WO2001009327A2 - Method of preventing the injury or death of retinal cells and treating ocular diseases - Google Patents

Method of preventing the injury or death of retinal cells and treating ocular diseases Download PDF

Info

Publication number
WO2001009327A2
WO2001009327A2 PCT/US2000/020710 US0020710W WO0109327A2 WO 2001009327 A2 WO2001009327 A2 WO 2001009327A2 US 0020710 W US0020710 W US 0020710W WO 0109327 A2 WO0109327 A2 WO 0109327A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
polypeptide
acid sequence
retinal
amino acid
Prior art date
Application number
PCT/US2000/020710
Other languages
French (fr)
Other versions
WO2001009327A3 (en
Inventor
Avi J. Ashkenazi
Kevin P. Baker
Audrey Goddard
Paul J. Godowski
Austin L. Gurney
Ivar J. Kljavin
Monique Lafleur
Melanie R. Mark
Scot A. Marsters
Robert M. Pitti
Colin K. Watanabe
William I. Wood
Original Assignee
Genentech, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from PCT/US1999/020944 external-priority patent/WO2000015792A2/en
Priority claimed from PCT/US1999/021090 external-priority patent/WO2000015796A2/en
Priority claimed from PCT/US1999/028214 external-priority patent/WO2001019987A1/en
Priority claimed from PCT/US1999/028313 external-priority patent/WO2000032221A2/en
Priority claimed from PCT/US1999/028301 external-priority patent/WO2000032776A2/en
Priority claimed from PCT/US2000/000219 external-priority patent/WO2000053753A2/en
Priority claimed from PCT/US2000/000376 external-priority patent/WO2000053755A2/en
Priority claimed from PCT/US2000/003565 external-priority patent/WO2001053486A1/en
Priority claimed from PCT/US2000/004341 external-priority patent/WO2000053756A2/en
Priority claimed from PCT/US2000/004414 external-priority patent/WO2001004311A1/en
Priority claimed from PCT/US2000/005004 external-priority patent/WO2000053757A2/en
Priority claimed from PCT/US2000/005841 external-priority patent/WO2000053758A2/en
Priority claimed from PCT/US2000/006884 external-priority patent/WO2001005972A1/en
Priority claimed from PCT/US2000/008439 external-priority patent/WO2000073454A1/en
Priority claimed from PCT/US2000/013705 external-priority patent/WO2000073445A2/en
Priority to AU63910/00A priority Critical patent/AU6391000A/en
Application filed by Genentech, Inc. filed Critical Genentech, Inc.
Priority to AU69018/00A priority patent/AU6901800A/en
Priority to PCT/US2000/022031 priority patent/WO2001040464A1/en
Priority to JP2001550255A priority patent/JP4280444B2/en
Priority to EP00982096A priority patent/EP1244784A2/en
Priority to CA002390685A priority patent/CA2390685C/en
Priority to PCT/US2000/030952 priority patent/WO2001049715A2/en
Priority to AU19167/01A priority patent/AU1916701A/en
Priority to AU6802801A priority patent/AU6802801A/en
Priority to CA002491258A priority patent/CA2491258A1/en
Priority to CA002492049A priority patent/CA2492049A1/en
Priority to CA002391455A priority patent/CA2391455A1/en
Priority to EP10005292A priority patent/EP2228446A1/en
Priority to JP2001542531A priority patent/JP2004522404A/en
Priority to EP06000585A priority patent/EP1661996A1/en
Priority to EP06000583A priority patent/EP1686134A3/en
Priority to AU20554/01A priority patent/AU2055401A/en
Priority to CA002494705A priority patent/CA2494705A1/en
Priority to CA002490853A priority patent/CA2490853A1/en
Priority to CA002490909A priority patent/CA2490909A1/en
Priority to EP05025102A priority patent/EP1672070A3/en
Priority to CA002491610A priority patent/CA2491610A1/en
Priority to EP00983846A priority patent/EP1250426A2/en
Priority to CA2709291A priority patent/CA2709291A1/en
Priority to CA002496312A priority patent/CA2496312A1/en
Priority to EP06000586A priority patent/EP1688497A1/en
Priority to EP06000584A priority patent/EP1669371A3/en
Priority to CA002491433A priority patent/CA2491433A1/en
Priority to EP06000582A priority patent/EP1666495A1/en
Priority to PCT/US2000/032678 priority patent/WO2001040466A2/en
Priority to EP06000588A priority patent/EP1690873A3/en
Priority to EP06000587A priority patent/EP1690872A3/en
Priority to EP06000589A priority patent/EP1661997A1/en
Priority to CA002492070A priority patent/CA2492070A1/en
Priority to EP06000581A priority patent/EP1666494A1/en
Publication of WO2001009327A2 publication Critical patent/WO2001009327A2/en
Priority to CA002534018A priority patent/CA2534018A1/en
Priority to CA002533903A priority patent/CA2533903A1/en
Priority to CA002531917A priority patent/CA2531917A1/en
Priority to CA002534030A priority patent/CA2534030A1/en
Priority to CA002534391A priority patent/CA2534391A1/en
Priority to JP2001567332A priority patent/JP2004508805A/en
Priority to CA002539214A priority patent/CA2539214A1/en
Priority to CA002401448A priority patent/CA2401448A1/en
Priority to PCT/US2001/006520 priority patent/WO2001068848A2/en
Priority to CA002533831A priority patent/CA2533831A1/en
Priority to CA002533991A priority patent/CA2533991A1/en
Priority to EP01945919A priority patent/EP1259614A2/en
Priority to CA002534186A priority patent/CA2534186A1/en
Priority to AU2001268028A priority patent/AU2001268028A1/en
Priority to US09/866,028 priority patent/US6642360B2/en
Priority to AU6531101A priority patent/AU6531101A/en
Priority to PCT/US2001/017800 priority patent/WO2001093983A1/en
Priority to CA002591656A priority patent/CA2591656A1/en
Priority to EP05024034A priority patent/EP1666497A3/en
Priority to EP04005726A priority patent/EP1489095A1/en
Priority to AU2001265311A priority patent/AU2001265311A1/en
Priority to EP05024023A priority patent/EP1683864A3/en
Priority to CA002591929A priority patent/CA2591929A1/en
Priority to EP05024032A priority patent/EP1659177A3/en
Priority to CA002591630A priority patent/CA2591630A1/en
Priority to EP05024028A priority patent/EP1686174A1/en
Priority to CA002591583A priority patent/CA2591583A1/en
Priority to JP2002501551A priority patent/JP2004510409A/en
Priority to EP05024033A priority patent/EP1666493A1/en
Priority to EP05024030A priority patent/EP1666491A1/en
Priority to CA002591814A priority patent/CA2591814A1/en
Priority to CA002585822A priority patent/CA2585822A1/en
Priority to EP05024038A priority patent/EP1702928A3/en
Priority to CA002410162A priority patent/CA2410162A1/en
Priority to EP05024025A priority patent/EP1666597A3/en
Priority to EP05024027A priority patent/EP1666596A1/en
Priority to CA002591841A priority patent/CA2591841A1/en
Priority to CA002591930A priority patent/CA2591930A1/en
Priority to EP05024031A priority patent/EP1666492A1/en
Priority to CA002594659A priority patent/CA2594659A1/en
Priority to EP05024035A priority patent/EP1666594A3/en
Priority to CA002591590A priority patent/CA2591590A1/en
Priority to EP05024037A priority patent/EP1700867A3/en
Priority to EP01939834A priority patent/EP1286749A1/en
Priority to CA002648048A priority patent/CA2648048A1/en
Priority to PCT/US2001/019692 priority patent/WO2002000690A2/en
Priority to EP01957073A priority patent/EP1309620A2/en
Priority to CA002648051A priority patent/CA2648051A1/en
Priority to CA002412211A priority patent/CA2412211A1/en
Priority to CA002648046A priority patent/CA2648046A1/en
