WO2000053754A1 - Compositions and methods for the treatment of tumor - Google Patents

Compositions and methods for the treatment of tumor Download PDF

Info

Publication number
WO2000053754A1
WO2000053754A1 PCT/US2000/000277 US0000277W WO0053754A1 WO 2000053754 A1 WO2000053754 A1 WO 2000053754A1 US 0000277 W US0000277 W US 0000277W WO 0053754 A1 WO0053754 A1 WO 0053754A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
antι
polypeptide
pro703
antibody
Prior art date
Application number
PCT/US2000/000277
Other languages
French (fr)
Inventor
Kevin P. Baker
Frederic J. Desauvage
Audrey Goddard
Austin L. Gurney
Robert D. Klein
Margaret Ann Roy
William I. Wood
Original Assignee
Genentech, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US1999/005028 external-priority patent/WO1999046281A2/en
Priority claimed from PCT/US1999/023089 external-priority patent/WO2000021996A2/en
Priority claimed from PCT/US1999/028313 external-priority patent/WO2000032221A2/en
Priority claimed from PCT/US1999/028564 external-priority patent/WO2000055319A1/en
Priority claimed from PCT/US1999/028551 external-priority patent/WO2000053750A1/en
Priority claimed from PCT/US1999/031274 external-priority patent/WO2000053752A2/en
Priority claimed from PCT/US1999/031243 external-priority patent/WO2000053751A1/en
Application filed by Genentech, Inc. filed Critical Genentech, Inc.
Priority to AU22248/00A priority Critical patent/AU2224800A/en
Priority to JP2000603377A priority patent/JP2004513602A/en
Priority to CA002361840A priority patent/CA2361840A1/en
Priority to KR1020017011399A priority patent/KR20030002292A/en
Priority to PCT/US2000/004341 priority patent/WO2000053756A2/en
Priority to EP00907314A priority patent/EP1263948A2/en
Priority to JP2000603379A priority patent/JP2004516227A/en
Priority to AU35144/00A priority patent/AU3514400A/en
Priority to KR1020017011406A priority patent/KR20010103046A/en
Priority to EP00913764A priority patent/EP1220905A2/en
Priority to CA002362427A priority patent/CA2362427A1/en
Priority to PCT/US2000/005841 priority patent/WO2000053758A2/en
Publication of WO2000053754A1 publication Critical patent/WO2000053754A1/en
Priority to CA002491610A priority patent/CA2491610A1/en
Priority to EP06000582A priority patent/EP1666495A1/en
Priority to EP06000588A priority patent/EP1690873A3/en
Priority to PCT/US2000/032678 priority patent/WO2001040466A2/en
Priority to EP06000587A priority patent/EP1690872A3/en
Priority to EP10005292A priority patent/EP2228446A1/en
Priority to EP00983846A priority patent/EP1250426A2/en
Priority to AU20554/01A priority patent/AU2055401A/en
Priority to EP06000586A priority patent/EP1688497A1/en
Priority to EP06000585A priority patent/EP1661996A1/en
Priority to CA2709291A priority patent/CA2709291A1/en
Priority to EP06000583A priority patent/EP1686134A3/en
Priority to CA002496312A priority patent/CA2496312A1/en
Priority to JP2001542531A priority patent/JP2004522404A/en
Priority to CA002490909A priority patent/CA2490909A1/en
Priority to CA002492070A priority patent/CA2492070A1/en
Priority to CA002492049A priority patent/CA2492049A1/en
Priority to CA002491258A priority patent/CA2491258A1/en
Priority to EP05025102A priority patent/EP1672070A3/en
Priority to CA002391455A priority patent/CA2391455A1/en
Priority to CA002491433A priority patent/CA2491433A1/en
Priority to CA002494705A priority patent/CA2494705A1/en
Priority to EP06000589A priority patent/EP1661997A1/en
Priority to EP06000581A priority patent/EP1666494A1/en
Priority to CA002490853A priority patent/CA2490853A1/en
Priority to EP06000584A priority patent/EP1669371A3/en
Priority to US09/828,366 priority patent/US20020010137A1/en
Priority to US09/918,585 priority patent/US20030060406A1/en
Priority to US09/978,295 priority patent/US20020156006A1/en
Priority to US09/978,193 priority patent/US20030073624A1/en
Priority to US09/978,299 priority patent/US20030199435A1/en
Priority to US09/978,192 priority patent/US20020177553A1/en
Priority to US09/978,189 priority patent/US6972325B2/en
Priority to US09/978,194 priority patent/US20030195333A1/en
Priority to US09/978,188 priority patent/US20030139328A1/en
Priority to US09/978,191 priority patent/US20030050239A1/en
Priority to US09/978,298 priority patent/US20030134785A1/en
Priority to US09/978,564 priority patent/US7195760B2/en
Priority to US09/978,423 priority patent/US20030069178A1/en
Priority to US09/978,681 priority patent/US20030195148A1/en
Priority to US09/978,403 priority patent/US20030050240A1/en
Priority to US09/981,915 priority patent/US20030054986A1/en
Priority to US09/978,824 priority patent/US20050124789A9/en
Priority to US09/978,665 priority patent/US7294700B2/en
Priority to US09/978,643 priority patent/US20030104998A1/en
Priority to US09/978,757 priority patent/US20030083248A1/en
Priority to US09/981,915 priority patent/US7285623B2/en
Priority to US09/978,375 priority patent/US7196165B2/en
Priority to US09/978,802 priority patent/US20030199674A1/en
Priority to US09/978,697 priority patent/US20020169284A1/en
Priority to US09/978,608 priority patent/US20030045462A1/en
Priority to US09/978,585 priority patent/US20030049633A1/en
Priority to US09/978,544 priority patent/US20030199436A1/en
Priority to US09/978,824 priority patent/US20030055216A1/en
Priority to US10/152,388 priority patent/US20040223964A1/en
Priority to US10/210,028 priority patent/US20030203446A1/en
Priority to US10/160,502 priority patent/US7220835B2/en
Priority to US10/165,247 priority patent/US7112657B2/en
Priority to US10/164,749 priority patent/US20040029218A1/en
Priority to US10/165,036 priority patent/US20050227342A1/en
Priority to US10/166,709 priority patent/US20030104536A1/en
Priority to US10/164,929 priority patent/US20030194781A1/en
Priority to US10/145,017 priority patent/US20030186365A1/en
Priority to US10/165,067 priority patent/US7279553B2/en
Priority to US10/143,029 priority patent/US7105640B2/en
Priority to US10/162,521 priority patent/US7067628B2/en
Priority to US10/164,829 priority patent/US20030194780A1/en
Priority to US10/145,089 priority patent/US7208575B2/en
Priority to US10/145,124 priority patent/US20030190701A1/en
Priority to US10/164,728 priority patent/US20030186368A1/en
Priority to US10/013,922 priority patent/US20030195345A1/en
Priority to US09/999,829 priority patent/US20030195344A1/en
Priority to US10/017,083 priority patent/US20030148376A1/en
Priority to US10/017,086 priority patent/US7122375B2/en
Priority to US09/999,833 priority patent/US6916648B2/en
Priority to US10/017,081 priority patent/US20030049684A1/en
Priority to US10/017,085 priority patent/US6974696B2/en
Priority to US09/999,832 priority patent/US20020192706A1/en
Priority to US09/999,830 priority patent/US20030077700A1/en
Priority to US09/999,832 priority patent/US7132283B2/en
Priority to US09/999,834 priority patent/US20030064407A1/en
Priority to US10/017,084 priority patent/US20030203402A1/en
Priority to US10/002,967 priority patent/US20030148373A1/en
Priority to US10/020,445 priority patent/US20030198994A1/en
Priority to US10/013,926 priority patent/US7074593B2/en
Priority to US10/013,917 priority patent/US7029874B2/en
Priority to US10/016,177 priority patent/US20030073131A1/en
Priority to US10/013,923 priority patent/US7169912B2/en
Priority to US10/013,928 priority patent/US20030215905A1/en
Priority to US10/013,925 priority patent/US7037710B2/en
Priority to US10/013,920 priority patent/US20040006219A1/en
Priority to US10/013,929 priority patent/US7019124B2/en
Priority to US10/013,918 priority patent/US20030211091A1/en
Priority to US10/013,921 priority patent/US20030068648A1/en
Priority to US10/013,927 priority patent/US7189529B2/en
Priority to US09/990,456 priority patent/US20020137890A1/en
Priority to US10/028,072 priority patent/US20030004311A1/en
Priority to US09/978,187 priority patent/US20030096744A1/en
Priority to US10/119,480 priority patent/US20040087769A1/en
Priority to US10/121,042 priority patent/US20030096386A1/en
Priority to US10/121,046 priority patent/US20030194791A1/en
Priority to US10/121,040 priority patent/US20030082759A1/en
Priority to US10/121,051 priority patent/US20030092147A1/en
Priority to US10/121,044 priority patent/US20030190717A1/en
Priority to US10/121,041 priority patent/US20030077776A1/en
Priority to US10/121,059 priority patent/US20030190721A1/en
Priority to US10/121,045 priority patent/US20030073210A1/en
Priority to US10/121,047 priority patent/US20030077778A1/en
Priority to US10/121,061 priority patent/US20030082761A1/en
Priority to US10/121,049 priority patent/US20030022239A1/en
Priority to US10/121,054 priority patent/US20030199054A1/en
Priority to US10/121,063 priority patent/US20030199055A1/en
Priority to US10/121,050 priority patent/US20030054516A1/en
Priority to US10/121,055 priority patent/US20030190718A1/en
Priority to US10/121,060 priority patent/US20030190722A1/en
Priority to US10/121,057 priority patent/US20030190719A1/en
Priority to US10/121,053 priority patent/US20030199053A1/en
Priority to US10/121,048 priority patent/US20030199051A1/en
Priority to US10/121,058 priority patent/US20030190720A1/en
Priority to US10/121,056 priority patent/US20030082760A1/en
Priority to US10/121,043 priority patent/US7220831B2/en
Priority to US10/121,052 priority patent/US20030199052A1/en
Priority to US10/121,062 priority patent/US20030077779A1/en
Priority to US10/123,108 priority patent/US7635478B2/en
Priority to US10/123,262 priority patent/US20030049816A1/en
Priority to US10/123,292 priority patent/US20030073211A1/en
Priority to US10/123,215 priority patent/US7291329B2/en
Priority to US10/123,156 priority patent/US20030194792A1/en
Priority to US10/123,213 priority patent/US20030199057A1/en
Priority to US10/123,236 priority patent/US20030068795A1/en
Priority to US10/123,214 priority patent/US7343721B2/en
Priority to US10/123,212 priority patent/US7276577B2/en
Priority to US10/123,322 priority patent/US20030199059A1/en
Priority to US10/123,261 priority patent/US20030068796A1/en
Priority to US10/123,157 priority patent/US20030190725A1/en
Priority to US10/123,109 priority patent/US20030190723A1/en
Priority to US10/123,213 priority patent/US7193048B2/en
Priority to US10/123,291 priority patent/US20030199058A1/en
Priority to US10/123,235 priority patent/US20030082762A1/en
Priority to US10/123,771 priority patent/US20030199060A1/en
Priority to US10/123,155 priority patent/US20030068794A1/en
Priority to US10/123,154 priority patent/US20030190724A1/en
Priority to US10/123,902 priority patent/US20030077781A1/en
Priority to US10/123,905 priority patent/US7285625B2/en
Priority to US10/123,910 priority patent/US7329404B2/en
Priority to US10/123,904 priority patent/US20030022328A1/en
Priority to US10/123,912 priority patent/US20030100087A1/en
Priority to US10/123,909 priority patent/US7193049B2/en
Priority to US10/123,906 priority patent/US20030190726A1/en
Priority to US10/123,903 priority patent/US20030073212A1/en
Priority to US10/123,907 priority patent/US7084258B2/en
Priority to US10/123,911 priority patent/US7408032B2/en
Priority to US10/123,913 priority patent/US20030203462A1/en
Priority to US10/123,905 priority patent/US20030087344A1/en
Priority to US10/123,908 priority patent/US7335728B2/en
Priority to US10/124,817 priority patent/US20030077786A1/en
Priority to US10/124,813 priority patent/US7312307B2/en
Priority to US10/124,814 priority patent/US7105335B2/en
Priority to US10/124,824 priority patent/US20030077659A1/en
Priority to US10/125,795 priority patent/US7304131B2/en
Priority to US10/124,816 priority patent/US20030190728A1/en
Priority to US10/124,820 priority patent/US20030190729A1/en
Priority to US10/124,822 priority patent/US7109305B2/en
Priority to US10/124,818 priority patent/US20030082763A1/en
Priority to US10/124,823 priority patent/US20030199062A1/en
Priority to US10/124,821 priority patent/US20030199023A1/en
Priority to US10/125,805 priority patent/US20030194794A1/en
Priority to US10/124,819 priority patent/US7285626B2/en
Priority to US10/125,704 priority patent/US7357926B2/en
Priority to US10/125,922 priority patent/US7309762B2/en
Priority to US10/125,927 priority patent/US20030190731A1/en
Priority to US10/125,932 priority patent/US7317079B2/en
Priority to US10/125,924 priority patent/US7342097B2/en
Priority to US10/125,931 priority patent/US20030199063A1/en
Priority to US10/127,831 priority patent/US20030082689A1/en
Priority to US10/128,689 priority patent/US20030087365A1/en
Priority to US10/131,823 priority patent/US7304132B2/en
Priority to US10/131,817 priority patent/US7291701B2/en
Priority to US10/131,825 priority patent/US7282566B2/en
Priority to US10/137,867 priority patent/US20030207349A1/en
Priority to US10/137,865 priority patent/US20030032155A1/en
Priority to US10/137,868 priority patent/US20030082764A1/en
Priority to US10/140,023 priority patent/US20030207416A1/en
Priority to US10/140,020 priority patent/US20030207415A1/en
Priority to US10/139,963 priority patent/US7288625B2/en
Priority to US10/139,980 priority patent/US7247710B2/en
Priority to US10/140,474 priority patent/US20030032156A1/en
Priority to US10/140,024 priority patent/US20040058424A1/en
Priority to US10/140,470 priority patent/US20030022331A1/en
Priority to US10/140,860 priority patent/US7307151B2/en
Priority to US10/140,864 priority patent/US20030207419A1/en
Priority to US10/140,928 priority patent/US20030068798A1/en
Priority to US10/140,805 priority patent/US20030207417A1/en
Priority to US10/140,809 priority patent/US20030207418A1/en
Priority to US10/140,808 priority patent/US7425621B2/en
Priority to US10/140,865 priority patent/US20030207420A1/en
Priority to US10/140,925 priority patent/US20030073215A1/en
Priority to US10/140,921 priority patent/US7317080B2/en
Priority to US10/141,754 priority patent/US7361732B2/en
Priority to US10/141,755 priority patent/US7297764B2/en
Priority to US10/141,760 priority patent/US7342104B2/en
Priority to US10/141,701 priority patent/US20030207421A1/en
Priority to US10/141,756 priority patent/US7488586B2/en
Priority to US10/142,425 priority patent/US20030207424A1/en
Priority to US10/143,113 priority patent/US7329730B2/en
Priority to US10/142,430 priority patent/US7309766B2/en
Priority to US10/143,114 priority patent/US20030036180A1/en
Priority to US10/142,417 priority patent/US7304133B2/en
Priority to US10/142,431 priority patent/US7285629B2/en
Priority to US10/142,423 priority patent/US20030049817A1/en
Priority to US10/143,032 priority patent/US7408033B2/en
Priority to US10/142,419 priority patent/US7153941B2/en
Priority to US10/146,730 priority patent/US20030207427A1/en
Priority to US10/146,792 priority patent/US20030207428A1/en
Priority to US10/147,528 priority patent/US20030219885A1/en
Priority to US10/147,536 priority patent/US20040077064A1/en
Priority to US10/147,492 priority patent/US20030082765A1/en
Priority to US10/147,519 priority patent/US20030077791A1/en
Priority to US10/152,395 priority patent/US7189534B2/en
Priority to US10/153,934 priority patent/US20030129695A1/en
Priority to US10/156,843 priority patent/US20030207805A1/en
Priority to US10/157,782 priority patent/US20030077792A1/en
Priority to US10/157,786 priority patent/US20030208055A1/en
Priority to US10/158,791 priority patent/US20030207429A1/en
Priority to US10/158,782 priority patent/US20030082766A1/en
Priority to US10/160,498 priority patent/US20030073216A1/en
Priority to US10/176,913 priority patent/US20030022298A1/en
Priority to JP2005264293A priority patent/JP2006068016A/en
Priority to US11/341,175 priority patent/US7468427B2/en
Priority to US11/786,466 priority patent/US20080182275A1/en
Priority to JP2007326613A priority patent/JP2008161190A/en
Priority to JP2007326609A priority patent/JP2008148701A/en
Priority to JP2007325484A priority patent/JP2008148699A/en
Priority to JP2007326424A priority patent/JP2008167749A/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702Regulators; Modulating activity
    • C07K14/4703Inhibitors; Suppressors
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • Malignant tumors are the second leading cause of death in the United States, after heart disease (Boring et al , CA Cancel J Clin . 43 7 [1993])
  • Cancer is characterized by an increase in the number of abnormal, or neoplastic cells derived from a normal tissue which proliferate to form a tumor mass, the invasion of adjacent tissues by these neoplastic tumor cells, and the generation of malignant cells which eventually spread via the blood or lymphatic system to regional lymph nodes and to distant sites (metastasis)
  • a cell proliferates under conditions in which normal cells would not grow Cancer manifests itself in a wide variety of forms, characterized by different degrees of mvasiveness and aggressiveness Alteration of gene expression is intimately related to the uncontrolled cell growth and de-differentiation which are a common feature of all cancers
  • the genomes of certain well studied tumors have been found to show decreased expression of recessive genes, usually referred to as tumor suppression genes, which would normally function to prevent malignant cell growth, and/or overexpression of certain dominant genes, such as oncogenes, that act to promote malignant giowth
  • tumor suppression genes which would normally function to prevent malignant cell growth, and/or overexpression
  • a well known mechanism of gene (e g oncogene) overexpression in cancer cells is gene amplification This is a process where in the chromosome of the ancestral cell multiple copies of a particular gene are produced The process involves unscheduled replication of the region of chromosome comprising the gene, followed by recombination of the replicated segments back into the chromosome (Alitalo et al , Adv Cancer Res , 47 235 281 [1986]) It is believed that the overexpression of the gene parallels gene amplification, ; e is proportionate to the number of copies made
  • a recombinant humanized anti-ErbB2 (anti-HER2) monoclonal antibody (a humanized version of the murine anti-ErbB2 antibody 4D5, referred to as rhuMAb HER2 or HerceptinTM) has been clinically active in patients with ErbB2-overexpressing metastatic breast cancers that had received extensive prior anticancer therapy. (Baselga et al., J. Clin. Oncol.. 14:737-744 [1996]).
  • anti-HER2 humanized anti-ErbB2
  • the present invention concerns compositions and methods for the diagnosis and treatment of neoplastic cell growth and proliferation in mammals, including humans.
  • the present invention is based on the identification of genes that are amplified in the genome of tumor cells. Such gene amplification is expected to be associated with the overexpression of the gene product and contribute to tumorigenesis. Accordingly, the proteins encoded by the amplified genes are believed to be useful targets for the diagnosis and/or treatment (including prevention) of certain cancers, and may act as predictors of the prognosis of tumor treatment.
  • the present invention concerns an isolated antibody which binds to a polypeptide designated herein as a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PRO ⁇ l 5, PR0531. PR0538, PR03664, PRO ⁇ l 8, PR0772, PRO703, PR0792 or PR0474 polypeptide.
  • the isolated antibody specifically binds to a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615. PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide.
  • the antibody induces the death of a cell which expresses a PR0213, PRO1330, PR01449, PR0237, PR0324. PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664. PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide.
  • the cell that expresses the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PRO ⁇ l 8, PR0772, PRO703, PR0792 or PR0474 polypeptide is a tumor cell that overexpresses the polypeptide as compared to a normal cell of the same tissue type.
  • the antibody is a monoclonal antibody, which preferably has non-human complementarity determining region (CDR) residues and human framework region (FR) residues. The antibody may be labeled and may be immobilized on a solid support.
  • the antibody is an antibody fragment, a single-chain antibody, or a humanized antibody which binds, preferably specifically, to a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
  • the invention concerns a composition of matter which comprises an antibody which binds, preferably specifically, to a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in admixture with a pharmaceutically acceptable carrier
  • the composition of matter comprises a therapeutically effective amount of the antibody
  • the composition comprises a further active ingredient, which may, for example, be a further antibody or a cytotoxic or chemotherapeutic agent
  • the composition is sterile
  • the invention concerns isolated nucleic acid molecules which encode anti- PR0213, anti PRO1330, ant ⁇ -PR01449, ant ⁇ -PR0237, ant ⁇ -PR0324, ant ⁇ -PR0351 , ant ⁇ -PR0362, ant ⁇ -PR0615, ant ⁇ -PR0531 , ant ⁇ -PR0538, ant ⁇ -PR03664, ant ⁇ -PR0618, ant ⁇ -PR0772, ant ⁇ -PRO703, ant ⁇ -PR0792 or anti- PR0474 antibodies, and vectors and recombinant host cells comprising such nucleic acid molecules
  • the invention concerns a method for producing an ant ⁇ -PR0213, anti-
  • the invention further concerns antagonists of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PRO-531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide that inhibit one or more of the biological and/or lmmunological functions or activities of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703 , PR0792 or PR0474 polypeptide
  • the invention concerns an isolated nucleic acid molecule that hybridizes to a nucleic acid molecule encoding a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR061 , PR0531 , PR0538, PR03664, PR0618 PR0772, PRO703, PR0792 or PR0474 polypeptide or the complement thereof
  • the isolated nucleic acid molecule is preferably DNA, and hybridization preferably occurs under stringent hybridization and wash conditions
  • Such nucleic acid molecules can act as antisense molecules of the amplified genes identified herein, which, in turn, can find use in the modulation of the transcription and/or translation of the respective amplified genes, or as antisense primers in amplification reactions
  • sequences can be used as part of a ribozyme and/or a triple helix sequence which, in turn, may be used in regulation of the amplified genes
  • the invention provides a method for determining the presence of
  • the present invention concerns a method of diagnosing tumor in a mammal, comprising detecting the level of expression of a gene encoding a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher expression level in the test sample as compared to the control sample, is indicative of the presence of tumor m the mammal from which the test tissue cells were obtained
  • the present invention concerns a method of diagnosing tumor in a mammal, comprising (a) contacting an ant ⁇ -PR0213, ant ⁇ -PRO1330, ant ⁇ -PR01449, ant ⁇ -PR0237, ant ⁇ -PR0324, anti- PR0351, ant ⁇ -PR0362, ant ⁇ -PR0615, ant ⁇ -PR0531 , ant ⁇ -PR0538, ant ⁇ -PR03664, ant ⁇ -PR0618, ant ⁇ -PR0772, ant ⁇ -PRO703, ant ⁇ -PR0792 or ant ⁇ -PR0474 antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the ant ⁇ -PR0213, ant ⁇ -PRO1330, ant ⁇ -PR01449, anti- PR0237, ant ⁇ -PR0324, ant ⁇ -PR0351 , ant ⁇ -PR0362, ant ⁇ -PR0615, ant ⁇ -PR
  • the detection may be qualitative or quantitative, and may be performed in comparison with monitoring the complex formation in a control sample ot known normal tissue cells of the same cell type A larger quantity of complexes formed in the test sample indicates the presence of tumor in the mammal from which the test tissue cells were obtained
  • the antibody preieiably cai nes a detectable label Complex formation can be monitored, for example, by light microscopy, flow cytometi) , fluo ⁇ metry, or other techniques known in the art
  • test sample is usually obtained from an individual suspected to have neoplastic cell growth or proliferation (e g cancerous cells)
  • the present invention concerns a cancer diagnostic kit comprising an ant ⁇ -PR0213, ant ⁇ -PRO1330, ant ⁇ -PR01449, ant ⁇ -PR0237, ant ⁇ -PR0324.
  • a carrier e.g., a buffer
  • the kit preferably contains instructions for using the antibody to detect the presence of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PRO ⁇ l 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in a sample suspected of containing the same.
  • the invention concerns a method for inhibiting the growth of tumor cells comprising exposing tumor cells which express a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PRO ⁇ l 8, PR0772, PRO703, PR0792 or PR0474 polypeptide to an effective amount of an agent which inhibits a biological and/or immunological activity and/or the expression of a PR0213, PRO1330, PR01449, PR0237, PR0324.
  • the agent preferably is an anti-PR0213, anti-PRO1330, anti-PR01449, anti-PR0237, anti- PR0324, anti-PR0351, anti-PR0362, anti-PR0615, anti-PR0531 , anti-PR0538, anti-PR03664, anti-PR0618, anti-PR0772, anti-PRO703, anti-PR0792 or anti-PR0474 antibody, a small organic and inorganic molecule, peptide, phosphopeptide, antisense or ribozyme molecule, or a triple helix molecule.
  • the agent e.g., the anti-PR0213, anti-PRO1330, anti-PR01449, anti-PR0237, anti-PR0324, anti-PR0351, anti-PR0362, anti-PR0615, anti-PR0531, anti-PR0538, anti-PR03664, anti-PRO ⁇ l 8, anti-PR0772, anti-PRO703, anti-PR0792 or anti-PR0474 antibody, induces cell death.
  • the tumor cells are further exposed to radiation treatment and/or a cytotoxic or chemotherapeutic agent.
  • the invention concerns an article of manufacture, comprising: a container; a label on the container; and a composition comprising an active agent contained within the container; wherein the composition is effective for inhibiting the growth of tumor cells and the label on the container indicates that the composition can be used for treating conditions characterized by overexpression of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PROG 18, PR0772, PRO703, PR0792 or PR0474 polypeptide as compared to a normal cell of the same tissue type.
  • the active agent in the composition is an agent which inhibits an activity and/or the expression of a PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide.
  • the active agent is an anti-PR0213, anti-PRO1330, anti- PR01449, anti-PR0237, anti-PR0324, anti-PR0351 , anti-PR0362, anti-PR0615, anti-PR0531 , anti-PR0538, anti-PR03664, anti-PRO ⁇ l 8, anti-PR0772, anti-PRO703. anti-PR0792 or anti-PR0474 antibody or an antisense oligonucleotide.
  • the invention also provides a method for identifying a compound that inhibits an activity of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664.
  • PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide comprising contacting a candidate compound with a PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide under conditions and for a time sufficient to allow these two components to interact and determining whether a biological and/or immunological activity of the PR0213.
  • PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is inhibited.
  • either the candidate compound or the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is immobilized on a solid support.
  • the non-immobilized component carries a detectable label.
  • this method comprises the steps of (a) contacting cells and a candidate compound to be screened in the presence of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide under conditions suitable for the induction of a cellular response normally induced by a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and (b) determining the induction of said cellular response to determine if the test compound is an effective antagonist.
  • the invention provides a method for identifying a compound that inhibits the expression of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in cells that express the polypeptide, wherein the method comprises contacting the cells with a candidate compound and determining whether the expression of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is inhibited.
  • this method comprises the steps of (a) contacting cells and a candidate compound to be screened under conditions suitable for allowing expression of the PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and (b) determining the inhibition of expression of said polypeptide.
  • the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a PR0213.
  • the isolated nucleic acid molecule comprises a nucleotide sequence having at least about
  • sequence identity preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to (a) a DNA molecule encoding a PR0213, PROl 330,
  • the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity
  • the invention concerns an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity vet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably
  • soluble extracellular domains of the herein described PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptides are contemplated.
  • Another embodiment is directed to fragments of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
  • polypeptide coding sequence or the complement thereof, that may find use as, for example, hybridization probes, for encoding fragments of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide that may optionally encode a polypeptide comprising a binding site for an anti-PR0213, anti-PRO 1330, anti-PRO 1449, anti-PR0237, anti-PR0324, anti-PR0351, anti-PR0362, anti-PR0615, anti-PR0531 , anti-PR0538, anti-PR03664, anti-PR0618,
  • nucleic acid fragments are usually at least about 20 nucleotides in length, preferably at least about 30 nucleotides in length, more preferably at least about 40 nucleotides in length, yet more preferably at least about 50 nucleotides in length, yet more preferably at least about 60 nucleotides in length, yet more preferably at least about 70 nucleotides in length, yet more preferably at least about 80 nucleotides in length, yet more preferably at least about
  • nucleotides in length yet more preferably at least about 100 nucleotides in length, yet more preferably at least about 110 nucleotides in length, yet more preferably at least about 120 nucleotides in length, yet more preferably at least about 130 nucleotides in length, yet more preferably at least about 140 nucleotides in length, yet more preferably at least about 150 nucleotides in length, yet more preferably at least about 160 nucleotides in length, yet more preferably at least about 170 nucleotides in length, yet more preferably at least about 180 nucleotides in length,
  • nucleotides in length yet more preferably at least about 190 nucleotides in length, yet more preferably at least about 200 nucleotides in length, yet more preferably at least about 250 nucleotides in length, yet more preferably at least about 300 nucleotides in length, yet more preferably at least about 350 nucleotides in length, yet more preferably at least about 400 nucleotides in length, yet more preferably at least about 450 nucleotides in length, yet more preferably at least about 500 nucleotides in length, yet more preferably at least about 600 nucleotides in length, yet more preferably
  • 35 polypeptide-encoding nucleotide sequence may be determined in a routine manner by aligning the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362.
  • PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PRO6I 8, PR0772, PRO703, PR0792 or PR0474 polypeptide-encoding nucleotide sequence fragment(s) are novel. All of such PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide-encoding nucleotide sequences are contemplated herein.
  • PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide fragments encoded by these nucleotide molecule fragments preferably those PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide fragments that comprise a binding site for an anti-PR0213, anti-PRO 1330, anti- PR01449, anti-PR0237, anti-PR0324, anti-PR0351, anti-PR0362, anti-PR0615, anti-PR0531, anti-PR0538, anti-PR03664, anti-PR0618, anti-PR0772, anti-PRO703, anti-
  • the invention provides isolated PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide encoded by any of the isolated nucleic acid sequences hereinabove identified.
  • the invention concerns an isolated PR0213, PROl 330, PRO 1449, PR0237, PR0324,
  • PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 967c sequence identity, yet
  • the invention concerns an isolated PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538.
  • PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 857o sequence identity, yet more preferably at least about 867c sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 887r sequence identity, yet more preferably at least about 897c sequence identity, yet more preferably at least about 907o sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 927o sequence identity, yet more preferably at least about 93% sequence identity
  • the invention concerns an isolated PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide comprising an amino acid sequence scoring at least about 807c positives, preferably at least about 81 % positives, more preferably at least about 82% positives, yet more preferably at least about 83% positives, yet more preferably at least about 84% positives, yet more preferably at least about 85% positives, yet more preferably at least about 86% positives, yet more preferably at least about 87% positives, yet more preferably at least about 88% positives, yet more preferably at least about 89% positives, yet more preferably at least about 90% positives, yet more preferably at least about 91 % positives, yet more preferably at least about 92% positives, yet more preferably at least about 93% positives, yet more preferably
  • the invention provides an isolated PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide without the N-terminal signal sequence and/or the initiating methionine and is encoded by a nucleotide sequence that encodes such an amino acid sequence as hereinbefore described Processes for producing the same are also herein described, wherein those processes comprise cultu ⁇ ng a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of thePR0213, PRO1330 PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and recovering the PR0213, PROl 330, PRO
  • Another aspect of the invention provides an isolated PR021 , PRO 1330, PRO 1449 PR0237, PR0324, PR0 1 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide which is eithei transmembrane domain-deleted or transmembrane domain inactivated Processes foi producing the same are also herein described, wherein those processes comprise cultu ⁇ ng a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PRO ⁇ l 8, PR0772, PRO703, PR0792 or PR0474 polypeptide and recovering the PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR
  • the invention concerns antagonists of a native PR0213, PRO 1330, PRO 1449,
  • the antagonist is an ant ⁇ -PR0213, anti-PRO1330, ant ⁇ -PR01449, ant ⁇ -PR0237, ant ⁇ -PR0324, ant ⁇ -PR0351, ant ⁇ -PR0362, ant ⁇ -PR0615, anti- PR0531, ant ⁇ -PR0538, ant ⁇ -PR03664, ant ⁇ -PR0618, ant ⁇ -PR0772, ant ⁇ -PRO703, ant ⁇ -PR0792 or ant ⁇ -PR0474 antibody or a small molecule
  • the invention concerns a method of identifying antagonists to a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide which comprise contacting the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide with a candidate molecule and monitoring a biological activity mediated by said PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
  • the invention concerns a composition of matter comprising a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, or an antagonist ot a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide as herein described, or an ant ⁇ -PR0213, ant ⁇ -PRO1330, ant ⁇ -PR01449, anti- PR0237, ant ⁇ -PR0324, ant ⁇ -PR0351 , ant ⁇ -PR0362, ant ⁇ -PR0615, ant ⁇ -PR0531 , ant ⁇ -PR0538.
  • the carrier is a pharmaceutically acceptable carrier
  • Another embodiment of the present invention is directed to the use ot a PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, or an antagonist thereof as hereinbefore described, or an ant ⁇ -PR0213, anti- PRO1330, ant ⁇ -PR01449, ant ⁇ -PR0237, ant ⁇ -PR0324, ant ⁇ -PR0351 , ant ⁇ -PR0362, ant ⁇ -PR0615, ant ⁇ -PR0531 , ant ⁇ -PR0538, ant ⁇ -PR03664, ant ⁇ -PR0618, ant ⁇ -PR0772, ant ⁇ -PRO703, ant ⁇ -PR0792 or ant ⁇ -PR0474 antibod ⁇ for the preparation of a medicament useful in the treatment of a condition which is responsive to the PR0213, PRO13
  • the invention provides vectors comprising DNA encoding any of the herein described polypeptides
  • Host cell comprising any such vector are also provided
  • the host cells may be CHO cells, E coli, yeast, or Baculovirus infected insect cells
  • a process for producing any of the herein described polypeptides is further provided and comprises cultu ⁇ ng host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture
  • the invention provides chimeric molecules comprising any of the herein described polypeptides fused to a heterologous polypeptide or amino acid sequence
  • Example of such chimeric molecules comprise any of the herein described polypeptides fused to an epitope tag sequence or a Fc region of an immunoglobulin
  • the invention provides an antibody which specifically binds to any of the above or below described polypeptides
  • the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody
  • the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or as antisense probes, wherein those probes may be derived from any of the above or below described nucleotide sequences
  • Figure 1 shows the nucleotide sequence (SEQ ID NO 1 ) of a cDNA containing a nucleotide sequence encoding native sequence PR0237, wherein the nucleotide sequence (SEQ ID NO 1 ) is a clone designated herein as DNA34353-1428 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 2 shows the amino acid sequence (SEQ ID NO 2) of a native sequence PR0237 polypeptide as derived from the coding sequence of SEQ ID NO 1
  • Figure 3 shows the nucleotide sequence (SEQ ID NO 3) of a cDNA containing a nucleotide sequence encoding native sequence PR0213 wherein the nucleotide sequence (SEQ ID NO 3) is a clone designated herein as DNA30943-1 163 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 4 shows the amino acid sequence (SEQ ID NO 4) of a native sequence PR0213 polypeptide as derived from the coding sequence of SEQ ID NO 3
  • Figure 5 shows the nucleotide sequence (SEQ ID NO 5) ot a cDNA containing a nucleotide sequence encoding native sequence PROl 330 wherein the nucleotide sequence (SEQ ID NO 5) is a clone designated herein as DNA64907 1 163 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 6 shows the amino acid sequence (SEQ ID NO 6) of a native sequence PROl 330 polypeptide as derived from the coding sequence ot SEQ ID NO 5
  • Figure 7 shows the nucleotide sequence (SEQ ID NO 7) ot a cDNA containing a nucleotide sequence encoding native sequence PRO 1449, wherein the nucleotide sequence (SEQ ID NO 7) is a clone designated herein as DNA64908-1 163 Also presented in bold font and underlined are the positions ot the respective start and stop codons
  • Figure 8 shows the amino acid sequence (SEQ ID NO 8) of a native sequence PR01449 polypeptide as derived from the coding sequence of SEQ ID NO 7
  • Figure 9 shows the nucleotide sequence (SEQ ID NO 9) of a cDNA containing a nucleotide sequence encoding native sequence PR0324, wherein the nucleotide sequence (SEQ ID NO 9) is a clone designated herein as DNA36343- 1310 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 10 shows the amino acid sequence (SEQ ID NO 10) of a native sequence PR0324 polypeptide as derived from the coding sequence of SEQ ID NO 9
  • Figure 1 1 shows the nucleotide sequence (SEQ ID NO 1 1 ) of a cDNA containing a nucleotide sequence encoding native sequence PR0351 , wherein the nucleotide sequence (SEQ ID NO 11 ) is a clone designated herein as DNA40571-1315 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 12 shows the ammo acid sequence (SEQ ID NO 12) of a native sequence PR0351 polypeptide as derived from the coding sequence of SEQ ID NO 1
  • Figure 13 shows the nucleotide sequence (SEQ ID NO 13) of a cDNA containing a nucleotide sequence encoding native sequence PR0362, wherein the nucleotide sequence (SEQ ID NO 13) is a clone designated herein as DNA45416 1251 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 14 shows the amino acid sequence (SEQ ID NO 14) of a native sequence PR0362 polypeptide as derived from the coding sequence of SEQ ID NO 13
  • Figure 15 shows the nucleotide sequence (SEQ ID NO 15) of a cDNA containing a nucleotide sequence encoding native sequence PR0615, wherein the nucleotide sequence (SEQ ID NO 15) is a clone designated herein as DNA48304-1323 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 16 shows the amino acid sequence (SEQ ID NO 16) of a native sequence PR0615 polypeptide as derived from the coding sequence of SEQ ID NO 15
  • Figure 17 shows the nucleotide sequence (SEQ ID NO 17) of a cDNA containing a nucleotide sequence encoding native sequence PR0531 , wherein the nucleotide sequence (SEQ ID NO 17) is a clone designated herein as DNA48 14-1320 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 18 shows the amino acid sequence (SEQ ID NO 18) of a native sequence PR0531 polypeptide as derived from the coding sequence of SEQ ID NO 17
  • Figure 19 shows the nucleotide sequence (SEQ ID NO 19) of a cDNA containing a nucleotide sequence encoding native sequence PR0538, wherein the nucleotide sequence (SEQ ID NO 19) is a clone designated herein as DNA48613 1268 Also presented in bold font and underlined are the positions ot the respective stait and stop codons
  • Figure 20 shows the amino acid sequence (SEQ ID NO 20) of a native sequence PR0538 polypeptide as derived fiom the coding sequence of SEQ ID NO 19
  • Figure 21 shows the nucleotide sequence (SEQ ID NO 21 ) of a cDNA containing a nucleotide sequence encoding native sequence PR03664, wherein the nucleotide sequence (SEQ ID NO 21 ) is a clone designated herein as DNA48614 1268 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 22 shows the amino acid sequence (SEQ ID NO 22) of a native sequence PR03664 polypeptide as derived from the coding sequence of SEQ ID NO 21
  • Figure 23 shows the nucleotide sequence (SEQ ID NO 23) of a cDNA containing a nucleotide sequence encoding native sequence PR0618, wherein the nucleotide sequence (SEQ ID NO 23) is a clone designated herein as DNA49152- 1324 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 24 shows the amino acid sequence (SEQ ID NO 24) of a native sequence PR0618 polypeptide as derived from the coding sequence of SEQ ID NO 23
  • Figure 25 shows an EST sequence designated herein as DNA35597 (SEQ ID NO 25)
  • Figure 26 shows the nucleotide sequence (SEQ ID NO 26) of a cDNA containing a nucleotide sequence encoding native sequence PR0772, wherein the nucleotide sequence (SEQ ID NO 26) is a clone designated herein as DNA49645 1347 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 27 shows the amino acid sequence (SEQ ID NO 27) of a native sequence PR0772 polypeptide as derived from the coding sequence of SEQ ID NO 26
  • Figure 28 shows the nucleotide sequence (SEQ ID NO 28) of a cDNA containing a nucleotide sequence encoding native sequence PRO703, wherein the nucleotide sequence (SEQ ID NO 28) is a clone designated herein as DNA50913-1287 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 29 shows the amino acid sequence (SEQ ID NO 29) of a native sequence PRO703 polypeptide as derived from the coding sequence of SEQ ID NO 28
  • Figure 30 shows the nucleotide sequence (SEQ ID NO 30) of a cDNA containing a nucleotide sequence encoding native sequence PR0792, wherein the nucleotide sequence (SEQ ID NO 30) is a clone designated herein as DNA56352-1358 Also presented in bold font and underlined are the positions of the respective start and stop codons
  • Figure 31 shows the amino acid sequence (SEQ ID NO 31 ) of a native sequence PR0792 polypeptide as derived from the coding sequence of SEQ ID NO 30
  • Figure 32 shows the nucleotide sequence (SEQ ID NO 32) of a cDNA containing a nucleotide sequence encoding native sequence PR0474, wherein the nucleotide sequence (SEQ ID NO 32) is a clone designated herein as DNA56045-1380 Also presented in bold font and underlined are the positions ot the respective start and stop codons
  • Figure 33 shows the amino acid sequence (SEQ ID NO 33) of a native sequence PR0474 polypeptide as derived from the coding sequence of SEQ ID NO 32 Detailed Description of the Invention I Definitions
  • gene amplification and “gene duplication” are used interchangeably and refer to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line
  • the duplicated region (a stretch of amplified DNA) is often referred to as "amphcon " Usually, the amount of the messenger RNA
  • Tumor refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues
  • cancer refers to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth
  • cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia More particular examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, pancreatic cancer, ghoblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, colorectal cancer, endometnal carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer
  • Treatment is an intervention performed with the intention of preventing the development or altering the pathology of a disorder
  • treatment refers to both therapeutic treatment and prophylactic or preventati ve measures
  • Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented
  • a therapeutic agent may directly decrease the pathology of tumor cells, or render the tumor cells more susceptible to treatment by other therapeutic agents, e g , radiation and/or chemotherapy
  • the "pathology" of cancer includes all phenomena that compromise the well-being of the patient This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, etc
  • “Mammal” for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cattle, pigs, sheep, etc
  • the mammal is human
  • Carriers as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed
  • the physiologically acceptable carrier is an aqueous pH buffered solution
  • physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids, antioxidants including ascorbic acid low molecular weight (less than about 10 residues) polypeptides, proteins, such as serum albumin, gelatin, oi immunoglobulins, hydrophilic polymeis such as polyvinylpyrrohdone, amino acids such as glycine, glutamine, asparagine, argimne oi lysine monosacc
  • cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells
  • the term is intended to include radioactive isotopes (e g., I 131 , I l2 ⁇ Y 9 " and Re 186 ), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof
  • chemotherapeutic agent is a chemical compound useful in the treatment of cancer
  • chemotherapeutic agents include ad ⁇ amycin, doxorubicin, epirubicin, 5-fluorourac ⁇ l, cytosine arabinoside ("Ara- C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e g , paclitaxel (Taxol, B ⁇ stol-Myers Squibb Oncology, Princeton, NJ), and doxetaxel (Taxotere, Rhone-Poulenc Rorer, Antony, Rnace), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, lfosfamide, mitomycin C, mitoxantrone, vinc ⁇ stine, vinorelbine, carboplatin, teniposide, daunomy
  • a “growth inhibitory agent” when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any of the genes identified herein, either in vttio or in vivo
  • the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase
  • growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce Gl arrest and M-phase arrest
  • Classical M-phase blockers include the vincas (vinc ⁇ stine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicm, etoposide, and bleomycin
  • Those agents that arrest Gl also spill over into S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5- fluorouracil
  • Doxorubicin is an anthracychne antibiotic
  • the full chemical name of doxorubicin is (8S-c ⁇ s)-10-[(3- am ⁇ no-2,3,6-t ⁇ deoxy- ⁇ -L-lyxo-hexapyranosyl)oxy]-7,8,9,10-tetrahyd ⁇ o-6,8,l l -t ⁇ hydroxy-8-(hydroxyacetyl)-l - methoxy-5 , 12-naphthacened ⁇ one
  • cytokine is a generic term for proteins released by one cell population which act on anothei cell as intercellular mediators Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones Included among the cytokines are growth hormone such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsuhn, relaxin, prorelaxin, glycoprotein hormones such as
  • nerve growth factors such as NGF- ⁇ , platelet- growth factor, transforming growth tactois (TGFs) such as TGF- ⁇ and TGF- ⁇ , insulin-like growth factor-I and -II, erythropoietin (EPO), osteoinductive factors, interferons such as interferon -a, - ⁇ , and - ⁇ , colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF), granulocyte-macrophage-CSF (GM-CSF), and granulocyte-CSF (G- CSF), interleukins (ILs) such as IL-1 , IL- 1 a, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11 , IL-12, a tumor necrosis factor such as TNF- ⁇ or TNF- ⁇ , and other polypeptide factors including LIF and kit ligand (KL) As used heiein
  • prodrug refers to a precursor or derivative form of a pharmaceutically active substance that is less cytotoxic to tumor cells compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form See, e g , Wil an, "Prodrugs in Cancer Chemotherapy", Biochemical Society Transactions.
  • the prodrugs of this invention include, but are not limited to, phosphate- containing prodrugs, thiophosphate-contaimng prodrugs, sulfate-containing prodrugs, peptide-contaimng prodrugs, D-amino acid-modified prodrugs, glysocylated prodrugs, ⁇ -lactam-contaimng prodrugs, optionally substituted phenoxyacetamide-containing prodrugs or optionally substituted phenylacetamide-containing prodrugs, 5- fluorocytosine and other 5-fluorou ⁇ d ⁇ ne prodrugs which can be converted into the more active cytotoxic free drug Examples of cytotoxic drugs that can be
  • an “effective amount” of a polypeptide disclosed herein or an antagonist thereof, in reference to inhibition of neoplastic cell growth, tumor growth or cancer cell growth is an amount capable of inhibiting, to some extent, the growth of target cells
  • the term includes an amount capable of invoking a growth inhibitory, cytostatic and/or cytotoxic effect and/or apoptosis of the target cells
  • An “effective amount” of a PRO polypeptide antagonist for purposes of inhibiting neoplastic cell growth, tumor growth or cancer cell growth may be determined empirically and in a routine manner
  • a “therapeutically effective amount”, in reference to the treatment ot tumor, refers to an amount capable of invoking one or more of the following effects ( 1 ) inhibition, to some extent, of tumor growth, including, slowing down and complete growth arrest, (2) reduction in the number of tumor cells, (3) reduction in tumor size, (4) inhibition (( e , reduction, slowing down or complete stopping) of tumor cell infiltration into peripheral organs, (5) inhibition (( e , reduction, slowing down or complete stopping) ot metastasis, (6) enhancement of anti-tumor immune response, which may, but does not have to, result in the regression or rejection of the tumor, and/or (7) relief, to some extent, of one or more symptoms associated w ith the disorder
  • a "therapeutically effective amount" of a PRO polypeptide antagonist for purposes of treatment of tumor may be determined empirically and in a routine mannei
  • a “growth inhibitory amount” of a PRO antagonist is an amount capable of inhibiting the growth of a cell, especially tumor, e g , cancer cell, either in vitro or in vivo
  • a “growth inhibitory amount” of a PRO antagonist foi purposes of inhibiting neoplastic cell growth may be determined empirically and in a routine mannei
  • a "cytotoxic amount” of a PRO antagonist is an amount capable of causing the destruction ot a cell, especially tumor, e g , cancer cell, either in vitw o ⁇ in vivo
  • a "cytotoxic amount" of a PRO antagonist for strig poses of inhibiting neoplastic cell growth may be determined empi ⁇ callv and in a routine manner
  • PRO polypeptide and "PRO” as used herein and when immediately followed by a numerical designation refer to various polypeptides, wherein the complete designation (i e , PRO/number) refers to specific polypeptide sequences as described herein
  • PRO/number polypeptide and “PRO/number” wherein the term “number” is provided as an actual numerical designation as used herein encompass native sequence polypeptides and polypeptide variants (which are further defined herein)
  • the PRO polypeptides described herein may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods
  • a “native sequence PRO polypeptide” comprises a polypeptide having the same ammo acid sequence as the corresponding PRO polypeptide derived from nature Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means
  • the term "native sequence PRO polypeptide” specifically encompasses naturally-occurring truncated or secreted forms of the specific PRO polypeptide (e g , an extracellular domain sequence), naturally-occurring variant forms (e g , alternatively spliced forms) and naturally-occurring allelic variants of the polypeptide
  • the native sequence PRO polypeptides disclosed herein are mature or full-length native sequence polypeptides comprising the full-length amino acids sequences shown in the accompanying figures Start and stop codons are shown in bold font and underlined in the figures However, while the PRO polypeptide disclosed in the accompanying figures are shown to begin with methionine residues designated herein as amino acid position 1 in the figures, it is conceivable
  • the PRO polypeptide "extracellular domain” or “ECD” refers to a form of the PRO polypeptide which is essentially free of the transmembrane and cytoplasmic domains Ordinarily, a PRO polypeptide ECD will have less than 1 c of such transmembrane and/or cytoplasmic domains and preferably, will have less than 0 57c of such domains It will be understood that any transmembrane domains identified for the PRO polypeptides of the present invention are identified pursuant to criteria routinely employed in the art for identifying that type of hydrophobic domain The exact boundaries of a transmembrane domain may vary but most likely by no more than about 5 amino acids at either end of the domain as initially identified herein Optionally, therefore, an extracellular domain of a transmembrane domain of a
  • PRO polypeptide may contain from about 5 or fewer amino acids on either side of the transmembrane domain/extracellular domain boundary as identified in the Examples or specification and such polypeptides, with or without the associated signal peptide, and nucleic acid encoding them, are comtemplated by the present invention
  • PRO variant polypeptides are at least about 10 amino acids in length, often at least about 20 amino acids in length, more often at least about 30 amino acids in length, more often at least about 40 amino acids in length, more often at least about 50 amino acids in length, more often at least about 60 amino acids
  • amino acids in length more often at least about 70 amino acids in length more often at least about 80 amino acids in length more often at least about 90 amino acids in length, more often at least about 100 amino acids in length more often at least about 150 amino acids in length, more often at least about 200 amino acids in length, more often at least about 300 amino acids in length, or more
  • Table 1 provides the complete source code for the ALIGN-2 sequence comparison
  • This source code may be routinely compiled tor use on a UNIX operating system to provide the ALIGN-2 sequence comparison computer program
  • Tables 2A 2D show hypothetical exemplifications for using the below described method to determine % amino acid sequence identity (Tables 2A-2B) and % nucleic acid sequence ⁇ dent ⁇ t ⁇ (Tables 2C 2D) using the ALIGN-2 sequence comparison computer program, wherein "PRO represents the amino acid sequence
  • Comparison Protein represents the amino acid sequence of a polypeptide against which the "PRO polypeptide of interest is being compared
  • PRO-DNA represents a hypothetical PRO-encoding nucleic acid sequence of interest
  • Comparison DNA represents the nucleotide sequence of a nucleic acid molecule against which the "PRO DNA” nucleic acid molecule of interest is being compared
  • "X", "Y ' and “Z ' each repiesent different hypothetical amino acid residues and "N", L and ' V each represent different hypothetical nucleotides.
  • Max file length is 65535 (limited by unsigned short x in the jmp struct)
  • a sequence with 1/3 or more of its elements ACGTU is assumed to be DNA
  • the program may create a tmp file in /tmp to hold info about traceback
  • static nm, /* matches in core - for checking */ static lmax, /* lengths of stripped file names */ static ⁇ j[2], /* jmp index for a path */ static nc[2] , /* number at start of current line */ static m[2] , /* current elem number — for gapping */ static s ⁇ z[2], static char *ps[2], /* ptr to current element */ static char *po[2], /* ptr to next output char slot */ static char out[2][P LINE] /* output line */ static char star[P LINE], /* set by starsQ */
  • *ps[ ⁇ ] toupper(*ps[ ⁇ ]), po[ ⁇ ] + + , ps[ ⁇ ] + + ,
  • *py+ + *px; else if ( ⁇ slower(*px))
  • *py+ + toupper(*px); if ( ⁇ ndex("ATGCU",*(py-l))) natgc+ + ; ⁇ ⁇
  • Page 2 ofnwsubr.c ...readjmps if 0 ⁇ 0 && dx[dmax]. offset && fj) ⁇
  • Percent (%) amino acid sequence identity' with respect to the PRO polypeptide sequences identified herein is defined as the percentage of ammo acid residues in a candidate sequence that are identical with the amino acid residues in a PRO sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Mega gn (DNASTAR) software Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared For purposes herein, however, % amino acid sequence identity values are obtained as described below by using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1 The ALIGN-2 sequence comparison computer program was authored by Genentech
  • % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows
  • % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B is calculated as follows
  • a % amino acid sequence identity value is determined by dividing (a) the number of matching identical amino acids residues between the amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide and the comparison amino acid sequence of interest (J e , the sequence against which the PRO polypeptide of interest is being compared which may be a PRO variant polypeptide) as determined by WU-BLAST-2 by (b) the total number of amino acid residues of the PRO polypeptide of interest
  • J e the sequence against which the PRO poly
  • PRO variant polynucleotides are at least about 30 nucleotides in length, often at least about 60 nucleotides in length, more often at least about 90 nucleotides in length, more often at least about 120 nucleotides in length, more often at least about 150 nucleotides in length, more often at least about 180 nucleotides in length, more often at least about 210 nucleotides in length, more often at least about 240 nucleotides in length, more often at least about 270 nucleotides in length, more often at least about 300 nucleotides in length, more often at least about 450 nucleotides in length, more often at least about 600 nucleotides in length, more often at least about 900 nucleotides in length, or more
  • Percent (%) nucleic acid sequence identity with respect to the PRO polypeptide-encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in a PRO polypeptide-encoding nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity Alignment for purposes ot determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megahgn (DNASTAR) software Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared For purposes herein, however, % nucleic acid sequence identity values are obtained as described below by using the sequence comparison computer program ALIGN-2, wherein the complete source code tor the ALIGN-2 program is provided in Table 1 The ALIGN
  • the % nucleic acid sequence ⁇ dent ⁇ t ⁇ ot a given nucleic acid sequence C to, with, oi against a given nucleic acid sequence D (which can alternativeh be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to v. ith or against a given nucleic acid sequence D) is calculated as follows
  • % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D is calculated as follows
  • a % nucleic acid sequence identity value is determined by dividing (a) the numbei ot matching identical nucleotides between the nucleic acid sequence of the PRO polypeptide encoding nucleic acid molecule ot interest having a sequence derived from the native sequence PRO polypeptide-encoding nucleic acid and the comparison nucleic acid molecule of interest (i e , the sequence against which the PRO polypeptide-encoding nucleic acid molecule of interest is being compared which may be a variant PRO polynucleotide) as determined by WU-BLAST-2 by (b) the total number of nucleotides of the PRO polypeptide- encoding nucleic acid molecule of interest
  • the nucleic acid sequence A is the comparison nucleic acid molecule of interest
  • isolated when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment Preferably, the isolated polypeptide is free of association with all components with which it is naturally associated Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes
  • the polypeptide will be purified ( 1 ) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducmg oi reducing conditions using Coomassie blue oi, preferably, silver stain Isolated polypeptide includes polypeptide in situ within recombinant eel Is, since at least one component ot the PRO natural environment will not be present Ordinarily, however, isolated polypeptide
  • an "isolated" nucleic acid molecule encoding a PRO polypeptide or an 'isolated” nucleic acid encoding an anti-PRO antibody is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the PRO-encoding nucleic acid or the anti-PRO-encoding nucleic acid Preferably, the isolated nucleic acid is free of association with all components with which it is naturally associated
  • An isolated PRO-encoding nucleic acid molecule or an anti- PRO-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature Isolated nucleic acid molecules therefore are distinguished from the PRO-encoding nucleic acid molecule or the anti-PRO- encoding nucleic acid molecule as it exists in natural cells
  • an isolated nucleic acid molecule encoding a PRO polypeptide or an anti-PRO antibody includes PRO-encoding nucleic acid molecules and anti-PRO-encoding
  • control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in a pai ticular host organism
  • the control sequences that are suitable for prokaryotes include a promoter, optionally an operator sequence, and a ⁇ bosome binding site
  • Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers
  • Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence
  • a ⁇ bosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation
  • "operably linked' means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase
  • enhancers do not have to be contiguous Linking is accomplished by ligation at convenient restriction sites If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice
  • antibody is used in the broadest sense and specifically covers, for example, single anti- PR0213, anti-PRO 1330, anti-PRO 1449, ant ⁇ -PR0237, anti PR0324, ant ⁇ -PR0351 ant ⁇ -PR0362, ant ⁇ -PR0615, ant ⁇ -PR0531, ant ⁇ -PR0538, ant ⁇ -PR03664, ant ⁇ -PR0618, ant ⁇ -PR0772 ant ⁇ -PRO703, ant ⁇ -PR0792 or anti- PR0474 monoclonal antibodies (including antagonist and neutralizing ant ⁇ bod ⁇ es),ant ⁇ -PR0213, anti PRO1330, anti-PRO 1449, ant ⁇ -PR0237, ant ⁇ -PR0324, ant ⁇ -PR0351 , ant ⁇ -PR0362, anti PR0615, ant ⁇ -PR0531 , ant ⁇ -PR0538, ant ⁇ -PR03664, ant ⁇ -PR0618, anti PR0772, ant ⁇ -PRO703, anti
  • “Stringency” of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures Hybridization generally depends on the ability of denatured DNA to reanneal when complementar) strands are present in an environment below their melting temperature The higher the degree of desired homology between the probe and hyb ⁇ dizable sequence, the higher the relative temperatuie which can be used As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so For additional details and explanation of stringency of hybridization reactions, see Ausubel et al , Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995)
  • “Stringent conditions” or “high stringency conditions”, as defined herein, may be identified by those that ( 1 ) employ low ionic strength and high temperature for washing, for example 0 015 M sodium chlo ⁇ de/0 0015 M sodium c ⁇ trate/0 1 % sodium dodecyl sulfate at 50°C, (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0 1 % bovine serum albumin/0 1 % F ⁇ coll/0 1 % polyv ⁇ nylpyrrol ⁇ done/50mM sodium phosphate buffer at pH 6 5 with 750 M sodium chloride, 75 mM sodium citrate at 42°C, or (3) employ 50% formamide, 5 x SSC (0 75 M NaCI, 0 075 M sodium citrate), 50 mM sodium phosphate (pH 6 8), 0 1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm
  • Modely stringent conditions may be identified as described by Sambrook et al , Molecular Cloning A Laboratory Manual. New York Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e g , temperature, ionic strength and % SDS) less stringent than those described above
  • An example of moderately stringent conditions is overnight incubation at 37°C in a solution comprising 20% formamide, 5 x SSC (150 mM NaCl, 15 mM t ⁇ sodium citrate), 50 mM sodium phosphate (pH 7 6), 5 x Denhardt s solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 35°C-50°C
  • the skilled artisan will recognize how to adjust the temperature, ionic strength etc as necessary to accommodate factors such as probe length and the like
  • the term ' epitope tagged when used herein refers to a chimeric
  • tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the polypeptide to which it is fused
  • the tag polypeptide preferably also is fairly unique so that the antibody does not substantially cross-react with other epitopes
  • Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 ammo acid residues (preferably, between about 10 and 20 ammo acid residues)
  • Active refers to form(s) ot PR0213, PRO 1330, PRO 1449, PR0237 PR0324, PR0351 , PRO-362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptides which retain a biological and/or an immunological activity/property of a native or naturally- occurring PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, wherein "biological” activity refers to a function (either inhibitory or stimulatory) caused by a native or naturally-occurring PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 .
  • Bio activity in the context of an antibody or another antagonist molecule that can be identified by the screening assays disclosed herein (e g , an organic or inorganic small molecule, peptide, etc ) is used to refer to the ability of such molecules to bind or complex with the polypeptides encoded by the amplified genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins oi otherwise interfere with the transcription or translation of a PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
  • a preferred biological activity is growth inhibition of a target tumor cell
  • Another preferred biological activity is cytotoxic activity resulting in the death of the target tumor cell
  • biological activity in the context of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide means the ability of aPRO213, PRO1330, PRO1449 PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide to induce neoplastic cell growth or uncontrolled cell growth
  • immunological cross-reactivity means immunological cross-reactivity with at least one epitope of a PR0213, PROl 330, PR01449, PR0237. PR0324, PR0351. PR0362, PR0615, PR0531 , PR0538, PR03664.
  • PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide "Immunological cross-reactivity" as used herein means that the candidate polypeptide is capable of competitively inhibiting the qualitative biological act ⁇ v ⁇ t> ot a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide having this activity with polyclonal antisera raised against the known active PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772.
  • PRO703, PR0792 or PR0474 polypeptide Such antisera are piepared in conventional fashion by meeting goats or rabbits, for example, subcutaneously with the known active analogue in complete Freund's ad)uvant, followed by booster lntrape ⁇ toneal or subcutaneous injection in incomplete Freunds
  • the immunological cross-reactivity preferably is ' specific", which means that the binding affinity of the immunologically cross-reactive molecule (e g , antibody) identified, to the corresponding PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351.
  • PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is significantly higher (preferably at least about 2-t ⁇ mes, more preferably at least about 4-t ⁇ mes, even more preferably at least about 8-t ⁇ mes, most preferably at least about 10-t ⁇ mes higher) than the binding affinity of that molecule to any other known native polypeptide
  • antagonist is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native PR0213 , PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide disclosed herein or the transcription or translation thereof
  • Suitable antagonist molecules specifically include antagonist antibodies or antibody fragments, fragments, peptides, small organic molecules, anti-sense nucleic acids, etc Included are methods for identifying antagonists of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide with a candidate antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the
  • “Native antibodies” and “native immunoglobulins” are usually heterotetrame ⁇ c glycoproteins of about 150,000 daltons. composed of two identical light (L) chains and two identical heavy (H) chains Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes Each heavy and light chain also has regularly spaced intrachain disulfide bridges Each heavy chain has at one end a variable domain (V H ) followed by a number of constant domains Each light chain has a variable domain at one end (V L ) and a constant domain at its other end, the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light-chain variable domain is aligned with the variable domain of the heavy chain Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains
  • variable refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody tor its particular antigen
  • CDRs complementarity-determining regions
  • hyperva ⁇ able regions both in the light-chain and the heavy-chain variable domains
  • the more highly conserved portions ot variable domains are called the framework (FR) regions
  • the variable domains of native heavy and light chains each comprise four FR regions, largely adopting a ⁇ -sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure
  • the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al , NIH Publ No 91-3242, Vol I, pages 647-669 (1991 ))
  • the constant domains see Kabat et al , NIH Publ No 91-3
  • hyperva ⁇ able region when used herein refers to the amino acid residues of an antibody which are responsible for antigen-binding
  • the hyperva ⁇ able region comprises amino acid residues from a "complementarity determining region" or "CDR" (; e , residues 24-34 (Ll ), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (HI), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain, Kabat et al , Sequences of Proteins of Immunological Interest, 5th Ed Public Health Service, National Institute of Health, Bethesda, MD [ 1991 ]) and/or those residues from a "hyperva ⁇ able loop" (t e , residues 26-32 (Ll ), 50-52 (L2) and 91-96 (L3) in the light chain variable domain and 26 32 (HI ), 53-55 (H2) and 96-101 (H3) in the heavy chain variable domain , Clothia and Lesk
  • Antibody fragments comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody
  • antibody fragments include Fab, Fab', F(ab') 2 , and Fv fragments, diabodies , linear antibodies (Zapata et al , Protein Eng .8(10) 1057- 1062 [ 1995]) , single-chain antibody molecules, and multispecific antibodies formed from antibody fragments
  • Papain digestion of antibodies produces two identical antigen-binding fragments, called “Fab” fragments, each with a single antigen-binding site, and a residual "Fc” fragment, whose name reflects its ability to crystallize readily Pepsin treatment yields an F(ab') 2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen
  • Fv is the minimum antibody fragment which contains a complete antigen-recognition and -binding site This region consists of a dimer of one heavy- and one light chain variable domain in tight, non covalent association It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the V H -V L dimer Collectively, the six CDRs confer antigen binding specificity to the antibody However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site
  • the Fab fragment also contains the constant domain of the light chain and the first constant domain (CH 1 ) of the heavy chain Fab fragments differ from Fab' fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH 1 domain including one or more cysteines from the antibody hinge region Fab'-SH is the designation herein for Fab in which the cysteine res ⁇ du
  • immunoglobulins can be assigned to one of two clearly distinct types, called kappa (K) and lambda ( ⁇ ) based on the amino acid sequences of their constant domains Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes There are five major classes of immunoglobulins IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e g , IgG 1 , IgG2, IgG3, IgG4, IgA, and IgA2
  • the heavy-chain constant domains that correspond to the different classes of immunoglobulins are called ⁇ , ⁇ , e, ⁇ , and ⁇ , respectively
  • the subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known
  • the term "monoclonal antibody” as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, t e , the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts Monoclonal antibodies are highly specific, being directed against a single antigenic site Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hyb ⁇ doma culture, uncontaminated by other immunoglobulins The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hyb ⁇ dom
  • the monoclonal antibodies herein specifically include ' chimeric antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the cha ⁇ n(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments ot such antibodies, so long as they exhibit the desired biological activity (U S Patent No 4,816,567, Morrison et al , Proc Natl Acad Sci USA, 8i 6851 -6855 [1984])
  • Humanized forms of non-human (e g , murine) antibodies are chimeric immunoglobulins, lmmunoglobulm chains or fragments thereof (such as Fv, Fab, Fab F(ab )., or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin
  • humanized antibodies are human immunoglobulins (recipient antibod ⁇ ) in which residues from a CDR ot the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity
  • donor antibody such as mouse, rat or rabbit having the desired specificity, affinity, and capacity
  • Fv FR residues ot the human immunoglobulin are replaced by corresponding non human residues
  • humanized antibodies ma comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences
  • Single-chain Fv or “sFv” antibody fragments comprise the V H and V L domains of antibody, wherein these domains are present in a single polypeptide chain
  • the Fv polypeptide further comprises a polypeptide linker between the V H and V L domains which enables the sFv to form the desired structure for antigen binding
  • diabodies refers to small antibody fragments with two antigen-binding sites, which fragments compiise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (V L ) in the same polypeptide chain (V H - V L )
  • V H heavy-chain variable domain
  • V L light-chain variable domain
  • an “isolated” antibody is one which has been identified and separated and/or recovered from a component of its natural environment Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes
  • the antibody will be purified (1 ) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use ot a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present Ordinarily, howe ⁇ e ⁇ , isolated antibody will be prepared by at least one purification step
  • label when used herein refers to a detectable compound oi composition which is conjugated directly or indirectly to the antibody so as to generate a "labeled antibody
  • the label may be detectable by itself (e g . radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable Radionuchdes that can serve as detectable labels include, for example, 1-131 , 1-123, 1-125, Y-90, Re- 188, Re- 186, At-21 1 , Cu-67, B ⁇ -212, and Pd- 109
  • the label may also be a non-detectable entity such as a toxin
  • solid phase is meant a non-aqueous matrix to which the antibody of the present invention can adhei e
  • solid phases encompassed herein include those formed partially or entirely of glass (e ? controlled pore glass), polysaccha ⁇ des (e g , agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones
  • the solid phase can comprise the well of an assay plate, in otheis it is a purification column (e g , an affinity chromatographv column) This term also includes a discontinuous solid phase of discrete particles, such as those described in U S Patent No 4,275,149
  • a "hposome” is a small vesicle composed of various types of hpids, phosphohpids and/or surfactant which is useful for delivery of a drug (such as a PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362,
  • the components of the hposome are commonly arranged in a bilayer formation, similar to the hpid arrangement of biological membranes
  • immunoadhesin designates antibody-like molecules which combine the binding specificity of a heterologous protein (an “adhesin”) with the effector functions of immunoglobulin constant domains Structurally, the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (t e , is “heterologous"), and an immunoglobulin constant domain sequence
  • the adhesin part of an immunoadhesin molecule typically is a contiguous am o acid sequence comprising at least the binding site of a receptor or a ligand
  • the immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG- 1 , IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM
  • PRQ213. PRO 1330. PRO 1449. PRQ237. PRQ324. PRQ351. PRQ362. PRQ615. PRQ531. PRQ538. PRQ3664. PRQ618. PRQ772. PRO703. PRQ792 and PRQ474 polypeptides
  • the present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PRO ⁇ l 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474
  • cDNA encoding PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 polypeptides has been identified and isolated, as disclosed in further detail in the Examples below It is noted that proteins produced in separate expression rounds may be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed However, for sake of simplicity, in the present specification the proteins encoded by the herein disclosed nucleic acid sequences as well as all
  • cDNA clones have been deposited with the ATCC
  • the actual nucleotide sequence of the clones can readily be determined by the skilled artisan by sequencing of the deposited clone using routine methods in the art
  • the predicted amino acid sequences can be determined from the nucleotide sequences using routine skill For the PR0213. PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531.
  • PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptides and encoding nucleic acid described herein Applicants have identified what are believed to be the reading frames best identifiable with the sequence information available at the time B PRQ213, PRO 1330, PRO 1449. PRQ237. PRQ324. PRQ351. PRQ362, PRQ615. PRQ531. PRQ538. PRQ3664. PRQ618. PRQ772. PRO703. PRQ792 and PRQ474 Variants
  • PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 polypeptides described herein it is contemplated that PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PRO ⁇ l 8, PR0772, PRO703, PR0792 andPR0474 variants can be prepared PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PRO ⁇ l 8, PR0772, PRO703, PR0792 and PR0474 variants can be prepared by introducing appropriate nucleotide changes into the PR0213, PRO1330, PR01449, PR0237
  • the variation is by substitution ot at least one am o acid with any other amino acid in one or more of the domains of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
  • the variation is by substitution ot at least one am o acid with any other amino acid in one or more of the domains of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
  • Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the PR
  • PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 polypeptide fragments are provided herein Such fragments may be truncated at the N-terminus or C-terminus, or may lack internal residues, for example, when compared with a full-length native protein Certain fragments lack ammo acid residues that are not essential for adesired biological activity of the PR0213, PROl 330, PRO1449, PR0237, PR0324, PR0351 , PRO362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
  • PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 fragments may be prepared by any of a number of conventional techniques Desired peptide fragments may be chemically synthesized
  • An alternative approach involves generating PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 fragments by enzymatic digestion, e g , by treating the protein with an enzyme known to cleave proteins at sites defined by particular amino acid residues, or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment
  • Yet another suitable technique involves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment,
  • PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide fragments share at least one biological and/or immunological activity with the native PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
  • conservative substitutions of interest are shown in Table 3 under the heading of preferred substitutions If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 3, or as f ui ther described below in reference to amino acid classes, are introduced and the products screened
  • Substantial modifications in function or immunological identity of the polypeptide are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area ot the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain Naturally occurring residues are divided into groups based on common side-chain properties
  • Non conservative substitutions will entail exchanging a member ot one ot these classes for another class
  • Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non conserved) sites
  • Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence
  • preferred scanning amino acids are relatively small, neutral ammo acids
  • amino acids include alanine, glycine, serine, and cysteine
  • Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant [Cunningham and Wells, Science, 244 1081-1085 (1989)]
  • Alanine is also typically preferred because it is the most common amino acid Further, it is frequently found in both buried and exposed positions [Creighton, The Proteins, (W H Freeman & Co , N Y ), Chothia, J Moi Biol , 150 1 (1976)] If alanine substitution does not yield adequate amounts of variant, an lsote ⁇ c amino acid can be used
  • PRQ213. PRO1330. PRQ1449. PRQ237. PRQ324. PRQ351. PRQ362. PRQ615. PRQ531. PRQ538. PRQ3664. PRQ618. PRQ772. PRO703. PRQ792 and PRQ474
  • Covalent modifications of PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 are included within the scope of this invention
  • One type of covalent modification includes reacting targeted amino acid residues of aPR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide with an organic de ⁇ vatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or
  • Another type of covalent modification of the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 orPR0474 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide "Altering the native glycosylation pattern' is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence PR02
  • PR0362, PR0615, PR0531, PR0538, PR03664, PRO ⁇ l 8, PR0772, PRO703, PR0792 or PR0474 polypeptide may be accomplished by alte ⁇ ng the amino acid sequence
  • the alteration may be made, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 (for O linked glycosylation sites)
  • the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the
  • Another means of increasing the number of carbohydrate moieties on the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703 PR0792 or PR0474 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide Such methods are described in the art, e g , in WO 87/05330 published 1 1 September 1987, and in Aphn and W ⁇ ston CRC C ⁇ t Rev Biochem . pp 259 306 (1981 )
  • Removal of carbohydrate moieties present on the PR0213, PRO 1330, PR01449, PR0237 PR0324 PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide may be accomplished chemically or enzymatically or by mutational substitution ot codons encoding for amino acid residues that serve as targets for glycosylation
  • Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddm, et al , Arch Biochem Biophys , 259 52 (1987) and by Edge et al , Anal Biochem .
  • Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo and exo-glycosidases as described by Thotakura et al , Meth Enzymol 138 350 (1987)
  • PR0213, PRO 1330, PR01449, PR0237 PR0324, PR0351 PR0362, PR0615, PR0531 , PR0538 PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 comprises linking the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide to one ot a variety of nonproteinaceous polymers, e g , polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U S Patent Nos 4,640,835, 4,496,689, 4,301,144, 4,670,417, 4,791 ,192 or 4,179,337
  • PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 of the present invention may also be modified in a way to form a chimeric molecule comprising PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 fused to another, heterologous polypeptide or ammo acid sequence
  • such a chimeric molecule comprises a fusion of the PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind
  • the epitope tag is generally placed at the amino- or carboxyl-terminus of the PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
  • the presence of such epitope-tagged forms ot the PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03
  • Tag polypeptides include the Flag- peptide [Hopp et al , BioTechnology, 6 1204-1210 (1988)].
  • the chimeric molecule mav comprise a fusion of the PR0213, PROl 330
  • the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI , CH2 and CH3 regions ot an IgG l molecule For the production ot immunoglobulin
  • PRO1330 PR01449. PRQ237. PRQ324. PRQ351. PR0362. PR Q 615, PRQ531. PRQ538. PRQ3664. PRQ618. PRQ772. PRO703. PRQ792 and PRQ474 Polypeptides
  • PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 by cultu ⁇ ng cells transformed or transfected with a vector containing PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 nucleic acid
  • alternative methods which are well known in the art, may be employed to prepare PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
  • alternative methods which are well known in the art, may be employed to prepare PR0213
  • In vitro protein synthesis may be performed using manual techniques or by automation Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions
  • Various portions of thePRO213,PRO1330, PRO1449,PRO237, PRO324, PRO351, PRO362, PRO615, PRO531 , PRO538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
  • PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be obtained from a cDNA library prepared from tissue believed to possess the PR0213, PRO 1330, PRO 1449, PR0237. PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 mRNA and to express it at a detectable level Accordingly, human PR0213, human PRO 1330, human PRO 1449, human PR0237, human PR0324, human PR0351 , human PR0362, human PR0615, human PR0531 , human PR0538 human PR03664, human PR0618, human PR0772, human PRO703, human PR0792 or human PR0474 DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as described in the Examples PR0213-, PRO1330-, PR01449-, PR0237-, PR0324-, PR0351-,
  • Probes such as antibodies to the PR0213, PRO 1330, PROl 449. PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 oi PR0474 polypeptide, or oligonucleotides of at least about 20-80 bases
  • Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook etal, Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989).
  • the oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized.
  • the oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like 32 P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided in Sambrook et al., supra.
  • Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) within defined regions of the molecule or across the full-length sequence can be determined using methods known in the art and as described herein.
  • Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al., supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.
  • Host cells are transfected or transformed with expression or cloning vectors described herein for PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
  • the culture conditions such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: a Practical Approach, M. Butler, ed. (IRL Press, 1991 ) and Sambrook et al, supra.
  • Methods of eukaryotic cell transfection and prokaryotic cell transformation are known to the ordinarily skilled artisan, for example, CaCl 2 , CaP0 4 , liposome-mediated and electroporation.
  • transformation is performed using standard techniques appropriate to such cells.
  • the calcium treatment employing calcium chloride, as described in Sambrook et al., supra, or electroporation is generally used for prokaryotes.
  • Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et al, Gene, 23:315 (1983) and WO 89/05859 published 29 June 1989.
  • Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells
  • Suitable prokaryotes include but are not limited to eubacte ⁇ a, such as Gram-negative or Gram-positive organisms, for example, Enterobacte ⁇ aceae such as E coli
  • E coli strains are publicly available, such as E coli KI 2 strain MM294 (ATCC 31 ,446), E colt XI 776 (ATCC 31 ,537), E coli strain W31 10 (ATCC 27,325) and E coli strain K5 772 (ATCC 53,635)
  • Other suitable prokaryotic host cells include Enterobacte ⁇ aceae such as Eschenchia, e g , E coli, Enterobactei , Erwima, Klebsiella, Proteus, Salmonella, e g Salmonella typhimurium, Set raha,
  • K fiagihs (ATCC 12,424) K bulgartcus (ATCC 16,045), AT wicketamii (ATCC 24,178), K waltu (ATCC 56 500) K diosoplulat urn (ATCC 36,906, Vanden Berg etal , Bio/Technology, 8 135 (1990)), K thei ⁇ toleians.
  • Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hansenula Candida Kloeckeia, Ptchia Saccharonnces Torulopsis, and Rhodotot ula
  • yeast capable of growth on methanol selected from the genera consisting of Hansenula Candida Kloeckeia, Ptchia Saccharonnces Torulopsis, and Rhodotot ula
  • yeast capable of growth on methanol selected from the genera consisting of Hansenula Candida Kloeckeia, Ptchia Saccharonnces Torulopsis, and Rhodotot ula
  • yeast capable of growth on methanol selected from the genera consisting of Hansenula Candida Kloeckeia, Ptchia Saccharonnces Torulopsis, and Rhodotot ula
  • Rhodotot ula Rhodotot ula
  • the nucleic acid (e g , cDNA or genomic DNA) encoding PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression Various vectors are publicly available The vector may, for example, be in the form of a plasmid, cosmid, viral particle, oi phage
  • the appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures In general, DNA is inserted into an appropriate restriction endonuclease s ⁇ te(s) using techniques known in the art
  • Vector components generally include, but are not limited to one or more of a signal sequence an origin ot replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence Construction
  • the PR0213, PRO 1330, PRO l 449, PR0237, PR0324 PR0351 , PR0362, PR0615, PR0531 , PR0538 PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be produced recombinantly not only directly but also as a fusion polypeptide with a heterologous polypeptide which may be a signal sequence or othei polypeptide having a specific cleavage site at the N terminus ot the mature protein or polypeptide
