 57 (SEQ ID NO 153) and is herein designated DNA49143- 1429

Clone DNA49143-1429 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 78-80 and ending at the stop codon at nucleotide positions 681 -683 (Figure 57) The predicted polypeptide precursor is 201 amino acids long (Figure 58, SEQ ID NO 154) The full-length PR0535 protein shown in Figure 58 has an estimated molecular weight of about 22,180 daltons and a pi of about 9 68

Analysis of the full-length PR0535 sequence shown in Figure 58 (SEQ ID NO 154) evidences the presence of a variety of important polypeptide domains as shown in Figure 58 wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PR0535 sequence evidences the presence of the following features a signal peptide fi om about amino acid 1 to about amino acid 25 a transmembrane domain from about amino acid 155 to about amino acid 174, a potential N-glycosylation site from about amino acid 196 to about amino acid 200, an N myπstoylation site from about amino acid 95 to about am o acid 100, an amidation site from about amino acid 1 19 to about amino acid 123, and FKBP type peptidyl-proly l cis trans isomer signature sequences from about amino acid 62 to about amino acid 78, from about amino acid 87 to about amino acid 123 and from about amino acid 128 to about ammo acid 141 Clone DNA49143 1429 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no 203013

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN 2 sequence alignment analysis of the full-length sequence shown in Figure 58 (SEQ ID NO 154) evidenced sequence identity between the PR0535 ammo acid sequence and the following Dayhoff sequences S71237, P_R935 1 PJR28980 S71238 FKB2_HUMAN, CELC05C8J , S55383, S72485, CELC50F2_6 and S75144

EXAMPLE 33

Isolation of cDNA clones encoding PRQ819 Use of the signal sequence algorithm described in Example 3 above allowed identification of an EST clustei sequence from the Incyte database, designated herein as 49605 This EST 49605 cluster sequence was then compared to a variety of expressed sequence tag (EST) databases which included public EST databases (t ς GenBank) and a proprietary EST DNA database (LIFESEQ^L Incyte Pharmaceuticals Palo Alto CA) to identity existing homologies The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al Methods in Enzymology 266 460 480 (1996)) Those comparisons resulting in a BLAST scoie ot 70 (or in some cases, 90) or greater that did not encode known pioteins were clustered and assembled into a consensus DNA sequence with the program phrap (Phil Gieen University of Washington Seattle Washington) The consensus sequence obtained therefrom is herein designated DNA56015

In light of an observed sequence homology between the DNA56015 consensus sequence and an EST sequence encompassed within clone no. H65785 from the Merck database, clone H65785 was purchased and the cDNA insert was obtained and sequenced. It was found herein that that insert encoded a full-length protein. The sequence of this cDNA insert is shown in Figure 59 (SEQ ID NO: 155) and is herein designated DNA57695- 1340. Clone DNA57695-1340 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 46-48 and ending at the stop codon at nucleotide positions 202-204 (Figure 59). The predicted polypeptide precursor is 52 amino acids long (Figure 60; SEQ ID NO: 156). The full-length PR0819 protein shown in Figure 60 has an estimated molecular weight of about 5,216 daltons and a pi of about 4.67.

Analysis of the full-length PR0819 sequence shown in Figure 60 (SEQ ID NO: 156) evidences the presence of a variety of important polypeptide domains as shown in Figure 60, wherein the locations given for those important polypeptide domains are approximate as described above. Analysis of the full-length PR0819 sequence evidences the presence of the following features: a signal peptide from about amino acid 1 to about amino acid 24; a potential N-myristoylation site from about amino acid 2 to about amino acid 8; and a region having homology to immunoglobulin light chain from about amino acid 5 to about amino acid 33. Clone DNA57695-1340 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no. 203006. An analysis of the Dayhoff database (version 35.45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 60 (SEQ ID NO: 156), evidenced sequence identity between the PR0819 amino acid sequence and the following Dayhoff sequences: HSU03899 , HUMIGLITEB , VG28_HSVSA, AF031522_1 , PAD l_YEAST and AF045484 .

EXAMPLE 34 Isolation of cDNA clones encoding PRQ826

Use of the signal sequence algorithm described in Example 3 above allowed identification of an EST cluster sequence from the Incyte database designated herein as 47283. This EST 47283 cluster sequence was then compared to a variety of expressed sequence tag (EST) databases which included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQ⁴'. Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al. Methods in Enzymology. 266:460-480 ( 1996)). Those comparisons resulting in a BLAST score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into a consensus DNA sequence with the program "phrap" (Phil Green, University of Washington, Seattle. Washington). The consensus sequence obtained therefrom is herein designated DNA56000. In light of an observed sequence homology between the DN A56000 consensus sequence and an EST sequence encompassed within clone no. W69233, from the Merck database, clone no. W69233 was purchased and the cDNA insert was obtained and sequenced. It was found herein that that insert encoded a full-length protein. The sequence of this cDNA insert is shown in Figure 61 (SEQ ID NO: 157) and is herein designated DNA57694- 1341 .

Clone DNA57694-1341 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 13- 15 and ending at the stop codon at nucleotide positions 310-312 (Figure 61 ). The predicted polypeptide precursor is 99 amino acids long (Figure 62. SEQ ID NO: 158). The full-length PR0826 protein shown in Figure 62 has an estimated molecular weight of about 1 1 ,052 daltons and a pi of about 7 47

Analysis ot the full-length PR0826 sequence shown in Figure 62 (SEQ ID NO 158) evidences the presence of a variety of important polypeptide domains as shown in Figure 62, wherein the locations given for those important polypeptide domains are approximate as described above Analysis ot the full-length PR0826 sequence evidences the presence of the following features a signal peptide from about amino acid 1 to about amino acid 22, potential N-myπstoylation sites from about amino acid 22 to about amino acid 28 and from about ammo acid 90 to about amino acid 96, and an amino acid sequence block having homology to peroxidase from about amino acid 16 to about amino acid 48

Clone DNA57694-1341 was deposited with the ATCC on June 23, 1998, and is assigned ATCC deposit no 203017

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 62 (SEQ ID NO 158), evidenced sequence identity between the PR0826 amino acid sequence and the following Dayhoff sequences CCU 12315_1 , SCU96108_6, CELF39F10_4 and HELT_HELHO

EXAMPLE 35

Isolation of cDNA clones encoding PROl 160 A consensus DNA sequence was assembled relative to other EST sequences using phrap as described in Example 1 above The consensus sequence is herein designated DNA40650 Based on this DNA40650 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PRO 1 160 PCR primers (forward and reverse) were synthesized based upon the DNA40650 consensus sequence Additionally, a synthetic oligonucleotide hybridization probe was constructed from the DNA40659 consensus sequence

In order to screen several libraries for a source of a full-length clone, DNA from the libraπes was screened by PCR amplification as per Ausubel. et al , Current Protocols in Molecular Biology , supia. with the PCR pπmei pair identified above A positive library was then used to isolate clones encoding the PRO l 160 gene using the probe oligonucleotide and one of the PCR primers

The oligonucleotide sequences used in the above piocedure were the following forward PCR primer (40650 f 1 )

5'-GCTCCCTGATCTTCATGTCACCACC-3' (SEQ ID NO 161 ) reverse PCR pπmei (40650 rl )

5'-CAGGGACACACTCTACCATTCGGGAG-3' (SEQ ID NO 162) hybridization probe (40650 p i )

5'-CCATCTTTCTGGTCTCTGCCCAGAATCCGACAACAGCTGCTC 3 (SEQ ID NO 163) RNA tor construction of the cDNA libraries was isolated fi om human breast tissue The cDNA hbiaπes used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego. CA The cDNA was primed with Notl site linked with blunt to Sail hemikinased adaptors, cleaved with Notl. sized appiopnately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor ot pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites DNA sequencing ot the clones isolated as described above gave the full-length DNA sequence for PRO 1 160

[herein designated as DNA62872-1509] (Figuie 63, SEQ ID NO 159) and the derived protein sequence tor PROl 160

The entire nucleotide sequence of DNA62872-1509 is shown m Figure 63 (SEQ ID NO 159) Clone DNA62872-1509 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 40-42 and ending at the stop codon at nucleotide positions 310-312 (Figure 63) The predicted polypeptide precursor is 90 amino acids long (Figure 64, SEQ ID NO 160) The full-length PROl 160 protein shown in Figure 64 has an estimated molecular weight of about 9,039 daltons and a pi of about 4 37

Analysis of the full-length PROl 160 sequence shown in Figure 64 (SEQ ID NO 160) evidences the presence of a variety of important polypeptide domains as shown in Figure 64, wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PRO 1 160 sequence evidences the presence of the following features a signal peptide from about amino acid 1 to about amino acid 19, and a protein kinase C phosphorylation site from about amino acid 68 to about amino acid 70 Clone DNA62872- 1509 has been deposited with ATCC on August 4, 1998 and is assigned ATCC deposit no 203100

An analysis of the Dayhoff database (vei sion 35 45 SwissProt 35). using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 64 (SEQ ID NO 160) evidenced sequence identity of the PROl 160 ammo acid sequence to the following Dayhoff sequences B30305, GEN13490, 153641 , S53363, HA34JBRELC, SP96_DICDI, S36326, SSU51 197 0 MUC 1 _XENLA TCU32448_1 and AF000409J

EXAMPLE 36 Isolation ot cDNA clones encoding PRO 1 186 Use of the signal sequence algorithm described in Example 3 above allowed identification ot an EST clustei sequence from the Incyte database This Incyte EST cluster sequence was then compared to a variety of expressed sequence tag (EST) databases which included public EST databases (e g GenBank) and a proprietary EST DNA database (LIFESEQ^®, Incyte Pharmaceuticals, Palo Alto, CA) to identity existing homologies The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al . Methods in Enzymology 266 460-480 (1996)) Those comparisons resulting in a BLAST scoie of 70 (oi in some cases, 90) or greater thai did not encode known proteins were clustered and assembled into a consensus DNA sequence with the program "phrap^" (Phil Green. Univeisity of Washington. Seattle Washington) The consensus sequence obtained theiefiom is herein designated DNA56748

In light of an observed sequence homology between the DNA56748 consensus sequence and an EST sequence no 3476792 encompassed within a clone (from a library constructed tiom ovarian tissue) including this Incyte

EST, identified from the Incyte database, the Incyte clone including Incyte EST no 3476792 was pui chased and the cDNA insert was obtained and sequenced It was found herein that that insert encoded a full-length protein The sequence of this cDNA insert is shown in Figure 65 (SEQ ID NO 164) and is herein designated DNA60621 - 1516

Clone DNA60621 -1516 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 91 -93 and ending at the stop codon at nucleotide positions 406-408 (Figure 65) The predicted polypeptide precursor is 105 amino acids long (Figure 66, SEQ ID NO 165) The full-length PROl 186 protein shown in Figure 66 has an estimated molecular weight of about 1 1 ,715 daltons and a pi of about 9 05

Analysis of the full-length PRO 1 186 sequence shown in Figure 66 (SEQ ID NO 165) evidences the presence of important polypeptide domains as shown in Figure 66, wherein the locations given for those important polypeptide domains are approximate as described above Analysis of the full-length PROl 186 sequence evidences the presence of a signal peptide from about amino acid 1 to about ammo acid 19, a tyrosine kinase phosphorylation site from about amino acid 88 to about amino acid 95, and N-myπstoylation sites from about amino acid 33 to about amino acid 39, from about amino acid 35 to about amino acid 41 , and from about amino acid 46 to about amino acid 52 Clone DNA60621 -1516 was deposited with the ATCC on August 4, 1998, and is assigned ATCC deposit no 203091

An analysis of the Dayhoff database (version 35 45 SwissProt 35), using the ALIGN-2 sequence alignment analysis of the full-length sequence shown in Figure 66 (SEQ ID NO 165), evidenced sequence identity between the PROl 186 amino acid sequence and the following Dayhoff sequences VPRA_DENPO, LFE4_CHICK, AF034208_1 , AF030433 , A55035, COLJRABIT, CELB0507_9, S67826 , S34665 and CRU73817

EXAMPLE 37

Isolation of cDNA clones encoding PRO 1246 Use of the signal sequence algorithm described in Example 3 above allowed identification of an EST clustei sequence from the Incyte database, designated Incyte EST clustei sequence no 56853 This Incyte EST clustei sequence no 56853 was then compared to a variety of expressed sequence tag (EST) databases which included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ⁰, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al , Methods in Enzymology. 266 460-480 ( 1996)) Those comparisons resulting in a BLAST score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into a consensus DNA sequence with the program ' phrap" (Phil Green, University of Washington Seattle, Washington) The consensus sequence obtained theietrom is heiein designated DNA56021

In light ot an observed sequence homology between the DN A56021 consensus sequence and an EST sequence encompassed within clone no 2481345. from the Incyte database, clone no 2481345 was purchased and the cDNA insert was obtained and sequenced It was found herein that that insert encoded a full-length protein The sequence of this cDNA insert is shown in Figures 67A-67B (SEQ ID NO 166) and is herein designated DNA64885- 1529 Clone DNA64885-1529 contains a single open leading fume with an apparent translational initiation site at nucleotide positions 1 19- 121 and ending at the stop codon at nucleotide positions 1727- 1729 (Figuies 67A-67B) The predicted polypeptide precursor is 536 amino acids long (Figure 68, SEQ ID NO 167) The full length PRO 1246 protein shown in Figure 68 has an estimated molecular weight of about 61 ,450 daltons and a pi ot about 9 17

Analysis ot the full-length PRO 1246 sequence shown in Figure 68 (SEQ ID NO 167) evidences the presence of a variety of important polypeptide domains as shown in Figure 68 wherein the locations given tor those important polypeptide domains are approximate as described above Analysis of the full-length PROl 246 sequence evidences the presence of the following features a signal peptide from amino acid 1 to about amino acid 15, a transmembrane domain from about amino acid 347 to about amino acid 365, potential N-glycosylation sites from about amino acid 108 to about amino acid 1 12, from about ammo acid 166 to about amino acid 170, from about amino acid 193 to about amino acid 197, from about amino acid 262 to about amino acid 266, from about amino acid 375 to about amino acid 379, from about amino acid 413 to about amino acid 417, and from about amino acid 498 to about amino acid 502, tyrosine kinase phosphorylation sites from about am o acid 103 to about ammo acid 1 10 and trom about amino acid 455 to about amino acid 462, N myπstoylation sites from about amino acid 104 to about amino acid 1 10, from about amino acid 344 to about amino acid 350, from about amino acid 348 to about amino acid 354 trom about amino acid 409 to about amino acid 415, and from about amino acid 496 to about amino acid 502, and ammo acid sequence blocks having homology to sulfatase proteins from about ammo acid 286 to about amino acid 315, from about amino acid 359 to about am o acid 369 and from amino acid 78 to about amino acid 97 Clone DNA64885 1529 was deposited with the ATCC on November 3, 1998, and is assigned ATCC deposit no 203457 An analysis of the Dayhoff database (version 35 45 SwissProt 35) using the ALIGN 2 sequence alignment analysis of the full-length sequence shown in Figure 68 (SEQ ID NO 167) evidenced sequence identity between the PR01246 amino acid sequence and the following Dayhoff sequences P_R51355, CELK09C4_1 BCU44852 IDSJrIUMAN G65169, E64903, ARSA_HUMAN GL6S_HUMAN, HSARSF_1 and GEN 12648

EXAMPLE 38 Stimulation of Endothehal Cell Proliferation Assay #8

This assay is designed to determine whether PRO polypeptides of the present invention show the ability to stimulate adrenal cortical capillary endothehal cell (ACE) growth PRO polypeptides testing positive in this assay would be expected to be useful for the therapeutic treatment ot conditions or disorders where angiogenesis would be beneficial including, for example wound healing, and the like (as would agonists ot these PRO polypeptides) Antagonists ot the PRO polypeptides testing positive in this assay would be expected to be usetul for the therapeutic treatment ot cancerous tumors PROl 186 showed positive results in this assav

Bovine adienal cortical capillary endothehal cells (ACE) (tiom primary cultuie maximum of 12 14 passages) weie plated in 96 well plates at 500 cells/well per l OO microhter Assay media included low glucose DMEM 10% calf serum 2 mM glutamιne and l X penicillin/stieptomycm/tungizone Control wells included the following ( 1 ) no ACE cells added, (2) ACE cells alone, (3) ACE cells plus VEGF (5 ng/ml) and (4) ACE cells plus FGr

(5ng/ml) The control or test sample, (in 100 microhter volumes) was then added to the wells (at dilutions ot 1 %

[ 63 0 1 % and 0 01 %, respectively) The cell cultures were incubated for 6-7 days at 37°C/5% CO, After the incubation, the media in the wells was aspirated, and the cells were washed IX with PBS An acid phosphatase reaction mixture ( 100 microhter, 0 1M sodium acetate, pH 5 5 0 1 % Triton X- 100 10 mM p-mtrophenyl phosphate) was then added to each well After a 2 hour incubation at 37 °C, the reaction was stopped by addition of 10 microhters 1 N NaOH Optical density (OD) was measured on a microplate reader at 405 nm

The activity of PROl 186 was calculated as the fold increase in proliferation (as determined by the acid phosphatase activity, OD 405 nm) relative to ( 1 ) cell only background, and (2) relative to maximum stimulation by

VEGF VEGF (at 3-10 ng/ml) and FGF (at 1 -5 ng/ml) were employed as an activity reference for maximum stimulation Results of the assay were considered "positive" if the observed stimulation was > 50% increase over background

PROl 186 assayed "positive" as follows 1 % dilution = 1 75 fold stimulation

0 1 % dilution = 1 39 fold stimulation

0 01 % dilution = 1 28 fold stimulation Compared to VEGF (5 ng/ml) control

1 % dilution = 1 24 fold stimulation Compared to FGB (5 ng/ml) control

1 % dilution = 1 46 fold stimulation

EXAMPLE 39 Inhibition of Vascular Endothehal Growth Factor (VEGF) Stimulated Proliferation ol Endothehal Cell Growth