Priority to AU2001278852A priority patent/AU2001278852A1/en
Priority to CA2709771A priority patent/CA2709771A1/en
Priority to DK08019420.2T priority patent/DK2042597T3/en
Priority to JP2002505812A priority patent/JP2004506413A/en
Priority to EP09004415A priority patent/EP2168980A1/en
Priority to EP09004418A priority patent/EP2075253A1/en
Priority to EP09004417A priority patent/EP2077276A1/en
Priority to EP10182597A priority patent/EP2275549A1/en
Priority to EP14166919.2A priority patent/EP2792747A1/en
Priority to EP08019420.2A priority patent/EP2042597B1/en
Priority to CA002416456A priority patent/CA2416456A1/en
Priority to AU2001273150A priority patent/AU2001273150A1/en
Priority to PCT/US2001/021066 priority patent/WO2002008288A2/en
Priority to JP2002514192A priority patent/JP2004514420A/en
Priority to EP01952391A priority patent/EP1354040A2/en
Priority to AU7315001A priority patent/AU7315001A/en
Priority to CA002416538A priority patent/CA2416538A1/en
Priority to EP01951036A priority patent/EP1309685A2/en
Priority to JP2002514188A priority patent/JP2004516013A/en
Priority to AU2001271973A priority patent/AU2001271973A1/en
Priority to PCT/US2001/021735 priority patent/WO2002008284A2/en
Priority to US09/902,634 priority patent/US20030082540A1/en
Priority to US09/902,713 priority patent/US20030082541A1/en
Priority to US09/902,759 priority patent/US20030077654A1/en
Priority to US09/902,903 priority patent/US20030044839A1/en
Priority to US09/902,615 priority patent/US20030092002A1/en
Priority to US09/902,692 priority patent/US20030054400A1/en
Priority to US09/902,979 priority patent/US20030113718A1/en
Priority to US09/902,853 priority patent/US20020192659A1/en
Priority to US09/902,572 priority patent/US20030108983A1/en
Priority to US09/902,736 priority patent/US20030049676A1/en
Priority to US09/903,925 priority patent/US20030096233A1/en
Priority to US09/903,806 priority patent/US20030130489A1/en
Priority to US09/903,603 priority patent/US20030148419A1/en
Priority to US09/904,119 priority patent/US20030049621A1/en
Priority to US09/903,823 priority patent/US20030104381A1/en
Priority to US09/903,749 priority patent/US7147853B2/en
Priority to US09/903,640 priority patent/US7208308B2/en
Priority to US09/903,562 priority patent/US6965015B2/en
Priority to US09/903,943 priority patent/US20030054349A1/en
Priority to US09/904,011 priority patent/US20030003530A1/en
Priority to US09/903,520 priority patent/US20030054401A1/en
Priority to US09/903,786 priority patent/US20030044793A1/en
Priority to US09/904,786 priority patent/US7557192B2/en
Priority to US09/904,992 priority patent/US20030135025A1/en
Priority to US09/905,291 priority patent/US20020160374A1/en
Priority to US09/904,938 priority patent/US20030211569A1/en
Priority to US09/905,088 priority patent/US20030073077A1/en
Priority to US09/904,877 priority patent/US20030186358A1/en
Priority to US09/905,056 priority patent/US20030054441A1/en
Priority to US09/905,125 priority patent/US6664376B2/en
Priority to US09/904,859 priority patent/US20030036060A1/en
Priority to US09/904,766 priority patent/US20030152999A1/en
Priority to US09/904,462 priority patent/US6878807B2/en
Priority to US09/904,920 priority patent/US6806352B2/en
Priority to US09/905,348 priority patent/US20030064923A1/en
Priority to US09/904,553 priority patent/US20030059828A1/en
Priority to US09/905,449 priority patent/US6965011B2/en
Priority to US09/904,485 priority patent/US20030064367A1/en
Priority to US09/904,532 priority patent/US7151160B2/en
Priority to US09/905,381 priority patent/US6818746B2/en
Priority to US09/905,075 priority patent/US7169906B2/en
Priority to US09/904,838 priority patent/US20030148370A1/en
Priority to US09/904,820 priority patent/US20030036094A1/en
Priority to US09/904,956 priority patent/US20030049622A1/en
Priority to US09/906,722 priority patent/US6946262B2/en
Priority to US09/906,646 priority patent/US6852848B2/en
Priority to US09/906,742 priority patent/US20030023054A1/en
Priority to US09/906,777 priority patent/US20030148371A1/en
Priority to US09/906,815 priority patent/US7094567B2/en
Priority to US09/906,838 priority patent/US7070979B2/en
Priority to US09/906,618 priority patent/US6828146B2/en
Priority to US09/906,760 priority patent/US20030096340A1/en
Priority to US09/906,700 priority patent/US6723535B2/en
Priority to US09/907,979 priority patent/US20030082542A1/en
Priority to US09/907,824 priority patent/US20020197671A1/en
Priority to US09/907,613 priority patent/US20030027145A1/en
Priority to US09/907,652 priority patent/US20030104469A1/en
Priority to US09/907,575 priority patent/US20030073079A1/en
Priority to US09/907,925 priority patent/US20030054352A1/en
Priority to US09/907,728 priority patent/US20030190611A1/en
Priority to US09/907,942 priority patent/US7087738B2/en
Priority to US09/908,093 priority patent/US20030017498A1/en
Priority to US09/907,841 priority patent/US7033825B2/en
Priority to US09/907,794 priority patent/US6635468B2/en
Priority to US09/909,320 priority patent/US7074592B2/en
Priority to US09/908,576 priority patent/US20040005553A1/en
Priority to US09/909,204 priority patent/US20030036061A1/en
Priority to US09/909,088 priority patent/US20020146709A1/en
Priority to US09/909,064 priority patent/US6818449B2/en
Priority to US09/918,585 priority patent/US20030060406A1/en
Publication of WO2001009327A3 publication Critical patent/WO2001009327A3/en
Priority to US09/941,992 priority patent/US20030082546A1/en
Priority to US09/943,851 priority patent/US20020150976A1/en
Priority to US09/944,396 priority patent/US20020132981A1/en
Priority to US09/944,432 priority patent/US20020142419A1/en
Priority to US09/944,413 priority patent/US20020156004A1/en
Priority to US09/943,762 priority patent/US20020142958A1/en
Priority to US09/944,403 priority patent/US20020165143A1/en
Priority to US09/943,780 priority patent/US20030096742A1/en
Priority to US09/944,449 priority patent/US20020102647A1/en
Priority to US09/943,664 priority patent/US20040091972A1/en
Priority to US09/944,457 priority patent/US6734288B2/en
Priority to US09/944,852 priority patent/US20030083479A1/en
Priority to US09/944,907 priority patent/US20020198147A1/en
Priority to US09/944,654 priority patent/US20020142959A1/en
Priority to US09/944,896 priority patent/US7189566B2/en
Priority to US09/944,929 priority patent/US7550573B2/en
Priority to US09/945,584 priority patent/US6908993B2/en
Priority to US09/945,015 priority patent/US20020132768A1/en
Priority to US09/944,944 priority patent/US6929947B2/en
Priority to US09/944,862 priority patent/US20020115145A1/en
Priority to US09/944,884 priority patent/US7018837B2/en
Priority to US09/945,587 priority patent/US6936254B2/en
Priority to US09/978,193 priority patent/US20030073624A1/en
Priority to US09/978,295 priority patent/US20020156006A1/en
Priority to US09/978,299 priority patent/US20030199435A1/en
Priority to US09/978,194 priority patent/US20030195333A1/en
Priority to US09/978,192 priority patent/US20020177553A1/en
Priority to US09/978,189 priority patent/US6972325B2/en