  • the signal sequence may be a component of the vector, or it may be a part ot the PR021 -, PRO 1330 PRO 1449 PR0237-, PR0324-, PR0351 , PR0362-, PR061 , PR05 1 - PR0538 PR03664-, PR0618-, PR0772 PRO703-, PR0792- or PR0474 encoding DNA that is inserted into the vector
  • the signal sequence may be a prok
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e g , ampicillin, neomycin, methotrexate, or tetracychne, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e g , the gene encoding D-alamne racemase for Bacilli
  • suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PR0213-, PRO1330-, PROl 449-, PR0237-, PR0324-, PR0351-, PR0362-, PR0615-, PR0531 -, PR0538-, PR03664-, PRO ⁇ l 8-, PR0772-, PRO703-, PR0792- or PR0474-encod ⁇ ng nucleic acid, such as DHFR or thymidine kinase
  • An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al , Proc Natl Acad Sci USA, 77.4216 (1980)
  • a suitable selection gene for use in yeast is the trp ⁇ gene present in the yeast plasmid YRp7 [Stinchcomb et al , Nature.
  • the trp ⁇ gene provides a selection marker for a mutant strain ot yeast lacking the ability to grow in tryptophan, for example, ATCC No 44076 or PEP4-1 [Jones, Genetics, 85 12 (1977)]
  • Expression and cloning vectors usually contain a promoter operably linked to the PR0213-, PRO1330-, PR01449-, PR0237-, PR0324-, PR0351 -, PR0362-, PR0615-, PR0531 -, PR0538-, PR03664-, PR0618-, PR0772-, PRO703-, PR0792- or PR0474-encod ⁇ ng nucleic acid sequence to direct mRNA synthesis
  • Pi o oters recognized by a variety of potential host cells are well know n Promoters suitable for use with prokaryotic hosts include the ⁇ -lactamase and lactose promoter systems [Chang etal .
  • Suitable promoting sequences toi use with yeast hosts include the promoters for 3- phosphoglycerate kinase [Hitzeman et al , J Biol Chem . 255 2073 ( 1980) j or other glycolytic enzymes [Hess et al J Ad ⁇ Enzyme Reg . 7 149 (1968), Holland, Biochemistry. ]7 4900 ( 1978)]. such as enolase.
  • yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enz ⁇ mes associated with nitrogen metabolism, metallothionein, glyceraldehyde 3- phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization Suitable vectors and promoters for use in yeast expression are further described in EP 73,657
  • PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (S V40), from heterologous mammalian promoters, e g , the actin promoter or an immunoglobulin promoter, and from heat shock promoters, provided such promoters are compatible with the host cell systems
  • viruses such as polyoma virus, fowlpo
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription
  • Many enhancer sequences are now known from mammalian genes (globm, elastase, albumin, ⁇ -fetoprotem, and insulin)
  • an enhancer from a eukaryotic cell virus examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers
  • the enhancer include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers The enhance
  • Expression vectors used in eukaryotic host cells will also contain sequences necessary for the termination ot transcription and for stabilizing the mRNA Such sequences are commonly available from the 5 and, occasionally 3 , untranslated regions of eukaryotic oi ⁇ iral DNAs or cDNAs These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PR021 PRO l 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362 PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
  • vectois and host cells suitable for adaptation to the synthesis ot PR0213 PRO 1330 PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 PR0538, PR03664, PR0618 PR0772 PRO703, PR0792 or PR0474 in recombinant vertebrate cell culture are described in Gething et al , Nature, 293 620-625 (1981 ). Mantei et al . Nature. 281 40-46 (1979) EP 1 17,060, and EP 1 17 058
  • Gene amplification and/or expression may be measured in a sample directly for example by conventional Southern blotting, Northern blotting to quantitate the transcription ot mRNA [Thomas, Pi c Natl Acad Sci USA 225201-5205 ( 1980)], dot blotting (DNA analysis) or m situ hybridization, using an appropriately labeled probe based on the sequences provided herein
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA RNA hybrid duplexes or DNA-protein duplexes
  • the antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected
  • Gene expression alternatively, may be measured by immunological methods, such as lmmunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product Antibodies useful for
  • PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be recovered from culture medium or from host cell lysates If membrane bound, it can be released from the membrane using a suitable detergent solution (e g , T ⁇ ton-X 100) or by enzymatic cleavage Cells employed in expression of PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents
  • PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362 PR0615, PR0531 PR0538, PR03664, PRO ⁇ l 8, PR0772, PRO703, PR0792 or PR0474 from recombinant cell proteins or polypeptides The following procedures are exemplary ot suitable purification procedures by fractionation on an ion-exchange column, ethanol precipitation, reverse phase HPLC, chromatography on silica or on a cation-exchange resm such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation, gel filtration using, for example, Sephadex G 75, protein A Sepharose columns to remove contaminants such as IgG, and metal chelating columns to bind epitope tagged forms ot the PR0213, PRO 1 30, PRO 1449, PR0237, PR0324 PR0351 , PR0362, PR0615, PR0531 , PR0538, PR
  • PRQ35 PRQ362. PRQ615. PRQ531 PRQ538, PRQ3664, PRQ6I 8 PRQ772, PRO703, PRQ792 or PRQ474 Polypeptides in Tumor Tissues and Cell Lines
  • the genome of prokaryotic and eukaryotic organisms is subjected to two seemingly conflicting requirements One is the preservation and propagation of DNA as the genetic information in its original form, to guarantee stable inheritance through multiple generations
  • the adaptive mechanisms can include qualitative or quantitative modifications of the genetic material
  • Qualitative modifications include DNA mutations, in which coding sequences are altered resulting in a structurally and/or functionally different protein
  • Gene amplification is a quantitative modification, whereby the actual number of complete coding sequence, i e , a gene, increases, leading to an increased number of available templates for transcription, an increased number of translatable transcripts, and, ultimately, to an increased abundance of the protein encoded by the amplified gene
  • the phenomenon of gene amplification and its underlying mechanisms have been investigated in vitio in several prokaryotic and eukaryotic culture systems
  • the best-charactei lzed example of gene amplification involves the culture of eukaryotic cells in medium containing variable concenti
  • Gene amplification is most commonly encountered in the development of resistance to cytotoxic drugs (antibiotics for bacteria and chemotherapeutic agents for eukaryotic cells) and neoplastic transformation Transformation of a eukaryotic cell as a spontaneous event or due to a vual oi chemical/environmental insult is typically associated with changes in the genetic material ot that cell
  • cytotoxic drugs antibiotics for bacteria and chemotherapeutic agents for eukaryotic cells
  • neoplastic transformation Transformation of a eukaryotic cell as a spontaneous event or due to a vual oi chemical/environmental insult is typically associated with changes in the genetic material ot that cell
  • One of the most common genetic changes observed in human malignancies are mutations of the ⁇ 53 protein p53 controls the transition of cells from the stationary (Gl ) to the replicative (S) phase and prevents this transition in the presence of DNA damage
  • Gl stationary
  • S replicative
  • one of the main consequences of disabling p53 mutations is the accumulation
  • CGH comparative genomic hybridization
  • such genes have been identified by quantitative PCR (S Gelmini et al , Chn Chem , 43 752 [1997]), by comparing DNA from a variety ot primary tumors, including bieast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thy us, testis, ovary, uterus, etc , tumor, or tu oi cell lines, with pooled DNA from healthy donors Quantitative PCR w as perfoimed using a TaqMan instiument (ABI) Gene-specific p ⁇ meis and fluorogenic probes were designed based upon the coding sequences ot the DNAs
  • Human lung carcinoma cell lines include A549 (SRCC768), Calu- 1 (SRCC769), Calu-6 (SRCC770), HI 57 (SRCC771 ), H441 (SRCC772) H460 (SRCC773), SKMES-1 (SRCC774), SW900 (SRCC775), H522 (SRCC832),and H810 (SRCC833), all available from ATCC
  • Primary human lung tumor cells usually derive from adenocarcinomas, squamous cell carcinomas, large cell carcinomas, non-small cell carcinomas, small cell carcinomas, and broncho alveolar carcinomas, and include, for example, SRCC724 (adenocarcinoma, abbreviated as "AdenoCa")(LTl ), SRCC725 (squamous cell carcinoma, abbreviated as "SqCCa)(LTl a), SRCC726 (adenocarc ⁇ noma)(LT2), SRCC727 (adenocarc ⁇ nom
  • SRCC891 (adenocarcinoma) (LT30), SRCC892 (squamous cell carcinoma) (LT31 ), SRCC894 (adenocarcinoma) (LT33)
  • human lung tumors designated SRCC1 125 [HF-000631 ], SRCC1127 [HF-000641], SRCC1 129 [HF-000643], SRCC1 133 [HF-000840], SRCC1 135 [HF-000842], SRCC1227 [HF-001291], SRCC1229 [HF-001293], SRCC1230 [HF-001294], SRCC1231 [HF-001295], SRCC1232 [HF-001296], SRCC1233 [HF-001297], SRCC1235 [HF-001299], and SRCC1236 [HF-001300]
  • Colon cancer cell lines include, for example, ATCC cell lines SW480 (adenocarcinoma, SRCC776), SW620 (lymph node metastasis of colon adenocarcinoma, SRCC777), Colo320 (carcinoma, SRCC778), HT29 (adenocarcinoma, SRCC779), HM7 (a high mucin producing variant of ATCC colon adenocarcinoma cell line, SRCC780, obtained fromDr Robert Warren, UCSF), CaWiDr (adenocarcinoma, SRCC781 ), HCT1 16 (carcinoma, SRCC782), SKCOl (adenocarcinoma, SRCC783), SW403 (adenocarcinoma, SRCC784), LS174T (carcinoma, SRCC785), Colo205 (carcinoma, SRCC828), HCT15 (carcinoma, SRCC829), HCC
  • CT23 (adenocarcinoma. SRCC910), CT24 (adenocarcinoma. SRCC91 1 ), CT25 (adenocarcinoma, SRCC912), CT26 (adenocarcinoma, SRCC913), CT27 (adenocarcinoma, SRCC914),CT28 (adenocarcinoma, SRCC915), CT29 (adenocarcinoma, SRCC916), CT30 (adenocarcinoma, SRCC917), CT31 (adenocarcinoma. SRCC918), CT32 (adenocarcinoma.
  • Human breast carcinoma cell lines include, tor example. HBL100 (SRCC759), MB435s (SRCC760), T47D (SRCC761 ), MB468(SRCC762), MB 175 (SRCC763), MB361 (SRCC764), BT20 (SRCC765), MCF7 (SRCC766), and SKBR3 (SRCC767), and human breast tumor center designated SRCC1057 [HF-000545] Also included are human breast tumors designated SRCC1094, SRCC1095, SRCC1096, SRCC1097, SRCC1098, SRCC1099, SRCC1 100, SRCC1 101 , and human breast met-lung-NS tumor designated SRCC893 [LT 32]
  • Human kidney tumor centers include SRCC989 [HF-00061 1 ] and SRCC1014 [HF-000613]
  • Human testis tumor center includes SRCC1001 [HF 000733] and testis tumor margin SRCC999 [HF-
  • Human parathyroid tumor includes SRCC1002 [HF-000831 ] and SRCC1003 [HF-000832]
  • gene amplification and/or gene expression in various tissues may be measured by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc Natl Acad Sci USA.77 5201-5205 [1980]), dotblott ⁇ ng(DNA analys ⁇ s), or « situ hybridization, using an appropriately labeled probe, based on the sequences provided herein Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes
  • Gene expression in various tissues may be measured by immunological methods, such as lmmunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product
  • Antibodies useful for lmmunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal Conveniently, the antibodies may be prepared against a native sequence PR0213, PRO 1330, PRO 1449, PR0237 PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to sequence PR0213 PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362 PR0615 PR0531 , PR0538, PR03664, PR06
  • amplification ot a given gene is functionally relevant, then that gene should be amplified more than neighboring genomic regions which are not important for tumor survival To test this the gene can be mapped to a particular chromosome, e g , by radiation-hybrid analysis The amplification level is then determined at the location identified, and at the neighboring genomic region Selective or preferential amplification at the genomic region to which the gene has been mapped is consistent with the possibility that the gene amplification observed promotes tumor growth or survival Chromosome mapping includes both framework and epicenter mapping For further details see e g , Stewart et al , Genome Research. _ 1 422-433 (1997) H Antibody Binding Studies
  • the results of the gene amplification study can be further verified by antibody binding studies, in which the ability of ant ⁇ -PR0213, anti-PROl 330, anti-PRO 1449, ant ⁇ -PR0237, ant ⁇ -PR0324, ant ⁇ -PR0351 , ant ⁇ -PR0362, ant ⁇ -PR0615, ant ⁇ -PR0531 , ant ⁇ -PR0538, ant ⁇ -PR03664, anti-PRO ⁇ l 8, ant ⁇ -PR0772, ant ⁇ -PRO703, anti PR0792 or ant ⁇ -PR0474 antibodies to inhibit the expression of PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptides on tumor (cancer) cells is tested
  • Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconju
  • Antibody binding studies may be carried out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays Zola, Monoclonal Antibodies A Manual of Techniques, pp 147-158 (CRC Press, Inc , 1987)
  • Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected
  • the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex
  • the second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay)
  • sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme
  • the tumor sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example
  • Cell-based assays and animal models for tumors can be used to verify the findings of the gene amplification assay, and further understand the relationship between the genes identified herein and the development and pathogenesis of neoplastic cell growth
  • the role ot gene products identified herein in the development and pathology of tumor or cancer can be tested by using primary tumor cells or cells lines that have been identified to amplify the genes herein Such cells include, for example, the breast colon and lung cancer cells and cell lines listed above
  • Suitable cells include for example, stable tumor cells lines such as, the B 104 1- 1 cell line (stable NIH-3T3 cell line transfected with the neu protooncogene) and tas transfected NIH-3T3 cells, which can be transfected with the desired gene, and monitored for tumorogenic growth
  • stable tumor cells lines such as, the B 104 1- 1 cell line (stable NIH-3T3 cell line transfected with the neu protooncogene) and tas transfected NIH-3T3 cells, which can be transfected with the desired gene, and monitored for tumorogenic growth
  • Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit tumorogenic cell growth by exerting cytostatic or cytotoxic activity on the growth of the transformed cells, or by mediating antibody-dependent cellular cytotoxicity (ADCC)
  • ADCC antibody-dependent cellular cytotoxicity
  • mice Animal models of tumors and cancers (e g , breast cancer, colon cancer, prostate cancer, lung cancer, etc ) include both non- recombinant and recombinant (transgenic) animals
  • Non-recombinant animal models include, for example, rodent, e g , murine models
  • Such models can be generated by introducing tumor cells into syngeneic mice using standard techniques, e g , subcutaneous injection, tail vein injection, spleen implantation, lntrape ⁇ toneal implantation, implantation under the renal capsule, or orthopin implantation, e g , colon cancer cells implanted in colonic tissue (See, e g , PCT publication No
  • the cells introduced into such animals can be derived from known tumor/cancer cell lines, such as, any of the above-listed tumor cell lines, and, for example, the B 104- 1 -1 cell line (stable NIH-3T3 cell line transfected with the neu protooncogene), las transfected NIH 3T3 cells Caco-2 (ATCC HTB 37), a moderately well differentiated grade II human colon adenocarcinoma cell line HT-29 (ATCC HTB-38), or from tumors and cancers Samples of tumor or cancer cells can be obtained from patients undergoing surgery, using standard conditions involv ing freezing and storing in liquid nitrogen (Karmali et al Bi J Cancer, 48 689-696 [1983])
  • Tumor cells can be introduced into animals such as nude mice, by a variety of procedures
  • the subcutaneous (s c ) space in mice is very suitable for tumor implantation
  • Tumors can be transplanted s c as solid blocks, as needle biopsies by use of a trochai , or as cell suspensions
  • tumor tissue fragments of suitable size are introduced into the s c space
  • Cell suspensions are freshly prepared from
  • Tumor cells can also be injected as subdermal implants In this location, the inoculum is deposited between the lower part of the dermal connective tissue and the s c tissue Boven and Winograd (1991), supra
  • Animal models of breast cancer can be generated, for example, by implanting rat neuroblastoma cells (from which the neu oncogen was initially isolated), or Hen-transformed NIH-3T3 cells into nude mice, essentially as described by Drebin et al , PNAS USA, 83 9129-9133 (1986)
  • animal models of colon cancer can be generated by passaging colon cancer cells in animals, e g , nude mice, leading to the appearance of tumors in these animals
  • An orthotopic transplant model of human colon cancer in nude mice has been described, for example, by Wang et al , Cancer Research, 54 4726-4728 ( 1994) and Too etal , Cancer Research. 55 681-684 (1995) This model is based on the so-called “METAMOUSE” sold by AntiCancer, Inc , (San Diego, California)
  • Tumors that arise in animals can be removed and cultured in vitt o Cells from the in viti o cultures can then be passaged to animals Such tumors can serve as targets for further testing or drug screening Alternatively, the tumors resulting from the passage can be isolated and RNA from pre passage cells and cells isolated after one or more rounds of passage analyzed for differential expression of genes of interest Such passaging techniques can be performed with any known tumor or cancer cell lines
  • Meth A, CMS4, CMS5, CMS21 , and WEHI-164 are chemically induced fibrosarcomas of BALB/c female mice (DeLeo et al , J Exp Med . 146 720 [1977]), which provide a highly controllable model system for studying the anti-tumor activities of various agents (Palladino et al , J Immunol , 138 4023-4032 [1987]) Briefly, tumor cells are propagated in vitro in cell culture Prior to injection into the animals, the cell lines are washed and suspended in buffer, at a cell density of about lOxl O 6 to 10xl0 7 cells/ml The animals are then infected subcutaneously with 10 to 100 ⁇ l of the cell suspension, allowing one to three weeks for a tumor to appear
  • the Lewis lung (3LL) carcinoma of mice which is one of the most thoroughly studied experimental tumors, can be used as an investigational tumor model Efficacy in this tumor model has been correlated with beneficial effects m the treatment of human patients diagnosed with small cell carcinoma of the lung (SCCL)
  • SCCL small cell carcinoma of the lung
  • This tumor can be introduced in normal mice upon injection of tumor fragments from an affected mouse or of cells maintained in culture (Zupi et al , Br J Cancer, 41 suppl 4 309 [ 1980]), and evidence indicates that tumors can be started from injection of even a single cell and that a very high proportion of infected tumor cells survive For further information about this tumor model see, Zacharski, Haemostasis J6 300-320 [1986])
  • One way of evaluating the efficacy of a test compound in an animal model on an implanted tumor is to measure the size of the tumor before and after treatment Traditionally, the size ot implanted tumors has been measured with a slide caliper in two or three dimensions The measure limited to
  • Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome of animals of interest, using standard techniques for producing transgenic animals
  • Animals that can serve as a target for transgenic manipulation include, without limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e g , baboons, chimpanzees and monkeys
  • Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (Hoppe and Wanger, U S Patent No 4,873,191), retrovirus-mediated gene transfer into germ lines (e g , Van der Putten et al , Proc Natl Acad Sci USA, 82 6148-615 [1985]), gene targeting in embryonic stem cells (Thompson etal , Cell, 56 313-321 [1989]), electroporation of embryos (Lo, Moi Cell Biol , 3 1803
  • transgenic animals include those that carry the transgene only in part of their cells (“mosaic animals”).
  • the transgene can be integrated either as a single transgene, or in concatamers, e g , head-to-head or head-to-tail tandems
  • Selective introduction of a transgene into a particular cell type is also possible by following, for example, the technique of Lasko et al , Proc Natl Acad Sci USA, 89 6232- 636 (1992)
  • the expression of the transgene in transgenic animals can be monitored by standard techniques For example, Southern blot analysis or PCR amplification can be used to verify the integration of the transgene The level of mRNA expression can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR, oi lmmunocytochemistry The animals are further examined for signs of tumor or cancer development
  • "knock out" animals can be constructed which have a defective or altered gene encoding a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide identified herein, as a result of homologous recombination between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal
  • cDNA encoding a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664 PR0618 PR0772, PRO703, PR0792 or PR0474 polypeptide can be used to clone genomic DNA encoding that polypeptide in accordance with established techniques A portion of the genomic DNA encoding a
  • Screening assays for drug candidates are designed to identity compounds that bind or complex with the polypeptides encoded by the genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins
  • Such screening assa> s w ill include assays amenable to high throughput screening of chemical libraries, making them particularly suitable toi identifying small molecule drug candidates
  • Small molecules contemplated include synthetic organic or inorganic compounds including peptides preferably soluble peptides, (poly)pept ⁇ de immunoglobulin fusions, and m particular antibodies including without limitation poly and monoclonal antibodies and antibody fragments, single chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments as well as human antibodies and antibody fragments
  • the assays can be performed in a variety of formats including protein-prote binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art
  • the polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e g , on a microtiter plate, by covalent or non-covalent attachments
  • a solid phase e g
  • an immobilized antibody e g , a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface
  • the assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e g , the coated surface containing the anchored component
  • the candidate compound interacts with but does not bind to a particular PR0213 , PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide encoded by a gene identified herein
  • its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions
  • Such assays include traditional approaches, such as, cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns
  • protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co workers [Fields and Song, Nature, 340 245 246 (1989), Chien et ⁇ l , Proc Natl Acad Sci USA, 88 9578-9582 (1991 )] as disclosed by Chevray and Nathans, Proc Natl Acad Sci USA,
  • the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide may be added to a cell along with the compound to be screened for a particular activity and the ability of the compound to inhibit the activity of interest in the presence of the PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide indicates that the compound is an antagonist to the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
  • expi ession cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PRO-538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and a cDNA libraiy created from this RNA is divided into pools and used to transtect COS cells or other cells that are not responsive to the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664 PRO ⁇ l 8, PR0772 PRO703, PR0792 or PR0474 polypeptide Transfected cells that are grown on glass slides are exposed to labeled PR0213, PRO 1330, PR01449, PR0237 PR0324, PR0351 ,
  • labeled PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide can be photoaffimty-linked with cell membrane or extract preparations that express the receptor molecule
  • Cross-linked material is resolved by PAGE and exposed to X ray film
  • the labeled complex containing the receptor can be excised, resolved into peptide fragments, and subjected to protein micro-sequencing
  • the amino acid sequence obtained from micro sequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor
  • mammalian cells or a membrane preparation expressing the receptor would be incubated with labeled PR0213, PROl 330, PR01449, PR0237, PR0324,
  • potential antagonists include an oligonucleotide that binds to the fusions of immunoglobulin with the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments
  • a potential antagonist may be a closely related protein, for example, a mutated form of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide that
  • PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where, e g , an antisense RNA or DNA molecule acts to block directly the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation
  • Antisense technology can be used to control gene expression through t ⁇ ple-hehx formation oi antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA
  • the 5' coding portion of the polynucleotide sequence which encodes the mature PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664 PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide herein, is used to design an antisense RNA
  • RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide (antisense - Okano, Neurochem , 56 560 (1991 ), Oh odeoxynucleotides as
  • Potential antagonists include small molecules that bind to the active site, the receptor binding site, or growth factor or other relevant binding site of the PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PRO ⁇ l 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, thereby blocking the normal biological activity of the PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PRO ⁇ l 8, PR0772, PRO703, PR0792or PR0474 polypeptide
  • small molecules include, but are not limited to, small peptides or peptide-hke molecules, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds
  • Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolvtic cleavage Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques For turthei details see, e g , Rossi, Current Biology, 4 469-471 (1994) and PCT publication No WO 97/335 ⁇ 1 (published
  • Nucleic acid molecules in triple helix formation used to inhibit transcription should be single stranded and composed of deoxynucleotides
  • the base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base-pairing rules, which generally require sizeable stretches of punnes oi py ⁇ midmes on one strand of a duplex
  • Hoogsteen base-pairing rules which generally require sizeable stretches of punnes oi py ⁇ midmes on one strand of a duplex
  • compositions and Methods tor the Tieatment of Tumoi s include without limitation, antibodies, small organic and inorganic molecules, peptides, phosphopeptides antisense and ribozyme molecules, triple helix molecules etc that inhibit the expression and/or actn ltv of the target gene product
  • antisense RNA and RNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation
  • oligodeoxy ⁇ bonucleotides derived from the translation initiation site, e g between about -10 and +10 positions of the target gene nucleotide sequence, are preferred
  • Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage
  • RNA target Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques For further details see, e g , Rossi, Current Biology, 4469-471 (1994), and PCT publication No WO 97/33551 (published September 18, 1997)
  • Nucleic acid molecules in triple helix formation used to inhibit transcription should be single-stranded and composed of deoxynucleotides
  • the base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of punnes or py ⁇ midines on one strand of a duplex
  • Hoogsteen base pairing rules which generally require sizeable stretches of punnes or py ⁇ midines on one strand of a duplex
  • Some of the most promising drug candidates according to the present invention are antibodies and antibody fragments which may inhibit the production or the gene product of the amplified genes identified herein and/or reduce the activity of the gene products
  • polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intrapentoneal injections
  • the immunizing agent may include the PR0213, PRO 1330 PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772 PRO703, PR0792 oi PR0474 polypeptide or a fusion protein thereof It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin.
  • adjuvants which may be employed include Freund's complete adjuvant and MPL TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate)
  • the immunization protocol may be selected by one skilled in the art without undue experimentation
  • anti PR0531 , ant ⁇ -PR0538, ant ⁇ -PR03664, ant ⁇ -PR0618, ant ⁇ -PR0772, ant ⁇ -PRO703, anti-PRO 792 or ant ⁇ -PR0474 antibodies may, alternatively, be monoclonal antibodies
  • Monoclonal antibodies may be prepared using hybndoma methods, such as those described by Kohler and Milstein, Nature, 256 495 ( 1975) In a hybndoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent Alternatively, the lymphocytes may be immunized in viti o
  • the immunizing agent will typically include the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, including fragments, or a fusion protein of such protein or a fragment thereof
  • PBLs peripheral blood lymphocytes
  • spleen cells or lymph node cells are used if non-human mammalian sources are desired
  • the lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybndoma cell
  • Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin Usually, rat
  • Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium
  • More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection (ATCC) Manassas, Virginia Human myeloma and mouse-human heteromyeloma cell lines also have been described foi the production of human monoclonal antibodies [Kozbor. J Immunol , 1 3 3001 ( 1984) Brodeurero/ . Monoclonal Antibody Production Techniques and Applications. Marcel Dekker. Inc . New Yoik. (1987) pp 51 -63]
  • the culture medium in which the hybndoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against PR0213, PRO1330, PR01449 PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538 PRO3664, PRO618, PRO772, PRO703, PRO792o ⁇ PR0474 Pieterably the binding specificity of monoclonal antibodies produced by the hybndoma cells is determined by immunoprecipitation or b> an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme linked immunoabsorbent assay (ELISA) Such techniques and assays are known in the art
  • the binding affinity of the monoclonal antibody can, 1 or example be determined by the Scatchard analysis of Munson and Pollard, Anal Biochem 107 220 ( 1980)
  • the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra] Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium Alternati ely, the hybndoma cells may be grown in vivo as ascites in a mammal
  • the monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as tor example protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography
  • the monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U S Patent No 4,816,567
  • DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e g , by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies)
  • the hybndoma cells of the invention serve as a preferred source of such DNA
  • the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells
  • the DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U S Patent No 4,816,567, Morrison
  • antibodies may further comprise humanized antibodies or human antibodies
  • Humanized forms of non-human (e g mu ⁇ ne) antibodies are chimeric immunoglobulins immunoglobulin chains or fi agments thereof (such as Fv, Fab, Fab', F(ab'), or other antigen-binding subsequences ot antibodies) which contain minimal sequence derived from non-human immunoglobulin Humanized antibodies include human immunoglobulins (recipient ant ⁇ bod>) in which residues from a complementary determining region (CDR) of the recipient are
  • a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human
  • These non- human amino acid residues are often referred to as "import' residues, which are typically taken from an "import" variable domain Humamzation can be essentially performed following the method of Winter and co-workers [Jones et al , Nature.
  • humanized antibodies are chimeric antibodies (U S Patent No 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter. J Moi Biol , 227 381 ( 1991 ), Marks et al , J Moi Biol , 222 581 (1991 )] The techniques of Cole et al , and Boerner et al , are also available for the preparation of human monoclonal antibodies (Cole etal , Monoclonal Antibodies and Cancer Therapy, Alan R Liss, p 77 (1985) and Boerner etal , J Immunol , 147(1 ) 86-95 (1991)] Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e g , mice in which the endogenous immunoglobulin genes have been partially or completely inactivated Upon challenge human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire This approach is described, for example, in U S
  • ADPT Antibody Dependent Enzyme Mediated Prodrug Therapy
  • the antibodies of the present invention may also be used in ADEPT by conjugating the antibody to a prodrug-activat g enzyme which converts a prodrug (e g , a peptidyl chemotherapeutic agent, see WO 81/01 145) to an active anti-cancer drug See, tor example, WO 88/07378 and U S Patent No 4,975,278
  • a prodrug-activat g enzyme which converts a prodrug (e g , a peptidyl chemotherapeutic agent, see WO 81/01 145) to an active anti-cancer drug
  • the enzyme component of the immunoconj ugate useful toi ADEPT includes any enzyme capable of acting on a prodrug in such as way so as to convert it into its moie activ e, cytotoxic form
  • Enzymes that are useful in the method of this invention include, but are not limited to, glycosidase, glucose oxidase, human lysosyme, human glucuromdase, alkaline phosphatase useful for converting phosphate-containing prodrugs into free drugs, arylsultatase useful for converting sulfate containing prodrugs into tree drugs, cytosine deammase useful tor converting non toxic 5-fluorocytos ⁇ ne into the anti cancer drug 5-fluorourac ⁇ l, pioteases, such as serratia protease, thermolysin, subtihsin, carboxypeptidases (e s> , carboxypeptidase G2 and carboxypeptidase A) and cathepsins (such as cathepsins B and L), that are useful for converting peptide-contai ng prodrugs into free drugs, D-alanylcarboxypeptidases, useful for converting pro
  • Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens
  • one of the binding specificities is for the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 the other one is for any other antigen, and preferably for a cell surface protein or receptor or receptor subunit
  • bispecific antibodies are known in the art Traditionally, the iecombinant production of bispecific antibodies is based on the co expression of two immunoglobulin heavy-chain/hght-chain pairs, where the two heavy chains have different specificities (Milstem and Cuello, Nature, 305 537-539 [ 1983]) Because of the random assortment of immunoglobulin heavy and light chains, these hybndomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure The purification of the correct molecule is usually accomplished by affinity chromatography steps Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker et al , EMBO J JO 3655-3659 (1991 ) Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences The fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge
  • the interface between a pair ot antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture
  • the preferred interface comprises at least a part of the CH3 region of an antibody constant domain
  • one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e g , tyrosine or tryptophan)
  • Compensatory "cavities" of identical or similar size to the large side cha ⁇ n(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e g , alanine or threonine)
  • Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e g , F(ab') 2 bispecific antibodies) Techniques for generating bispecific antibodies from antibody fragments have been described in the literature For example, bispecific antibodies can be prepared using chemical linkage Brennan et al , Science, 229 81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab') 2 fragments These fragments are reduced in the presence of the dithiol complexing agent sodium arsemte to stabilize vicinal dithiols and prevent intermolecular disulfide formation The Fab' fragments generated are then converted to thiomtrobenzoate (TNB) derivatives One of the Fab'-TNB derivatives is then reconverted to the Fab'- thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody
  • TAB thiomtrobenzoate
  • Fab' fragments may be directly recovered from E coli and chemically coupled to form bispecific antibodies
  • Shalaby et al , J Exp Med , 175 217-225 (1992) describe the production of a fully humanized bispecific antibody F(ab') 2 molecule
  • Each Fab' fragment was separately secreted from E coli and subjected to directed chemical coupling in vitw to form the bispecific antibody
  • the bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets
  • bispecific antibodies have been produced using leucine zippers Kostelny et al , J Immunol . 148(5) 1547- 1553 (1992)
  • the leucine zipper peptides from the Fos and Jun proteins were linked to the Fab portions of two different antibodies by gene fusion
  • the antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers
  • This method can also be utilized for the production of antibody homodimers
  • the "diabody ' technology described by Holhnger et al , Proc Natl Acad Sci USA.90 6444-6448 ( 1993) has pi ovided an alternative mechanism for making bispecific antibody fragments
  • the fragments comprise a heavy-chain variable domain (V H ) connected to a light-chain variable domain (V L ) by a linker which is too short to allow pairing between the two domains on the same chain According
  • Antibodies with more than two valencies are contemplated
  • trispecif ic antibodies can be prepared Tutt et al , J Immunol . 147 60 ( 1991 )
  • Exemplary bispecific antibodies may bind to two different epitopes on a given polypeptide herein
  • an anti-polypeptide arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e g , CD2, CD3, CD28, or B7), or Fc receptors for IgG (Fc ⁇ R), such as Fc ⁇ RI (CD64), Fc ⁇ RII (CD32) and Fc ⁇ RIII (CD16) so as to focus cellular defense mechanisms to the cell expressing the particular polypeptide
  • Bispecific antibodies may also be used to localize cytotoxic agents to cells which express a particular polypeptide
  • These antibodies possess a polypeptide binding arm and an arm which binds a cytotoxic agent or a radionuclide
  • Heteroco ugate Antibodies are composed of two covalently joined antibodies Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U S Patent No 4,676,980], and for treatment of HIV infection [WO 91/00360, WO 92/200373, EP 03089] It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosshnking agents For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond Examples of suitable reagents for this purpose include lminothiolate and methyl-4- mercaptobuty ⁇ midate and those disclosed, for example, in U S Patent No 4,676,980
  • cyste e res ⁇ due(s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region
  • the homodimenc antibody thus generated may have improved internalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC) See Caron et al , J Exp Med , 176 1191-1 195 ( 1992) and Shopes, J Immunol , 148 2918-2922 ( 1992)
  • Homodimenc antibodies with enhanced anti-tumor acti v ⁇ t> may also be prepared using heterobifunctional cross-linkers as described in Wolff etal , Cancer Research, 53 2560 2565 (1993)
  • an antibody can be engineered which has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities See, Ste enson et al , Anti-Cancer Drug
  • the invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e g , an enzymatically activ e toxin ot bacterial, fungal, plant oi animal origin, or fragments thereof, or a small molecule toxin), or a radioactive isotope e , a radioconjugate)
  • a cytotoxic agent such as a chemotherapeutic agent, toxin (e g , an enzymatically activ e toxin ot bacterial, fungal, plant oi animal origin, or fragments thereof, or a small molecule toxin)
  • toxin e g , an enzymatically activ e toxin ot bacterial, fungal, plant oi animal origin, or fragments thereof, or a small molecule toxin
  • radioactive isotope e a radioconjugate
  • Enzymatically active protein toxins and fragments thereof which can be used include diphtheria A chain, nonbmding active fragments of diphtheria toxin, cholera toxin, botuhnus toxin exotoxin A chain (from Pseudomonas aei uginosa), ncin A chain, ab ⁇ n A chain, modeccin A chain alpha-sarcin Aleui ites foidu proteins, dianthin proteins, Plntolaca amencana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin crot , sapaonana officinahs inhibitor, gelonin, saponn, mitogelhn, restnctocm, phenomycin, enomycin and the tncothecenes
  • Small molecule toxins include, for example, cahcheamicins, maytansinoids, palytoxin and CC 1065 A variety of radionuch
  • Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein coupling agents such as N-succm ⁇ m ⁇ dyl-3-(2-py ⁇ dyld ⁇ th ⁇ ol) propionate (SPDP), lminothiolane (IT), bifunctional derivatives of lmidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as b ⁇ s-(p-d ⁇ azon ⁇ umbenzoyl)-ethylened ⁇ am ⁇ ne), diisocyanates (such as tolyene 2,6-d ⁇ socyanate), and bis- active fluorine compounds (such as l,5-d ⁇ fluoro-2,4-d ⁇ n ⁇ trobenzen
  • Immunoliposomes The antibodies disclosed herein may also be formulated as immunoliposomes Liposomes containing the antibody are prepared by methods known the art, such as described in Epstein etal , Proc Natl Acad Sci USA, 82 3688 (1985), Hwang et al , Proc Natl Acad Sci USA, 724030 (1980), and U S Patent Nos 4485,045 and 4,544,545 Liposomes with enhanced circulation time are disclosed in U S Patent No 5,01 ,556
  • Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphaudylchohne, cholesterol and PEG-denvatized phosphatidylethanolamine (PEG PE) Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al J Biol Chem .
  • a chemotherapeutic agent such as Doxorubicin is optionally contained within the hposome See, Gabizon efa/ , J National Cancer Inst 81(19) 1484 (1989)
  • Antibodies specifically binding the product of an amplified gene identified herein, as well as othei molecules identified by the screening assays disclosed heieinbefore, can be administered tor the tieatment of tumors including cancers, in the form ot pharmaceutical compositions If the protein encoded by the amplified gene is mtracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred However, lipofections or liposomes can also be used to deliver the antibod) or an antibody fragment into cells Where antibody fragments are used, the smallest inhibitory fragment which specifically binds to the binding domain of the target protein is preferred For example, based upon the variable region sequences of an antibody, peptide molecules can be designed which retain the ability to bind the target protein sequence Such peptides can be synthesized chemically and/or produced by recombinant DNA technology (see, e g , Marasco et l , Proc Natl Acad Sci USA, 90 7889-7893 [1993])
  • Therapeutic formulations ot the antibody are prepared for storage by mixing the antibody having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences. 16th edition, Osol, A ed [1980]), in the form of lyophilized formulations or aqueous solutions
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids, antioxidants including ascorbic acid and methionine, preservatives (such as octadecyldimethylbenzyl ammonium chloride, hexamethomum chloride, benzalkomum chloride, benzethomum chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and /
  • compositions herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other Alternatively, or in addition, the composition may comprise a cytotoxic agent, cytokine or growth inhibitor) agent Such molecules are suitably present in combination in amounts that are effective tor the purpose intended
  • the active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by mterfacial polymerization, for example, hydroxymethylcellulose or gelatin microcapsules and poly- (methylmethacylate) microcapsules, respectively, in colloidal diug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano particles and nanocapsules) or in macroemulsions Such techniques are disclosed in Remington s Pharmaceutical Sciences, 16th edition, Osol A ed (1980)
  • the formulations to be used for /// vivo administration must be sterile This is readily accomplished by filtration through sterile filtration membranes
  • Sustained-release preparations may be prepared Suitable examples ot sustained release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e g , films or microcapsules
  • ot sustained-release matrices include polyesters hydrogels (for example, poly(2 hydroxyethyl-methacrylate) or poly(v ⁇ nylalcohol)), polylactides (U S Pat No 3,773,919), copolymers of L glutamic acid and ethyl L glutamate, non degradable ethylene vinyl acetate degradable lactic acid glycolic acid copolymers such as the LUPRON DEPOT TM (injectable microspheres composed of lactic acid-glycohc acid copolymer and leuprohde acetate), and poly-D-(-)-3-hydroxybuty ⁇ c acid While polymers such as ethylene-vinyl acetate and lactic acid
  • the antibodies and other anti -tumor compounds of the present invention may be used to treat various conditions, including those characterized by overexpression and/or activation of the amplified genes identified herein
  • Exemplary conditions or disorders to be treated with such antibodies and other compounds include benign or malignant tumors (e g , renal, liver, kidney, bladder, breast, gastric, ovarian, coloiectal, prostate, pancreatic, lung, vulval, thyroid, hepatic carcinomas, sarcomas, ghoblastomas, and various head and neck tumors), leukemias and lymphoid malignancies, other disorders such as neuronal, ghal, astrocytal, hypothalamic and other glandular, macrophagal, epithelial, stromal and blastocoehc disorders, and inflammatory, angiogemc and lmmunologic disorders
  • the anti-t tumors e g , renal, liver, kidney, bladder, breast, gastric, ovarian, coloiec
  • chemotherapeutic agents may be administered to the patient Preparation and dosing schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determined empirically by the skilled practitioner Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service Ed , M C Perry, Williams &W ⁇ lkms, Baltimore, MD (1992)
  • the chemotherapeutic agent may precede or follow administration of the anti-tumor agent, e g , antibody, or may be given simultaneously therewith
  • the antibody may be combined with an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onap ⁇ stone (see. EP 616812) in dosages known for such molecules
  • the antibodies herein are co-administered with a growth inhibitory agent
  • the growth inhibitory agent may be administered first, followed by an antibody of the present invention
  • simultaneous administration or administration of the antibody of the present invention first is also contemplated Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth inhibitory agent and the antibody herein
  • an anti-tumor agent e g , an antibody herein will depend on the type of disease to be treated, as defined above, the severity and course of the disease whether the agent is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the agent, and the discretion of the attending physician
  • the agent is suitably administered to the patient at one time or over a series of treatments
  • ⁇ g/kg to 15 mg/kg (e g , 0 1 -20 mg/kg) of antibody is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion
  • a typical daily dosage might range from about 1 ⁇ g/kg to 100 mg/kg or more, depending on the factors mentioned above
  • the treatment is sustained until a desired suppression of disease symptoms occurs
  • other dosage regimens may be useful The progress of this therapy is easily monitored by conventional techniques and assays
  • an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above comprises a container and a label Suitable containers include, for example, bottles, vials, syringes, and test tubes
  • the containers may be formed from a variety of materials such as glass or plastic
  • the container holds a composition which is effective for diagnosing or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic inaction needle)
  • the active agent in the composition is usually an anti-tumor agent capable of interfering with the activitv of a gene product identified herein, e g , an antibody
  • the label on or associated with, the container indicates that the composition is used for diagnosing or treating the condition of choice
  • the article of manufacture may turthei comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline Ringer's solution and dext
  • antibodies directed against the piotem products of genes amplified in tumor cells can be used as tumor diagnostics or prognostics
  • antibodies, including antibody fragments can be used to qualitatively or quantitatively detect the expression of proteins encoded by the amplified genes ("marker gene products")
  • the antibody preferably is equipped with a detectable, e g , fluorescent label, and binding can be monitored by light microscopy, flow cytometry, fluo ⁇ metry, or other techniques known in the art These techniques are particularly suitable, if the amplified gene encodes a cell surface protein, e g , a growth factor Such binding assays are performed essentially as described in section 5 above
  • In situ detection of antibody binding to the marker gene products can be performed, for example, by immunofluorescence or immunoelectron microscopy
  • a histological specimen is removed from the patient, and a labeled antibody is applied to it, preferably by overlaying the antibody on a biological sample
  • This procedure also allows for determining the distribution of the marker gene product in the tissue examined It will be apparent for those skilled in the art that a wide variety of histological methods are readily available for in situ detection
  • the present invention uses standard piocedures of recombinant DNA technolog) such as those described hereinabove and in the following textbooks Sambrook et al , Molecular Cloning A Laboratory Manual. Cold Spring Harbor Press N Y , 1989, Ausubel etal . Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience N Y , 1989, Innis eta! , PCR Protocols A Guide to Methods and Applications. Academic Press. Inc , N Y , 1990, Harlow et al . Antibodies A Laboratory Manual Cold Spring Harbor Press. Cold Spring Harbor. 1988 Gait, Oligonucleotide Synthesis, IRL Press, Oxford, 1984, R I Fieshney, Animal Cell Culture, 1987. Cohgan et al . Current Protocols in Immunology, 1991 EXAMPLE 1
  • ECD extracellular domain sequences
  • EST expressed sequence tag
  • DNA28735 A consensus DNA sequence was assembled relative to other Incyte EST sequences using phrap This consensus sequence is herein designated DNA28735 Based on the DNA28735 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of PR0213, PRO1330 and PR01449 full-length coding sequences Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 - 1 5kbp In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology, with the PCR
  • oligonucleotide hybridization probe was constructed from the consensus DNA28735 sequence which had the following nucleotide sequence hybridization probe
  • RNA for construction of the cDNA libraries was isolated from human fetal lung tissue
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commeicially available reagents such as those from Invitrogen, San Diego, CA
  • the cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appiop ⁇ ately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the St ii site, see, Holmes et al . Science, 253 1278- 1280 ( 1 91 )) in the unique Xhol and Notl sites
  • DNA30943-1 163 (SEQ ID NO 3), DNA64907-1 163 (SEQ ID NO 5) and DNA64908-1 163 (SEQ ID NO 7) contain single open reading frames with apparent translational initiation sites at nucleotide positions 399-401 , 488-490 and 326-328, respectively, and ending at the stop codons at nucleotide positions 1218-1220, 1307-1309 and 1145-1 147, respectively ( Figures 3, 5 and 7, respectively)
  • the predicted polypeptide precursors are 273, 273 and 273 amino acids long, respectively ( Figures 4, 6 and 8, respectively)
  • Analysis ot the full-length PR0213, PRO 1330 and PRO 1449 sequences shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6) and Figure 8 (SEQ ID NO 8), respectively evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 19, cAMP- and cGMP-dependent protein kinase phosphorylation sites from about amino acid
  • EXAMPLE 2 Isolation of cDNA Clones Encoding PRQ237
  • the extracellular domain (ECD) sequences (including the secretion signal, if any) of about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST ) databases
  • the EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA)
  • the search was performed using the computei program BLAST or BLAST2 ( Altshul et al , Methods in Enzymoiogy.266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap'
  • DNA30905 Based on the DNA30905 consensus sequence oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence ot interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0237
  • Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product ot about 100-1000 bp in length
  • the probe sequences are typically 40-55 bp in length
  • additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp
  • DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology with the PCR primer pair A positive library was then used to isolate clones en
  • PCR primers (forward and reverse) were synthesized forward PCR primer
  • a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30905 sequence which had the following nucleotide sequence hybridization probe 5'-GCCTCTTTGTCAACGTTGCCAGTACCTCTAACCCATTCCTCAGTCGCCTC 3' (SEQ ID NO 39)
  • DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0237 gene using the probe oligonucleotide and one ot the PCR primers
  • RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB 153)
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA
  • the cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikmased adaptois, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-1280 (1991)) in the unique Xhol and Notl sites
  • DNA sequencing of the clones isolated as described above gave the full length DNA sequence tor PR0237
  • EXAMPLE 3 Isolation of cDNA Clones Encoding a Human PRQ324
  • the extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag
  • EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA) The search was performed using the computer program BLAST or BLAST2 (Altshul etal , Methods in Enzymology. 266 460-480 (1996)) as a comparison of the
  • DNA34347 Based on the DNA34347 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0324 Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -
  • PCR primers (forward and reverse) were synthesized forward PCR primer 1
  • oligonucleotide hybridization probe was constructed from the consensus DNA34347 sequence which had the following nucleotide sequence hybridization probe
  • RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB6)
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA
  • the cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites
  • DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0324
  • DNA36343 1310 [herein designated as DNA36343 1310] (SEQ ID NO 9) and the derived PR0324 protein sequence (SEQ ID NO 10)
  • DNA36343-1310 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 144- 146 and ending at the stop codon at nucleotide positions 101 1-1013 ( Figure 9, SEQ ID NO 9)
  • the predicted polypeptide precursor is 289 amino acids long ( Figure 10, SEQ ID NO 10)
  • the full-length PR0324 protein shown in Figure 10 has an estimated molecular weight of about 32,268 daltons and a pi of about 9 21
  • Analysis of the particular PR0324 polypeptide sequence shown in Figure 10 evidence the presence of the following a signal peptide from about amino acid 1 to about amino acid 31 , a transmembrane domain from about amino acid 136 to about amino acid 157, a tyrosine kinase phosphorylation site from about ammo acid 106 to about amino acid 114, and regions that
  • oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for a PR0351
  • Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length
  • the probe sequences are typically 40-55 bp in length
  • additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp
  • DNA from the libraries was screened by PCR amplification, as per Ausubel etal , Current Protocols in Molecular Biology, with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs
  • a synthetic oligonucleotide hybridization probe was constructed from DNA35950 which had the following nucleotide sequence hybridization probe 5'-GGCTGGCATCATCAGCTTTGCATCAAGCTGTGCCCAGGAGGACGC-3' (SEQ ID NO 48)
  • DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above A positive library was then used to isolate clones encoding the PR0351 gene using the probe oligonucleotide and one of the PCR primers
  • RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB230)
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen. San Diego CA
  • the cDN A was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vectoi (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science. 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites
  • DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0351
  • DNA40571 -1315 [herein designated as DNA40571 -1315] (SEQ ID NO 1 1 ) and the derived PR0351 protein sequence (SEQ ID NO 12)
  • DNA40571 - 1315 contains two open reading frames with an apparent translational initiation site at nucleotide positions 189- 191 and a second open reading frame beginning at nucleotide 470 with the two open reading frames ending at the stop codons at nucleotide positions 363-365 and 2009 201 1 , respectivel) ( Figure 1 1 )
  • the predicted polypeptide precursor is 571 amino acids long ( Figure 12)
  • Important regions of the amino acid sequence of PR0351 include the signal peptide (amino acid residues 1 to about 15), regions having sequence similai lty to serine proteases of the trypsin family (i e , amino acid residues from about 79 to about 96, from about 343 to about 360 and from about 237 to about 248), two N-glycosylation sites (; e , amino acid residues from about 37 to about 41 and from about 564
  • EXAMPLE 5 Isolation of cDNA Clones Encoding PRQ362
  • the extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases
  • the EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA)
  • the search was performed using the computer program BLAST or BLAST2 (Altshul etal , Methods in Enzymology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap” (Phil Green, University of Washington, Seattle, Washington)
  • DNA42257 Based on the DNA42257 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0362
  • Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100- 1000 bp in length The probe sequences are typically 40-55 bp in length
  • additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1 5 kbp
  • DN A from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Moleculai Biology, with the PCR primer pair A positive library was then used to isolate clones
  • PCR primers (forward and reverse) were synthesized forward PCR primer 1
  • RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB 153)
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK
  • DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0362 [herein designated as DNA45416-1251 ] (SEQ ID NO 13) and the derived PR0362 protein sequence (SEQ ID NO 14) The entire nucleotide sequence of DNA45416-1251 is shown in Figure 13 (SEQ ID NO 13) Clone
  • DNA45416-1251 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 1 19-121 and ending at the stop codon at nucleotide positions 1082-1084 (Figure 13)
  • the predicted polypeptide precursor is 321 amino acids long ( Figure 14, SEQ ID NO 14)
  • the full-length PR0362 (UNQ317) protein shown in Figure 14 has an estimated molecular weight of about 35,544 daltons and a pi of about 8 51
  • Analysis of the full-length PR0362 polypeptide as shown in Figure 14 evidences the presence of the following a signal sequence from about amino acid 1 to about amino acid 19, a transmembrane domain from about amino acid 281 to about amino acid 300, a glycosaminoglycan attachment site from about amino acid 149 to about amino acid 153, a cAMP and cGMP-dependent protein kinase phoshorylation site from about amino acid 308 to about ammo acid 312, and N-my ⁇ stoylation sites from
  • EXAMPLE 6 Isolation of cDNA Clones Encoding Human PRQ615
  • the extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases
  • the EST databases included public EST databases (e c , GenBank) and a proprietary EST DNA database (LIFESEQ*, Incyte Pharmaceuticals, Palo Alto C ⁇ )
  • the search was performed using the computei program BLAST or BLAST2 (Altshul et al , Methods in Enzvmology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program 'phrap' (Phil Green, University of Washington,
  • oligonucleotide hybridization probe was constructed from the consensus DNA42240 sequence which had the following nucleotide sequence hybridization probe
  • DNA from the libia ⁇ es was screened by PCR amplification with one of the PCR primer pairs identified above A positive library was then used to isolate clones encoding the PR0615 gene using the probe oligonucleotide and one of the PCR primers RNA for construction of the cDNA libraries was isolated f I om human bone marrow tissue (LIB255)
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl.
  • a suitable cloning vector such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, vee, Holmes et al . Science 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites
  • DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0615 [herein designated as DNA48304-1 23] (SEQ ID NO 15) and the derived PR0615 protein sequence (SEQ ID NO 15)
  • EXAMPLE 7 Isolation of cDNA Clones Encoding PRQ531 An ECD database was searched and an expressed sequence tag (EST) from LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA was identified This EST was identified as fragment number 1810051 which showed homology to protocadhenn 3 Based on this sequence, a search was performed using the computer program BLAST or BLAST2 (Altshul et al , Methods in Enzymology, 266 460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington) A consensus DNA sequence was assembled relative to other EST sequences using repeated cycles of
  • oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0531
  • Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length
  • the piobe sequences are typically 40-55 bp in length
  • additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp
  • DNA from the libraries was screened by PCR amplification, as per Ausubel etal , Current Protocols in Molecular Biology, with the PCR p ⁇ mei pair A positive library was then used to isolate clones encoding the gene ot interest using the probe oligonucleotide and one of the p ⁇
  • a pair of PCR primers (forward and reverse) were synthesized forward PCR primer
  • a synthetic oligonucleotide hybridization probe was constructed from the consensus sequence which had the following nucleotide sequence hybridization probe 5'-TTAGTTGCTCCATTCAGGAGGATCTACCCTTCCTCCTGAAATCCGCGGAA-3' (SEQ ID NO 61 )
  • DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive hbiary was then used to isolate clones encoding the PR0531 gene using the probe oligonucleotide and one of the PCR primers
  • RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB 153)
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA
  • the cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD , pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites
  • DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0531 [herein designated as DNA48314-1320] (SEQ ID NO 17) and the derived PR0531 protein sequence (SEQ ID NO 18)
  • a cadhe ⁇ n extiacellular repeated domain signature is found at about amino acids 122-133, 231 -242, 336-347, 439-450 and 549-560.
  • an ATP/GTP-binding site motif A (P-loop) is found at about amino acids 285-293 of SEQ ID NO 18, N-glycosylation sites are found at least at about amino acids 567-571 , 786-790, 418-422 and 436-440 of SEQ ID NO 18
  • the signal peptide is at about amino acids 1 -26, and the transmembrane domain is at about amino acids 685-712 ot SEQ ID NO 18
  • Alto, CA was searched foi homology to the murine GFR 3 nucleotide sequence and the EST sequence
  • INC3574209 was identified and found to have 61 % sequence identity in the aligned region between the two sequences The following primers were created in order to screen tor the corresponding full length cDNAs newa3 F
  • DNA from the libraries referenced below was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology (1995), with the PCR primer pair A strong PCR product was identified in all libraries analyzed (fetal lung, fetal kidney and placenta)
  • a human fetal lung pRK5 vector library was selected and enriched for positive cDNA clones by extension of single stranded DNA from plasmid libraries grown in dug-/bung- hosts using the newa3 R primer RNA for construction of the cDN A libraries was isolated from human fetal lung tissue
  • the cDNA library used to isolate the cDNA clones was constructed by standard methods using commercially available reagents (e g , Invitrogen, San Diego, CA, Clontech, etc )
  • the cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (pRKB or pRKD, pRK5B is a precursor of p
  • DNA48613-1268 SEQ ID NO 19
  • DNA48614-1268 SEQ ID NO 21
  • Amino acid sequence analysis of DNA48613-1268 revealed a PR0538 polypeptide (SEQ ID NO 20) having a 400 amino acid reading frame sequence with a predicted 26 residue long N-terminal signal peptide
  • the predicted mature protein is 374 amino acids long, with a calculated molecular weight of appioximately 41 kDa
  • EXAMPLE 9 Isolation of cDNA Clones Encoding Human PRQ618
  • the extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases
  • the EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA) The search was pei formed using the computer program BLAST or BLAST2 (Altshul et al .
  • DNA35597 (SEQ ID NO 25) was extended using repeated cycles of BLAST and phrap to extend the sequence as far as possible using Incyte and Genentech proprietary EST sequences The extended assembly sequence was used to generate the consensus nucleotide sequence designated herein as DNA43335, which was used to derive the final full length sequence for DNA49152- 1324 (SEQ ID NO 23)
  • the sequence DNA35597 is an EST proprietary to Genentech Based on DNA35597, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the PR0618 full-length coding sequence
  • Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100- 1000 bp in length
  • the probe sequences are typically 40-55 bp in length
  • additional oligonucleotides are synthesized when the consensus sequence
  • DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above A positive library was then used to isolate full length clones encoding the PR0618 gene using the second probe oligonucleotide and one of the second set of PCR primers RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB229)
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl.
  • a suitable cloning vector such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al Science. 253 1278-1280 (1991 )) in the unique Xhol and Notl sites
  • a secondary cDNA library was generated in order to preferentially represent the 5' ends of the primary cDNA clones
  • Sp6 RNA was generated from the primary library (described above), and this RNA was used to generate a random primed cDNA library in the vector pSST-AMY 0 using reagents and protocols from Life Technologies (Super Script Plasmid System, referenced above)
  • the double stranded cDNA was sized to 500-1000 bp, hnkered with blunt to Notl adaptors cleaved with Sfil, and cloned into Sfil/Notl cleaved vector pSST-AMY 0 is a cloning vector that has a yeast alcohol dehydrogenase promoter preceding the cDNA cloning sites and the mouse amylase sequence (the mature sequence without the secretion signal) followed by the yeast alcohol dehydiogenase terminator, after the cloning sites
  • DNA from the library described in paragraph 2 above was chilled on ice to which was added electrocompetent DH 10B bacteria (Life Technologies, 20 ml) The bacte ⁇ a and vector mixtuie was then electroporated as recommended by the manufacturer Subsequently, SOC media (Life Technologies, I ml) was added and the mixture was incubated at 37 ° C for 30 minutes The ti anstormants were then plated onto 20 standai d 150 mm LB plates containing ampicillin and incubated for 16 hours (37° C) Positive colonies were scraped off the plates and the DNA was isolated from the bacterial pellet using standard protocols, e g , CsCl-gradient The purified DNA was then carried on to the yeast protocols below
  • the yeast methods were divided into three categories ( 1 ) Transformation of yeast with the plasmid/cDNA combined vector, (2) Detection and isolation of yeast clones secreting amylase, and (3) PCR amplification of the insert directly from the yeast colony and purification of the DNA for sequencing and further analysis
  • yeast strain used was HD56-5A (ATCC-90785) This strain has the following genotype MAT alpha, ura3-52, leu2-3, leu2- 1 12, h ⁇ s3-l 1 , h ⁇ s3- 15, MAL + , SUC + , GAL +
  • yeast mutants can be employed which have deficient post translational pathways Such mutants may have translocation deficient alleles in seel 1 , secll, sec ⁇ l, with truncated secl ⁇ being most preferred
  • antagonists including antisense nucleic acids and/or ligands
  • which interfere with the normal operation of these genes, other proteins implicated in this post translation pathway e g , SEC61p, SEC72p, SEC62p, SEC63p, TDJlp or SSAl p-4p
  • the complex formation of these proteins may also be preferably employed in combination with the amylase-expressing yeast
  • the selective media used was a synthetic complete dextrose agar lacking uracil (SCD-Uia) prepared as described in Kaiser et al , Methods in Yeast Genetics Cold Spring Harbor Press, Cold Sp ⁇ ng Harbor, NY, p 208-210 (1994) Transformants were grown at 30 °C for 2-3 da>s
  • the detection of colonies secreting amylase was performed by including red starch in the selective growth media Starch was coupled to the red dye (Reactive Red-120, Sigma) as per the procedure described by Biely et al , Anal Biochem .
  • the coupled starch was incorporated into the SCD Ura agar plates at a final concentration of 0 1 % (w/v), and was buffered with potassium phosphate to a pH of 7 0 (50-100 mM final concentration)
  • the underlined regions ot the oligonucleotides annealed to the ADH promoter legion and the amylase region, respectively, and amplified a 307 bp region from vector pSST-AMY 0 when no insert was present
  • the first 18 nucleotides of the 5 end of these oligonucleotides contained annealing sites lor the sequencing primers, wherein these sequences may differ depending upon the sequencing primers employed
  • the total product ot the PCR reaction from an empty vector was 343 bp
  • signal sequence-tused cDNA resulted in considerably longer nucleotide sequences
  • an aliquot of the reaction (5 ⁇ l) was examined by agarose gel electrophoresis in a 1 % agarose gel using a T ⁇ s-Borate EDTA (TBE) buffering system as described by Sambrook et al , supra Clones resulting in a single strong PCR product largei than 400 bp weie
  • DNA43509 A cDNA sequence isolated in the above screen was found, by BLAST and FastA sequence alignment, to have sequence homology to a nucleotide sequence encoding human A4 protein This isolated cDNA sequence is herein designated DNA43509 Based on the sequence homology, probes were generated from the sequence of the DNA43509 molecule and used to screen a human fetal lung library (LIB25) prepared as described in paragraph 1 above
  • the cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278 1280 (1991 )), and the cDNA size cut was less than 2800 bp
  • a pair of PCR primers (forward and reverse) were synthesized based on the DNA43509 sequence forward PCR primer 5'-CGTTTTGCAGAACCTACTCAGGCAG 3 (SEQ ID NO 73) reverse PCR primer
  • an oligonucleotide hybridization probe was synthesized to confirm the amplification hybridization probe 5'-AAAGTGCTGCTGCTGGGTCTGCAGACGCGATGGATAACGT-3' (SEQ ID NO 75) Using the above described primers and library, a full length clone was identified (DNA49645 1347, Figure
  • SEQ ID NO 26 that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 131-133 and ending at the stop codon found at nucleotide positions 587 589 (see Figure 26)
  • the predicted polypeptide precursor is 152 amino acids long has a calculated molecular weight of approximately 17,170 daltons and an estimated pi of approximately 9 62
  • Analysis of the full-length PR0772 sequence shown in Figure 27 evidences the presence of the following a potential type II transmembrane domain from about amino acid 26 to about ammo acid 42, other potential transmembrane domains from about amino acid 44 to about amino acid 65, fiom about amino acid 81 to about amino acid 101 and from about amino acid 109 to about amino acid 129, leucine zipper pattern sequences from about amino acid 78 to about amino acid 100 and from about amino acid 85 to about amino acid 107 an N-my ⁇ stoylation site from about amino acid 1 10 to about amino acid 1 16, and a ribonucleo
  • EXAMPLE 1 Isolation of cDNA Clones Encoding Human PRO703
  • the extracellular domain (ECD) sequences (including the secretion signal, it any) of from about 950 known secreted proteins from the Swiss Prot public protein database were used to search expressed sequence tag (EST) databases
  • the EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA)
  • the search was performed using the computer program BLAST or BLAST2 ( Altshul et al , Methods in Enzymology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap” (Phil Green, University of Washington, Seattle, Washington) A consensus DNA
  • oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for the PRO703 sequence
  • Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length
  • the probe sequences are typically 40-55 bp in length
  • additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp
  • DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology, with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs
  • Forward and reverse PCR primers were synthesized forward PCR primer 5'-GAGAGCCATGGGGCTCCACCTG-3' (SEQ ID NO 76) reverse PCR primer
  • a synthetic oligonucleotide hybridization probe was constructed having the sequence hybridization probe 5'-CCAGTGCCAGGATACCTCTCTTCCCCCCAGAGCATAACAGACACG-3' (SEQ ID NO 80)
  • SEQ ID NO 80 sequence hybridization probe 5'-CCAGTGCCAGGATACCTCTCTTCCCCCCAGAGCATAACAGACACG-3'
  • RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227)
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commerciall) available reagents such as those from Invitrogen, San Diego CA
  • the cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sf ii site, see Holmes et al , Science. 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites
  • DNA50913-1287 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 1 15-1 17 and ending at the stop codon at nucleotide positions 2305-2307 ( Figure 28, SEQ ID NO 28)
  • the predicted polypeptide precursor is 730 amino acids long ( Figure 29)
  • the full-length PRO703 protein shown in Figure 29 has an estimated molecular weight of about 78,644 daltons and a pi ofabout 7 65
  • Important regions of the amino acid sequence encoded by nucleotides 1 15-2304 of PRO703 include a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 136 to about amino acid 140, a type II transmembrane domain from about amino acid 45 to about amino acid 65, an other transmembrane domain from about amino acid 379 to about amino acid 398, N-glycosylation sites from about amino acid 37 to about ammo acid 41 and from about amino acid 483
  • EXAMPLE 12 Isolation of cDNA Clones Encoding Human PRQ792
  • the extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases
  • the EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA)
  • the search was performed using the computei program BLAST or BLAST2 ( Altshul et al , Methods in Enzymology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle Washington)
  • DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0792 gene using the probe oligonucleotide and one of the PCR primers
  • RNA for construction of the cDNA libraries was isolated from human bone marrow tissue (LIB255)
  • the cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA
  • the cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD , pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-1280 (1991 )) in the unique Xhol and Notl sites
  • DNA sequencing of the clones isolated as described above gave the full-length DNA sequence encoding the native sequence PR0792 [herein designated as DNA56352 1358] (SEQ ID NO 30) and the derived protein sequence for PR0792
  • the extracellular domain (ECD) sequences (including the secretion signal if any) of from about 950 known secreted proteins from the Swiss Prot public protein database were used to search expressed sequence tag (EST) databases
  • the EST databases included public EST databases (e g , GenBank, Merck/Wash U) and a proprietary EST DNA database (LIFESEQ ® , Incyte Pharmaceuticals, Palo Alto, CA)
  • the search was performed using the computer program BLAST or BLAST2 (Altshul et al , Methods in Enzymology, 266 460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap” (Phil Green, University of Washington, Seattle, Washington)
  • DNA49818 An initial consensus DNA sequence was assembled relative to other EST sequences using phrap The initial consensus DNA sequence was then extended using repeated cycles of BLAST and phrap to extend the initial consensus sequence as far as possible using the sources of EST sequences discussed above The extended consensus sequence obtained is herein designated DNA49818
  • an N glycosylation site is at about amino acids 138-141 of SEQ ID NO 33
  • short-chain alcohol dehydrogenase family protein homologies are at about amino acids 10-22, 81 -91 , 134 171 and 176-185 of SEQ ID NO 33
  • the corresponding nucleotides can be routinel) determined given the sequences provided herein
  • PR021 -, PRO 1330-, PRO 1449 PR0237-, PR0324-, PR0351 -, PR0362 , PR0615-, PR0531 -, PR0538 , PR03664-, PR0618-, PR0772 , PRO703 PR0792- and PR0474-encod ⁇ ng genes are amplified in the genome of certain human lung, colon and/or breast cancers and/or cell lines Amplification is associated with overexpression of the gene product, indicating that the pol)pept ⁇ des are useful targets toi therapeutic intervention in certain cancers such as colon, lung, breast and other cancers
  • Therapeutic agents ma) take the form of antagonists of PR0213, PRO1330, PR01449, PR0237 PR0324 PR0351 , PR0362, PR0615 PR0531 , PR0538, PR03664 PR0618, PR0772, PRO703, PR0792 oi PR0474 polypeptide, for example, mu ⁇ ne-human chimeric, humanized or human
  • the starting material for the screen was genomic DNA isolated from a variety cancers
  • the DNA is quantitated precisely, e g , fluoromet ⁇ cally
  • DNA was isolated from the cells often normal healthy individuals which was pooled and used as assay controls for the gene copy in healthy individuals (not shown)
  • the 5' nuclease assay for example, TaqManTM
  • real-time quantitative PCR for example, ABI P ⁇ zm 7700 Sequence Detection SystemTM (Perkin Elmer, Applied Biosystems Division, Foster City, CA)
  • the results were used to determine whether the DNA encoding PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 is over-represented in any of the primary lung or colon cancers or cancer cell lines or breast cancer cell lines that were
  • the results of the TaqmanTM are reported in delta ( ⁇ ) CT units
  • One unit corresponds to 1 PCR cycle or approximately a 2-fold amplification relative to normal, two units corresponds to 4-fold, 3 units to 8-fold amplification and so on Quantitation was obtained using primers and a TaqmanTM fluorescent probe derived from the PR0213-, PRO1330-, PR01449-, PR0237-, PR0324-, PR0351-, PR0362-, PR0615-, PR0531-, PR0538-, PR03664-, PR0618-, PR0772-, PRO703-, PR0792- or PR0474-encodmg gene Regions of PR0213 , PRO 1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 which are most likely to contain unique nucleic acid sequences and which are least likely
  • PR0213, PRO1330 and PR01449 (DNA30943-1163, DNA64907- 1 163 and DNA64908-1 163, respectively)
  • PR0362 (DNA45416-1251 ) 45416 tm f l 5'-TGTGGCACAGACCCAATCCT-3' (SEQ ID NO 102)
  • PR0531 (DNA48314-1320): 48314.tm.fl : 5'-TTCAAGTTCCTGAAGCCGATTAT-3' (SEQ ID NO: 108)
  • PR0538 & PR03664 (DNA48613-1268 & DNA48614-1268):
  • PR0618 (DNA49152-1324): 49152.tm.fl :
  • PRO703 (DNA50913-1287) 50913 tm fl
  • PR0474 (DNA56045-1380) 56045 tm f 1 5' AAACTCCAACCTGTATCAGATGCA 3' (SEQ ID NO 129)
  • the 5 nuclease assay reaction is a fluorescent PCR-based technique which makes use of the 5' exonuclease acti vit) of Taq DNA polymerase enzyme to monitor amplification in real time 1 wo oligonucleotide primers are used to generate an amplicon typical ot a PCR reaction
  • a third oligonucleotide or probe is designed to detect nucleotide sequence located between the two PCR p ⁇ meis
  • the probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent d>e Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe.
  • the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner.
  • the resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore.
  • One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
  • the 5' nuclease procedure is run on a real-time quantitative PCR device such as the ABI Prism 7700TM
  • the system consists of a thermocycler, laser, charge-coupled device (CCD) camera and computer.
  • the system amplifies samples in a 96- well format on a thermocycler.
  • laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD.
  • the system includes software for running the instrument and for analyzing the data.
  • Ct 5' Nuclease assay data are initially expressed as Ct, or the threshold cycle. This is defined as the cycle at which the reporter signal accumulates above the background level of fluorescence.
  • the Ct values are used as quantitative measurement of the relative number of starting copies of a particular target sequence in a nucleic acid sample when comparing cancer DNA results to normal human DNA results.
  • Table 4 describes the stage, T stage and N stage of various primary tumors which were used to screen the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 compounds of the invention.
  • DNA Preparation DNA was prepared from cultured cell lines, primary tumors, and normal human blood The isolation was performed using purification kit buffer set and protease and all from Qiagen according to the manufacturer s instructions and the description below Cell cultuie sis
  • Tumor samples were weighed and placed into 50 ml conical tubes and held on ice Processing was limited to no more than 250 mg tissue per preparation (1 tip/preparation)
  • the protease solution was freshly prepared by diluting into 6 25 ml cold ddH 2 0 to a final concentration of 20 mg/ml and stored at 4°C G2 buffer (20 ml) was prepared by diluting DNAse A to a final concentration of 200 mg/ml (from 100 mg/ml stock)
  • the tumor tissue was homogenated in 19 ml G2 buffer for 60 seconds using the large tip of the polytron in a laminar-flow TC hood in order to avoid inhalation of aerosols, and held at room temperature Between samples, the polytron was cleaned by spinning at 2 x 30 seconds each in 2L ddH 2 0, followed by G2 buffer (50 ml) If tissue was still present on the generator tip, the apparatus was disassembled and cleaned
  • nuclei were suspended into 2 ml Cl buffer (4"C) and 6 ml ddHoO (4"C) Vortexing was repeated until the pellet was white The nuclei were then suspended into the residual buffer using a 200 ⁇ l tip G2 buffer ( 10 ml) was added to the suspended nuclei while gently vortexing, followed by vigorous vortexing for 30 seconds Qiagen protease was added (200 ul) and incubated at 50°C for 60 minutes The incubation and centrifugation were repeated until the lysates were cleai (e g , incubating additional
  • Genomic DNA was equilibrated ( 1 sample per maxi tip preparation) with 10 ml QBT buffer QF elution buffer was equilibrated at 50"C The samples were vortexed for 30 seconds, then loaded onto equilibrated tips and drained by gravity The tips were washed with 2 x 15 ml QC buffer The DNA was eluted into 30 ml silanized, autoclaved 30 ml Corex tubes with 15 ml QF buffer (50"C) Isopropanol ( 10 5 ml) was added to each sample, the tubes covered with parafin and mixed by repeated inversion until the DNA precipitated Samples were pelleted by centrifugation in the SS-34 rotor at 15,000 rpm for 10 minutes at 4"C The pellet location was marked, the supernatant discarded, and 10 ml 70% ethanol (4°C) was added Samples were pelleted again by centrifugation on the SS 34 rotor at 10,000 rpm for 10 minutes at
  • DNA levels in each tube were quantified by standard A 26( / A 2M , spectrophotometry on a 1 20 dilution (5 ⁇ l DNA + 95 ⁇ l ddH,0) using the 0 1 ml quartz cuvettes in the Beckman DU640 spectrophotometer A, 6 ,/A, M) ratios were in the range of 1 8-1 9
  • Each DNA sample was then diluted further to approximately 200 ng/ml in TE (pH 8 5) If the original material was highly concentrated (about 700 ng/ ⁇ l), the material was placed at 50°C for several hours until resuspended
  • Fluoromet ⁇ c DNA quantitation was then performed on the diluted material (20-600 ng/ml) using the manufacturer's guidelines as modified below This was accomplished by allowing a Hoeffer DyNA Quant 200 fluorometer to warm-up for about 15 minutes
  • the Hoechst dye working solution (#H33258, 10 ⁇ l, prepared withm 12 hours of use) was diluted into 100 ml 1 x TNE buffer A 2 ml cuvette was filled with the fluorometer solution, placed into the machine, and the machine was zeroed pGEM 3Zf (+) (2 ⁇ l, lot #360851026) was added to 2 ml ot fluorometer solution and calibrated at 200 units An additional 2 ⁇ l of pGEM 3Zf (4-) DNA was then tested and the reading confirmed at 400 +/- 10 units Each sample was then read at least in triplicate When 3 samples were found to be within 10% of each other, their average was taken and this value was used as the quantification value
  • PR03664, PR0618, PR0772, PRO703, PR0792 oi PR0474 compounds ot the invention were screened in the following primary tumors and the resulting ⁇ Ct values are reported in Table 5 Table 5 ⁇ Ct values in lung and colon primary tumor and cell line models
  • PRQ213, PRO1330 and PRQ1449 (DNA30943-1 163, DNA64909-1 163 and DNA64908-1 163. respectively)
  • PR0237 would be expected to have utility in cancer therapy
  • PRQ351 (DNA40571 1315)
  • Table 5 The ⁇ Ct values for DN A40571 - 1315 in a variety of tumors are reported in Table 5 A ⁇ Ct of > 1 was typically used as the threshold value tor amplification scoring as this represents a doubling of gene cop) Table 5 indicates that significant amplification of nucleic acid encoding PR0351 occu ⁇ ed in primary lung tumors LT9 LT10, LTl 1 , LT13, LT15, LT16, LT17, LT18, LT19 and LT21 Because amplification of DN A40571 1 1 occurs in lung tumoi s, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0351 would be expected to have utility in cancer therapy
  • PRQ362 (DNA45416- 1251 )
  • Table 5 The ⁇ Ct values for DNA48304-1323 in a variety of tumors are reported in Table 5 A ⁇ Ct ot >1 was typically used as the threshold value for amplification scoring, as this represents a doubling of gene copy Table 5 indicates that significant amplification of nucleic acid encoding PR0615 occurred ( 1 ) in primary lung tumors LT3, LT6, LT7, LT9, LTIO, LTl 1 , LT12, LT13, LT15, LT16, LT17, LT19 and LT21 , and (2) in primary colon tumors CT2, CT3, CT10, CT12, CT14, CT15, CT16, CT17, CT4, CT5, CT1 1 and CT18
  • PRO703 (DNA50913-1287)
  • Table 5 indicates that significant amplification of nucleic acid encoding PRO703 occurred (1 ) in primary lung tumors LTla, LT3, LT6, LT7, LTIO, LTl 1 , LTl 2, LT13, LT15, LT16 LT17, LT19 and LT21 , and (2) in primary colon tumors CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CT1 CT4, CT5, CT6, CT7, CT1 1 and CT18 Because amplification of DNA50913-1287 occurs in various tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PRO703 would
  • Table 5 The ⁇ Ct values for DNA56045-1380 in a variety of tumors are reported in Table 5 A ⁇ Ct of >1 was typically used as the threshold value for amplification scoring, as this represents a doubling of gene copy Table 5 indicates that significant amplification of nucleic acid encoding PR0474 occurred (1 ) in primary lung tumors LTla, LT3, LT6, LT7, LT9, LTIO, LT1 1 , LT12, LT13, LT15, LT16, LT17, LT18, LT19 and LT21 , and (2) in primary colon tumors CT2, CT3, CT4, CT5, CT6, CT8, CT10, CT1 1 , CT12, CT14, CT15, CT16, CT17, CT1 and CT18
  • In situ Hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations It may be useful, for example, to identify sites of gene expression, analyze the tissue distribution of transcription, identify and localize viral infection, follow changes in specific mRNA synthesis, and aid in chromosome mapping
  • RNAs 1 0 ⁇ l DNA template (1 ⁇ g) 1 0 ⁇ l H,0
  • the tubes were incubated at 37 °C for one hour A total of 1 0 ⁇ l RQ1 DNase was added, followed by incubation at 37 °C tor 15 minutes A total of 90 ⁇ l TE ( 10 M Tris pH 7 6/1 mM EDTA pH 8 0) was added and the mixture was pipetted onto DE81 paper The remaining solution was loaded in a MICROCON-50 ultrafiltration unit, and spun using program 10 (6 minutes) The filtration unit was inverted over a second tube and spun using program 2 (3 minutes) After the final recovery spin, a total of 100 ⁇ l TE was added, then 1 ⁇ l of the final product was pipetted on DE81 paper and counted in 6 ml of BIOFLUOR IITM The probe was run on a TBE/urea gel A total of 1 -3 ⁇ l of the probe or 5 ⁇ l of RNA Mrk III was added to 3 ⁇ l of
  • the slides were removed from the freezer, placed on aluminum trays, and thawed at room temperature for 5 minutes The trays were placed in a 55 °C incubator for five minutes to reduce condensation The slides were fixed for 10 minutes in 4% paraformaldehyde on ice in the fume hood, and washed in 0 5 x SSC for 5 minutes, at room temperature (25 ml 20 x SSC + 975 ml SQ H 2 0) After deproteination in 0 5 ⁇ g/ml proteinase K for 10 minutes at 37°C (12 5 ⁇ l of 10 mg/ml stock in 250 ml prewarmed RNAse-free RNAse buffer), the sections were washed in 0 5 x SSC for 10 minutes at room temperature The sections were dehydrated in 70%, 95%, and 100% ethanol, 2 minutes each
  • the slides were laid out in a plastic box lined with Box buffer (4 x SSC, 50% formamide) - saturated filter paper
  • the tissue was covered with 50 ⁇ l of hybridization buffer (3 75 g dextran sultate + 6 ml SQ H 2 0), vortexed, and heated in the microwave for 2 minutes with the cap loosened After cooling on ice, 18 75 ml formamide, 3 75 ml 20 x SSC, and 9 ml SQ H 2 0 were added, and the tissue was vortexed well and incubated at 42 °C for 1 -4 hours D Hybiidization
  • PRO703. PRQ792 or PRQ474 as a hybridization probe The following method describes use of a nucleotide sequence encoding a PR0213, PRO 1330, PRO 1449,