Assay #9 The ability of various PRO polypeptides to inhibit VEGF stimulated proliferation of endothehal cells was tested Polypeptides testing positive m this assay are useful for inhibiting endothehal cell growth in mammals where such an effect would be beneficial, e g , for inhibiting tumor growth Specifically, bovine adrenal cortical capillary endothehal cells (ACE) (from primary culture, maximum of

12- 14 passages) were plated in 96-weIl plates at 500 cells/well pei 100 microhtei Assay media included low glucose DMEM. 10% calf serum, 2 mM glutamine, and I X penicillm/streptomycin/tungizone Contiol wells included the following (1 ) no ACE cells added, (2) ACE cells alone, (3) ACE cells plus 5 ng/ml FGF, (4) ACE cells plus 3 ng/ml VEGF, (5) ACE cells plus 3 ng/ml VEGF plus 1 ng/ml TGF-bet a and (6) ACE cells plus 3 ng/ml VEGF plus 5 ng/ml LIF The test samples, poly-his tagged PRO polypeptides (in 100 miciolitei volumes), weie then added to the wells (at dilutions of 1 %. 0 1 % and 0 01 %, lespectively) The cell cultuies weie incubated foi 6-7 days at 37°C/5% CO, Attei the incubation the media in the wells w as aspirated, and the cells weie washed IX w ith PBS An acid phosphatase reaction mixtuie ( 100 miciolitei 0 1 M sodium acetate pH 5 5, 0 1 % Triton X-100, 10 mM p-mtrophenyl phosphate) was then added to each well Attei a 2 houi incubation at 37 °C the reaction was stopped by addition of 10 microhtei s 1 N NaOH Optical density (OD) was measured on a microplate reader at 405 nm The activity of PRO polypeptides was calculated as the percent inhibition of VEGF (3 ng/ml) stimulated proliferation (as determined by measuring acid phosphatase activity at OD 405 nm) relative to the cells without stimulation TGF-beta was employed as an activity reference at 1 ng/ml, since TGF-beta blocks 70-90% of VEGF- stimulated ACE cell proliferation The results, as shown in TABLE4 below, are indicative of the utility of the PRO polypeptides in cancer therapy and specifically in inhibiting tumor angiogenesis The numerical values (relative inhibition) shown in TABLE 4 are determined by calculating the percent inhibition of VEGF stimulated proliferation by the PRO polypeptides relative to cells without stimulation and then dividing that percentage into the percent inhibition obtained by TGF-β at 1 ng/ml which is known to block 70-90% of VEGF stimulated cell proliferation The results are considered positive if the PRO ploypeptide exhibits 30% or greater inhibition of VEGF stimulation of endothehal cell growth (relative inhibition 30% or greater)

TABLE 4 Inhibition of VEGF Stimilated Endothehal Cell Growth

PRO Name PRO Concentration Relative % Inhibition

PRO 172 0.01% 90.0 PRO 172 0.10% 95.0

PRO 172 1.00% 67.0

PRO 175 0.01% 100.0 PRO 175 0.10% 82.0 PRO 175 1.00% 31.0

PRO 175 0.01% 73.0 PRO 175 0.10% 37.0 PRO 175 1.00% 16.0

PROl 78 0.01% 101.0

PROl 78 0.10% 101.0 PR0178 1.00% 54.0

PROl 88 0.01% 35.0 PRO 188 0.10% 34.0 PRO 188 1.00% 82.0

PROl 88 0.01% 119.0 PROl 88 0.10% 113.0 PROl 88 1.00% 65.0

PRO 179 0.01% 119.0 PRO 179 0.10% 107.0 PRO 179 1.00% 45.0

PRO 179 0.01% 96.0 PRO 179 0.10% 83.0 PROl 79 1.00% 26.0

PRO 197 0.01% 90.0

PRO 197 0.10% 79.0 PRO 197 1.00% 68.0

PRO 198 0.01% 48.0 PRO 198 0.10% 50.0 PRO 198 1.00% 64.0

PRO 198 0.01% 119.0 PRO 198 0.10% 119.0 PRO 198 1.00% 60.0

PRO 182 0.01% 52.0 PRO 182 0.10% 26.0 PRO 182 1.00% 13.0 TABLE 4 Continued Inhibition of VEGF Stimilated Endothehal Cell Growth

PRO Name PRO Concentration Relative % Inhibition

PRO 182 0.099 nM 107.0 PRO 182 0.99 nM 100.0

PROl 82 9.90 nM 66.0

PRO200 0.01 % 96.0 PRO200 0.10% 90.0 PRO200 1.00% 52.0

PRO200 0.01 % 91.0 PRO200 0.10% 93.0 PRO200 1.00% 57.0

PRO200 0.072 nM 1 15.0

PRO200 0.72 nM 1 13.0 PRO200 7.2 nM 60.0

PR021 1 0.01 % 99.0 PR021 1 0.10% 67.0 PR021 1 1.00% 20.0

PR021 1 0.01 % 109.0 PR021 1 0.10% 95.0 PR021 1 1.00% 27.0

PR0217 0.01 % 106.0 PR0217 0.10% 84.0 PR0217 1.00% 39.0

PR0217 2.5 nM 20.0 PR0217 25 nM 88.0 PR0217 250 nM 58.0

PR021 5.7 nM 61.0 PR0219 57 nM 109.0 PR0219 570 nM 97.0

PR0221 0.01 % 103.0 PR0221 0.10% 82.0 PR0221 1.00% 31.0

PR0221 0.01 % 106.0 PR0221 0.10% 93.0 PR0221 1.00% 43.0

PR0224 0.01 % 101.0 PR0224 0.10% 65.0 PR0224 1.00% 23.0

PR0228 0.01 % 99.0 PR0228 0.10% 93.0 PR0228 1.00% 57.0 TABLE 4 Continued Inhibition of VEGF Stimilated Endothehal Cell Growth

PRO Name PRO Concentration Relative % Inhibition

PR0228 0.01 % 95.0

PR0228 0.10% 77.0

PR0228 1.00% 16.0

PR0228 0.01 % 98.0

PR0228 0.10% 88.0

PR0228 1.00% 48.0

PR0245 0.01 % 76.0

PR0245 0.10% 35.0

PR0245 1.00% 1 1.0

PR0245 0.48 nM 103.0

PR0245 4.80 nM 95.0

PR0245 48 nM 49.0

PR0246 0.01 % 104.0

PR0246 0.10% 100.0

PR0246 1.00% 49.0

PR0258 0.01 % 98.0

PR0258 0.10% 95.0

PR0258 1.00% 60.0

PR0258 0.01 % 106.0

PR0258 0.10% 102.0

PR0258 1.00% 69.0

PR0261 0.01 nM 95.0

PR0261 0.10 nM 62.0

PR0261 1.00 nM 50.0

PR0261 0.01 nM 1 10.0

PR0261 0.10 nM 103.0

PR0261 1.00 nM 60.0

PR0272 0.01 % 95.0

PR0272 0.10% 57.0

PR0272 1.00% 18.0

PRO301 0.01 % 92.0

PRO301 0.10% 85.0

PRO301 1.00% 68.0

PRO30 I 7 μM 102.0

PRO301 70 μM 88.0

PRO301 700 μM 44.0

PR0322 0.01 % 92.0

PR0322 0.10% 91.0

PR0322 1.00% 49.0 TABLE 4 Continued Inhibition of VEGF Stimilated Endothehal Cell Growth

PRO Name PRO Concentration Relative % Inhibition

PR0322 0.045 nM 100.0 PR0322 0.45 nM 1 1 1.0

PR0322 4.50 nM 53.0

PR0328 0.01 % 98.0 PR0328 0.10% 96.0 PR0328 1.00% 60.0

PR0331 0.01 % 88.0 PR0331 0.10% 82.0 PR0331 1.00% 56.0

PR0366 0.01 % 107.0

PR0366 0.10% 1 12.0 PR0366 1.00% 60.0

PR0366 0.01 % 1 16.0 PR0366 0.10% 1 12.0 PR0366 1.00% 70.0

PR0366 0.009 nM 108.0 PR0366 0.090 nM 106.0 PR0366 0.900 nM 43.0

EXAMPLE 40 Induction of c-f^'os in Endothelial Cells Assav #34 This assay is designed to determine whether PRO polypeptides show the ability to induce c-fos in endothelial cells. PRO polypeptides testing positive in this assay would be expected to be useful for the therapeutic treatment of conditions or disorders where angiogenesis would be beneficial including, for example, wound healing, and the like (as would agonists of these PRO polypeptides). Antagonists of the PRO polypeptides testing positive in this assay would be expected to be useful for the therapeutic treatment of cancerous tumors. Human venous umbilical vein endothelial cells (HUVEC, Cell Systems) in growth media (50% Ham's FI 2 w/o GHT: low glucose, and 50% DMEM without glycine: with NaHC03. 1 % glutamine, 10 mM HEPES, 10% FBS, 10 ng/ml bFGF) were plated on 96- well microtiter plates at a cell density of l x l 0 ' cells/well. The day after plating, the cells were starved by removing the growth media and treating the cells with 100 μl/well test samples and controls (positive control: growth media; negative control: 10 mM HEPES. 140 mM NaCl, 4% (w/v) mannitol. pH 6.8). The cells were incubated for 30 minutes at 37°C, in 5% C0₂. The samples were removed, and the first part of the bDNA kit protocol (Chiron Diagnostics, cat. #6005-037) was followed, where each capitalized reagent/buffer listed below was available from the kit.

Briefly, the amounts of the TM Lysis Buffer and Probes needed for the tests were calculated based on information provided by the manufacturei The appropriate amounts of thawed Pi obes were added to the TM Lysis Buffer The Capture Hybridization Buffer was warmed to room temperature The bDNA strips were set up in the metal strip holders, and 100 μl of Capture Hybridization Buffer was added to each b-DNA well needed, followed by incubation for at least 30 minutes The test plates with the cells were removed from the incubator, and the media was gently removed using the vacuum manifold 100 μl of Lysis Hybridization Buffer with Probes were quickly pipetted into each well of the microtiter plates The plates were then incubated at 55 °C for 15 minutes Upon removal from the incubator, the plates were placed on the vortex mixer with the microtiter adapter head and vortexed on the #2 setting for one minute 80 μl of the lysate was removed and added to the bDNA wells containing the Capture Hybridization Buffer, and pipetted up and down to mix The plates were incubated at 53 °C for at least 16 hours

On the next day, the second part of the bDNA kit protocol was followed Specifically, the plates were removed from the incubator and placed on the bench to cool foi 10 minutes The volumes of additions needed wei e calculated based upon information provided by the manufacturei An Amphfiei Working Solution was prepared by making a 1 100 dilution of the Amplifier Concentrate (20 f m μl) in AL Hybridization Buffer The hybridization mixture was removed from the plates and washed twice with Wash A 50 μl ot Amplifier Working Solution w as added to each well and the wells were incubated at 53 °C for 30 minutes The plates were then removed from the incubatoi and allowed to cool for 10 minutes The Label Probe Working Solution was prepared by making a 1 100 dilution of Label Concentrate (40 pmoles/μl) in AL Hybridization Buffer After the 10-mιnute cool-down period, the amplifier hybridization mixture was removed and the plates were washed twice with Wash A 50 μl of Label Probe Working Solution was added to each well and the wells were incubated at 5 °C foi 15 minutes After cooling for 10 minutes, the Substrate was warmed to room temperature Upon addition of 3 μl of Substrate Enhancer to each ml of Substrate needed for the assay, the plates were allowed to cool for 10 minutes, the label hybridization mixture was removed, and the plates were washed twice with Wash A and three times with Wash D 50 μl of the Substrate Solution with Enhancer was added to each well The plates were incubated for 30 minutes at 37 °C and RLU was read in an appropriate luminometei

The replicates were averaged and the coefficient ot vai lation was determined The measure of activ lty of the fold increase over the negative control (HEPES buffei described above) value was indicated by chemiluminescence units (RLU) The results are shown in TABLE 5 below, and are considered positive it the PRO polypeptide exhibits at least a two-fold value over the negative control Negative control = 1 00 RLU at 1 00% dilution Positive control = 8 39 RLU at 1 00% dilution

TABLE 5 Induction of c-fos in Endothelial Cells

PRO Name PRO Concentration RLU values

PR0356 1.8 nM 2.12 PR0356 18.0 nM 2.45

PR0356 180.0 nM 1.40

PR0356 1.8 nM 2J3 PR0356 18.0 nM 2.77 PR0356 180.0 nM 2.05

PRO 179 0.01 % 1.78 PRO 179 0.10% 1 J3 PRO 179 1.00% 3.1 1

PRO 179 0.10% 1.23

PRO 179 1.00% 1.69 PRO 179 10.00% 2.43

PR0364 0.086 nM 1.10 PR0364 0.860 nM 1.43 PR0364 8.600 nM 1.34

PR0364 0.086 nM 3.35 PR0364 0.860 nM 3.76 PR0364 8.600 nM 2.19

PR0535 1.35 nM 1.26 PR0535 13.50 nM 1.59 PR0535 135 nM 2.17

PR0535 1 .35 nM 3.16 PR0535 13.50 nM 4.03 PR0535 135 nM 2.26

PROS 19 0.0232 nM 2.18

PR0819 0.232 nM 2.12 PROS 19 2.320 nM 1.77

PR0826 0.1 1 nM 2.16 PR0826 1.10 nM 1.87 PR0826 1 1.00 nM 2.39

PRO l 160 0.01 % 2.46 PROl 160 0.10% 2.19 PRO l 160 1.00% 1.40

PRO l 160 0.01 % 2.64 PRO l 160 0.10% 2.08 PROl 160 1 .00% 1.44 EXAMPLE 41 Human Venous Endothehal Cell Ca Flux Assay ASY#68 This assay is designed to determine whether PRO polypeptides show the ability to stimulate calcium flux in human umbilical vein endothehal cells (HUVEC, Cell Systems) Ca influx is a well documented response upon binding of certain ligands to their receptors A test compound that results in a positive response in the present Ca influx assay can be said to bind to a specific receptor and activate a biological signaling pathway in human endothehal cells This could ultimately lead, for example to cell division, inhibition of cell proliferation, endothelial tube formation, cell migration, apoptosis, etc

Human venous umbilical vein endothelial cells (HUVEC, Cell Systems) in growth media (50 50 without glycine, l % glutamιne, lOmM Hepes, 10% FBS, 10 ng/ml Bfgf), were plated on 96-well microtiter ViewPlates-96 (Packard Instrument Company Part #6005182) microtiter plates at a cell density of 2 x 10⁴ cells/well The day after plating, the cells were washed three times with buffer (HBSS plus 10 mM Hepes), leaving 100 μl/well Then 100 μl/well of 8 μM Fluo-3 (2x) was added The cells were incubated for 1 5 hours at 37°C/5% CO, After incubation, the cells were then washed 3x with buffer (described above) leaving 100 μl/well Test samples of the PRO polypeptides were prepared on different 96-well plates at 5x concentration in buffei The positive control corresponded to 50 μM lonomycin (5x), the negative control corresponded to Protein 32 Cell plate and sample plates weie run on a FLIPR (Molecular Devices) machine The FLIPR machine added 25 μl ot test sample to the cells, and readings were taken every second for one minute, then every 3 seconds for the next three minutes

The fluorescence change trom baseline to the maximum rise of the curve (Δ change) was calculated, and replicates averaged The rate of fluorescence increase was monitored, and only those samples which had a Δ change greater than 1000 and a rise within 60 seconds, were considered positive In the following TABLE 6, the results are expressed relative to the positive control

TABLE 6 Human Venous Endothehal Cell Ca Flux Assay P PRROO NNaammee PRO Concentration Relative A in Fluorescence

PRO 179 0 01 %

PRO 179 0 10%

PRO 179 1 00%

PRO 179 0 01 %

PRO 179 0 10%

PRO 179 1 00%

PRO 1246 0 007 nM

PRO 1246 0 070 nM

PRO 1246 0 700 nM

PPRROO 11224466 0 0 000077 nnMM

PRO 1246 0 070 nM

PRO 1246 0 700 nM EXAMPLE 42 Induction of Endothehal Cell Apoptosis ASY#73 The ability of PRO polypeptides to induce apoptosis in endothelial cells was tested in human venous umbilical vein endothehal cells (HUVEC, Cell Systems) A positive test in the assay is indicative of the usefulness of the polypeptide in therapeutically treating tumors as well as vascular disorders where inducing apoptosis of endothehal cells would be beneficial

The ability of PRO polypeptides to induce apoptosis in endothehal cells was tested m human venous umbilical vein endothelial cells (HUVEC, Cell Systems), using a 96-well format, 0% serum media supplemented with 100 ng/ml VEGF (As HUVEC cells are easily dislodged from the plating surface, all pipetting in the wells must be done as gently as practicable )

The medium was aspired and the cells washed once with PBS 5 ml of 1 x trypsin was added to the cells in a T-175 flask, and the cells were allowed to stand until they were released trom the plate (about 5-10 minutes)

Trypsi zation was stopped by adding 5 ml of growth media The cells were spun at 1000 rpm for 5 minutes at 4°C

The media was aspirated and the cells were resuspended in 10 ml ot 10% serum complemented medium (Cell Systems), 1 x penicillin/streptomycin