Priority to US09/978,298 priority patent/US20030134785A1/en
Priority to US09/978,188 priority patent/US20030139328A1/en
Priority to US09/978,191 priority patent/US20030050239A1/en
Priority to US09/978,423 priority patent/US20030069178A1/en
Priority to US09/978,403 priority patent/US20030050240A1/en
Priority to US09/978,375 priority patent/US7196165B2/en
Priority to US09/978,585 priority patent/US20030049633A1/en
Priority to US09/978,564 priority patent/US7195760B2/en
Priority to US09/978,802 priority patent/US20030199674A1/en
Priority to US09/981,915 priority patent/US7285623B2/en
Priority to US09/978,824 priority patent/US20050124789A9/en
Priority to US09/978,697 priority patent/US20020169284A1/en
Priority to US09/978,757 priority patent/US20030083248A1/en
Priority to US09/978,643 priority patent/US20030104998A1/en
Priority to US09/978,544 priority patent/US20030199436A1/en
Priority to US09/978,681 priority patent/US20030195148A1/en
Priority to US09/978,665 priority patent/US7294700B2/en
Priority to US09/981,915 priority patent/US20030054986A1/en
Priority to US09/978,824 priority patent/US20030055216A1/en
Priority to US10/210,028 priority patent/US20030203446A1/en
Priority to US10/152,388 priority patent/US20040223964A1/en
Priority to US10/164,728 priority patent/US20030186368A1/en
Priority to US10/160,502 priority patent/US7220835B2/en
Priority to US10/165,036 priority patent/US20050227342A1/en
Priority to US10/145,089 priority patent/US7208575B2/en
Priority to US10/162,521 priority patent/US7067628B2/en
Priority to US10/143,029 priority patent/US7105640B2/en
Priority to US10/165,067 priority patent/US7279553B2/en
Priority to US10/166,709 priority patent/US20030104536A1/en
Priority to US10/145,124 priority patent/US20030190701A1/en
Priority to US10/165,247 priority patent/US7112657B2/en
Priority to US10/164,749 priority patent/US20040029218A1/en
Priority to US10/145,017 priority patent/US20030186365A1/en
Priority to US10/164,829 priority patent/US20030194780A1/en
Priority to US10/164,929 priority patent/US20030194781A1/en
Priority to US10/013,922 priority patent/US20030195345A1/en
Priority to US09/999,832 priority patent/US20020192706A1/en
Priority to US10/017,085 priority patent/US6974696B2/en
Priority to US10/017,083 priority patent/US20030148376A1/en
Priority to US09/999,832 priority patent/US7132283B2/en
Priority to US09/999,830 priority patent/US20030077700A1/en
Priority to US10/020,445 priority patent/US20030198994A1/en
Priority to US10/017,086 priority patent/US7122375B2/en
Priority to US09/999,834 priority patent/US20030064407A1/en
Priority to US10/002,967 priority patent/US20030148373A1/en
Priority to US09/999,833 priority patent/US6916648B2/en
Priority to US09/999,829 priority patent/US20030195344A1/en
Priority to US10/017,084 priority patent/US20030203402A1/en
Priority to US10/017,081 priority patent/US20030049684A1/en
Priority to US10/013,920 priority patent/US20040006219A1/en
Priority to US10/013,923 priority patent/US7169912B2/en
Priority to US10/013,917 priority patent/US7029874B2/en
Priority to US10/013,925 priority patent/US7037710B2/en
Priority to US10/013,921 priority patent/US20030068648A1/en
Priority to US10/013,926 priority patent/US7074593B2/en
Priority to US10/016,177 priority patent/US20030073131A1/en
Priority to US10/013,929 priority patent/US7019124B2/en
Priority to US10/013,918 priority patent/US20030211091A1/en
Priority to US10/013,928 priority patent/US20030215905A1/en
Priority to US10/013,927 priority patent/US7189529B2/en
Priority to US09/990,711 priority patent/US20030032023A1/en
Priority to US09/993,583 priority patent/US7074897B2/en
Priority to US09/991,073 priority patent/US20020127576A1/en
Priority to US09/991,854 priority patent/US20030059780A1/en
Priority to US09/993,667 priority patent/US20030022187A1/en
Priority to US09/990,443 priority patent/US20030054987A1/en
Priority to US09/990,444 priority patent/US6930170B2/en
Priority to US09/990,456 priority patent/US20020137890A1/en
Priority to US09/990,726 priority patent/US20030054359A1/en
Priority to US09/990,438 priority patent/US20030027754A1/en
Priority to US09/990,436 priority patent/US20020198148A1/en
Priority to US09/993,469 priority patent/US20030068623A1/en
Priority to US09/990,440 priority patent/US20030060407A1/en
Priority to US09/990,562 priority patent/US20030027985A1/en
Priority to US09/990,442 priority patent/US20020132252A1/en
Priority to US09/990,427 priority patent/US20030073809A1/en
Priority to US09/993,687 priority patent/US20020198149A1/en
Priority to US09/992,521 priority patent/US20030083461A1/en
Priority to US09/993,748 priority patent/US20030069403A1/en
Priority to US09/992,598 priority patent/US6956108B2/en
Priority to US09/991,163 priority patent/US20020132253A1/en
Priority to US09/997,440 priority patent/US20030059833A1/en
Priority to US09/997,573 priority patent/US20030049682A1/en
Priority to US09/997,601 priority patent/US20030054404A1/en
Priority to US09/997,666 priority patent/US7244816B2/en
Priority to US09/997,514 priority patent/US7019116B2/en
Priority to US09/997,641 priority patent/US20030224358A1/en
Priority to US09/998,041 priority patent/US20030119001A1/en
Priority to US09/997,683 priority patent/US20030059783A1/en
Priority to US09/997,428 priority patent/US20030027162A1/en
Priority to US09/997,666 priority patent/US20030027163A1/en
Priority to US09/997,559 priority patent/US20030054403A1/en
Priority to US09/997,628 priority patent/US20030059782A1/en
Priority to US09/997,529 priority patent/US7309761B2/en
Priority to US09/997,585 priority patent/US7166282B2/en
Priority to US09/997,384 priority patent/US7119177B2/en
Priority to US09/997,333 priority patent/US6953836B2/en
Priority to US09/998,156 priority patent/US20030044806A1/en
Priority to US09/997,641 priority patent/US7112656B2/en
Priority to US09/997,653 priority patent/US7034122B2/en
Priority to US09/997,384 priority patent/US20030087305A1/en
Priority to US09/997,529 priority patent/US20030134284A1/en
Priority to US09/997,857 priority patent/US20030064375A1/en
Priority to US09/997,349 priority patent/US7034106B2/en
Priority to US09/997,601 priority patent/US7189814B2/en
Priority to US09/997,585 priority patent/US20030119055A1/en
Priority to US09/998,041 priority patent/US7309775B2/en
Priority to US09/997,542 priority patent/US20030068647A1/en
Priority to US09/997,614 priority patent/US20030124531A1/en
Priority to US09/990,437 priority patent/US20030045463A1/en
Priority to US09/990,441 priority patent/US7041804B2/en
Priority to US09/991,181 priority patent/US6913919B2/en
Priority to US09/991,157 priority patent/US7101687B2/en
Priority to US09/991,150 priority patent/US20030194760A1/en
Priority to US09/991,172 priority patent/US20030050457A1/en
Priority to US09/989,729 priority patent/US20030059831A1/en
Priority to US09/989,721 priority patent/US20020142961A1/en
Priority to US09/989,735 priority patent/US6972185B2/en
Priority to US09/989,727 priority patent/US20020072497A1/en
Priority to US09/989,328 priority patent/US7056736B2/en
Priority to US09/989,722 priority patent/US20020072067A1/en