Abstract

The invention concerns compositions and methods for the diagnosis and treatment of neoplastic cell growth and proliferation in mammals, including humans. The invention is based upon the identification of genes that are amplified in the genome of tumor cells. Such gene amplification is expected to be associated with the overexpression of the gene product as compared to normal cells of the same tissue type and contribute to tumorigenesis. Accordingly, the proteins encoded by the amplified genes are believed to be useful targets for the diagnosis and/or treatment (including prevention) of certain cancers, and may act as predictors of the prognosis of tumor treatment. The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Description

COMPOSITIONS AND METHODS FOR THE TREATMENT OF TUMOR
Field of the Invention The present invention relates to compositions and methods for the diagnosis and treatment of tumor
Background of the Invention Malignant tumors (cancers) are the second leading cause of death in the United States, after heart disease (Boring et al , CA Cancel J Clin . 43 7 [1993])
Cancer is characterized by an increase in the number of abnormal, or neoplastic cells derived from a normal tissue which proliferate to form a tumor mass, the invasion of adjacent tissues by these neoplastic tumor cells, and the generation of malignant cells which eventually spread via the blood or lymphatic system to regional lymph nodes and to distant sites (metastasis) In a cancerous state, a cell proliferates under conditions in which normal cells would not grow Cancer manifests itself in a wide variety of forms, characterized by different degrees of mvasiveness and aggressiveness Alteration of gene expression is intimately related to the uncontrolled cell growth and de-differentiation which are a common feature of all cancers The genomes of certain well studied tumors have been found to show decreased expression of recessive genes, usually referred to as tumor suppression genes, which would normally function to prevent malignant cell growth, and/or overexpression of certain dominant genes, such as oncogenes, that act to promote malignant giowth Each of these genetic changes appears to be responsible for importing some of the traits that, in aggregate, represent the full neoplastic phenotype (Hunter, Cell 64 1 129 [1991 ] and Bishop Cell. 64 235-248 [19911)
A well known mechanism of gene (e g oncogene) overexpression in cancer cells is gene amplification This is a process where in the chromosome of the ancestral cell multiple copies of a particular gene are produced The process involves unscheduled replication of the region of chromosome comprising the gene, followed by recombination of the replicated segments back into the chromosome (Alitalo et al , Adv Cancer Res , 47 235 281 [1986]) It is believed that the overexpression of the gene parallels gene amplification, ; e is proportionate to the number of copies made
Proto oncogenes that encode growth factors and growth factor receptors have been identified to pla> important roles in the pathogenesis of various human malignancies including breast cancer For example, it has been found that the human ErbB2 gene (erbB2, also known as her2, or c erbB 2), which encodes a 185-kd transmembrane glycoprotein receptor (pi 85HER HER2) related to the epidermal growth factor receptor EGFR), is overexpressed in about 25% to 30% of human breast cancer (Slamon et al . Science 235 177 182 [1987], Slamon et al., Science. 244:707-712 [1989]).
It has been reported that gene amplification of a proto-oncogene is an event typically involved in the more malignant forms of cancer, and could act as a predictor of clinical outcome (Schwab et al., Genes Chromosomes Cancer, : 181-193 [1990] ; Alitalo et al., supra). Thus, erbB2 overexpression is commonly regarded as a predictor of a poor prognosis, especially in patients with primary disease that involves axillary lymph nodes (Slamon et al., [ 1987] and [ 1989] , supra; Ravdin and Chamness, Gene. 159: 19-27 [ 1995] ; and Hynes and Stern, Biochim. Biophys. Acta. 1198: 165-184 [1994]), and has been linked to sensitivity and/or resistance to hormone therapy and chemotherapeutic regimens, including CMF (cyclophosphamide, methotrexate, and fluoruracil) and anthracyclines (Baselga etal., Oncology. 11 (3 Suppl l):43-48 [1997]). However, despite the association oferbBl overexpression with poor prognosis, the odds of HER2-positive patients responding clinically to treatment with taxanes were greater than three times those of HER2-negative patients (Ibid). A recombinant humanized anti-ErbB2 (anti-HER2) monoclonal antibody (a humanized version of the murine anti-ErbB2 antibody 4D5, referred to as rhuMAb HER2 or Herceptin™) has been clinically active in patients with ErbB2-overexpressing metastatic breast cancers that had received extensive prior anticancer therapy. (Baselga et al., J. Clin. Oncol.. 14:737-744 [1996]). In light of the above, there is obvious interest in identifying novel methods and compositions which are useful for diagnosing and treating tumors which are associated with gene amplification.
Summary of the Invention A. Embodiments The present invention concerns compositions and methods for the diagnosis and treatment of neoplastic cell growth and proliferation in mammals, including humans. The present invention is based on the identification of genes that are amplified in the genome of tumor cells. Such gene amplification is expected to be associated with the overexpression of the gene product and contribute to tumorigenesis. Accordingly, the proteins encoded by the amplified genes are believed to be useful targets for the diagnosis and/or treatment (including prevention) of certain cancers, and may act as predictors of the prognosis of tumor treatment.
In one embodiment, the present invention concerns an isolated antibody which binds to a polypeptide designated herein as a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PROόl 5, PR0531. PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 polypeptide. In one aspect, the isolated antibody specifically binds to a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615. PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide. In another aspect, the antibody induces the death of a cell which expresses a PR0213, PRO1330, PR01449, PR0237, PR0324. PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664. PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide. Often, the cell that expresses the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 polypeptide is a tumor cell that overexpresses the polypeptide as compared to a normal cell of the same tissue type. In yet another aspect, the antibody is a monoclonal antibody, which preferably has non-human complementarity determining region (CDR) residues and human framework region (FR) residues. The antibody may be labeled and may be immobilized on a solid support. In yet another aspect, the antibody is an antibody fragment, a single-chain antibody, or a humanized antibody which binds, preferably specifically, to a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
In another embodiment, the invention concerns a composition of matter which comprises an antibody which binds, preferably specifically, to a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in admixture with a pharmaceutically acceptable carrier In one aspect, the composition of matter comprises a therapeutically effective amount of the antibody In another aspect, the composition comprises a further active ingredient, which may, for example, be a further antibody or a cytotoxic or chemotherapeutic agent Preferably, the composition is sterile
In a further embodiment, the invention concerns isolated nucleic acid molecules which encode anti- PR0213, anti PRO1330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or anti- PR0474 antibodies, and vectors and recombinant host cells comprising such nucleic acid molecules In a still further embodiment, the invention concerns a method for producing an antι-PR0213, anti-
PRO1330, antι-PRO1449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody, wherein the method comprises cultuπng a host cell transformed with a nucleic acid molecule which encodes the antibody under conditions sufficient to allow expression of the antibody, and recovering the antibody from the cell culture
The invention further concerns antagonists of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PRO-531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide that inhibit one or more of the biological and/or lmmunological functions or activities of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703 , PR0792 or PR0474 polypeptide
In a further embodiment, the invention concerns an isolated nucleic acid molecule that hybridizes to a nucleic acid molecule encoding a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR061 , PR0531 , PR0538, PR03664, PR0618 PR0772, PRO703, PR0792 or PR0474 polypeptide or the complement thereof The isolated nucleic acid molecule is preferably DNA, and hybridization preferably occurs under stringent hybridization and wash conditions Such nucleic acid molecules can act as antisense molecules of the amplified genes identified herein, which, in turn, can find use in the modulation of the transcription and/or translation of the respective amplified genes, or as antisense primers in amplification reactions Furthermore, such sequences can be used as part of a ribozyme and/or a triple helix sequence which, in turn, may be used in regulation of the amplified genes In another embodiment, the invention provides a method for determining the presence of a PR0213
PRO 1330, PRO 1449, PR0237, PR0324 PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in a sample suspected of containing a PR0213, PRO1 30, PRO 1449, PR0237, PR0324, PR0351 PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703 , PR0792 or PR0474 polypeptide, wherein the method comprises exposing the sample to an antι-PR0213 , antι-PRO1330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, anti- PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody and determining binding of the antibody to a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR03 1 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in the sample In another embodiment, the invention provides a method for determining the presence of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in a cell, wherein the method comprises exposing the cell to an antι-PR0213, antι-PRO1330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, anti- PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody and determining binding of the antibody to the cell
In yet another embodiment, the present invention concerns a method of diagnosing tumor in a mammal, comprising detecting the level of expression of a gene encoding a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher expression level in the test sample as compared to the control sample, is indicative of the presence of tumor m the mammal from which the test tissue cells were obtained
In another embodiment, the present invention concerns a method of diagnosing tumor in a mammal, comprising (a) contacting an antι-PR0213, antι-PRO1330, antι-PR01449, antι-PR0237, antι-PR0324, anti- PR0351, antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between the antι-PR0213, antι-PRO1330, antι-PR01449, anti- PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody and a PR0213. PRO1330 PR01449, PR0237, PR0324 PR0351 , PR0362, PR0615, PR0531. PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 oi PR0474 polypeptide in the test sample, wherein the formation ot a complex is indicative of the presence of a tumor in said mammal The detection may be qualitative or quantitative, and may be performed in comparison with monitoring the complex formation in a control sample ot known normal tissue cells of the same cell type A larger quantity of complexes formed in the test sample indicates the presence of tumor in the mammal from which the test tissue cells were obtained The antibody preieiably cai nes a detectable label Complex formation can be monitored, for example, by light microscopy, flow cytometi) , fluoπmetry, or other techniques known in the art
The test sample is usually obtained from an individual suspected to have neoplastic cell growth or proliferation (e g cancerous cells)
In another embodiment, the present invention concerns a cancer diagnostic kit comprising an antι-PR0213, antι-PRO1330, antι-PR01449, antι-PR0237, antι-PR0324. antι-PR0351 , antι-PR0362, antι-PR0615, anti- PR0531, antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772. antι-PRO703, antι-PR0792 or antι-PR0474 antibody and a carrier (e.g., a buffer) in suitable packaging. The kit preferably contains instructions for using the antibody to detect the presence of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in a sample suspected of containing the same. In yet another embodiment, the invention concerns a method for inhibiting the growth of tumor cells comprising exposing tumor cells which express a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 polypeptide to an effective amount of an agent which inhibits a biological and/or immunological activity and/or the expression of a PR0213, PRO1330, PR01449, PR0237, PR0324. PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, wherein growth of the tumor cells is thereby inhibited. The agent preferably is an anti-PR0213, anti-PRO1330, anti-PR01449, anti-PR0237, anti- PR0324, anti-PR0351, anti-PR0362, anti-PR0615, anti-PR0531 , anti-PR0538, anti-PR03664, anti-PR0618, anti-PR0772, anti-PRO703, anti-PR0792 or anti-PR0474 antibody, a small organic and inorganic molecule, peptide, phosphopeptide, antisense or ribozyme molecule, or a triple helix molecule. In a specific aspect, the agent, e.g., the anti-PR0213, anti-PRO1330, anti-PR01449, anti-PR0237, anti-PR0324, anti-PR0351, anti-PR0362, anti-PR0615, anti-PR0531, anti-PR0538, anti-PR03664, anti-PROόl 8, anti-PR0772, anti-PRO703, anti-PR0792 or anti-PR0474 antibody, induces cell death. In a further aspect, the tumor cells are further exposed to radiation treatment and/or a cytotoxic or chemotherapeutic agent.
In a further embodiment, the invention concerns an article of manufacture, comprising: a container; a label on the container; and a composition comprising an active agent contained within the container; wherein the composition is effective for inhibiting the growth of tumor cells and the label on the container indicates that the composition can be used for treating conditions characterized by overexpression of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PROG 18, PR0772, PRO703, PR0792 or PR0474 polypeptide as compared to a normal cell of the same tissue type. In particular aspects, the active agent in the composition is an agent which inhibits an activity and/or the expression of a PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide. In preferred aspects, the active agent is an anti-PR0213, anti-PRO1330, anti- PR01449, anti-PR0237, anti-PR0324, anti-PR0351 , anti-PR0362, anti-PR0615, anti-PR0531 , anti-PR0538, anti-PR03664, anti-PROόl 8, anti-PR0772, anti-PRO703. anti-PR0792 or anti-PR0474 antibody or an antisense oligonucleotide.
The invention also provides a method for identifying a compound that inhibits an activity of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664. PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, comprising contacting a candidate compound with a PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide under conditions and for a time sufficient to allow these two components to interact and determining whether a biological and/or immunological activity of the PR0213. PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is inhibited. In a specific aspect, either the candidate compound or the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is immobilized on a solid support. In another aspect, the non-immobilized component carries a detectable label. In a preferred aspect, this method comprises the steps of (a) contacting cells and a candidate compound to be screened in the presence of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide under conditions suitable for the induction of a cellular response normally induced by a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and (b) determining the induction of said cellular response to determine if the test compound is an effective antagonist.
In another embodiment, the invention provides a method for identifying a compound that inhibits the expression of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in cells that express the polypeptide, wherein the method comprises contacting the cells with a candidate compound and determining whether the expression of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is inhibited. In a preferred aspect, this method comprises the steps of (a) contacting cells and a candidate compound to be screened under conditions suitable for allowing expression of the PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and (b) determining the inhibition of expression of said polypeptide.
B. Additional Embodiments
In other embodiments of the present invention, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a PR0213. PRO1330, PR01449, PR0237, PR0324, PR0351 ,
PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618. PR0772, PRO703, PR0792 or PR0474 polypeptide.
In one aspect, the isolated nucleic acid molecule comprises a nucleotide sequence having at least about
80% sequence identity, preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to (a) a DNA molecule encoding a PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351. PR0362, PROόl 5, PR0531 , PR0538, PR03664. PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide having a full-length amino acid sequence as disclosed herein, an amino acid sequence lacking the signal peptide as disclosed herein, an extracellular domain of a transmembrane protein, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of the full-length amino acid sequence as disclosed herein, or (b) the complement of the DNA molecule of (a)
In other aspects, the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to (a) a DNA molecule comprising the coding sequence of a full-length PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide cDNA as disclosed herein, the coding sequence of a PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide lacking the signal peptide as disclosed herein, the coding sequence of an extracellular domain of a transmembrane PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, with or without the signal peptide as disclosed herein or the coding sequence of any other specifically defined fragment of the full length amino acid sequence as disclosed herein, or (b) the complement of the DNA molecule of (a)
In a further aspect, the invention concerns an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% sequence identity, preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity vet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 96% sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to (a) a DNA molecule that encodes the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATCC as disclosed herein or (b) the complement of the DNA molecule of (a) Another aspect of the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 polypeptide which is either transmembrane domain-deleted or transmembrane domain-inactivated, or is complementary to such encoding nucleotide sequence, 5 wherein the transmembrane domain(s) of such polypeptide are disclosed herein. Therefore, soluble extracellular domains of the herein described PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptides are contemplated. Another embodiment is directed to fragments of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
10 polypeptide coding sequence, or the complement thereof, that may find use as, for example, hybridization probes, for encoding fragments of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide that may optionally encode a polypeptide comprising a binding site for an anti-PR0213, anti-PRO 1330, anti-PRO 1449, anti-PR0237, anti-PR0324, anti-PR0351, anti-PR0362, anti-PR0615, anti-PR0531 , anti-PR0538, anti-PR03664, anti-PR0618,
15 anti-PR0772, anti-PRO703, anti-PR0792 or anti-PR0474 antibody or as antisense oligonucleotide probes. Such nucleic acid fragments are usually at least about 20 nucleotides in length, preferably at least about 30 nucleotides in length, more preferably at least about 40 nucleotides in length, yet more preferably at least about 50 nucleotides in length, yet more preferably at least about 60 nucleotides in length, yet more preferably at least about 70 nucleotides in length, yet more preferably at least about 80 nucleotides in length, yet more preferably at least about
20 90 nucleotides in length, yet more preferably at least about 100 nucleotides in length, yet more preferably at least about 110 nucleotides in length, yet more preferably at least about 120 nucleotides in length, yet more preferably at least about 130 nucleotides in length, yet more preferably at least about 140 nucleotides in length, yet more preferably at least about 150 nucleotides in length, yet more preferably at least about 160 nucleotides in length, yet more preferably at least about 170 nucleotides in length, yet more preferably at least about 180 nucleotides in length,
25 yet more preferably at least about 190 nucleotides in length, yet more preferably at least about 200 nucleotides in length, yet more preferably at least about 250 nucleotides in length, yet more preferably at least about 300 nucleotides in length, yet more preferably at least about 350 nucleotides in length, yet more preferably at least about 400 nucleotides in length, yet more preferably at least about 450 nucleotides in length, yet more preferably at least about 500 nucleotides in length, yet more preferably at least about 600 nucleotides in length, yet more preferably
30 at least about 700 nucleotides in length, yet more preferably at least about 800 nucleotides in length, yet more preferably at least about 900 nucleotides in length and yet more preferably at least about 1000 nucleotides in length, wherein in this context the term "about" means the referenced nucleotide sequence length plus or minus 10% of that referenced length. It is noted that novel fragments of a PR0213, PRO 1330. PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772. PRO703, PR0792 or PR0474
35 polypeptide-encoding nucleotide sequence may be determined in a routine manner by aligning the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362. PR0615, PR053 I , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well known sequence alignment programs and determining which PR0213, PRO1330, PR01449, PR0237, PR0324. PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PRO6I 8, PR0772, PRO703, PR0792 or PR0474 polypeptide-encoding nucleotide sequence fragment(s) are novel. All of such PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide-encoding nucleotide sequences are contemplated herein. Also contemplated are the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide fragments encoded by these nucleotide molecule fragments, preferably those PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide fragments that comprise a binding site for an anti-PR0213, anti-PRO 1330, anti- PR01449, anti-PR0237, anti-PR0324, anti-PR0351, anti-PR0362, anti-PR0615, anti-PR0531, anti-PR0538, anti-PR03664, anti-PR0618, anti-PR0772, anti-PRO703, anti-PR0792 or anti-PR0474 antibody.
In another embodiment, the invention provides isolated PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide encoded by any of the isolated nucleic acid sequences hereinabove identified. In a certain aspect, the invention concerns an isolated PR0213, PROl 330, PRO 1449, PR0237, PR0324,
PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 81% sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 85% sequence identity, yet more preferably at least about 86% sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 88% sequence identity, yet more preferably at least about 89% sequence identity, yet more preferably at least about 90% sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 92% sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 95% sequence identity, yet more preferably at least about 967c sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 997c sequence identity to a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PR0618, PR0772. PRO703, PR0792 or PR0474 polypeptide having a full-length amino acid sequence as disclosed herein, an amino acid sequence lacking the signal peptide as disclosed herein, an extracellular domain of a transmembrane protein, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of the full-length amino acid sequence as disclosed herein.
In a further aspect, the invention concerns an isolated PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538. PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide comprising an amino acid sequence having at least about 80% sequence identity, preferably at least about 81 % sequence identity, more preferably at least about 82% sequence identity, yet more preferably at least about 83% sequence identity, yet more preferably at least about 84% sequence identity, yet more preferably at least about 857o sequence identity, yet more preferably at least about 867c sequence identity, yet more preferably at least about 87% sequence identity, yet more preferably at least about 887r sequence identity, yet more preferably at least about 897c sequence identity, yet more preferably at least about 907o sequence identity, yet more preferably at least about 91 % sequence identity, yet more preferably at least about 927o sequence identity, yet more preferably at least about 93% sequence identity, yet more preferably at least about 94% sequence identity, yet more preferably at least about 957c sequence identity, yet more preferably at least about 967o sequence identity, yet more preferably at least about 97% sequence identity, yet more preferably at least about 98% sequence identity and yet more preferably at least about 99% sequence identity to an amino acid sequence encoded by any of the human protein cDNAs deposited with the ATCC as disclosed herein
In a further aspect, the invention concerns an isolated PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide comprising an amino acid sequence scoring at least about 807c positives, preferably at least about 81 % positives, more preferably at least about 82% positives, yet more preferably at least about 83% positives, yet more preferably at least about 84% positives, yet more preferably at least about 85% positives, yet more preferably at least about 86% positives, yet more preferably at least about 87% positives, yet more preferably at least about 88% positives, yet more preferably at least about 89% positives, yet more preferably at least about 90% positives, yet more preferably at least about 91 % positives, yet more preferably at least about 92% positives, yet more preferably at least about 93% positives, yet more preferably at least about 94% positives, yet more preferably at least about 95% positives, yet more preferably at least about 96% positives, yet more preferably at least about 97% positives, yet more preferably at least about 987c positives and yet more preferably at least about 997c positives when compared with the amino acid sequence of a PR0213 , PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide having a full-length amino acid sequence as disclosed herein, an amino acid sequence lacking the signal peptide as disclosed herein, an extracellular domain of a transmembrane protein, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of the full-length amino acid sequence as disclosed herein
In a specific aspect, the invention provides an isolated PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide without the N-terminal signal sequence and/or the initiating methionine and is encoded by a nucleotide sequence that encodes such an amino acid sequence as hereinbefore described Processes for producing the same are also herein described, wherein those processes comprise cultuπng a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of thePR0213, PRO1330 PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and recovering the PR0213, PROl 330, PRO 1449, PR0237, PR0324 PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide from the cell culture
Another aspect of the invention provides an isolated PR021 , PRO 1330, PRO 1449 PR0237, PR0324, PR0 1 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide which is eithei transmembrane domain-deleted or transmembrane domain inactivated Processes foi producing the same are also herein described, wherein those processes comprise cultuπng a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 polypeptide and recovering the PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615. PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide from the cell culture In yet another embodiment, the invention concerns antagonists of a native PR0213, PRO 1330, PRO 1449,
PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide as defined herein In a particular embodiment, the antagonist is an antι-PR0213, anti-PRO1330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351, antι-PR0362, antι-PR0615, anti- PR0531, antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody or a small molecule
In a further embodiment, the invention concerns a method of identifying antagonists to a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide which comprise contacting the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide with a candidate molecule and monitoring a biological activity mediated by said PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide Preferably, the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is a native PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
In a still further embodiment, the invention concerns a composition of matter comprising a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, or an antagonist ot a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide as herein described, or an antι-PR0213, antι-PRO1330, antι-PR01449, anti- PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538. antι-PR03664 antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody, in combination with a carπei Optionally, the carrier is a pharmaceutically acceptable carrier
Another embodiment of the present invention is directed to the use ot a PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, or an antagonist thereof as hereinbefore described, or an antι-PR0213, anti- PRO1330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibod} for the preparation of a medicament useful in the treatment of a condition which is responsive to the PR0213, PRO1330, PR01449. PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792or PR0474 polypeptide, an antagonist thereof or an antι-PR0213, anti-PRO 1330, anti- PRO 1449, antι-PR0237, antι-PR0324. antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody
In other embodiments of the piesent invention, the invention provides vectors comprising DNA encoding any of the herein described polypeptides Host cell comprising any such vector are also provided By way of example, the host cells may be CHO cells, E coli, yeast, or Baculovirus infected insect cells A process for producing any of the herein described polypeptides is further provided and comprises cultuπng host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture
In other embodiments, the invention provides chimeric molecules comprising any of the herein described polypeptides fused to a heterologous polypeptide or amino acid sequence Example of such chimeric molecules comprise any of the herein described polypeptides fused to an epitope tag sequence or a Fc region of an immunoglobulin In another embodiment, the invention provides an antibody which specifically binds to any of the above or below described polypeptides Optionally, the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody
In yet other embodiments, the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or as antisense probes, wherein those probes may be derived from any of the above or below described nucleotide sequences
Brief Description of the Figures Figure 1 shows the nucleotide sequence (SEQ ID NO 1 ) of a cDNA containing a nucleotide sequence encoding native sequence PR0237, wherein the nucleotide sequence (SEQ ID NO 1 ) is a clone designated herein as DNA34353-1428 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 2 shows the amino acid sequence (SEQ ID NO 2) of a native sequence PR0237 polypeptide as derived from the coding sequence of SEQ ID NO 1
Figure 3 shows the nucleotide sequence (SEQ ID NO 3) of a cDNA containing a nucleotide sequence encoding native sequence PR0213 wherein the nucleotide sequence (SEQ ID NO 3) is a clone designated herein as DNA30943-1 163 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 4 shows the amino acid sequence (SEQ ID NO 4) of a native sequence PR0213 polypeptide as derived from the coding sequence of SEQ ID NO 3 Figure 5 shows the nucleotide sequence (SEQ ID NO 5) ot a cDNA containing a nucleotide sequence encoding native sequence PROl 330 wherein the nucleotide sequence (SEQ ID NO 5) is a clone designated herein as DNA64907 1 163 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 6 shows the amino acid sequence (SEQ ID NO 6) of a native sequence PROl 330 polypeptide as derived from the coding sequence ot SEQ ID NO 5
Figure 7 shows the nucleotide sequence (SEQ ID NO 7) ot a cDNA containing a nucleotide sequence encoding native sequence PRO 1449, wherein the nucleotide sequence (SEQ ID NO 7) is a clone designated herein as DNA64908-1 163 Also presented in bold font and underlined are the positions ot the respective start and stop codons Figure 8 shows the amino acid sequence (SEQ ID NO 8) of a native sequence PR01449 polypeptide as derived from the coding sequence of SEQ ID NO 7
Figure 9 shows the nucleotide sequence (SEQ ID NO 9) of a cDNA containing a nucleotide sequence encoding native sequence PR0324, wherein the nucleotide sequence (SEQ ID NO 9) is a clone designated herein as DNA36343- 1310 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 10 shows the amino acid sequence (SEQ ID NO 10) of a native sequence PR0324 polypeptide as derived from the coding sequence of SEQ ID NO 9
Figure 1 1 shows the nucleotide sequence (SEQ ID NO 1 1 ) of a cDNA containing a nucleotide sequence encoding native sequence PR0351 , wherein the nucleotide sequence (SEQ ID NO 11 ) is a clone designated herein as DNA40571-1315 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 12 shows the ammo acid sequence (SEQ ID NO 12) of a native sequence PR0351 polypeptide as derived from the coding sequence of SEQ ID NO 1 1 Figure 13 shows the nucleotide sequence (SEQ ID NO 13) of a cDNA containing a nucleotide sequence encoding native sequence PR0362, wherein the nucleotide sequence (SEQ ID NO 13) is a clone designated herein as DNA45416 1251 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 14 shows the amino acid sequence (SEQ ID NO 14) of a native sequence PR0362 polypeptide as derived from the coding sequence of SEQ ID NO 13
Figure 15 shows the nucleotide sequence (SEQ ID NO 15) of a cDNA containing a nucleotide sequence encoding native sequence PR0615, wherein the nucleotide sequence (SEQ ID NO 15) is a clone designated herein as DNA48304-1323 Also presented in bold font and underlined are the positions of the respective start and stop codons Figure 16 shows the amino acid sequence (SEQ ID NO 16) of a native sequence PR0615 polypeptide as derived from the coding sequence of SEQ ID NO 15
Figure 17 shows the nucleotide sequence (SEQ ID NO 17) of a cDNA containing a nucleotide sequence encoding native sequence PR0531 , wherein the nucleotide sequence (SEQ ID NO 17) is a clone designated herein as DNA48 14-1320 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 18 shows the amino acid sequence (SEQ ID NO 18) of a native sequence PR0531 polypeptide as derived from the coding sequence of SEQ ID NO 17
Figure 19 shows the nucleotide sequence (SEQ ID NO 19) of a cDNA containing a nucleotide sequence encoding native sequence PR0538, wherein the nucleotide sequence (SEQ ID NO 19) is a clone designated herein as DNA48613 1268 Also presented in bold font and underlined are the positions ot the respective stait and stop codons
Figure 20 shows the amino acid sequence (SEQ ID NO 20) of a native sequence PR0538 polypeptide as derived fiom the coding sequence of SEQ ID NO 19
Figure 21 shows the nucleotide sequence (SEQ ID NO 21 ) of a cDNA containing a nucleotide sequence encoding native sequence PR03664, wherein the nucleotide sequence (SEQ ID NO 21 ) is a clone designated herein as DNA48614 1268 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 22 shows the amino acid sequence (SEQ ID NO 22) of a native sequence PR03664 polypeptide as derived from the coding sequence of SEQ ID NO 21
Figure 23 shows the nucleotide sequence (SEQ ID NO 23) of a cDNA containing a nucleotide sequence encoding native sequence PR0618, wherein the nucleotide sequence (SEQ ID NO 23) is a clone designated herein as DNA49152- 1324 Also presented in bold font and underlined are the positions of the respective start and stop codons Figure 24 shows the amino acid sequence (SEQ ID NO 24) of a native sequence PR0618 polypeptide as derived from the coding sequence of SEQ ID NO 23
Figure 25 shows an EST sequence designated herein as DNA35597 (SEQ ID NO 25)
Figure 26 shows the nucleotide sequence (SEQ ID NO 26) of a cDNA containing a nucleotide sequence encoding native sequence PR0772, wherein the nucleotide sequence (SEQ ID NO 26) is a clone designated herein as DNA49645 1347 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 27 shows the amino acid sequence (SEQ ID NO 27) of a native sequence PR0772 polypeptide as derived from the coding sequence of SEQ ID NO 26
Figure 28 shows the nucleotide sequence (SEQ ID NO 28) of a cDNA containing a nucleotide sequence encoding native sequence PRO703, wherein the nucleotide sequence (SEQ ID NO 28) is a clone designated herein as DNA50913-1287 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 29 shows the amino acid sequence (SEQ ID NO 29) of a native sequence PRO703 polypeptide as derived from the coding sequence of SEQ ID NO 28 Figure 30 shows the nucleotide sequence (SEQ ID NO 30) of a cDNA containing a nucleotide sequence encoding native sequence PR0792, wherein the nucleotide sequence (SEQ ID NO 30) is a clone designated herein as DNA56352-1358 Also presented in bold font and underlined are the positions of the respective start and stop codons
Figure 31 shows the amino acid sequence (SEQ ID NO 31 ) of a native sequence PR0792 polypeptide as derived from the coding sequence of SEQ ID NO 30
Figure 32 shows the nucleotide sequence (SEQ ID NO 32) of a cDNA containing a nucleotide sequence encoding native sequence PR0474, wherein the nucleotide sequence (SEQ ID NO 32) is a clone designated herein as DNA56045-1380 Also presented in bold font and underlined are the positions ot the respective start and stop codons Figure 33 shows the amino acid sequence (SEQ ID NO 33) of a native sequence PR0474 polypeptide as derived from the coding sequence of SEQ ID NO 32 Detailed Description of the Invention I Definitions
The phrases "gene amplification" and "gene duplication" are used interchangeably and refer to a process by which multiple copies of a gene or gene fragment are formed in a particular cell or cell line The duplicated region (a stretch of amplified DNA) is often referred to as "amphcon " Usually, the amount of the messenger RNA
(mRNA) produced, ( e , the level of gene expression, also increases in the proportion of the number of copies made of the particular gene expressed
"Tumor", as used herein, refers to all neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth Examples of cancer include but are not limited to, carcinoma, lymphoma, blastoma, sarcoma, and leukemia More particular examples of such cancers include breast cancer, prostate cancer, colon cancer, squamous cell cancer, small-cell lung cancer, non-small cell lung cancer, gastrointestinal cancer, pancreatic cancer, ghoblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, hepatoma, colorectal cancer, endometnal carcinoma, salivary gland carcinoma, kidney cancer, liver cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer
"Treatment" is an intervention performed with the intention of preventing the development or altering the pathology of a disorder Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventati ve measures Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented In tumor (e g , cancer) treatment, a therapeutic agent may directly decrease the pathology of tumor cells, or render the tumor cells more susceptible to treatment by other therapeutic agents, e g , radiation and/or chemotherapy
The "pathology" of cancer includes all phenomena that compromise the well-being of the patient This includes, without limitation, abnormal or uncontrollable cell growth, metastasis, interference with the normal functioning of neighboring cells, release of cytokines or other secretory products at abnormal levels, suppression or aggravation of inflammatory or immunological response, etc
"Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cattle, pigs, sheep, etc Preferably, the mammal is human "Carriers" as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed Often the physiologically acceptable carrier is an aqueous pH buffered solution Examples ot physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids, antioxidants including ascorbic acid low molecular weight (less than about 10 residues) polypeptides, proteins, such as serum albumin, gelatin, oi immunoglobulins, hydrophilic polymeis such as polyvinylpyrrohdone, amino acids such as glycine, glutamine, asparagine, argimne oi lysine monosacchaπdes, disacchaπdes, and other caibohydrates including glucose mannose, or dextrms, chelating agents such as EDTA, sugar alcohols such as mannitol or sorbitol, salt-forming counteπons such as sodium, and/or nonionic surfactants such as TWEEN1 , polyethylene glycol (PEG), and PLURONICS™ Administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order
The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells The term is intended to include radioactive isotopes (e g., I131, Il2\ Y9" and Re186), chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or fragments thereof
A "chemotherapeutic agent" is a chemical compound useful in the treatment of cancer Examples of chemotherapeutic agents include adπamycin, doxorubicin, epirubicin, 5-fluorouracιl, cytosine arabinoside ("Ara- C"), cyclophosphamide, thiotepa, busulfan, cytoxin, taxoids, e g , paclitaxel (Taxol, Bπstol-Myers Squibb Oncology, Princeton, NJ), and doxetaxel (Taxotere, Rhone-Poulenc Rorer, Antony, Rnace), toxotere, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, lfosfamide, mitomycin C, mitoxantrone, vincπstine, vinorelbine, carboplatin, teniposide, daunomyc , carminomycin, aminopteπn, dactinomycin, mitomycins, esperamicins (see U S Pat No 4,675,187), 5-FU, 6-thιoguanιne, 6-mercaptopuπne, actinomycin D, VP-16, chlorambucil, melphalan, and other related nitrogen mustards Also included in this definition are hormonal agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapπstone
A "growth inhibitory agent" when used herein refers to a compound or composition which inhibits growth of a cell, especially cancer cell overexpressing any of the genes identified herein, either in vttio or in vivo Thus, the growth inhibitory agent is one which significantly reduces the percentage of cells overexpressing such genes in S phase Examples of growth inhibitory agents include agents that block cell cycle progression (at a place other than S phase), such as agents that induce Gl arrest and M-phase arrest Classical M-phase blockers include the vincas (vincπstine and vinblastine), taxol, and topo II inhibitors such as doxorubicin, epirubicin, daunorubicm, etoposide, and bleomycin Those agents that arrest Gl also spill over into S-phase arrest, for example, DNA alkylating agents such as tamoxifen, prednisone, dacarbazine, mechlorethamine, cisplatin, methotrexate, 5- fluorouracil, and ara-C Further information can be found in The Molecular Basis of Cancer, Mendelsohn and Israel, eds , Chapter 1 , entitled "Cell cycle regulation, oncogens, and antineoplastic drugs" by Murakami etal , (WB Saunders Philadelphia, 1995), especially p 13
"Doxorubicin" is an anthracychne antibiotic The full chemical name of doxorubicin is (8S-cιs)-10-[(3- amιno-2,3,6-tπdeoxy-α-L-lyxo-hexapyranosyl)oxy]-7,8,9,10-tetrahydιo-6,8,l l -tπhydroxy-8-(hydroxyacetyl)-l - methoxy-5 , 12-naphthacenedιone The term "cytokine" is a generic term for proteins released by one cell population which act on anothei cell as intercellular mediators Examples of such cytokines are lymphokines, monokines, and traditional polypeptide hormones Included among the cytokines are growth hormone such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone, parathyroid hormone, thyroxine, insulin, proinsuhn, relaxin, prorelaxin, glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH), hepatic growth factor, fibroblast giowth factor, prolactin, placental lactogen, tumor necrosis factor-α and -β, mulleπan-inhibiting substance, mouse gonadotropin-associated peptide, inhibin, activin, vascular endothehal growth factor, lntegπn thrombopoietin (TPO). nerve growth factors such as NGF-β, platelet- growth factor, transforming growth tactois (TGFs) such as TGF-α and TGF-β, insulin-like growth factor-I and -II, erythropoietin (EPO), osteoinductive factors, interferons such as interferon -a, -β, and -γ, colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF), granulocyte-macrophage-CSF (GM-CSF), and granulocyte-CSF (G- CSF), interleukins (ILs) such as IL-1 , IL- 1 a, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11 , IL-12, a tumor necrosis factor such as TNF-α or TNF-β, and other polypeptide factors including LIF and kit ligand (KL) As used heiein, the term cytokine includes proteins from natural sources or from recombinant cell culture and biologically active equivalents of the native sequence cytokines
The term "prodrug" as used in this application refers to a precursor or derivative form of a pharmaceutically active substance that is less cytotoxic to tumor cells compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form See, e g , Wil an, "Prodrugs in Cancer Chemotherapy", Biochemical Society Transactions. j4 375-382, 615th Meeting, Belfast (1986), and Stella et al , "Prodrugs A Chemical Approach to Targeted Drug Delivery", Directed Drug Delivery, Borchardt et al , (ed ), pp 147-267, Humana Press ( 1985) The prodrugs of this invention include, but are not limited to, phosphate- containing prodrugs, thiophosphate-contaimng prodrugs, sulfate-containing prodrugs, peptide-contaimng prodrugs, D-amino acid-modified prodrugs, glysocylated prodrugs, β-lactam-contaimng prodrugs, optionally substituted phenoxyacetamide-containing prodrugs or optionally substituted phenylacetamide-containing prodrugs, 5- fluorocytosine and other 5-fluorouπdιne prodrugs which can be converted into the more active cytotoxic free drug Examples of cytotoxic drugs that can be deπvatized into a prodrugs form for use in this invention include, but are not limited to, those chemotherapeutic agents described above
An "effective amount" of a polypeptide disclosed herein or an antagonist thereof, in reference to inhibition of neoplastic cell growth, tumor growth or cancer cell growth, is an amount capable of inhibiting, to some extent, the growth of target cells The term includes an amount capable of invoking a growth inhibitory, cytostatic and/or cytotoxic effect and/or apoptosis of the target cells An "effective amount" of a PRO polypeptide antagonist for purposes of inhibiting neoplastic cell growth, tumor growth or cancer cell growth, may be determined empirically and in a routine manner
A "therapeutically effective amount", in reference to the treatment ot tumor, refers to an amount capable of invoking one or more of the following effects ( 1 ) inhibition, to some extent, of tumor growth, including, slowing down and complete growth arrest, (2) reduction in the number of tumor cells, (3) reduction in tumor size, (4) inhibition (( e , reduction, slowing down or complete stopping) of tumor cell infiltration into peripheral organs, (5) inhibition (( e , reduction, slowing down or complete stopping) ot metastasis, (6) enhancement of anti-tumor immune response, which may, but does not have to, result in the regression or rejection of the tumor, and/or (7) relief, to some extent, of one or more symptoms associated w ith the disorder A "therapeutically effective amount" of a PRO polypeptide antagonist for purposes of treatment of tumor may be determined empirically and in a routine mannei
A "growth inhibitory amount" of a PRO antagonist is an amount capable of inhibiting the growth of a cell, especially tumor, e g , cancer cell, either in vitro or in vivo A "growth inhibitory amount" of a PRO antagonist foi purposes of inhibiting neoplastic cell growth may be determined empirically and in a routine mannei
A "cytotoxic amount" of a PRO antagonist is an amount capable of causing the destruction ot a cell, especially tumor, e g , cancer cell, either in vitw oτ in vivo A "cytotoxic amount" of a PRO antagonist for pui poses of inhibiting neoplastic cell growth may be determined empiπcallv and in a routine manner
The terms "PRO polypeptide" and "PRO" as used herein and when immediately followed by a numerical designation refer to various polypeptides, wherein the complete designation (i e , PRO/number) refers to specific polypeptide sequences as described herein The terms "PRO/number polypeptide" and "PRO/number" wherein the term "number" is provided as an actual numerical designation as used herein encompass native sequence polypeptides and polypeptide variants (which are further defined herein) The PRO polypeptides described herein may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods
A "native sequence PRO polypeptide" comprises a polypeptide having the same ammo acid sequence as the corresponding PRO polypeptide derived from nature Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means The term "native sequence PRO polypeptide" specifically encompasses naturally-occurring truncated or secreted forms of the specific PRO polypeptide (e g , an extracellular domain sequence), naturally-occurring variant forms (e g , alternatively spliced forms) and naturally-occurring allelic variants of the polypeptide In various embodiments of the invention, the native sequence PRO polypeptides disclosed herein are mature or full-length native sequence polypeptides comprising the full-length amino acids sequences shown in the accompanying figures Start and stop codons are shown in bold font and underlined in the figures However, while the PRO polypeptide disclosed in the accompanying figures are shown to begin with methionine residues designated herein as amino acid position 1 in the figures, it is conceivable and possible that other methionine residues located either upstream or downstream from the amino acid position 1 in the figures may be employed as the starting amino acid residue for the PRO polypeptides
The PRO polypeptide "extracellular domain" or "ECD" refers to a form of the PRO polypeptide which is essentially free of the transmembrane and cytoplasmic domains Ordinarily, a PRO polypeptide ECD will have less than 1 c of such transmembrane and/or cytoplasmic domains and preferably, will have less than 0 57c of such domains It will be understood that any transmembrane domains identified for the PRO polypeptides of the present invention are identified pursuant to criteria routinely employed in the art for identifying that type of hydrophobic domain The exact boundaries of a transmembrane domain may vary but most likely by no more than about 5 amino acids at either end of the domain as initially identified herein Optionally, therefore, an extracellular domain of a
PRO polypeptide may contain from about 5 or fewer amino acids on either side of the transmembrane domain/extracellular domain boundary as identified in the Examples or specification and such polypeptides, with or without the associated signal peptide, and nucleic acid encoding them, are comtemplated by the present invention
The approximate location of the "signal peptides' of the various PRO polypeptides disclosed herein are shown in the present specification and/or the accompanying figures It is noted, however, that the C-terminal boundary of a signal peptide may vary, but most likely by no more than about 5 amino acids on either side of the signal peptide C-terminal boundary as initially identified herein, wherein the C-terminal boundary of the signal peptide may be identified pursuant to criteria routinely employed in the art for identifying that type ot amino acid sequence element (e g , Nielsen et al , Prot Eng , K) 1 -6 ( 1997) and von Heinie et al , Nucl Acids Res , 14 4683-4690 (1986)) Moreover, it is also recognized that in some cases, cleavage of a signal sequence from a secreted polypeptide is not entirely uniform, resulting in more than one secreted species These mature polypeptides, where the signal peptide is cleaved within no more than about 5 amino acids on either side of the C-terminal boundary of the signal peptide as identified herein, and the polynucleotides encoding them, are contemplated by the present invention "PRO polypeptide variant" means an active PRO polypeptide as defined above or below having at least about 807c amino acid sequence identity with a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other fragment of a full length PRO 5 polypeptide sequence as disclosed herein Such PRO polypeptide variants include, for instance, PRO polypeptides wherein one or more ammo acid residues are added, or deleted, at the N- or C-terminus of the full length native am o acid sequence Ordinarily, a PRO polypeptide variant will have at least about 807o amino acid sequence identity, preferably at least about 81 % amino acid sequence identity, more preferably at least about 827o amino acid sequence identity, more preferably at least about 83% amino acid sequence identity, more preferably at least about
10 84% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably at least about 86% amino acid sequence identity, more preferably at least about 877c amino acid sequence identity, more preferably at least about 887e amino acid sequence identity, more preferably at least about 897c am o acid sequence identity, more preferabl> at least about 90% amino acid sequence identity, more preferably at least about 91 % amino acid sequence identity, more preferably at least about 927c amino acid sequence identity, more
15 preferably at least about 93% amino acid sequence identity, more preferably at least about 94% amino acid sequence identity, more preferably at least about 95 % amino acid sequence identity, more preferably at least about 967c ammo acid sequence identity, more preferably at least about 97% amino acid sequence identity, more preferably at least about 98% amino acid sequence identity and most preferably at least about 997c amino acid sequence identity with a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence lacking
20 the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of a full-length PRO polypeptide sequence as disclosed herein Ordinarily, PRO variant polypeptides are at least about 10 amino acids in length, often at least about 20 amino acids in length, more often at least about 30 amino acids in length, more often at least about 40 amino acids in length, more often at least about 50 amino acids in length, more often at least about 60 amino acids
25 in length, more often at least about 70 amino acids in length more often at least about 80 amino acids in length more often at least about 90 amino acids in length, more often at least about 100 amino acids in length more often at least about 150 amino acids in length, more often at least about 200 amino acids in length, more often at least about 300 amino acids in length, or more
As shown below, Table 1 provides the complete source code for the ALIGN-2 sequence comparison
30 computer program This source code may be routinely compiled tor use on a UNIX operating system to provide the ALIGN-2 sequence comparison computer program
In addition, Tables 2A 2D show hypothetical exemplifications for using the below described method to determine % amino acid sequence identity (Tables 2A-2B) and % nucleic acid sequence ιdentιt\ (Tables 2C 2D) using the ALIGN-2 sequence comparison computer program, wherein "PRO represents the amino acid sequence
35 of a hypothetical PRO polypeptide ot interest "Comparison Protein represents the amino acid sequence of a polypeptide against which the "PRO polypeptide of interest is being compared "PRO-DNA represents a hypothetical PRO-encoding nucleic acid sequence of interest, ' Comparison DNA represents the nucleotide sequence of a nucleic acid molecule against which the "PRO DNA" nucleic acid molecule of interest is being compared, "X", "Y ' and "Z ' each repiesent different hypothetical amino acid residues and "N", L and ' V each represent different hypothetical nucleotides.
Table 1
* C-C increased from 12 to 15
* Z is average of EQ
* B is average of ND
* match with stop is _M; stop-stop = 0; J (joker) match = 0 */
#define _M -8 /* value of a match with a stop */ int day [26] [26] = {
/* A" B C D E F G H I J K L M N O P Q R S T U V W X Y Z*/ t*A*/ 2, 0,-2, 0, 0,-4, 1,-1,-1, 0,-1,-2,-1, 0,_M, 1, 0,-2, 1, 1, 0, 0,-6, 0,-3, 0},
/*B */ 0, 3,-4, 3, 2,-5, 0, 1,-2, 0, 0,-3,-2, 2,_M,-1, 1, 0, 0, 0, 0,-2,-5, 0,-3, 1}, t*C */ -2,-4,15,-5,-5,-4,-3,-3,-2, 0,-5,-6,-5,-4,_M,-3,-5,-4, 0,-2, 0,-2,-8, 0, 0,-5}, t*D*t 0, 3,-5, 4, 3,-6, 1, 1,-2, 0, 0,-4,-3, 2,_M,-1, 2,-1, 0, 0, 0,-2,-7, 0,-4, 2},
/*E*t 0, 2,-5, 3, 4,-5, 0, 1,-2, 0, 0,-3,-2, 1,_M,-1, 2,-1, 0, 0, 0,-2,-7, 0,-4, 3}, /* p */ -4,-5,-4,-6,-5, 9,-5,-2, 1, 0,-5, 2, 0,-4,_M,-5,-5,-4,-3,-3, 0,-1, 0, 0, 7,-5}, t*G*t 1, 0,-3, 1, 0,-5, 5,-2,-3, 0,-2,-4,-3, 0,_M,-l,-l,-3, 1, 0, 0,-1,-7, 0,-5, 0}, t*H*t -1, 1,-3, 1, 1,-2,-2, 6,-2, 0, 0,-2,-2, 2,_M, 0, 3, 2,-1,-1, 0,-2,-3, 0, 0, 2}, -1,-2,-2,-2,-2, 1,-3,-2, 5, 0,-2, 2, 2,-2,_M,-2,-2,-2,-l, 0, 0, 4,-5, 0,-1,-2}, t*J */ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,_M, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, t*K*/ -1, 0,-5, 0, 0,-5,-2, 0,-2, 0, 5,-3, 0, 1,_M,-1, 1, 3, 0, 0, 0,-2,-3, 0,-4, 0},
/*L*/ -2,-3,-6,-4,-3, 2,-4,-2, 2, 0,-3, 6, 4,-3,_M,-3,-2,-3,-3,-l, 0, 2,-2, 0,-1,-2}, t*M*t -1,-2,-5,-3,-2, 0,-3,-2, 2, 0, 0, 4, 6,-2,_M,-2,-l, 0,-2,-1, 0, 2,-4, 0,-2,-1}, t*N*/ 0, 2,-4, 2, 1,-4, 0, 2,-2, 0, 1,-3,-2, 2,_M,-1, 1, 0, 1, 0, 0,-2,-4, 0,-2, 1}, t*o*/ _M, M, M, M, M, M, M, M, M, M, M,_ , M, M, 0, M,_M,_M,_M,_M,_M,_M,_M,_M,Jvf,_M},
/* p */ 1, -1, -3, -1, -1, ,-5, -1, .0, ,-2, , 0, ,-ι. ,-3 rl- ,-ι, , M ,6. .0, , 0, 1,0,0,-1,-6,0,-5,0}, t*Q*t 0, 1, -5, 2, 2, -5, -1, 3, -2, 0, 1, -2, -1, 1, M, 0, 4, 1,-1,-1,0,-2,-5,0,-4, 3}, t*R*t -2, 0, -4, -1, -1, ,-4, ,-3, ,2: rl. , 0, ,3, ,-3, 0, 0, M, 0, 1, 6,0,-1,0,-2,2,0,-4,0}, t*S*/ 1, 0, 0, 0, 0, -3, 1, -1, -1, 0, 0, -3, -2, 1, M, 1, -1, 0,2, 1.0,-1,-2,0,-3,0}, /* Ύ *I 1, 0, -2, 0, 0, -3, 0, -1, 0, 0, 0, -1, -1, o, M, 0, -1, -1, 1, 3,0,0,-5,0,-3,0}, t*U*t 0, 0, 0, 0, 0, 0, 0, 0, o, 0, o, 0, 0, 0," M, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0}, /* v */ 0, -2, -2, -2, -2, ,-ι, ■-1, rl- ,4, ,0, -1: ,2, 2, -2~ M, ,-1, rl, ,-2,-1, 0, 0, 4,-6, 0,-2,-2}, t* w*t -6, -5, -8, -1, rl. , 0, rl.. ,-3. ,-5. , 0. ,-3 ,-2. ,-4. ,-4. , M ,-6 ,-5 ,2,-2,-5,0,-6,17,0,0,-6}, t*x*/ 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, M, 0, 0, 0.0,0, 0,0,0,0,0,0}, j* Y *j •3, -3, 0, -4, -4, ,7, -5, 0, -1, 0, -4, ,-ι, rl. rϊ, M, ,-5. ,-4. ,-4,-3,-3,0,-2, 0,0,10,-4}, t*z*/ 0, 1, -5, 2, 3, -5, 0, 2, -2, 0, 0, -2, -1, 1, M, 0, 3, 0, 0, 0, 0,-2,-6, 0,-4, 4} };
Page 1 of day. h */
^include < stdio h >
#include < ctype h >
#defιne MAXJMP 16 /* max jumps in a diag */
#defιne MAXGAP 24 /* don't continue to penalize gaps larger than this */
#define JMPS 1024 /* max jmps in an path */
#define MX 4 /* save if there's at least MX-1 bases since last jmp */
#define DMAT 3 /* value of matching bases */
#define DMIS 0 /* penalty for mismatched bases */
#define DINSO 8 /* penalty for a gap */
#define DINS1 1 /* penalty per base */
#define PINSO 8 /* penalty for a gap */
#define PINS1 4 /* penalty per residue */ struct jmp { short n[MAXJMP], /* size of jmp (neg for dely) unsigned short x[MAXJMP], /* base no of jmp in seq x *
}. /* limits seq to 2^16 -1 */ struct diag { int score, /* score at last jmp */ long offset, /* offset of prev block */ short ljmp, /* current jmp index */ struct jmp JP /* list of jmps */
}. struct path { int spc, /* number of leading spaces */ short n[JMPS], /* size of jmp (gap) */ int x[JMPS], /* loc of jmp (last elem before gap) */
char *ofιle, /* output file name */ char *namex[2], /* seq names getseqsQ */ char *prog, /* prog name for err msgs */ char *seqx[2], /* seqs getseqs() */ int dmax, /* best diag nw() */ int dmaxO, /* final diag */ int dna, /* set it dna mainQ / int endgaps, /* set if penalizing end gaps */ int gapx, gapy, /* total gaps in seqs */ int lenO, lenl , /* seq lens */ int ngapx, ngapy, /* total size of gaps */ int smax, /* max score nw() */ int *xbm, /* bitmap for matching */ long offset, /* current offset in jmp file */ struct diag *dx, /* holds diagonals */ struct path PPPl, /* holds path for seqs */ char *calloc(), *malloc(), *mdex(), *strcpy(), char *getseq(), *g_calloc(),
Page 1 of nw.h /* Needleman-Wunsch alignment program
*
* usage progs filel file2
* where filel and fιle2 are two dna or two protein sequences
* The sequences can be in upper- or lower-case an may contain ambiguity
* Any lines beginning with ',', '>' or ' < ' are ignored
* Max file length is 65535 (limited by unsigned short x in the jmp struct)
* A sequence with 1/3 or more of its elements ACGTU is assumed to be DNA
* Output is in the file "align out" *
* The program may create a tmp file in /tmp to hold info about traceback
* Original version developed under BSD 4.3 on a vax 8650 */
^include "nw h" ^include "day h" static _dbval[26] = { 1,14,2,13,0,0,4,11,0,0,12,0,3,15,0,0,0,5,6,8,8,7,9,0,10,0
}; static jpbval[26] = {
1,2|(1<<('D'-'A'))|(1<<('N'-'A')), 4, 8, 16,32,64,
128, 256, OxFFFFFFF, 1< < 10, 1< < 11, 1< < 12, 1< < 13, 1< < 14,
1< < 15, 1< < 16, 1< < 17, 1< < 18, 1< < 19, 1< <20, 1< <21, 1< <22,
1<<23, 1<<24, 1<<25|(1<<('E'-'A'))|(1<<('Q'-'A'))
Figure imgf000025_0001
int ac, char *av[],
{ prog = ■ av[0], if (ac ' = 3){ fpπntf(stderr. usage %s filel file2\n", prog), fpπntf(stderr where filel and file2 are two dna or two protein sequences \n '), fprmtf(stderr,"The sequences can be in upper- or lower-case\n"), fpπntt(stderr,"Any lines beginning with ',' or ' < ' are ιgnored\n ), fpπntf(stderr, "Output is in the file V'ahgn out\"\n' ), exιt(l),
} namex[0] = av[l], namex[l] = av[2], seqx[0] = getseq(namex[0] , &len0), seqx[l] = getseq(namex[l], &lenl), xbm = (dna)'? dbval _pbval , endgaps = 0, /* 1 to penalize endgaps */ ofile = ' align out" /* output file */ nw(), / fill in the matrix, get the possible jmps readjmpsO, / get the actual jmps */ pπnt(), /: print stats, alignment */ cleanup(O), /* unlink any tmp files */
Page 1 of nw.c /* do the alignment, return best score: maιn()
* dna: values in Fitch and Smith, PNAS, 80, 1382-1386, 1983
* pro: PAM 250 values
* When scores are equal, we prefer mismatches to any gap, prefer
* a new gap to extending an ongoing gap, and prefer a gap in seqx
Figure imgf000026_0001
nw() n { char *px, *py; /* seqs and ptrs */ int *ndely, *dely; /* keep track of dely */ int ndelx, delx; /* keep track of delx */ int *tmp; /* for swapping rowO, rowl */ int mis, /* score for each type */ int insO, msl , /* insertion penalties */ register id; /* diagonal index */ register ij; /* jmp index */ register *col0, *coll, /* score for curr, last row */ register xx, yy; /* index into seqs */ dx = (struct diag *)g_calloc("to get diags", lenO+lenl + 1, sizeof(struct diag)); ndely = (int *)g_calloc("to get ndely", lenl + 1 , sizeof(int)), dely = (int *)g_calloc("to get dely", lenl + 1, sizeof(int)); colO = (int *)g_calloc("to get colO", lenl + 1 , sizeof(int)); coll = (int *)g_calloc("to get coll ", lenl + 1, sizeof(int)); insO = (dna)? DINSO : PINSO; msl = (dna)? DINS 1 : PINS1, smax = -10000, if (endgaps) { for (col0[0] = dely[0] = -insO, yy = 1 ; yy < = lenl , yy + +) { col0[yy] = dely[yy] = col0[yy-l] - msl , ndely [yy] = yy,
} col0[0] = 0, /* Waterman Bull Math Biol 84 */
} else for (yy = 1; yy < = lenl, yy + +)
Figure imgf000026_0002
/* fill in match matrix */ for (px = seqx[0], xx = 1; xx < = lenO; px + + , xx+ +) { /* initialize first entry in col
*/ if (endgaps) { if (xx = 1) col l[0] = delx = -(ιns0 + ιnsl), else col l [0] delx = col0[0] - msl ndelx = xx,
} else { coll[0] = 0, delx = -insO, ndelx = 0,
Page 2 of nw.c ...n for (py = seqx[l], yy = 1; yy < = lenl, py+ +, yy+ +) { mis = col0[yy-l], if (dna) mis + = (xbm[*px-'A']&xbm[*py-'A']y> DMAT : DMIS; else mis + = _day[*px-'A'][*py-'A'];
/* update penalty for del in x seq,
* favor new del over ongong del
* ignore MAXGAP if weighting endgaps */ if (endgaps | | ndely[yy] < MAXGAP) { if (col0[yy] - insO > = dely[yy]) { dely[yy] = colOfyy] - (msO + insl); ndely [yy] = 1 ; } else { dely[yy] - = msl; ndely [yy] + + ; }
} else { if (colO[yy] - (msO + insl) > = dely[yy]) { delyfyy] = col0[yy] - (msO + insl), ndely [yy] = 1 ,
} else ndely[yy] + + ,
/* update penalty for del in y seq, * favor new del over ongong del
*l if (endgaps | | ndelx < MAXGAP) { if (coll [yy-l] - msO > = delx) { delx = col l [yy-l] - (msO + insl), ndelx = 1 , } else { delx -= msl , ndelx+ + , }
} else { if (coll [yy-l] - (msO + msl) > = delx) { delx = coll[yy-l] - (msO + insl), ndelx = 1 ,
} else ndelx+ + ;
}
/* pick the maximum score; we're favoring * mis over any del and delx over del}
*/
Page 3 of nw.c ...nw id = xx yy + lenl - 1, if (mis > = delx && mis > = dely[yy])
Figure imgf000028_0001
else if (delx > = dely[yy]) { coll [yy] = delx, ij = dx[ιd] ymp, if (dx[ιd] jp n[0] && ('dna | | (ndelx > = MAXJMP <fc& xx > dx[ιd] jp x[ιj] +MX) | | mis > dx[ιd] score + DINSO)) {
Figure imgf000028_0002
if (+ + ιj > = MAXJMP) { wπtejmps(ιd), ij = dx[ιd] ljmp = 0, dx[ιd] offset = offset, offset + = sizeof (struct jmp) + sιzeof(offset),
} } dx[ιd] jp n[ιj] = ndelx, dx[ιd] jp x[ιj] = xx, dx[ιd] score = delx,
} else { coll jyy] = dely[yy], IJ = dx[ιd] ymp, if (dx[ιd] jp n[0] && ('dna | | (ndely[yy] > = MAXJMP
&& xx > dx[ιd] jp x[ιj] +MX) | | mis > dx[ιd] score+DINSO)) { dx[ιd] ιjmp+ + , if (+ +ιj > = MAXJMP) { wπtejmps(ιd), ij = dx[ιd] ljmp = 0, dx[ιd] offset = offset, offset + = sizeof(struct jmp) + sizeof (offset),
} } dx[ιd] jp n[ιj] = -ndely[yy] dx[ιd] jp x[y] = xx, dx[ιd] score = dely[yy],
} if (xx = = lenO && yy < lenl) { /* last col */ if (endgaps) collfyy] = ιns0 + msl *(lenl-yy), if (col 1 [yy] > smax) { smax = coll[yy], dmax = id, } } } if (endgaps && xx < lenO) coll [yy 1] = ιns0 + msl*(len0 xx) if (coll [y 1] > smax) { smax = coll [yy 1] , dmax = id,
} tmp = colO, colO = col l coll = tmp,
}
(void) free((char *)ndely), (void) free((char *)dely), (void) free((char *)col0), (void) free((char *)coll)
Page 4 of nw.c /* *
* pπntO - only routine visible outside this module
*
* static
* getmatO — trace back best path, count matches pπnt()
* pr_ahgn() - print alignment of described in array p[] pπnt()
* dumpblock() — dump a block of lines with numbers, stars pr_ahgn()
* nums() - put out a number line dumpblockO
* putlmeO — put out a line (name, [num], seq, [num]) dumpblockO
* stars() -put a line of stars dumpblockO
* stπpnameO — strip any path and prefix from a seqname */
^include ' nw h"
^define SPC 3
#define P LINE 256 /* maximum output line */
#define P SPC 3 /* space between name or num and seq */ extern day [26] [26], int olen, /* set output line length */
FILE *fx, /* output file */ pπnto print
{ int lx, ly, firstgap, lastgap, /* overlap */ if ((fx = fopen(ofιle, ' w")) = = 0) { fpπntf(stderr, " %s can't write %s\n' , prog, ofile), cleanup(l),
} fpπntf(fx, < first sequence %s (length = %d)\n' , namex[0], lenO), fpπntf(f\, < second sequence %s (length = %d)\n , namex[l], lenl),
Figure imgf000029_0001
lx = lenO, ly = lenl , firstgap = lastgap = 0, if (dmax < lenl 1) { /* leading gap in x */ pp[0] spc = firstgap = lenl - dmax - 1 ,
1> - = pp[0] spc,
} else if (dmax > lenl 1) { /* leading gap in y */ pp[l] spc = firstgap = dmax - (lenl - 1), lx - = pp[l] spc,
} if (dmaxO < lenO - 1) { /* trailing gap in x */ lastgap = lenO - dmaxO 1 , lx -= lastgap,
} else if (dmaxO > lenO 1) { /* trailing gap in y */ lastgap = dmaxO (lenO 1), ly - = lastgap,
} getmat(lx, ly, firstgap, lastgap), pr_ahgn(),
Page 1 of nwpπnt.c * trace back the best path, count matches
*/ static getmat(lx, ly, firstgap, lastgap) getmat int lx, ly, / /* "core" (minus endgaps) */ int firstgap, lastgap, / /* leading trailing overlap */ int nm, lO, ii, sizO, siz char outx[32], double pet, register nO, nl , register char *pO, *pl ,
/* get total matches, score */
Figure imgf000030_0001
pO = seqx[0] + pp[l] spc, pi = seqx[l] + pp[0] spc, nO = pp[l] spc + 1 , nl = pp[0] spc + 1 , nm = 0, while ( *p0 &<fe *ρl ) {
Figure imgf000030_0002
if (xbm[*pO-'A']&xbm[*pl-'A']) nm + + , if (nO+ + = = pp[0] x[ιO]) sizO = pp[0] n[ιO+ +],
Figure imgf000030_0003
}
/* pet homology
* if penalizing endgaps, base is the shorter seq
* else, knock off overhangs and take shorter core */ if (endgaps) lx = (lenO < lenl) lenO lenl , else lx = (lx < ly)'' lx ly, pet = 100 *(double)nm/(double)lx, tpπntf(tx, "\n' ), fpπntf(fx, ' < %d match%s in an overlap of %d % 2f percent sιmιlaπtγ\n nm, (nm = = l)7 " " ' es' , lx, pet),
Page2ofnwprmt.c fpπntf(fx, " < gaps in first sequence %d' , gapx), .getmat if (gapx) {
(void) spπntf(outx, " (%d %s%s)", ngapx, (dna) "base" "residue" , (ngapx = = I)7 "s"), fpπntf(fx, " %s", outx), fpπntf(fx, ", gaps in second sequence %d", gapy), if (gapy) {