The cells were plated on 96-well microtiter plates (Amersham Lite Science, cytostar-T scintillating microplate, RPNQ160, sterile, tissue-culture treated, individually wrapped), in 10% serum (CSG-medium, Cell Systems), at a density of 2 x 10⁴ cells per well in a total volume of 100 μl PR0228 polypeptide was added in triplicate at dilutions of 1 %, 0 33% and 0 1 1 % Wells without cells were used as a blank and wells with cells only were used as a negative control As a positive control 1 3 serial dilutions of 50 μl of a 3x stock of staurosponne were used The ability of the PR0228 polypeptide to induce apoptosis was determined using Annexin V, a member of the calcium and phosphohpid binding proteins, to detect apoptosis

0 2 ml Annexin V - Biotin stock solution (100 μg/ml) were diluted in 4 6 ml 2 x Ca^,+ binding buffer and 2 5% BSA (1 25 dilution) 50 μls of the diluted Annexin V - Biotin solution were added to each well (except controls) to a final concentration of 1 0 μg/ml The samples were incubated for 10-15 minutes with Annexin-Biotin pnoi to direct addition of -"S-Streptavidin

was diluted in 2x Ca²⁺ Binding butter. 2 5% BSA and was added to all wells at a final concentration of 3 x I O⁴ cpm well The plates were then sealed, centπfuged at 1000 rpm for 15 minutes and placed on orbital shaker foi 2 hours The analysis was performed on 1450 Microbeta Ti dux (Wallac) The results are shown in TABLE 7 below where percent above background represents the percentage amount of counts per minute above the negative controls Percents greatei than oi equal to 30% above background are considered positive TABLE 7

Induction of Endothehal Cell Apoptosis

PRO Name PRO Concentration Percent Above Background

PR0228 0 1 1 % 0 7%

PR0228 0 1 1 % 47 6%

PR0228 0 33% 92 2%

PR0228 0 33% 123 7%

PR0228 1 00% 51 4%

PR0228 1 00% 95 3%

EXAMPLE 43

Enhancement of Heart Neonatal Hypertrophy Assay #1 This assay is designed to measure the ability of PRO polypeptides to stimulate hypertrophy of neonatal heart PRO polypeptides testing positive in this assay are expected to be useful tor the therapeutic treatment of various cardiac insufficiency disorders Cardiac myocytes from 1 -day old Hailan Sprague Dawley lats were obtained Cells (180 μl at 7 5 x 10 /ml serum <0 1 %, freshly isolated) are added on day 1 to 96-well plates previously coated with DMEM/F12 + 4% FCS Test samples containing the test PRO polypeptide or growth medium only (negative control) (20 μl/well) are added directly to the wells on day 1 PGF (20 μl/well) is then added on day 2 at final concentration of 10⁶ M The cells are then stained on day 4 and visually scored on day 5 wherein cells showing no increase in size as compared to negative controls are scored 0 0, cells showing a small to moderate increase in size as compared to negative controls are scored 1 0 and cells showing a large increase in size as compared to negative controls are scored 2 0 The results are shown in TABLE 8 below

TABLE 8 Enhancement of Heart Neonatal Hypertrophy PRO Name PRO Concentration Growth Enhancement Score

PRO 179 0 01 % 0 PRO 179 0 10% 0 PRO 179 1 00%

PRO 179 0 01 % 0 PRO 179 0 10% 0 PRO 179 1 00% 1

PRO 195 0 01 % 0 PRO 195 0 10% 1 PRO 195 1 00% 1

PR0224 0 01 % PR0224 0 10% PR0224 1 00% EXAMPLE 44 In situ Hybridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations It may be usetul, for example, to identity sites of gene expression, analyze the tissue distribution of transcription, identify and localize viral infection, follow changes in specific mRNA synthesis, and aid in chromosome mapping

In situ hybridization was performed following an optimized version of the protocol by Lu and Gillett, Cell Vision, 1 169 176 (1994), using PCR-generated ³³P-labeIed πboprobes Briefly, formahn-fixed, paraffin-embedded human tissues were sectioned, deparaffinized, deproteinated in proteinase K (20 g/ml) for 15 minutes at 37 °C, and further processed for in situ hybridization as described by Lu and Gillett, supia A (^1λ-P)UTP-labeled antisense πboprobe was generated from a PCR product and hybridized at 55 °C overnight The slides were dipped in Kodak NTB2™ nuclear track emulsion and exposed for 4 weeks — P-Riboprobe synthesis

6 0 μl (125 mCi) of "P-UTP (Amersham BF 1002, SA<2000 Ci/mmol) were speed vacuum dried To each tube containing dried "P-UTP the following ingredients were added 2 0 μl 5x transcription buffer

1 O μl DTT (lOO mM)

2 0 μl NTP mix (2 5 mM 10 μl each of 10 mM GTP, CTP & ATP + 10 μl H₂0) 1 0 μl UTP (50 μM) 1 0 μl RNAsin

1 0 μl DNA template (1 μg) 1 O μl H )

1 0 μl RNA polymerase (for PCR products T3 = AS T7 = S usually)

The tubes were incubated at 37 °C for one hour A total of 1 0 μl RQ1 DNase was added followed by incubation at 37 °C for 15 minutes A total of 90 μl TE ( 10 mM Tns pH 7 6/1 mM EDTA pH S 0) was added and the mixture was pipetted onto DE81 paper The lemdining solution was lodded in d MICROCON-50™ ultrafiltration unit, dnd spun using piogram 10 (6 minutes) The filtrdtion unit was inverted ovei a second tube and spun using program 2 (3 minutes) After the final recov ery spin a total of l OO l TE was added then 1 u\ ot the final product was pipetted on DE81 paper and counted in 6 ml of BIOFLUOR II™ The probe was run on a TBE/urea gel A total of 1 3 «1 ot the probe or 5 μl of RNA Mrk III w as added to

3 μl of loading buffei After heating on a 95 °C heat block for three minutes, the gel was immediately placed on ice The wells of gel were flushed and the sample was loaded and run at 1 80-250 volts tor 45 minutes The gel was wrapped in plastic wrap (SARAN¹ brand) and exposed to XAR film with an intensifying scieen in a 70°C freezer one hour to overnight — P Hvbndization

A Pt etieatment offwzen sections

The slides were removed from the freezer, placed on aluminum tiays, and thawed at room tempeiatuie foi 5 minutes The trays were placed in a 55 °C incubator for five minutes to i educe condensation The slides were fixed for 10 minutes in 4% paratormaldehyde on ice in the fume hood, and washed in 0 5 x SSC for 5 minutes, at room temperature (25 ml 20 x SSC + 975 ml SQ H₂0) After deprotei nation in 0 5 μg/ml proteinase K for 10 minutes at 37 °C (12 5 μl of 10 mg/ml stock in 250 ml prewarmed RNAse-free RNAse buffer), the sections weie washed in 0 5 x SSC for 10 minutes at room temperature The sections were dehydrated in 70%, 95%, and 100% ethanol 2 minutes each

B Preti eatment ofpai affm-embedded sections

The slides were deparaffimzed, placed in SQ H₂0, and rinsed twice in 2 x SSC at room temperature, for 5 minutes each time The sections were deproteinated in 20 μg/ml proteinase K (500 μl of 10 mg/ml in 250 ml RNase-free RNase buffer, 37 °C, 15 minutes) for human embryo tissue, or 8 x proteinase K (100 μl in 250 ml Rnase buffer, 37 °C, 30 minutes) for formalin tissues Subsequent rinsing in 0 5 x SSC and dehydration were performed as described above

C Prehybitdization

The slides were laid out in a plastic box lined with Box buffer (4 x SSC, 50% formamide) - saturated filter paper The tissue was covered with 50 μl of hybridization buffer (3 75 g dextran sulfate + 6 ml SQ H₂0), vortexed and heated in the microwave for 2 minutes with the cap loosened After cooling on ice, 18 75 ml formamide, 3 75 ml 20 x SSC, and 9 ml SQ H₂0 were added, and the tissue was vortexed well and incubated at 42°C for 1-4 hours

D Hybi tdization

1 0 x I O⁶ cpm probe and 1 0 μl tRNA (50 mg/ml stock) per slide were heated at 95 °C for 3 minutes The slides were cooled on ice, and 48 μl hybridization buffer was added per slide After vortexmg, 50 μl ¹³P mix was added to 50 μl prehybπdization on the slide The slides were incubated overnight at 55 °C

E Washes

Washing was done for 2x 10 minutes with 2xSSC, EDTA at room tempeiature (400 ml 20 x SSC + 16 ml 0 25

M EDTA, V_t=4L), followed by RNAseA treatment at 37 °C foi 30 minutes (500 μl ot 10 mg/ml in 250 ml Rnase buffer = 20 μg/ml), The slides were washed 2 x 10 minutes with 2 x SSC EDTA at room temperatuie The stringency wash conditions were as follows 2 hours at 55 °C, 0 1 x SSC, EDTA (20 ml 20 x SSC + 16 ml EDTA

V,=4L)

F Oligonucleotides

In situ analysis was pei formed on twelve of the DNA sequences disclosed herein The oligonucleotides employed for these analyses are as follows

( 1 ) DNA19355- 1 150 (PRQ175) (TNF motif homolog) 19355 p i

5'-TCTAATACGACTCACTATAGCTCAGGGGAAGAGCCAAAGA-3' (SEQ ID NO 168)

19355 p2 5'-TGAATTAACCCTCACTAAAGCAGTGCAATGCAGGGGACTA-3' (SEQ ID NO 169) (2) DNA23339- 1 130 (PRO 178) (NL8 - TIE ligand homolog) NL8 pl :

5'-GGATTCTAATACGACTCACTATAGGGCCACGGGCGCTGTGTGCTGGAG-3' (SEQ ID NO: 170) NL8 p2: 5'-CTATGAAATTAACCCTCACTAAAGGGATGGTGGGGACCGCAGGGTGAC-3' (SEQ ID NO: 171 ) NL8 p3:

5'-GGATTCTAATACGACTCACTATAGGGCCCGCCACGAGGAGCTGTTACG-3' (SEQ ID NO: 172) NL8 p4:

5'-CTATGAAATTAACCCTCACTAAAGGGATGACCTGCAGGCATGGGAGAA-3' (SEQ ID NO: 173) NL8 p5:

5'-GGATTCTAATACGACTCACTATAGGGCGGCCGCCACGAGGAGCTGTTA-3' (SEQ ID NO: 174)

NL8 p6:

5'-CTATGAAATTAACCCTCACTAAAGGGAGGGGCTCTGGGGCTGGGTC-3' (SEQ ID NO: 175)

(3) DNA28497-1 130 (PROl 88) (NL5 - ΗE ligand homolog) NL5 pl :

5'-GGATTCTAATACGACTCACTATAGGGCCAACACCAAGGGGCAAGATG-3' (SEQ ID NO: 176)

NL5 p2:

S'-CTATGAAATTAACCCTCACTAAAGGGAGGGCTTTTGGTGGGAGAAGTT-S' (SEQ ID NO: 177)

(4) DNA29101 -1 122 (PRO200) (VEGF homolog) 29101 pi :

5'-GGATTCTAATACGACTCACTATAGGGCGGCGGAATCCAACCTGAGTAG-3' (SEQ ID NO: 178)

29101p2:

5'-CTATGAAATTAACCCTCACTAAAGGGAGCGGCTATCCTCCTGTGCTC-3' (SEQ ID NO: 179)

(5) DNA33094-1 131 (PRQ217) (EGF homolog) 33094 pi :

5^*-GGATTCTAATACGACTCACTATAGGGCTCAGAAAAGCGCAACAGAGAA-3' (SEQ ID NO: 180)

33094 p2:

5'-CTATGAAATTAACCCTCACTAAAGGGATGTCTTCCATGCCAACCTTC-3' (SEQ ID NO: 181 )

(6) DNA33089-1 132 (PRQ221 ) ( 1 TM receptor homolog) 33089 p i :

5'-GGATTCTAATACGACTCACTATAGGGCTGTGCTTTCATTCTGCCAGTA-3' (SEQ ID NO: 182)

33089 p2:

5'-CTATGAAATTAACCCTCACTAAAGGGAGGGTACAATTAAGGGGTGGAT-3' (SEQ ID NO: 183) (7) DNA33221 -1 133 (PR0224) (LDLR homolog - 1 TM) 33221 pi :

5'-GGATTCTAATACGACTCACTATAGGGCGCAGCGATGGCAGCGATGAGG-3' (SEQ ID NO: 184) 33221 p2: 5'-CTATGAAATTAACCCTCACTAAAGGGACAGACGGGGCAGCAGGGAGTG-3' (SEQ ID NO: 185)

(8) DNA35638-1 141 (PRQ245) ( 1 TM receptor homolog) 35638 pi : 5'-GGATTCTAATACGACTCACTATAGGGCGGGAAGATGGCGAGGAGGAG-3' (SEQ ID NO: 186)

35638 p2: 5'-CTATGAAATTAACCCTCACTAAAGGGACCAAGGCCACAAACGGAAATC-3' (SEQ ID NO: 187)

(9) DNA35639-1 172 (PRQ246) (adenovirus R homolog)

35639 pi :

5'-GGATTCTAATACGACTCACTATAGGGCTTGCTGCGGTTTTTGTTCCTG-3' (SEQ ID NO: 188) 35639 p2: 5'-CTATGAAATTAACCCTCACTAAAGGGAGCTGCCGATCCCACTGGTATT-3' (SEQ ID NO: 189)

(10) DNA35918-1 174 (PRQ258) (CRTAM homolog) 35918 pi :

5'-GGATTCTAATACGACTCACTATAGGGCCCGCCTCGCTCCTGCTCCTG-3' (SEQ ID NO: 190) 35918 p2: 5'-CTATGAAATTAACCCTCACTAAAGGGAGGATTGCCGCGACCCTCACAG-3' (SEQ ID NO: 191 )

( 1 1 ) DNA33473-1 176 (PRQ261 ) (WISP2 - CTGF homolog) 33473 pi :

5'-GGATTCTAATACGACTCACTATAGGGCGCGAGGACGGCGGCTTCA-3' (SEQ ID NO: 192)

33473 p2: 5'-CTATGAAATTAACCCTCACTAAAGGGAAGAGTCGCGGCCGCCCTTTTT-3' (SEQ ID NO: 193)

( 12) DNA47365- 1206 (PRQ364) (novel TNF receptor) 47365 p i :

5'-GGATTCTAATACGACTCACTATAGGGCAACCCGAGCATGGCACAGCAC-3' (SEQ ID NO: 194) 47365 p2: 5'-CTATGAAATTAACCCTCACTAAAGGGATCTCCCAGCCGCCCCTTCTC-3^' (SEQ ID NO: 195) G Results

In situ analysis was performed on the above twelve DNA sequences disclosed herein The results from these analyses are as follows

(1 ) DNA 19355-1 150 (PRO l 75) (TNF motif homolog) In human fetal tissues there was a specific positive signal over the population of adrenal endothehal cells

Endothelial cells elsewhere were negative

(2) DNA23339-1 130 (PROl 78) (NL8 ΗE ligand homolog)

In human fetal tissues, there was a distinctive expression pattern in the lower limb at the connective tissue interface between skeletal muscle and bone (primitive periosteum) Expression adj acent to vascular tissue suggests a possible link with angiogenesis In thymus tissue, there was an apparent increase in expression in the medulla Expression in the smooth muscle of the trachea was also observed In the brain cerebral cortex, an increase in expression appeared to occur in cortical neurons In the small intestine, expression was observed in smooth muscle and connective tissue of the lamina propria Expression was also observed in the smooth muscle and connective tissue of the stomach (lamina propria) No expression was observed in the spinal cord, thyroid, adrenals or liver No expression was observed in the placenta but the vascular smooth muscle of the cord showed positive results Expression in the body wall showed a similar pattern to lower limb expression

The highly organized expression patterns in the developing limb, intestine and body wall suggests a distinctive role at these sites indicating a possible role in angiogenesis and patterning Fetal multiblock tissues included liver, kidney, adrenals thyroid lungs, heart, great vessels small intestine, spleen, thymus, pancreas, bram spinal cord, body wall, pelvis and lower limb

Adult multiblock tissues included liver, kidney, adrenals myocardium aorta, spleen, lymph node, pancreas, lung and skin All tissues examined were negative

(3) DNA2S497 1 1 0 (PROl 88) (NL5 TIE ligand homolog) In fetal tissues the lower limb showed a high degree ot expression at sites of enchondral bone formation in osteocytes and in the peπosteum peπchondi mm ot developing bones In addition, high expression was observed in osteocytes and in the peπosteum peπchondπum ot dev eloping bones The expression distribution suggests a role in bone formation and/or differentiation A faint inci ease in expiession in thyroid epithelial cells was also observed In addition, the body wall sho ed a high degree ot expiession in osteocytes and in the peπosteum peπchondπum of developing bones, likewise suggesting a i ole in bone toi mation/ditterentiation Thymus, trachea, bram (cerebral cortex), spinal coid small intestine, adrenals liver stomach, placenta and cord all showed negative results

In adult tissues expression was obseived over benign breast epithelium in areas of apocπne metaplasia and sclerosing adenosis Expression was also seen over infiltrating breast ductal carcinoma cells Liv er heart and hepatocellular caicinoma showed negative results Possible expression occurred in adult squamous epithelium ot skin and in the adult adienal cortex All othei tissues were negative

[ 79 Fetal multiblock tissues included liver, kidney, adrenal, thyroid, lungs, heart, great vessels, small intestine, spleen, thymus, pancreas, brain, spinal cord, body wall, pelvis and lower limb Adult multiblock tissues included liver, kidney adrenal, myocardium, aorta, spleen, lymph node, pancreas lung and skin