Priority to US09/989,726 priority patent/US7018811B2/en
Priority to US09/989,862 priority patent/US20030130182A1/en
Priority to US09/989,279 priority patent/US7083978B2/en
Priority to US09/989,723 priority patent/US20020072092A1/en
Priority to US09/989,734 priority patent/US7491529B2/en
Priority to US09/989,732 priority patent/US7037679B2/en
Priority to US09/989,728 priority patent/US7029873B2/en
Priority to US09/989,724 priority patent/US7060812B2/en
Priority to US09/989,731 priority patent/US20020103125A1/en
Priority to US09/989,293 priority patent/US7034136B2/en
Priority to US09/989,725 priority patent/US20030139329A1/en
Priority to US09/989,730 priority patent/US7157247B2/en
Priority to US10/052,586 priority patent/US20020127584A1/en
Priority to US09/978,187 priority patent/US20030096744A1/en
Priority to US10/081,056 priority patent/US20040043927A1/en
Priority to US10/119,480 priority patent/US20040087769A1/en
Priority to US10/121,040 priority patent/US20030082759A1/en
Priority to US10/121,046 priority patent/US20030194791A1/en
Priority to US10/121,042 priority patent/US20030096386A1/en
Priority to US10/121,059 priority patent/US20030190721A1/en
Priority to US10/121,041 priority patent/US20030077776A1/en
Priority to US10/121,051 priority patent/US20030092147A1/en
Priority to US10/121,047 priority patent/US20030077778A1/en
Priority to US10/121,044 priority patent/US20030190717A1/en
Priority to US10/121,045 priority patent/US20030073210A1/en
Priority to US10/121,062 priority patent/US20030077779A1/en
Priority to US10/121,043 priority patent/US7220831B2/en
Priority to US10/121,055 priority patent/US20030190718A1/en
Priority to US10/121,052 priority patent/US20030199052A1/en
Priority to US10/121,058 priority patent/US20030190720A1/en
Priority to US10/121,049 priority patent/US20030022239A1/en
Priority to US10/121,061 priority patent/US20030082761A1/en
Priority to US10/121,063 priority patent/US20030199055A1/en
Priority to US10/121,054 priority patent/US20030199054A1/en
Priority to US10/121,056 priority patent/US20030082760A1/en
Priority to US10/121,060 priority patent/US20030190722A1/en
Priority to US10/121,050 priority patent/US20030054516A1/en
Priority to US10/121,053 priority patent/US20030199053A1/en
Priority to US10/121,048 priority patent/US20030199051A1/en
Priority to US10/121,057 priority patent/US20030190719A1/en
Priority to US10/123,215 priority patent/US7291329B2/en
Priority to US10/123,214 priority patent/US7343721B2/en
Priority to US10/123,213 priority patent/US7193048B2/en
Priority to US10/123,109 priority patent/US20030190723A1/en
Priority to US10/123,236 priority patent/US20030068795A1/en
Priority to US10/123,235 priority patent/US20030082762A1/en
Priority to US10/123,322 priority patent/US20030199059A1/en
Priority to US10/123,291 priority patent/US20030199058A1/en
Priority to US10/123,292 priority patent/US20030073211A1/en
Priority to US10/123,261 priority patent/US20030068796A1/en
Priority to US10/123,155 priority patent/US20030068794A1/en
Priority to US10/123,771 priority patent/US20030199060A1/en
Priority to US10/123,108 priority patent/US7635478B2/en
Priority to US10/123,157 priority patent/US20030190725A1/en
Priority to US10/123,156 priority patent/US20030194792A1/en
Priority to US10/123,262 priority patent/US20030049816A1/en
Priority to US10/123,212 priority patent/US7276577B2/en
Priority to US10/123,213 priority patent/US20030199057A1/en
Priority to US10/123,154 priority patent/US20030190724A1/en
Priority to US10/123,905 priority patent/US20030087344A1/en
Priority to US10/123,909 priority patent/US7193049B2/en
Priority to US10/123,910 priority patent/US7329404B2/en
Priority to US10/123,913 priority patent/US20030203462A1/en
Priority to US10/123,906 priority patent/US20030190726A1/en
Priority to US10/123,902 priority patent/US20030077781A1/en
Priority to US10/123,903 priority patent/US20030073212A1/en
Priority to US10/123,912 priority patent/US20030100087A1/en
Priority to US10/123,907 priority patent/US7084258B2/en
Priority to US10/123,904 priority patent/US20030022328A1/en
Priority to US10/123,911 priority patent/US7408032B2/en
Priority to US10/123,908 priority patent/US7335728B2/en
Priority to US10/123,905 priority patent/US7285625B2/en
Priority to US10/124,821 priority patent/US20030199023A1/en
Priority to US10/124,817 priority patent/US20030077786A1/en
Priority to US10/124,820 priority patent/US20030190729A1/en
Priority to US10/124,818 priority patent/US20030082763A1/en
Priority to US10/125,805 priority patent/US20030194794A1/en
Priority to US10/124,824 priority patent/US20030077659A1/en
Priority to US10/124,814 priority patent/US7105335B2/en
Priority to US10/124,813 priority patent/US7312307B2/en
Priority to US10/125,795 priority patent/US7304131B2/en
Priority to US10/124,819 priority patent/US7285626B2/en
Priority to US10/124,816 priority patent/US20030190728A1/en
Priority to US10/124,822 priority patent/US7109305B2/en
Priority to US10/125,704 priority patent/US7357926B2/en
Priority to US10/124,823 priority patent/US20030199062A1/en
Priority to US10/125,927 priority patent/US20030190731A1/en
Priority to US10/125,931 priority patent/US20030199063A1/en
Priority to US10/125,924 priority patent/US7342097B2/en
Priority to US10/125,922 priority patent/US7309762B2/en
Priority to US10/125,932 priority patent/US7317079B2/en
Priority to US10/127,831 priority patent/US20030082689A1/en
Priority to US10/128,689 priority patent/US20030087365A1/en
Priority to US10/131,825 priority patent/US7282566B2/en
Priority to US10/131,817 priority patent/US7291701B2/en
Priority to US10/131,823 priority patent/US7304132B2/en
Priority to US10/137,867 priority patent/US20030207349A1/en
Priority to US10/137,865 priority patent/US20030032155A1/en
Priority to US10/137,868 priority patent/US20030082764A1/en
Priority to US10/140,024 priority patent/US20040058424A1/en
Priority to US10/140,470 priority patent/US20030022331A1/en
Priority to US10/140,020 priority patent/US20030207415A1/en
Priority to US10/140,023 priority patent/US20030207416A1/en
Priority to US10/140,474 priority patent/US20030032156A1/en
Priority to US10/139,980 priority patent/US7247710B2/en
Priority to US10/139,963 priority patent/US7288625B2/en
Priority to US10/140,860 priority patent/US7307151B2/en
Priority to US10/140,809 priority patent/US20030207418A1/en
Priority to US10/140,921 priority patent/US7317080B2/en
Priority to US10/140,925 priority patent/US20030073215A1/en
Priority to US10/140,864 priority patent/US20030207419A1/en
Priority to US10/140,808 priority patent/US7425621B2/en
Priority to US10/140,805 priority patent/US20030207417A1/en
Priority to US10/140,865 priority patent/US20030207420A1/en
Priority to US10/140,928 priority patent/US20030068798A1/en
Priority to US10/141,756 priority patent/US7488586B2/en
Priority to US10/141,760 priority patent/US7342104B2/en
Priority to US10/141,701 priority patent/US20030207421A1/en
Priority to US10/141,754 priority patent/US7361732B2/en
Priority to US10/141,755 priority patent/US7297764B2/en