(void) spπntf(outx, " (%d %s%s)", ngapy, (dna)9 "base" "residue", (ngapy I)9 "s"), fpπntf(fx, " %s", outx),
} if (dna) fpπntf(fx,
"\n < score %d (match = %d, mismatch = %d, gap penalty = %d + %d per base)\n", smax, DMAT, DMIS, DINSO, DINS1), else fpπntf(fx,
"\n< score %d (Dayhoff PAM 250 matrix, gap penalty %d + %d per resιdue)\n" , smax, PINSO, PINS1), if (endgaps) fpπntf(fx,
" < endgaps penalized left endgap %d %s s, right endgap %d %s%s\n", firstgap, (dna)9 "base" "residue", (firstgap = = l)9 " " "s", lastgap, (dna)9 "base" "residue", (lastgap = = l)9 '" "s"), else fpπntf(fx, " < endgaps not penalιzed\n"),
static nm, /* matches in core - for checking */ static lmax, /* lengths of stripped file names */ static ιj[2], /* jmp index for a path */ static nc[2] , /* number at start of current line */ static m[2] , /* current elem number — for gapping */ static sιz[2], static char *ps[2], /* ptr to current element */ static char *po[2], /* ptr to next output char slot */ static char out[2][P LINE] /* output line */ static char star[P LINE], /* set by starsQ */
/*
* print alignment of described in struct path pp[]
*/ static pr ahgn() pr align
{ int nn, /* char count */ int more, register 1 , for (1 = 0 lmax = 0, l < 2, ι + +) { nn = stπpname(namex[ι]), if (nn > lmax) lmax = nn, nc[ι] = 1 , m[ι] = 1 , sιz[ι] = lj[l] = 0, ps[ι] = seqxfi], po[ι] = OUt[l]
Page 3 of nwprmt.c for (nn = nm = 0, more = 1 , more, ) { ...pr align for (I = more = 0, l < 2, ι+ +) { /*
* do we have more of this sequence7 */ if (' *ps[ι]) continue, more+ + , if (pp[ι] spc) { /* leading space */ *po[ι] + + = ' ', pp[ι] spc-,
} else if (sιz[ι]) { /* in a gap */
*po[ι] + + = '- , sιz[ι]- ,
} else { /* we're putting a seq element
*/ *po[ι] = *ps[ι], if (ιslower(*ps[ι]))
*ps[ι] = toupper(*ps[ι]), po[ι] + + , ps[ι] + + ,
/*
* are we at next gap for this seq9
*/ if (m[ι] = = pp[ι] x[ιj [ι]]) { /*
* we need to merge all gaps
* at this location */ sιz[ι] = pp[ι] n[ιj[ι] + +] , while (m[ι] = = p?[ι] x[ιj[ι]]) sιz[ιl + = pp[ι] n[ιj[ι] + +]
} m[ι] + + ,
}
} if (+ +nn = = olen | | 'more && nn) { dumpblockO, for (l = 0, l < 2, ι+ +) po[ι] = out[ι], nn = 0, }
* dump a block of lines, including numbers, stars pr_ahgn() */ static dumpblockO dumpblock
{ register I, for (I = 0, l < 2, ι + +) *po[ι] = '\0 ,
Page4ofnwpπnt.c ..dumpblock
(void) putc('\n', fx); for(ι = 0; l < 2; ι + +) { if (*out[ι] && (*out[ι] != ' ' I I *(po[ι]) '= ' ')){ if(ι ==0) nums(ι); if 0 == 0&&*out[l]) stars(); puthne(ι), if = = 0 && *out[l]) fpπntf(fx, star); if(ι == 1) nums(ι);
}
}
/*
* put out a number line: dumpblockO */ static nums(ιx) nums int lx, /* index in out[] holding seq line */
{ char nhne[P_LINE]; register I, j, register char *pn, *px, *py, for (pn = nhne, l = 0; l < lmax + P SPC; ι+ + , pn++)
*pn = ' '; for (I = nc[ιx], py = outfix]; *py; py + +, pn+ +) { if (*py == ' ' I I *py == '-')
*pn else { if(ι%10 == 0 || (l == 1 &&nc[ιx] '= 1)) { j = (K 0)9 -i : i; for (px = pn; j; j /= 10, px— )
*px =j%10 + '0', if 0 < 0)
*px = '-';
} else
*pn ι+ + ,
}
}
*pn = '\0', nc[ιx] = l, for (pn = nhne; *pn; pn+ +) (void) putc^pn, tx), (void) putc('\n', fx);
* put out a line (name, [num], seq, [num]) dumpblockO
* static puthne(ιx) putline
Figure imgf000033_0001
Page5ofnwprint.c ...putline int register char px. for (px = namexfix], 1 = 0, *px && *px px+ + , 1++)
(void) putc(*px, fx); for (, i < lmax + P SPC, ι++)
(void) putcO ', fx),
/* these count from 1
* m[] is current element (from 1)
* nc[] is number at start of current line */ for (px = out[ιx], *px; px+ +)
(void) putc(*px&0x7F, fx), (void) putc('\n', fx),
* put a line of stars (seqs always in out[0], out[l]). dumpblockO
*/ static stars() stars { int register char *p0, *pl, ex, *px, if C*out[0] I I (*out[0] == ' && *(po[0]) == ' ') I I '*out[l] I I (*out[l] == ' '&& *(po[l]) == ' ')) return, px = star, for (I = lmax+P SPC, l, ι~)
*px+ + = ' ', for(p0 = outfO], pi = out[l], *p0 && *pl, p0+ + , pl + +){ if (ιsalpha(*pO) && ιsalpha(*pl)) { if (xbm[*pO-'A']&xbm[*pl -'A']){ ex = '* , nm + + ,
} else if ('dna && _day[*p0- 'A'][*pl- A'] > 0) cx = ' ', else ex = ' ',
} else ex = ',
*p\+ + = ex, px+ + = '\n , px = ' '\0 ,
Pageόofnwprint.c I*
* strip path or prefix from pn, return len: pr_align()
*/ static stripname(pn) Stripname char *pn; /* file name (may be path) */
{ register char *px, *py;
Py = 0; for (px = pn; *px; px+ +) if (*px = = V) py = px + 1; if (py)
(void) strcpy(pn, py); return(strlen(pn));
Page 7 ofnwprint.c I*
* cleanupO — cleanup any tmp file
* getseqO — read in seq, set dna, len, maxlen
* g_calloc() — calloc() with error checkin
* readjmpsO — get the good jmps, from tmp file if necessary
* wntejmpsO — write a filled array of jmps to a tmp file: nw() */
#include "nw.h" #include < sys/file.h > char *jname = "/tmp/homgXXXXXX"; /* tmp file for jmps */
FILE *fj; int cleanupO; /* cleanup tmp file */ long lseek();
/*
* remove any tmp file if we blow
*/ cleanupO) cleanup int { if (fj)
(void) unlιnk(jname); exιt(ι);
/*
* read, return ptr to seq, set dna, len, maxlen
* skip lines starting with ' ; ' , ' < ' , or ' > '
* seq in upper or lower case */ char * getseq(file, len) getseq char *file; /* file name */ int *len; /* seq len */ char hne[1024], *pseq; register char *px, *py; int natgc, tlen;
FILE *fp; if ((fp = fopen(file, "r")) = = 0) { fpπntf(stderr, " %s: can't read %s\n", prog, file); exιt(l);
} tlen = natgc = 0; while (fgets(hne, 1024, fp)) { if (*hne = = ' ; ' | | *lιne = = ' < ' | | *hne = = ' > ') continue; for (px = line; *px ! = '\n' ; px + +) if (ιsupper(*px) | | ιslower(*px)) tlen+ + ;
} if ((pseq = malloc((unsigned)(tlen+6))) = = 0) { tpπntf(stderr, " %s: malloc() failed to get %d bytes for %s\n", prog, tlen+6. file), exιt(l);
} pseq[0] = pseq[l] = pseq [2] = pseq [3] = '\0';
Page 1 of nwsubr.c ...getseq py = pseq + 4; *len = tlen; rewιnd(fp); while (fgets(hne, 1024, fp)) { if Online = = ';' 1 1 *hne = = ' < ' 1 1 *hne = = ' > ') continue, for (px = line; *px ! = '\n' ; px+ +) { if (ιsupper(*px))
*py+ + = *px; else if (ιslower(*px))
*py+ + = toupper(*px); if (ιndex("ATGCU",*(py-l))) natgc+ + ; } }
*py + + = '\0' ; *py = '\0' ; (void) fclose(fp); dna = natgc > (tlen/3); return(pseq+4),
} char * g_calloc(msg, nx, sz) g_callθC char *msg; /* program, calling routine */ int nx, sz; /* number and size of elements */
{ char *px, *calloc(); if ((px = calloc((unsigned)nx, (unsigned)sz)) = = 0) { if (*msg) { fpπntf(stderr, " %s: g_calloc() failed %s (n= %d, sz= %d)\n", prog, msg, nx, sz); exιt(l), } } return (px),
}
/* * get final jmps from dx[] or tmp file, set pp[], reset dmax mam()
*/ readjmpsO readjmps
{ int fd = -1 , int siz, lO, ii; register l, j, xx, if (fj) {
(void) fclose(fj), if ((fd = open(jname, 0_RDONLY, 0)) < 0) { tpπntf(stderr, " %s- can't open() %s\n" , prog, jname), cleanup(l), } } for (I = IO = ii = 0, dmaxO = dmax, xx = lenO, , ι + +) { while (1) { for (j = dx[dmax] ijmp, j > = 0 && dx[dmax].]p.x[jl > = xx; j~)
Page 2 ofnwsubr.c ...readjmps if 0 < 0 && dx[dmax]. offset && fj) {
(void) lseek(fd, dx[dmax]. offset, 0);
(void) read(fd, (char *)&dx[dmax].jp, sizeof(struct jmp)),
(void) read(fd, (char *)&dx[dmax]. offset, sizeof (dx [dmax] . offset)), dx[dmax] .ιjmp = MAXJMP-1 ,
} else break;
} if (l > = JMPS) { fpπntf(stderr, " %s: too many gaps in alιgnment\n", prog); cleanup(l); } if 0 > = 0) { siz = dx[dmax].jp.nfj], xx = dx[dmax].jp.x[j];
Figure imgf000038_0001
if (siz < 0) { /* gap in second seq */
Figure imgf000038_0002
/* id = xx - yy + lenl - 1 */ pp[l].x[ιl] = xx - dmax + lenl - 1 , gapy + + , ngapy -= siz; /* ignore MAXGAP when doing endgaps */ siz = (-siz < MAXGAP | | endgaps)9 -siz : MAXGAP; ιl + + ;
} else if (siz > 0) { /* gap in first seq */
Figure imgf000038_0003
gapx + + ; ngapx + = siz, /* ignore MAXGAP when doing endgaps */ siz = (siz < MAXGAP | | endgaps) ' siz MAXGAP, ι0+ + ; } } else break; }
/* reverse the order of jmps */ for 0 = 0, ι0~; j < lO, j + + , ι0~) { i = pp[0].n[)], pp[0].n[]] = pp[0].n[ι0]; pp[0].n[ι0] = i, i = pp[0J xbl; pp[0] xϋ] = pp[0] x[ι0j; pp[0] x[.0] = i, } for = 0, ii— ; j < ιl , j + + , ιl~) { i = pp[l] .n[)], pp[ll n[)] = pp[l] .n[. l]; pp[l ] n[ι l ] = ., i = pp[l] x[j], pp[l] λ|j] = pp[l] x[ιl]; pp[l].x[ι l] = i,
} if (fd > = 0)
(void) close(fd); if (fj) {
(void) unhnk(jname), fj = 0, offset = 0, }
Page 3 of nwsubr.c /* * write a filled jmp struct offset of the prev one (if any): nw()
*/ wπtejmps(ιχ) writejmps int lx;
{ char *mktemp(); if (!fj) { if (mktemp(jname) < 0) { fpπntf(stderr, " %s: can't mktempO %s\n", prog, jname); cleanup(l);
} if ((fj = fopen(jname, "w")) = = 0) { fpπntf(stderr, " %s: can't write %s\n", prog, jname), exιt(l), } }
(void) fwπte((char *)&dx[ιx].jp, sizeof (struct jmp), 1, fj), (void) fwπte((char *)&dx[ιx]. offset, sizeof(dx[ιx]. offset), 1, fj),
Page 4 ofnwsubr.c Table 2A
PRO XXXXXXXXXXXXXXX (Length = 15 amino acids)
Comparison Protein XXXXXYYYYYYY (Length = 12 ammo acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two polypeptide sequences as determined by ALIGN-2) divided by (the total number of ammo acid residues of the PRO polypeptide) =
5 divided by 15 = 33.3 %
Table 2B
PRO XXXXXXXXXX (Length = 10 ammo acids)
Comparison Protein XXXXXYYYYYYZZYZ (Length = 15 ammo acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two polypeptide sequences as determined by ALIGN-2) divided by (the total number of ammo acid residues of the PRO polypeptide) =
5 divided by 10 = 50%
Table 2C
PRO-DNA NNNNNNNNNNNNNN (Length = 14 nucleotides)
Comparison DNA NNNNNNLLLLLLLLLL (Length = 16 nucleotides)
% nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid sequences as determined by ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic acid sequence) =
6 divided by 14 = 42.9%
Table 2D
PRO-DNA NNNNNNNNNNNN (Length = 12 nucleotides)
Comparison DNA NNNNLLLVV (Length = 9 nucleotides)
% nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid sequences as determined by ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic acid sequence) =
4 divided by 12 = 33.3%
' Percent (%) amino acid sequence identity' with respect to the PRO polypeptide sequences identified herein is defined as the percentage of ammo acid residues in a candidate sequence that are identical with the amino acid residues in a PRO sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Mega gn (DNASTAR) software Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared For purposes herein, however, % amino acid sequence identity values are obtained as described below by using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1 The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc , and the source code shown in Table 1 has been filed with user documentation in the U S Copyright Office, Washington D C , 20559, where it is registered under U S Copyright Registration No TXU510087 The ALIGN-2 program is publicly available through Genentech, Inc , South San Francisco, California or may be compiled from the source code provided in Table 1 The ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4 0D All sequence comparison parameters are set by the ALIGN-2 program and do not vary
For purposes herein, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows
100 times the fraction X/Y
where X is the number of ammo acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total numbei ot ammo acid residues in B It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A As examples of % amino acid sequence identity calculations, Tables 2A-2B demonstrate how to calculate the % amino acid sequence identity of the amino acid sequence designated "Comparison Protein to the amino acid sequence designated "PRO Unless specifically stated otheiwise, all % amino acid sequence identity values used herein aie obtained as described above using the ALIGN-2 sequence comparison computer program However, % amino acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al , Nucleic Acids Res , 25 3389-3402 (1997)) The NCBI-BLAST2 sequence comparison program may be downloaded from http //www ncbi nlm mh gov NCBI-BLAST2 uses several search parameters, wherein all ot those search parameters are set to default values including, for example, unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0 01 , constant for multi-pass = 25 dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62
In situations where NCBI-BLAST2 is employed for amino acid sequence comparisons, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by the sequence alignment program NCBI-BLAST2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A
In addition, % amino acid sequence identity may also be determined using the WU-BLAST-2 computer program (Altschul et al , Methods in Enzvmology, 266 460-480 (1996)) Most of the WU-BLAST-2 search parameters are set to the default values Those not set to default values, ( e , the adjustable parameters, are set with the following values overlap span = 1, overlap fraction = 0 125, word threshold (T) = 1 1 , and scoring matrix = BLOSUM62 For purposes herein, a % amino acid sequence identity value is determined by dividing (a) the number of matching identical amino acids residues between the amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide and the comparison amino acid sequence of interest (J e , the sequence against which the PRO polypeptide of interest is being compared which may be a PRO variant polypeptide) as determined by WU-BLAST-2 by (b) the total number of amino acid residues of the PRO polypeptide of interest For example, in the statement "a polypeptide comprising an amino acid sequence A which has or having at least 80% amino acid sequence identity to the amino acid sequence B", the amino acid sequence A is the comparison amino acid sequence of interest and the amino acid sequence B is the amino acid sequence of the PRO polypeptide of interest "PRO variant polypeptide or "PRO variant nucleic acid sequence" means a nucleic acid molecule which encodes an active PRO polypeptide as defined below and which has at least about 80% nucleic acid sequence identity with a nucleotide acid sequence encoding a full-length native sequence PRO polypeptide sequence as disclosed herein, a full-length native sequence PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein Ordinarily, a PRO variant polynucleotide will have at least about 80% nucleic acid sequence identity, more preferably at least about 81 % nucleic acid sequence identity, more preferably at least about 82% nucleic acid sequence identity, more preferably at least about 83% nucleic acid sequence identity, more preferably at least about 84% nucleic acid sequence identity more preferably at least about 85% nucleic acid sequence identity, more preferably at least about 86% nucleic acid sequence identity, more preferably at least about 87% nucleic acid sequence identity, more preferably at least about 88% nucleic acid sequence identity more preferably at least about 89% nucleic acid sequence identity, more preferably at least about 90% nucleic acid sequence identity, more preferably at least about 91 % nucleic acid sequence identity, more preferably at least about 92% nucleic acid sequence identity, more preferably at least about 93% nucleic acid sequence identity, more preferably at least about 94% nucleic acid sequence identity, more preferably at least about 95% nucleic acid sequence identity, more preferably at least about 96% nucleic acid sequence identity, more preferably at least about 97% nucleic acid sequence identity, more preferably at least about 98% nucleic acid sequence identity and yet more preferably at least about 99% nucleic acid sequence identity with the nucleic acid sequence encoding a full-length native sequence PRO polypeptide sequence as disclosed herein, a full-length native sequence PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal sequence, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein Variants do not encompass the native nucleotide sequence
Ordinarily, PRO variant polynucleotides are at least about 30 nucleotides in length, often at least about 60 nucleotides in length, more often at least about 90 nucleotides in length, more often at least about 120 nucleotides in length, more often at least about 150 nucleotides in length, more often at least about 180 nucleotides in length, more often at least about 210 nucleotides in length, more often at least about 240 nucleotides in length, more often at least about 270 nucleotides in length, more often at least about 300 nucleotides in length, more often at least about 450 nucleotides in length, more often at least about 600 nucleotides in length, more often at least about 900 nucleotides in length, or more
"Percent (%) nucleic acid sequence identity" with respect to the PRO polypeptide-encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in a PRO polypeptide-encoding nucleic acid sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity Alignment for purposes ot determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, ALIGN-2 or Megahgn (DNASTAR) software Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full-length of the sequences being compared For purposes herein, however, % nucleic acid sequence identity values are obtained as described below by using the sequence comparison computer program ALIGN-2, wherein the complete source code tor the ALIGN-2 program is provided in Table 1 The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc , and the source code shown in Table 1 has been tiled with user documentation in the U S Copyright Office, Washington D C , 20559, where it is registered under U S Copyright Registration No TXU510087 The ALIGN-2 program is publicly available through Genentech, Inc , South San Francisco, California or may be compiled from the source code provided in Table 1 The ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4 0D All sequence comparison parameters are set by the ALIGN-2 program and do not vary
For purposes herein, the % nucleic acid sequence ιdentιt\ ot a given nucleic acid sequence C to, with, oi against a given nucleic acid sequence D (which can alternativeh be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to v. ith or against a given nucleic acid sequence D) is calculated as follows
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of C and D, and where Z is the total number of nucleotides in D It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C As examples of % nucleic acid sequence identity calculations, Tables 2C-2D demonstrate how to calculate the % nucleic acid sequence identity of the nucleic acid sequence designated "Comparison DNA" to the nucleic acid sequence designated "PRO- DNA" Unless specifically stated otherwise, all % nucleic acid sequence identity values used herein are obtained as described above using the ALIGN-2 sequence comparison computer program However, % nucleic acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul etal , Nucleic Acids Res . 25 3389-3402 (1997)) The NCBI-BLAST2 sequence comparison program may be downloaded from http //www ncbi nlm nih gov NCBI-BLAST2 uses several search parameters, wherein all of those search parameters are set to default values including, for example, unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e- value = 001, constant for multi-pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62
In situations where NCBI-BLAST2 is employed for sequence comparisons, the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) is calculated as follows
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the sequence alignment program NCBI- BLAST2 in that program's alignment of C and D, and where Z is the total number of nucleotides in D It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C
In addition, % nucleic acid sequence identity values may also be generated using the WU-BLAST-2 computer program (Altschul et al , Methods in Enzymology. 266 460-480 ( 1996)) Most of the WU-BLAST-2 search parameters are set to the default values Those not set to default values, i e , the adjustable paiameters, are set with the following values overlap span = 1 , overlap fraction = 0 125, word threshold (T) = 1 1. and scoring matrix = BLOSUM62 For purposes herein, a % nucleic acid sequence identity value is determined by dividing (a) the numbei ot matching identical nucleotides between the nucleic acid sequence of the PRO polypeptide encoding nucleic acid molecule ot interest having a sequence derived from the native sequence PRO polypeptide-encoding nucleic acid and the comparison nucleic acid molecule of interest (i e , the sequence against which the PRO polypeptide-encoding nucleic acid molecule of interest is being compared which may be a variant PRO polynucleotide) as determined by WU-BLAST-2 by (b) the total number of nucleotides of the PRO polypeptide- encoding nucleic acid molecule of interest For example, in the statement "an isolated nucleic acid molecule comprising a nucleic acid sequence A which has or having at least 80% nucleic acid sequence identity to the nucleic acid sequence B", the nucleic acid sequence A is the comparison nucleic acid molecule of interest and the nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest In other embodiments, PRO variant polynucleotides are nucleic acid molecules that encode an active PRO polypeptide and which are capable of hybridizing, preferably under stringent hybridization and wash conditions, to nucleotide sequences encoding the full-length PRO polypeptide shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8), Figure 2 (SEQ ID NO 2), Figure 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14), Figure 16 (SEQ ID NO 16), Figure 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figure 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), or Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 31 ) or Figure 33 (SEQ ID NO 33), respectively PRO variant polypeptides may be those that are encoded by a PRO variant polynucleotide The term "positives", in the context of the amino acid sequence identity comparisons performed as described above, includes amino acid residues in the sequences compared that are not only identical, but also those that have similar properties Amino acid residues that score a positive value to an ammo acid residue of interest are those that are either identical to the amino acid residue of interest or are a preferred substitution (as defined in Table 3 below) of the amino acid residue of interest For purposes herein, the % value of positives of a given amino acid sequence A to, with, or against a given am o acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % positives to, with, or against a given amino acid sequence B) is calculated as follows
100 times the fraction X/Y
where X is the number of amino acid residues scoring a positive value as defined above by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total numbei ot amino acid residues in B It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % positives of A to B will not equal the % positives of B to A
"Isolated," when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment Preferably, the isolated polypeptide is free of association with all components with which it is naturally associated Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes In preferred embodiments, the polypeptide will be purified ( 1 ) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducmg oi reducing conditions using Coomassie blue oi, preferably, silver stain Isolated polypeptide includes polypeptide in situ within recombinant eel Is, since at least one component ot the PRO natural environment will not be present Ordinarily, however, isolated polypeptide will be prepared by at least one purification step
An "isolated" nucleic acid molecule encoding a PRO polypeptide or an 'isolated" nucleic acid encoding an anti-PRO antibody, is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the PRO-encoding nucleic acid or the anti-PRO-encoding nucleic acid Preferably, the isolated nucleic acid is free of association with all components with which it is naturally associated An isolated PRO-encoding nucleic acid molecule or an anti- PRO-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature Isolated nucleic acid molecules therefore are distinguished from the PRO-encoding nucleic acid molecule or the anti-PRO- encoding nucleic acid molecule as it exists in natural cells However, an isolated nucleic acid molecule encoding a PRO polypeptide or an anti-PRO antibody includes PRO-encoding nucleic acid molecules and anti-PRO-encoding nucleic acid molecules contained in cells that ordinarily express PRO polypeptides or express anti-PRO antibodies where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells
The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a pai ticular host organism The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a πbosome binding site Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers
Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence, or a πbosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation Generally, "operably linked' means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase However, enhancers do not have to be contiguous Linking is accomplished by ligation at convenient restriction sites If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice
The term "antibody" is used in the broadest sense and specifically covers, for example, single anti- PR0213, anti-PRO 1330, anti-PRO 1449, antι-PR0237, anti PR0324, antι-PR0351 antι-PR0362, antι-PR0615, antι-PR0531, antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772 antι-PRO703, antι-PR0792 or anti- PR0474 monoclonal antibodies (including antagonist and neutralizing antιbodιes),antι-PR0213, anti PRO1330, anti-PRO 1449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, anti PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, anti PR0772, antι-PRO703, anti PR0792 or anti PR0474 antibody compositions with polyepitopic specificity, single chain antι-PR0213, anti-PRO 1330, anti-PRO 1449 anti PR0237, anti PR0324, antι-PR0351 , antι-PR0362, anti-PROόl 5, antι-PR0531 , anti PR0538 antι-PR03664 antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibodies, and fragments ot anti PR0213, anti-PRO 1330, anti PRO 1449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362 antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or anti PR0474 antibodies (see below) The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, t e , the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts
"Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures Hybridization generally depends on the ability of denatured DNA to reanneal when complementar) strands are present in an environment below their melting temperature The higher the degree of desired homology between the probe and hybπdizable sequence, the higher the relative temperatuie which can be used As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so For additional details and explanation of stringency of hybridization reactions, see Ausubel et al , Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995)
"Stringent conditions" or "high stringency conditions", as defined herein, may be identified by those that ( 1 ) employ low ionic strength and high temperature for washing, for example 0 015 M sodium chloπde/0 0015 M sodium cιtrate/0 1 % sodium dodecyl sulfate at 50°C, (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0 1 % bovine serum albumin/0 1 % Fιcoll/0 1 % polyvιnylpyrrolιdone/50mM sodium phosphate buffer at pH 6 5 with 750 M sodium chloride, 75 mM sodium citrate at 42°C, or (3) employ 50% formamide, 5 x SSC (0 75 M NaCI, 0 075 M sodium citrate), 50 mM sodium phosphate (pH 6 8), 0 1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0 1 % SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0 2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed by a high-stringency wash consisting of 0 1 x SSC containing EDTA at 55°C
"Moderately stringent conditions" may be identified as described by Sambrook et al , Molecular Cloning A Laboratory Manual. New York Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e g , temperature, ionic strength and % SDS) less stringent than those described above An example of moderately stringent conditions is overnight incubation at 37°C in a solution comprising 20% formamide, 5 x SSC (150 mM NaCl, 15 mM tπsodium citrate), 50 mM sodium phosphate (pH 7 6), 5 x Denhardt s solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 35°C-50°C The skilled artisan will recognize how to adjust the temperature, ionic strength etc as necessary to accommodate factors such as probe length and the like The term ' epitope tagged" when used herein refers to a chimeric polypeptide comprising a PR0213
PRO1330, PR01449, PR0237, PR0324, PR0351 PR0362, PR0615, PR053 I , PR0538, PR03664, PR0618 PR0772, PRO703, PR0792 or PR0474 polypeptide fused to a ' tag polypeptide" The tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the polypeptide to which it is fused The tag polypeptide preferably also is fairly unique so that the antibody does not substantially cross-react with other epitopes Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 ammo acid residues (preferably, between about 10 and 20 ammo acid residues)
' Active" or "activity' for the purposes herein refers to form(s) ot PR0213, PRO 1330, PRO 1449, PR0237 PR0324, PR0351 , PRO-362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptides which retain a biological and/or an immunological activity/property of a native or naturally- occurring PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, wherein "biological" activity refers to a function (either inhibitory or stimulatory) caused by a native or naturally-occurring PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide other than the ability to induce the production of an antibody against an antigenic epitope possessed by a a native or naturally-occurring PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and an "immunological" activity refers to the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally-occurring PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
"Biological activity" in the context of an antibody or another antagonist molecule that can be identified by the screening assays disclosed herein (e g , an organic or inorganic small molecule, peptide, etc ) is used to refer to the ability of such molecules to bind or complex with the polypeptides encoded by the amplified genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins oi otherwise interfere with the transcription or translation of a PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide A preferred biological activity is growth inhibition of a target tumor cell Another preferred biological activity is cytotoxic activity resulting in the death of the target tumor cell
The term "biological activity" in the context of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide means the ability of aPRO213, PRO1330, PRO1449 PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide to induce neoplastic cell growth or uncontrolled cell growth
The phrase "immunological activity" means immunological cross-reactivity with at least one epitope of a PR0213, PROl 330, PR01449, PR0237. PR0324, PR0351. PR0362, PR0615, PR0531 , PR0538, PR03664. PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide "Immunological cross-reactivity" as used herein means that the candidate polypeptide is capable of competitively inhibiting the qualitative biological actιvιt> ot a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide having this activity with polyclonal antisera raised against the known active PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772. PRO703, PR0792 or PR0474 polypeptide Such antisera are piepared in conventional fashion by meeting goats or rabbits, for example, subcutaneously with the known active analogue in complete Freund's ad)uvant, followed by booster lntrapeπtoneal or subcutaneous injection in incomplete Freunds The immunological cross-reactivity preferably is ' specific", which means that the binding affinity of the immunologically cross-reactive molecule (e g , antibody) identified, to the corresponding PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351. PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is significantly higher (preferably at least about 2-tιmes, more preferably at least about 4-tιmes, even more preferably at least about 8-tιmes, most preferably at least about 10-tιmes higher) than the binding affinity of that molecule to any other known native polypeptide
The term "antagonist" is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native PR0213 , PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide disclosed herein or the transcription or translation thereof Suitable antagonist molecules specifically include antagonist antibodies or antibody fragments, fragments, peptides, small organic molecules, anti-sense nucleic acids, etc Included are methods for identifying antagonists of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide with a candidate antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide A "small molecule" is defined herein to have a molecular weight below about 500 Daltons "Antibodies" (Abs) and "immunoglobulins" (Igs) are glycoproteins having the same structural characteristics While antibodies exhibit binding specificity to a specific antigen, immunoglobulins include both antibodies and other antibody-like molecules which lack antigen specificity Polypeptides of the latter kind are, for example, produced at low levels by the lymph system and at increased levels by myelomas The term "antibody" is used in the broadest sense and specifically covers, without limitation, intact monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e g , bispecific antibodies) formed from at least two intact antibodies, and antibody fragments so long as they exhibit the desired biological activity
"Native antibodies" and "native immunoglobulins" are usually heterotetrameπc glycoproteins of about 150,000 daltons. composed of two identical light (L) chains and two identical heavy (H) chains Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes Each heavy and light chain also has regularly spaced intrachain disulfide bridges Each heavy chain has at one end a variable domain (VH) followed by a number of constant domains Each light chain has a variable domain at one end (VL) and a constant domain at its other end, the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light-chain variable domain is aligned with the variable domain of the heavy chain Particular amino acid residues are believed to form an interface between the light- and heavy-chain variable domains
The term "variable" refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody tor its particular antigen However, the variability is not evenly distributed throughout the variable domains of antibodies It is concentrated in three segments called complementarity-determining regions (CDRs) or hypervaπable regions both in the light-chain and the heavy-chain variable domains The more highly conserved portions ot variable domains are called the framework (FR) regions The variable domains of native heavy and light chains each comprise four FR regions, largely adopting a β-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the β-sheet structure The CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen-binding site of antibodies (see Kabat et al , NIH Publ No 91-3242, Vol I, pages 647-669 (1991 )) The constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody-dependent cellular toxicity
The term "hypervaπable region" when used herein refers to the amino acid residues of an antibody which are responsible for antigen-binding The hypervaπable region comprises amino acid residues from a "complementarity determining region" or "CDR" (; e , residues 24-34 (Ll ), 50-56 (L2) and 89-97 (L3) in the light chain variable domain and 31-35 (HI), 50-65 (H2) and 95-102 (H3) in the heavy chain variable domain, Kabat et al , Sequences of Proteins of Immunological Interest, 5th Ed Public Health Service, National Institute of Health, Bethesda, MD [ 1991 ]) and/or those residues from a "hypervaπable loop" (t e , residues 26-32 (Ll ), 50-52 (L2) and 91-96 (L3) in the light chain variable domain and 26 32 (HI ), 53-55 (H2) and 96-101 (H3) in the heavy chain variable domain , Clothia and Lesk, J Moi Biol . 196 901 -917 [ 1987] ) "Framework" or "FR" residues are those variable domain residues other than the hypervaπable region residues as herein defined
"Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments, diabodies , linear antibodies (Zapata et al , Protein Eng .8(10) 1057- 1062 [ 1995]) , single-chain antibody molecules, and multispecific antibodies formed from antibody fragments Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab" fragments, each with a single antigen-binding site, and a residual "Fc" fragment, whose name reflects its ability to crystallize readily Pepsin treatment yields an F(ab')2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen
"Fv" is the minimum antibody fragment which contains a complete antigen-recognition and -binding site This region consists of a dimer of one heavy- and one light chain variable domain in tight, non covalent association It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer Collectively, the six CDRs confer antigen binding specificity to the antibody However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site The Fab fragment also contains the constant domain of the light chain and the first constant domain (CH 1 ) of the heavy chain Fab fragments differ from Fab' fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH 1 domain including one or more cysteines from the antibody hinge region Fab'-SH is the designation herein for Fab in which the cysteine resιdue(s) ot the constant domains bear a free thiol group F(ab'), antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them Other chemical couplings ot antibody fragments are also known
The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda (λ) based on the amino acid sequences of their constant domains Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes There are five major classes of immunoglobulins IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e g , IgG 1 , IgG2, IgG3, IgG4, IgA, and IgA2 The heavy-chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, e, γ, and μ, respectively The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known
The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, t e , the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts Monoclonal antibodies are highly specific, being directed against a single antigenic site Furthermore, in contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen In addition to their specificity, the monoclonal antibodies are advantageous in that they are synthesized by the hybπdoma culture, uncontaminated by other immunoglobulins The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybπdoma method first described by Kohler et al , Nature, 256 495 [1975], or may be made by recombinant DNA methods (see, e g , U S Patent No 4,816,567) The "monoclonal antibodies" may also be isolated from phage antibody libraries using the techniques described in Clackson et al , Nature, 352 624-628 [1991 ] and Marks et al , J Moi Biol , 222 581 -597 ( 1991), for example
The monoclonal antibodies herein specifically include ' chimeric antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chaιn(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments ot such antibodies, so long as they exhibit the desired biological activity (U S Patent No 4,816,567, Morrison et al , Proc Natl Acad Sci USA, 8i 6851 -6855 [1984])
"Humanized forms of non-human (e g , murine) antibodies are chimeric immunoglobulins, lmmunoglobulm chains or fragments thereof (such as Fv, Fab, Fab F(ab )., or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin For the most part, humanized antibodies are human immunoglobulins (recipient antibod}) in which residues from a CDR ot the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity In some instances, Fv FR residues ot the human immunoglobulin are replaced by corresponding non human residues Furthermore, humanized antibodies ma comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences These modifications are made to further refine and maximize antibody performance In general, the humanized antibody will comprise substantially all of at least one and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those ot a non human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin For further details, see, Jones et al , Nature, 321 522-525 (1986), Reichmann et al , Nature 332.323-329 [1988], and Presta, Curr Op Struct Biol , 2 593-596 ( 1992) The humanized antibody includes a PRIMAΗZED™ antibody wherein the antigen-binding region of the antibody is derived from an antibody produced by immunizing macaque monkeys with the antigen of interest
" Single-chain Fv" or "sFv" antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for antigen binding For a review of sFv see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol 113, Rosenburg and Moore eds , Springer- Verlag, New York, pp 269-315 (1994)
The term "diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments compiise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) in the same polypeptide chain (VH - VL) By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites Diabodies are described more fully in, for example, EP 404,097, WO 93/1 1161 , and Holhnger et al , Proc Natl Acad Sci USA, 90 6444-6448 (1993)
An "isolated" antibody is one which has been identified and separated and/or recovered from a component of its natural environment Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes In preferred embodiments, the antibody will be purified (1 ) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use ot a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present Ordinarily, howe\ eι , isolated antibody will be prepared by at least one purification step
The word "label" when used herein refers to a detectable compound oi composition which is conjugated directly or indirectly to the antibody so as to generate a "labeled antibody The label may be detectable by itself (e g . radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable Radionuchdes that can serve as detectable labels include, for example, 1-131 , 1-123, 1-125, Y-90, Re- 188, Re- 186, At-21 1 , Cu-67, Bι-212, and Pd- 109 The label may also be a non-detectable entity such as a toxin
By "solid phase" is meant a non-aqueous matrix to which the antibody of the present invention can adhei e Examples of solid phases encompassed herein include those formed partially or entirely of glass (e ? controlled pore glass), polysacchaπdes (e g , agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones In certain embodiments, depending on the context, the solid phase can comprise the well of an assay plate, in otheis it is a purification column (e g , an affinity chromatographv column) This term also includes a discontinuous solid phase of discrete particles, such as those described in U S Patent No 4,275,149
A "hposome" is a small vesicle composed of various types of hpids, phosphohpids and/or surfactant which is useful for delivery of a drug (such as a PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362,
PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide or antibody thereto and, optionally, a chemotherapeutic agent) to a mammal The components of the hposome are commonly arranged in a bilayer formation, similar to the hpid arrangement of biological membranes
As used herein, the term "immunoadhesin" designates antibody-like molecules which combine the binding specificity of a heterologous protein (an "adhesin") with the effector functions of immunoglobulin constant domains Structurally, the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (t e , is "heterologous"), and an immunoglobulin constant domain sequence The adhesin part of an immunoadhesin molecule typically is a contiguous am o acid sequence comprising at least the binding site of a receptor or a ligand The immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG- 1 , IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM
JJ_ Compositions and Methods of the Invention
A Full-length PRQ213. PRO 1330. PRO 1449. PRQ237. PRQ324. PRQ351. PRQ362. PRQ615. PRQ531. PRQ538. PRQ3664. PRQ618. PRQ772. PRO703. PRQ792 and PRQ474 polypeptides
The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PROόl 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 In particular, cDNA encoding PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 polypeptides has been identified and isolated, as disclosed in further detail in the Examples below It is noted that proteins produced in separate expression rounds may be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed However, for sake of simplicity, in the present specification the proteins encoded by the herein disclosed nucleic acid sequences as well as all further native homologues and variants included in the foregoing definition of PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PROό 15, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 will be referred to as "PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474", regardless of their origin or mode of preparation
As disclosed in the Examples below , cDNA clones have been deposited with the ATCC The actual nucleotide sequence of the clones can readily be determined by the skilled artisan by sequencing of the deposited clone using routine methods in the art The predicted amino acid sequences can be determined from the nucleotide sequences using routine skill For the PR0213. PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531. PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptides and encoding nucleic acid described herein, Applicants have identified what are believed to be the reading frames best identifiable with the sequence information available at the time B PRQ213, PRO 1330, PRO 1449. PRQ237. PRQ324. PRQ351. PRQ362, PRQ615. PRQ531. PRQ538. PRQ3664. PRQ618. PRQ772. PRO703. PRQ792 and PRQ474 Variants
In addition to the full-length native sequence PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 polypeptides described herein, it is contemplated that PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 andPR0474 variants can be prepared PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 and PR0474 variants can be prepared by introducing appropriate nucleotide changes into the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 DNA, and/or by synthesis of the desired PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide Those skilled in the art will appreciate that amino acid changes may alter post-translational processes of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics
Variations in the native full-length sequence PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 or in various domains of the PRO213,PRO1330,PRO1449,PRO237, PRO324, PRO351 , PRO362, PRO615, PRO531 ,PRO538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 described herein can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U S Patent No 5,364,934 Variations may be a substitution, deletion or insertion of one or more codons encoding the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 that results in a change in the amino acid sequence of the PR0213, PRO1330, PR01449. PR0237, PR0324, PR0351 , PR0362, PR0615 PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 as compared with the native sequence PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538 PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 Optionally the variation is by substitution ot at least one am o acid with any other amino acid in one or more of the domains of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772 PRO703, PR0792 or PR0474 with that of homologous known protein molecules and minimizing the number ot amino acid sequence changes made in regions of high homology Amino acid substitutions can be the result ot replacing one amino acid with another amino acid having similar structuial and/or chemical properties, such as the replacement ot a leucine with a serine, ( e , conservative amino acid replacements Insertions or deletions may optionally be in the range of about 1 to 5 amino acids The variation allowed may be determined by systematical making insertions, deletions oi substitutions of amino acids in the sequence and testing the resulting variants for activity exhibited by the full-length or mature native sequence
PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 polypeptide fragments are provided herein Such fragments may be truncated at the N-terminus or C-terminus, or may lack internal residues, for example, when compared with a full-length native protein Certain fragments lack ammo acid residues that are not essential for adesired biological activity of the PR0213, PROl 330, PRO1449, PR0237, PR0324, PR0351 , PRO362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 fragments may be prepared by any of a number of conventional techniques Desired peptide fragments may be chemically synthesized An alternative approach involves generating PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 fragments by enzymatic digestion, e g , by treating the protein with an enzyme known to cleave proteins at sites defined by particular amino acid residues, or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment Yet another suitable technique involves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment, by polymerase chain reaction (PCR) Oligonucleotides that define the desired termini of the DNA fragment are employed at the 5' and 3' primers in the PCR Preferably, PR0213, PRO1330, PR01449, PR0237. PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide fragments share at least one biological and/or immunological activity with the native PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
In particular embodiments, conservative substitutions of interest are shown in Table 3 under the heading of preferred substitutions If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 3, or as f ui ther described below in reference to amino acid classes, are introduced and the products screened
Table 3
Original Exemplary Preferred
Residue Substitutions Substitutions
Figure imgf000059_0001
Arg (R) lys, gin, asn lys
Asn (N) gin, his, lys, arg gin
Asp (D) glu glu
Cys (C) ser ser
Gin (Q) asn asn Glu (E) asp asp
Gly (G) pro, ala ala
His (H) asn, gin, lys, arg arg lie (I) leu, val, met, ala, phe, norleucine leu Leu (L) norleucme, lie, val,
Figure imgf000059_0002
Phe (F) leu, val, lie, ala, tyr leu Pro (P) ala ala
Ser (S) thr thr
Thr (T) ser ser
Trp (W) tyr, phe tyr
Tyr (Y) trp, phe, thr, ser phe Val (V) tie, leu, met, phe, ala, norleucine leu
Substantial modifications in function or immunological identity of the polypeptide are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area ot the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain Naturally occurring residues are divided into groups based on common side-chain properties
(1 ) hydrophobic norleucine, met, ala, val, leu, lie,
(2) neutral hydrophilic cys, ser, thr,
(3) acidic asp, glu, (4) basic asn, gin, his, lys, arg,
(5) residues that influence chain orientation gly, pro, and
(6) aromatic trp, tyr, phe
Non conservative substitutions will entail exchanging a member ot one ot these classes for another class Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non conserved) sites
The variations can be made using methods known in the art such as oligonucleotide mediated (site directed) mutagenesis, alanine scanning and PCR mutagenesis Site-directed mutagenesis [Carter et al , Nucl Acids Res . 13 4331 (1986), Zoller et al , Nucl Acids Res , ]0 6487 ( 1987) |, cassette mutagenesis [Wells et al , Gene, 34 315 (1985)] restriction selection mutagenesis [Wells et al , Philos Trans R Soc London SerA, 317 415 (1986)] or other known techniques can be performed on the cloned DNA to produce the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 variant DNA
Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence Among the preferred scanning amino acids are relatively small, neutral ammo acids Such amino acids include alanine, glycine, serine, and cysteine Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant [Cunningham and Wells, Science, 244 1081-1085 (1989)] Alanine is also typically preferred because it is the most common amino acid Further, it is frequently found in both buried and exposed positions [Creighton, The Proteins, (W H Freeman & Co , N Y ), Chothia, J Moi Biol , 150 1 (1976)] If alanine substitution does not yield adequate amounts of variant, an lsoteπc amino acid can be used
C Modifications of PRQ213. PRO1330. PRQ1449. PRQ237. PRQ324. PRQ351. PRQ362. PRQ615. PRQ531. PRQ538. PRQ3664. PRQ618. PRQ772. PRO703. PRQ792 and PRQ474
Covalent modifications of PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 and PR0474 are included within the scope of this invention One type of covalent modification includes reacting targeted amino acid residues of aPR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide with an organic deπvatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 Deπvatization with bifunctional agents is useful, for instance, for crosshnking PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772 PRO703, PR0792 or PR0474 to a water-msoluble support matrix or surface for use in the method for purifying antι-PR0213, anti-PRO 1330, anti-PRO 1449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, anti-PROόl 8, antι-PR0772, anti PRO703, antι-PR0792 or antι-PR0474 antibodies, and vice-versa Commonly used crosshnking agents include, e g , 1 , 1 -bιs(dιazoacetyl)- 2-phenylethane, glutaraldehyde, N-hydroxysuccimmide esters, for example, esters with 4-azιdosalιcylιc acid, homobifunctional lmidoesters, including disuccinimidyl esteis such as 3,3 -dιthιobιs(succιnιmιdylρropιonate), bifunctional maleimides such as bis-N maleιmιdo-l ,8-octane and agents such as methyl-3 [(p- azιdophenyl)dιthιo]propιoιmιdate
Other modifications include deamidation of glutarninyl and asparagmyl residues to the corresponding glutam l and aspartyl residues, respectively, hydroxylation of prohne and lysine phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the α-amino groups ot lysine, arginine, and histidine side chains [T E Creighton Proteins Structure and Molecular Properties W H Freeman & Co San Francisco, pp 79-86 (1983)] acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group
Another type of covalent modification of the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 orPR0474 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide "Altering the native glycosylation pattern' is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 In addition, the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present Addition of glycosylation sites to the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 ,
PR0362, PR0615, PR0531, PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 polypeptide may be accomplished by alteπng the amino acid sequence The alteration may be made, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 (for O linked glycosylation sites) The PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids
Another means of increasing the number of carbohydrate moieties on the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703 PR0792 or PR0474 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide Such methods are described in the art, e g , in WO 87/05330 published 1 1 September 1987, and in Aphn and Wπston CRC Cπt Rev Biochem . pp 259 306 (1981 )
Removal of carbohydrate moieties present on the PR0213, PRO 1330, PR01449, PR0237 PR0324 PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide may be accomplished chemically or enzymatically or by mutational substitution ot codons encoding for amino acid residues that serve as targets for glycosylation Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddm, et al , Arch Biochem Biophys , 259 52 (1987) and by Edge et al , Anal Biochem . 1 18 131 (1981 ) Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo and exo-glycosidases as described by Thotakura et al , Meth Enzymol 138 350 (1987)
Another type of covalent modification of PR0213, PRO 1330, PR01449, PR0237 PR0324, PR0351 PR0362, PR0615, PR0531 , PR0538 PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 comprises linking the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide to one ot a variety of nonproteinaceous polymers, e g , polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U S Patent Nos 4,640,835, 4,496,689, 4,301,144, 4,670,417, 4,791 ,192 or 4,179,337
The PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538,
PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 of the present invention may also be modified in a way to form a chimeric molecule comprising PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 fused to another, heterologous polypeptide or ammo acid sequence
In one embodiment, such a chimeric molecule comprises a fusion of the PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind The epitope tag is generally placed at the amino- or carboxyl-terminus of the PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 The presence of such epitope-tagged forms ot the PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 oi PR0474 can be detected using an antibody against the tag polypeptide Also, provision of the epitope tag enables thePRO213, PRO1330, PRO1449, PRO237, PRO324, PRO351 , PRO362, PRO615,PRO531,PRO538,PRO3664, PR0618, PR0772, PRO703, PR0792 or PR0474 to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag Various tag polypeptides and their respective antibodies are well known in the art Examples include poly-histidine (poly-His) or poly-histidine- glycine (poly-His-gly) tags, the flu HA tag polypeptide and its antibody 12CA5 [Field et al , Moi Cell Biol , 8 2159-2165 (1988)], the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al , Molecular and Cellular Biology. 5 3610-3616 (1985)], and the Herpes Simplex virus glycoprotein D (gD) tag and its antibody [Paborsky etal , Protein Engineering, 3(6) 547-553 (1990)] Other tag polypeptides include the Flag- peptide [Hopp et al , BioTechnology, 6 1204-1210 (1988)]. the KT3 epitope peptide [Martin et al , Science, 255 192- 194 ( 1992)] , an -tubulm epitope peptide [Skinner et al , J Biol Chem , 266 15163-15166 (1991 )], and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al , Proc Natl Acad Sci USA, 87 6393-6397 ( 1990)]
In an alternative embodiment, the chimeric molecule mav comprise a fusion of the PR0213, PROl 330
PR01449, PR0237, PR0324, PR0351, PR0362, PR0615 PR0531 , PR0538, PR03664, PR0618, PR0772,
PRO703, PR0792 or PR0474 with an immunoglobulin or a particular region of an immunoglobulin Foi a bivalent form of the chimeric molecule (also referred to as an "immunoadhesin"), such a fusion could be to the Fc region of an IgG molecule The Ig fusions preferably include the substitution ot a soluble (transmembrane domain deleted or inactivated) form of a PR0213, PROl 330, PROl 449, PR0237 PR0324, PR0351 , PR0362, PR0615, PR05 1 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in place of at least one variable region within an Ig molecule In a particularly preferred embodiment, the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI , CH2 and CH3 regions ot an IgG l molecule For the production ot immunoglobulin fusions see also, US Patent No 5,428,130 issued June 27, 1995 D Preparation of PRQ213. PRO1330. PR01449. PRQ237. PRQ324. PRQ351. PR0362. PRQ615, PRQ531. PRQ538. PRQ3664. PRQ618. PRQ772. PRO703. PRQ792 and PRQ474 Polypeptides
The description below relates primarily to production of PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 by cultuπng cells transformed or transfected with a vector containing PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 nucleic acid It is, of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 For instance, the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 sequence, or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques [see, e g , Stewart etal , Solid-Phase Peptide Synthesis, W H Freeman Co , San Francisco, CA (1969), Merrifield, J Am Chem Soc . 85 2149-2154 (1963)] In vitro protein synthesis may be performed using manual techniques or by automation Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions Various portions of thePRO213,PRO1330, PRO1449,PRO237, PRO324, PRO351, PRO362, PRO615, PRO531 , PRO538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
a Isolation of DNA Encoding a PRQ213, PRO1330, PRQ1449, PRQ237, PRQ324. PRQ351 ,
PRQ362, PRQ615, PRQ531. PRQ538, PRQ3664, PRQ618, PRQ772, PRO703, PRQ792 or PRQ474 Polypeptide
DNA encoding PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 ,
PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be obtained from a cDNA library prepared from tissue believed to possess the PR0213, PRO 1330, PRO 1449, PR0237. PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 mRNA and to express it at a detectable level Accordingly, human PR0213, human PRO 1330, human PRO 1449, human PR0237, human PR0324, human PR0351 , human PR0362, human PR0615, human PR0531 , human PR0538 human PR03664, human PR0618, human PR0772, human PRO703, human PR0792 or human PR0474 DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as described in the Examples PR0213-, PRO1330-, PR01449-, PR0237-, PR0324-, PR0351-, PR0362-, PR0615-, PR0531 -, PR0538- PR03664-, PR0618-, PR0772-, PRO703-, PR0792- or PR0474-encodιng gene may also be obtained from a genomic library or by oligonucleotide synthesis
Libraries can be screened with probes (such as antibodies to the PR0213, PRO 1330, PROl 449. PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 oi PR0474 polypeptide, or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook etal, Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989). An alternative means to isolate the gene encoding PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 is to use PCR methodology [Sambrook et al., supra; Dieffenbach et al, PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)].
The Examples below describe techniques for screening a cDNA library. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like 32P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided in Sambrook et al., supra.
Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) within defined regions of the molecule or across the full-length sequence can be determined using methods known in the art and as described herein.
Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al., supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.
b. Selection and Transformation of Host Cells
Host cells are transfected or transformed with expression or cloning vectors described herein for PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. The culture conditions, such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: a Practical Approach, M. Butler, ed. (IRL Press, 1991 ) and Sambrook et al, supra.
Methods of eukaryotic cell transfection and prokaryotic cell transformation are known to the ordinarily skilled artisan, for example, CaCl2, CaP04, liposome-mediated and electroporation. Depending on the host cell used, transformation is performed using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described in Sambrook et al., supra, or electroporation is generally used for prokaryotes. Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et al, Gene, 23:315 (1983) and WO 89/05859 published 29 June 1989. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52:456- 457 (1978) can be employed. General aspects of mammalian cell host system transfections have been described in U.S. Patent No. 4,399,216. Transformations into yeast are typically carried out according to the method of Van Solmgen et al , J Bact . HO 946 ( 1977) and Hsiao et al , Proc Natl Acad Sci (USA), 76 3829 ( 1979) Howevei , other methods for introducing DNA into cells, such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e g , polybrene, polyornithme. may also be used For various techniques for transforming mammalian cells, see, Keown et al , Methods in Enzvmology, 185 527-537 ( 1990) and Mansour et al , Nature, 336 348-352 (1988)
Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells Suitable prokaryotes include but are not limited to eubacteπa, such as Gram-negative or Gram-positive organisms, for example, Enterobacteπaceae such as E coli Various E coli strains are publicly available, such as E coli KI 2 strain MM294 (ATCC 31 ,446), E colt XI 776 (ATCC 31 ,537), E coli strain W31 10 (ATCC 27,325) and E coli strain K5 772 (ATCC 53,635) Other suitable prokaryotic host cells include Enterobacteπaceae such as Eschenchia, e g , E coli, Enterobactei , Erwima, Klebsiella, Proteus, Salmonella, e g Salmonella typhimurium, Set raha, e g , Serratia marcescans, and Shigella, as well as Bacilli such as B subtilis and B licheniformis (e g , B lichentformis 41 P disclosed in DD 266,710 published 12 April 1989), Pseudomonas such as P aeruginosa, and Streptomyces These examples are illustrative rather than limiting Strain W31 10 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations Preferably, the host cell secretes minimal amounts of proteolytic enzymes For example, strain W31 10 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E coli W31 10 strain 1 A2, which has the complete genotype tonA , E colt W3110 strain 9E4, which has the complete genotype tonA ptr3, E coli W31 10 strain 27C7 (ATCC 55,244), which has the complete genotype tonA ptι3 phoA E15 (argF-lac)169 degP ompTkan', E coli W31 10 strain 37D6, which has the complete genotype tonA ptι3 phoA El 5 (argF-lac)I69 degP ompT rbs7 t G kai , E coli W31 10 strain 40B4, which is strain 37D6 with a non-kanamycin resistant degP deletion mutation, and an E colt strain having mutant peπplasmic protease disclosed in U S Patent No 4,946,783 issued 7 August 1990 Alternatively, in viti o methods of cloning, e g , PCR or other nucleic acid polymerase reactions, are suitable In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning oi expression hosts tor PR0213-, PRO1330-, PROl 449-, PR0237-, PR0324-, PR0351 -, PR0362-, PR0615 , PR0531-, PR0538-, PR03664-, PR0618-, PR0772-, PRO703-, PR0792 oi PR0474-encodmg vectoi s Saccharom^ces ceievisiae is a commonly used lower eukaryotic host microorganism Others include Schtzosacchar ounces pombe (Beach and Nurse, Nature, 290 140 1 1981 ], EP 139.383 published 2 May 1985), Kluweroimces hosts (U S Patent No 4,943,529, Fleer et al , Bιo/Technolog\ 9 968-975 (1991 )) such as, e g , K lactis (MW98-8C, CBS683, CBS4574, Louvencourt etal , J Bacteπol , 737 [ 1983]). K fiagihs (ATCC 12,424) K bulgartcus (ATCC 16,045), AT wicketamii (ATCC 24,178), K waltu (ATCC 56 500) K diosoplulat urn (ATCC 36,906, Vanden Berg etal , Bio/Technology, 8 135 (1990)), K thei σtoleians. d K maixtanus,
Figure imgf000065_0001
ιa (ΕP 402,226), Pichia pastons (EP 183.070, Sreekπshna et al , J Basic Microbiol 28 265 278 [1988]), Candida Tnchoderma teesia (EP 244,234), Neuiospoia ciassa (Case et al , Proc Natl Acad Sci USA, 76 5259-5263 [ 1979]), Schwannio nces such as Schwaniuonnces occidentals (EP 394.538 published 31 Octobei 1990), and filamentous fungi such as, e g , Neuiospoia, Penicillium, To podadiwn (WO 91/00357 published 10 January 1991 ), and Aspeigύlus hosts such as A nidulans aWz c et al Biochem Bioplns Res Commun 1 12 284-289 [ 1983], Tilburn et al , Gene, 26 205 221 [19831. Yelton e. a/ . Proc Natl Acad Sci USA. 81 1470 1474 [ 1984]) andΛ nigei (Kelly and Hynes, EMBO J .4 475 479 [1985]) Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hansenula Candida Kloeckeia, Ptchia Saccharonnces Torulopsis, and Rhodotot ula A list of specific species that are exemplary of this class of yeasts may be found in C Anthony, The Biochemistry of Methylotrophs 269 (1982) Suitable host cells for the expression of glycosylated PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 are derived from multicellular organisms Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells More specific examples include monkey kidney CVl line transformed by SV40 (COS 7, ATCC CRL 1651), human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al , J Gen Virol , 36 59 (1977)), Chinese hamster ovary cells/-DHFR (CHO), Urlaub and Chasm, Proc Natl Acad Sci USA, 77 4216 (1980)), mouse sertoh cells (TM4, Mather, Biol Reprod , 23 243-251 (1980)), human lung cells (W138, ATCC CCL 75), human liver cells (Hep G2, HB 8065), and mouse mammary tumor (MMT 060562, ATCC CCL51 ) The selection of the appropriate host cell is deemed to be within the skill in the art
c Selection and Use of a Replicable Vector
The nucleic acid (e g , cDNA or genomic DNA) encoding PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression Various vectors are publicly available The vector may, for example, be in the form of a plasmid, cosmid, viral particle, oi phage The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures In general, DNA is inserted into an appropriate restriction endonuclease sιte(s) using techniques known in the art Vector components generally include, but are not limited to one or more of a signal sequence an origin ot replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan
The PR0213, PRO 1330, PRO l 449, PR0237, PR0324 PR0351 , PR0362, PR0615, PR0531 , PR0538 PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be produced recombinantly not only directly but also as a fusion polypeptide with a heterologous polypeptide which may be a signal sequence or othei polypeptide having a specific cleavage site at the N terminus ot the mature protein or polypeptide In general the signal sequence may be a component of the vector, or it may be a part ot the PR021 -, PRO 1330 PRO 1449 PR0237-, PR0324-, PR0351 , PR0362-, PR061 , PR05 1 - PR0538 PR03664-, PR0618-, PR0772 PRO703-, PR0792- or PR0474 encoding DNA that is inserted into the vector The signal sequence may be a prokaryotic signal sequence selected, for example, from the group ot the alkaline phosphatase, penicillinase, lpp, or heat-stable enteiotoxin II leaders For yeast secretion the signal sequence may be, e e , the yeast invertase leader alpha factor leader (including Satchaionnces and Kluw ei oun c es α-tactor leadei s, the latter described in U S Patent No 5,010, 182), or acid phosphatase leader, the C albicans glucoamylase leader (EP 362,179 published 4 April 1990), orthe signal described in WO 90/13646 published 15 November 1990 In mammalian cell expression, mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells Such sequences are well known for a variety of bacteria, yeast, and viruses The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker
Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e g , ampicillin, neomycin, methotrexate, or tetracychne, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e g , the gene encoding D-alamne racemase for Bacilli
An example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PR0213-, PRO1330-, PROl 449-, PR0237-, PR0324-, PR0351-, PR0362-, PR0615-, PR0531 -, PR0538-, PR03664-, PROόl 8-, PR0772-, PRO703-, PR0792- or PR0474-encodιng nucleic acid, such as DHFR or thymidine kinase An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al , Proc Natl Acad Sci USA, 77.4216 (1980) A suitable selection gene for use in yeast is the trp\ gene present in the yeast plasmid YRp7 [Stinchcomb et al , Nature. 282 39 (1979), Kingsman et al , Gene, 2 141 (1979), Tschemper et al , Gene, JO 157 (1980)] The trp\ gene provides a selection marker for a mutant strain ot yeast lacking the ability to grow in tryptophan, for example, ATCC No 44076 or PEP4-1 [Jones, Genetics, 85 12 (1977)]
Expression and cloning vectors usually contain a promoter operably linked to the PR0213-, PRO1330-, PR01449-, PR0237-, PR0324-, PR0351 -, PR0362-, PR0615-, PR0531 -, PR0538-, PR03664-, PR0618-, PR0772-, PRO703-, PR0792- or PR0474-encodιng nucleic acid sequence to direct mRNA synthesis Pi o oters recognized by a variety of potential host cells are well know n Promoters suitable for use with prokaryotic hosts include the β-lactamase and lactose promoter systems [Chang etal . Nature.275 615 (1978), Goeddel etal , Nature, 281 544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res , 8 4057 (1980), EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al , Proc Natl Acad Sci USA, 80 21 -25 (1983)] Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S D ) sequence operably linked to the DNA encoding PR0213, PROl 30 PRO 1449, PR0237, PR0324, PR0351 , PRO-362 PR0615 PR0531 , PR0538, PR03664, PR0618, PR0772. PRO703 PR0792 or PR0474
Examples of suitable promoting sequences toi use with yeast hosts include the promoters for 3- phosphoglycerate kinase [Hitzeman et al , J Biol Chem . 255 2073 ( 1980) j or other glycolytic enzymes [Hess et al J Ad\ Enzyme Reg . 7 149 (1968), Holland, Biochemistry. ]7 4900 ( 1978)]. such as enolase. glyceraldehyde 3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphotiuctokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase tπosephosphate isomerase, phosphoglucose isomerase, and glucokinase Other yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enz\ mes associated with nitrogen metabolism, metallothionein, glyceraldehyde 3- phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization Suitable vectors and promoters for use in yeast expression are further described in EP 73,657
PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (S V40), from heterologous mammalian promoters, e g , the actin promoter or an immunoglobulin promoter, and from heat shock promoters, provided such promoters are compatible with the host cell systems
Transcription of a DNA encoding the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 by higher eukaryotes may be increased by inserting an enhancer sequence into the vector Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription Many enhancer sequences are now known from mammalian genes (globm, elastase, albumin, α-fetoprotem, and insulin) Typically, however, one will use an enhancer from a eukaryotic cell virus Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers The enhancer may be spliced into the vector at a position 5 oi 3 to the PR0213, PROl 30, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 coding sequence, but is preferably located at a site 5' from the promoter
Expression vectors used in eukaryotic host cells (yeast, iungi insect, plant, animal, human, or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination ot transcription and for stabilizing the mRNA Such sequences are commonly available from the 5 and, occasionally 3 , untranslated regions of eukaryotic oi \ iral DNAs or cDNAs These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PR021 PRO l 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362 PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474
Still other methods, vectois and host cells suitable for adaptation to the synthesis ot PR0213 PRO 1330 PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 PR0538, PR03664, PR0618 PR0772 PRO703, PR0792 or PR0474 in recombinant vertebrate cell culture are described in Gething et al , Nature, 293 620-625 (1981 ). Mantei et al . Nature. 281 40-46 (1979) EP 1 17,060, and EP 1 17 058
d Detecting Gene Amplification/Expression
Gene amplification and/or expression may be measured in a sample directly for example by conventional Southern blotting, Northern blotting to quantitate the transcription ot mRNA [Thomas, Pi c Natl Acad Sci USA 225201-5205 ( 1980)], dot blotting (DNA analysis) or m situ hybridization, using an appropriately labeled probe based on the sequences provided herein Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA RNA hybrid duplexes or DNA-protein duplexes The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected Gene expression, alternatively, may be measured by immunological methods, such as lmmunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product Antibodies useful for lmmunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal Conveniently, the antibodies may be prepared against a native sequence PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against an exogenous sequence fused to PR0213, PRO 1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 DNA and encoding a specific antibody epitope
e Purification of Polypeptide
Forms of PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be recovered from culture medium or from host cell lysates If membrane bound, it can be released from the membrane using a suitable detergent solution (e g , Tπton-X 100) or by enzymatic cleavage Cells employed in expression of PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents
It may be desired to purify PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362 PR0615, PR0531 PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 from recombinant cell proteins or polypeptides The following procedures are exemplary ot suitable purification procedures by fractionation on an ion-exchange column, ethanol precipitation, reverse phase HPLC, chromatography on silica or on a cation-exchange resm such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation, gel filtration using, for example, Sephadex G 75, protein A Sepharose columns to remove contaminants such as IgG, and metal chelating columns to bind epitope tagged forms ot the PR0213, PRO 1 30, PRO 1449, PR0237, PR0324 PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 Various methods of protein purification may be employed and such methods are know n in the art and described for example in Deutscher, Methods in Enzymology, 182 (1990) Scopes Piotein Purification Principles and Practice Spπnger-Verlag, New York (1982) The purification step(s) selected will depend for example, on the nature of the production process used and the particular PR021 , PROl 330, PRO 1449, PR0237, PR0324, PR0351 PR0362, PR0615 PR0531 PR0538 PR03664, PR0618, PR0772, PRO703 PR0792 or PR0474 produced E Amplification of Genes Encoding the PRQ213 PRO1330. PRQ1449. PRQ237. PRQ324,
PRQ351. PRQ362. PRQ615. PRQ531 PRQ538, PRQ3664, PRQ6I 8 PRQ772, PRO703, PRQ792 or PRQ474 Polypeptides in Tumor Tissues and Cell Lines
The present invention is based on the identification and characterization of genes that are amplified in certain cancer cells
The genome of prokaryotic and eukaryotic organisms is subjected to two seemingly conflicting requirements One is the preservation and propagation of DNA as the genetic information in its original form, to guarantee stable inheritance through multiple generations On the other hand, cells or organisms must be able to adapt to lasting environmental changes The adaptive mechanisms can include qualitative or quantitative modifications of the genetic material Qualitative modifications include DNA mutations, in which coding sequences are altered resulting in a structurally and/or functionally different protein Gene amplification is a quantitative modification, whereby the actual number of complete coding sequence, i e , a gene, increases, leading to an increased number of available templates for transcription, an increased number of translatable transcripts, and, ultimately, to an increased abundance of the protein encoded by the amplified gene The phenomenon of gene amplification and its underlying mechanisms have been investigated in vitio in several prokaryotic and eukaryotic culture systems The best-charactei lzed example of gene amplification involves the culture of eukaryotic cells in medium containing variable concentiations of the cytotoxic drug methotrexate (MTX) MTX is a fohc acid analogue and interferes with DNA synthesis by blocking the enzyme dihydrofolate reductase (DHFR) During the initial exposure to low concentrations of MTX most cells (>99 9%) will die A small number of cells survive, and are capable of growing in increasing concentrations of MTX by producing large amounts of DHFR RNA and protein The basis of this overproduction is the amplification of the single DHFR gene The additional copies of the gene are found as extrachromosomal copies in the form of small supernumerary chromosomes (double minutes) or as integrated chromosomal copies
Gene amplification is most commonly encountered in the development of resistance to cytotoxic drugs (antibiotics for bacteria and chemotherapeutic agents for eukaryotic cells) and neoplastic transformation Transformation of a eukaryotic cell as a spontaneous event or due to a vual oi chemical/environmental insult is typically associated with changes in the genetic material ot that cell One of the most common genetic changes observed in human malignancies are mutations of the ρ53 protein p53 controls the transition of cells from the stationary (Gl ) to the replicative (S) phase and prevents this transition in the presence of DNA damage In othei words, one of the main consequences of disabling p53 mutations is the accumulation and propagation of DNA damage, i e , genetic changes Common types of genetic changes in neoplastic cells are in addition to point mutations, amplifications and gross, structural alterations such as translocations
The amplification of DNA sequences may indicate a specific functional lequirement as illustrated in the DHFR experimental system Therefore the amplification of ceitain oncogenes in malignancies points toward a causative role of these genes in the process of malignant tianstormation and maintenance of the transformed phenotype This hypothesis has gained support in recent studies Foi example the bcl 2 protein was found to be amplified in certain types of non-Hodgkin's lymphoma This protein inhibits apoptosis and leads to the progressive accumulation of neoplastic cells Membeis ot the gene family ot giowth factor receptors have been found to be amplified in various types of cancers suggesting that overexpression of these receptors may make neoplastic cells less susceptible to limiting amounts of available growth factor Examples include the amplification of the androgen receptor in recurrent prostate cancer during androgen deprivation therapy and the amplification ot the growth factor receptor homologue ERB2 in breast cancer Lastly, genes involved in intracellular signaling and control of cell cycle progression can undergo amplification during malignant transformation This is illustrated by the amplification of the bcl-I and ras genes in various epithelial and lymphoid neoplasms
These earlier studies illustrate the feasibility of identifying amplified DNA sequences in neoplasms, because this approach can identify genes important for malignant transformation The case ot ERB2 also demonstrates the feasibility from a therapeutic standpoint, since transforming proteins may represent novel and specific targets for tumor therapy
Several different techniques can be used to demonstrate amplified genomic sequences Classical cytogenetic analysis of chromosome spreads prepared from cancer cells is adequate to identify gross structural alterations, such as translocations, deletions and inversions Amplified genomic regions can only be visualized, if they involve large regions with high copy numbers or are present as extrachromosomal material While cytogenetics was the first technique to demonstrate the consistent association of specific chromosomal changes with particular neoplasms, it is inadequate for the identification and isolation of manageable DNA sequences The more recently developed technique of comparative genomic hybridization (CGH) has illustrated the widespread phenomenon of genomic amplification in neoplasms Tumor and normal DNA are hybridized simultaneously onto metaphases of normal cells and the entire genome can be screened by image analysis for DNA sequences that are present in the tumor at an increased frequency (WQ 93/18, 186, Gray et al . Radiation Res . 137 275-289 [1994]) As a scree ng method, this type of analysis has revealed a large number of recurring amphcons (a stretch of amplified DNA) in a variety of human neoplasms Although CGH is more sensitne than classical cytogenetic analysis in identifying amplified stretches of DNA, it does not allow a rapid identification and isolation of coding sequences within the amphcon by standard molecular genetic techniques The most sensitive methods to detect gene amplification are polymerase chain reaction (PCR)-based assays
These assays utilize very small amount of tumor DNA as starting material, are exquisitely sensitive, provide DNA that is amenable to further analysis, such as sequencing and are suitable for high-volume throughput analysis
The above-mentioned assays are not mutually exclusive, but are f I equently used in combination to identify amplifications in neoplasms While cytogenetic analysis and CGH represent screening methods to survey the entire genome for amplified regions, PCR-based assays are most suitable for the final identification of coding sequences, i e , genes in amplified regions
According to the present invention, such genes have been identified by quantitative PCR (S Gelmini et al , Chn Chem , 43 752 [1997]), by comparing DNA from a variety ot primary tumors, including bieast, lung, colon, prostate, brain, liver, kidney, pancreas, spleen, thy us, testis, ovary, uterus, etc , tumor, or tu oi cell lines, with pooled DNA from healthy donors Quantitative PCR w as perfoimed using a TaqMan instiument (ABI) Gene-specific pπmeis and fluorogenic probes were designed based upon the coding sequences ot the DNAs
Human lung carcinoma cell lines include A549 (SRCC768), Calu- 1 (SRCC769), Calu-6 (SRCC770), HI 57 (SRCC771 ), H441 (SRCC772) H460 (SRCC773), SKMES-1 (SRCC774), SW900 (SRCC775), H522 (SRCC832),and H810 (SRCC833), all available from ATCC Primary human lung tumor cells usually derive from adenocarcinomas, squamous cell carcinomas, large cell carcinomas, non-small cell carcinomas, small cell carcinomas, and broncho alveolar carcinomas, and include, for example, SRCC724 (adenocarcinoma, abbreviated as "AdenoCa")(LTl ), SRCC725 (squamous cell carcinoma, abbreviated as "SqCCa)(LTl a), SRCC726 (adenocarcιnoma)(LT2), SRCC727 (adenocarcιnoma)(LT3), SRCC728 (adenocarcιnoma)(LT4), SRCC729 (squamous cell carcιnoma)(LT6), SRCC730 (adeno/squamous cell carcιnoma)(LT7), SRCC731 (adenocarcιnoma)(LT9), SRCC732 (squamous cell carcιnoma)(LT10), SRCC733 (squamous cell carcιnoma)(LTl 1 ), SRCC734 (adenocarcmoma)(LT12), SRCC735 (adeno/squamous cell carcιnoma)(LT13), SRCC736 (squamous cell carcιnoma)(LTl 5), SRCC737 (squamous cell carcιnoma)(LTl 6), SRCC738 (squamous cell carcinomaXLTl 7), SRCC739 (squamous cell carcιnoma)(LTl 8), SRCC740 (squamous cell carcιnoma)(LTl 9), SRCC741 (lung cell carcinoma, abbreviated as "LCCa")(LT21), SRCC81 1 (adenocarcιnoma)(LT22), SRCC825 (adenocarcιnoma)(LT8), SRCC886 (adenocarcιnoma)(LT25), SRCC887 (squamous cell carcinoma) (LT26), SRCC888 (adeno-BAC carcinoma) (LT27), SRCC889 (squamous cell carcinoma) (LT28), SRCC890 (squamous cell carcinoma) (LT29). SRCC891 (adenocarcinoma) (LT30), SRCC892 (squamous cell carcinoma) (LT31 ), SRCC894 (adenocarcinoma) (LT33) Also included are human lung tumors designated SRCC1 125 [HF-000631 ], SRCC1127 [HF-000641], SRCC1 129 [HF-000643], SRCC1 133 [HF-000840], SRCC1 135 [HF-000842], SRCC1227 [HF-001291], SRCC1229 [HF-001293], SRCC1230 [HF-001294], SRCC1231 [HF-001295], SRCC1232 [HF-001296], SRCC1233 [HF-001297], SRCC1235 [HF-001299], and SRCC1236 [HF-001300]
Colon cancer cell lines include, for example, ATCC cell lines SW480 (adenocarcinoma, SRCC776), SW620 (lymph node metastasis of colon adenocarcinoma, SRCC777), Colo320 (carcinoma, SRCC778), HT29 (adenocarcinoma, SRCC779), HM7 (a high mucin producing variant of ATCC colon adenocarcinoma cell line, SRCC780, obtained fromDr Robert Warren, UCSF), CaWiDr (adenocarcinoma, SRCC781 ), HCT1 16 (carcinoma, SRCC782), SKCOl (adenocarcinoma, SRCC783), SW403 (adenocarcinoma, SRCC784), LS174T (carcinoma, SRCC785), Colo205 (carcinoma, SRCC828), HCT15 (carcinoma, SRCC829), HCC2998 (carcinoma, SRCC830), and KM 12 (carcinoma, SRCC831 ) Primary colon tumors include colon adenocarcinomas designated CT2 (SRCC742), CT3 (SRCC743) ,CT8 (SRCC744), CT10 (SRCC745), CT12 (SRCC746), CT14 (SRCC747), CTI5 (SRCC748), CT16 (SRCC749), CT17 (SRCC750), CT1 (SRCC751 ), CT4 (SRCC752), CT5 (SRCC753), CT6 (SRCC754), CT7 (SRCC755), CT9 (SRCC756), CT1 1 (SRCC757), CT18 (SRCC758), CT19 (adenocarcinoma, SRCC906), CT20 (adenocarcinoma, SRCC907), CT21 (adenocarcinoma, SRCC908), CT22 (adenocarcinoma, SRCC909). CT23 (adenocarcinoma. SRCC910), CT24 (adenocarcinoma. SRCC91 1 ), CT25 (adenocarcinoma, SRCC912), CT26 (adenocarcinoma, SRCC913), CT27 (adenocarcinoma, SRCC914),CT28 (adenocarcinoma, SRCC915), CT29 (adenocarcinoma, SRCC916), CT30 (adenocarcinoma, SRCC917), CT31 (adenocarcinoma. SRCC918), CT32 (adenocarcinoma. SRCC919), CT33 (adenocarcinoma, SRCC920), CT35 (adenocarcinoma, SRCC921 ). and CT36 (adenocarcinoma, SRCC922) Also included are human colon tumor centers designated SRCC 1051 [HF-000499], SRCC 1052 [HF-000539], SRCC1053 [HF-000575], SRCC1054 [HF-000698] SRCC1 142 [HF-000762], SRCC 1 144 [HF-000789], SRCC1 146 [HF-000795] and SRCC1 148[HF-00081 1 ]
Human breast carcinoma cell lines include, tor example. HBL100 (SRCC759), MB435s (SRCC760), T47D (SRCC761 ), MB468(SRCC762), MB 175 (SRCC763), MB361 (SRCC764), BT20 (SRCC765), MCF7 (SRCC766), and SKBR3 (SRCC767), and human breast tumor center designated SRCC1057 [HF-000545] Also included are human breast tumors designated SRCC1094, SRCC1095, SRCC1096, SRCC1097, SRCC1098, SRCC1099, SRCC1 100, SRCC1 101 , and human breast met-lung-NS tumor designated SRCC893 [LT 32]
Human kidney tumor centers include SRCC989 [HF-00061 1 ] and SRCC1014 [HF-000613] Human testis tumor center includes SRCC1001 [HF 000733] and testis tumor margin SRCC999 [HF-
000716]
Human parathyroid tumor includes SRCC1002 [HF-000831 ] and SRCC1003 [HF-000832]
F Tissue Distribution
The results of the gene amplification assays herein can be verified by further studies, such as, by determining mRNA expression in various human tissues
As noted before, gene amplification and/or gene expression in various tissues may be measured by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc Natl Acad Sci USA.77 5201-5205 [1980]), dotblottιng(DNA analysιs), or « situ hybridization, using an appropriately labeled probe, based on the sequences provided herein Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes
Gene expression in various tissues, alternatively, may be measured by immunological methods, such as lmmunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product Antibodies useful for lmmunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal Conveniently, the antibodies may be prepared against a native sequence PR0213, PRO 1330, PRO 1449, PR0237 PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to sequence PR0213 PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362 PR0615 PR0531 , PR0538, PR03664, PR0618 PR0772, PRO703, PR0792 or PR0474 DNA and encoding a specific antibody epitope General techniques for generating antibodies, and special protocols for Northern blotting and /// situ hybridization are provided hereinbelow
G Chromosome Mapping
If the amplification ot a given gene is functionally relevant, then that gene should be amplified more than neighboring genomic regions which are not important for tumor survival To test this the gene can be mapped to a particular chromosome, e g , by radiation-hybrid analysis The amplification level is then determined at the location identified, and at the neighboring genomic region Selective or preferential amplification at the genomic region to which the gene has been mapped is consistent with the possibility that the gene amplification observed promotes tumor growth or survival Chromosome mapping includes both framework and epicenter mapping For further details see e g , Stewart et al , Genome Research. _ 1 422-433 (1997) H Antibody Binding Studies
The results of the gene amplification study can be further verified by antibody binding studies, in which the ability of antι-PR0213, anti-PROl 330, anti-PRO 1449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, anti-PROόl 8, antι-PR0772, antι-PRO703, anti PR0792 or antι-PR0474 antibodies to inhibit the expression of PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptides on tumor (cancer) cells is tested Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies, the preparation of which will be described hereinbelow
Antibody binding studies may be carried out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays Zola, Monoclonal Antibodies A Manual of Techniques, pp 147-158 (CRC Press, Inc , 1987)
Competitive binding assays rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody The amount of target protein (encoded by a gene amplified in a tumor cell) in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies To facilitate determining the amount of standard that becomes bound, the antibodies preferably are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound
Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected In a sandwich assay, the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex See, e g , U S Patent No 4,376,1 10 The second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay) For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme For lmmunohistochemistry, the tumor sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example
I Cell-Based Tumor Assays
Cell-based assays and animal models for tumors (e g , cancers) can be used to verify the findings of the gene amplification assay, and further understand the relationship between the genes identified herein and the development and pathogenesis of neoplastic cell growth The role ot gene products identified herein in the development and pathology of tumor or cancer can be tested by using primary tumor cells or cells lines that have been identified to amplify the genes herein Such cells include, for example, the breast colon and lung cancer cells and cell lines listed above
In a different approach, cells of a cell type known to be involved in a particular tumor are transfected with the cDNAs herein and the ability of these cDNAs to induce excessive growth is analyzed Suitable cells include for example, stable tumor cells lines such as, the B 104 1- 1 cell line (stable NIH-3T3 cell line transfected with the neu protooncogene) and tas transfected NIH-3T3 cells, which can be transfected with the desired gene, and monitored for tumorogenic growth Such transfected cell lines can then be used to test the ability of poly- or monoclonal antibodies or antibody compositions to inhibit tumorogenic cell growth by exerting cytostatic or cytotoxic activity on the growth of the transformed cells, or by mediating antibody-dependent cellular cytotoxicity (ADCC) Cells transfected with the coding sequences of the genes identified herein can further be used to identify drug candidates for the treatment of cancer
In addition, primary cultures derived from tumors in transgenic animals (as described below) can be used in the cell-based assays herein, although stable cell lines are preferred Techniques to derive continuous cell lines from transgenic animals are well known in the art (see, e g , Small et al , Moi Cell Biol , 5 642-648 [1985])
J Animal Models A variety of well known animal models can be used to further understand the role of the genes identified herein in the development and pathogenesis of tumors, and to test the efficacy of candidate therapeutic agents, including antibodies, and other antagonists of the native polypeptides, including small molecule antagonists The in vivo nature of such models makes them particularly predictive of responses in human patients Animal models of tumors and cancers (e g , breast cancer, colon cancer, prostate cancer, lung cancer, etc ) include both non- recombinant and recombinant (transgenic) animals Non-recombinant animal models include, for example, rodent, e g , murine models Such models can be generated by introducing tumor cells into syngeneic mice using standard techniques, e g , subcutaneous injection, tail vein injection, spleen implantation, lntrapeπtoneal implantation, implantation under the renal capsule, or orthopin implantation, e g , colon cancer cells implanted in colonic tissue (See, e g , PCT publication No WO 97/33551, published September 18, 1997) Probably the most often used animal species in oncological studies are lmmunodeficient mice and, in particular, nude mice The observation that the nude mouse with hypo/aplasia could successfully act as a host for human tumor xenografts has lead to its widespread use for this purpose The autosomal recessive nu gene has been introduced into a very large number of distinct congenic strains of nude mouse, including, for example, ASW, A/He, AKR BALB/c, B 10 LP, C17 C3H, C57BL, C57, CBA DBA DDD, I/st, NC, NFR, NFS, NFS/N NZB, NZC, NZW P, RIII and SJL In addition, a wide variety of other animals with inherited immunological defects other than the nude mouse have been bred and used as recipients ot tumor xenografts For further details see, e g , The Nude Mouse in Oncology Research, E Boven and B Winograd eds CRC Press, Inc , 1991
The cells introduced into such animals can be derived from known tumor/cancer cell lines, such as, any of the above-listed tumor cell lines, and, for example, the B 104- 1 -1 cell line (stable NIH-3T3 cell line transfected with the neu protooncogene), las transfected NIH 3T3 cells Caco-2 (ATCC HTB 37), a moderately well differentiated grade II human colon adenocarcinoma cell line HT-29 (ATCC HTB-38), or from tumors and cancers Samples of tumor or cancer cells can be obtained from patients undergoing surgery, using standard conditions involv ing freezing and storing in liquid nitrogen (Karmali et al Bi J Cancer, 48 689-696 [1983])
Tumor cells can be introduced into animals such as nude mice, by a variety of procedures The subcutaneous (s c ) space in mice is very suitable for tumor implantation Tumors can be transplanted s c as solid blocks, as needle biopsies by use of a trochai , or as cell suspensions For solid block or trochar implantation, tumor tissue fragments of suitable size are introduced into the s c space Cell suspensions are freshly prepared from
7" primary tumors or stable tumor cell lines, and injected subcutaneously Tumor cells can also be injected as subdermal implants In this location, the inoculum is deposited between the lower part of the dermal connective tissue and the s c tissue Boven and Winograd (1991), supra
Animal models of breast cancer can be generated, for example, by implanting rat neuroblastoma cells (from which the neu oncogen was initially isolated), or Hen-transformed NIH-3T3 cells into nude mice, essentially as described by Drebin et al , PNAS USA, 83 9129-9133 (1986)
Similarly, animal models of colon cancer can be generated by passaging colon cancer cells in animals, e g , nude mice, leading to the appearance of tumors in these animals An orthotopic transplant model of human colon cancer in nude mice has been described, for example, by Wang et al , Cancer Research, 54 4726-4728 ( 1994) and Too etal , Cancer Research. 55 681-684 (1995) This model is based on the so-called "METAMOUSE" sold by AntiCancer, Inc , (San Diego, California)
Tumors that arise in animals can be removed and cultured in vitt o Cells from the in viti o cultures can then be passaged to animals Such tumors can serve as targets for further testing or drug screening Alternatively, the tumors resulting from the passage can be isolated and RNA from pre passage cells and cells isolated after one or more rounds of passage analyzed for differential expression of genes of interest Such passaging techniques can be performed with any known tumor or cancer cell lines
For example, Meth A, CMS4, CMS5, CMS21 , and WEHI-164 are chemically induced fibrosarcomas of BALB/c female mice (DeLeo et al , J Exp Med . 146 720 [1977]), which provide a highly controllable model system for studying the anti-tumor activities of various agents (Palladino et al , J Immunol , 138 4023-4032 [1987]) Briefly, tumor cells are propagated in vitro in cell culture Prior to injection into the animals, the cell lines are washed and suspended in buffer, at a cell density of about lOxl O6 to 10xl07 cells/ml The animals are then infected subcutaneously with 10 to 100 μl of the cell suspension, allowing one to three weeks for a tumor to appear
In addition, the Lewis lung (3LL) carcinoma of mice, which is one of the most thoroughly studied experimental tumors, can be used as an investigational tumor model Efficacy in this tumor model has been correlated with beneficial effects m the treatment of human patients diagnosed with small cell carcinoma of the lung (SCCL) This tumor can be introduced in normal mice upon injection of tumor fragments from an affected mouse or of cells maintained in culture (Zupi et al , Br J Cancer, 41 suppl 4 309 [ 1980]), and evidence indicates that tumors can be started from injection of even a single cell and that a very high proportion of infected tumor cells survive For further information about this tumor model see, Zacharski, Haemostasis J6 300-320 [1986]) One way of evaluating the efficacy of a test compound in an animal model on an implanted tumor is to measure the size of the tumor before and after treatment Traditionally, the size ot implanted tumors has been measured with a slide caliper in two or three dimensions The measure limited to two dimensions does not accurately reflect the size of the tumor, therefore it is usually converted into the corresponding volume by using a mathematical formula However, the measurement of tumor size is very inaccurate The therapeutic effects of a drug candidate can be better described as treatment-induced giowth delay and specific growth delay Anothei important variable in the description of tumor growth is the tumor volume doubling time Computer programs for the calculation and description of tumor growth are also available, such as the program repoited by Rygaard and Spang Thomsen Proc 6th Int Workshop on Immune-Deficient Animals, Wu and Sheng eds Basel, 1989, 301 It is noted, however, that necrosis and inflammatory responses following treatment may actually result in an increase in tumor size, at least initially Therefore, these changes need to be carefully monitored, by a combination of a morphometπc method and flow cytometπc analysis
Recombinant (transgenic) animal models can be engineered by introducing the coding portion of the genes identified herein into the genome of animals of interest, using standard techniques for producing transgenic animals Animals that can serve as a target for transgenic manipulation include, without limitation, mice, rats, rabbits, guinea pigs, sheep, goats, pigs, and non-human primates, e g , baboons, chimpanzees and monkeys Techniques known in the art to introduce a transgene into such animals include pronucleic microinjection (Hoppe and Wanger, U S Patent No 4,873,191), retrovirus-mediated gene transfer into germ lines (e g , Van der Putten et al , Proc Natl Acad Sci USA, 82 6148-615 [1985]), gene targeting in embryonic stem cells (Thompson etal , Cell, 56 313-321 [1989]), electroporation of embryos (Lo, Moi Cell Biol , 3 1803-1814 [1983]), sperm mediated gene transfer (Lavitrano et al , Cell, 5 717-73 [1989]) For review, see, for example, U S Patent No 4,736,866
For the purpose of the present invention, transgenic animals include those that carry the transgene only in part of their cells ("mosaic animals") The transgene can be integrated either as a single transgene, or in concatamers, e g , head-to-head or head-to-tail tandems Selective introduction of a transgene into a particular cell type is also possible by following, for example, the technique of Lasko et al , Proc Natl Acad Sci USA, 89 6232- 636 (1992)
The expression of the transgene in transgenic animals can be monitored by standard techniques For example, Southern blot analysis or PCR amplification can be used to verify the integration of the transgene The level of mRNA expression can then be analyzed using techniques such as in situ hybridization, Northern blot analysis, PCR, oi lmmunocytochemistry The animals are further examined for signs of tumor or cancer development
Alternatively, "knock out" animals can be constructed which have a defective or altered gene encoding a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide identified herein, as a result of homologous recombination between the endogenous gene encoding the polypeptide and altered genomic DNA encoding the same polypeptide introduced into an embryonic cell of the animal For example, cDNA encoding a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664 PR0618 PR0772, PRO703, PR0792 or PR0474 polypeptide can be used to clone genomic DNA encoding that polypeptide in accordance with established techniques A portion of the genomic DNA encoding a particular PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration Typically, several kilobases of unaltered flanking DNA (both at the 5 and 3' ends) are included in the vector [see e g , Thomas and Capecchi, Cell 51 503 (1987) for a description of homologous recombination vectors] The vectoi is introduced into an embryonic stem cell line (e g , by electroporation) and cells in which the introduced DNA has homologously recombined with the endogenous DNA are selected [see e g , Li et al , Cell, 69 915 (1992)] The selected cells are then injected into a blastocyst of an animal (e g , a mouse or rat) to form aggregation chimeras [ see e g Bradley, in Teraiocarcinomas and Embryonic Stem Cells A Practical Approach E J Robertson, ed (IRL, Oxford, 1987), pp 1 13 152] A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out' animal Progeny harboring the homologously recombined DNA in their germ cells can be identified by standard techniques and used to breed animals in which all cells of the animal contain the homologously recombined DNA Knockout animals can be characterized for instance, by their ability to defend against certain pathological conditions and by their development of pathological conditions due to absence of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
The efficacy of antibodies specifically binding the polypeptides identified herein and other drug candidates, can be tested also in the treatment of spontaneous animal tumors A suitable target for such studies is the feline oral squamous cell carcinoma (SCC) Feline oral SCC is a highly invasive, malignant tumor that is the most common oral malignancy of cats, accounting for over 60% of the oral tumors reported in this species It rarely metastasizes to distant sites, although this low incidence of metastasis may merely be a reflection of the short survival times for cats with this tumor These tumors are usually not amenable to surgery, primarily because of the anatomy of the feline oral cavity At present, there is no effective treatment for this tumor Prior to entry into the study, each cat undergoes complete clinical examination, biopsy, and is scanned by computed tomography (CT) Cats diagnosed with subhngual oral squamous cell tumors are excluded from the study The tongue can become paralyzed as a result of such tumor, and even if the treatment kills the tumor, the animals may not be able to feed themselves Each cat is treated repeatedly, over a longer period of time Photographs of the tumors will be taken daily during the treatment period, and at each subsequent recheck After treatment, each cat undergoes another CT scan CT scans and thoracic radiograms are evaluated every 8 weeks thereafter The data are evaluated for differences in survival, response and toxicity as compared to control groups Positive response may require evidence of tumor regression, preferably with improvement of quality of life and/or increased lite span
In addition, other spontaneous animal tumors, such as fibrosarcoma, adenocarcinoma, lymphoma, chrondroma, leiomyosarcoma of dogs, cats, and baboons can also be tested Of these mammary adenocarcinoma in dogs and cats is a preferred model as its appearance and behavior are very similai to those in humans However, the use of this model is limited by the rare occurrence of this type ot tumor in animals
K Screening Assays for Drug Candidates
Screening assays for drug candidates are designed to identity compounds that bind or complex with the polypeptides encoded by the genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins Such screening assa> s w ill include assays amenable to high throughput screening of chemical libraries, making them particularly suitable toi identifying small molecule drug candidates Small molecules contemplated include synthetic organic or inorganic compounds including peptides preferably soluble peptides, (poly)peptιde immunoglobulin fusions, and m particular antibodies including without limitation poly and monoclonal antibodies and antibody fragments, single chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments as well as human antibodies and antibody fragments The assays can be performed in a variety of formats including protein-prote binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art
All assays are common in that they call for contacting the drug candidate with a polypeptide encoded by a nucleic acid identified herein under conditions and for a time sufficient to allow these two components to interact In binding assays, the interaction is binding and the complex formed can be isolated or detected in the reaction mixture In a particular embodiment, the polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e g , on a microtiter plate, by covalent or non-covalent attachments Non- covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying Alternatively, an immobilized antibody, e g , a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface The assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e g , the coated surface containing the anchored component When the reaction is complete, the non-reacted components are removed, e g , by washing, and complexes anchored on the solid surface are detected When the originally non-immobilized component carries a detectable label, the detection of label immobilized on the surface indicates that complexing occuπed Where the originally non-immobilized component does not carry a label, complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex
If the candidate compound interacts with but does not bind to a particular PR0213 , PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide encoded by a gene identified herein, its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions Such assays include traditional approaches, such as, cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns In addition, protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co workers [Fields and Song, Nature, 340 245 246 (1989), Chien et αl , Proc Natl Acad Sci USA, 88 9578-9582 (1991 )] as disclosed by Chevray and Nathans, Proc Natl Acad Sci USA, 89 5789-5793 (1991)] Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, while the other one functioning as the transcription activation domain The yeast expression system described in the foregoing publications (generally, referred to as the "two-hybrid system") takes advantage of this propert}, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4 and another, in which candidate activating proteins are fused to the activation domain The expression of a GALl lαcL reporter gene under control ot a GAL4-actιvated promoter depends on reconstitution of GAL4 activity via prote -protein interaction Colonies containing interacting polypeptides are detected with a chromogenic substrate tor β-galactosidase A complete kit (MATCHMAKER™) for identifying protein-protein interactions between two specific proteins using the two hybrid technique is commercially available from Clontech This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions
Compounds that interfere with the interaction ofa PR0213-, PRO 1330 , PRO 1449 , PR0237 , PR0324 , PR0351 , PR0362-, PR0615-, PR0531-, PR0538 , PR03664-, PR0618-, PR0772 , PRO703-, PR0792- oi PR0474 encoding gene identified herein and other intra oi extracellular components can be tested as follows usually a reaction mixture is prepared containing the product of the amplified gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products To test the ability of a test compound to inhibit binding, the reaction is run in the absence and in the presence of the test compound In addition, a placebo may be added to a third reaction mixture, to serve as positive control The binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described hereinabove The formation of a complex in the control reactιon(s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner
To assay for antagonists, the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide may be added to a cell along with the compound to be screened for a particular activity and the ability of the compound to inhibit the activity of interest in the presence of the PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide indicates that the compound is an antagonist to the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide Alternatively, antagonists may be detected by combining the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and a potential antagonist with membrane-bound PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide receptors or recombinant receptors under appropriate conditions for a competitive inhibition assay The PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide can be labeled, such as by radioactivity, such that the number of PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 polypeptide molecules bound to the receptor can be used to determine the effectiveness of the potential antagonist The gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting Cohgan et al , Current Protocols in Immun . 1(2) Chapter 5 ( 1991 ) Preferably, expi ession cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PRO-538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide and a cDNA libraiy created from this RNA is divided into pools and used to transtect COS cells or other cells that are not responsive to the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664 PROόl 8, PR0772 PRO703, PR0792 or PR0474 polypeptide Transfected cells that are grown on glass slides are exposed to labeled PR0213, PRO 1330, PR01449, PR0237 PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618 PR0772, PRO703, PR0792 or PR0474 polypeptide The PR0213, PROl 30 PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PROS31 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide can be labeled by a variety of means including lodination or inclusion of a recognition site for a site-specific protein kinase Following fixation and incubation, the slides are subjected to autoradiographic analysis Positive pools are identified and sub-pools are prepared and re-transfected using an interactive sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor
As an alternative approach for receptor identification, labeled PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide can be photoaffimty-linked with cell membrane or extract preparations that express the receptor molecule Cross-linked material is resolved by PAGE and exposed to X ray film The labeled complex containing the receptor can be excised, resolved into peptide fragments, and subjected to protein micro-sequencing The amino acid sequence obtained from micro sequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor In another assay for antagonists, mammalian cells or a membrane preparation expressing the receptor would be incubated with labeled PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615,
PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in the presence of the candidate compound The ability of the compound to enhance or block this interaction could then be measured
More specific examples of potential antagonists include an oligonucleotide that binds to the fusions of immunoglobulin with the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments Alternatively, a potential antagonist may be a closely related protein, for example, a mutated form of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide that recognizes the receptor but imparts no effect, thereby competitively inhibiting the action of the PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PROS31 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide Another potential PR0213, PRO1330, PR01449, PR0237, PR0324 PR0351 PR0362, PR0615
PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where, e g , an antisense RNA or DNA molecule acts to block directly the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation Antisense technology can be used to control gene expression through tπple-hehx formation oi antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA For example, the 5' coding portion of the polynucleotide sequence, which encodes the mature PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664 PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide herein, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix see Lee et al , Nucl Acids Res . 6 3073 ( 1979) Cooney et al , Science, 241 456 (1988), Dervan et al , Science, 251 1360 ( 1991 )), thereby preventing transcription and the production of the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR061 PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide (antisense - Okano, Neurochem , 56 560 (1991 ), Oh odeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press Boca Raton, FL, 1988) The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide When antisense DNA is used, oligodeoxyπbonucleotides derived from the translation-initiation site, e g , between about -10 and 4-10 positions of the target gene nucleotide sequence, are preferred Antisense RNA or DNA molecules are generally at least about 5 bases in length, about 10 bases in length, about 15 bases in length, about 20 bases in length, about 25 bases in length, about 30 bases in length, about 35 bases in length, about 40 bases in length, about 45 bases in length, about 50 bases in length, about 55 bases in length, about 60 bases in length, about 65 bases in length, about 70 bases in length, about 75 bases in length, about 80 bases in length, about 85 bases in length, about 90 bases in length, about 95 bases in length, about 100 bases in length, or more
Potential antagonists include small molecules that bind to the active site, the receptor binding site, or growth factor or other relevant binding site of the PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, thereby blocking the normal biological activity of the PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792or PR0474 polypeptide Examples of small molecules include, but are not limited to, small peptides or peptide-hke molecules, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolvtic cleavage Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques For turthei details see, e g , Rossi, Current Biology, 4 469-471 (1994) and PCT publication No WO 97/335^ 1 (published
September 18, 1997)
Nucleic acid molecules in triple helix formation used to inhibit transcription should be single stranded and composed of deoxynucleotides The base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base-pairing rules, which generally require sizeable stretches of punnes oi pyπmidmes on one strand of a duplex For further details see. e g , PCT publication No WO 97/335 1 , supta
These small molecules can be identified by any one or more of the screening assays discussed hereinabov e and/or by any other screening techniques well known for those skilled in the art
L Compositions and Methods tor the Tieatment of Tumoi s The compositions useful in the treatment of tumors associated with the amplification ot the genes identified herein include without limitation, antibodies, small organic and inorganic molecules, peptides, phosphopeptides antisense and ribozyme molecules, triple helix molecules etc that inhibit the expression and/or actn ltv of the target gene product
For example, antisense RNA and RNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation When antisense DNA is used, oligodeoxyπbonucleotides derived from the translation initiation site, e g , between about -10 and +10 positions of the target gene nucleotide sequence, are preferred
Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage
Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques For further details see, e g , Rossi, Current Biology, 4469-471 (1994), and PCT publication No WO 97/33551 (published September 18, 1997)
Nucleic acid molecules in triple helix formation used to inhibit transcription should be single-stranded and composed of deoxynucleotides The base composition of these oligonucleotides is designed such that it promotes triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of punnes or pyπmidines on one strand of a duplex For further details see e g , PCT publication No WO 97/33551, supra These molecules can be identified by any or any combination of the screening assays discussed hereinabove and/or by any other screening techniques well known for those skilled in the art
M Antibodies
Some of the most promising drug candidates according to the present invention are antibodies and antibody fragments which may inhibit the production or the gene product of the amplified genes identified herein and/or reduce the activity of the gene products
1 Polyclonal Antibodies
Methods of preparing polyclonal antibodies are known to the skilled aitisan Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intrapentoneal injections The immunizing agent may include the PR0213, PRO 1330 PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772 PRO703, PR0792 oi PR0474 polypeptide or a fusion protein thereof It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin. serum albumin, bovine thyioglobuhn, and soybean trypsin inhibitoi Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate) The immunization protocol may be selected by one skilled in the art without undue experimentation
2 Monoclonal Antibodies
The antι-PR0213, anti-PRO 1330, anti-PRO 1449, antι-PR0237, anti PR0324, antι-PR0351 , antι-PR0362, antι-PR0615. anti PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, anti-PRO 792 or antι-PR0474 antibodies may, alternatively, be monoclonal antibodies Monoclonal antibodies may be prepared using hybndoma methods, such as those described by Kohler and Milstein, Nature, 256 495 ( 1975) In a hybndoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent Alternatively, the lymphocytes may be immunized in viti o
The immunizing agent will typically include the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, including fragments, or a fusion protein of such protein or a fragment thereof Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybndoma cell [Goding, Monoclonal Antibodies Principles and Practice, Academic Press, (1986) pp 59-103] Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin Usually, rat or mouse myeloma cell lines are employed The hybndoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the untused, immortalized cells For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoπbosyl transferase (HGPRT or HPRT), the culture medium foi the hybndomas typically will include hypoxanthine, aminopteπn, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells
Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection (ATCC) Manassas, Virginia Human myeloma and mouse-human heteromyeloma cell lines also have been described foi the production of human monoclonal antibodies [Kozbor. J Immunol , 1 3 3001 ( 1984) Brodeurero/ . Monoclonal Antibody Production Techniques and Applications. Marcel Dekker. Inc . New Yoik. (1987) pp 51 -63]
The culture medium in which the hybndoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against PR0213, PRO1330, PR01449 PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538 PRO3664, PRO618, PRO772, PRO703, PRO792oι PR0474 Pieterably the binding specificity of monoclonal antibodies produced by the hybndoma cells is determined by immunoprecipitation or b> an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme linked immunoabsorbent assay (ELISA) Such techniques and assays are known in the art The binding affinity of the monoclonal antibody can, 1 or example be determined by the Scatchard analysis of Munson and Pollard, Anal Biochem 107 220 ( 1980)
After the desired hybndoma cells are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra] Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium Alternati ely, the hybndoma cells may be grown in vivo as ascites in a mammal
The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as tor example protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography
The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U S Patent No 4,816,567 DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e g , by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies) The hybndoma cells of the invention serve as a preferred source of such DNA Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U S Patent No 4,816,567, Morrison et al , supra] or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide Such a non-immunoglobuhn polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody The antibodies may be monovalent antibodies Methods for preparing monovalent antibodies are well known in the art For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosshnking Alternatively, the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosshnking In vitro methods are also suitable for preparing monovalent antibodies Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art
3 Human and Humanized Antibodies
Theantι-PR0213, anti-PROl 330, anti-PRO 1449, antι-PR0237, antι-PR0324, anti PR0351 , anti PR0362, anti-PROόl 5, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibodies may further comprise humanized antibodies or human antibodies Humanized forms of non-human (e g muπne) antibodies are chimeric immunoglobulins immunoglobulin chains or fi agments thereof (such as Fv, Fab, Fab', F(ab'), or other antigen-binding subsequences ot antibodies) which contain minimal sequence derived from non-human immunoglobulin Humanized antibodies include human immunoglobulins (recipient antιbod>) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity In some instances, Fv framewoik residues of the human immunoglobulin are replaced by corresponding non-human residues Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all oi substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al , Nature, 321 522-525 (1986), Riechmann et al , Nature, 332 323-329 (1988), and Presta, Curr Op Struct Biol , 2 593-596 (1992)]
Methods for humanizing non-human antibodies are well known in the art Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human These non- human amino acid residues are often referred to as "import' residues, which are typically taken from an "import" variable domain Humamzation can be essentially performed following the method of Winter and co-workers [Jones et al , Nature. 321 522-525 (1986), Riechmann et al , Nature, 332 323-327 (1988), Verhoeyen et al , Science, 239 1534- 1536 ( 1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody Accordingly, such "humanized" antibodies are chimeric antibodies (U S Patent No 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies
Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter. J Moi Biol , 227 381 ( 1991 ), Marks et al , J Moi Biol , 222 581 (1991 )] The techniques of Cole et al , and Boerner et al , are also available for the preparation of human monoclonal antibodies (Cole etal , Monoclonal Antibodies and Cancer Therapy, Alan R Liss, p 77 (1985) and Boerner etal , J Immunol , 147(1 ) 86-95 (1991)] Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e g , mice in which the endogenous immunoglobulin genes have been partially or completely inactivated Upon challenge human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire This approach is described, for example, in U S Patent Nos 5,545,807, 5,545,806, 5,569,825, 5,625, 126, 5,633,425, 5,661 ,016, and in the following scientific publications Marks et al , Bio/Technology, 10 779 783 (1992), Lonberg etal , Nature, 368 856-859 (1994), Morrison Nature, 368 812 13 ( 1994). Fishwild et al . Nature Biotechnology 14 845-51 (1996), Neuberger, Nature Biotechnology, 14 826 (1996), Lonberg and Huszar. Intern Rev Immunol , 3 65-93 (1995)
4 Antibody Dependent Enzyme Mediated Prodrug Therapy (ADEPT)
The antibodies of the present invention may also be used in ADEPT by conjugating the antibody to a prodrug-activat g enzyme which converts a prodrug (e g , a peptidyl chemotherapeutic agent, see WO 81/01 145) to an active anti-cancer drug See, tor example, WO 88/07378 and U S Patent No 4,975,278
The enzyme component of the immunoconj ugate useful toi ADEPT includes any enzyme capable of acting on a prodrug in such as way so as to convert it into its moie activ e, cytotoxic form
Enzymes that are useful in the method of this invention include, but are not limited to, glycosidase, glucose oxidase, human lysosyme, human glucuromdase, alkaline phosphatase useful for converting phosphate-containing prodrugs into free drugs, arylsultatase useful for converting sulfate containing prodrugs into tree drugs, cytosine deammase useful tor converting non toxic 5-fluorocytosιne into the anti cancer drug 5-fluorouracιl, pioteases, such as serratia protease, thermolysin, subtihsin, carboxypeptidases (e s> , carboxypeptidase G2 and carboxypeptidase A) and cathepsins (such as cathepsins B and L), that are useful for converting peptide-contai ng prodrugs into free drugs, D-alanylcarboxypeptidases, useful for converting prodrugs that contain D-amino acid substituents, carbohydrate-cleaving enzymes such as β-galactosidase and neuraminidase useful for converting glycosylated prodrugs into free drugs, β lactamase useful tor converting drugs denvatized with β-lactams into free drugs, and penicillin amidases, such as penicillin Vamidase or penicillin G amidase, useful for converting diugs denvatized at their amme nitrogens with phenoxyacetyl or phenylacetyl groups, respectively, into free drugs Alternatively, antibodies with enzymatic activity, also known in the art as "abzymes" can be used to convert the prodrugs of the invention into free active drugs (see, e g , Massey, Nature, 328 457-458 (1987)) Antibody-abzyme conjugates can be prepared as described herein for delivery of the abzyme to a tumor cell population The enzymes of this invention can be covalently bound to the antι-PR0213 , anti-PRO 1330, anti-PRO 1449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, anti PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibodies by techniques well known in the art such as the use of the heterobifunctional cross-linking agents discussed above Alternatively, fusion proteins comprising at least the antigen binding region of the antibody of the invention linked to at least a functionally active portion of an enzyme of the invention can be constructed using recombinant DNA techniques well known in the art (see, e g , Neuberger et al , Nature, 312 604-608 ( 1984))
5 Bispecific Antibodies
Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens In the present case, one of the binding specificities is for the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 the other one is for any other antigen, and preferably for a cell surface protein or receptor or receptor subunit
Methods for making bispecific antibodies are known in the art Traditionally, the iecombinant production of bispecific antibodies is based on the co expression of two immunoglobulin heavy-chain/hght-chain pairs, where the two heavy chains have different specificities (Milstem and Cuello, Nature, 305 537-539 [ 1983]) Because of the random assortment of immunoglobulin heavy and light chains, these hybndomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure The purification of the correct molecule is usually accomplished by affinity chromatography steps Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker et al , EMBO J JO 3655-3659 (1991 ) Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences The fusion preferably is with an immunoglobulin heavy chain constant domain, comprising at least part of the hinge CH2, and CH3 regions It is preteπed to have the first heavy-cham constant region (CHI ) containing the site necessary for light-chain binding piesent in at least one ot the fusions DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host oiganism For turthei details of generating bispecific antibodies see, for example, Suresh et al , Methods in Enzymology, 121 210(1986)
According to another approach described in WO 96/2701 1 , the interface between a pair ot antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture The preferred interface comprises at least a part of the CH3 region of an antibody constant domain In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e g , tyrosine or tryptophan) Compensatory "cavities" of identical or similar size to the large side chaιn(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e g , alanine or threonine) This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers
Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e g , F(ab')2 bispecific antibodies) Techniques for generating bispecific antibodies from antibody fragments have been described in the literature For example, bispecific antibodies can be prepared using chemical linkage Brennan et al , Science, 229 81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab')2 fragments These fragments are reduced in the presence of the dithiol complexing agent sodium arsemte to stabilize vicinal dithiols and prevent intermolecular disulfide formation The Fab' fragments generated are then converted to thiomtrobenzoate (TNB) derivatives One of the Fab'-TNB derivatives is then reconverted to the Fab'- thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes
Fab' fragments may be directly recovered from E coli and chemically coupled to form bispecific antibodies Shalaby et al , J Exp Med , 175 217-225 (1992) describe the production of a fully humanized bispecific antibody F(ab')2 molecule Each Fab' fragment was separately secreted from E coli and subjected to directed chemical coupling in vitw to form the bispecific antibody The bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets
Vanous techniques for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described For example, bispecific antibodies have been produced using leucine zippers Kostelny et al , J Immunol . 148(5) 1547- 1553 (1992) The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab portions of two different antibodies by gene fusion The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers This method can also be utilized for the production of antibody homodimers The "diabody ' technology described by Holhnger et al , Proc Natl Acad Sci USA.90 6444-6448 ( 1993) has pi ovided an alternative mechanism for making bispecific antibody fragments The fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) by a linker which is too short to allow pairing between the two domains on the same chain Accordingly, the VH and VL domains of one fragment aie forced to pair with the complementai y VL and VH domains of another fragment, thereby forming two antigen-binding sites Another strategy tor making bispecific antibody fragments by the use ot single-chain Fv (sFv) dimers has also been reported See, Gruber et al , J Immunol 152 5368 ( 1994)
Antibodies with more than two valencies are contemplated For example, trispecif ic antibodies can be prepared Tutt et al , J Immunol . 147 60 ( 1991 ) Exemplary bispecific antibodies may bind to two different epitopes on a given polypeptide herein Alternatively, an anti-polypeptide arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e g , CD2, CD3, CD28, or B7), or Fc receptors for IgG (FcγR), such as FcγRI (CD64), FcγRII (CD32) and FcγRIII (CD16) so as to focus cellular defense mechanisms to the cell expressing the particular polypeptide Bispecific antibodies may also be used to localize cytotoxic agents to cells which express a particular polypeptide These antibodies possess a polypeptide binding arm and an arm which binds a cytotoxic agent or a radionuclide chelator, such as EOTUBE, DPTA, DOTA, or TETA Another bispecific antibody of interest binds the polypeptide and further binds tissue factor (TF)
6 Heteroco ugate Antibodies Heteroconjugate antibodies are composed of two covalently joined antibodies Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U S Patent No 4,676,980], and for treatment of HIV infection [WO 91/00360, WO 92/200373, EP 03089] It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosshnking agents For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond Examples of suitable reagents for this purpose include lminothiolate and methyl-4- mercaptobutyπmidate and those disclosed, for example, in U S Patent No 4,676,980
7 Effector function engineering
It may be desirable to modify the antibody of the invention with respect to effector function, so as to enhance the effectiveness of the antibody in treating cancer, for example For example, cyste e resιdue(s) may be introduced in the Fc region, thereby allowing interchain disulfide bond formation in this region The homodimenc antibody thus generated may have improved internalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC) See Caron et al , J Exp Med , 176 1191-1 195 ( 1992) and Shopes, J Immunol , 148 2918-2922 ( 1992) Homodimenc antibodies with enhanced anti-tumor acti vιt> may also be prepared using heterobifunctional cross-linkers as described in Wolff etal , Cancer Research, 53 2560 2565 (1993) Alternatively, an antibody can be engineered which has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities See, Ste enson et al , Anti-Cancer Drug Design, 3 219-230 (1989)
8 Immunoconiugates
The invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e g , an enzymatically activ e toxin ot bacterial, fungal, plant oi animal origin, or fragments thereof, or a small molecule toxin), or a radioactive isotope e , a radioconjugate)
Chemotherapeutic agents useful in the generation of such immunoconjugates have been described above
Enzymatically active protein toxins and fragments thereof which can be used include diphtheria A chain, nonbmding active fragments of diphtheria toxin, cholera toxin, botuhnus toxin exotoxin A chain (from Pseudomonas aei uginosa), ncin A chain, abπn A chain, modeccin A chain alpha-sarcin Aleui ites foidu proteins, dianthin proteins, Plntolaca amencana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin crot , sapaonana officinahs inhibitor, gelonin, saponn, mitogelhn, restnctocm, phenomycin, enomycin and the tncothecenes Small molecule toxins include, for example, cahcheamicins, maytansinoids, palytoxin and CC 1065 A variety of radionuchdes are available for the production of radioconjugated antibodies Examples include 12Bι, 13,I, 131In, ι"Y and 186Re
Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein coupling agents such as N-succmιmιdyl-3-(2-pyπdyldιthιol) propionate (SPDP), lminothiolane (IT), bifunctional derivatives of lmidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p-azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bιs-(p-dιazonιumbenzoyl)-ethylenedιamιne), diisocyanates (such as tolyene 2,6-dπsocyanate), and bis- active fluorine compounds (such as l,5-dιfluoro-2,4-dιnιtrobenzene) For example, a ncin lmmunotoxin can be prepared as described in Vitetta et al , Science, 238 1098 (1987) Carbon- 14-labeled 1 -ιsothιocyanatobenzyl-3 methyldiethylene tnaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody .See, W094/1 1026 In another embodiment, the antibody may be conjugated to a "receptor" (such as streptavidin) for utilization in tumor pretargetmg wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand ' (e g , avid ) which is conjugated to a cytotoxic agent (e g , a radionucleotide)
9 Immunoliposomes The antibodies disclosed herein may also be formulated as immunoliposomes Liposomes containing the antibody are prepared by methods known the art, such as described in Epstein etal , Proc Natl Acad Sci USA, 82 3688 (1985), Hwang et al , Proc Natl Acad Sci USA, 724030 (1980), and U S Patent Nos 4485,045 and 4,544,545 Liposomes with enhanced circulation time are disclosed in U S Patent No 5,01 ,556
Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphaudylchohne, cholesterol and PEG-denvatized phosphatidylethanolamine (PEG PE) Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al J Biol Chem . 257 286-288 (1982) via a disulfide interchange reaction A chemotherapeutic agent (such as Doxorubicin) is optionally contained within the hposome See, Gabizon efa/ , J National Cancer Inst 81(19) 1484 (1989)
N Pharmaceutical Compositions
Antibodies specifically binding the product of an amplified gene identified herein, as well as othei molecules identified by the screening assays disclosed heieinbefore, can be administered tor the tieatment of tumors including cancers, in the form ot pharmaceutical compositions If the protein encoded by the amplified gene is mtracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred However, lipofections or liposomes can also be used to deliver the antibod) or an antibody fragment into cells Where antibody fragments are used, the smallest inhibitory fragment which specifically binds to the binding domain of the target protein is preferred For example, based upon the variable region sequences of an antibody, peptide molecules can be designed which retain the ability to bind the target protein sequence Such peptides can be synthesized chemically and/or produced by recombinant DNA technology (see, e g , Marasco et l , Proc Natl Acad Sci USA, 90 7889-7893 [1993])
Therapeutic formulations ot the antibody are prepared for storage by mixing the antibody having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences. 16th edition, Osol, A ed [1980]), in the form of lyophilized formulations or aqueous solutions Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids, antioxidants including ascorbic acid and methionine, preservatives (such as octadecyldimethylbenzyl ammonium chloride, hexamethomum chloride, benzalkomum chloride, benzethomum chloride, phenol, butyl or benzyl alcohol, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, 3-pentanol, and /w-cresol), low molecular weight (less than about 10 residues) polypeptides, proteins, such as serum albumin, gelatin, or immunoglobulins, hydrophilic polymers such as polyvinylpyrrohdone, amino acids such as glycine, glutamine, asparagme, histidine, arginine, or lysine, monosacchandes, disacchandes, and other carbohydrates including glucose, mannose, or dextnns, chelating agents such as EDTA, sugars such as sucrose, mannitol, trehalose or sorbitol, salt-forming counter-ions such as sodium, metal complexes (e g , Zn-protein complexes), and/or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG) Non-antibody compounds identified by the screening assays of the present invention can be formulated in an analogous manner, using standard techniques well known in the art
The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other Alternatively, or in addition, the composition may comprise a cytotoxic agent, cytokine or growth inhibitor) agent Such molecules are suitably present in combination in amounts that are effective tor the purpose intended
The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by mterfacial polymerization, for example, hydroxymethylcellulose or gelatin microcapsules and poly- (methylmethacylate) microcapsules, respectively, in colloidal diug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano particles and nanocapsules) or in macroemulsions Such techniques are disclosed in Remington s Pharmaceutical Sciences, 16th edition, Osol A ed (1980)
The formulations to be used for /// vivo administration must be sterile This is readily accomplished by filtration through sterile filtration membranes
Sustained-release preparations may be prepared Suitable examples ot sustained release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e g , films or microcapsules Examples ot sustained-release matrices include polyesters hydrogels (for example, poly(2 hydroxyethyl-methacrylate) or poly(vιnylalcohol)), polylactides (U S Pat No 3,773,919), copolymers of L glutamic acid and ethyl L glutamate, non degradable ethylene vinyl acetate degradable lactic acid glycolic acid copolymers such as the LUPRON DEPOT ™ (injectable microspheres composed of lactic acid-glycohc acid copolymer and leuprohde acetate), and poly-D-(-)-3-hydroxybutyπc acid While polymers such as ethylene-vinyl acetate and lactic acid-glycohc acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in lmmunogemcity Rational strategies can be devised for stabilization depending on the mechanism involved For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophihzing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions
O Methods of Treatment
It is contemplated that the antibodies and other anti -tumor compounds of the present invention may be used to treat various conditions, including those characterized by overexpression and/or activation of the amplified genes identified herein Exemplary conditions or disorders to be treated with such antibodies and other compounds, including, but not limited to, small organic and inorganic molecules, peptides, antisense molecules, etc , include benign or malignant tumors (e g , renal, liver, kidney, bladder, breast, gastric, ovarian, coloiectal, prostate, pancreatic, lung, vulval, thyroid, hepatic carcinomas, sarcomas, ghoblastomas, and various head and neck tumors), leukemias and lymphoid malignancies, other disorders such as neuronal, ghal, astrocytal, hypothalamic and other glandular, macrophagal, epithelial, stromal and blastocoehc disorders, and inflammatory, angiogemc and lmmunologic disorders The anti-tumor agents of the present invention, e g , antibodies, are administered to a mammal, preferably a human, in accord with known methods, such as intravenous administration as a bolus or by continuous infusion over a period of time, by intramuscular, intrapentoneal, intracerobrospinal subcutaneous, intra-articulai , intrasynovial, intrathecal, oral, topical, or inhalation routes Intravenous administration of the antibody is preferred
Other therapeutic regimens may be combined with the administration ot the anti-cancer agents, e g , antibodies of the instant invention For example, the patient to be treated with such anti-cancer agents may also receive radiation therapy Alternatively, or in addition, a chemotherapeutic agent may be administered to the patient Preparation and dosing schedules for such chemotherapeutic agents may be used according to manufacturers' instructions or as determined empirically by the skilled practitioner Preparation and dosing schedules for such chemotherapy are also described in Chemotherapy Service Ed , M C Perry, Williams &Wιlkms, Baltimore, MD (1992) The chemotherapeutic agent may precede or follow administration of the anti-tumor agent, e g , antibody, or may be given simultaneously therewith The antibody may be combined with an anti-oestrogen compound such as tamoxifen or an anti-progesterone such as onapπstone (see. EP 616812) in dosages known for such molecules
It may be desirable to also administer antibodies against other tumor associated antigens such as antibodies which bind to the ErbB2, EGFR, ErbB3, ErbB4, or vascular endothelial factor (VEGF) Alternatively, or in addition, two or more antibodies binding the same or two or more different antigens disclosed herein may be co- adrmnistered to the patient Sometimes, it may be beneficial to also administer one or more cytokines to the patient In a preferred embodiment, the antibodies herein are co-administered with a growth inhibitory agent For example, the growth inhibitory agent may be administered first, followed by an antibody of the present invention However, simultaneous administration or administration of the antibody of the present invention first is also contemplated Suitable dosages for the growth inhibitory agent are those presently used and may be lowered due to the combined action (synergy) of the growth inhibitory agent and the antibody herein
For the pi evention or treatment of disease, the appropriate dosage of an anti-tumor agent, e g , an antibody herein will depend on the type of disease to be treated, as defined above, the severity and course of the disease whether the agent is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the agent, and the discretion of the attending physician The agent is suitably administered to the patient at one time or over a series of treatments
For example, depending on the type and severity of the disease, about 1 μg/kg to 15 mg/kg (e g , 0 1 -20 mg/kg) of antibody is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion A typical daily dosage might range from about 1 μg/kg to 100 mg/kg or more, depending on the factors mentioned above For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until a desired suppression of disease symptoms occurs However, other dosage regimens may be useful The progress of this therapy is easily monitored by conventional techniques and assays
P Articles of Manufacture
In another embodiment of the invention, an article of manufacture containing materials useful for the diagnosis or treatment of the disorders described above is provided The article of manufacture comprises a container and a label Suitable containers include, for example, bottles, vials, syringes, and test tubes The containers may be formed from a variety of materials such as glass or plastic The container holds a composition which is effective for diagnosing or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic inaction needle) The active agent in the composition is usually an anti-tumor agent capable of interfering with the activitv of a gene product identified herein, e g , an antibody The label on or associated with, the container indicates that the composition is used for diagnosing or treating the condition of choice The article of manufacture may turthei comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline Ringer's solution and dextrose solution It may further include other materials desirable from a commercial and usei standpoint, including other buffers, diluents, f lltei s, needles, syringes, and package inserts with instructions tor use
Q Diagnosis and Prognosis of Tumois
While cell surface pioteins, such as growth receptors ov erexpressed in certain tumors are excellent targets for drug candidates or tumor (e g cancer) treatment, the same proteins along with secreted proteins encoded bv the genes amplified in tumor cells find additional use in the diagnosis and prognosis ot tumoi s For example antibodies directed against the piotem products of genes amplified in tumor cells can be used as tumor diagnostics or prognostics For example, antibodies, including antibody fragments, can be used to qualitatively or quantitatively detect the expression of proteins encoded by the amplified genes ("marker gene products") The antibody preferably is equipped with a detectable, e g , fluorescent label, and binding can be monitored by light microscopy, flow cytometry, fluoπmetry, or other techniques known in the art These techniques are particularly suitable, if the amplified gene encodes a cell surface protein, e g , a growth factor Such binding assays are performed essentially as described in section 5 above
In situ detection of antibody binding to the marker gene products can be performed, for example, by immunofluorescence or immunoelectron microscopy For this purpose, a histological specimen is removed from the patient, and a labeled antibody is applied to it, preferably by overlaying the antibody on a biological sample This procedure also allows for determining the distribution of the marker gene product in the tissue examined It will be apparent for those skilled in the art that a wide variety of histological methods are readily available for in situ detection
The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety
EXAMPLES Commercially available reagents referred to in the examples were used according to manufacturer's instructions unless otherwise indicated The source of those cells identified in the following examples, and throughout the specification, by ATCC accession numbers is the American Type Culture Collection, 10801 University Blvd , Manassas, VA 201 10-2209 All original deposits referred to in the present application were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty) This assures maintenance of a viable culture of the deposit tor 30 years from the date ot deposit The deposit will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc , and ATCC, which assures permanent and unrestricted availability of the progeny of the culture ot the deposit to the public upon issuance of the pertinent U S patent or upon laying open to the public ot any U S or foreign patent application whichever comes first, and assures availability ot the progeny to one determined by the U S Commissioner ot Patents and Trademarks to be entitled thereto according to 35 USC 122 and the Commissioner's tules pursuant thereto (including 37 CFR § 1 14 with particulai reference to 886 OG 638)
Unless otherwise noted, the present invention uses standard piocedures of recombinant DNA technolog) such as those described hereinabove and in the following textbooks Sambrook et al , Molecular Cloning A Laboratory Manual. Cold Spring Harbor Press N Y , 1989, Ausubel etal . Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience N Y , 1989, Innis eta! , PCR Protocols A Guide to Methods and Applications. Academic Press. Inc , N Y , 1990, Harlow et al . Antibodies A Laboratory Manual Cold Spring Harbor Press. Cold Spring Harbor. 1988 Gait, Oligonucleotide Synthesis, IRL Press, Oxford, 1984, R I Fieshney, Animal Cell Culture, 1987. Cohgan et al . Current Protocols in Immunology, 1991 EXAMPLE 1
Isolation of cDNA clones Encoding PRQ213, PRO 1330 and PROl 449
The extracellular domain (ECD) sequences (including the secretion signal, if any'1 from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search various expressed sequence tag (EST) databases The EST databases included a proprietary EST DNA database (LIFESEQ®, Incyte
Pharmaceuticals, Palo Alto, CA) The search was performed using the computer program BLAST or BLAST2
(Altshul et al , Methods in Enzymology, 266 460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases
90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington)
A consensus DNA sequence was assembled relative to other Incyte EST sequences using phrap This consensus sequence is herein designated DNA28735 Based on the DNA28735 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of PR0213, PRO1330 and PR01449 full-length coding sequences Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 - 1 5kbp In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology, with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs A pair of PCR primers (forward and reverse) were synthesized forward PCR primer
5'-TGGAGCAGCAATATGCCAGCC-3' (SEQ ID NO 34) reverse PCR primer 5'-TTTTCCACTCCTGTCGGGTTGG-3' (SEQ ID NO 35)
Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA28735 sequence which had the following nucleotide sequence hybridization probe
5,-GGTGACACTTGCCAGTCAGATGTGGATGAATGCAGTGCTAGGAGGG-3' (SEQ ID NO 36) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0213, PRO1330 and/or PR01449 gene using the probe oligonucleotide and one ot the PCR primers
RNA for construction of the cDNA libraries was isolated from human fetal lung tissue The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commeicially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appiopπately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the St ii site, see, Holmes et al . Science, 253 1278- 1280 ( 1 91 )) in the unique Xhol and Notl sites
DNA sequencing of the clones isolated as described above gave the full-length DNA sequence encoding PRO 1330 (DNA64907- 1 163, SEQ ID NO 5, Figure 5), PRO 1449 (DNA64908- 1 163, SEQ ID NO 7, Figure 7) and PR0213 (DNA30943-1163, SEQ ID NO 3, Figure 3)
DNA30943-1 163 (SEQ ID NO 3), DNA64907-1 163 (SEQ ID NO 5) and DNA64908-1 163 (SEQ ID NO 7) contain single open reading frames with apparent translational initiation sites at nucleotide positions 399-401 , 488-490 and 326-328, respectively, and ending at the stop codons at nucleotide positions 1218-1220, 1307-1309 and 1145-1 147, respectively (Figures 3, 5 and 7, respectively) The predicted polypeptide precursors are 273, 273 and 273 amino acids long, respectively (Figures 4, 6 and 8, respectively) Analysis ot the full-length PR0213, PRO 1330 and PRO 1449 sequences shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6) and Figure 8 (SEQ ID NO 8), respectively evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 19, cAMP- and cGMP-dependent protein kinase phosphorylation sites from about amino acid 93 to about amino acid 97 and from about amino acid 270 to about amino acid 274, N-myπstoylation sites from about amino acid 19 to about amino acid 25, from about ammo acid 78 to about ammo acid 84, from about amino acid 97 to about amino acid 103, from about amino acid 100 to about amino acid 106, from about amino acid 103 to about amino acid 109, from about amino acid 157 to about amino acid 163, from about ammo acid 191 to about amino acid 197 and from about amino acid 265 to about amino acid 271 , an amidation site from about amino acid 26 to about ammo acid 30, an aspartic acid and asparagme hydroxylation site from about amino acid 152 to about amino acid 164, a cell attachment site from about amino acid 130 to about amino acid 133, and an EGF-like domain cysteme pattern signature from about amino acid 123 to about ami no acid ' 35 DNA30943-1 163, DNA64907-1 163 and DNA64908-1 163 have been deposited with ATCC
EXAMPLE 2 Isolation of cDNA Clones Encoding PRQ237 The extracellular domain (ECD) sequences (including the secretion signal, if any) of about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases The EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA) The search was performed using the computei program BLAST or BLAST2 ( Altshul et al , Methods in Enzymoiogy.266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap'
A consensus DNA sequence was assembled relative to other EST sequences using phrap This consensus sequence is herein designated DNA30905 Based on the DNA30905 consensus sequence oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence ot interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0237 Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product ot about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs
PCR primers (forward and reverse) were synthesized forward PCR primer
5'-TCTGCTGAGGTGCAGCTCATTCAC-3' (SEQ ID NO 37) reverse PCR primer 5 -GAGGCTCTGGAAGATCTGAGATGG-3' (SEQ ID NO 38)
Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA30905 sequence which had the following nucleotide sequence hybridization probe 5'-GCCTCTTTGTCAACGTTGCCAGTACCTCTAACCCATTCCTCAGTCGCCTC 3' (SEQ ID NO 39) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0237 gene using the probe oligonucleotide and one ot the PCR primers
RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB 153) The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikmased adaptois, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-1280 (1991)) in the unique Xhol and Notl sites DNA sequencing of the clones isolated as described above gave the full length DNA sequence tor PR0237
[(DNA34353 1428)] (SEQ ID NO 1 ) and the derived PR0237 protein sequence (Figure 2, SEQ ID NO 2)
The entire nucleotide sequence of DNA34353 1428 is shown in Figure 1 (SEQ ID NO 1 ) Clone DNA34353 1428 (SEQ ID NO 1 ) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 586-588 and ending at the stop codon at nucleotide positions 1570 1572 (Figure 1 ) The predicted polypeptide precursor is 328 ammo acids long (Figure 2, SEQ ID NO 2) The full-length PR0237 protein shown in Figure 2 (SEQ ID NO 2) has an estimated molecular weight ot about 36,238 daltons and a pi of about 9 90 Analysis of the full-length PR0237 sequence shown in Figuie 2 (SEQ ID NO 2) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 23, a transmembrane domain from about ammo acid 177 to about amino acid 199, potential N-glycosylation sites from about amino acid 1 18 to about amino acid 122 from about amino acid 170 to about amino acid 174 and from about amino acid 260 to about amino acid 264, and eukaryotic-type carbonic anhydrase sequence homology blocks from about amino acid 222 to about amino acid 271 from about amino acid 128 to about amino acid 165 and from about amino acid 45 to about ammo acid 93 Clone DNA34353 1428 has been deposited with ATCC on May 12, 1998 and is assigned ATCC deposit no 209855
EXAMPLE 3 Isolation of cDNA Clones Encoding a Human PRQ324 The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag
(EST) databases The EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA) The search was performed using the computer program BLAST or BLAST2 (Altshul etal , Methods in Enzymology. 266 460-480 (1996)) as a comparison of the
ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington) A consensus DNA sequence was assembled relative to other EST sequences using phrap This consensus sequence is herein designated DNA34347 Based on the DNA34347 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0324 Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 - 1 5kbp In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology, with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs
PCR primers (forward and reverse) were synthesized forward PCR primer 1
5'-GCAATGAACTGGGAGCTGC-3' (SEQ ID NO 40) forward PCR primer 2
5'-CTGTGAATAGCATCCTGGG 3 (SEQ ID NO 41 ) forward PCR primer 3
5' CTTTTCAAGCCACTGGAGGG-3' (SEQ ID NO 42) reverse PCR primer 1 5'-CTGTAGACATCCAAGCTGGTATCC-3 (SEQ ID NO 43) reverse PCR primer 2
5*-AAGAGTCTGCATCCACACCACTC-3 (SEQ ID NO 44)
Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA34347 sequence which had the following nucleotide sequence hybridization probe
5'-ACCTGACGCTACTATGGGCCGAGTGGCAGGGACGACGCCCAGAATG-3' (SEQ ID NO 45)
In order to screen several libraries tor a source of a full-length clone, DNA from the libraries w as screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0324 gene using the probe oligonucleotide and one of the PCR primers
RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB6) The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0324
[herein designated as DNA36343 1310] (SEQ ID NO 9) and the derived PR0324 protein sequence (SEQ ID NO 10)
The entire nucleotide sequence of DNA36343-1310 is shown in Figure 9 (SEQ ID NO 9) Clone DNA36343-1310 (SEQ ID NO 9) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 144- 146 and ending at the stop codon at nucleotide positions 101 1-1013 (Figure 9, SEQ ID NO 9) The predicted polypeptide precursor is 289 amino acids long (Figure 10, SEQ ID NO 10) The full-length PR0324 protein shown in Figure 10 has an estimated molecular weight of about 32,268 daltons and a pi of about 9 21 Analysis of the particular PR0324 polypeptide sequence shown in Figure 10 (SEQ ID NO 10) evidence the presence of the following a signal peptide from about amino acid 1 to about amino acid 31 , a transmembrane domain from about amino acid 136 to about amino acid 157, a tyrosine kinase phosphorylation site from about ammo acid 106 to about amino acid 114, and regions that are homologous to short chain alcohol dehydrogenase regions from about amino acid 80 to about amino acid 91 , from about amino acid 131 to about amino acid 169, and from about ammo acid 176 to about amino acid 186 Clone DNA36343- 1310 has been deposited with ATCC on March 31 , 1998 and is assigned ATCC deposit No 209718
EXAMPLE 4
Isolation of cDNA Clones Encoding a Human PRQ351 Polypeptide The extracellular domain (ECD) sequences (including the secretion signal, if any) from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases The EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ0, Incyte Pharmaceuticals, Palo Alto, CA) The search was performed using the computer program BLAST or BLAST2 (Altshul et al , Methods in Enzymology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington) The consensus DNA sequence assembled relative to other EST sequences using phrap has been designated herein as "<Consen0920>' The <Consen0920> consensus DNA sequence was then extended using repeated cycles of BLAST and phrap to extend the consensus sequence as fai as possible using various other EST sequences The consensus assembly sequence obtained is herein designated DNA35950
Based on the DNA35950 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for a PR0351 Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel etal , Current Protocols in Molecular Biology, with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs
Forward and reverse PCR primers were synthesized forward PCR primer
5'-CCTGTGCTGTGCCTCGAGCCTGAC-3' (SEQ ID NO 46) reverse PCR primer 5'-GTGGGCAGCAGTTAGCACCGCCTC-3' (SEQ ID NO 47)
Additionally, a synthetic oligonucleotide hybridization probe was constructed from DNA35950 which had the following nucleotide sequence hybridization probe 5'-GGCTGGCATCATCAGCTTTGCATCAAGCTGTGCCCAGGAGGACGC-3' (SEQ ID NO 48) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above A positive library was then used to isolate clones encoding the PR0351 gene using the probe oligonucleotide and one of the PCR primers
RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB230) The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen. San Diego CA The cDN A was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vectoi (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science. 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0351
[herein designated as DNA40571 -1315] (SEQ ID NO 1 1 ) and the derived PR0351 protein sequence (SEQ ID NO 12)
The entire nucleotide sequence of DNA40571 - 1315 is shown in Figure 1 1 (SEQ ID NO 1 1 ) Clone DNA40571 -1 15 contains two open reading frames with an apparent translational initiation site at nucleotide positions 189- 191 and a second open reading frame beginning at nucleotide 470 with the two open reading frames ending at the stop codons at nucleotide positions 363-365 and 2009 201 1 , respectivel) (Figure 1 1 ) The predicted polypeptide precursor is 571 amino acids long (Figure 12) Important regions of the amino acid sequence of PR0351 include the signal peptide (amino acid residues 1 to about 15), regions having sequence similai lty to serine proteases of the trypsin family (i e , amino acid residues from about 79 to about 96, from about 343 to about 360 and from about 237 to about 248), two N-glycosylation sites (; e , amino acid residues from about 37 to about 41 and from about 564 to about 568), and three Knngle domains (t e , amino acid residues from about 79 to about 97, from about 343 to about 361 and from about 235 to about 248) DNA40571 -1315 has been deposited with ATCC and is assigned ATCC deposit no 209784
EXAMPLE 5 Isolation of cDNA Clones Encoding PRQ362 The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases The EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA) The search was performed using the computer program BLAST or BLAST2 (Altshul etal , Methods in Enzymology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington)
A consensus DNA sequence was assembled relative to other EST sequences using phrap This consensus sequence is herein designated DNA42257 Based on the DNA42257 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0362 Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100- 1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1 5 kbp In order to screen several libraries for a full-length clone, DN A from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Moleculai Biology, with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs
PCR primers (forward and reverse) were synthesized forward PCR primer 1
5'-TATCCCTCCAATTGAGCACCCTGG-3' (SEQ ID NO 49) forward PCR primer 2 5'-GTCGGAAGACATCCCAACAAG-3 (SEQ ID NO 50) reverse PCR primer 1
5'-CTTCACAATGTCGCTGTGCTGCTC-3 (SEQ ID NO 51 ) reverse PCR primer 2 5'-AGCCAAATCCAGCAGCTGGCTTAC-3' (SEQ ID NO 52) Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA42257 sequence which had the following nucleotide sequence hybridization probe 5' TGGATGACCGGAGCCACTACACGTGTGAAGTCACCTGGCAGACTCCTGAT-3' (SEQ ID NO 53)
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR pπmer pairs identified above A positive library was then used to isolate clones encoding the PR0362 gene using the probe oligonucleotide and one of the PCR primers RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB 153) The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-1280 (1991)) in the unique Xhol and Notl sites
DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0362 [herein designated as DNA45416-1251 ] (SEQ ID NO 13) and the derived PR0362 protein sequence (SEQ ID NO 14) The entire nucleotide sequence of DNA45416-1251 is shown in Figure 13 (SEQ ID NO 13) Clone
DNA45416-1251 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 1 19-121 and ending at the stop codon at nucleotide positions 1082-1084 (Figure 13) The predicted polypeptide precursor is 321 amino acids long (Figure 14, SEQ ID NO 14) The full-length PR0362 (UNQ317) protein shown in Figure 14 has an estimated molecular weight of about 35,544 daltons and a pi of about 8 51 Analysis of the full-length PR0362 polypeptide as shown in Figure 14 evidences the presence of the following a signal sequence from about amino acid 1 to about amino acid 19, a transmembrane domain from about amino acid 281 to about amino acid 300, a glycosaminoglycan attachment site from about amino acid 149 to about amino acid 153, a cAMP and cGMP-dependent protein kinase phoshorylation site from about amino acid 308 to about ammo acid 312, and N-myπstoylation sites from about amino acid 2 to about amino acid 8, from about amino acid 148 to about amino acid 154 from about amino acid 158 to about amino acid 164, from about ammo acid 207 to about ammo acid 213, and from about amino acid 215 to about amino acid 221 Clone DNA45416- 1251 has been deposited with ATCC on February 5, 1998 and is assigned ATCC deposit no 209620
EXAMPLE 6 Isolation of cDNA Clones Encoding Human PRQ615 The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases The EST databases included public EST databases (e c , GenBank) and a proprietary EST DNA database (LIFESEQ*, Incyte Pharmaceuticals, Palo Alto C \) The search was performed using the computei program BLAST or BLAST2 (Altshul et al , Methods in Enzvmology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program 'phrap' (Phil Green, University of Washington, Seattle Washington) A consensus DNA sequence was assembled relative to other Incyte EST sequences using phrap This consensus sequence is herein designated <consen0205> The <consen0205> sequence was then extended using repeated cycles of BLAST and phrap to extend the virtual sequence as far as possible using other GenBank and Incyte EST sequences This extended consensus virtual sequence is termed DNA42240 Based on DNA42240, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0615 Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100- 1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology, with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning procedure using the probe oligonucleotide and one of the pπmer pairs
Forward and reverse PCR piimers were synthesized forward PCR primer
5'-TGGTCTTCGCCTTGATCGTGTTCT-3' (SEQ ID NO 54) forward PCR primer
5'-GTGTACTGAGCGGCGGTTAG-3' (SEQ ID NO 55) reverse PCR primer 5'-CTGAAGGTGATGGCTGCCCTCAC-3' (SEQ ID NO 56) reverse PCR primer
5'-CCAGGAGGCTCATGGGAAAGTCC-3' (SEQ ID NO 57)
Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus DNA42240 sequence which had the following nucleotide sequence hybridization probe
5'-CCACGAGTCTAAGCAGATGTACTGCGTGTTCAACCGCAACGAGGATGCCT-3' (SEQ ID NO 58)
In order to screen several libraries tor a source of a full-length clone, DNA from the libiaπes was screened by PCR amplification with one of the PCR primer pairs identified above A positive library was then used to isolate clones encoding the PR0615 gene using the probe oligonucleotide and one of the PCR primers RNA for construction of the cDNA libraries was isolated f I om human bone marrow tissue (LIB255) The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl. sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, vee, Holmes et al . Science 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites
DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0615 [herein designated as DNA48304-1 23] (SEQ ID NO 15) and the derived PR0615 protein sequence (SEQ ID NO 15)
The entire nucleotide sequence of DNA48304-1323 is shown in Figure 15 (SEQ ID NO 15) Clone DNA48304- 1323 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 51 -53 and ending at the stop codon at nucleotide positions 723-725 (Figure 15, SEQ ID NO 15) The predicted polypeptide piecursor is 224 amino acids long (Figure 16, SEQ ID NO 16) The full-length PR0615 protein shown in Figure 16 has an estimated molecular weight of about 24,810 daltons and a pi of about 4 75 Important regions of the amino acid sequence of PR0615 include a type II transmembrane domain, corresponding to about amino acids 24-43, other transmembrane domains, corresponding to about amino acids 74-90, 108-126, and 145- 161 , respectively, and a potential N-glycosylation site, corresponding to about amino acids 97- 101 Clone DNA48304-1323 has been deposited with ATCC and is assigned ATCC deposit no 209811
EXAMPLE 7 Isolation of cDNA Clones Encoding PRQ531 An ECD database was searched and an expressed sequence tag (EST) from LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA was identified This EST was identified as fragment number 1810051 which showed homology to protocadhenn 3 Based on this sequence, a search was performed using the computer program BLAST or BLAST2 (Altshul et al , Methods in Enzymology, 266 460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington) A consensus DNA sequence was assembled relative to other EST sequences using repeated cycles of
BLAST and phrap This consensus sequence is designated DNA42807
Based on the DNA42807 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for PR0531 Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length The piobe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel etal , Current Protocols in Molecular Biology, with the PCR pπmei pair A positive library was then used to isolate clones encoding the gene ot interest using the probe oligonucleotide and one of the pπmer pairs
A pair of PCR primers (forward and reverse) were synthesized forward PCR primer
5'-CTGAGAACGCGCCTGAAACTGTG-3' (SEQ ID NO 59) reverse PCR primer 5'-AGCGTTGTCATTGACATCGGCG-3' (SEQ ID NO 60)
Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus sequence which had the following nucleotide sequence hybridization probe 5'-TTAGTTGCTCCATTCAGGAGGATCTACCCTTCCTCCTGAAATCCGCGGAA-3' (SEQ ID NO 61 )
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive hbiary was then used to isolate clones encoding the PR0531 gene using the probe oligonucleotide and one of the PCR primers
RNA for construction of the cDNA libraries was isolated from human fetal brain tissue (LIB 153) The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD , pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites
DNA sequencing of the clones isolated as described above gave the full-length DNA sequence for PR0531 [herein designated as DNA48314-1320] (SEQ ID NO 17) and the derived PR0531 protein sequence (SEQ ID NO 18)
The entire representative nucleotide sequence of DNA48314- 1320 is shown in Figure 17 (SEQ ID NO 17) It is understood that the actual sequence is that within the clone deposited with the ATCC as DNA48314-1320 Clone DNA48314-1320 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 171-173 and ending at the stop codon at nucleotide positions 2565-2567 (Figure 17) The predicted polypeptide precursor is 789 ammo acids long (Figure 18, SEQ ID NO 18) The full-length PR0531 protein shown in Figure 18 (SEQ ID NO 18) has an estimated molecular weight of about 87.552 daltons and a pi of about 4 84 Clone DNA48314-1320 has been deposited with the ATCC on March 26, 1998, and has been assigned deposit number 209702
In PR0531 (Figure 18, SEQ ID NO 18), a cadheπn extiacellular repeated domain signature is found at about amino acids 122-133, 231 -242, 336-347, 439-450 and 549-560. an ATP/GTP-binding site motif A (P-loop) is found at about amino acids 285-293 of SEQ ID NO 18, N-glycosylation sites are found at least at about amino acids 567-571 , 786-790, 418-422 and 436-440 of SEQ ID NO 18 The signal peptide is at about amino acids 1 -26, and the transmembrane domain is at about amino acids 685-712 ot SEQ ID NO 18
EXAMPLE 8 Isolation of cDNA Clones Encoding PRQ538 and PRQ3664
A proprietary expressed sequence tag (EST) DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo
Alto, CA) was searched foi homology to the murine GFR 3 nucleotide sequence and the EST sequence
INC3574209 was identified and found to have 61 % sequence identity in the aligned region between the two sequences The following primers were created in order to screen tor the corresponding full length cDNAs newa3 F
5'-GCCTCTCGCAGCCGGAGACC-3' (SEQ ID NO 62) newsa3 R
5'-CAGGTGGGATCAGCCTGGCAC-3' (SEQ ID NO 63)
DNA from the libraries referenced below was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology (1995), with the PCR primer pair A strong PCR product was identified in all libraries analyzed (fetal lung, fetal kidney and placenta)
In order to isolate a corresponding cDNA clone encoding a full length protein, a human fetal lung pRK5 vector library was selected and enriched for positive cDNA clones by extension of single stranded DNA from plasmid libraries grown in dug-/bung- hosts using the newa3 R primer RNA for construction of the cDN A libraries was isolated from human fetal lung tissue The cDNA library used to isolate the cDNA clones was constructed by standard methods using commercially available reagents (e g , Invitrogen, San Diego, CA, Clontech, etc ) The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-1280 (1991 )) in the unique Xhol and Notl sites To enrich for positive cDNA clones, the pπmer extension reaction contained 10 μl of lOx PCR buffer (Perkin Elmer, USA), 1 μl dNTP (20 mM), 1 μl library DNA (200 ng), 1 μl primer, 86 5 μl H20 and 1 μl Amphtaq (Perkin Elmer, USA) added after a hot start The reaction was denatured for 1 minute at 95°C, annealed for 1 minute at 60°C, and then extended for 15 minutes at 72°C The DNA was extracted with phenol/chloroform, precipitated with ethanol, and then transformed by electroporation into a DH10HB host bacteria The entire transformation mixture was plated onto 10 plates and colonies were allowed to form Colonies were lifted onto nylon membranes and screened with the following oligonucleotide probe derived from the original EST nucleotide sequence newa3 probe 5'-TCTCGCAGCCGGAGACCCCCTTCCCACAGAAAGCCGACTCA-3' (SEQ ID NO 64)
Filters were hybridized with the probe overnight at 42°C in 50% formamide, 5xSSC, 10x Denhardt's 0 05M sodium phosphate (pH 6 5), 0 1 % sodium pyrophosphate, and 50 μg/ml of sonicated salmon sperm DNA Filters were then rinsed in 2xSSC washed in 0 1 xSSC, 0 1 % SDS, and then exposed overnight to Kodak X Ray films Five positive clones were identified Pure positive clones were obtained after colony purification and secondary screening
Two of the isolated clones were sequenced These cDNA sequences were designated DNA48613-1268 (SEQ ID NO 19) and DNA48614-1268 (SEQ ID NO 21 ) Amino acid sequence analysis of DNA48613-1268 revealed a PR0538 polypeptide (SEQ ID NO 20) having a 400 amino acid reading frame sequence with a predicted 26 residue long N-terminal signal peptide The predicted mature protein is 374 amino acids long, with a calculated molecular weight of appioximately 41 kDa
A comparison of the encoded PR03664 amino acid sequence (SEQ ID NO 22) of DN A48614- 1268 (SEQ ID NO 21 ) between the encoded PR0538 amino acid sequence (SEQ ID NO 20) of DNA4861 - 1268 (SEQ ID NO 19) i evealed DNA48614- 1268 to be an alternatively spliced form ot DNA48613-1268 The difference between the t o sequences is a 30 amino acid deletion (amino acid positions 127-157) in the PR03664 sequence, counting from the initiation methionine Interestingly, none ot the cysteines aie deleted in PR03664 (SEQ ID NO 22) Analysis of the full-length PR0538 polypeptide as shown in Figure 20 evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 26, N-glycosylation sites from about amino acid 95 to about amino acid 99, from about amino acid 148 to about amino acid 152 and from about amino acid 309 to about amino acid 313, a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 231 to about amino acid 235, N-myπstoylation sites from about ammo acid 279 to about amino acid 285 and from about amino acid 294 to about amino acid 300, and prokaryotic membrane hpoprotein hpid attachment sites from about amino acid 306 to about amino acid 317 and from about ammo acid 379 to about amino acid 390 Analysis of the full-length PR03664 polypeptide as shown in Figure 22 evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 26, N-glycosylation sites from about amino acid 95 to about ammo acid 99 and from about amino acid 278 to about amino acid 282, a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 200 to about acid 204, N-myπstoylation sites from about amino acid 248 to about amino acid 254 and from about amino acid 263 to about amino acid 269, and prokaryotic membrane hpoprotein hpid attachment sites from about amino acid 275 to about amino acid 286 and from about amino acid 348 to about ammo acid 359 Clones DNA48613- 1268 and DN A48614- 1268 have been deposited with the ATCC and are assigned ATCC deposit nos 209752 and 209751 , respectively
EXAMPLE 9 Isolation of cDNA Clones Encoding Human PRQ618 The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases The EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA) The search was pei formed using the computer program BLAST or BLAST2 (Altshul et al . Methods in Enzy ology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or m some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington Seattle, Washington) The above analysis gave rise to a single sequence corresponding to Incyte EST clone 2517079 which is herein designated DNA30900 Oligonucleotide probes (shown below) based upon the DNA30900 sequence were employed to screen a cDNA library from human fetal liver tissue as described below, and a partial cDNA clone was identified, herein designated DNA35597 (Figure 25, SEQ ID NO 25) The probes used for the isolation of DNA35597 (SEQ ID NO 25) were the following forward PCR primer
5 -TAACAGCTGCCC ACTGCTTCCAGG-3 (SEQ ID NO 65 ) reverse PCR primer
5'-TAATCCAGCAGTGCAGGCCGGG-3 (SEQ ID NO 66) hybridization probe
5'-ATGGCCTCCACGGTGCTGTGGACCGTGTTCCTGGGCAAGGTGTGGCAGAA-3 (SEQ ID NO 67)
DNA35597 (SEQ ID NO 25) was extended using repeated cycles of BLAST and phrap to extend the sequence as far as possible using Incyte and Genentech proprietary EST sequences The extended assembly sequence was used to generate the consensus nucleotide sequence designated herein as DNA43335, which was used to derive the final full length sequence for DNA49152- 1324 (SEQ ID NO 23) The sequence DNA35597 is an EST proprietary to Genentech Based on DNA35597, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the PR0618 full-length coding sequence Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100- 1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1 5 kbp In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology, with the PCR primer pair A positive libraiy was then used to isolate partial clones encoding the gene of interest using a probe oligonucleotide and one of the following primer pairs
The second screening of a human fetal liver library (LIB229) from oligos based on DNA43335 forward PCR primer
5'-TGCCTATGCACTGAGGAGGCAGAAG 3' (SEQ ID NO 68) reverse PCR primer
5'-AGGCAGGGACACAGAGTCCATTCAC-3' (SEQ ID NO 69) hybridization probe 5'-AGTATGATTTGCCGTGCACCCAGGGCCAGTGGACGATCCAGAACAGGAGG-3'(SEQ ID NO 70)
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above A positive library was then used to isolate full length clones encoding the PR0618 gene using the second probe oligonucleotide and one of the second set of PCR primers RNA for construction of the cDNA libraries was isolated from human fetal liver tissue (LIB229) The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl. sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al Science. 253 1278-1280 (1991 )) in the unique Xhol and Notl sites
DNA sequencing of the clones isolated as described above gave the full-length DNA sequence DNA49152- 1324 (SEQ ID NO 23) and the derived protein sequence foi the PR0618 (SEQ ID NO 24)
The entire nucleotide sequence of DNA49152-1324 is shown in Figure 23 (SEQ ID NO 23) Clone DNA49152- 1324 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 73 75 and ending at the stop codon at nucleotide positions 2479-2481 (Figure 23) The predicted polypeptide precursor is 802 ammo acids long (Figure 24, SEQ ID NO 24) The full-length PR0618 protein shown in Figure 24 (SEQ ID NO 24) has an estimated molecular weight of about 88.846 daltons and a pi of about 6 41 Important regions of the amino acid sequence of PR0618 include a type II transmembrane domain from about amino acid 46 to about amino acid 67, a sequence typical of a protease, trypsin family, histidine active site from about amino acid 604 to about amino acid 610, multiple N-glycosylation sites from about amino acid 127 to about amino acid 131 , from about amino acid 175 to about amino acid 179, from about amino acid 207 to about ammo acid 21 1 , from about amino acid 329 to about amino acid 333, from about ammo acid 424 to about amino acid 428, from about amino acid 444 to about amino acid 448 and from about amino acid 509 to about amino acid 513, two sequences typical of a Knngle domain from about amino acid 746 to about amino acid 759 and from about amino acid 592 to about amino acid 610, a region having sequence similarity to Kalhkrein light chain from about amino acid 568 to about amino acid 779, and a region having sequence similarity to low-density hpoprotein receptor from about amino acid 451 to about amino acid 567 Clone DNA49152-1324 has been deposited with ATCC and is assigned ATCC deposit no 209813
EXAMPLE 10 Isolation of cDNA Clones Encoding Human PRQ772
1 Preparation of ohgo dT primed cDNA library mRNA was isolated from human fetal lung tissue using reagents and protocols from Invitrogen, San Diego
CA (Fast Track 2) This RNA was used to generate an ohgo dT primed cDNA library in the vector pRK5D using reagents and protocols from Life Technologies, Gaithersburg, MD (Super Script Plasmid System) In this procedure, the double stranded cDNA was sized to greater than 1000 bp and the Sall/Notl hnkered cDNA was cloned into Xhol/Notl cleaved vector pRK5D is a cloning vector that has an sp6 transcription initiation site followed by an Sfil restriction enzyme site preceding the Xhol/Notl cDNA cloning sites
2 Preparation of random primed cDNA library
A secondary cDNA library was generated in order to preferentially represent the 5' ends of the primary cDNA clones Sp6 RNA was generated from the primary library (described above), and this RNA was used to generate a random primed cDNA library in the vector pSST-AMY 0 using reagents and protocols from Life Technologies (Super Script Plasmid System, referenced above) In this procedure the double stranded cDNA was sized to 500-1000 bp, hnkered with blunt to Notl adaptors cleaved with Sfil, and cloned into Sfil/Notl cleaved vector pSST-AMY 0 is a cloning vector that has a yeast alcohol dehydrogenase promoter preceding the cDNA cloning sites and the mouse amylase sequence (the mature sequence without the secretion signal) followed by the yeast alcohol dehydiogenase terminator, after the cloning sites Thus, cDNAs cloned into this vector that aie fused in frame with amylase sequence will lead to the secretion of amylase ti om appropriately transfected yeast colonies
3 Transformation and Detection
DNA from the library described in paragraph 2 above was chilled on ice to which was added electrocompetent DH 10B bacteria (Life Technologies, 20 ml) The bacteπa and vector mixtuie was then electroporated as recommended by the manufacturer Subsequently, SOC media (Life Technologies, I ml) was added and the mixture was incubated at 37 ° C for 30 minutes The ti anstormants were then plated onto 20 standai d 150 mm LB plates containing ampicillin and incubated for 16 hours (37° C) Positive colonies were scraped off the plates and the DNA was isolated from the bacterial pellet using standard protocols, e g , CsCl-gradient The purified DNA was then carried on to the yeast protocols below
The yeast methods were divided into three categories ( 1 ) Transformation of yeast with the plasmid/cDNA combined vector, (2) Detection and isolation of yeast clones secreting amylase, and (3) PCR amplification of the insert directly from the yeast colony and purification of the DNA for sequencing and further analysis
The yeast strain used was HD56-5A (ATCC-90785) This strain has the following genotype MAT alpha, ura3-52, leu2-3, leu2- 1 12, hιs3-l 1 , hιs3- 15, MAL+, SUC+, GAL+ Preferably, yeast mutants can be employed which have deficient post translational pathways Such mutants may have translocation deficient alleles in seel 1 , secll, secβl, with truncated seclλ being most preferred Alternatively, antagonists (including antisense nucleic acids and/or ligands) which interfere with the normal operation of these genes, other proteins implicated in this post translation pathway (e g , SEC61p, SEC72p, SEC62p, SEC63p, TDJlp or SSAl p-4p) or the complex formation of these proteins may also be preferably employed in combination with the amylase-expressing yeast
Transformation was performed based on the protocol outlined by Gietz et al , Nucl Acid Res , 20 1425 (1992) Transformed cells were then inoculated from agar into YEPD complex media broth (100 ml) and grown overnight at 30° C The YEPD broth was prepared as described in Kaiser et al , Methods in Yeast Genetics, Cold Spring Harbor Press, Cold Spring Harbor, NY, p 207 (1994) The overnight culture was then diluted to about 2 x 106 cells/ml (approx ODf)()n=0 1 ) into fresh YEPD broth (500 ml) and regrown to 1 x 107 cells/ml (approx ODβw=04-0 5) The cells were then harvested and prepared for transformation by transfer into GS3 rotor bottles in a Sorval
GS3 rotor at 5,000 rpm for 5 minutes, the supernatant discarded, and then resuspended into sterile water, and centrifuged again in 50 ml falcon tubes at 3,500 rpm in a Beckman GS-6KR centrifuge The supernatant was discarded and the cells were subsequently washed with Lι,OAc/TE ( 10 ml, 10 mM Tris-HCl, 1 mM EDTA pH 7 5, 100 mM Lι2OAc), and resuspended into Lι,OAc/TE (2 5 ml) Transformation took place by mixing the prepared cells ( 100 μl) with freshly denatured single stranded salmon testes DNA (Lofstrand Labs, Gaithersburg, MD) and transtorming DNA (1 μg, vol < 10 μl) in microfuge tubes The mixture was mixed briefly by vortex g. then 407c PEG/TE (600 μl, 40% polyethylene glycol-4000 10 mM Tris-HCl, 1 M EDTA, 100 M Lι,OAc, pH 7 5) was added This mixture w as gently mixed and incubated at 30 C while agitating for 30 minutes The cells were then heat shocked at 42° C tor 15 minutes, and the reaction vessel centrifuged in a microfuge at 12,000 rpm for 5-10 seconds, decanted and resuspended into TE (500 μl, 10 mM Tris-HCl 1 mM EDTA pH 7 5) followed by recentπfugation The cells were then diluted into TE ( 1 ml) and aliquots (200 μl) were spread onto the selective media previously prepared in 150 mm growth plates (VWR)
Alternatively, instead of multiple small reactions, the transformation was performed using a single, large scale reaction, wherein reagent amounts were scaled up accordingly
The selective media used was a synthetic complete dextrose agar lacking uracil (SCD-Uia) prepared as described in Kaiser et al , Methods in Yeast Genetics Cold Spring Harbor Press, Cold Spπng Harbor, NY, p 208-210 (1994) Transformants were grown at 30 °C for 2-3 da>s The detection of colonies secreting amylase was performed by including red starch in the selective growth media Starch was coupled to the red dye (Reactive Red-120, Sigma) as per the procedure described by Biely et al , Anal Biochem . 172 176-179 (1988) The coupled starch was incorporated into the SCD Ura agar plates at a final concentration of 0 1 % (w/v), and was buffered with potassium phosphate to a pH of 7 0 (50-100 mM final concentration)
The positive colonies were picked and streaked across fresh selective media (onto 150 mm plates) in order to obtain well isolated and identifiable single colonies Well isolated single colonies positive for amylase secretion were detected by direct incorporation of red starch into buffered SCD-Ura agar Positive colonies were determined by their ability to break down starch resulting in a clear halo around the positive colony visualized directly
4 Isolation of DNA by PCR Amplification
When a positive colony was isolated, a portion of it was picked by a toothpick and diluted into sterile water (30 μl) in a 96 well plate At this time, the positive colonies were either frozen and stored for subsequent analysis or immediately amplified An aliquot of cells (5 μl) was used as a template for the PCR reaction in a 25 μl volume containing 0 5 μl Klentaq (Clontech, Palo Alto, CA), 4 0 μl 10 mM dNTP's (Perkin Elmer-Cetus), 2 5 μl Klentaq buffer (Clontech), 0 25 μl forward ohgo 1 , 0 25 μl reverse ohgo 2, 12 5 μl distilled water The sequence of the forward oligonucleotide 1 was
5'-TGTAAAACGACGGCCAGTTAAATAGACCTGCAATTATTAATCT-3' (SEQ ID NO 71 ) The sequence of reverse oligonucleotide 2 was
5'-CAGGAAACAGCTATGACCACCTGCACACCTGCAAATCCATT 3' (SEQ ID NO 72) PCR was then performed as follows a Denature 92 C, 5 minutes b 3 cycles of Denature 92 C, 30 seconds
Anneal 59 C 30 seconds
Extend 72 C, 60 seconds cc 3 3 ccyycclleess ooff D Deennaattuurree 92 C, 30 seconds
Anneal 57 C, 30 seconds
Extend 72 C, 60 seconds d 25 cycles of Denature 92 C, 30 seconds
Anneal 55 C, 30 seconds E Exxtteenndd 72 C, 60 seconds e Hold 4 C
The underlined regions ot the oligonucleotides annealed to the ADH promoter legion and the amylase region, respectively, and amplified a 307 bp region from vector pSST-AMY 0 when no insert was present Typically, the first 18 nucleotides of the 5 end of these oligonucleotides contained annealing sites lor the sequencing primers, wherein these sequences may differ depending upon the sequencing primers employed Thus the total product ot the PCR reaction from an empty vector was 343 bp However, signal sequence-tused cDNA resulted in considerably longer nucleotide sequences Following the PCR, an aliquot of the reaction (5 μl) was examined by agarose gel electrophoresis in a 1 % agarose gel using a Tπs-Borate EDTA (TBE) buffering system as described by Sambrook et al , supra Clones resulting in a single strong PCR product largei than 400 bp weie further analyzed by DNA sequencing after purification with a 96 Qiaquick PCR clean-up column (Qiagen Inc , Chats worth, CA)
5 Identification of Full-length Clone
A cDNA sequence isolated in the above screen was found, by BLAST and FastA sequence alignment, to have sequence homology to a nucleotide sequence encoding human A4 protein This isolated cDNA sequence is herein designated DNA43509 Based on the sequence homology, probes were generated from the sequence of the DNA43509 molecule and used to screen a human fetal lung library (LIB25) prepared as described in paragraph 1 above The cloning vector was pRK5B (pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278 1280 (1991 )), and the cDNA size cut was less than 2800 bp
A pair of PCR primers (forward and reverse) were synthesized based on the DNA43509 sequence forward PCR primer 5'-CGTTTTGCAGAACCTACTCAGGCAG 3 (SEQ ID NO 73) reverse PCR primer
5'-CCTCCACCAACTGTCAATGTTGTGG-3 (SEQ ID NO 74)
Additionally, an oligonucleotide hybridization probe was synthesized to confirm the amplification hybridization probe 5'-AAAGTGCTGCTGCTGGGTCTGCAGACGCGATGGATAACGT-3' (SEQ ID NO 75) Using the above described primers and library, a full length clone was identified (DNA49645 1347, Figure
26, SEQ ID NO 26) that contained a single open reading frame with an apparent translational initiation site at nucleotide positions 131-133 and ending at the stop codon found at nucleotide positions 587 589 (see Figure 26) The predicted polypeptide precursor is 152 amino acids long has a calculated molecular weight of approximately 17,170 daltons and an estimated pi of approximately 9 62 Analysis of the full-length PR0772 sequence shown in Figure 27 (SEQ ID NO 27) evidences the presence of the following a potential type II transmembrane domain from about amino acid 26 to about ammo acid 42, other potential transmembrane domains from about amino acid 44 to about amino acid 65, fiom about amino acid 81 to about amino acid 101 and from about amino acid 109 to about amino acid 129, leucine zipper pattern sequences from about amino acid 78 to about amino acid 100 and from about amino acid 85 to about amino acid 107 an N-myπstoylation site from about amino acid 1 10 to about amino acid 1 16, and a ribonucleotide reductase large subunit protein from about amino acid 1 16 to about amino acid 128 Clone DNA49645-1347 has been deposited with ATCC on April 28, 1998 and is assigned ATCC deposit no 209809
EXAMPLE 1 1 Isolation of cDNA Clones Encoding Human PRO703 The extracellular domain (ECD) sequences (including the secretion signal, it any) of from about 950 known secreted proteins from the Swiss Prot public protein database were used to search expressed sequence tag (EST) databases The EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA) The search was performed using the computer program BLAST or BLAST2 ( Altshul et al , Methods in Enzymology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington) A consensus DNA sequence was assembled relative to other GenBank and Incyte EST sequences using phrap This consensus sequence is herein designated DNA43047
Based on the DNA43047 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for the PRO703 sequence Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al , Current Protocols in Molecular Biology, with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs
Forward and reverse PCR primers were synthesized forward PCR primer 5'-GAGAGCCATGGGGCTCCACCTG-3' (SEQ ID NO 76) reverse PCR primer
5'-GGAGAATGTGGCCACAAC-3' (SEQ ID NO 77) reverse PCR primer 5'-GCCCTGGCACAGTGACTCCATAGACG-3' (SEQ ID NO 78) reverse PCR primer
5'-ATCCACTTCAGCGGACAC-3' (SEQ ID NO 79)
Additionally, a synthetic oligonucleotide hybridization probe was constructed having the sequence hybridization probe 5'-CCAGTGCCAGGATACCTCTCTTCCCCCCAGAGCATAACAGACACG-3' (SEQ ID NO 80) In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above A positive library was then used to isolate clones encoding the PRO703 gene using the probe oligonucleotide and one ot the PCR primers
RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227) The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commerciall) available reagents such as those from Invitrogen, San Diego CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD, pRK5B is a precursor of pRK5D that does not contain the Sf ii site, see Holmes et al , Science. 253 1278- 1280 ( 1991 )) in the unique Xhol and Notl sites
DNA sequencing of the clones isolated as described above gave the full-length DNA sequence encoding the native sequence PRO703 [herein designated as DNA50913-1287] (SEQ ID NO 28) and the derived protein sequence for PRO703 The entire nucleotide sequence of DNA50913-1287 is shown in Figure 28 (SEQ ID NO 28) Clone
DNA50913-1287 (SEQ ID NO 28) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 1 15-1 17 and ending at the stop codon at nucleotide positions 2305-2307 (Figure 28, SEQ ID NO 28) The predicted polypeptide precursor is 730 amino acids long (Figure 29) The full-length PRO703 protein shown in Figure 29 (SEQ ID NO 29) has an estimated molecular weight of about 78,644 daltons and a pi ofabout 7 65 Important regions of the amino acid sequence encoded by nucleotides 1 15-2304 of PRO703 include a cAMP- and cGMP-dependent protein kinase phosphorylation site from about amino acid 136 to about amino acid 140, a type II transmembrane domain from about amino acid 45 to about amino acid 65, an other transmembrane domain from about amino acid 379 to about amino acid 398, N-glycosylation sites from about amino acid 37 to about ammo acid 41 and from about amino acid 483 to about amino acid 487, and a putative AMP-bmding domain signature from about amino acid 332 to about amino acid 344 Clone DNA50913-1287 has been deposited with ATCC and is assigned ATCC deposit no 209716
EXAMPLE 12 Isolation of cDNA Clones Encoding Human PRQ792 The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases The EST databases included public EST databases (e g , GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA) The search was performed using the computei program BLAST or BLAST2 ( Altshul et al , Methods in Enzymology, 266 460-480 ( 1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle Washington) The above described analysis gave rise to a single sequence which corresponds
Figure imgf000114_0001
to Incyte EST clone 1988930, which is also herein designated as DNA38106 Based on the DNA38106 consensus sequence, oligonucleotides were synthesized 1 ) to identify by PCR a cDNA library that contained the sequence of interest, and 2) tor use as probes to isolate a clone of the full-length coding sequence for the PRO703 sequence Foi ward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length The probe sequences are typically 40-55 bp in length In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1 -1 5 kbp In oider to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification as pei Ausubel etal Current Protocols in Molecular Biology, with the PCR primer pair A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs Foi ward and reverse PCR pπmers were synthesized forward PCR primer
5'-GCGAGAACTGTGTCATGATGCTGC-3 (SEQ ID NO 81 ) reverse PCR primer
5'-GTTTCTGAGACTCAGCAGCGGTGG-3 (SEQ ID NO 82) Additionally, a synthetic oligonucleotide hybridization probe was constructed having the sequence hybridization probe
5'-CACCGTGTGACAGCGAGAAGGACGGCTGGATCTGTGAGAAAAGGCACAAC-3' (SEQ ID NO 83)
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above A positive library was then used to isolate clones encoding the PR0792 gene using the probe oligonucleotide and one of the PCR primers
RNA for construction of the cDNA libraries was isolated from human bone marrow tissue (LIB255) The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA The cDNA was primed with ohgo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD , pRK5B is a precursor of pRK5D that does not contain the Sfil site, see, Holmes et al , Science, 253 1278-1280 (1991 )) in the unique Xhol and Notl sites
DNA sequencing of the clones isolated as described above gave the full-length DNA sequence encoding the native sequence PR0792 [herein designated as DNA56352 1358] (SEQ ID NO 30) and the derived protein sequence for PR0792
The entire nucleotide sequence of DNA56352-1358 is shown in Figure 30 (SEQ ID NO 30) Clone DNA56352 1358 (SEQ ID NO 30) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 67 69 and ending at the stop codon at nucleotide positions 946-948 (Figure 30, SEQ ID NO 30) The predicted polypeptide precursor is 293 ammo acids long (Figure 31 ) The full length PR0792 protein shown in Figure 31 (SEQ ID NO 31 ) has an estimated molecular weight of about 32,562 daltons and a pi of about 6 53 Analysis ol the full-length PR0792 sequence shown in Figure 31 (SEQ ID NO 31 ) evidences the presence of the following a signal peptide from about amino acid 1 to about amino acid 46 a type II transmembrane domain from about amino acid 31 to about am o acid 54, potential N-glycosylation sites from about amino acid 73 to about amino acid 77 and from about amino acid 159 to about amino acid 163, a leucine zipper amino acid sequence pattern from about amino acid 102 to about amino acid 124, potential N-myπstolation sites from about amino acid 18 to about amino acid 24 from about amino acid 133 to about amino acid 1 9 and fiom about amino acid 242 to about amino acid 248, and a C type lectm domain signature block from about amino acid 264 to about am o acid 288 Clone UNQ431 (DNA56352-1358) has been deposited with ATCC on May 6 1998
EXAMPLE 13 Isolation ot cDNA Clones Encoding Human PRQ474
The extracellular domain (ECD) sequences (including the secretion signal if any) of from about 950 known secreted proteins from the Swiss Prot public protein database were used to search expressed sequence tag (EST) databases The EST databases included public EST databases (e g , GenBank, Merck/Wash U) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA) The search was performed using the computer program BLAST or BLAST2 (Altshul et al , Methods in Enzymology, 266 460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington)
An initial consensus DNA sequence was assembled relative to other EST sequences using phrap The initial consensus DNA sequence was then extended using repeated cycles of BLAST and phrap to extend the initial consensus sequence as far as possible using the sources of EST sequences discussed above The extended consensus sequence obtained is herein designated DNA49818
Based upon an observed homology between the DNA49818 consensus sequence and Merck EST sequence no H77889, the Merck EST sequence was purchased and its insert was obtained and sequenced DNA sequencing of the insert gave the full-length DNA sequence for PR0474 [herein designated as DNA56045-1380] (SEQ ID NO 32) and the derived protein sequence for PR0474
The entire nucleotide sequence of DNA56045-1380 is shown in Figure 32 (SEQ ID NO 32) Clone DNA56045-1380 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 106-108 and ending at the stop codon at nucleotide positions 916-918 (Figure 32) The predicted polypeptide precursor is 270 amino acids long (Figure 33) The full-length PR0474 protein shown in Figure 33 has an estimated molecular weight of about 28,317 daltons and a pl ot about 6 0 Clone DNA56045-1380 has been deposited with the ATCC Regarding the sequence, it is understood that the deposited clone contains the correct sequence, and the sequences provided herein are based on known sequencing techniques
Still analyzing the amino acid sequence of SEQ ID NO 33, an N glycosylation site is at about amino acids 138-141 of SEQ ID NO 33, and short-chain alcohol dehydrogenase family protein homologies are at about amino acids 10-22, 81 -91 , 134 171 and 176-185 of SEQ ID NO 33 The corresponding nucleotides can be routinel) determined given the sequences provided herein
EXAMPLE 14
Gene Amplification
This example shows that the PR021 -, PRO 1330-, PRO 1449 PR0237-, PR0324-, PR0351 -, PR0362 , PR0615-, PR0531 -, PR0538 , PR03664-, PR0618-, PR0772 , PRO703 PR0792- and PR0474-encodιng genes are amplified in the genome of certain human lung, colon and/or breast cancers and/or cell lines Amplification is associated with overexpression of the gene product, indicating that the pol)peptιdes are useful targets toi therapeutic intervention in certain cancers such as colon, lung, breast and other cancers Therapeutic agents ma) take the form of antagonists of PR0213, PRO1330, PR01449, PR0237 PR0324 PR0351 , PR0362, PR0615 PR0531 , PR0538, PR03664 PR0618, PR0772, PRO703, PR0792 oi PR0474 polypeptide, for example, muπne-human chimeric, humanized or human antibodies against a PR0213 PROl 330, PRO 1449, PR0237,
PR0324, PR0351 , PR0362 PR0615, PR0531 , PR0538, PR03664 PR0618, PR0772, PRO703, PR0792 oi PR0474 polypeptide
The starting material for the screen was genomic DNA isolated from a variety cancers The DNA is quantitated precisely, e g , fluorometπcally As a negative control, DNA was isolated from the cells often normal healthy individuals which was pooled and used as assay controls for the gene copy in healthy individuals (not shown) The 5' nuclease assay (for example, TaqMan™) and real-time quantitative PCR (for example, ABI Pπzm 7700 Sequence Detection SystemTM (Perkin Elmer, Applied Biosystems Division, Foster City, CA)), were used to find genes potentially amplified in certain cancers The results were used to determine whether the DNA encoding PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 is over-represented in any of the primary lung or colon cancers or cancer cell lines or breast cancer cell lines that were screened The primary lung cancers were obtained from individuals with tumors of the type and stage as indicated in Table 4 An explanation of the abbreviations used for the designation of the primary tumors listed m Table 4 and the pi imary tumors and cell lines referred to throughout this example has been given hereinbefore
The results of the Taqman™ are reported in delta (Δ ) CT units One unit corresponds to 1 PCR cycle or approximately a 2-fold amplification relative to normal, two units corresponds to 4-fold, 3 units to 8-fold amplification and so on Quantitation was obtained using primers and a Taqman™ fluorescent probe derived from the PR0213-, PRO1330-, PR01449-, PR0237-, PR0324-, PR0351-, PR0362-, PR0615-, PR0531-, PR0538-, PR03664-, PR0618-, PR0772-, PRO703-, PR0792- or PR0474-encodmg gene Regions of PR0213 , PRO 1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 which are most likely to contain unique nucleic acid sequences and which are least likely to have spliced out introns are preferred for the primer and probe derivation, e g , 3-untranslated regions The sequences for the primers and probes (forward, reverse and probe) used for the PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703 PR0792 or PR0474 gene amplification analysis were as follows
PR0213, PRO1330 and PR01449 (DNA30943-1163, DNA64907- 1 163 and DNA64908-1 163, respectively)
30943 tm f3
5'-CGTTCGTGCAGCGTGTGTA-3' (SEQ ID NO 84)
30943 tm p3
5'-CTTCCTCACCACCTGCGACG GG-3' (SEQ ID NO 85) 30943 tm r3
5'-GGTAGGCGGTCCTATAGATGGTT-3' (SEQ ID NO 86)
30943 tm fl