(4) DNA29101 -1 122 (PRO200) (VEGF homolog) Expression in Human Tissues

In fetal tissues, expression was observed in developing lower limb bones at the edge of the cartilagenous anlage (t e , around the outside edge) Also, expression was seen in developing tendons in vascular smooth muscle and in cells embracing developing skeletal muscle myocytes and myotubes Expression was also observed at the epiphyseal growth plate Expression was also seen in the marginal sinus of developing lymph nodes In addition, expression in the thymus was seen in the subcapsular region of the thymic cortex, possibly representing either the subcapsular epithelial cells or the proliferating thymocytes that are found in this region Expression in the smooth muscle of the trachea was also reported In the bra cerebral cortex, focal expression occuπed in cortical neurons Expression was also observed in the following tissues smooth muscle of the small intestine, generalized expression over the thyroid epithelium, liver expression in ductal plate cells, stomach expression in mural smooth muscle, fetal skin expression in the basal layer of squamous epithelium, placenta expression in interstitial cells (in trophoblastic vilh) and cord expression in the wall of arteries and vein The spleen, spinal cord, and the adrenals showed negative results

Expression patterns suggest that this VEGF homolog may be involved in cell differentiation and/or proliferation The expression pattern in developing skeletal muscle suggests a possible role in myoblast differentiation and/or proliferation

Expiession in Tumoi and Fetal Tissues

High expression was observed at the following sites

Chimp ovary - granulosa cells of maturing follicles, lower intensity signal observed ovei thecal cells Chimp parathyi oid high expression ovei chiet cells

Human fetal testis - moderate expression over stromal cells surrounding developing tubules Human fetal lung - high expression over chondrocytes in developing bronchial tree and low level expression over branching bronchial epithelium

Specific expression was not observed over the renal cell, gastric and colo c carcinomas Fetal tissues examined (El 2 El 6 weeks) included placenta, umbilical cord liv er, kidney, adrenals, thyroid, lungs heart, great vessels, esophagus, stomach small intestine, spleen, thymus, pancreas biain, eye, spinal coid body wall, pelvis and lower limb

Adult tissues examined included liver, kidney, adrenals, myocardium aorta spleen lv mph node, pancreas lung skin, cerebral cortex (rm), hippocampus (rm). cerebellum (i m), penis, eye, bladdei , gastric carcinoma, colon colomc carcinoma, chondrosarcoma, acetominophen induced liver mjuiy and hepatic ciπ hosis (5) DNA33094-1 131 (PRQ217) (EGF homolog)

A highly distinctive expression pattern was observed in the human embryo in the outer smooth muscle layer of the Gl tract, respiratory cartilage, branching respiratory epithelium, oseoblasts, tendons, gonads, in the optic nerve head and the developing dermis In adult tissues, expression was seen in the epidermal pegs of the chimp tongue, and the basal epithehal/myoepithehal cells of the prostate and urinary bladder Also, expression was observed in the alveolai lining cells of the adult lung, mesenchymal cells juxtaposed to erectile tissue in the penis and the cerebral cortex (possibly in ghal cells) In the kidney, expression was only seen in disease tissue, specifically in cells surrounding thyroidized renal tubules Human fetal tissues examined (E12-E16 weeks) included placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb

Adult human tissues examined included kidney (normal and end-stage), adrenals, myocardium, aorta, spleen, lymph node, gall bladder, pancreas, lung, skin, eye (including retina), prostate, bladder, and liver (normal, cirrhotic, acute failure)

Non-human primate tissues examined included

Chimp tissues salivary gland, stomach, thyroid, parathyroid, skin, thymus, ovary, lymph node

Rhesus Monkey tissues cerebral cortex, hippocampus, cerebellum and penis

(6) DNA33089- 1 132 (PRQ221 ) (1 TM receptor homolog)

Specific expression was observed over fetal cerebral white and grey matter, as well as over neurons in the spinal cord The probe appears to cross react with rat In addition low level expression occurred over cerebellar neurons in adult ihesus brain All other tissues were negative

Fetal tissues examined (E12-E16 weeks) included placenta umbilical coid, hvei , kidney, adrenals, thyroid lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb

Adult tissues examined included liver, kidney, adrenals, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (rm), hippocampus (rm), cerebellum (rm), penis, eye, bladder, stomach, gastπc carcinoma colon, colomc carcinoma chondrosarco a, acetominophen induced liver ιn|ury and hepatic cirrhosis

(7) DNA33221 - 1 133 (PRQ224) (LDLR homolog - 1 TM)

Expression was limited to the vascular endothehum in fetal spleen, adult spleen, fetal liver, adult thyroid and adult lymph node (in chimp) Additional site of expression was obsei ved in the developing spinal ganglia All other tissues were negative Human fetal tissues examined (E12-E16 weeks) included placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels esophagus, stomach, small intestine, spleen thymus. pancieas, brain, eye, spinal cord, body wall, pelvis and lower limb

Adult human tissues examined included kidney (normal and end-stage), adrenals, myocardium, aorta, spleen, lymph node, pancreas, lung skin, eye (including retina), bladder, and liver (normal, cirrhotic, acute failure) Non-human primate tissues examined included Chimp Tissues salivary gland, stomach, thyroid, parathyroid, skin, thymus, ovaiy, lymph node Rhesus Monkey Tissues cerebral cortex, hippocampus, cerebellum, penis

(8) DNA35638-1 141 (PRQ245) (1 TM receptor homolog) Expression in human adult and fetal tissues Expression was observed in the endothehum lining of fetal and placental vessels Endothehal expression was confined to these tissue blocks Expression was also observed over intermediate trophoblast cells of the placenta All other tissues were negative

Fetal tissues examined (E12-E16 weeks) included placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, biain, eye, spinal cord, body wall, pelvis and lower limb

Adult tissues examined included liver, kidney, adrenals, myocardium, aorta, spleen, lymph node, pancreas, lung, skin, cerebral cortex (rm), hippocampus (rm), cerebellum (rm), penis, eye, bladder, stomach, gastric carcinoma, colon, colomc carcinoma, thyroid (chimp), parathyroid (chimp), ovary (chimp), chondrosarcoma, acetominophen induced liver injury and hepatic cirrhosis Expression in inflamed human tissues (psoriasis, IBD, inflamed kιdne\, inflamed lung, hepatitis (hvei block) normal tonsil, adult and clump multiblocks

Expression was observed in a subset of fetal vessels in the endothehum and in the placenta but no expression was seen in a variety of normal adult human tissues or vessels Evaluation of expression of this molecule in vessels of inflamed human tissues were compared to non-inflamed tissues In this iegard, expression was observed in the endothehum/intima of large vessels in the lung afflicted with chionic inflammation, in superficial dermal vessels of psoπatic skin, in arteπoles in a specimen of chronic sclerosing nephritis, and in capillaries including the perifolhcular sinuses of tonsil No expression was seen in normal skin (human foreskin specimens), normal lung inflamed (eight IBD specimens) or normal large bowel, chronically inflamed oi cirrhotic liver, normal adult cardiac tissue or adrenal gland

(9) DNA35639-1 172 (PRQ246) (adenovirus R homolog)

Strong expression was observed in fetal vascular endothehum. including tissues of the CNS A lowei level of expression was seen in adult vasculature, including the CNS Higher levels of expression were not obv IOUS in tumor vascular endothehum A signal was also seen ovei bone matrix and adult spleen but not obviously cell associated Human fetal tissues examined (E12-E16 weeks) included placenta, umbilical cord hvei , kidney, adrenals thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis, testis and lower limb

Adult human tissues examined included kidney (normal and end-stage), adrenals, spleen, lymph node, pancreas, lung, eye (including retina), bladder, and liver (normal, cirrhotic, acute failure) Non-human primate tissues examined included Chimp adrenal tissues and Rhesus monkey tissues (cerebral cortex hippocampus)

(10) DNA35918-1 174 (PRQ258) (CRTAM homolog) Expression in human adult and fetal tissues

Strong expression was observed in the nervous system In the rhesus monkey brain, expression was seen in cortical cerebellar and hippocampus neurons Expression was also seen over spinal neurons in the fetal spinal cord, the developing brain and the inner aspects of the fetal retina In addition, expression occurred over developing dorsal root and autonomic ganglia as well as enteric nerves In the adult prostate, expression occurred over ganglion cells In the rat, there was strong expression over the developing hind brain and spinal cord Strong expression was also seen over interstitial cells in the placental vilh All other tissues were negative Fetal tissues examined (E12-E16 weeks) included placenta, umbilical cord, liver, kidney, adrenals, thyroid, lungs, heart, great vessels, esophagus, stomach, small intestine, spleen, thymus, pancreas, brain, eye, spinal cord, body wall, pelvis and lower limb

Adult tissues examined included liver kidney, renal cell carcinoma, adrenals, aorta, spleen, lymph node, pancreas, lung, myocardium, skin, cerebral cortex (rm), hippocampus (rm), cerebellum (rm), bladder, prostate, stomach, gastric carcinoma colon, colomc carcinoma, thyroid (chimp), parathyroid (chimp), ovary (chimp), chondrosarcoma, acetominophen induced liver injury and hepatic cirrhosis

Expression in normal and damaged Rhesus Chimp and human biain sections

In normal cerebral cortex, expression was observed in all layers in a neuronal pattern Expression was also observed in pyramidal, granule and polymorphic cell layers of the hippocampus In cerebellum mRNA was localized to the granule cell layer and cells in the molecular layer, but not in Purkinje neurons In infarcted cerebellum, the pattern was slightly different the granule layer signal was reduced and therefore the Golgi II signal stood out as being strongly expressed Also the signal was dispeised around the exteπoi of areas wheie Puikinje cells were missing

Expression in mouse brains High expression was observed throughout the developing and adult mouse brain but does not appear to show any regional specificity

( 1 1 ) DNA33473-1 176 (PRQ261 ) (WISP 2 - CTGF homolog)

Strong expression was observed in dermal fibroblasts in normal adult skin Strong expiession w as also seen in two cirrhotic livers at sites of active hepatic fibrosis In addition, moderate expression was seen ov ei f asiculata cells ot the adrenal cortex Localization of expiession supports a role tor this factor in extiacellulai matrix formation and/or turnover

Expression in human breast caicinoma and normal breast tissue and in lung caicinoma

Expression was negative in benign and malignant epithelial cells in two breast tumors examined, but specific hybridization occurred in mesenchymal cells, particularly in areas of tissue repair including dystrophic ossification The signal seemed to be localized to the same cell population in both breast tumoi s Most positive cells had the morphology of fibroblasts, yet smooth muscle cells appeared to be negative The signal is less intense in lung tumoi tissue, however the section examined showed less tissue repair compared with the breast tumor slides Normal lung and kidney tissue were essentially negative In summary, expression of mRNA occurred in mesenchymal cells involved in tissue repair and or collagen deposition The signal was particularly strong in benign fibroblast-hke cells adjacent to either infiltrating breast carcinoma cells or tissue destruction due to benign, inflammatory conditions (duct rupture) Of note, was the fact that deposition of benign osteoid seemed to correlate with strong expression of RNA Expression in normal human colon and colon caicinoma

None of the sections examined showed a positive hybridization signal in tumor cells Positive signals of variable intensity were observed in mesenchymal cells of either fibroblast or smooth muscle differentiation Fibroblasts with a positive signal were observed adjacent to invasive tumor, if this tumor elicited a so-called desmoplastic response (fibroblastic proliferation with deposition of collagenous fibrosis) Positive smooth muscle cells were seen in mostly arterial vessels of medium size The positive signals were focally distributed within individual sections but showed variability from section to section

(12) DNA47365-1206 (PRQ364) (novel TNF receptor)

In tetal tissues, expression was observed in the fascia lining the anterior surface of the vertebral body Expression was also seen over the tetal retina Low expression occurred over fetal neurons All other tissues were negative

EXAMPLE 45 Use of PRO 172, PRO 175. PRO 178, PRO 188, PRQ356, PRO 179, PRO 197, PRO 198 PRO 182 PR0195,

PRO200, PRQ21 1 , PRQ217, PRQ219, PRQ221. PRQ224, PRQ228, PRQ245, PRQ246, PRQ258, PRQ261 PRQ272, PRO301 , PRQ322, PRQ328, PRQ331 , PRQ364. PRQ366 PRQ535. PRQ819. PR0826. PROl 160

PROl 186 or PROl 246 as a Hybridization Probe The following method describes use of a nucleotide sequence encoding PRO 172 PRO 175, PRO 178, PRO 188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328 PR03 1 , PR0364. PR0366, PR0535 PROS 19, PR0826, PROl 160, PROl 186 or PRO 1246 as a hybndization probe

DNA comprising the coding sequence of full-length or mature PR0172, PR0175 PR0178, PR0188,

PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 I , PR02 I 7, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331. PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 (as shown in Figures 1 A-1B, 3A-3B, 5, 7A-7B, 9A-9B, 11A-11B, 13, 15, 17, 19, 21A-21B, 23, 25A-25B, 27A-27B, 29, 31, 33A-33B, 35, 37, 39, 41, 43, 45, 47, 49, 51A-51B, 53, 55, 57, 59, 61, 63, 65 and 67A-67B, respectively, SEQ ID NOS: 1,8, 10, 15, 20,25,30,35,40,45,50,56,61,66,71,76,81.90,95, 100J07, 112,118,126, 131,136,141.151,153,155,157, 159J 64 and 166, respectively) or a fragment thereof is employed as a probe to screen for homologous DNAs (such as those encoding naturally-occurring variants of PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211, PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301, PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1160, PRO 1186 or PRO 1246) in human tissue cDNA libraries or human tissue genomic libraries.

Hybridization and washing of filters containing either library DNAs is performed under the following high- stringency conditions. Hybridization of radiolabeled probe derived from the gene encoding PRO 172, PRO 175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211, PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1160, PROl 186 or PROl 246 polypeptide to the filters is performed in a solution of 50% formamide, 5x SSC, 0.1 % SDS, 0.1 % sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dextran sulfate at 42"C for 20 hours. Washing of the filters is performed in an aqueous solution of 0.1 x SSC and 0.1 % SDS at 42"C.

DNAs having a desired sequence identity with the DNA encoding full-length native sequence can then be identified using standard techniques known in the art.

EXAMPLE 46

Expression of Nucleic Acid Encoding PRQ172. PRQ175, PR017S, PRQ188, PRQ356, PRQ179, PRQ197,

PROl 98, PROl 82, PRO 195, PRO200, PRQ211, PRQ217. PRQ21 , PRQ221, PRQ224, PRQ228, PRQ245,

PRQ246, PRQ258, PRQ261 , PRQ272. PRO301. PRQ322, PRQ328. PRQ331. PRQ364, PRQ366. PRQ535, PRQ819, PRQ826, PROl 160, PROl 186 or PRO 1246 in E. coli

This Example illustrates preparation of an unglycosylated form of PR0172, PR0175, PR0178, PR0188,

PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211. PR0217, PR0219, PR0221,

PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301, PR0322, PR0328, PR0331,

PR0364, PR0366. PR0535, PR0819, PR0826, PRO 1160. PRO 1186 or PRO 1246 by recombinant expression in E. coli.

The DNA sequence encoding PR0172,PR0175, PROl 78, PROl 88. PR0356. PROl 79, PROl 97, PRO 198, PR0182, PR0195, PRO200, PR0211, PR0217, PR0219, PR0221, PR0224, PR022S, PR0245, PR0246, PR0258, PR0261. PR0272, PRO301. PR0322. PR0328, PR0331, PR0364, PR0366, PR0535. PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 (SEQ ID NOS: 1,8, 10, 15, 20.25, 30, 35.40,45, 50, 56, 61, 66, 71, 76,81,90,95,100,107, 112, 118,126, 131, 136, 41, 151, 153, 155,157, 159.164, or 166, respectively) is initially amplified using selected PCR primers. The primers should contain restriction enzyme sites that correspond to the restriction enzyme sites on the selected expression vector A variety of expression vectors may be employed An example ofa suitable vector is pBR322 (derived from£ coli, see Bolivar etal , Gene, 2 95 (1977)), which contains genes for ampicillm and tetracychne resistance The vector is digested with restriction enzyme and dephosphorylated The PCR-amphfied sequences are then ligated into the vector The vector will preferably include sequences that encode an antibiotic resistance gene, a trp piomoter, a poly-His leader (including the first six STTI codons, poly-His sequence, and enterokinase cleavage site), the region encoding PRO 172, PRO 175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246, lambda transcriptional terminator, and an argU gene

The hgation mixture is then used to transform a selected E colt strain using the methods described in Sambrook et al , supia Transformants are identified by their ability to grow on LB plates and antibiotic-resistant colonies are then selected Plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequencing Selected clones can be grown overnight in liquid culture medium such as LB broth supplemented with antibiotics The overnight culture may subsequently be used to inoculate a larger-scale culture The cells are then grown to a desired optical density, during which the expression promoter is turned on

After cultuπng the cells for several more hours, the cells can be harvested by centrifugation The cell pellet obtained by the centrifugation can be solubihzed using various agents known in the art, and the solubihzed PRO 172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819 PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide can then be purified using a metal -chelatmg column under conditions that allow tight binding of the polypeptide PR0197, PR0195, PRO200 PR0224, PRO301 PR0328, PR0364, PR0366 and PROl 186 were successfully expressed in E coli in a poly-His tagged foim by the above procedure

EXAMPLE 47 Expression of Nucleic Acid Encoding PROl 72, PRO 175, PRO 178, PROl 88, PRQ356, PRO 179, PRO 197, PRO 198, PRO 182 PRO 195 PRO200 PRQ21 1 PRQ217 PRQ219 PRQ221 PRQ224 PRQ228 PRQ245 PRQ246. PRQ258 PRQ261. PRQ272 PRO301 , PRQ322 PRQ328, PRQ331 PRQ364 PRQ366, PRQ535 PRQ819 PRQ826, PROl 160, PROl 186 or PRO 1246 in Mammalian Cells This Example illustrates preparation of a potentially glycosylated form ot PRO 172, PROl 75, PRO 178 PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219 PR0221 , PR0224 PR0228, PR0245, PR0246, PR0258 PR0261 , PR0272, PRO301 , PR0322, PR0328 PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO l 160, PRO l 186 or PR01246 by recombinant expression in mammalian cells The vector, pRK5 (see, EP 307.247, published March 15, 1989), is employed as the expression vectoi Optionally, the PROl 72, PROl 75, PR0178, PROl 88, PR0356, PROl 79, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 DNA is ligated into pRK5 with selected restriction enzymes to allow insertion of the DNA encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PRO 197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 using hgation methods such as described in Sambrook et al , supra The resulting vector is called pRK5-(DNA encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246)