Priority to US10/142,430 priority patent/US7309766B2/en
Priority to US10/142,425 priority patent/US20030207424A1/en
Priority to US10/143,113 priority patent/US7329730B2/en
Priority to US10/143,114 priority patent/US20030036180A1/en
Priority to US10/142,417 priority patent/US7304133B2/en
Priority to US10/142,431 priority patent/US7285629B2/en
Priority to US10/143,032 priority patent/US7408033B2/en
Priority to US10/142,423 priority patent/US20030049817A1/en
Priority to US10/142,419 priority patent/US7153941B2/en
Priority to US10/146,792 priority patent/US20030207428A1/en
Priority to US10/146,730 priority patent/US20030207427A1/en
Priority to US10/147,528 priority patent/US20030219885A1/en
Priority to US10/147,492 priority patent/US20030082765A1/en
Priority to US10/147,536 priority patent/US20040077064A1/en
Priority to US10/147,519 priority patent/US20030077791A1/en
Priority to US10/152,395 priority patent/US7189534B2/en
Priority to US10/153,934 priority patent/US20030129695A1/en
Priority to US10/156,843 priority patent/US20030207805A1/en
Priority to US10/157,786 priority patent/US20030208055A1/en
Priority to US10/157,782 priority patent/US20030077792A1/en
Priority to US10/160,498 priority patent/US20030073216A1/en
Priority to US10/158,791 priority patent/US20030207429A1/en
Priority to US10/158,782 priority patent/US20030082766A1/en
Priority to US10/173,695 priority patent/US20030032101A1/en
Priority to US10/173,708 priority patent/US20030040053A1/en
Priority to US10/173,700 priority patent/US20030027262A1/en
Priority to US10/173,697 priority patent/US20030032102A1/en
Priority to US10/173,689 priority patent/US20030166104A1/en
Priority to US10/173,694 priority patent/US20030166107A1/en
Priority to US10/173,692 priority patent/US20030166188A1/en
Priority to US10/173,698 priority patent/US20030166108A1/en
Priority to US10/173,702 priority patent/US20030170793A1/en
Priority to US10/173,690 priority patent/US20030166105A1/en
Priority to US10/173,691 priority patent/US20030166106A1/en
Priority to US10/173,703 priority patent/US20030170794A1/en
Priority to US10/173,696 priority patent/US20030082767A1/en
Priority to US10/173,706 priority patent/US20030022293A1/en
Priority to US10/173,707 priority patent/US20030166110A1/en
Priority to US10/173,699 priority patent/US20030166109A1/en
Priority to US10/173,701 priority patent/US20030104538A1/en
Priority to US10/173,705 priority patent/US20030032103A1/en
Priority to US10/173,704 priority patent/US20030170795A1/en
Priority to US10/173,693 priority patent/US20030073169A1/en
Priority to US10/174,590 priority patent/US20030008352A1/en
Priority to US10/174,586 priority patent/US20030032106A1/en
Priority to US10/174,578 priority patent/US20030073170A1/en
Priority to US10/174,588 priority patent/US20030027266A1/en
Priority to US10/174,583 priority patent/US7211645B2/en
Priority to US10/174,585 priority patent/US20030032105A1/en
Priority to US10/174,589 priority patent/US20030166114A1/en
Priority to US10/174,576 priority patent/US7125962B2/en
Priority to US10/174,591 priority patent/US20030166115A1/en
Priority to US10/174,579 priority patent/US20030027264A1/en
Priority to US10/174,574 priority patent/US20030170796A1/en
Priority to US10/174,570 priority patent/US20030211572A1/en
Priority to US10/175,740 priority patent/US20030027268A1/en
Priority to US10/174,587 priority patent/US20030166113A1/en
Priority to US10/174,569 priority patent/US20030166111A1/en
Priority to US10/174,572 priority patent/US20030027263A1/en
Priority to US10/174,582 priority patent/US20030027265A1/en
Priority to US10/174,581 priority patent/US7153939B2/en
Priority to US10/175,737 priority patent/US20030013153A1/en
Priority to US10/175,753 priority patent/US20030077732A1/en
Priority to US10/175,746 priority patent/US20030027270A1/en
Priority to US10/175,744 priority patent/US20030166119A1/en
Priority to US10/175,745 priority patent/US20030166120A1/en
Priority to US10/175,752 priority patent/US20030022295A1/en
Priority to US10/175,738 priority patent/US20030022294A1/en
Priority to US10/175,750 priority patent/US20030073172A1/en
Priority to US10/175,754 priority patent/US20030166123A1/en
Priority to US10/175,742 priority patent/US20030166118A1/en
Priority to US10/175,749 priority patent/US20050196832A1/en
Priority to US10/175,739 priority patent/US20030027267A1/en
Priority to US10/175,741 priority patent/US20030073171A1/en
Priority to US10/175,751 priority patent/US20030166122A1/en
Priority to US10/175,747 priority patent/US20030032107A1/en
Priority to US10/175,743 priority patent/US20030027269A1/en
Priority to US10/175,748 priority patent/US20030166121A1/en
Priority to US10/175,735 priority patent/US20030082715A1/en
Priority to US10/175,736 priority patent/US20030166117A1/en
Priority to US10/176,911 priority patent/US20030032113A1/en
Priority to US10/176,914 priority patent/US20030017543A1/en
Priority to US10/176,913 priority patent/US20030022298A1/en
Priority to US10/176,990 priority patent/US20030036119A1/en
Priority to US10/176,920 priority patent/US20030166129A1/en
Priority to US10/176,757 priority patent/US7317082B2/en
Priority to US10/176,759 priority patent/US20030166128A1/en
Priority to US10/176,491 priority patent/US20030087373A1/en
Priority to US10/176,746 priority patent/US20030068680A1/en
Priority to US10/176,919 priority patent/US20030032114A1/en
Priority to US10/176,754 priority patent/US7709602B2/en
Priority to US10/176,918 priority patent/US7495083B2/en
Priority to US10/176,921 priority patent/US20030027276A1/en
Priority to US10/176,993 priority patent/US20030027280A1/en
Priority to US10/176,988 priority patent/US20030170802A1/en
Priority to US10/176,483 priority patent/US20030017541A1/en
Priority to US10/176,484 priority patent/US20030059876A9/en
Priority to US10/176,753 priority patent/US20030044917A1/en
Priority to US10/176,487 priority patent/US20030032110A1/en
Priority to US10/176,749 priority patent/US20030017542A1/en
Priority to US10/176,981 priority patent/US20030170800A1/en
Priority to US10/176,485 priority patent/US20030032109A1/en
Priority to US10/176,482 priority patent/US20030022296A1/en
Priority to US10/176,479 priority patent/US20030040054A1/en
Priority to US10/176,490 priority patent/US20030170798A1/en
Priority to US10/176,917 priority patent/US20030044918A1/en
Priority to US10/176,493 priority patent/US20030032111A1/en
Priority to US10/176,989 priority patent/US20030170803A1/en
Priority to US10/176,747 priority patent/US20030027273A1/en
Priority to US10/176,488 priority patent/US20030027271A1/en
Priority to US10/176,987 priority patent/US20030027278A1/en
Priority to US10/176,915 priority patent/US20030017544A1/en
Priority to US10/176,925 priority patent/US20030032115A1/en
Priority to US10/176,979 priority patent/US20030087374A1/en
Priority to US10/176,489 priority patent/US20030166125A1/en
Priority to US10/176,760 priority patent/US7339033B2/en
Priority to US10/176,751 priority patent/US20030036117A1/en
Priority to US10/176,985 priority patent/US20030027277A1/en
Priority to US10/176,983 priority patent/US20030170801A1/en