5 -AGATG TGGATGAATG CAGTGCTA-3' (SEQ ID NO 87)
30943 t p 1 5'-ATCAACACCGCCGGCAGTTACTGG-3' (SEQ ID NO 88)
30943 tm rl
5'-ACAGAGTGTACCGTCTGCAGACA-3' (SEQ ID NO 89) 30943 3trn-5
5'-AGCCTCCTGGTGCACTCCT-3' (SEQ ID NO 90)
30943 3trn-probe
5'-CGACTCCCTGAGCGAGCAGATTTCC-3' (SEQ ID NO 91 ) 30943 3trn-3
5'-GCTGGGCAGTCACGAGTCTT-3' (SEQ ID NO 92)
PR0237 (DNA34353-1428) 34353 tm f
5'-AATCCTCCATCTCAGATCTTCCAG-3' (SEQ ID NO 93) 34353 tm p
5'-CCTCAGCGGTAACAGCCGGCC-3' (SEQ ID NO 94)
34353 tm r
5'-TGGGCCAAGGGCTGC-3' (SEQ ID NO 95)
PR0324 (DNA36343-1310) 36343 t fl
5'-TGGTGGATAACCAACAAGATGG-3' (SEQ ID NO 96)
36343 tmpl
5'-GAGTCTGCATCCACACCACTCTTAAAGTTCTCAA-3' (SEQ ID NO 97)
36343 tmrl 5'-CAGGTGCTCTTTTCAGTCATGTTT-3' (SEQ ID NO 98)
PR0351 (DNA40571-1315) 40571 tm f l
5'-TGGCCATTCTCAGGACAAGAG-3' (SEQ ID NO 99)
40571 tm pl 5'-CAGTAATGCCATTTGCCTGCCTGCAT-3' (SEQ ID NO 100)
40571 tm rl 5'-TGCCTGGAATC ACATGACA-3 (SEQ ID NO 101 )
PR0362 (DNA45416-1251 ) 45416 tm f l 5'-TGTGGCACAGACCCAATCCT-3' (SEQ ID NO 102)
45416 t pl
5'-GACCCTGAAGGCCTCCGGCCT-3' (SEQ ID NO 103)
45416 tm rl 5'-GAGAGAGGGAAGGCAGCTATGTC-3' (SEQ ID NO 104) PR0615 (DNA48304-1323): 48304.tm.f 1 :
5'-CAGCCCCTCTCTTTCACCTGT-3' (SEQ ID NO: 105)
48304.tm.pl : 5'-CCATCCTGTGCAGCTGACACACAGC-3' (SEQ ID NO: 106)
48304.tm.rl : 5'-GC CAGGCTATGA GGCTCCTT-3' (SEQ ID NO: 107)
PR0531 (DNA48314-1320): 48314.tm.fl : 5'-TTCAAGTTCCTGAAGCCGATTAT-3' (SEQ ID NO: 108)
48814.tm.pl :
5'-CCAACTTCCCTCCCCAGTGCCCT-3' (SEQ ID NO: 109)
48814.tm.rl : 5'-TTGGGGAAGGTAGAATTTCCTTGTAT-3' (SEQ ID NO: 1 10)
PR0538 & PR03664 (DNA48613-1268 & DNA48614-1268):
48613.tm.fl :
5'-CCCCATCTCCACTTCTGATTCA-5' (SEQ ID NO: 1 1 1 )
48613.tm.pl :
5'-CACAATTTAGCCATGTCATCTGGTGGTGA-5' (SEQ ID NO: 1 12) 48613.tm.rl :
5'-ATTCTGGTGATCCTGGTAGTCAAGA-5' (SEQ ID NO: 1 13)
PR0618 (DNA49152-1324): 49152.tm.fl :
5'-CCCTTCTGCCTCCCAATTCT-3' (SEQ ID NO: 1 14) 49152.tm.pl :
5'-TCTCCTCCGTCCCCTTCCTCCACT-3' (SEQ ID NO: 1 15)
49152.tm.rl :
5'-TGAGCCACTGCCTTGCATTA-3' (SEQ ID NO: 1 16)
PR0772 (DNA49645-1347): 49645.tm.f2:
5'-TCTGCAGACGCGATGGATAA-3' (SEQ ID NO: 1 17)
49645. tm.p2:
5'-CCGAAAATAAAACATCGCCCCTTCTGC-3' (SEQ ID NO: 1 18) 49645 tm r2
5'-CACGTGGCCTTTCACACTGA-3* (SEQ ID NO 1 19) 49645 tm fl
5'-ACTTGTGACAGCAGTATGCTGTCTT-3' (SEQ ID NO 120) 49645 tm pl
5'-AAGCTTCTGTTCAATCCCAGCGGTCC-3' (SEQ ID NO 121 )
49645 tm rl
5'-ATGCACAGGCTTTTTCTGGTAA-3' (SEQ ID NO 122)
PRO703 (DNA50913-1287) 50913 tm fl
5'-GCAGGAAACCTTCGAATCTGAG-3' (SEQ ID NO 123)
50913 tm pl
5'-ACACCTGAGGCACCTGAGAGAGGAACTCT-3' (SEQ ID NO 124)
50913 tm rl 5'-GACAGCCCAGTACACCTGCAA 3' (SEQ ID NO 125)
PR0792 (DNA56352-1358) 56352 tm fl
5'-GACGGCTGGATCTGTGAGAAA-3 (SEQ ID NO 126)
56352 tm pl 5'-CACAACTGCTGACCCCGCCCA 3' (SEQ ID NO 127)
56352 tm rl 5'-CCAGGATACGACATGCTGCAA-3 (SEQ ID NO 128)
PR0474 (DNA56045-1380) 56045 tm f 1 5' AAACTCCAACCTGTATCAGATGCA 3' (SEQ ID NO 129)
56045 tm p l
5'-CCCCCAAGCCCTTAGACTCTAAGCCC-3 (SEQ ID NO 130)
56045 tm rl 5'-G CCCGGCACCTTGCTAAC 3 (SEQ ID NO 131 )
The 5 nuclease assay reaction is a fluorescent PCR-based technique which makes use of the 5' exonuclease acti vit) of Taq DNA polymerase enzyme to monitor amplification in real time 1 wo oligonucleotide primers are used to generate an amplicon typical ot a PCR reaction A third oligonucleotide or probe, is designed to detect nucleotide sequence located between the two PCR pπmeis The probe is non-extendible by Taq DNA polymerase enzyme, and is labeled with a reporter fluorescent dye and a quencher fluorescent d>e Any laser-induced emission from the reporter dye is quenched by the quenching dye when the two dyes are located close together as they are on the probe. During the amplification reaction, the Taq DNA polymerase enzyme cleaves the probe in a template-dependent manner. The resultant probe fragments disassociate in solution, and signal from the released reporter dye is free from the quenching effect of the second fluorophore. One molecule of reporter dye is liberated for each new molecule synthesized, and detection of the unquenched reporter dye provides the basis for quantitative interpretation of the data.
The 5' nuclease procedure is run on a real-time quantitative PCR device such as the ABI Prism 7700TM
Sequence Detection. The system consists of a thermocycler, laser, charge-coupled device (CCD) camera and computer. The system amplifies samples in a 96- well format on a thermocycler. During amplification, laser-induced fluorescent signal is collected in real-time through fiber optics cables for all 96 wells, and detected at the CCD. The system includes software for running the instrument and for analyzing the data.
5' Nuclease assay data are initially expressed as Ct, or the threshold cycle. This is defined as the cycle at which the reporter signal accumulates above the background level of fluorescence. The Ct values are used as quantitative measurement of the relative number of starting copies of a particular target sequence in a nucleic acid sample when comparing cancer DNA results to normal human DNA results.
Table 4 describes the stage, T stage and N stage of various primary tumors which were used to screen the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 compounds of the invention.
Table 4 Primary Lung and Colon Tumor Profiles
Primary Tumor Stage Other Stage Dukes Stage T Stage N Stage
Human lung tumor SqCCA (SRCC724) [LT1 ] IB TI Nl Human lung tumoi NSCCa (SRCC725) [LT1 a] IA T3 NO
Human lung tumor AdenoCa (SRCC726) [LT2] IB T2 NO
Human lung tumor AdenoCa (SRCC727) [LT3] IB TI N2
Human lung tumor SqCCq (SRCC728) [LT4] IIB T2 NO
Human lung tumor AdenoCa (SRCC729) [LT6] IV TI NO Human lung tumor Aden/SqCCa (SRCC730) [LT7] IB TI NO
Human lung tumor AdenoCa (SRCC731 ) [LT9] IIB T2 NO
Human lung tumor SqCCa (SRCC732) [LT10] IA T2 Nl
Human lung tumor AdenoCa (SRCC733) [LT11 ] IB TI Nl
Human lung tumor AdenoCa (SRCC734) [LT12] IIA T2 NO Human lung tumor BAC (SRCC735) [LT13] IB T2 NO
Human lung tumor SqCCa (SRCC736) [LT15] IB T2 NO
Human lung tumor SqCCa (SRCC737) [LT16] IB T2 NO
Human lung tumor SqCCa (SRCC738) [LT17] IIB T2 Nl
Human lung tumor SqCCa (SRCC739) [LT18] IB T2 NO Human lung tumor SqCCa (SRCC740) [LT19] IB T2 NO
Human lung tumor LCCa (SRCC741 ) [LT21 ] IIB T3 Nl
Human colon AdenoCa (SRCC742) [CT2] M l D pT4 NO
Human colon AdenoCa (SRCC743) [CT3] B pT3 NO
Human colon AdenoCa (SRCC 744) [CT8] B T3 NO Human colon AdenoCa (SRCC745) [CT10] A pT2 NO
Human colon AdenoCa (SRCC746) [CT12] MO, Rl B T3 NO
Human colon AdenoCa (SRCC747) [CT14] pMO, RO B pT3 pNO
Human colon AdenoCa (SRCC748) [CT15] M 1 , R2 D T4 N2
Human colon AdenoCa (SRCC749) [CT16] pMO B pT3 pNO Human colon AdenoCa (SRCC750) [CT17] C 1 pT3 pNl
Human colon AdenoCa (SRCC751 ) [CT1 ] MO, R 1 B pT3 NO
Human colon AdenoCa (SRCC752) [CT4] B pT3 M0
Human colon AdenoCa (SRCC753) [CT5] G2 Cl pT3 pNO
Human colon AdenoCa (SRCC754) [CT6] pMO, RO B pT3 pNO Human colon AdenoCa (SRCC755) [CT7] Gl A pT2 pNO
Human colon AdenoCa (SRCC756) [CT9] G3 D pT4 pN2
Human colon AdenoCa (SRCC757) [CT11 ] B T3 NO
Human colon AdenoCa (SRCC758) [CT18] MO RO B pT3 pNO
DNA Preparation DNA was prepared from cultured cell lines, primary tumors, and normal human blood The isolation was performed using purification kit buffer set and protease and all from Qiagen according to the manufacturer s instructions and the description below Cell cultuie sis
Cells were washed and trypsinized at a concentration of 7 5 x 10s per tip and pelleted bv centπfuging at 1000 rpm for 5 minutes at 4 C followed by washing again with 1/2 volume ot PBS and recentπtugation The pellets were washed a third time the suspended cells collected and washed 2x with PBS The cells were then suspended into 10 ml PBS Butter C l was equilibrated at 4 C Qiagen protease #19155 was diluted into 6 25 ml cold ddHΛ to a final concentiation of 20 mg/ml and equilibiated at 4 C 10 ml of G2 Buttei was prepared by diluting Qiagen RNAse A stock ( 100 mg/ml) to a final concentration of 200 μg/ml Butter C 1 ( 10 ml, 4°C) and ddH20 (40 ml, 4"C) were then added to the 10 ml of cell suspension, mixed by inverting and incubated on ice for 10 minutes The cell nuclei were pelleted by centπfuging in a Beckman swinging bucket rotor at 2500 rpm at 4°C for 15 minutes The supernatant was discarded and the nuclei were suspended with a vortex into 2 ml Buffer Cl (at 4°C) and 6 ml ddH20, followed by a second 4"C centrifugation at 2500 rpm for 15 minutes The nuclei were then resuspended into the residual buffer using 200 μl per tip G2 buffei ( 10 ml) was added to the suspended nuclei while gentle vortexing was applied Upon completion of buffer addition, vigorous vortexing was applied for 30 seconds Qiagen protease (200 μl, prepared as indicated above) was added and incubated at 50°C for 60 minutes The incubation and centrifugation were repeated until the lysates were clear (e g , incubating additional 30-60 minutes, pelleting at 3000 x g for 10 min , 4°C) Solid human tumoi sample prepai atton and lysis
Tumor samples were weighed and placed into 50 ml conical tubes and held on ice Processing was limited to no more than 250 mg tissue per preparation (1 tip/preparation) The protease solution was freshly prepared by diluting into 6 25 ml cold ddH20 to a final concentration of 20 mg/ml and stored at 4°C G2 buffer (20 ml) was prepared by diluting DNAse A to a final concentration of 200 mg/ml (from 100 mg/ml stock) The tumor tissue was homogenated in 19 ml G2 buffer for 60 seconds using the large tip of the polytron in a laminar-flow TC hood in order to avoid inhalation of aerosols, and held at room temperature Between samples, the polytron was cleaned by spinning at 2 x 30 seconds each in 2L ddH20, followed by G2 buffer (50 ml) If tissue was still present on the generator tip, the apparatus was disassembled and cleaned
Qiagen protease (prepared as indicated above, 1 0 ml) was added, followed by vortexing and incubation at 50°C for 3 hours The incubation and centrifugation were repeated until the lysates were clear (e g , incubating additional 30-60 minutes, pelleting at 3000 x g for 10 min , 4"C)
Human blood prepai ation and hsis
Blood was drawn from healthy volunteers using standard infectious agent protocols and citrated into 10 ml samples per tip Qiagen protease was freshly prepared by dilution into 6 25 ml cold ddH20 to a final concentration of 20 mg/ml and stored at 4°C G2 buffer was prepared by diluting RNAse A to a final concentration of 200 μg/ml from 100 mg/ml stock The blood (10 ml) was placed into a 50 ml conical tube and 10 ml Cl buffei and 30 ml ddH20 (both previously equilibrated to 4"C) were added, and the components mixed by inverting and held on ice for 10 minutes The nuclei were pelleted with a Beckman swinging bucket rotor at 2500 rpm, 4"C for
15 minutes and the supernatant discarded With a vortex, the nuclei were suspended into 2 ml Cl buffer (4"C) and 6 ml ddHoO (4"C) Vortexing was repeated until the pellet was white The nuclei were then suspended into the residual buffer using a 200 μl tip G2 buffer ( 10 ml) was added to the suspended nuclei while gently vortexing, followed by vigorous vortexing for 30 seconds Qiagen protease was added (200 ul) and incubated at 50°C for 60 minutes The incubation and centrifugation were repeated until the lysates were cleai (e g , incubating additional
30-60 minutes, pelleting at 3000 x g for 10 mm , 4"C) Pui cation ofcleaied hsates
(1 ) Isolation of genomic DNA
Genomic DNA was equilibrated ( 1 sample per maxi tip preparation) with 10 ml QBT buffer QF elution buffer was equilibrated at 50"C The samples were vortexed for 30 seconds, then loaded onto equilibrated tips and drained by gravity The tips were washed with 2 x 15 ml QC buffer The DNA was eluted into 30 ml silanized, autoclaved 30 ml Corex tubes with 15 ml QF buffer (50"C) Isopropanol ( 10 5 ml) was added to each sample, the tubes covered with parafin and mixed by repeated inversion until the DNA precipitated Samples were pelleted by centrifugation in the SS-34 rotor at 15,000 rpm for 10 minutes at 4"C The pellet location was marked, the supernatant discarded, and 10 ml 70% ethanol (4°C) was added Samples were pelleted again by centrifugation on the SS 34 rotor at 10,000 rpm for 10 minutes at 4°C The pellet location was marked and the supernatant discarded The tubes were then placed on their side in a drying rack and dried 10 minutes at 37"C, taking care not to overdry the samples
After drying, the pellets were dissolved into 1 0 ml TE (pH 8 5) and placed at 50°C for 1 -2 hours Samples were held overnight at 4°C as dissolution continued The DNA solution was then transferred to 1 5 ml tubes with a 26 gauge needle on a tuberculin syringe The transfer was repeated 5x in order to shear the DNA Samples were then placed at 50°C for 1 -2 hours
(2) Quantitation of genomic DNA and preparation for gene amplification assay
The DNA levels in each tube were quantified by standard A26(/ A2M, spectrophotometry on a 1 20 dilution (5 μl DNA + 95 μl ddH,0) using the 0 1 ml quartz cuvettes in the Beckman DU640 spectrophotometer A,6,/A,M) ratios were in the range of 1 8-1 9 Each DNA sample was then diluted further to approximately 200 ng/ml in TE (pH 8 5) If the original material was highly concentrated (about 700 ng/μl), the material was placed at 50°C for several hours until resuspended
Fluorometπc DNA quantitation was then performed on the diluted material (20-600 ng/ml) using the manufacturer's guidelines as modified below This was accomplished by allowing a Hoeffer DyNA Quant 200 fluorometer to warm-up for about 15 minutes The Hoechst dye working solution (#H33258, 10 μl, prepared withm 12 hours of use) was diluted into 100 ml 1 x TNE buffer A 2 ml cuvette was filled with the fluorometer solution, placed into the machine, and the machine was zeroed pGEM 3Zf (+) (2 μl, lot #360851026) was added to 2 ml ot fluorometer solution and calibrated at 200 units An additional 2 μl of pGEM 3Zf (4-) DNA was then tested and the reading confirmed at 400 +/- 10 units Each sample was then read at least in triplicate When 3 samples were found to be within 10% of each other, their average was taken and this value was used as the quantification value
The fluorometπcly determined concentration was then used to dilute each sample to 10 ng/μl in ddH^O This was done simultaneously on all template samples for a single TaqMan™ plate assay, and with enough material to run 500 1000 assays The samples were tested in triplicate with Taqman™ primers and probe both B-actin and GAPDH on a single plate with normal human DNA and no-template controls The diluted samples were used provided that the CT value of normal human DNA subtracted from test DNA was +/- 1 Ct The diluted, lot qualified genomic DNA was stored in 1 0 ml aliquots at -80"C Aliquots which were subsequently to be used in the gene amplification assay were stored at 4"C Each 1 ml aliquot is enough for 8 9 plates or 64 tests Gene amplification
Figure imgf000124_0001
The PRO213, PRO 1330, PRO 1449, PRO237, PRO324, PRO351 PR0362. PR0615 PR0531 , PR0538
PR03664, PR0618, PR0772, PRO703, PR0792 oi PR0474 compounds ot the invention were screened in the following primary tumors and the resulting ΔCt values are reported in Table 5 Table 5 ΔCt values in lung and colon primary tumor and cell line models
Figure imgf000125_0001
Table 5 Continued ΔCt values in lung and colon pi imary tumor and cell line models
t\>
I
Figure imgf000126_0001
Table 5 Continued ΔCt values in lung and colon primary tumor and cell line models
Figure imgf000127_0001
Table 5 Continued ΔCt values in lung and colon primary tumor and cell line models
Figure imgf000128_0001
Table 5 Continued ΔCt values in lung and colon primary tumor and cell line models
Figure imgf000129_0001
Table 5 Continued ΔCt values in lung and colon primary tumor and cell line models
rv> oo
10
Figure imgf000130_0001
DISCUSSION AND CONCLUSION
PRQ213, PRO1330 and PRQ1449 (DNA30943-1 163, DNA64909-1 163 and DNA64908-1 163. respectively)
The ΔCt values for DNA30943-1 163, DNA64909-1 163 and DNA64908 1 163 in a variety of tumors are reported in Table 5 A ΔCt of >1 was typically used as the threshold value for amplification scoring, as this represents a doubling of gene copy Table 5 indicates that significant amplification ot nucleic acid encoding PRO213. PRO1330 and PR01449 occurred (l) m primary lung tumors LTl , LTla, LT3, LT4. LT6, LT7, LT9, LTl 1 , LT12, LT13, LT15, LT16, LT17, LT19, LT21 and LT22, (2) in primary colon tumors CT2, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CT4, CT5 and CT6, (3) in lung tumor cell lines Calu 1, H441 and H810, and (4) m colon tumor cell lines HT29, SW403, LS174T, HCT15 and HCC2998 Because amplification of DNA30943-1163, DNA64909-1 163 and DNA64908-1163 occurs m various tumors, they are highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0213 , PRO 1330 and PRO 1449 would be expected to have utility in cancer therapy
PRQ237 (DNA34353-1428) The ΔCt values for DNA34353-1428 in a variety of tumors are reported in Table 5 A ΔCt of >1 was typically used as the threshold value for amplification scoring, as this represents a doubling of gene copy Table
5 indicates that significant amplification of nucleic acid encoding PR0237 occurred in primary lung tumors LT 1 a,
LT3, LT6, LT7, LTIO, LTl 3, LT16 and LTl 7
Because amplification of DNA34353-1428 occurs in various lung tumors, it is highly probable to play a significant lole in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the
PR0237 would be expected to have utility in cancer therapy
PRQ324 (DNA36343-1310)
The ΔCt values for DNA36343 1310 in a variety of tumors are reported in Table 5 A ΔCt of > 1 was typically used as the threshold value for amplification scoring, as this represents a doubling of gene copy Table 5 indicates that significant amplification ot nucleic acid encoding PR0324 occuπed in primary lung tumors LTl 1 LT12, LT16 LT17, LT19 and LT21
Because amplification of DNA36343-1310 occurs in various lung tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e antibodies) directed against the PR0324 would be expected to ha\ e utility in cancer therapy
PRQ351 (DNA40571 1315)
The ΔCt values for DN A40571 - 1315 in a variety of tumors are reported in Table 5 A ΔCt of > 1 was typically used as the threshold value tor amplification scoring as this represents a doubling of gene cop) Table 5 indicates that significant amplification of nucleic acid encoding PR0351 occuπed in primary lung tumors LT9 LT10, LTl 1 , LT13, LT15, LT16, LT17, LT18, LT19 and LT21 Because amplification of DN A40571 1 1 occurs in lung tumoi s, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0351 would be expected to have utility in cancer therapy
PRQ362 (DNA45416- 1251 )
The ΔCt values for DNA45416-1251 in a variety of tumors are reported in Table 5 A ΔCt ot >1 was typically used as the threshold value for amplification scoring, as this represents a doubling of gene copy Table 5 indicates that significant amplification of nucleic acid encoding PR0362 occurred in pπmary lung tumors LT2, LT4 and LTIO
Because amplification of DNA45416-1251 occurs in lung tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0362 would be expected to have utility in cancer therapy
PRQ615 (DNA48304-1323)
The ΔCt values for DNA48304-1323 in a variety of tumors are reported in Table 5 A ΔCt ot >1 was typically used as the threshold value for amplification scoring, as this represents a doubling of gene copy Table 5 indicates that significant amplification of nucleic acid encoding PR0615 occurred ( 1 ) in primary lung tumors LT3, LT6, LT7, LT9, LTIO, LTl 1 , LT12, LT13, LT15, LT16, LT17, LT19 and LT21 , and (2) in primary colon tumors CT2, CT3, CT10, CT12, CT14, CT15, CT16, CT17, CT4, CT5, CT1 1 and CT18
Because amplification of DNA48304-1323 occurs in various tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0615 would be expected to have utility in cancer therapy
PRQ531 (DNA48314-1320)
The ΔCt values for DNA48314-1320 in a variety of tumors are reported in Table 5 A ΔCt of >1 was typically used as the threshold value for amplification scoring, as this represents a doubling of gene copy Table
5 indicates that significant amplification of nucleic acid encoding PR0531 occurred ( 1 ) in primary lung tumors
LTla, LT3, LT4, LT6, LT9, LTI O, LTl 1 , LT12, LT13, LT15, LT17 and LT19, and (2) in primary colon tumors CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CT5, CT9 and CT1 1
Because amplification of DNA48314-1320 occurs in various tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0531 would be expected to have utility in cancer therapy
PRQ538 and PRQ3664 (DNA48613-1268 and DNA48614- 1268) The ΔCt values for DNA48613-1268 and DNA48614- 1268 in a \ anety of tumors are reported in Table
5 A ΔCt of > 1 was typically used as the threshold value for amplification scoring as this represents a doubling of gene copy Table 5 indicates that significant amplification of nucleic acid encoding PR0538 and PR03664 occurred in primary lung tumors LT7, LT9, LT10, LTl 1 , LTl 3, LTl 5, LTl 7 and LT21
Because amplification of DNA48613-1268 and DNA48614-1268 occurs in various lung tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0538 and PR03664 would be expected to have utility in cancer therapy
PRQ618 (DNA49152- 1324)
The ΔCt values for DNA49152-1324 in a variety of tumors are reported in Table 5 A ΔCt of >1 was typically used as the threshold value for amplification scoπng, as this represents a doubling of gene copy Table 5 indicates that significant amplification of nucleic acid encoding PROόl 8 occurred in primary lung tumors LT3, LT9, LTI O, LTl 1 and LTl 7
Because amplification of DNA49152-1324 occurs in lung tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0618 would be expected to have utility in cancer therapy
PRQ772 (DNA49645-1347)
The ΔCt values for DNA49645-1347 in a variety of tumors are reported in Table 5 A ΔCt of >1 was typically used as the threshold value for amplification scoπng, as this represents a doubling of gene copy Table 5 indicates that significant amplification of nucleic acid encoding PR0772 occuπed in primary lung tumors LTl a, LT3, LT6, LT9, LTIO, LTl 1 , LTl 3, LTl 5, LTl 7 and LTl 9
Because amplification of DNA49645- 1347 occurs in lung tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0772 would be expected to have utility in cancer therapy
PRO703 (DNA50913-1287) The ΔCt values for DNA50913 1287 in a variety of tumors aie reported in Table 5 A ΔCt of >1 was typically used as the threshold value for amplification scoring as this represents a doubling of gene copy Table 5 indicates that significant amplification of nucleic acid encoding PRO703 occurred (1 ) in primary lung tumors LTla, LT3, LT6, LT7, LTIO, LTl 1 , LTl 2, LT13, LT15, LT16 LT17, LT19 and LT21 , and (2) in primary colon tumors CT2, CT3, CT8, CT10, CT12, CT14, CT15, CT16, CT17, CT1 CT4, CT5, CT6, CT7, CT1 1 and CT18 Because amplification of DNA50913-1287 occurs in various tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PRO703 would be expected to have utility in cancer therapy
PRQ792 (DNA56352-1358)
The ΔCt values for DNA56352-1358 in a variety of tumors are reported in Table 5 A ΔCt of > 1 was typically used as the threshold value for amplification scoring as this represents a doubling of gene cop\ Table 5 indicates that significant amplification of nucleic acid encoding PR0792 occurred (1 ) in pπmary lung tumors LTla, LT3, LT6, LT9, LT10, LTl 1 , LT13, LT15, LT17, and LT19 and (2) in primary colon tumor CT2
Because amplification of DNA56352-1358 occurs in various tumors, it is highly probable to play a significant role in tumor formation or growth As a result antagonists (e g , antibodies) directed against the PR0792 would be expected to have utility cancer therapy
PRQ474 (DNA56045 1380)
The ΔCt values for DNA56045-1380 in a variety of tumors are reported in Table 5 A ΔCt of >1 was typically used as the threshold value for amplification scoring, as this represents a doubling of gene copy Table 5 indicates that significant amplification of nucleic acid encoding PR0474 occurred (1 ) in primary lung tumors LTla, LT3, LT6, LT7, LT9, LTIO, LT1 1 , LT12, LT13, LT15, LT16, LT17, LT18, LT19 and LT21 , and (2) in primary colon tumors CT2, CT3, CT4, CT5, CT6, CT8, CT10, CT1 1 , CT12, CT14, CT15, CT16, CT17, CT1 and CT18
Because amplification of DNA56045-1380 occurs in various tumors, it is highly probable to play a significant role in tumor formation or growth As a result, antagonists (e g , antibodies) directed against the PR0474 would be expected to have utility in cancer therapy
EXAMPLE 15 In situ Hybridization In situ hybridization is a powerful and versatile technique for the detection and localization of nucleic acid sequences within cell or tissue preparations It may be useful, for example, to identify sites of gene expression, analyze the tissue distribution of transcription, identify and localize viral infection, follow changes in specific mRNA synthesis, and aid in chromosome mapping
In situ hybridization was performed following an optimized version of the protocol by Lu and Gillett, Cell Vision, 1 169-176 ( 1994), using PCR-generated "P-labeled πboprobes Briefly, formalin-fixed, paraffin-embedded human tissues were sectioned, deparaffinized, deproteinated in proteinase K (20 g/ml) for 15 minutes at 37 °C, and further processed for in situ hybridization as described by Lu and Gillett, supia A (33 P)UTP-labeled antisense πboprobe was generated from a PCR product and hybridized at 55 °C overnight The slides were dipped in Kodak NTB2™ nuclear track emulsion and exposed for 4 weeks — P-Riboprobe synthesis 6 0μl (125 mCι) of P-UTP (AmershamBF 1002, SA<2000 Cι/mmol) were speed vacuum dried To each tube containing dried "P UTP, the following ingredients were added 2 0 μl 5x transcription buffer
1 O μl DTT (lOO mM)
2 0 μl NTP mix (2 5 mM 10 μl each of 10 mM GTP, CTP & ATP + 10 μl H,0) 1 0 μl UTP (50 μM)
1 0 μl RNAs 1 0 μl DNA template (1 μg) 1 0 μl H,0
1 0 μl RNA polymerase (for PCR products T3 = AS T7 = S, usually) The tubes were incubated at 37 °C for one hour A total of 1 0 μl RQ1 DNase was added, followed by incubation at 37 °C tor 15 minutes A total of 90 μl TE ( 10 M Tris pH 7 6/1 mM EDTA pH 8 0) was added and the mixture was pipetted onto DE81 paper The remaining solution was loaded in a MICROCON-50 ultrafiltration unit, and spun using program 10 (6 minutes) The filtration unit was inverted over a second tube and spun using program 2 (3 minutes) After the final recovery spin, a total of 100 μl TE was added, then 1 μl of the final product was pipetted on DE81 paper and counted in 6 ml of BIOFLUOR II™ The probe was run on a TBE/urea gel A total of 1 -3 μl of the probe or 5 μl of RNA Mrk III was added to 3 μl of loading buffer After heating on a 95 °C heat block for three minutes, the gel was immediately placed on ice The wells of gel were flushed, and the sample was loaded and run at 180-250 volts for 45 minutes The gel was wrapped in plastic wrap (SARAN™ brand) and exposed to XAR film with an intensifying screen in a -70°C freezer one hour to overnight -P-Hybπdization
A Pretreatment of frozen sections
The slides were removed from the freezer, placed on aluminum trays, and thawed at room temperature for 5 minutes The trays were placed in a 55 °C incubator for five minutes to reduce condensation The slides were fixed for 10 minutes in 4% paraformaldehyde on ice in the fume hood, and washed in 0 5 x SSC for 5 minutes, at room temperature (25 ml 20 x SSC + 975 ml SQ H20) After deproteination in 0 5 μg/ml proteinase K for 10 minutes at 37°C (12 5 μl of 10 mg/ml stock in 250 ml prewarmed RNAse-free RNAse buffer), the sections were washed in 0 5 x SSC for 10 minutes at room temperature The sections were dehydrated in 70%, 95%, and 100% ethanol, 2 minutes each
B Pretreatment of paraffin-embedded sections The slides were deparaffinized, placed in SQ H20, and rinsed twice in 2 x SSC at room temperature, for
5 minutes each time The sections were deproteinated in 20 μg/ml proteinase K (500 μl of 10 mg/ml in 250 ml RNase-free RNase buffer, 37 °C, 15 minutes) for human embryo tissue, or 8 x proteinase K ( 100 μl in 250 ml Rnase buffer, 37 °C, 30 minutes) for formalin tissues Subsequent rinsing in 0 5 x SSC and dehydiation were performed as described above C Prelnbridization
The slides were laid out in a plastic box lined with Box buffer (4 x SSC, 50% formamide) - saturated filter paper The tissue was covered with 50 μl of hybridization buffer (3 75 g dextran sultate + 6 ml SQ H20), vortexed, and heated in the microwave for 2 minutes with the cap loosened After cooling on ice, 18 75 ml formamide, 3 75 ml 20 x SSC, and 9 ml SQ H20 were added, and the tissue was vortexed well and incubated at 42 °C for 1 -4 hours D Hybiidization
1 0 x 106 cpm probe and 1 0 μl tRNA (50 mg/ml stock) per slide were heated at 95 °C for 3 minutes The slides were cooled on ice, and 48 μl hybridization buffer was added per slide After vortexing 50 μl 3,P mix was added to 50 μl prehybπdization on the slide The slides were incubated overnight at 55 °C E Washes Washing was done for 2x10 minutes with 2xSSC, EDTA at room temperatuie (400 ml 20 x SSC 4- 16 ml
0 25 M EDTA, Vt=4L), followed by RNAseA treatment at 37 °C for 30 minutes (500 μl ot 10 mg/ml in 250 ml Rnase buffer = 20 μg/ml), The slides were washed 2 xlO minutes with 2 x SSC, EDTA at room temperature The stringency wash conditions were as follows 2 hours at 55 °C, 0 1 x SSC, EDTA (20 ml 20 λ SSC 4- 16 ml EDTA, V,=4L)
F Oligonucleotides
In situ analysis was performed on one of the DNA sequences disclosed herein The oligonucleotides employed for these analyses are as follows
B-404K 5'-GGATTCTAATACGACTCACTATAGGGCGCTGCCCCGGCTGGAAGAG-3' (SEQ ID NO 132) B-404L 5'-CTATGAAATTAACCCTCACTAAAGGGAAGCGCTGGGCAGTCACGAGTC-3' (SEQ ID NO 133) A-396K 5'-GGATTCTAATACGACTCACTATAGGGCGGATGGCGGGGTGACACTTG-3' (SEQ ID NO 134) B-407I 5*-CTATGAAATTAACCCTCACTAAAGGGACTTGGGATGCCGTTGGGGTAG-3' (SEQ ID NO 135)
G Results DNA64907-1 163 Expression In Lung Adenocarcinoma And Squamous Carcinoma
In human fetal tissues there was strong specific expression over arterial, venous, capillary and sinusoidal endothehum in all tissues examined, except for fetal brain In normal adult tissues expression was low to absent, but when present appeared expression was confined to the vasculature Highest expression in adult tissues was observed regionally in vessels running within the white matter of rhesus brain Elevated expression was also observed in vasculature of many inflamed and diseased tissues, including tumor vasculature In some of these tissues it was unclear if expression was solely confined to vascular endothehum
In the 15 lung tumors examined no expression was seen over the malignant epithelium, however, vascular expression was observed in many of the tumors and adjacent lung tissue Moderate, apparently non-specific background, was seen with this probe over hyalinised collagen and sites of tissue necrosis Some signal, also thought to be non-specific, was seen over the chimp gastric mucosa, transitional cell epithelium of human adult bladder and fetal retina
EXAMPLE 16
Use of PRQ213, PRO1330, PRQ1449. PRQ237. PRQ324, PRQ351 , PRQ362 PRQ615 PRQ531. PRQ538
PRQ3664, PRQ618 PRQ772. PRO703. PRQ792 or PRQ474 as a hybridization probe The following method describes use of a nucleotide sequence encoding a PR0213, PRO 1330, PRO 1449,
PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703,
PR0792 or PR0474 polypeptide as a hybridization probe
DNA comprising the coding sequence of a full-length or mature "PR0213 , PRO 1330, PRO 1449, PR0237 PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474" polypeptide as disclosed herein and/or fragments thereof may be employed as a probe to screen foi homologous DNAs (such as those encoding naturally-occurring variants of PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772 PRO703 PR0792 or PR0474) in human tissue cDNA libraries or human tissue genomic libraries
Hybridization and washing of filters containing either library DNAs is performed under the following high stringency conditions Hybridization of radiolabeled PR0213-, PRO1330-, PRO l 449-, PR0237-, PR0324-, PR0351 -, PR0362-, PR0615-, PR0531-, PR0538-, PR03664-. PR0618-, PR0772-, PRO703-, PR0792- or PR0474-deπved probe to the filters is performed in a solution of 50% formamide, 5x SSC, 0 1 % SDS, 0 1 % sodium pyrophosphate, 50 mM sodium phosphate, pH 6 8, 2x Denhardt's solution, and 10% dextran sulfate at 42"C for 20 hours Washing of the filters is performed in an aqueous solution of 0 1 x SSC and 0 1 % SDS at 42°C DNAs having a desired sequence identity with the DNA encoding full-length native sequence PR0213,
PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 can then be identified using standard techniques known in the art
EXAMPLE 17 Expression of PRQ213, PRO1330, PRQ1449. PRQ237. PRQ324. PRQ351. PRQ362. PRQ615. PRQ531 , PRQ538, PRQ3664, PRQ618. PRQ772. PRO703. PRQ792 or PRQ474 Polypeptides in E coli
This example illustrates preparation of an unglycosylated form of PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 by recombinant expression in E coli
The DNA sequence encoding the PRO polypeptide of interest is initially amplified using selected PCR primers The primers should contain restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector A variety of expression vectors may be employed An example of a suitable vector is pBR322 (derived from E colt, see Bolivar et al , Gene, 2 95 (1977)) which contains genes for ampicillin and tetracychne resistance The vector is digested with restriction enzyme and dephosphorylated The PCR amplified sequences are then ligated into the vector The vector will preferably include sequences which encode for an antibiotic resistance gene, a trp promoter, a poly-His leader (including the first six SΗI codons, poly-His sequence, and enterok ase cleavage site), the PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 coding region, lambda transcriptional terminator, and an argU gene
The ligation mixture is then used to transform a selected E coli strain using the methods described in Sambrook et al , supia Transformants are identified by their ability to grow on LB plates and antibiotic resistant colonies aie then selected Plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequencing
Selected clones can be grown overnight in liquid culture medium such as LB broth supplemented with antibiotics The overnight culture may subsequently be used to inoculate a larger scale culture The cells are then grown to a desired optical density, during which the expression promoter is turned on
After cultuπng the cells for several more hours, the cells can be harvested by centrifugation The cell pellet obtained by the centrifugation can be solubilized using various agents known in the art and the solubihzed PR0213 PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362. PR061 5 PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 protein can then be purif ied using a metal chelating column under conditions that allow tight binding of the protein
PR0237, PR0213, PRO1330 and PR01449 were successfully expiessed in E cob in a poly-His tagged form using the following procedure The DNA encoding PR0237, PR0213, PRO 1330 and PR01449 was initially amplified using selected PCR primers The primers contained restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector, and other useful sequences providing for efficient and reliable translation initiation, rapid purification on a metal chelation column, and proteolytic removal with enterokinase The PCR-amplified, poly-His tagged sequences were then ligated into an expression vector, which was used to transform an E coli host based on strain 52 (W31 10 fuhA(tonA) Ion galE rpoHts(htpRts) clpP(ladq) Transformants were first grown in LB containing 50 mg/ml carbenicilhn at 30°C with shaking until an O D of 3-5 at 600 nm was reached Cultures were then diluted 50-100 fold into CRAP media (prepared by mixing 3 57 g (NH4)2S04, 0 71 g sodium cιtrate«2H,0, 1 07 g KCl, 5 36 g Difco yeast extract 5 36g Sheffield hycase SF in 500 ml water, as well as 1 10 mM MPOS, pH 7 3, 0 55% (w/v) glucose and 7 mM MgS04) and grown for approximately 20-30 hours at 30CC with shaking Samples were removed to verify expression by SDS PAGE analysis, and the bulk culture was centrifuged to pellet the cells Cell pellets were frozen until purification and refolding
E coli paste from 0 5 to 1 L fermentations (6-10 g pellets) was resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris, pH 8 buffer Solid sodium sulfite and sodium tetrathionate were added to make final concentrations of 0 IM and 0 02 M, respectively, and the solution was stiπed overnight at 4°C This step results in a denatured protein with all cysteine residues blocked by sulfitolization The solution was centrifuged at 40,000 rpm in a Beckman Ultracentifuge for 30 mm The supernatant was diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7 4) and filtered through 0 22 micron filters to clarify The clarified extract was loaded onto a 5 ml Qiagen Ni 1+-NTA metal chelate column equilibrated in the metal chelate column buffer The column was washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7 4 The proteins were eluted with buffer containing 250 mM imidazole Fractions containing the desired protein were pooled and stored at 4°C Protein concentration was estimated by its absorbance at 280 nm using the calculated extinction coefficient based on its ammo acid sequence
The protein was refolded by diluting sample slowly into freshly prepared refolding buffer consisting of 20 mM Tris pH 8 6, 0 3 M NaCI, 2 5 M urea, 5 mM cysteine, 20 mM glycine and 1 mM EDTA Refolding volumes were chosen so that the final protein concentration was between 50 to 100 micrograms/ml The refolding solution was stiπed gently at 4CC for 12 36 hours The refolding reaction was quenched by the addition of TFA to a final concentration of 0 4% (pH of approximately 3) Before further purification of the protein the solution was filtered through a 0 22 micron filter and acetonitπle was added to 2 10% final concentration The refolded protein was chromatographed on a Poros Rl/H reversed phase column using a mobile buffei of 0 1 % TFA with elution with a gradient of acetonitπle from 10 to 80% Aliquots of fractions with A-,w, absorbance were analyzed on SDS polyacrylamide gels and fractions containing homogeneous refolded protein were pooled Generally the properly refolded species of most proteins are eluted at the lowest concentrations of acetonitπle since those species are the most compact with their hydrophobic interiors shielded from mtei action with the re\ ersed phase resin Aggregated species are usually eluted at higher acetonitπle concentrations In addition to resoh ing mistolded forms of proteins from the desired form, the reversed phase step also iemoves endotoxin from the samples
Fractions containing the desired folded PR0237 PR0213, PRO 1330 and PR01449 protein were pooled and the acetonitπle removed using a gentle stream of nitrogen directed at the solution Proteins were formulated into 20 mM Hepes pH 6 8 with 0 14 M sodium chloride and 4% mannitol by dialysis or by gel filtration using G25 Superfine (Pharmacia) resins equilibrated in the formulation buffer and sterile filtered
EXAMPLE 18
Expression of PR0213 PRO 1330. PRO 1449 PRQ237. PRQ324 PRQ351. PRQ362. PRQ615. PRQ531
PRQ538 PRQ3664. PRQ618, PRQ772, PRO703. PRQ792 or PRQ474 in mammalian cells This example illustrates preparation of a potentially glycosylated form of PR0213, PROl 330, PROl 449,
PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703,
PR0792 or PR0474 by recombinant expression in mammalian cells
The vector, pRK5 (see EP 307,247, published March 15, 1989), is employed as the expression vector Optionally, the PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 DNA is ligated into pRK5 with selected restriction enzymes to allow insertion of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 DNA using ligation methods such as described in Sambrook et al , supra The resulting vector is called pRK5-PR0213, pRK5-PRO1330, pRK5 PR01449, pRK5 PR0237, pRK5-PR0324, pRK5-PR0351 , pRK5-PR0362, pRK5-PR0615, pRK5-PR0531 , pRK5-PR0538, pRK5-PR03664, pRK5-PR0618, pRK5-PR0772, pRK5-PRO703, pRK5-PR0792 or pRK5- PR0474
In one embodiment, the selected host cells may be 293 cells Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue culture plates in medium such as DMEM supplemented with fetal calf serum and optionally, nutrient components and/or antibiotics About 10 μg pRK5-PR0213, pRK5 PRO1330, pRK5 PR01449, pRK5-PR0237, pRK5-PR0324, pRK5-PR0351 , pRK5-PR0362, pRK5-PR0615, pRK5-PR0531 , pRK5-PR0538, pRK5-PR03664, pRK5-PR0618, pRK5-PR0772, pRK5 PRO703, pRK5-PR0792 or pRK5- PR0474 DNA is mixed with about 1 μg DNA encoding the VA RNA gene [Thimmappaya et al , Cell, 3J_ 543 (1982)] and dissolved in 500 μl of 1 mM Tπs-HCI, 0 1 mM EDTA, 0 227 M CaCl, To this mixture is added, dropwise, 500 μl of 50 mM HEPES (pH 7 35), 280 mM NaCI, 1 5 mM NaP04, and a precipitate is allowed to form for 10 minutes at 25"C The precipitate is suspended and added to the 293 cells and allowed to settle for about four hours at 37°C The culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for 30 seconds The 293 cells are then washed with serum free medium, fresh medium is added and the cells are incubated for about 5 days
Approximately 24 hours after the transfections, the culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 μCi/ml ,5S cysteine and 200 μCi/ml
Figure imgf000139_0001
After a 12 hour incubation, the conditioned medium is collected, concentrated on a spm filter and loaded onto a 15% SDS gel The processed gel may be dried and exposed to film for a selected period of time to reveal the presence of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615 PR0531 , PR0538, PR03664 PR0618 PR0772, PRO703, PR0792 or PR0474 polypeptide The cultuies containing transfected cells may undergo further incubation (in serum free medium) and the medium is tested in selected bioassays
In an alternative technique PR0213, PRO1330, PR01449, PR0237 PR0324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 DNA may be introduced into 293 cells transiently using the dextran sulfate method described by Somparyrac et al , Proc Natl Acad Sci , \ 2 7575 (1981) 293 cells are grown to maximal density in a spinner flask and 700 μg pRK5-PR0213, pRK5- PRO1330, pRK5-PR01449, pRK5-PR0237, pRK5-PR0324, pRK5-PR0351 , pRK5-PR0362, pRK5-PR0615, pRK5-PR0531 , pRK5-PR0538, pRK5-PR03664, pRK5-PR0618, pRK5-PR0772, pRK5-PRO703, pRK5- PR0792 or pRK5-PR0474 DNA is added The cells are first concentrated from the spinner flask by centrifugation and washed with PBS The DNA-dextran precipitate is incubated on the cell pellet for four hours The cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into the spinner flask containing tissue culture medium, 5 μg/ml bovine insulin and 0 1 μg/ml bovine transferπn After about four days, the conditioned media is centrifuged and filtered to remove cells and debris The sample containing expressed PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 can then be concentrated and purified by any selected method, such as dialysis and/or column chromatography
In another embodiment PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 can be expressed in CHO cells The pRK5-PR0213, pRK5-PRO 1330, pRK5-PRO 1449, pRK5-PR0237, pRK5-PR0324, pRK5-PR0351 , pRK5- PR0362, pRK5-PR0615, pRK5-PR0531, pRK5-PR0538, pRK5-PR03664, pRK5-PR0618, pRK5-PR0772, pRK5-PRO703, pRK5-PR0792 or pRK5-PR0474 vector can be transfected into CHO cells using known reagents such as CaP04 or DEAE-dextran As described above, the cell cultures can be incubated, and the medium replaced with culture medium (alone) or medium containing a radiolabel such as 3,S-methιonιne After determining the presence of the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, the culture medium may be replaced with serum free medium Preferably, the cultures are incubated for about 6 days, and then the conditioned medium is harvested The medium containing the expressed PR0213, PR01330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 can then be concentrated and purified by any selected method
Epitope-tagged PR0213. PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PRO-531 , PR0538, PR03664, PR0618, PR0772, PRO703 PR0792 or PR0474 may also be expressed in host CHO cells The PR0213, PRO1330, PR01449, PR0237 PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may be subcloned out of the pRK5 vector The subclone insert can undergo PCR to fuse in frame with a selected epitope tag such as a poly-His tag into a Baculovirus expression vector The poly-His tagged PR0213, PRO 1330. PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 insert can then be subcloned into a S V40 driven \ ector containing a selection marker such as DHFR for selection of stable clones Finally, the CHO cells can be transfected (as described above) with the SV40 driven vectoi Labeling may be performed, as described above, to verify expression The culture medium containing the expi essed poly-His tagged PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362. PR0615, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 can then be concentrated and purified by any selected method such as by Nr+-chelate affinity chromatography Expression in CHO and/or COS cells may also be accomplished by a transient expression procedure
PR0237, PR0324, PR0362, PR0531 , PR0538, PR0772 and PRO703 were expressed in CHO and/or COS cells by a transient expression procedure, whereas PROl 330 and PR0792 were expressed in CHO cells by a stable procedure Stable expression in CHO cells was performed using the following procedure The proteins were expressed as an IgG construct (immunoadhesin) in which the coding sequences for the soluble forms (e g , extracellular domains) of the respective proteins were fused to an IgGl constant region sequence containing the hinge, CH2 and CH2 domains and/or a poly-His tagged form
Following PCR amplification, the respective DNAs were subcloned in a CHO expression vector using standard techniques as described in Ausubel et al , Current Protocols of Molecular Biology. Unit 3 16, John Wiley and Sons (1997) CHO expression vectors are constructed to have compatible restriction sites 5' and 3' of the DNA of interest to allow the convenient shuttling of cDNA's The vector used for expression in CHO cells is as described in Lucas etal , Nucl Acids Res . 24 9 (1774-1779 (1996), and uses the SV40 early promoter/enhancer to drive expression of the cDNA of interest and dihydrofolate reductase (DHFR) DHFR expression permits selection for stable maintenance of the plasmid following transfection Twelve micrograms of the desired plasmid DNA were introduced into approximately 10 million CHO cells using commercially available transfection reagents Superfecf® (Qiagen), Dosper® or Fugene® (Boehringer Mannheim) The cells were grown as described in Lucas et al , supia Approximately 3 x 107 cells are frozen in an ampule for further growth and production as described below
The ampules containing the plasmid DNA were thawed by placement into a water bath and mixed by vortexing The contents were pipetted into a centrifuge tube containing 10 mis of media and centrifuged at 1000 rpm for 5 minutes The supernatant was aspirated and the cells were resuspended in 10 ml of selective media (0 2 μm filtered PS20 with 5% 0 2 μm diafiltered fetal bovine serum) The cells were then ahquoted into a 100 ml spinner containing 90 ml of selective media After 1 2 days, the cells were transferred into a 250 ml spinner filled with 150 ml selective growth medium and incubated at 37"C After another 2-3 days, 250 ml, 500 ml and 2000 ml spinners were seeded with 3 x 103 cells/ml The cell media was exchanged with fresh media by centrifugation and resuspension in production medium Although any suitable CHO media may be employed, a production medium described in US Patent No 5, 122,469, issued June 16, 1992 was actually used 3L production spinner was seeded at 1 2 x 106 cells/ml On day 0, the cell number and pH were determined On day 1 , the spinner was sampled and sparging with filtered air was commenced On day 2, the spinner was sampled, the temperature shifted to 33°C, and 30 ml of 500 g/L glucose and 0 6 ml of 10% antifoam (e g , 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion) added Throughout the production, the pH was adjusted as necessary to keep at around 7 2 After 10 days, or until viability dropped below 70%, the cell cultuie was harvested by centrifugation and filtered through a 0 22 μm filter The filtrate was either stored at 4"C or immediately loaded onto columns foi purification For the poly-His tagged constructs, the proteins were purified using a Ni 1+-NTA column (Qiagen) Befoi e purification, imidazole was added to the conditioned media to a concentration of 5 mM The conditioned media was pumped onto a 6 ml Ni 2+-NTA column equilibrated in 20 mM Hepes, pH 7 4, buffer containing 0 3 M NaCI and 5 mM imidazole at a flow rate of 4-5 ml/min at 4 C After loading, the column was washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein was subsequently desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCI and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80°C.
Immunoadhesin (Fc containing) constructs were purified from the conditioned media as follows. The conditioned medium was pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 mM Na phosphate buffer, pH 6.8. After loading, the column was washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein was immediately neutralized by collecting 1 ml fractions into tubes containing 275 μl of 1 M Tris buffer, pH 9. The highly purified protein was subsequently desalted into storage buffer as described above for the poly-His tagged proteins. The homogeneity was assessed by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman degradation.
EXAMPLE 19 Expression of PRQ213. PRO1330. PRQ1449. PRQ237, PRQ324, PRQ351 , PRQ362, PRQ615, PRQ531. PRQ538. PRQ3664, PRQ618. PRQ772. PRO703. PRQ792 or PRQ474 in Yeast The following method describes recombinant expression of PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 in yeast.
First, yeast expression vectors are constructed for intracellular production or secretion of PR0213,
PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618,
PR0772, PRO703 , PR0792 or PR0474 from the ADH2/GAPDH promoter. DNA encoding PR0213 , PRO 1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664. PR0618, PR0772,
PRO703, PR0792 or PR0474 and the promoter is inserted into suitable restriction enzyme sites in the selected plasmid to direct intracellular expression of PR0213, PRO 1330, PR01449, PR0237, PR0324, PR0351 , PR0362,
PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474. For secretion, DNA encoding PR0213, PRO1330. PR01449, PR0237. PR0324. PR0351 , PR0362, PR0615. PRO-531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 can be cloned into the selected plasmid, together with
DNA encoding the ADH2/G APDH promoter, a native PR0213 , PRO 1330, PRO 1449, PR0237, PR0324, PR0351 ,
PR0362, PROόl 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 signal peptide or other mammalian signal peptide, or, for example, a yeast alpha-factor or invertase secretory signal/leader sequence, and linker sequences (if needed) for expression of PR0213, PROl 330, PROl 449. PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474.
Yeast cells, such as yeast strain AB 1 10, can then be transformed with the expression plasmids described above and cultured in selected fermentation media. The transformed yeast supernatants can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gels with
Coomassie Blue stain. Recombinant PR0213, PROl 330, PROl 449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 ,
PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 can subsequently be isolated and purified by removing the yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters The concentrate containing PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 may further be purified using selected column chromatography resins
EXAMPLE 20 Expression of PRQ213. PRO1330. PRQ1449. PRQ237 PRQ324, PRQ351 PRQ362, PRQ615. PRQ531.
PRQ538. PRQ3664, PRQ618, PRQ772, PRO703, PRQ792 or PRQ474 in Baculovirus-infected Insect Cells The following method describes recombinant expression in Baculovirus-infected insect cells The sequence codιngforPRO213, PRO1330, PRO1449, PRO237, PRO324, PRO351,PRO362, PRO615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 is fused upstream of an epitope tag contained within a baculovirus expression vector Such epitope tags include poly-His tags and immunoglobulin tags (like Fc regions of IgG) A variety of plasmids may be employed, including plasmids derived from commercially available plasmids such as pVLl 393 (Novagen) Briefly, the sequence encoding PR0213, PRO 1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 or the desired portion of the coding sequence of PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 [such as the sequence encoding the extracellular domain of a transmembrane protein or the sequence encoding the mature protein if the protein is extracellular] is amplified by PCR with primers complementary to the 5' and 3' regions The 5' primer may incorporate flanking (selected) restriction enzyme sites The product is then digested with those selected restriction enzymes and subcloned into the expression vector Recombinant baculovirus is generated by co-transfecting the above plasmid and BaculoGold™ virus DNA
(Pharmingen) into Spodoptei afrugψerda ("Sf9") cells (ATCC CRL 171 1 ) using hpofectin (commercially available from GIBCO BRL) After 4 - 5 days of incubation at 28"C, the released viruses are harvested and used for further amplifications Viral infection and protein expression are performed as described by O'Reilley et al , Baculovirus expression vectors A Laboratory Manual, Oxford Oxford University Press (1994) Expressed poly-His tagged PR0213, PRO 1330, PR01449, PR0237 PR0324, PR0351 , PR0362,
PR0615, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 can then be purified, for example, by Nι2+-chelate affinity chromatography as follows Extracts are prepared from recombinant virus- mfected Sf9 cells as described by Rupert et al , Nature, 362 175 179 ( 1993) Briefly, St9 cells are washed, resuspended in sonication buffer (25 ml Hepes, pH 7 9, 12 5 mM MgCI, 0 1 mM EDTA, 10% glycerol, 0 1 % NP- 40, 0 4 M KCl), and sonicated twice for 20 seconds on ice The sonicates are cleared by centrifugation, and the supernatant is diluted 50-fold in loading buffer (50 mM phosphate, 300 mM NaCI, 10% glycerol, pH 7 8) and filtered through a 0 45 μm filter A Nf +-NTA agarose column (commercially a\ ailable from Qiagen) is prepared with a bed volume ot 5 ml, washed with 25 ml of water and equilibrated with 25 ml of loading buffer The filtered cell extract is loaded onto the column at 0 5 ml per minute The column is washed to baseline A,M, with loading buffer, at which point fraction collection is started Next, the column is washed with a secondaiy wash buffer (50 mM phosphate, 300 mM NaCI, 10% glycerol, pH 6 0), which elutes nonspecif icallv bound protein After reaching A2 (1 baseline again, the column is developed with a 0 to 500 mM imidazole gradient in the secondary wash buffer One ml fractions are collected and analyzed by SDS-PAGE and silver staining or Western blot with Nι2+-NTA- conjugated to alkaline phosphatase (Qiagen) Fractions containing the eluted Hιs10-tagged PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474, respectively, are pooled and dialyzed against loading buffer Alternatively, purification of the IgG tagged (or Fc tagged) PR0213, PRO1330, PR01449, PR0237,
PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PRO6I 8, PR0772, PRO703, PR0792 or PR0474 can be performed using known chromatography techniques, including for instance, Ptotein A or protein G column chromatography
While expression is actually performed in a 0 5-2 L scale, it can be readily scaled up for larger (e g , 8 L) preparations The proteins are expressed as an IgG construct (immunoadhesin), in which the protein extracellular region is fused to an IgGl constant region sequence containing the hinge, CH2 and CH3 domains and/or in poiy- His tagged forms
Following PCR amplification, the respective coding sequences are subcloned into a baculovirus expression vector (pb PH IgG for IgG fusions and pb PH His c for poly-His tagged proteins), and the vector and Baculogold® baculovirus DNA (Pharmingen) are co-transfected into 105 Spodoptera fi ugiperda ("Sf9") cells (ATCC CRL 1711), using Lipofectin (Gibco BRL) pb PH IgG and pb PH His are modifications of the commercially available baculovirus expression vector pVLl 393 (Pharmingen), with modified polylinker regions to include the His or Fc tag sequences The cells are grown in Hink's TNM-FH medium supplemented with 10% FBS (Hyclone) Cells are incubated for 5 days at 28 °C The supernatant is harvested and subsequently used for the first viral amplification by infecting Sf9 cells in Hink's TNM-FH medium supplemented with 10% FBS at an approximate multiplicity of infection (MOI) of 10 Cells are incubated for 3 days at 28 °C The supernatant is harvested and the expression of the constructs in the baculovirus expression vector is determined by batch binding of 1 ml of supernatant to 25 ml of Ni 2+-NTA beads (QIAGEN) for histidine tagged proteins or Protein-A Sepharose CL-4B beads (Pharmacia) for IgG tagged proteins followed by SDS-PAGE analysis comparing to a known concentration of protein standard by Coomassie blue staining
The first viral amplification supernatant is used to infect a spinner culture (500 ml) of Sf9 cells grown in ESF-921 medium (Expression Systems LLC) at an approximate MOI of 0 1 Cells are incubated for 3 days at 28 °C The supernatant is harvested and filtered Batch binding and SDS-PAGE analysis are repeated, as necessary, until expression of the spinner culture is confirmed The conditioned medium from the transfected cells (0 5 to 3 L) is harvested by centrifugation to remove the cells and filtered through 0 22 micron filters For the poly-His tagged constructs, the protein construct is purified using a Ni 2+-NTA column (Qiagen) Before purification, imidazole is added to the conditioned media to a concentration of 5 mM The conditioned media is pumped onto a 6 ml Ni 1+-NTA column equilibrated in 20 mM Hepes, pH 7 4, buffer containing 0 3 M NaCI and 5 mM imidazole at a flow rate of 4-5 ml/min at 4°C Aftei loading, the column is washed with additional equilibration buffer and the protein eluted with equilibration buffei containing 0 25 M imidazole The highly purified protein is subsequently desalted into a storage buffer containing 10 mM Hepes, 0 14 M NaCI and 4% manmtol, pH 6 8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80°C Immunoadhesin (Fc containing) constructs of proteins are purified from the conditioned media as follows
The conditioned media is pumped onto a 5 ml Protein A column (Pharmacia) which has been equilibrated in 20 mM
Na phosphate buffer, pH 6 8 After loading, the column is washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3 5 The eluted protein is immediately neutralized by collecting 1 ml fractions into tubes containing 275 ml of 1 M Tris buffer, pH 9 The highly purified protein is subsequently desalted into storage buffer as described above for the poly-His tagged proteins The homogeneity of the proteins is verified by
SDS polyacrylamide gel (PEG) electrophoresis and N-terminal amino acid sequencing by Edman degradation
PR0362 and PR0538 were expressed in Baculovirus -infected Sf9 insect cells by the above procedure
Alternatively, a modified baculovirus procedure may be used incorporating high 5 cells In this procedure, the DNA encoding the desired sequence is amplified with suitable systems, such as Pfu (Stratagene), or fused upstream (5'-of) of an epitope tag contained with a baculovirus expression vector Such epitope tags include poly- His tags and immunoglobulin tags (like Fc regions of IgG) A variety of plasmids may be employed, including plasmids derived from commercially available plasmids such as pIEl -1 (Novagen) The ρIEl-1 and pIEl-2 vectors are designed for constitutive expression of recombinant proteins from the baculovirus lei promoter in stably- transformed insect cells The plasmids differ only in the orientation of the multiple cloning sites and contain all promoter sequences known to be important for lei -mediated gene expression in unmfected insect cells as well as the hr5 enhancer element pIEl-1 and pIEl-2 include the translation initiation site and can be used to produce fusion proteins Briefly, the desired sequence or the desired portion of the sequence (such as the sequence encoding the extracellular domain of a transmembrane protein) is amplified by PCR with primers complementary to the 5' and 3' regions The 5' primer may incorporate flanking (selected) restriction enzyme sites The product is then digested with those selected restriction enzymes and subcloned into the expression vector For example, derivatives ofpIEl -1 can include the Fc region of human IgG (pb PH IgG) or an 8 histidine (pb PH His) tag downstream (3'-of) the desired sequence Preferably, the vector construct is sequenced for confirmation
High 5 cells are grown to a confluency of 50% under the conditions of 27 °C, no CO,, NO pen/strep For each 150 mm plate, 30 μg of pIE based vector containing the sequence is mixed with 1 ml Ex-Cell medium (Media Ex-Cell 401 4- 1/100 L-Glu JRH Biosciences #14401 -78P (note this media is light sensitive)), and in a separate tube, 100 μl of CellFectin (CellFECTIN (GibcoBRL #10362-010) (vortexed to mix)) is mixed with 1 ml of Ex-Cell medium The two solutions are combined and allowed to incubate at room temperature for 15 minutes 8 ml of Ex- Cell media is added to the 2 ml of DNA/CellFECTIN mix and this is layered on high 5 cells that have been washed once with Ex-Cell media The plate is then incubated in darkness for 1 hour at room temperature The DNA/CellFECTIN mix is then aspirated and the cells are washed once with Ex-Cell to lemove excess CellFECTIN, 30 ml of fresh Ex-Cell media is added and the cells are incubated for 3 days at 28"C The supernatant is harvested and the expression of the sequence in the baculovirus expression vector is determined by batch binding of 1 ml of supernatant to 25 ml of Ni 2+-NTA beads (QIAGEN) for histidine tagged proteins or Protein-A Sepharose CL-4B beads (Pharmacia) for IgG tagged proteins followed by SDS-PAGE analysis comparing to a known concentration of protein standard by Coomassie blue staining
The conditioned media from the transfected cells (0 5 to 3 L) is harvested by centrifugation to remove the cells and filtered through 0 22 micron filters For the poly-His tagged constructs, the protein comprising the sequence is purified using a Ni 2+-NTA column (Qiagen) Before purification, imidazole is added to the conditioned media to a concentration of 5 mM The conditioned media is pumped onto a 6 ml Ni 2+-NTA column equilibrated in 20 mM Hepes, pH 7 4, buffer containing 0 3 M NaCI and 5 mM imidazole at a flow rate of 4-5 ml/min at 48"C After loading, the column is washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0 25 M imidazole The highly purified protein is then subsequently desalted into a storage buffer containing 10 mM Hepes, 0 14 M NaCI and 4% mannitol, pH 6 8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80°C
Immunoadhesin (Fc containing) constructs of proteins are purified from the conditioned media as follows The conditioned media is pumped onto a 5 ml Protein A column (Pharmacia) which has been equilibrated in 20 mM Na phosphate buffer, pH 6 8 After loading, the column is washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3 5 The eluted protein is immediately neutralized by collecting 1 ml fractions into tubes containing 275 ml of 1 M Tris butter, pH 9 The highly purified protein is subsequently desalted into storage buffer as described above for the poly-His tagged proteins The homogeneity of the sequence is assessed by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman degradation and other analytical procedures as desired or necessary
PR0362, PR0237, PR0531 , PR0538 and PR0792 were successfully expressed by the above modified baculovirus procedure incorporating high 5 cells
EXAMPLE 21 Preparation of Antibodies that Bind PRQ213. PROl 330, PROl 449. PRQ237. PRQ324. PRQ351. PRQ362. PRQ615. PRQ531 , PRQ538. PRQ3664. PRQ618. PRQ772, PRO703, PRQ792 or PRQ474
This example illustrates preparation of monoclonal antibodies which can specifically bind PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664. PR0618, PR0772, PRO703, PR0792 or PR0474
Techniques for producing the monoclonal antibodies are known in the art and are described, tor instance in Goding, supra Immunogens that may be employed include purified PR0213, PRO 1330. PR01449. PR0237 PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703 PR0792 or PR0474 fusion proteins containing PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 and cells expressing recombinant PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PROό 15, PR0531 , PR0538, PR03664, PROόl 8, PR0772, PRO703, PR0792 or PR0474 on the cell surface Selection of the immunogen can be made by the skilled artisan without undue experimentation
Mice, such as Balb/c, are immunized with the PR0213, PR01330. PRO 1449, PR0237, PR0324. PR0351 PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 oi PR0474 immunogen emulsified in complete Freund's adjuvant and injected subcutaneously or intraperitoneally in an amount from 1 - 100 micrograms Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the animal's hmd foot pads The immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant Thereafter, for several weeks, the mice ma> also be boosted with additional immunization injections Serum samples may be periodically obtained from the mice by retro-orbital bleeding for testing in ELISA assays to detect antι-PR0213, anti-PRO 1330, anti-PRO 1449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772. antι-PRO703, antι-PR0792 or antι-PR0474 antibodies After a suitable antibody titer has been detected, the animals "positive" for antibodies can be injected with a ftnal intravenous injection of PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 Three to four days later, the mice are sacrificed and the spleen cells are harvested The spleen cells are then fused (using 35% polyethylene glycol) to a selected murine myeloma cell line such as P3X63AgU 1 , available from ATCC, No CRL 1597 The fusions generate hybndoma cells which can then be plated in 96 well tissue culture plates containing HAT (hypoxanthine, aminopteπn, and thymidine) medium to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids
The hybndoma cells will be screened in an ELISA for reactivity against PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 Determination of "positive" hybπdoma cells secreting the desired monoclonal antibodies against PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 is within the skill in the art
The positive hybndoma cells can be injected lntrapeπtoneally into syngeneic Balb/c mice to produce ascites containing the antι-PR0213, anti-PROl 330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351 , anti- PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 monoclonal antibodies Alternatively, the hybndoma cells can be grown in tissue culture flasks or roller bottles Purification of the monoclonal antibodies produced in the ascites can be accomplished using ammonium sulfate precipitation, followed by gel exclusion chromatography Alternatively, affinity chromatography based upon binding of antibody to protein A or protein G can be employed
Deposit of Material
The following materials have been deposited with the American Type Culture Collection, 10801 University Blvd , Manassas VA 201 10-2209, USA (ATCC)
Material ATCC Deposit No Deposit Date DNA30943-1 163 209791 4/21/98 DNA64907-1 163 203242 9/9/98 DNA64908-1 163 203243 9/9/98 DNA34353-1428 209855 5/12/98 DNA36343-1310 209718 3/31/98 DNA40571-1315 209784 4/21/98 DNA45416-1251 209620 2/5/98 DNA48304-1323 209811 4/28/98 DNA48314-1320 209702 3/26/98
DNA48613-1268 209752 4/7/98
DNA48614-1268 209751 4/7/98
DNA49152- 1324 209813 4/28/98
DNA49645-1347 209809 4/28/98
DNA50913-1287 209716 3/31/98
DNA56352-1358 209846 5/6/98
DNA56045-1380 209865 5/14/98
These deposits were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit ot Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty) This assures the maintenance of a viable culture of the deposit for 30 years from the date of deposit The deposit will be made available by the ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc , and the ATCC, which assures permanent and unrestricted availability of the progeny of the culture of the deposit to the public upon issuance of the pertinent U S patent or upon laying open to the public of any U S or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U S Commissioner of Patents and Trademarks to be entitled thereto according to 35 U S C § 122 and the Commissioner's rules pursuant thereto (including 37 C F R § 1 14 with particular reference to 886 OG 638)
The assignee of the present application has agreed that if a culture of the materials on deposit should die or be lost or destroyed when cultivated under suitable conditions, the materials will be promptly replaced on notification with another of the same Availability of the deposited material is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention The present invention is not to be limited in scope by the construct deposited, since the deposited embodiment is intended as a single illustration of certain aspects ot the invention and any constructs that are functionally equivalent are within the scope of this invention The deposit of material herein does not constitute an admission that the written description herein contained is inadequate to enable the practice of any aspect of the invention, including the best mode thereof, nor is it to be construed as limiting the scope of the claims to the specific illustrations that it represents Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims

Claims

WHAT IS CLAIMED IS
1 An isolated antibody that binds to a PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
2 The antibody of Claim 1 which specifically binds to said polypeptide
3 The antibody of Claim 1 which induces the death of a cell that expresses said polypeptide
4 The antibody of Claim 3, wherein said cell is a cancer cell that overexpresses said polypeptide as compared to a normal cell of the same tissue type
5 The antibody of Claim 1 which is a monoclonal antibody
6 The antibody of Claim 5 which comprises a non human complementarity determining region (CDR) or a human framework region (FR)
7 The antibody of Claim 1 which is labeled
8 The antibody of Claim 1 which is an antibody fragment or a single-chain antibody
9 A composition of matter which comprises an antibody of Claim 1 in admixture with a pharmaceutically acceptable carrier
10 The composition of matter of Claim 9 which comprises a therapeutically effective amount of said antibody
1 1 The composition of matter of Claim 9 which further comprises a cytotoxic or a chemothei apeutic agent
12 An isolated nucleic acid molecule that encodes the antibody of Claim 1
13 A vector comprising the nucleic acid molecule of Claim 12
14 A host cell comprising the vector of Claim 13
15 A method for producing an antibody that binds to a PR0213, PRO 1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, said method comprising culturing the host cell of Claim 14 under conditions sufficient to allow expression of said antibody and recovering said antibody from the cell culture
16 An antagonist of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351. PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
17 The antagonist of Claim 16, wherein said antagonist inhibits tumor cell growth
18 An isolated nucleic acid molecule that hybridizes to a nucleic acid sequence that encodes a PR0213 , PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, or the complement thereof
19 The isolated nucleic acid molecule of Claim 18, wherein said hybridization is under stringent hybridization and wash conditions
20 A method for determining the presence of a PR0213, PROl 330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in a sample suspected of containing said polypeptide, said method comprising exposing the sample to an antι-PR0213, antι-PRO1330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, anti- PROόl 5, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody and determining binding of said antibody to said polypeptide in said sample
21 The method of Claim 20, wherein said sample comprises a cell suspected of containing a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
22 The method of Claim 21 , wherein said cell is a cancer cell
23 A method of diagnosing tumor in a mammal said method comprising detecting the level of expression of a gene encoding a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide (a) in a test sample of tissue cells obtained from the mammal, and (b) in a control sample of known normal tissue cells of the same cell type, wherein a higher expression level in the test sample, as compared to the control sample is indicative of the presence of tumor in the mammal from which the test tissue cells were obtained
24 A method of diagnosing tumor in a mammal, said method comprising (a) contacting an anti- PR0213, antι-PRO1330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664. antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or anti- PR0474 antibody with a test sample of tissue cells obtained from the mammal, and (b) detecting the formation of a complex between said antibody and a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in the test sample, wherein the formation of a complex is indicative of the presence of a tumor in said mammal
25 The method of Claim 24, wherein said antibody is detectably labeled
26 The method of Claim 24, wherein said test sample of tissue cells is obtained from an individual suspected of having neoplastic cell growth or proliferation
27 A cancer diagnostic kit comprising an antι-PR0213, anti-PROl 330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody and a carrier in suitable packaging
28 The kit of Claim 27 which further comprises instructions for using said antibody to detect the presence of a PR0213, PROl 330, PR01449, PR0237, PRO-324, PR0351 , PR0362, PROόl 5, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in a sample suspected of containing the same
29 A method for inhibiting the growth of tumor cells, said method comprising exposing tumor cells that express a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide to an effective amount of an agent that inhibits a biological activity of said polypeptide, wherein growth of said tumor cells is thereby inhibited
30 The method of Claim 29, wherein said tumor cells overexpress said polypeptide as compared to normal cells of the same tissue type
31 The method of Claim 29 wherein said agent is an antι-PR0213, antι-PRO1330, antι-PR01449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PR0362, anti-PROόl 5, antι-PR0531 , antι-PR0538, antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody
32 The method ot Claim 31 , wherein said antι-PR0213, anti-PRO 1330, anti-PRO 1449, antι-PR0237 antι-PR0324, antι-PR0351 , antι-PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664. anti-PROό 18, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody induces cell death
33 The method of Claim 29, wherein said tumor cells are turthei exposed to radiation treatment, a cytotoxic agent or a chemotherapeutic agent
34 A method for inhibiting the growth of tumor cells, said method comprising exposing tumor cells that express a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide to an effective amount of an agent that inhibits the expiession of said polypeptide, wherein growth of said tumor cells is thereby inhibited
35 The method of Claim 34, wherein said tumor cells overexpress said polypeptide as compared to normal cells of the same tissue type
36 The method of Claim 34, wherein said agent is an antisense oligonucleotide that hybridizes to a nucleic acid which encodes the PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide or the complement thereof
37 The method of Claim 36, wherein said tumor cells are further exposed to radiation treatment, a cytotoxic agent or a chemotherapeutic agent
38 An article of manufacture, comprising a container, a label on the container, and a composition comprising an active agent contained within the container, wherein the composition is effective for inhibiting the growth of tumor cells and wherein the label on the container indicates that the composition is effective for treating conditions characterized by overexpression of a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in said tumor cells as compared to in normal cells of the same tissue type
39 The article of manufacture of Claim 38, wherein said active agent inhibits a biological activity of and/or the expression of said PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide
40 The article of manufacture of Claim 39, wherein said active agent is an antι-PR0213, anti-PRO 1330, anti-PROl 449, antι-PR0237, antι-PR0324, antι-PR0351 , antι-PRO-362, antι-PR0615, antι-PR0531 , antι-PR0538. antι-PR03664, antι-PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody
41 The article of manufacture of Claim 39, wherein said active agent is an antisense oligonucleotide
42 A method of identifying a compound that inhibits a biological or immunological activity of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351 PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide said method comprising contacting a candidate compound with said polypeptide under conditions and for a time sufficient to allow the two components to interact and determining whether a biological or immunological activity of said polypeptide is inhibited
43 The method of Claim 42, wherein said candidate compound is an antι-PR0213, antι-PRO1330, anti- PRO 1449, antι-PR0237, antι-PR0324, antι-PR0351 , anti PR0362, antι-PR0615, antι-PR0531 , antι-PR0538, antι-PR03664, anti PR0618, antι-PR0772, antι-PRO703, antι-PR0792 or antι-PR0474 antibody
44 The method of Claim 42, wherein said candidate compound or said PR0213, PROl 330, PRO 1449, PR0237, PR0324, PR0351 , PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide is immobilized on a solid support
45 The method of Claim 44, wherein the non-immobilized component is detectably labeled
46 A method of identifying a compound that inhibits an activity of a PR0213, PRO 1330, PRO 1449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531, PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide, said method comprising the steps of (a) contacting cells and a candidate compound to be screened in the presence of said polypeptide under conditions suitable for the induction of a cellular response normally induced by said polypeptide and (b) determining the induction of said cellular response to determine if the test compound is an effective antagonist, wherein the lack of induction of said cellular response is indicative of said compound being an effective antagonist
47 A method for identifying a compound that inhibits the expression of a PR0213, PRO1330, PR01449, PR0237, PR0324, PR0351, PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide in cells that express said polypeptide, wherein said method comprises contacting said cells with a candidate compound and determining whether expression of said polypeptide is inhibited
48 The method of Claim 47, wherein said candidate compound is an antisense oligonucleotide
49 Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence that encodes an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8), Figure 2 (SEQ ID NO 2), Figure 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14), Figure 16 (SEQ ID NO 16), Figure 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figuie 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 1 ) and Figure 33 (SEQ ID NO 33)
50 Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequence shown in Figure 3 (SEQ ID NO 3)„ Figure 5 (SEQ ID NO 5), Figure 7 (SEQ ID NO 7), Figure 1 (SEQ ID NO 1 ), Figure 9 (SEQ ID NO 9), Figure 1 1 (SEQ ID NO 1 1 ), Figure 13 (SEQ ID NO 13), Figure 15 (SEQ ID NO 15), Figure 17 (SEQ ID NO 17), Figure 19 (SEQ ID NO 19), Figure 21 (SEQ ID NO 21 ), Figure 23A-B (SEQ ID NO 23), Figure 26 (SEQ ID NO 26), Figure 28 (SEQ ID NO 28), Figure 30 (SEQ ID NO 30) and Figure 32 (SEQ ID NO 32)
51 Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence selected from the group consisting of the full-length coding sequence of the nucleotide sequence shown in Figure 3 (SEQ ID NO 3)„ Figure 5 (SEQ ID NO 5), Figure 7 (SEQ ID NO 7), Figure 1 (SEQ ID NO 1 ). Figure 9 (SEQ ID NO 9), Figure 1 1 (SEQ ID NO 1 1), Figure 13 (SEQ ID NO 13), Figure 15 (SEQ ID NO 15), Figure 17 (SEQ ID NO 17), Figure 19 (SEQ ID NO 19), Figure 21 (SEQ ID NO 21 ), Figure 23A-B (SEQ ID NO 23), Figure 26 (SEQ ID NO 26), Figure 28 (SEQ ID NO 28), Figure 30 (SEQ ID NO 30) and Figure 32 (SEQ ID NO 32)
52 Isolated nucleic acid having at least 80% nucleic acid sequence identity to the full-length coding sequence of the DNA deposited under ATCC accession number 209791 , 203242, 203243, 209855, 209718, 209784, 209620, 20981 1 , 209702, 209752, 209751 , 209813, 209809, 209716, 209846 or 209865
53 A vector comprising the nucleic acid of any one of Claims 49 to 52
54 The vector of Claim 53 operably linked to control sequences recognized by a host cell transformed with the vector
55 A host cell comprising the vector of Claim 53
56 The host cell of Claim 55, wherein said cell is a CHO cell
57 The host cell of Claim 55 wherein said cell is an E coli
58 The host cell of Claim 55, wherein said cell is a yeast cell
59 The host cell of Claim 55 wherein said cell is a Baculovirus-infected insect cell
60 A process for producing a PR0213, PRO 1330, PRO 1449, PR0237, PR0324. PR0351. PR0362, PR0615, PR0531 , PR0538, PR03664, PR0618, PR0772, PRO703, PR0792 or PR0474 polypeptide comprising culturing the host cell of Claim 55 under conditions suitable for expression of said polypeptide and recovering said po peptide from the cell culture
61 An isolated polypeptide having at least 80% amino acid sequence identity to an ammo acid sequence selected from the group consisting of the am o acid sequence shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8) Figure 2 (SEQ ID NO 2) Figure 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14), Figure 16 (SEQ ID NO 16), Figure 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figure 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 31) and Figure 33 (SEQ ID NO 33)
62 An isolated polypeptide scoring at least 80% positives when compared to an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8), Figure 2 (SEQ ID NO 2), Figure 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14), Figure 16 (SEQ ID NO 16), Figure 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figure 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 31) and Figure 33 (SEQ ID NO 33)
63 An isolated polypeptide having at least 80% amino acid sequence identity to an ammo acid sequence encoded by the full-length coding sequence of the DNA deposited under ATCC accession number 209791, 203242, 203243, 209855, 209718, 209784, 209620, 20981 1 , 209702, 209752, 209751 , 209813, 209809, 209716, 209846 or 209865
64 A chimeric molecule comprising a polypeptide according to any one of Claims 61 to 63 fused to a heterologous amino acid sequence
65 The chimeric molecule of Claim 64, wherein said heterologous amino acid sequence is an epitope tag sequence
66 The chimeric molecule of Claim 64, wherein said heterologous amino acid sequence is a Fc region of an immunoglobulin
67 An antibody which specifically binds to a polypeptide according to any one of Claims 61 to 63
68 The antibody of Claim 67, wherein said antibody is a monoclonal antibody, a humanized antibody or a single-chain antibody
69 Isolated nucleic acid having at least 80% nucleic acid sequence identity to
(a) a nucleotide sequence encoding the polypeptide shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8), Figure 2 (SEQ ID NO 2), Figui e 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14), Figure 16 (SEQ ID NO 16), Figure 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figure 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 31 ) or Figure 33 (SEQ ID NO 33), lacking its associated signal peptide
(b) a nucleotide sequence encoding an extracellular domain of the polypeptide shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8) Figuie 2 (SEQ ID NO 2) Figure 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14) Figure 16 (SEQ ID NO 16), Figure 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figuie 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 31 ) or Figure 33 (SEQ ID NO 33), with its associated signal peptide, or
(c) a nucleotide sequence encoding an extracellular domain of the polypeptide shown in Figure 4
(SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8), Figure 2 (SEQ ID NO 2), Figure 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14), Figure 16 (SEQ ID NO 16), Figure 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figure 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 31 ) or Figure 33 (SEQ ID NO 33), lacking its associated signal peptide
70 An isolated polypeptide having at least 80% amino acid sequence identity to
(a) the polypeptide shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8), Figure 2 (SEQ ID NO 2), Figure 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14), Figure 16 (SEQ ID NO 16), Figure 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figure 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 31 ) or Figure 33 (SEQ ID NO 33), lacking its associated signal peptide,
(b) an extracellular domain of the polypeptide shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8), Figure 2 (SEQ ID NO 2), Figure 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14), Figure 16 (SEQ ID NO 16), Figure 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figure 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 31 ) or Figure 33 (SEQ ID NO 33), with its associated signal peptide, or
(c) an extracellular domain of the polypeptide shown in Figure 4 (SEQ ID NO 4), Figure 6 (SEQ ID NO 6), Figure 8 (SEQ ID NO 8), Figure 2 (SEQ ID NO 2), Figure 10 (SEQ ID NO 10), Figure 12 (SEQ ID NO 12), Figure 14 (SEQ ID NO 14), Figure 16 (SEQ ID NO 16), Figui e 18 (SEQ ID NO 18), Figure 20 (SEQ ID NO 20), Figure 22 (SEQ ID NO 22), Figure 24 (SEQ ID NO 24), Figure 27 (SEQ ID NO 27), Figure 29 (SEQ ID NO 29), Figure 31 (SEQ ID NO 31 ) or Figure 33 (SEQ ID NO 33), lacking its associated signal peptide
PCT/US2000/000277 1997-03-31 2000-01-06 Compositions and methods for the treatment of tumor WO2000053754A1 (en)

Priority Applications (246)

Application Number Priority Date Filing Date Title
AU22248/00A AU2224800A (en) 1999-03-08 2000-01-06 Compositions and methods for the treatment of tumor
JP2000603377A JP2004513602A (en) 1999-03-08 2000-02-18 Secreted and transmembrane polypeptides and nucleic acids encoding them
CA002361840A CA2361840A1 (en) 1999-03-08 2000-02-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
KR1020017011399A KR20030002292A (en) 1999-03-08 2000-02-18 Secreted and Transmembrane Polypeptides and Nucleic Acids Encoding the Same
PCT/US2000/004341 WO2000053756A2 (en) 1999-03-08 2000-02-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP00907314A EP1263948A2 (en) 1999-03-08 2000-02-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2000603379A JP2004516227A (en) 1999-03-08 2000-03-02 Compositions and methods for treating immune-related diseases
AU35144/00A AU3514400A (en) 1999-03-08 2000-03-02 Compositions and methods for the treatment of immune related diseases
KR1020017011406A KR20010103046A (en) 1999-03-08 2000-03-02 Compositions and Methods for the Treatment of Immune Related Diseases
EP00913764A EP1220905A2 (en) 1999-03-08 2000-03-02 Composition and methods for the treatment of immune related diseases
CA002362427A CA2362427A1 (en) 1999-03-08 2000-03-02 Compositions and methods for the treatment of immune related diseases
PCT/US2000/005841 WO2000053758A2 (en) 1999-03-08 2000-03-02 Compositions and methods for the treatment of immune related diseases
CA002491610A CA2491610A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000582A EP1666495A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000588A EP1690873A3 (en) 1999-12-01 2000-12-01 Composition and methods for the diagnosis of tumours
PCT/US2000/032678 WO2001040466A2 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000587A EP1690872A3 (en) 1999-12-01 2000-12-01 Composition and methods for the diagnosis of tumours
EP10005292A EP2228446A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptieds and nucleic acids encoding the same
EP00983846A EP1250426A2 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding same
AU20554/01A AU2055401A (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000586A EP1688497A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000585A EP1661996A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA2709291A CA2709291A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000583A EP1686134A3 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002496312A CA2496312A1 (en) 1999-12-01 2000-12-01 Colon tumour marker pro4799 polypeptides and nucleic acids encoding the same
JP2001542531A JP2004522404A (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding them
CA002490909A CA2490909A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002492070A CA2492070A1 (en) 1999-12-01 2000-12-01 Lung tumor marker pro4329 polypeptides and nucleic acids encoding the same
CA002492049A CA2492049A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002491258A CA2491258A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05025102A EP1672070A3 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002391455A CA2391455A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002491433A CA2491433A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002494705A CA2494705A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000589A EP1661997A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000581A EP1666494A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002490853A CA2490853A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000584A EP1669371A3 (en) 1999-12-01 2000-12-01 Composition and methods for the diagnosis of tumours
US09/828,366 US20020010137A1 (en) 1997-09-18 2001-04-05 Methods and compositions for inhibiting neoplastic cell growth
US09/918,585 US20030060406A1 (en) 1997-10-17 2001-07-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,295 US20020156006A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,193 US20030073624A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,299 US20030199435A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,192 US20020177553A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,189 US6972325B2 (en) 1997-10-17 2001-10-15 PRO273 polypeptides
US09/978,194 US20030195333A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,188 US20030139328A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,191 US20030050239A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,298 US20030134785A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/981,915 US7285623B2 (en) 1997-10-17 2001-10-16 PRO337 polypeptides
US09/978,608 US20030045462A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,544 US20030199436A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,665 US7294700B2 (en) 1997-10-17 2001-10-16 Anti-PRO846 antibodies
US09/978,585 US20030049633A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,681 US20030195148A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,403 US20030050240A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/981,915 US20030054986A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,824 US20050124789A9 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,564 US7195760B2 (en) 1997-10-17 2001-10-16 Anti-pro363 antibodies
US09/978,643 US20030104998A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,757 US20030083248A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,423 US20030069178A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,375 US7196165B2 (en) 1997-10-17 2001-10-16 PRO363 polypeptides
US09/978,802 US20030199674A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,697 US20020169284A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,824 US20030055216A1 (en) 1997-10-17 2001-10-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/210,028 US20030203446A1 (en) 1998-10-07 2001-10-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/152,388 US20040223964A1 (en) 1998-03-17 2001-10-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/145,089 US7208575B2 (en) 1998-10-07 2001-10-19 PRO531 polypeptides
US10/160,502 US7220835B2 (en) 1998-07-30 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/164,728 US20030186368A1 (en) 1998-05-13 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/145,124 US20030190701A1 (en) 1998-04-30 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/165,067 US7279553B2 (en) 1998-05-13 2001-10-19 PRO1083 polypeptides
US10/164,749 US20040029218A1 (en) 1998-10-07 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/165,036 US20050227342A1 (en) 1998-10-07 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/166,709 US20030104536A1 (en) 1998-10-07 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/164,929 US20030194781A1 (en) 1998-03-30 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/145,017 US20030186365A1 (en) 1998-03-26 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/165,247 US7112657B2 (en) 1998-10-07 2001-10-19 PRO697 polypeptides
US10/143,029 US7105640B2 (en) 1997-10-17 2001-10-19 Anti-pro792 antibodies
US10/162,521 US7067628B2 (en) 1998-03-17 2001-10-19 PRO788 polypeptides
US10/164,829 US20030194780A1 (en) 1998-04-29 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,922 US20030195345A1 (en) 1997-10-17 2001-10-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,084 US20030203402A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/002,967 US20030148373A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/020,445 US20030198994A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,083 US20030148376A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/999,829 US20030195344A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,086 US7122375B2 (en) 1997-10-17 2001-10-24 PRO274 nucleic acids
US09/999,833 US6916648B2 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,081 US20030049684A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,085 US6974696B2 (en) 1997-10-17 2001-10-24 PRO853 nucleic acids
US09/999,832 US20020192706A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/999,830 US20030077700A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/999,832 US7132283B2 (en) 1997-10-17 2001-10-24 PRO273 polypeptides
US09/999,834 US20030064407A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,921 US20030068648A1 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,918 US20030211091A1 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,929 US7019124B2 (en) 1997-10-17 2001-10-25 PRO788 nucleic acids
US10/013,920 US20040006219A1 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,927 US7189529B2 (en) 1997-10-17 2001-10-25 PRO792 nucleic acids
US10/016,177 US20030073131A1 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,923 US7169912B2 (en) 1997-10-17 2001-10-25 PRO1017 nucleic acids
US10/013,928 US20030215905A1 (en) 1998-10-07 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,925 US7037710B2 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,926 US7074593B2 (en) 1998-04-01 2001-10-25 PRO 703 nucleic acids
US10/013,917 US7029874B2 (en) 1998-03-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,456 US20020137890A1 (en) 1997-03-31 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/028,072 US20030004311A1 (en) 1997-06-18 2001-12-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,187 US20030096744A1 (en) 1997-10-17 2002-01-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/119,480 US20040087769A1 (en) 1998-09-10 2002-04-09 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,047 US20030077778A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,045 US20030073210A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,059 US20030190721A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,042 US20030096386A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,046 US20030194791A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,040 US20030082759A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,051 US20030092147A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,044 US20030190717A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,041 US20030077776A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,061 US20030082761A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,062 US20030077779A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,052 US20030199052A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,043 US7220831B2 (en) 1997-03-31 2002-04-12 PRO235 polypeptides
US10/121,049 US20030022239A1 (en) 1997-06-18 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,054 US20030199054A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,063 US20030199055A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,050 US20030054516A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,055 US20030190718A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,060 US20030190722A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,057 US20030190719A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,053 US20030199053A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,048 US20030199051A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,058 US20030190720A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,056 US20030082760A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,108 US7635478B2 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,262 US20030049816A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,292 US20030073211A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,215 US7291329B2 (en) 1997-03-31 2002-04-15 Antibodies against PRO4406
US10/123,156 US20030194792A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,213 US20030199057A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,236 US20030068795A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,214 US7343721B2 (en) 1997-03-31 2002-04-15 PRO4406 polypeptide
US10/123,212 US7276577B2 (en) 1997-03-31 2002-04-15 PRO1866 polypeptides
US10/123,322 US20030199059A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,261 US20030068796A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,157 US20030190725A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,109 US20030190723A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,213 US7193048B2 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,291 US20030199058A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,235 US20030082762A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,771 US20030199060A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,155 US20030068794A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,154 US20030190724A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,902 US20030077781A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,905 US7285625B2 (en) 1997-06-18 2002-04-16 PRO536 polypeptides
US10/123,910 US7329404B2 (en) 1997-03-31 2002-04-16 Antibodies against PRO1310
US10/123,904 US20030022328A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,912 US20030100087A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,909 US7193049B2 (en) 1997-03-31 2002-04-16 PRO862 polypeptides
US10/123,906 US20030190726A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,903 US20030073212A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,907 US7084258B2 (en) 1997-03-31 2002-04-16 Antibodies against the PRO862 polypeptides
US10/123,911 US7408032B2 (en) 1997-03-31 2002-04-16 PRO1188 polypeptides
US10/123,913 US20030203462A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,905 US20030087344A1 (en) 1997-06-18 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,908 US7335728B2 (en) 1997-03-31 2002-04-16 PRO1310 polypeptides
US10/124,817 US20030077786A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,813 US7312307B2 (en) 1997-03-31 2002-04-17 PRO1056 polypeptides
US10/124,814 US7105335B2 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,824 US20030077659A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/125,795 US7304131B2 (en) 1997-03-31 2002-04-17 PRO1483 polypeptides
US10/124,816 US20030190728A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,820 US20030190729A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,822 US7109305B2 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,818 US20030082763A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,823 US20030199062A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,821 US20030199023A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/125,805 US20030194794A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,819 US7285626B2 (en) 1997-03-31 2002-04-17 PRO1076 polypeptides
US10/125,704 US7357926B2 (en) 1997-03-31 2002-04-17 Antibodies against PRO1879 and the use thereof
US10/125,922 US7309762B2 (en) 1997-03-31 2002-04-19 PRO1360 polypeptides
US10/125,927 US20030190731A1 (en) 1997-03-31 2002-04-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/125,932 US7317079B2 (en) 1997-03-31 2002-04-19 PRO812 polypeptides
US10/125,924 US7342097B2 (en) 1997-03-31 2002-04-19 PRO1309 polypeptides
US10/125,931 US20030199063A1 (en) 1997-03-31 2002-04-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/127,831 US20030082689A1 (en) 1997-03-31 2002-04-22 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/128,689 US20030087365A1 (en) 1997-03-31 2002-04-23 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/131,823 US7304132B2 (en) 1997-03-31 2002-04-24 PRO1693 polypeptides
US10/131,817 US7291701B2 (en) 1997-03-31 2002-04-24 PRO1777 polypeptides
US10/131,825 US7282566B2 (en) 1997-03-31 2002-04-24 PRO1779 polypeptide
US10/137,867 US20030207349A1 (en) 1997-03-31 2002-05-03 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/137,865 US20030032155A1 (en) 1997-03-31 2002-05-03 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/137,868 US20030082764A1 (en) 1997-03-31 2002-05-03 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,023 US20030207416A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,020 US20030207415A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/139,963 US7288625B2 (en) 1997-03-31 2002-05-06 PRO4395 polypeptides
US10/139,980 US7247710B2 (en) 1997-03-31 2002-05-06 PRO4395 antibodies
US10/140,474 US20030032156A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,024 US20040058424A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,470 US20030022331A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,860 US7307151B2 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,864 US20030207419A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,928 US20030068798A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,805 US20030207417A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,809 US20030207418A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,808 US7425621B2 (en) 1997-03-31 2002-05-07 Antibodies against the PRO4401 polypeptide
US10/140,865 US20030207420A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,925 US20030073215A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,921 US7317080B2 (en) 1997-03-31 2002-05-07 PRO4303 polypeptides
US10/141,754 US7361732B2 (en) 1997-03-31 2002-05-08 PRO4400 polypeptides
US10/141,755 US7297764B2 (en) 1997-03-31 2002-05-08 PRO4318 polypeptides
US10/141,760 US7342104B2 (en) 1997-03-31 2002-05-08 Antibodies against the PRO4320 polypeptide
US10/141,701 US20030207421A1 (en) 1997-03-31 2002-05-08 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/141,756 US7488586B2 (en) 1997-03-31 2002-05-08 PRO4409 polypeptides
US10/142,425 US20030207424A1 (en) 1997-03-31 2002-05-09 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/143,113 US7329730B2 (en) 1997-03-31 2002-05-09 PRO4348 polypeptides
US10/142,430 US7309766B2 (en) 1997-03-31 2002-05-09 PRO5774 polypeptides
US10/143,114 US20030036180A1 (en) 1997-03-31 2002-05-09 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/142,417 US7304133B2 (en) 1997-03-31 2002-05-09 PRO4389 polypeptides
US10/142,431 US7285629B2 (en) 1997-03-31 2002-05-10 Pro5005 polypeptides
US10/142,423 US20030049817A1 (en) 1997-03-31 2002-05-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/143,032 US7408033B2 (en) 1997-03-31 2002-05-10 PRO5995 polypeptides
US10/142,419 US7153941B2 (en) 1997-03-31 2002-05-10 Antibodies that bind PRO4994 polypeptides
US10/146,730 US20030207427A1 (en) 1997-03-31 2002-05-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/146,792 US20030207428A1 (en) 1997-03-31 2002-05-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/147,528 US20030219885A1 (en) 1997-03-31 2002-05-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/147,536 US20040077064A1 (en) 1997-03-31 2002-05-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/147,492 US20030082765A1 (en) 1997-03-31 2002-05-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/147,519 US20030077791A1 (en) 1997-03-31 2002-05-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/152,395 US7189534B2 (en) 1997-03-31 2002-05-21 PRO4320 polynucleotide
US10/153,934 US20030129695A1 (en) 1997-03-31 2002-05-22 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/156,843 US20030207805A1 (en) 1997-06-18 2002-05-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/157,782 US20030077792A1 (en) 1997-03-31 2002-05-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/157,786 US20030208055A1 (en) 1997-03-31 2002-05-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/158,791 US20030207429A1 (en) 1997-03-31 2002-05-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/158,782 US20030082766A1 (en) 1997-03-31 2002-05-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/160,498 US20030073216A1 (en) 1997-03-31 2002-05-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,913 US20030022298A1 (en) 1997-09-15 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2005264293A JP2006068016A (en) 1999-12-01 2005-08-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US11/341,175 US7468427B2 (en) 1997-03-31 2006-01-27 Antibodies to PRO1275 polypeptide
US11/786,466 US20080182275A1 (en) 1998-12-22 2007-04-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2007326613A JP2008161190A (en) 1999-12-01 2007-12-18 Secreted and transmembrane polypeptide and nucleic acid encoding the same
JP2007326609A JP2008148701A (en) 1999-12-01 2007-12-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2007325484A JP2008148699A (en) 1999-12-01 2007-12-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2007326424A JP2008167749A (en) 1999-12-01 2007-12-18 Secreted and transmembrane polypeptide and nucleic acid encoding the same

Applications Claiming Priority (22)

Application Number Priority Date Filing Date Title
PCT/US1999/005028 WO1999046281A2 (en) 1998-03-10 1999-03-08 Novel polypeptides and nucleic acids encoding the same
USPCT/US99/05028 1999-03-08
US12395799P 1999-03-12 1999-03-12
US60/123,957 1999-03-12
US12677399P 1999-03-29 1999-03-29
US60/126,773 1999-03-29
US13023299P 1999-04-21 1999-04-21
US60/130,232 1999-04-21
US13144599P 1999-04-28 1999-04-28
US60/131,445 1999-04-28
PCT/US1999/023089 WO2000021996A2 (en) 1998-10-13 1999-10-05 Methods and compositions for inhibiting neoplastic cell growth
USPCT/US99/23089 1999-10-05
USPCT/US99/28313 1999-11-30
PCT/US1999/028313 WO2000032221A2 (en) 1998-12-01 1999-11-30 Promotion or inhibition of angiogenesis and cardiovascularization
PCT/US1999/028551 WO2000053750A1 (en) 1999-03-08 1999-12-02 Compositions and methods for the treatment of tumors
USPCT/US99/28564 1999-12-02
PCT/US1999/028564 WO2000055319A1 (en) 1999-03-12 1999-12-02 Methods and compositions for inhibiting neoplastic cell growth
USPCT/US99/28551 1999-12-02
PCT/US1999/031274 WO2000053752A2 (en) 1999-03-08 1999-12-30 Promotion or inhibition of angiogenesis and cardiovascularization
PCT/US1999/031243 WO2000053751A1 (en) 1999-03-08 1999-12-30 Methods and compositions for inhibiting neoplastic cell growth
USPCT/US99/31243 1999-12-30
USPCT/US99/31274 1999-12-30

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/000219 Continuation-In-Part WO2000053753A2 (en) 1994-09-08 2000-01-05 Promotion or inhibition of angiogenesis and cardiovascularization

Related Child Applications (2)

Application Number Title Priority Date Filing Date
PCT/US2000/003565 Continuation-In-Part WO2001053486A1 (en) 1994-09-08 2000-02-11 Compositions and methods for the treatment of tumor
US10/119,480 Continuation US20040087769A1 (en) 1998-09-10 2002-04-09 Secreted and transmembrane polypeptides and nucleic acids encoding the same

Publications (1)

Publication Number Publication Date
WO2000053754A1 true WO2000053754A1 (en) 2000-09-14

Family

ID=56289988

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/000277 WO2000053754A1 (en) 1997-03-31 2000-01-06 Compositions and methods for the treatment of tumor

Country Status (2)

Country Link
AU (1) AU2224800A (en)
WO (1) WO2000053754A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7547767B2 (en) 2002-09-24 2009-06-16 Centocor Ortho Biotech Inc. Growth arrest specific gene 6 peptides, antibodies, compositions, methods and uses

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993020238A2 (en) * 1992-04-07 1993-10-14 The Johns Hopkins University Amplification of human mdm2 gene in human tumors
WO1994000603A1 (en) * 1992-06-26 1994-01-06 The Trustees Of Princeton University Method for detecting pre-cancerous or cancerous cells using p90 antibodies or probes
WO1998057983A2 (en) * 1997-06-18 1998-12-23 Zymogenetics, Inc. Mammalian neuro-growth factor like protein
WO1999046281A2 (en) * 1998-03-10 1999-09-16 Genentech, Inc. Novel polypeptides and nucleic acids encoding the same
DE19817946A1 (en) * 1998-04-17 1999-10-21 Metagen Gesellschaft Fuer Genomforschung Mbh New nucleic acid sequences expressed in normal uterine tissues, and derived polypeptides, for treatment of uterine cancer and identification of therapeutic agents
WO1999054437A2 (en) * 1998-04-23 1999-10-28 Millennium Pharmaceuticals, Inc. Novel molecules of the t125-related protein family and uses thereof

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993020238A2 (en) * 1992-04-07 1993-10-14 The Johns Hopkins University Amplification of human mdm2 gene in human tumors
WO1994000603A1 (en) * 1992-06-26 1994-01-06 The Trustees Of Princeton University Method for detecting pre-cancerous or cancerous cells using p90 antibodies or probes
WO1998057983A2 (en) * 1997-06-18 1998-12-23 Zymogenetics, Inc. Mammalian neuro-growth factor like protein
WO1999046281A2 (en) * 1998-03-10 1999-09-16 Genentech, Inc. Novel polypeptides and nucleic acids encoding the same
DE19817946A1 (en) * 1998-04-17 1999-10-21 Metagen Gesellschaft Fuer Genomforschung Mbh New nucleic acid sequences expressed in normal uterine tissues, and derived polypeptides, for treatment of uterine cancer and identification of therapeutic agents
WO1999054437A2 (en) * 1998-04-23 1999-10-28 Millennium Pharmaceuticals, Inc. Novel molecules of the t125-related protein family and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
COLLINS V: "Gene amplification in human gliomas", GLIA,US,WILEY-LISS, NEW YORK, NY, vol. 15, no. 3, November 1995 (1995-11-01), pages 289 - 296-96, XP002109702, ISSN: 0994-1491 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7547767B2 (en) 2002-09-24 2009-06-16 Centocor Ortho Biotech Inc. Growth arrest specific gene 6 peptides, antibodies, compositions, methods and uses

Also Published As

Publication number Publication date
AU2224800A (en) 2000-09-28

Similar Documents

Publication Publication Date Title
AU2003200731B2 (en) Compositions and methods for the treatment of tumor
WO2000053755A2 (en) Compositions and methods for the treatment of tumor
EP1657256A2 (en) Compositions and methods for the treatment of tumor
CA2378182C (en) Compositions and methods for the treatment of tumors
WO2003032813A2 (en) Methods for the treatment of carcinoma
AU773055C (en) Compositions and methods for the treatment of tumors
WO2000037640A9 (en) Compositions and methods for the treatment of tumor
WO2001005836A1 (en) Polypeptidic compositions and methods for the treatment of tumors
WO2000053754A1 (en) Compositions and methods for the treatment of tumor
AU756400B2 (en) Compositions and methods for the treatment of tumor
CA2478728A1 (en) Compositions and methods for the treatment of tumors
NZ513423A (en) Compositions and methods for the treatment of tumors
ZA200106059B (en) Compositions and methods for the treatment of tumors.
AU2002340233A1 (en) Methods for the treatment of carcinoma

Legal Events

Date Code Title Description
ENP Entry into the national phase

Ref country code: US

Ref document number: 1999 380138

Date of ref document: 19990825

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase

Ref country code: US

Ref document number: 1999 423843

Date of ref document: 19991112

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A1

Designated state(s): AE AL AM AT AU AZ BA BB BG BR BY CA CH CN CR CU CZ DE DK DM EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MD MG MK MN MW MX NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GH GM KE LS MW SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)