In one embodiment, the selected host cells are 293 cells Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue culture plates in medium such as DMEM supplemented with fetal calf serum and optionally, nutrient components and/or antibiotics About 10 μg DNA of pRK5-(DNA encoding PRO 172, PROl 75, PROl 78, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PROl 246) is mixed with about 1 μg DNA encoding the VA RNA gene (Thimmappaya et al , Cell 3J_ 543 ( 1982)) and dissolved in 500 μl ot 1 mM Tris-HCl, 0 1 mM EDTA, 0 227 M CaCl₂ To this mixture is added, dropwise, 500 μl of 50 mM HEPES (pH 7 35), 280 mM NaCl, 1 5 mM NaP0₄, and a precipitate is allowed to form for 10 minutes at 25"C The precipitate is suspended and added to the 293 cells and allowed to settle for about four hours at 37"C The culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for 30 seconds The 293 cells are then washed with serum- free medium, fresh medium is added, and the cells are incubated for about 5 days

Approximately 24 hours after the transfections, the culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 μCi/ml ^,1S-cysteιne and 200 μQ/ml

After a 12- hour incubation, the conditioned medium is collected, concentrated on a spin filter, and loaded onto a 15% SDS gel The processed gel may be dried and exposed to film for a selected period of time to reveal the presence of the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366. PR0535, PR0819, PR0826, PRO l 160, PROl 186 or PRO 1246 polypeptide The cultures containing transfected cells may undergo furthei incubation (in serum-tree medium) and the medium is tested in selected bioassays In an alternative technique, the gene encoding PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PRO 179,

PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272. PRO301 , PR0322, PR0328, PR03 I , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 may be introduced into 293 cells transiently using the dextran sulfate method described by Somparyrac et al , Proc Natl Acad Sci , J_2 7575 (1981 ) 293 cells are grown to maximal density in a spinner flask and 700 μg pRK5-(DNA encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331. PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246) is added The cells are first concentrated from the spinner flask by centrifugation and washed with PBS The DNA-dextran precipitate is incubated on the cell pellet for four hours The cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into the spinner flask containing tissue culture medium, 5 μg/ml bovine insulin, and 0 1 μg/ml bovine transferπn After about four days, the conditioned media is centrifuged and filtered to remove cells and debris The sample containing the expressed gene encoding the PROl 72, PROl 75, PROl 78, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide can then be concentrated and purified by any selected method, such as dialysis and/or column chromatography

In another embodiment, the gene encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261, PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 can be expressed in CHO cells The pRK5-(DNA encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR033 I , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246) nucleic acid can be transfected into CHO cells using known reagents such as CaP0₄ or DEAE-dextran As described above, the cell cultures can be incubated, and the medium replaced with culture medium (alone) or medium containing a radiolabel such as

After determining the presence of PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246. PR0258. PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366. PR0535, PROS 19, PR0826, PROl 160. PROl 186 or PROl 246 polypeptide, the culture medium may be replaced with serum-tree medium Preferably, the cultures aie incubated for about 6 days, and then the conditioned medium is harvested The medium containing the expressed PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182. PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261. PR0272 PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PROS 19. PR0826, PRO 1 160. PRO 1 186 or PRO 1246 can then be concentrated and purified by any selected method Epitope-tagged gene encoding the PR0172, PR0175, PR0178, PR0188. PR0356 PROI 79, PR0197

PRO 198, PROl 82, PRO 195, PRO200, PR021 1 , PR0217, PR0219. PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR032S, PR0331. PR0364 PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide may also be expressed in host CHO cells. The gene encoding PRO 172, PRO 175, PRO 178, PROl 88, PR0356, PRO 179, PRO 197, PRO 198, PRO 182, PRO 195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 may be subcloned out of the pRK5 vector. The subclone insert can undergo PCR amplification to fuse in frame with a selected epitope tag such as a poly-His tag into a baculovirus expression vector. The gene insert encoding the poly-His-tagged-[PR0172, PROl 75, PRO 178, PROl 88, PR0356, PRO 179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246] can then be subcloned into a SV40- driven vector containing a selection marker such as DHFR for selection of stable clones. Finally, the CHO cells can be transfected (as described above) with the SV40-driven vector. Labeling may be performed, as described above, to verify expression. The culture medium containing the expressed gene encoding the poly-His-tagged-[PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 ,

PR0322, PR0328, PR0331. PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246] can then be concentrated and purified by any selected method, such as by Ni ⁺-chelate affinity chromatography.

PR0172, PROl 75, PR0178, PROl 88, PR0356, PR0179, PROl 97, PR0198, PROl 82, PRO200, PR021 1 ,

PR0217, PR0219, PR0221 , PR0224, PR0245, PR0258, PR0261 , PRO301 , PR0322, PR0328, PR0364, PR0366, PR0535, PR0826, PRO 1160, and PRO 1246 were stably expressed in CHO cells by the above described method. In addition, PR0172, PR0178, PR0356, PR0182, PR0245, PR0258, PRO301 , PR0322, PR0328, PR0364, PR0366, PR0535 and PR0826 were expressed in CHO cells by a transient procedure.

EXAMPLE 48 Expression of Nucleic Acid Encoding PROl 72. PROl 75. PROl 78. PROl 88. PRQ356. PROl 79. PRQ197.

PRO 198. PROl 82. PRO 195. PRO200. PRQ21 1 , PRQ217, PRQ219, PRQ22 I , PRQ224, PRQ228, PRQ245, PRQ246, PRQ258. PRQ261. PRQ272, PRO301. PRQ322. PRQ32S, PRQ331. PRQ364. PRQ366, PRQ535, PRQ819, PRQ826, PRO 1 160. PRO 1 186 or PRO 1246 in Yeast The following method describes recombinant expression of the gene encoding PRO 172, PRO 175, PRO 178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200. PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261. PR0272. PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO l 160, PRO l 186 or PRO 1246 in yeast.

First, yeast expression vectors are constructed for intracellular production or secretion of PRO 172, PRO 175,

PR0178. PR0188, PR0356, PR0179. PR0197, PR0198, PRO I 82, PR0195. PRO200, PR021 1. PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245. PR0246, PR025S, PR0261 , PR0272, PRO301. PR0322,

PR0328, PR0331 , PR0364. PR0366. PR0535, PR0819. PR0826, PRO 1 160, PRO 1 186 or PRO 1246 from the

ADH2/GAPDH promoter. DNA encoding PRO 172, PRO 175, PRO 178, PROI SS, PR0356, PRO 179, PRO 197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 and the promoter is inserted into suitable restriction enzyme sites in the selected plasmid to direct intracellular expression of the gene encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR032S, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PROl 186 or PROl 246. For secretion, DNA encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195. PRO200, PR0211 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PRO 1186 or PRO 1246 can be cloned into the selected plasmid, together with DNA encoding the ADH2/GAPDH promoter, a native PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1160, PRO 1186 or PRO 1246 signal peptide or other mammalian signal peptide, or, for example, a yeast alpha- factor or invertase secretory signal/leader sequence, and linker sequences (if needed) for expression of the gene encoding PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221, PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PRO 1 186 or PRO 1246.

Yeast cells, such as yeast strain AB 1 10, can then be transformed with the expression plasmids described above and cultured in selected fermentation media. The transformed yeast supernatants can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gels with Coomassie Blue stain. Recombinant PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182.

PR0195, PRO200, PR021 1 , PR0217. PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 can subsequently be isolated and purified by removing the yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PRO 179, PRO 197, PRO 198, PRO 182. PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224. PR0228, PR0245, PR0246, PR0258. PR0261 , PR0272, PRO301 , PR0322, PR0328, PR033 I , PR0364, PR0366. PR0535, PR0819, PR0826. PRO l 160, PRO l 186 or PRO 1246 may further be purified using selected column-chromatography resins. EXAMPLE 49 Expression of Nucleic Acid Encoding PROl 72, PROl 75. PROl 78, PROl 88. PRQ356, PRO 179, PROl 97, PRO 198, PROl 82, PRO 195. PRO200. PRQ21 1. PRQ217. PRQ219. PRQ221. PRQ224, PRQ228, PRQ245, PRQ246, PRQ258, PRQ261. PRQ272. PRO301. PRQ322, PRQ328, PRQ331 , PRQ364, PRQ366. PRQ535. PRQ819. PRQ826, PROl 160, PROl 186 or PRO 1246 in Baculovirus-infected Insect Cells

The following method describes recombinant expression in Baculovirus-infected insect cells The sequence coding for PROl 72, PROl 75, PROl 78, PROl 88, PR0356, PROl 79, PRO 197, PRO 198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331, PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 is fused upstream of an epitope tag contained within a baculovirus expression vector Such epitope tags include poly-His tags and immunoglobulin tags (like Fc regions of IgG) A variety of plasmids may be employed, including plasmids deπved from commercially available plasmids such as pVL1393 (Novagen) Briefly, the sequence encoding PR0172, PROl 75, PROl 78, PROl 88, PR0356, PROl 79, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 or the desired portion of the coding sequence of PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR0211 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301, PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 [such as the sequence encoding the extracellular domain of a transmembrane protein or the sequence encoding the mature protein if the protein is extracellular] is amplified by PCR with primers complementary to the 5' and 3' regions The 5' primer may incorporate flanking (selected) restriction enzyme sites The product is then digested with those selected restriction enzymes and subcloned into the expression vector

Recombinant baculovirus is generated by co-transfecting the above plasmid and BaculoGoldTM virus DNA (Pharmingen) into Spodoptei afi Mg/pe/-fo ("Sf9") cells (ATCC CRL 171 1 ) using hpofectin (commercially available from GIBCO-BRL) After 4 - 5 days of incubation at 28 °C, the released viruses are harvested and used tor further amplifications Viral infection and protein expression are performed as described by O'Reilley et al , Baculovirus

Expression Vectors A Laboratory Manual (Oxford Oxford University Press (1994))

Expressed poly-His tagged-[PR0172, PRO 175, PROl 78, PROl 88, PR0356, PRO 179, PRO 197, PRO 198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246. PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535. PR0819. PR0826, PRO l 160, PROl 186 or PR01246] can then be purified, for example, by Ni ²⁺-chelate affinity chromatography as follows Extracts are prepared trom recombinant virus-infected Sf9 cells as described by Rupert et al , Nature, 362 175- 179 (1993) Brief ly, Sf9 cells are washed, resuspended in so cation butter (25 ml Hepes, pH 7 9. 12 5 mM MgCl₂, 0 1 mM EDTA, 10% glycerol. 0 1 % NP-40, 0 4 M KCl), and sonicated twice toi 20 seconds on ice The sonicates are cleared by centrifugation, and the supernatant is diluted 50-told in loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7 8) and filtered through a 0 45 μm filtei A Ni ²⁺-NTA agarose column (commercially available trom Qiagen) is prepared with a bed volume of 5 ml, washed with 25 ml of water and equilibrated with 25 ml of loading buffer The filtered cell extract is loaded onto the column at 0 5 ml per minute The column is washed to baseline A „ with loading buffer, at which point fraction collection is started Next, the column is washed with a secondary wash buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 6 0), which elutes non specifically- bound protein After reaching A,_M> baseline again, the column is developed with a 0 to 500 mM lmidazole gradient in the secondary wash buffer One ml tractions are collected and analyzed by SDS-PAGE and silver staining or Western blot with Ni ¹⁺-NTA-conjugated to alkaline phosphatase (Qiagen) Fractions containing the eluted His _l0-tagged-[PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PRO 179, PRO 197, PRO 198, PROl 82, PROl 95, PRO200, PR021 1, PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160 PROl 186 or PROl 2461, lespectively, are pooled and dialyzed against loading buffer

Alternatively, purification of thelgG-tagged (or Fc tagged)-[PRO 172, PROl 75, PRO 178, PROl 88, PR0356, PR0179, PR0197, PR0198 PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364 PR0366, PR0535, PR0819, PR0826, PROl 160, PRO l 186 or PR01246] can be performed using known chromatography techniques, including for instance, Protein A or piotein G column chromatography

While expression was actually performed in a 0 5-2 L scale, it can be readily scaled up for larger (e g , 8 L) preparations The proteins were expressed as an IgG construct (immunoadhesin), in which the protein extracellular region was fused to an IgGl constant region sequence containing the hinge, CH2 and CH3 domains and/or in poly-His tagged forms

Following PCR amplification, the respective coding sequences were subcloned into a baculovirus expression vector (pb PH IgG for IgG fusions and pb PH His c torpoly-His tagged proteins) and the vector and Baculogold® baculovirus DNA (Pharmmgen) were co-transfected into 105 Spodoptei a fi ugψei da ( 'Sf9") cells (ATCC CRL 171 1 ) using Lipotectin (Gibco BRL) pb PH IgG and pb PH His are modifications of the commercially available baculovirus expression vector pVL 1393 (Pharmmgen), with modified polyhnkei legions to include the His oi Fc tag sequences The cells were grown in Hink s TNM-FH medium supplemented with 10% FBS (Hyclone) Cells were incubated tor 5 days at 28°C The supernatant was harvested and subsequently used for the fust viral amplification by infecting Sf9 cells in Hink s TNM FH medium supplemented with 10% FBS at an approximate multiplicity of infection (MOI) of 10 Cells were incubated for 3 days at 28 °C The supernatant was harvested and the expiession of the constructs in the baculovirus expression v ectoi was determined by batch binding of 1 ml ot supernatant to 25 ml of Ni ¹⁺ NTA beads (QIAGEN) for histidine tagged proteins or Protem-A Sephaiose CL-4B beads (Pharmacia) for IgG tagged proteins followed by SDS PAGE analysis comparing to a known concentration of protein standard by Coomassie blue staining The first viral amplification supernatant was used to infect a spinnei cultuie (500 ml) ot Sf9 cells grow n in

ESF-921 medium (Expiession Systems LLC) at an approximate MOI of 0 1 Cells were incubated foi 3 days at 28 °C The supernatant was harvested and filtered Batch binding and SDS PAGE analysis was repeated as necessary, until expression of the spinner culture was confirmed

The conditioned medium fiom the transfected cells (0 5 to 3 L) was harvested by centrifugation to remove the cells and filtered through 0 22 micron filters For the poly-His tagged constructs, the protein construct were purified using a Ni ²⁺-NTA column (Qiagen) Before purification lmidazole was added to the conditioned media to a concentration of 5 mM The conditioned media were pumped onto a 6 ml Ni ²⁺-NTA column equilibrated in 20 mM Hepes, pH 7 4, buffer containing 0 3 M NaCl and 5 mM lmidazole at a flow rate of 4-5 ml/mm at 4°C After loading, the column was washed with additional equilibration buffer and the protein eluted with equilibration buffei containing 0 25 M lmidazole The highly purified protein was subsequently desalted into a storage buffer containing 10 mM Hepes, 0 14 M NaCl and 4% mannitol, pH 6 8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80°C

Immunoadhesin (Fc containing) constructs ot proteins were purified from the conditioned media as follows The conditioned media were pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 mM Na phosphate buffer, pH 6 8 After loading, the column was washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3 5 The eluted protein was immediately neutralized by collecting 1 ml fractions into tubes containing 275 ml of 1 M Tns buffer, pH 9 The highly purified protein was subsequently desalted into storage buffer as described above tor the poly-His tagged proteins The homogeneity of the proteins was verified by SDS polyacrylamide gel (PEG) electrophoresis and N-terminal ammo acid sequencing by Edman degradation

PROl 72, PROl 75, PROl 78, PR0356, PR0228, PR0258, PR0272, PRO301 , PR0322 PR0819, and PR0826 were successfully expressed in Baculovirus- infected insect Sf9 cells by the above procedure

Alternatively, a modified baculovirus procedure may be used incorporating hιgh-5 cells In this procedure the DNA encoding the desned sequence was amplified with suitable systems, such as Pfu (Stratagene) or fused upstream (5'-ot) of an epitope tag contained with a baculovirus expression vector Such epitope tags include poly-His tags and immunoglobulin tags (like Fc regions of IgG) A variety of plasmids may be employed including plasmids derived from commercially available plasmids such as pIEl - 1 (Novagen) The pIEI - 1 and pIE 1 -2 vectoi s are designed tor constitutive expression of recombinant proteins from the baculovirus le i promoter in stably-transformed insect cells The plasmids differ only in the orientation of the multiple cloning sites and contain all promoter sequences known to be important for lei -mediated gene expression in un fected insect cells as well as the hr5 enhancer element pIEl - 1 and pIEl -2 include the translation initiation site and can be used to produce fusion proteins Briefly, the desired sequence or the desired portion ot the sequence (such as the sequence encoding the extracellular domain of a transmembrane protein) was amplified by PCR with primers complementary to the 5 and 3' legions The 5' pπmeι may incorporate flanking (selected) lestπction enzyme sites The product was then digested w ith those selected restriction enzymes and subcloned into the expression v ector For example, den v ati ves of pIE 1 - 1 can include the Fc region of human IgG (pb PH IgG) or an 8 histidine (pb PH His) tag dow nstream (3 -of) the desired sequence Preferably , the vector consti uct is sequenced toi confirmation