Priority to US10/176,480 priority patent/US20030166124A1/en
Priority to US10/176,755 priority patent/US20030166127A1/en
Priority to US10/176,986 priority patent/US20030073173A1/en
Priority to US10/176,486 priority patent/US7354999B2/en
Priority to US10/176,752 priority patent/US20030170799A1/en
Priority to US10/176,982 priority patent/US20030044919A1/en
Priority to US10/176,924 priority patent/US20030166131A1/en
Priority to US10/176,750 priority patent/US20030027274A1/en
Priority to US10/176,991 priority patent/US20030027324A1/en
Priority to US10/176,748 priority patent/US20030040055A1/en
Priority to US10/176,922 priority patent/US20030166130A1/en
Priority to US10/176,481 priority patent/US20030032108A1/en
Priority to US10/176,923 priority patent/US20030068681A1/en
Priority to US10/176,492 priority patent/US20030027272A1/en
Priority to US10/176,758 priority patent/US20030008353A1/en
Priority to US10/176,756 priority patent/US20030032112A1/en
Priority to US10/176,916 priority patent/US20030040056A1/en
Priority to US10/176,978 priority patent/US20030032116A1/en
Priority to US10/179,523 priority patent/US20030215909A1/en
Priority to US10/179,514 priority patent/US20030044922A1/en
Priority to US10/179,526 priority patent/US20030100061A1/en
Priority to US10/179,521 priority patent/US20030170806A1/en
Priority to US10/179,515 priority patent/US20030166135A1/en
Priority to US10/179,519 priority patent/US7339024B2/en
Priority to US10/179,511 priority patent/US20030104539A1/en
Priority to US10/179,517 priority patent/US20030170805A1/en
Priority to US10/179,513 priority patent/US20030044921A1/en
Priority to US10/179,512 priority patent/US20030166134A1/en
Priority to US10/179,518 priority patent/US20030104540A1/en
Priority to US10/179,522 priority patent/US20030044923A1/en
Priority to US10/179,508 priority patent/US20030166133A1/en
Priority to US10/179,509 priority patent/US20030207392A1/en
Priority to US10/179,516 priority patent/US20030040058A1/en
Priority to US10/179,510 priority patent/US20030032117A1/en
Priority to US10/179,525 priority patent/US20030040060A1/en
Priority to US10/179,506 priority patent/US20030044920A1/en
Priority to US10/179,520 priority patent/US20030096353A1/en
Priority to US10/179,507 priority patent/US20030040057A1/en
Priority to US10/180,545 priority patent/US20030040062A1/en
Priority to US10/180,555 priority patent/US20030032123A1/en
Priority to US10/180,547 priority patent/US20030032121A1/en
Priority to US10/180,554 priority patent/US20050202526A1/en
Priority to US10/180,548 priority patent/US7696319B2/en
Priority to US10/180,552 priority patent/US7348415B2/en
Priority to US10/180,551 priority patent/US20030036123A1/en
Priority to US10/180,540 priority patent/US20030040061A1/en
Priority to US10/180,559 priority patent/US20030032124A1/en
Priority to US10/180,546 priority patent/US20030032120A1/en
Priority to US10/180,544 priority patent/US20030032119A1/en
Priority to US10/180,557 priority patent/US20030022301A1/en
Priority to US10/180,543 priority patent/US20030032118A1/en
Priority to US10/180,541 priority patent/US20030036120A1/en
Priority to US10/180,560 priority patent/US20030044925A1/en
Priority to US10/180,556 priority patent/US7355000B2/en
Priority to US10/180,549 priority patent/US20030032122A1/en
Priority to US10/180,542 priority patent/US20030036121A1/en
Priority to US10/180,553 priority patent/US7365156B2/en
Priority to US10/180,550 priority patent/US20030064440A1/en
Priority to US10/180,999 priority patent/US7297767B2/en
Priority to US10/183,011 priority patent/US20030068682A1/en
Priority to US10/183,014 priority patent/US20030064441A1/en
Priority to US10/183,009 priority patent/US7339034B2/en
Priority to US10/183,018 priority patent/US20030104541A1/en
Priority to US10/180,998 priority patent/US7087421B2/en
Priority to US10/183,015 priority patent/US20030044926A1/en
Priority to US10/183,002 priority patent/US20030054454A1/en
Priority to US10/183,012 priority patent/US7718770B2/en
Priority to US10/183,008 priority patent/US20030040064A1/en
Priority to US10/183,013 priority patent/US7309769B2/en
Priority to US10/183,003 priority patent/US20030082716A1/en
Priority to US10/183,010 priority patent/US20030032126A1/en
Priority to US10/183,017 priority patent/US20030040065A1/en
Priority to US10/183,001 priority patent/US7084255B2/en
Priority to US10/183,016 priority patent/US20030082717A1/en
Priority to US10/183,005 priority patent/US7317093B2/en
Priority to US10/181,000 priority patent/US7319137B2/en
Priority to US10/183,006 priority patent/US7297776B2/en
Priority to US10/183,019 priority patent/US7425605B2/en
Priority to US10/184,633 priority patent/US20030068683A1/en
Priority to US10/184,631 priority patent/US20030036134A1/en
Priority to US10/184,654 priority patent/US7378486B2/en
Priority to US10/184,627 priority patent/US7282569B2/en
Priority to US10/184,638 priority patent/US20030054456A1/en
Priority to US10/184,630 priority patent/US20030036133A1/en
Priority to US10/184,613 priority patent/US20030119105A1/en
Priority to US10/184,615 priority patent/US20030044927A1/en
Priority to US10/184,651 priority patent/US7291704B2/en
Priority to US10/184,642 priority patent/US7332573B2/en
Priority to US10/184,616 priority patent/US20030036128A1/en
Priority to US10/184,614 priority patent/US20030032128A1/en
Priority to US10/184,627 priority patent/US20030040070A1/en
Priority to US10/184,630 priority patent/US7304143B2/en
Priority to US10/184,628 priority patent/US7309770B2/en
Priority to US10/184,640 priority patent/US7271250B2/en
Priority to US10/184,618 priority patent/US7393917B2/en
Priority to US10/184,652 priority patent/US20030032134A1/en
Priority to US10/184,612 priority patent/US20030036127A1/en
Priority to US10/184,641 priority patent/US20030073174A1/en
Priority to US10/184,619 priority patent/US20030049738A1/en
Priority to US10/184,645 priority patent/US7291718B2/en
Priority to US10/184,623 priority patent/US20030032129A1/en
Priority to US10/184,635 priority patent/US20030032130A1/en
Priority to US10/184,637 priority patent/US20030032131A1/en
Priority to US10/184,650 priority patent/US20030036138A1/en
Priority to US10/184,636 priority patent/US20030036136A1/en
Priority to US10/184,646 priority patent/US20030032132A1/en
Priority to US10/184,629 priority patent/US20030036132A1/en
Priority to US10/184,617 priority patent/US20030036129A1/en
Priority to US10/184,647 priority patent/US20030032133A1/en
Priority to US10/184,621 priority patent/US20030054455A1/en
Priority to US10/184,658 priority patent/US20030027281A1/en
Priority to US10/184,625 priority patent/US20030040068A1/en
Priority to US10/184,634 priority patent/US20030068684A1/en
Priority to US10/184,655 priority patent/US20030040073A1/en
Priority to US10/184,632 priority patent/US20030036135A1/en
Priority to US10/184,656 priority patent/US20030044931A1/en
Priority to US10/184,624 priority patent/US20030104542A1/en
Priority to US10/184,644 priority patent/US20030044930A1/en
Priority to US10/184,643 priority patent/US20030044929A1/en
Priority to US10/184,657 priority patent/US20030104543A1/en