Hιgh-5 cells are grown to a conf luency ot 50% under the conditions of. 27 °C, no C02, NO pen/sti ep Foi each 150 mm plate, 30 μg of pIE based vectoi containing the sequence was mixed with 1 ml Ex-Cell medium (Media Ex-Cell 401 + 1/100 L-Glu JRH Biosciences #14401 -78P (note this media is light sensitive)), and in a separate tube, 100 μl of CellFectin (CellFECTIN (GibcoBRL #10362-010) (vortexed to mix)) was mixed with 1 ml of Ex-Cell medium The two solutions were combined and allowed to incubate at room temperature for 15 minutes 8 ml of Ex-Cell media was added to the 2 ml of DNA/CellFECTIN mix and this is layered on hιgh-5 cells that have been washed once with Ex-Cell media The plate is then incubated in darkness for 1 hour at room temperature The DNA/CellFECTIN mix is then aspirated, and the cells are washed once with Ex-Cell to remove excess CellFECTIN, 30 ml of fresh Ex-Cell media was added and the cells are incubated for 3 days at 28 °C The supernatant was harvested and the expression of the sequence in the baculovirus expression vector was determined by batch binding of 1 ml of supernatant to 25 ml of Ni ²⁺-NTA beads (QIAGEN) for histidine tagged proteins or Protein-A Sepharose CL-4B beads (Pharmacia) for IgG tagged proteins followed by SDS-PAGE analysis comparing to a known concentration of protein standard by Coomassie blue staining

The conditioned media from the transfected cells (0 5 to 3 L) was harvested by centrifugation to remove the cells and filtered through 0 22 micron filters For the poly-His tagged constructs, the protein compπsing the sequence is purified using a Ni ⁺-NTA column (Qiagen) Before purification, lmidazole is added to the conditioned media to a concentration of 5 mM The conditioned media was pumped onto a 6 ml Ni ^,+-NTA column equilibrated in 20 mM Hepes, pH 7 4, buffei containing 0 3 M NaCl and 5 mM lmidazole at a flow rate of 4-5 ml/min at 48 °C After loading, the column was washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0 25 M lmidazole The highly purified protein was then subsequently desalted into a storage buffer containing lO mM Hepes, 0 14 M NaCl and 4% mannitol, pH 6 8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80 °C

Immunoadhesin (Fc containing) constructs of proteins were purified trom the conditioned media as follows The conditioned media was pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 mM Na phosphate buffer, pH 6 8 After loading, the column was washed extensively with equilibration buffei before elution with 100 mM citric acid, pH 3 5 The eluted protein was immediately neutralized by collecting 1 ml fractions into tubes containing 275 ml of I M Tns buffer. pH 9 The highly purified protein was subsequently desalted into storage buffer as described above for the poly-His tagged proteins The homogeneity of the sequence was assessed by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman degradation and other analytical procedures as desired or necessary

PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PRO198, PR0182 PR0195 PRO200. PRO21 1 , PR0217, PR0221. PR0224, PR0228, PR0245, PR0246, PR0258. PR0272 PRO301 , PR0322, PR0328 PR03 1 , PR0364. PR0366, PR0535 PR0819, PR0826, PRO 1 160, and PRO 1 186 were expressed in high 5 cells by the above described method EXAMPLE 50

Preparation of Antibodies that Bind PRQ 172, PRQ175, PRQ178, PRQ 188, PRQ356, PRQ179, PRQ197,

PRO 198, PRO 182, PRO 195, PRO200, PRQ21 1 , PRQ217. PRQ219, PRQ221 , PRQ224, PRQ228, PRQ245,

PRQ246, PRQ258, PRQ261 , PRQ272. PRO301. PRQ322. PRQ328, PRQ331 , PRQ364, PRQ366. PRQ535. PROS 19. PRQ826. PROl 160. PROl 186 or PRO 1246

This Example illustrates preparation of monoclonal antibodies that can specifically bind PRO 172, PROl 75. PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322. PR0328. PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 Techniques for producing the monoclonal antibodies are known in the art and are described, for instance, in

Goding, supia Immunogens that may be employed include purified PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PRO l 186 or PRO 1246 fusion proteins containing PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1. PR0217, PR0219, PR0221 , PR0224, PR0228. PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246, and cells expressing the gene encoding PR0172, PR0175, PR0178, PR0188, PRO-356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 on the cell surface Selection ot the immunogen can be made by the skilled artisan without undue experimentation

Mice, such as Balb/c, are immunized with the PRO 172, PROl 75, PRO 178, PRO I SS, PR0356, PRO 179.

PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228. PR0245, PR0246, PR0258. PR0261 , PR0272, PRO301 , PR0322. PR0328. PR0331 , PR0364, PR0366

PR0535, PROS 19, PR0826, PROl 160, PROl 186 or PRO 1246 immunogen emulsified in complete Freund s adjuvant and injected subcutaneously or lntrapeπtoneally in an amount trom 1 to 100 micrograms Alternatively. the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the animal's hind toot pads The immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant Thereafter, for sevei al weeks, the mice may also be boosted with additional immunization injections Serum samples may be periodically obtained trom the mice by letio-orbital bleeding tor testing in ELISA assays to detect anti-PRO 172. anti-PRO 175. anti-PRO 178, anti-PRO 188, anti-

PR0356. anti-PRO 179, anti-PRO 197, anti-PRO 198, anti-PRO 182, anti-PRO 195. antι-PRO2()0, antι-PR021 1 , anti

PR0217. antι-PR0219, antι-PR0221. antι-PR0224. antι-PR0228, antι-PR0245, antι-PR0246, antι-PR025S, anti- PR0261 , antι-PR0272, antι-PRO301. antι-PR0322. antι-PRO_328. antι-PR0331. antι-PR0364, antι-PR0366, anti-

PR0535, antι-PR0819, anti-PR0826. anti-PRO l 160. anti-PRO l 186 oi anti-PRO 1246 antibodies

After a suitable antibody titei has been detected, the animals "positive' tor antibodies can be injected with a final intravenous injection ot PR0172, PR0175, PR0178, PRO I 88, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258 PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366 PR0535, PR0819 PR0826, PRO 1 160, PRO 1 186 or PRO 1246 Three to tour days later, the mice are sacrificed and the spleen cells are harvested The spleen cells are then fused (using 35% polyethylene glycol) to a selected muπne myeloma cell line such as P3X63AgU 1 , available from ATCC, No CRL 1597 The fusions generate hybridoma cells that can then be plated in 96-well tissue culture plates containing HAT medium to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids

The hybridoma cells will be screened in an ELISA for reactivity against PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364. PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 Determination of "positive" hybridoma cells secreting the desired monoclonal antibodies against PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224 PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PROS26 PROl 160, PRO l 186 or PRO 1246 is within the skill in the art

The positive hybridoma cells can be injected lntrapeπtoneally into syngeneic Balb/c mice to produce ascites containing the anti-PROl 72, anti-PROl 75, anti-PROl 78, anti-PROl 88, antι-PR0356, anti-PROl 79, anti-PRO 197, anti-PRO 198, anti-PRO 182, anti-PRO 195, antι-PRO200, antι-PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221 antι-PR0224, antι-PR0228, antι-PR0245, antι-PR0246, antι-PR0258, antι-PR0261 , antι-PR0272, antι-PRO301 , antι-PR0322, antι-PR0328, antι-PR0331 , antι-PR0364, antι-PR0366, antι-PR0535, anti-PROS 19, antι-PR0826 anti-PROl 160 anti-PROl 186 or anti-PROl 246 monoclonal antibodies Alternatively, the hybridoma cells can be grown in tissue-culture flasks or roller bottles Purification of the monoclonal antibodies produced in the ascites can be accomplished using ammonium-sulfate precipitation followed by gel-exclusion chromatography Alternatively affinity chromatography based upon binding of antibody to protein A or protein G can be employed

Deposit of Material

The following mateπal(s) has/have been deposited with the American Type Culture Collection, 10801 University Blv d Manassas, VA 201 10-2209, USA (ATCC)

Material ATCC Deo No Deposit Date

DNA35916-1 161 209419 October 28, 1997

DNA 19355- 1 150 209466 November 18 1997

DNA23339- 1 130 209282 September I S 1997

DNA28497-1 130 209279 Septembei I S, 1997

DNA47470-1 130-P 1 209422 October 28, 1997

DNA16451-1078 209281 Septembei I S 1997 DNA22780- 1078 209284 September 1 8, 1997 DNA33457- 1078 209283 September 18, 1997 DNA27865-1091 209296 September 23, 1997 DNA26847-1395 209772 April 14, 1998 DNA29101 -1 122 209653 March 5, 1998 DNA32292-1 131 209258 September 16, 1997 DNA33094-1 131 209256 September 16, 1997 DNA32290-1 164 209384 October 16, 1997 DNA33089-1 132 209262 September 16, 1997 DNA33221 -1 133 209263 September 16, 1997 DNA33092-1202 209420 October 28. 1997 DNA35638-1 141 209265 September 16, 1997 DNA35639-1 172 209396 October 17, 1997 DNA35918-1 174 209402 October 17. 1997 DNA33473-1 176 209391 October 17, 1997 DNA40620-1 183 209388 October 17, 1997 DNA40628-1216 209432 November 7, 1997 DNA48336-1309 209669 March 1 1 , 1998 DNA40587-1231 209438 November 7, 1997 DNA40981 -1234 209489 November 21 , 1997 DNA47365-1206 209436 November 7, 1997 DNA33085-1 1 10 209087 May 30, 1997 DNA49143- 1429 203013 June 23, 1998 DNA57695-1340 203006 June 23, 1998 DNA57694-1341 203017 June 23. 1998 DNA62872-1509 203100 August 4, 1998 DNA60621 - 1516 203091 August 4, 1998 DNA64885- 1529 203457 November 3. 1998

This deposit was made under the provisions ot the Budapest Treaty on the International Recognition of the Deposit of Miciooiganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty) This assures maintenance of a viable culture of the deposit foi 30 years from the date ot deposit The deposit will be made available by ATCC under the terms of the Budapest Tieaty, and subject to an agieement between Genentech, Inc , and ATCC, which assures pei manent and unrestricted availability ot the progeny of the cultuie of the deposit to the public upon issuance of the pertinent U S patent or upon laying open to the public ot any U S oi foreign patent application, whichever comes first, and assures availability ot the progeny to one determined by the U S Commissioner of Patents and Trademarks to be entitled thereto according to 35 USC § 122 and the Commissioner s rules pursuant thereto (including 37 CFR § 1 14 with particular reference to 886 OG 638)

The assignee of the present application has agreed that if a culture of the mateπal(s) on deposit should die or be lost or destroyed when cultivated under suitable conditions, the mateπal(s) will be promptly replaced on notification with another of the same Availability of the deposited mateπal(s) is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws

The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention The present invention is not to be limited in scope by the construct(s) deposited, since the deposited embodιment(s) is/are intended as single ιllustratιon(s) of certain aspects of the invention and any constructs that are functionally equivalent are within the scope of this invention The deposit of mateπal(s) herein does not constitute an admission that the written description herein contained is inadequate to enable the practice of any aspect of the invention, including the best mode thereof, nor is it to be construed as limiting the scope ot the claims to the specific illustrations that it represents Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims

Claims

WHAT IS CLAIMED IS:

1. A composition comprising a PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PRO I 82, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224. PR0228, PR0245. PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535. PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide or agonist or antagonist thereof, in admixture with a pharmaceutically acceptable carrier.

2. The composition of Claim 1 comprising a therapeutically effective amount of said polypeptide or said agonist or antagonist thereof.

3. The composition of Claim 1 , wherein the agonist is an anti-PR0172, anti-PR0175, anti-PR0178, anti- PRO 188, anti-PR0356, anti-PRO 179, anti-PRO 197, anti-PRO 198, anti-PRO 182, anti-PRO 195, anti-PRO200, anti- PR0211 , anti-PR0217, anti-PR0219, anti-PR0221 , anti-PR0224, anti-PR0228, anti-PR0245, anti-PR0246, anti- PR0258, anti-PR0261 , anti-PR0272, anti-PRO301 , anti-PR0322, anti-PR0328. anti-PR0331 , anti-PR0364, anti- PR0366, anti-PR0535, anti-PR0819, anti-PR0826, anti-PROl 160, anti-PRO l 186 or anti-PRO 1246 antibody.

4. The composition of Claim 1 , wherein the antagonist is an anti-PRO 172, anti-PROl 75, anti-PRO 178. anti- PRO 188, anti-PR0356, anti-PRO 179, anti-PRO 197, anti-PRO 198, anti-PRO 182, anti-PRO 195, anti-PRO200, anti- PR021 1 , anti-PR0217, anti-PR0219, anti-PR0221 , anti-PR0224, anti-PR0228, anti-PR0245, anti-PR0246, anti- PR0258, anti-PR0261 , anti-PR0272, anti-PRO301 , anti-PR0322, anti-PR0328. anti-PR0331 , anti-PR0364, anti- PR0366, anti-PR0535. anti-PR0819, anti-PR0826, anti-PROl 160, anti-PROl 186 or anti-PRO 1246 antibody.

5. The composition of Claim 1 further comprising a cardiovascular, endothelial, angiogenic or angiostatic agent.

6. A method of preparing the composition of Claim 1 comprising admixing a PRO 172, PRO 175. PRO 178. PR0188, PR0356, PR0179, PR0197. PR0198, PR0182, PR0195, PRO200. PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245. PR0246, PR0258, PR0261 , PR0272, PRO30 I , PR0322, PR0328, PR0331 , PR0364. PR0366, PR0535. PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide or agonist or antagonist thereof, with a pharmaceutically acceptable carrier.

7. An article of manufacture comprising:

( 1 ) a composition comprising (a) a PRO 172, PRO 175. PRO 178. PRO 188, PR0356, PRO 179. PRO 197, PR0198. PR0182, PR0195. PRO200. PR021 1 , PR0217. PR0219, PR0221 , PR0224. PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272. PRO301 , PR0322, PR0328, PR03 1 , PR0364. PR0366, PR0535, PR0819, PR0826, PRO 1 160. PRO 1 186 or PRO 1246 polypeptide, (b) an agonist of a PRO 172, PRO 175, PRO 178. PR0188, PR0356, PR0179. PR0197, PR0198, PR0182, PR0195. PRO200, PR02U , PR0217, PR0219. PR0221 , PR0224 PR0228 PR0245, PR0246, PR0258 PR0261 , PR0272, PRO301 , PR0322 PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide, or (c) an antagonist of a PR0172, PR0175, PR0178, PR0188, PR0356, PRO I 79, PR0197 PR0198, PR0182, PR0195, PRO200 PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide, in admixture with a pharmaceutically acceptable carrier.

(2) a container containing said composition, and

(3) a label affixed to said container, or a package insert included in said container, referring to the use of said composition, in the treatment of a cardiovascular, endothehal, and angiogenic disorder

8 The article of manufacture of Claim 7, wherein said agonist is an anti-PRO 172, anti-PROl 75, anti- PROl 78, anti-PRO 188, antι-PR0356, anti-PROl 79, anti-PRO 197, anti-PRO 198, anti-PRO 182, anti-PRO 195, anti- PRO200, antι-PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221 , antι-PR0224, antι-PR0228, antι-PR0245, anti- PR0246, antι-PR0258, antι-PR0261 , antι-PR0272, antι-PRO301. antι-PR0322, antι-PR0328, antι-PR0331 , anti- PR0364, antι-PR0366, antι-PR0535, antι-PR0819, antι-PR0826, anti-PRO 1 160, anti-PRO 1 186 or anti-PRO 1246 antibody

9 The article of manufacture of Claim 7, wherein said antagonist is an anti-PRO 172, anti-PROl 75, anti- PROl 78, anti-PROl 88, antι-PR0356, anti-PROl 79, anti-PRO 197, anti-PRO 198, anti-PRO 182, anti-PRO 195, anti PRO200, antι-PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221 , antι-PR0224, antι-PR0228, antι-PR0245, anti- PR0246, antι-PR0258, antι-PR0261 , antι-PR0272, antι-PRO301 antι-PR0322, antι-PR0328, antι-PR0331 , anti- PR0364, antι-PR0366, antι-PR0535, antι-PR0819, antι-PR0826, anti-PRO 1 160, anti-PRO 1 186 or anti-PRO 1246 antibody

10 The article of manufacture of Claim 7 wherein said composition comprises a therapeutically effectiv e amount of said polypeptide or agonist or antagonist thereof in admixture with said pharmaceutically acceptable carrier

1 1 A method for identifying an agonist of a PRO 172 PRO 175 PRO 178, PROI SS, PR0356, PRO 179 PROl 97. PRO 198, PROl 82, PRO 195, PRO200, PR021 1 PR0217, PR0219, PR0221 , PR0224, PR0228 PR0245, PR0246, PR0258. PR0261 , PR0272 PRO301 PR0322, PR0328. PR0331 , PR0364 PR0366 PR0535, PR0819 PR0826, PRO l 160, PRO! 186 or PRO 1246 polypeptide comprising

(a) contacting cells and a test compound to be screened undei conditions suitable for the induction of a cellular response normally induced by a PRO 172, PRO 175 PRO 178, PRO 188 PR0356, PRO 179 PRO 197 PRO 198, PROl 82 PR0195, PRO200, PR021 1 , PR0217 PR0219 PR0221 , PR0224, PR022S, PR0245 PR0246, PR0258 PR0261 , PR0272, PRO301 , PR0322 PR0328, PR0331 , PR0364 PR0366 PR0535, PROS 1 , PR0826, PRO 1 160, PRO 1 186 or PRO 1246 poly peptide, and (b) determining the induction ot said cellular response to determine it the test compound is an effective agonist, wherein the induction of said cellular response is indicative of said test compound being an effective agonist

12 The method of Claim 1 1 , wherein the cellular response normally induced by said polypeptide is stimulation ot cell proliferation