Priority to US10/184,626 priority patent/US20030040069A1/en
Priority to US10/184,620 priority patent/US20030044928A1/en
Priority to US10/184,622 priority patent/US20030036130A1/en
Priority to US10/187,887 priority patent/US7285645B2/en
Priority to US10/187,884 priority patent/US20030036155A1/en
Priority to US10/187,747 priority patent/US7291707B2/en
Priority to US10/187,601 priority patent/US7291705B2/en
Priority to US10/187,739 priority patent/US7291706B2/en
Priority to US10/187,598 priority patent/US20030036142A1/en
Priority to US10/187,588 priority patent/US7351795B2/en
Priority to US10/187,597 priority patent/US20030036141A1/en
Priority to US10/187,594 priority patent/US7294335B2/en
Priority to US10/187,886 priority patent/US7291708B2/en
Priority to US10/187,603 priority patent/US20030036146A1/en
Priority to US10/188,766 priority patent/US7351804B2/en
Priority to US10/187,747 priority patent/US20030036150A1/en
Priority to US10/188,769 priority patent/US20030036157A1/en
Priority to US10/188,780 priority patent/US7268217B2/en
Priority to US10/187,753 priority patent/US20030036152A1/en
Priority to US10/187,757 priority patent/US7276578B2/en
Priority to US10/187,751 priority patent/US20030036151A1/en
Priority to US10/188,767 priority patent/US7312310B2/en
Priority to US10/187,602 priority patent/US20030036145A1/en
Priority to US10/188,770 priority patent/US7358340B2/en
Priority to US10/187,885 priority patent/US20030032138A1/en
Priority to US10/187,746 priority patent/US20030036149A1/en
Priority to US10/187,600 priority patent/US20030036143A1/en
Priority to US10/187,743 priority patent/US20030036148A1/en
Priority to US10/188,773 priority patent/US20030036159A1/en
Priority to US10/187,754 priority patent/US20030036153A1/en
Priority to US10/188,781 priority patent/US20030036160A1/en
Priority to US10/188,774 priority patent/US20030040074A1/en
Priority to US10/187,741 priority patent/US20030036147A1/en
Priority to US10/188,775 priority patent/US20030040075A1/en
Priority to US10/187,596 priority patent/US20030032136A1/en
Priority to US10/187,745 priority patent/US7250490B2/en
Priority to US10/192,010 priority patent/US20030044932A1/en
Priority to US10/194,461 priority patent/US20030054459A1/en
Priority to US10/194,423 priority patent/US7339025B2/en
Priority to US10/194,361 priority patent/US20030036161A1/en
Priority to US10/194,365 priority patent/US7381791B2/en
Priority to US10/194,462 priority patent/US7388073B2/en
Priority to US10/195,893 priority patent/US20030206188A1/en
Priority to US10/195,883 priority patent/US20060073544A1/en
Priority to US10/195,892 priority patent/US7385033B2/en
Priority to US10/195,888 priority patent/US20060073545A1/en
Priority to US10/195,894 priority patent/US20030043176A1/en
Priority to US10/195,889 priority patent/US7534856B2/en
Priority to US10/195,897 priority patent/US20030036164A1/en
Priority to US10/195,901 priority patent/US20030036165A1/en
Priority to US10/195,902 priority patent/US20030038826A1/en
Priority to US10/196,743 priority patent/US20030038827A1/en
Priority to US10/196,762 priority patent/US20030040078A1/en
Priority to US10/196,759 priority patent/US20030071835A1/en
Priority to US10/196,756 priority patent/US7304145B2/en
Priority to US10/196,760 priority patent/US7408034B2/en
Priority to US10/196,745 priority patent/US7423120B2/en
Priority to US10/197,942 priority patent/US20030175882A1/en
Priority to US10/199,464 priority patent/US20030032140A1/en
Priority to US10/198,768 priority patent/US20030049756A1/en
Priority to US10/199,316 priority patent/US20030068726A1/en
Priority to US10/199,462 priority patent/US20030054468A1/en
Priority to US10/205,904 priority patent/US20030073813A1/en
Priority to US10/429,667 priority patent/US20030207401A1/en
Priority to US10/735,014 priority patent/US7442772B2/en
Priority to US10/797,366 priority patent/US7378507B2/en
Priority to US10/805,667 priority patent/US20050037458A1/en
Priority to US10/943,353 priority patent/US20050059115A1/en
Priority to US11/100,159 priority patent/US7425613B2/en
Priority to US11/189,442 priority patent/US20060246465A1/en
Priority to JP2005264293A priority patent/JP2006068016A/en
Priority to JP2005264294A priority patent/JP2006081548A/en
Priority to US11/296,155 priority patent/US20060127983A1/en
Priority to US11/323,117 priority patent/US20070092941A1/en
Priority to US11/341,175 priority patent/US7468427B2/en
Priority to US11/518,609 priority patent/US20070077623A1/en
Priority to JP2006266069A priority patent/JP2007049999A/en
Priority to JP2007083124A priority patent/JP2007238619A/en
Priority to US11/786,466 priority patent/US20080182275A1/en
Priority to JP2007326609A priority patent/JP2008148701A/en
Priority to JP2007326613A priority patent/JP2008161190A/en
Priority to JP2007326424A priority patent/JP2008167749A/en
Priority to JP2007325484A priority patent/JP2008148699A/en
Priority to US12/079,178 priority patent/US20090170158A1/en
Priority to JP2008153789A priority patent/JP2008301822A/en
Priority to JP2008194721A priority patent/JP2009039118A/en
Priority to JP2008194678A priority patent/JP2009039117A/en
Priority to JP2008194764A priority patent/JP2009039119A/en
Priority to JP2011173336A priority patent/JP6033531B2/en
Priority to JP2014187275A priority patent/JP2015037408A/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578—NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/16—Ophthalmology
    • G01N2800/164—Retinal disorders, e.g. retinopathy

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to the use of PRO polypeptides to delay, prevent or rescue retinal neurons, including photoreceptors, other retinal cells or supportive cells (e.g. Müller cells or RPE cells) from injury and/or death. Conditions comprehended by treatment of the present PRO polypeptides (including variants), antibodies, compositions and articles of manufacture include: retinal detachment, age-related and other maculopathies, photic retinopathies, surgery-induced retinopathies (either mechanically or light-induced), toxic retinopathies including those resulting from foreign bodies in the eye, diabetic retinopathies, retinopathy of prematurity, viral retinopathies such as CMV or HIV retinopathy related to AIDS, uveitis, ischemic retinopathies due to venous or arterial occlusion or other vascular disorder, retinopathies due to trauma or penetrating lesions of the eye, peripheral vitreoretinopathy, and inherited retinal degenerations. Exemplary retinal degenerations include e.g., hereditary spastic paraplegia with retinal degeneration (Kjellin and Barnard-Scholz syndromes), retinitis pigmentosa, Stargardt disease, Usher syndrome (retinitis pigmentosa with congenital hearing loss), and Refsum syndrome (retinitis pigmentosa, hereditary hearing loss, and polyneuropathy). Additional disorders which result in death of retinal neurons include, retinal tears, detachment of the retina and pigment epithelium, degenerative myopia, acute retinal necrosis syndrome (ARN), traumatic chorioretinopathies or contusion (Purtscher's Retinopathy) and edema.