13 A method for identifying a compound that inhibits an activity ot a PRO 172. PRO 175, PRO 178, PRO 188, PR0356, PR0179. PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide comprising contacting a test compound with said polypeptide under conditions and for a time sufficient to allow the test compound and polypeptide to interact and determining whether the activity of said polypeptide is inhibited

14 A method for identifying a compound the inhibits an activity of a PROl 72, PROl 75. PROl 78. PROl 88, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364. PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide comprising the steps of

(a) contacting cells and a test compound to be screened in the presence of said polypeptide under conditions suitable foi the induction of a cellular response normally induced by said polypeptide, and

(b) determining the induction of said cellular lesponse to determine if the test compound is an effective antagonist

15 The method of Claim 14, wherein the cellulai response normally induced by said polypeptide is stimulation of cell proliferation

16 A method for identifying a compound that inhibits the expression ot a PRO 172, PRO 175. PRO 178, PR0188 PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 PR0224, PR0228, PR0245. PR0246, PR0258, PR0261 , PR0272, PRO301 PR0322. PR0328, PR0331 PR0364, PR0366, PR0535, PROS 19. PR0826, PRO 1 160, PRO 1 186 or PROl 246 poly peptide in cells that normally expresses the polypeptide, wherein the method comprises contacting the cells with a test compound under conditions suitable for allowing expression ot said polypeptide and determining whethei the expression of said polypeptide is inhibited

17 An agonist of a PROl 72, PRO l 75, PRO l 78. PRO l 88, PR0356, PROl 79, PRO 197. PR0198. PRO l 82. PR0195. PRO200, PR021 1 , PR0217, PR0219, PR0221. PR0224, PR0228, PR0245 PR0246. PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535. PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide

18 An antagonist of a PR0172, PR0175. PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide

19 A compound that inhibits the expression of a PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PRO 179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1, PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PROS 19, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide in a mammalian cell which expresses said polypeptide

20 The compound of Claim 19, wherein said compound is an antisense oligonucleotide

21 An isolated antibody that binds to a PR0172, PROl 75, PRO l 78, PROl 88, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide

22 The antibody of Claim 21 which is a monoclonal antibody

23 The antibody of Claim 21 which is an antibody fragment

24 The antibody of Claim 21 which is a single-chain antibody

25 A method for diagnosing a disease or susceptibility to a disease which is related to a mutation in a PRO 172, PROl 75, PRO 178, PROl 88, PR0356, PRO 179, PRO 197, PRO 198. PRO 182, PRO 195, PRO200, PR021 1. PR0217, PR0219, PR0221. PR0224, PR0228, PR0245, PR0246 PR025S, PR0261 PR0272 PRO301 , PR0322, PR0328, PR0331 PR0364. PR0366. PR0535, PROS 19, PR0826, PRO 1 160, PRO 1 186 oi PRO 1246 polypeptide-encoding nucleic acid sequence comprising determining the piesence or absence of said mutation in said polypeptide-encoding nucleic acid sequence, wherein the presence oi absence ot said mutation is indicative ot the presence of said disease oi susceptibility to said disease

26 A method ol diagnosing a cardiovascular, endothehal or angiogenic disoider in a mammal which comprises analyzing the level of expression ot a gene encoding a PRO 172, PRO 175, PRO 178. PRO 188 PR0356, PROl 79, PRO 197, PROl 98, PROl 82. PROl 95, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PRO-322, PR0328, PR0331 , PR0364, PR0366, PRO-535, PROS 19, PR0826. PRO 1 160 PRO 1 186 or PRO 1246 polypeptide (a) in a test sample of tissue cells obtained from said mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher or lower expression level in the test sample as compared to the control sample is indicative of the presence of a cardiovascular, endothehal or angiogenic disorder in said mammal

27 A method of diagnosing a cardiovascular, endothehal or angiogenic disorder in a mammal which comprises detecting the presence or absence of a PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195. PRO200, PR021 1 , PR0217. PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328. PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PRO 1 160, PRO 1 186 or PRO 1246 polypeptide in a test sample of tissue cells obtained from said mammal, wherein the presence or absence of said polypeptide in said test sample is indicative of the presence of a cardiovascular, endothehal or angiogenic disorder in said mammal

28 A method of diagnosing a cardiovascular, endothehal or angiogenic disorder in a mammal comprising (a) contacting an anti-PRO 172, anti-PRO 175, anti-PROl 78, anti-PRO 188, antι-PR0356, anti-PRO 179, anti- PRO^, anti-PROl 98, anti-PROl 82, anti-PROl 95, antι-PRO200, antι-PR021 1 , antι-PR0217, antι-PR0219, anti- PR0221 , antι-PR0224, antι-PR0228, antι-PR0245, antι-PR0246, antι-PR0258, antι-PR0261 , antι-PR0272, anti- PRO301, antι-PR0322, antι-PR0328, antι-PR0331 , antι-PR0364, antι-PR0366, antι-PR0535, antι-PR0819, anti- PR0826, anti-PRO 1 160, anti-PROl 186 or anti-PRO 1246 antibody with a test sample ot tissue cells obtained from the mammal, and (b) detecting the formation of a complex between said antibody and a PROl 72, PROl 75, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195 PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246. PR0258, PR0261 PR0272 PRO301 , PR0322, PR0328.PR0331 PR0364, PR0366.PR0535, PR0819.PR0826. PR01 160. PROl 186 or PRO 1246 polypeptide in the test sample, wherein the formation of said complex is indicative of the presence of a cardiovascular, endothelial or angiogenic disorder in the mammal

29 A method tor determining the presence of a PRO 172, PRO 175, PRO 178, PRO 188, PR0356, PRO 179, PR0197, PR0198. PR0182, PR0195, PRO200, PR021 1 , PR02 I 7, PR0219. PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258. PR0261 , PR0272, PRO301 , PR0322, PR0328, PR03 1 , PR0364, PR0366, PR0535, PROS 19, PR0826, PRO l 160. PROl 186 or PRO 1246 polypeptide in a sample comprising contacting a sample suspected ot containing said polypeptide with an anti-PRO 172 anti-PRO 175. anti-PRO 178, anti-PRO 188, antι-PR0356, anti-PRO 179. anti-PROl 97, anti-PRO 198 anti-PRO 182, anti-PRO 195. antι-PRO200. antι-PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221 , antι-PR0224, antι-PR0228, antι-PR0245. antι-PR0246. antι-PR0258. antι-PR0261 , antι-PR0272 antι-PRO301 , antι-PR0322, antι-PR0328, antι-PR0331. antι-PR0364, antι-PR0366, antι-PR0535,antι-PR08 l 9 antι-PR0826, anti-PRO l 160 anti-PRO l 186 oi anti-PRO 1246 antibody and determining binding of said antibody to a component of said sample

30 A cardiovascular, endothehal or angiogenic disorder diagnostic kit compπsing an anti-PRO 172, anti- PRO 175, anti-PRO 178, anti-PRO 188, antι-PR0356, anti-PRO 179, anti-PRO 197, anti-PRO 198, anti-PRO 182. anti- PRO 195, antι-PRO200, antι-PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221 , antι-PR0224, antι-PR0228, anti- PR0245, antι-PR0246, antι-PR0258, antι-PR0261 , antι-PR0272, antι-PRO301 , antι-PR0322, antι-PR0328, anti PR0331 , antι-PR0364, antι-PR0366, antι-PR0535, antι-PR0819, antι-PR0826, anti-PROl 160, anti-PROl 186 or anti-PROl 246 antibody and a carrier in suitable packaging

31 A method for treating a cardiovascular, endothelial or angiogenic disorder in a mammal comprising administering to the mammal a therapeutically effective amount of a PR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826. PRO l 160, PROl 186 or PR01246 polypeptide or agonist or antagonist thereof

32 The method according to Claim 31 , wherein the mammal is human

33 The method of Claim 32, wherein the human has suffered myocardial infaiction

34 The method of Claim 32, wherein the human has cardiac hypertrophy, trauma, a cancer, or age-related macular degeneration

35 The method of Claim 34, wherein the cardiac hypertrophy is characterized by the presence of an elevated level ot PGF₂„

36 The method of Claim 31 , wherein the PRO 172, PRO 175 PRO 178 PRO I SS PR0356, PRO 179 PROl 97, PRO 198, PRO 182, PROl 95, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228 PR0245. PR0246, PR0258, PR0261 , PR0272, PRO301 PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide is administered together w ith a cardiovasculai , endothehal or angiogenic agent

37 The method of Claim 34, wherein the PRO 172 PRO 175 PRO 178, PRO I SS PR0356, PRO 179 PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 PR02 I 7, PR0219, PR0221 , PR0224, PR0228 PR0245, PR0246, PR0258, PR0261. PR0272, PRO301 PR0322, PR0328 PR0331 PR0364, PR0366 PR0535, PROS 19 PR0826, PRO l 160, PROl 186 or PRO 1246 polypeptide is administered following pπmaiy angioplasty 38 The method of Claim 31 wherein the cardiovascular endothehal or angiogenic disorder is cancer

39 The method of Claim 38 wherein the PR0172, PR0175, PR0178, PR0188, PR0356, PR0179 PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PROS 19, PR0826 PRO l 160, PROl 186 or PRO 1246 polypeptide is administered in combination with a chemotherapeutic agent, a growth inhibitory agent or a cytotoxic agent

40 The method of Claim 31 wherein said agonist is an antι-PR0172, antι-PR0175, antι-PR0178, anti- PROl 88, antι-PR0356, anti-PRO 179. anti-PROl 97, anti-PROl 98, anti-PROl 82, anti-PROl 95, antι-PRO200, anti- PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221 , antι-PR0224, antι-PR0228, antι-PR0245, antι-PR0246, anti- PR0258, antι-PR0261 , antι-PR0272, antι-PRO301 , antι-PR0322, antι-PR0328, antι-PR0331 , antι-PR0364, anti- PR0366, antι-PR0535, antι-PR0819, antι-PR0826, anti-PROl 160, anti-PRO l 186 or antι-PR01246 antibody

41 The method of Claim 31 wherein said antagonist is an anti-PRO 172, anti-PRO 175, anti-PROl 78, anti- PROl 88, antι-PR0356, anti-PRO 179, anti-PRO 197. anti-PRO 198, anti-PRO 182, anti-PRO 195, antι-PRO200. anti- PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221 , antι-PR0224, antι-PR0228, antι-PR0245, antι-PR0246, anti- PR0258, antι-PR0261. antι-PR0272, antι-PRO301 , antι-PR0322, antι-PR0328, antι-PR0331 , antι-PR0364, anti- PR0366, antι-PR0535, antι-PR0819, antι-PR0826, anti-PROl 160, anti-PROl 186 or anti-PROl 246 antibody

42 A method tor treating a cardiovascular, endothehal or angiogenic disorder in a mammal comprising administering to the mammal a nucleic acid molecule that encodes a PR0172, PR0175, PR0178, PR0188 PR0356, PR0179, PR0197 PRO 198, PRO 182 PR0195 PRO200, PR021 1 , PR0217, PR0219, PR0221 PR0224 PR0228, PR0245, PR0246, PR0258 PR0261 PR0272, PRO301 PR0322, PR0328. PR0331 , PR0364, PR0366 PR0535, PR0819, PR0826 PRO l 160 PROl 186 or PRO 1246 polypeptide oi agonist oi antagonist thereof

43 The method of Claim 42 wherein said agonist is an anti PRO 172 anti-PRO 175, anti-PRO 178, anti PRO 188, antι-PR0356. anti-PRO 179, anti-PRO 197, anti-PRO 198, anti-PRO 182. anti-PRO 195, antι-PRO200 anti- PR021 1 , antι-PR0217, antι-PR0219, antι-PR0221. antι-PR0224, antι-PR0228 antι-PR0245, antι-PR0246 anti- PR025S, antι-PR0261 antι-PR0272. antι-PRO301. antι-PR0322, antι-PR032S, antι-PR03 1 , antι-PR0364 anti- PR0366, antι-PR0535, anti-PROS 19, antι-PR0826, anti-PRO 1 160, anti-PRO 1 186 or anti-PRO 1246 antibody

44 The method of Claim 42 wherein said antagonist is an anti-PRO 172 anti-PRO 175, anti PRO 178 anti PROl 88 antι-PR0356, anti-PRO 179, anti-PRO 197. anti-PRO 198. anti-PRO 1 82, anti-PRO 1 5. antι-PRO200 anti PR021 l . antι-PR0217, antι-PR0219, antι-PR0221 antι-PR0224, antι-PR0228, antι-PR0245 anti PR0246, antι PR0258. antι-PR0261 , antι-PR0272. antι-PRO301. antι-PR0322, antι-PR0328, antι-PR0331 , antι-PR0364, anti PR0366, antι-PR0535. antι-PR0819, antι-PR0826, anti-PROl 160. anti-PROl 186 or antι-PR01246 antibody

45 The method of Claim 42, wherein the mammal is human

46 The method of Claim 42, wherein the nucleic acid molecule is administered via ex

o gene therapy

47 A recombinant retroviral particle comprising a retroviral vector consisting essentially of ( 1 ) a promoter, (2) nucleιc acιdencodιngaPR0172, PR0175, PR0178, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PR01246 polypeptide or agonist or antagonist thereof, and (3) a signal sequence foi cellular secretion of the polypeptide, whei ein the retroviral vectoi is in association with retroviral structural proteins

48 An ex vivo producer cell comprising a nucleic acid construct that expi esses retroviral structural proteins and also comprises a retroviral vector consisting essentially of a ( 1 ) promoter, (2) nucleic acid encoding a PRO 172. PR0175, PROI 78, PR0188, PR0356, PR0179, PR0197, PR0198, PR0182, PR0195, PRO200, PR021 1. PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide or agonist or antagonist thereof, and (3) a signal sequence for cellular secretion ot the polypeptide, wherein said producer cell packages the retroviral vector in association with the structural proteins to produce recombinant retroviral particles

49 A method for inhibiting endothelial cell growth in a mammal comprising administering to the mammal a PR0172, PR0175, PR0178, PR0188. PR0179, PR0197, PR0198, PR0182, PRO200, PR021 1. PR0217, PR0219, PR0221 , PR0224, PR0228 PR0245, PR0246, PR0258 PR0261. PR0272. PRO301 , PR0322 PR0328, PR0331 or PR0366 polypeptide or agonist thereof wherein endothehal cell growth in said mammal is inhibited

50 A method for stimulating endothehal cell growth in a mammal comprising administering to the mammal a PR0356. PROl 79 PR0364. PR0535, PR0819, PR0826, PROl 160. PROl 186 oi PRO 1246 polypeptide oi agonist thereof, wherein endothelial cell growth in said mammal is stimulated

51 A method of inhibiting endothehal cell growth in a mammal compi ising administering to the mammal an antagonist of a PR0356, PRO 179, PR0364, PR0535, PROS 19, PR0826. PRO l 160 PRO l 186 or PRO 1246 polypeptide, wheiein endothehal cell growth in said mammal is inhibited

52 A method of stimulating endothelial cell growth in a mammal comprising administering to the mammal an antagonist ot a PR0172, PR0175, PR0178, PR0188, PR0179, PR0197, PR0198, PR0182, PRO200 PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 or PR0366 polypeptide, wherein endothehal cell growth in said mammal is stimulated

53 A method tor inducing cardiac hypertrophy in a mammal comprising administering to the mammal a PRO 179, PRO 195 or PR0224 polypeptide or agonist thereof, wheiein cardiac hypertrophy in said mammal is induced

54 A method of reducing cardiac hypertrophy in a mammal compπsing administering to the mammal an antagonist of a PRO 179, PRO 195 or PR0224 polypeptide, wherein cardiac hypertrophy in said mammal is reduced

55 A method tor inhibiting angiogenesis induced by a PR0356, PRO 179, PR0364, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide in a mammal comprising administering a therapeutically effective amount of an antι-PR0356, anti-PRO 179, antι-PR0364 antι-PR0535, antι-PR0819, antι-PR0826. anti- PROl 160, anti-PROl 186 or anti-PROl 246 antibody to the mammal, wherein said angiogenesis is inhibited

56 A method for stimulating angiogenesis induced by a PR0356, PRO 179, PR0364, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PROl 246 polypeptide in a mammal compπsing administering a therapeutically effective amount of said polypeptide to the mammal, wherein said angiogenesis is stimulated

57 Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence that encodes an amino acid sequence selected from the group consisting of the am o acid sequence shown in Figure 2 (SEQ ID NO 2), Figure 4 (SEQ ID NO 9), Figure 6 (SEQ ID NO 1 1 ), Figure 8 (SEQ ID NO 16), Figure 10 (SEQ ID NO 21 ), Figure 12 (SEQ ID NO 26) Figure 14 (SEQ ID NO 31 ) Figuie 16 (SEQ ID NO 36), Figure 1 8 (SEQ ID NO 41 ), Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51 ). Figure 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67), Figure 30 (SEQ ID NO 72) Figure 32 (SEQ ID NO 77), Figuie 34 (SEQ ID NO 82), Figure 36 (SEQ ID NO 91 ), Figure 38 (SEQ ID NO 96), Figure 40 (SEQ ID NO 101 ), Figure 42 (SEQ ID NO 108), Figure 44 (SEQ ID NO 1 13), Figure 46 (SEQ ID NO 1 19), Figure 48 (SEQ ID NO 127), Figure 50 (SEQ ID NO 1 2), Figure 52 (SEQ ID NO 137), Figure 54 (SEQ ID NO 142), Figuie 56 (SEQ ID NO 152), Figure 58 (SEQ ID NO 154), Figure 60 (SEQ ID NO 156), Figuie 62 (SEQ ID NO 158) Figure 64 (SEQ ID NO 160) Figure 66 (SEQ ID NO 165) and Figure 68 (SEQ ID NO 167)

58 Isolated nucleic acid hav ing at least 807c nucleic acid sequence identity to a nucleotide sequence selected trom the group consisting of the nucleotide sequence show n in Figuies 1 A I B (SEQ ID NO 1 ) Figuies 3A-3B (SEQ ID NO 8), Figure 5 (SEQ ID NO 10), Figures 7A-7B (SEQ ID NO 15), Figuies 9A-9B (SEQ ID NO 20), Figui es 1 1 A- 1 1 B (SEQ ID NO 25), Figure 13 (SEQ ID NO 30), Figui e 1 (SEQ ID NO 35), Figui e 17 (SEQ ID NO 40), Figure 19 (SEQ ID NO 45), Figures 21 A-21 B (SEQ ID NO 50), Figure 23 (SEQ ID NO 56), Figures 25A-25B (SEQ ID NO 61 ), Figures 27A-27B (SEQ ID NO 66), Figure 29 (SEQ ID NO 71 ), Figure 1 (SEQ ID NO 76), Figures 33A-33B (SEQ ID NO 81 ), Figure 35 (SEQ ID NO 90), Figure 37 (SEQ ID NO 95), Figure 39 (SEQ ID NO 100), Figure 41 (SEQ ID NO 107), Figure 43 (SEQ ID NO 1 12), Figure 45 (SEQ ID NO 1 18), Figure 47 (SEQ ID NO 126), Figure 49 (SEQ ID NO 131 ), Figures 51 A-51 B (SEQ ID NO 136), Figure 53 (SEQ ID NO 141 ), Figure 55 (SEQ ID NO 151 ), Figure 57 (SEQ ID NO 153), Figure 59 (SEQ ID NO 155), Figure 61 (SEQ ID NO 157), Figure 63 (SEQ ID NO 159), Figure 65 (SEQ ID NO 164), and Figures 67A-67B (SEQ ID NO 166)

59 Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence selected from the group consisting of the full-length coding sequence of the nucleotide sequence shown in Figures 1A-1B (SEQ ID NO 1 ), Figures 3A-3B (SEQ ID NO 8), Figure 5 (SEQ ID NO 10), Figures 7A-7B (SEQ ID NO 15), Figures 9A-9B (SEQ ID NO 20). Figures 1 1 A- 1 1 B (SEQ ID NO 25), Figure 13 (SEQ ID NO 30), Figure 15 (SEQ ID NO 35), Figure 17 (SEQ ID NO 40), Figure 19 (SEQ ID NO 45), Figures 21 A-21 B (SEQ ID NO 50), Figure 23 (SEQ ID NO 56), Figures 25A-25B (SEQ ID NO 61 ) Figuies 27A-27B (SEQ ID NO 66), Figure 29 (SEQ ID NO 71 ), Figure 31 (SEQ ID NO 76), Figuies 33A-33B (SEQ ID NO 81 ), Figure 35 (SEQ ID NO 90) Figure 37 (SEQ ID NO 95), Figure 39 (SEQ ID NO 100) Figure 41 (SEQ ID NO 107), Figure 43 (SEQ ID NO 1 12), Figure 45 (SEQ ID NO 1 18), Figure 47 (SEQ ID NO 126), Figure 49 (SEQ ID NO 131 ), Figures 51 A 51B (SEQ ID NO 136), Figure 53 (SEQ ID NO 141 ), Figure 55 (SEQ ID NO 151 ), Figure 57 (SEQ ID NO 153), Figure 59 (SEQ ID NO 155), Figure 61 (SEQ ID NO 157), Figure 63 (SEQ ID NO 159), Figure 65 (SEQ ID NO 164), and Figures 67A-67B (SEQ ID NO 166)

60 Isolated nucleic acid having at least 80% nucleic acid sequence identity to the full-length coding sequence of the DNA deposited under ATCC accession number 209419, 209466, 209282, 209279, 209422 209281 , 209284, 209283, 209296 209772 209653, 209258, 209256 209384, 209262, 209263 209420, 209265 209396, 209402, 209391 209388, 209432 209669 209438 209489 209436, 209087, 203013, 203006, 203017 203100, 203091 or 203457

61 A vector comprising the nucleic acid ot any one of Claims 57 to 60

62 The vectoi of Claim ό l opeiably linked to control sequences recognized by a host cell transformed with the vectoi

63 A host cell comprising the vector of Claim 61

64 The host cell ot Claim 63, wherein said cell is a CHO cell 65 The host cell of Claim 63 wherein said cell is an E coli

66 The host cell of Claim 63 wherein said cell is a yeast cell

67 The host cell of Claim 63, wherein said cell is a Baculovirus infected insect cell

68 A process for producing a PRO 172, PRO 175, PRO 178, PROl 88, PR0356, PRO 179, PRO 197, PR0198, PR0182, PR0195, PRO200, PR021 1 , PR0217, PR0219, PR0221 , PR0224, PR0228, PR0245, PR0246, PR0258, PR0261 , PR0272, PRO301 , PR0322, PR0328, PR0331 , PR0364, PR0366, PR0535, PR0819, PR0826, PROl 160, PROl 186 or PRO 1246 polypeptide comprising cultuπng the host cell of Claim 63 under conditions suitable for expression of said polypeptide and recovering said polypeptide from the cell culture

69 An isolated polypeptide having at least 80% amino acid sequence identity to an amino acid sequence selected from the group consisting of the ammo acid sequence shown in Figure 2 (SEQ ID NO 2) Figure 4 (SEQ ID NO 9), Figure 6 (SEQ ID NO 1 1 ), Figure 8 (SEQ ID NO 16), Figure 10 (SEQ ID NO 21 ), Figure 12 (SEQ ID NO 26), Figuie 14 (SEQ ID NO 31 ), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO 41 ). Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51 ), Figure 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67), Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 77), Figure 34 (SEQ ID NO 82), Figure 36 (SEQ ID NO 91 ), Figure 38 (SEQ ID NO 96), Figure 40 (SEQ ID NO 101 ), Figure 42 (SEQ ID NO 108) Figure 44 (SEQ ID NO 1 13), Figure 46 (SEQ ID NO 1 19), Figure 48 (SEQ ID NO 127) Figuie 50 (SEQ ID NO 1 2), Figure 52 (SEQ ID NO 137), Figure 54 (SEQ ID NO 142), Figure 56 (SEQ ID NO 152), Figure 58 (SEQ ID NO 154) Figure 60 (SEQ ID NO 156), Figure 62 (SEQ ID NO 158), Figure 64 (SEQ ID NO 160), Figure 66 (SEQ ID NO 165), and Figure 68 (SEQ ID NO 167)

70 An isolated polypeptide scoring at least 80% positives when compared to an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 2 (SEQ ID NO 2) Figure 4 (SEQ ID NO 9) Figure 6 (SEQ ID NO 1 1 ), Figure 8 (SEQ ID NO 16) Figui e 10 (SEQ ID NO 21 ), Figure 12 (SEQ ID NO 26), Figure 14 (SEQ ID NO 1 ), Figure 16 (SEQ ID NO 36), Figure 1 8 (SEQ ID NO 41 ), Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51 ), Figuie 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67) Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 77), Figure 34 (SEQ ID NO 82), Figure 36 (SEQ ID NO 91 ) Figure 38 (SEQ ID NO 96), Figure 40 (SEQ ID NO 101 ), Figure 42 (SEQ ID NO 108) Figure 44 (SEQ ID NO 1 1 ) Figure 46 (SEQ ID NO 1 19), Figure 48 (SEQ ID NO 127) Figure 50 (SEQ ID NO 1 32) Figure 52 (SEQ ID NO 137) Figure 54 (SEQ ID NO 142), Figure 56 (SEQ ID NO 152) Figure 58 (SEQ ID NO 1 4) Figuie 60 (SEQ ID NO 156), Figure 62 (SEQ ID NO 158), Figuie 64 (SEQ ID NO 160), Figure 66 (SEQ ID NO 165) and Figure 68 (SEQ ID NO 167)

71 An isolated polypeptide having at least 80% amino acid sequence identity to an amino acid sequence encoded by the full-length coding sequence of the DNA deposited under ATCC accession number 209419, 209466, 209282, 209279, 209422, 209281 , 209284, 209283, 209296, 209772, 209653, 209258, 209256, 209384, 209262 209263, 209420, 209265, 209396, 209402, 209391 , 209388 209432, 209669, 209438, 209489, 209436 209087 20301 , 203006, 203017, 203100, 203091 , or 203457

72 A chimeric molecule comprising a polypeptide according to any one of Claims 69 to 71 fused to a heterologous amino acid sequence

73 The chimeric molecule of Claim 72, wherein said heterologous amino acid sequence is an epitope tag sequence

74 The chimeric molecule of Claim 72, wherein said heterologous ammo acid sequence is a Fc region of an immunoglobulin

75 An antibody which specifically binds to a polypeptide according to any one of Claims 69 to 71

76 The antibody of Claim 75 wherein said antibody is a monoclonal antibody, a humanized antibody oi a single-chain antibody

77 Isolated nucleic acid having at least 80% nucleic acid sequence identity to

(a) a nucleotide sequence encoding the polypeptide shown in Figure 2 (SEQ ID NO 2), Figure 4 (SEQ ID NO 9), Figure 6 (SEQ ID NO 1 1 ) Figure 8 (SEQ ID NO 16), Figure 10 (SEQ ID NO 21 ), Figure 12 (SEQ ID NO 26), Figure 14 (SEQ ID NO 31 ), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO 41 ), Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51 ), Figure 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67), Figuie 30 (SEQ ID NO 72) Figure 32 (SEQ ID NO 77), Figure 34 (SEQ ID NO 82) Figure 36 (SEQ ID NO 91 ), Figure 38 (SEQ ID NO 96) Figure 40 (SEQ ID NO 101 ), Figure 42 (SEQ ID NO 108), Figure 44 (SEQ ID NO 1 13), Figure 46 (SEQ ID NO 119) Figure 48 (SEQ ID NO 127) Figure 50 (SEQ ID NO 132), Figure 52 (SEQ ID NO 137), Figure 54 (SEQ ID NO 142), Figure 56 (SEQ ID NO 1 52), Figuie 58 (SEQ ID NO 1 54), Fιgure 60 (SEQ ID NO 156), Figure 62 (SEQ ID NO 158), Figure 64 (SEQ ID NO 160), Figure 66 (SEQ ID NO 165), or Figure 68 (SEQ ID NO 167), lacking its associated signal peptide

(b) a nucleotide sequence encoding an extracellular domain ot the polypeptide shown in Figure 2 (SEQ ID NO 2), Figure 4 (SEQ ID NO 9), Figure 6 (SEQ ID NO 1 1 ), Figure 8 (SEQ ID NO 16), Figure 10 (SEQ ID NO 21 ), Figure 12 (SEQ ID NO 26) Figure 14 (SEQ ID NO 31 ), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO 41 ), Figure 20 (SEQ ID NO 46) Figure 22 (SEQ ID NO 1 ), Figure 24 (SEQ ID NO 57) Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67) Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 77), Figure 34 (SEQ ID NO 82), Figuie 36 (SEQ ID NO 91 ) Figure 38 (SEQ ID NO 96), Figure 40 (SEQ ID NO 101 ) Figure 42 (SEQ ID NO 108), Figure 44 (SEQ ID NO 1 13), Figure 46 (SEQ ID NO 1 19), Figuie 48 (SEQ ID NO 127) Figure 50 (SEQ ID NO 132), Figure 52 (SEQ ID NO 137), Figure 54 (SEQ ID NO 142), Figure 56 (SEQ ID NO 152), Figuie 58 (SEQ ID NO 154), Figure 60 (SEQ ID NO 156), Figure 62 (SEQ ID NO 158), Figure 64 (SEQ ID NO 160), Figure 66 (SEQ ID NO 165), or Figure 68 (SEQ ID NO 167), with its associated signal peptide. or

(c) a nucleotide sequence encoding an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO 2), Figure 4 (SEQ ID NO 9), Figure 6 (SEQ ID NO 1 1 ), Figure 8 (SEQ ID NO 16), Figure 10 (SEQ ID NO 21 ), Figui e 12 (SEQ ID NO 26), Figure 14 (SEQ ID NO 31 ), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO 41 ), Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51 ), Figure 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67), Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 77) Figure 34 (SEQ ID NO 82), Figure 36 (SEQ ID NO 91 ), Figure 38 (SEQ ID NO 96), Figure 40 (SEQ ID NO 101 ), Figure 42 (SEQ ID NO 108), Figure 44 (SEQ ID NO 1 13), Figure 46 (SEQ ID NO 1 19), Figure 48 (SEQ ID NO 127), Figure 50 (SEQ ID NO 132), Figure 52 (SEQ ID NO 137), Figure 54 (SEQ ID NO 142), Figure 56 (SEQ ID NO 152), Figure 58 (SEQ ID NO 154), Figure 60 (SEQ ID NO 156), Figure 62 (SEQ ID NO 158), Figure 64 (SEQ ID NO 160), Figure 66 (SEQ ID NO 165), or Figure 68 (SEQ ID NO 167), lacking its associated signal peptide

78 An isolated polypeptide having at least 80% amino acid sequence identity to

(a) the polypeptide shown in Figure 2 (SEQ ID NO 2) Figure 4 (SEQ ID NO 9), Figure 6 (SEQ ID NO 1 1 ), Figure 8 (SEQ ID NO 16), Figui e 10 (SEQ ID NO 21 ), Figure 12 (SEQ ID NO 26), Figui e 14 (SEQ ID NO 31 ), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO 41 ), Figure 20 (SEQ ID NO 46), Figure 22 (SEQ ID NO 51 ), Figure 24 (SEQ ID NO 57), Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67), Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 77). Figure 34 (SEQ ID NO 82), Figure 36 (SEQ ID NO 91 ), Figure 38 (SEQ ID NO 96), Figure 40 (SEQ ID NO 101 ), Figure 42 (SEQ ID NO 108), Figure 44 (SEQ ID NO 1 13), Figure 46 (SEQ ID NO 1 19) Figure 48 (SEQ ID NO 127), Figure 50 (SEQ ID NO 132) Figure 52 (SEQ ID NO 1 37), Figure 54 (SEQ ID NO 142), Figure 56 (SEQ ID NO 152), Figure 58 (SEQ ID NO I 54), Figure 60 (SEQ ID NO 1 56), Figure 62 (SEQ ID NO 158) Figure 64 (SEQ ID NO 160) Figure 66 (SEQ ID NO 165), or Figure 68 (SEQ ID NO 167) lacking its associated signal peptide,

(b) an extracellular domain of the polypeptide shown in Figuie 2 (SEQ ID NO 2), Figure 4 (SEQ ID NO 9) Figure 6 (SEQ ID NO 1 1 ), Figure 8 (SEQ ID NO 16), Figure 10 (SEQ ID NO 21 ), Figure 12 (SEQ ID NO 26), Figure 14 (SEQ ID NO 31 ), Figure 16 (SEQ ID NO 36), Figure 18 (SEQ ID NO 41 ), Figure 20 (SEQ ID NO 46) Figure 22 (SEQ ID NO 51 ), Figure 24 (SEQ ID NO 57) Figure 26 (SEQ ID NO 62), Figure 28 (SEQ ID NO 67) Figure 30 (SEQ ID NO 72), Figure 32 (SEQ ID NO 77), Figure 34 (SEQ ID NO 82) Figuie 36 (SEQ ID NO 91 ), Figure 38 (SEQ ID NO 96), Figuie 40 (SEQ ID NO 101 ), Figure 42 (SEQ ID NO 108) Figure 44 (SEQ ID NO 1 13) Figure 46 (SEQ ID NO 1 19), Figure 48 (SEQ ID NO 127) Figure 50 (SEQ ID NO 1 2), Figure 52 (SEQ ID NO 137) Figure 54 (SEQ ID NO 142) Figure 56 (SEQ ID NO 1 52), Figuie 58 (SEQ ID NO I 54), Figure 60 (SEQ ID NO 156), Figure 62 (SEQ ID NO 158), Figure 64 (SEQ ID NO 1 0) Figuie 66 (SEQ ID NO 165), or Figure 68 (SEQ ID NO 167) with its associated signal peptide, oi

(c) an extracellular domain of the polypeptide shown in Figuie 2 (SEQ ID NO 2), Figure 4 (SEQ ID NO 9), Figure 6 (SEQ ID NO 1 1 ), Figure 8 (SEQ ID NO 16), Figure 10 (SEQ ID NO 21 ), Figure 12 (SEQ ID NO 26) Figure 14 (SEQ ID NO:31 ), Figure 16 (SEQ ID NO:36), Figure 18 (SEQ ID NO:41 ), Figure 20 (SEQ ID NO:46). Figure 22 (SEQ ID NO:51 ), Figure 24 (SEQ ID NO:57), Figure 26 (SEQ ID NO:62), Figure 28 (SEQ ID NO:67). Figure 30 (SEQ ID NO:72), Figure 32 (SEQ ID NO:77), Figure 34 (SEQ ID NO:82), Figure 36 (SEQ ID N0:91 ), Figure 38 (SEQ ID NO:96), Figure 40 (SEQ ID NO: 101 ), Figure 42 (SEQ ID NO: 108), Figure 44 (SEQ ID NO: 1 13), Figure 46 (SEQ ID NO: 1 19), Figure 48 (SEQ ID NO: 127), Figure 50 (SEQ ID NO: 132), Figure 52 (SEQ ID NO: 137), Figure 54 (SEQ ID NO: 142), Figure 56 (SEQ ID NO: 152), Figure 58 (SEQ ID NO: 154), Figure 60 (SEQ ID NO: 156), Figure 62 (SEQ ID NO: 158), Figure 64 (SEQ ID NO: 160), Figure 66 (SEQ ID NO: 165), or Figure 68 (SEQ ID NO: 167), lacking its associated signal peptide.