Description

METHOD OF PREVENTING THE INJURY OR DEATH OF RETINAL CELLS AND TREATING
OCULAR DISEASES
BACKGROUND
The present invention relates to a method of promoting retinal cell survival as well as preventing retinal cell degradation and to the treatment of diseases or conditions which are characterized by retinal neuron death.
The retina is the light-sensitive portion of the eye. The retina contains the cones and rods (collectively "photoreceptors"), the photosensitive cells. The rods contain rhodopsin, the rod photopigment, and the cones contain 3 distinct photopigments, which respond to light and transmit signals through successive neurons to ultimately trigger a neural discharge in the output cells of the retina, the ganglion cells. The signal is carried by the optic nerve to the visual cortex where it is registered as a visual stimulus.
In the center of the retina is the macula lutea, which is about 1/3 to 1/2 cm in diameter. The macula provides detailed vision, particularly in the center (the fovea), because the cones are higher in density. Blood vessels, ganglion cells, inner nuclear layer and cells, and the plexiform layers are all displaced to one side (rather than resting above the ones), thereby allowing light a more direct path to the cones.
Under the retina is the choroid, a collection of blood vessels embedded within a fibrous tissue, and the pigmented epithelium (PE), which overlays the choroid layer. The choroidal blood vessels provide nutrition to the retina (particularly its visual cells). The choroid and PE are found at the posterior of the eye.
The retinal pigment epithelial (RPE) cells, which make up the PE, produce, store and transport a variety of factors that are responsible for the normal function and survival of photoreceptors. RPE are multifunctional cells that transport metabolites to the photoreceptors from their blood supply, the chorio capillaris of the eye. The RPE cells also function to recycle vitamin A as it moves between the photoreceptors and the RPE during light and dark adaptation. RPE cells also function as macrophages, phagocytizing the rhythmically-shed tips of the outer segments of rods and cones, which are produced in the normal course of cell physiology. Various ions, proteins and water move between the RPE cells and the interphotoreceptor space, and these molecules ultimately effect the metabolism and viability of the photoreceptors.
The Miiller cell is the most prominent glial cell within the retina, and could also be important for maintaining the viability of visual cells. Miiller cells traverse the entire retina in a radial direction from the ganglion cells to the external limiting membrane, a photoreceptor-photoreceptor and Miiller cell- photoreceptor contact point. In addition to providing structural support, Miiller cells regulate the control of ionic concentrations, degradation of neurotransmitter, removal of certain metabolites and may be a source of important factors that promote the normal differentiation of photoreceptor cells. Kljavin and Reh (1991), J. Nettroscience jj.: 2985-2994. Although a search for defects in Miiller cells has not specifically been examined, any disease or injury affecting their normal function most likely would have a dramatic influence on the health of rods and cones. Finally, the death of rod photoreceptors may influence the viability of cones. One common feature in degenerations involving mutations in rod specific genes (i.e., rhodopsin) is that cones also eventually die. The reason for the loss of cones has not been determined, although it has been suggested that dying rods may release endotoxins. Bird (1992), Opthal. Pediatric. Genet. J_3: 57-66. Diseases or injury to the retina can lead to blindness if retinal cells are injured or killed. The photoreceptor cells are particularly susceptible to injury since they are often the first cells to degenerate or suffer damage as a result of a traumatizing event or condition. Hereditary defects in specific photoreceptor genes, retinal detachment, circulatory disorders, overexposure to light, toxic effects to drugs and nutritional deficiencies are among the wide array of causes that can result in the death of photoreceptor cells. Developmental and hereditary diseases of the retina account for around 20 percent of all legal blindness in the United States. Report of the Retinal and Choroidal Panel: Vision Research - A National Plan 1983- 1987, vol. 2, part I, summary page 2. For example, retinitis pigmentosa (RP), a genetic based progressive disease is characterized by incremental loss of peripheral vision and night blindness, which is due in large part to the loss of photoreceptor cells. RP is a group of hereditary diseases and presently afflicts about one in 3000 persons worldwide. Wong, F. (1995) Arch. Ophthalmol. 113: 1245-47. Total blindness is the usual outcome in more progressive stages of this disease. Macular degeneration, another major cause of blindness, is a complex group of disorders that affects the central or predominantly cone portion of the retina. Cones are primarily responsible for acute vision. Diabetic retinopathy, a frequent complication in individuals with diabetes mellitus, is estimated to be the fifth leading cause of new blindness. However, it is the second leading cause of blindness among individuals of 45-74 years of age. Moreover, these problems are only expected to get worse as the general population ages.
Photoreceptor degeneration may also occur as a result of overexposure to light, various environmental trauma or by any pathological condition characterized by death or injury of retinal neurons or photoreceptors. Photoreceptor loss may also be influenced by cellular or extracellular retinal components. The primary example of extracellular stimulus is related to the close association between the pigment epithelium (PE) and the photoreceptor cells. As mentioned previously, the PE transports metabolites to and from the photoreceptors as well as removes discarded cellular material. Retinal detachment, which involves the separation of the neural retina from the PE leads to photoreceptor death. Furthermore, the degree of cell loss is dependent upon the duration of the separation. Gouras et al.fOVS Υ 3167-3174 (1991).
Additionally, diseases of the PE can lead to photoreceptor cell loss. The primary example of this is the Royal College of Surgeons (RCS) rat, which has an inherited retinal dystrophy due to a defect in the PE, resulting in photoreceptor cell death during the normal course of the animal's life. Mullen & La Vail, Science 192: 799-801 (1976). In this animal, the PE are unable to phagocytize outersegment debris which accumulates between the photoreceptor cells and the PE, and as a result, provide a useful model system to study the role of trophic factors on the retina. A delay of photoreceptor death is obtained through the proximal placement of normal PE cells both in experimental chimeras, Mullen & La Vail, supra and by transplantation of PE from healthy animals. Li & Turner, Exp. Eye Res. 47: 911-917 (1988); Sheedlo et al, Int. Rev. Cytol. 138: 1-49 (1992); Lavail et al., Exp. Eye Res. 55: 555-562 (1992); Lavail et al., PNAS 89: 11249-11253 (1992). In all of these experiments, the "rescue" extended beyond the boundaries of the normal PE cells, and suggests the presence of difussible trophic factor(s) produced by the PE cells.
Another useful animal model is the albino rat. In this animal, normal illumination levels of light, if continuous, can cause complete degeneration of photoreceptors. Results obtained using such rats as a model to identify survival enhancing factors appear to correlate well with data obtained using RCS rats. Moreover, different factors can be compared and complications can be assessed more quickly in the light damage model than can be assessed by testing factors in models which are based on the slowly evolving dystrophy of the RCS rat. Using albino rats, it has been determined that a number of agents, when administered systemically
(intraperitoneally) can be used to ameliorate retinal cell death or injury caused by exposure to light. In general, exposure to light generates oxygen free radicals and lipid peroxidation products. Accordingly, compounds that act as antioxidants or as scavengers of oxygen free radicals reduce photoreceptor degeneration. Agents such as ascorbate, Organisciak et al., Invest. Opthal. & Vis. Sci. 26: 1580-1588 (1985), flunarizine, Edward et al, Arch. Ophthalmol. 109: 554-562 (1991), and di ethylthiourea, Lam et al., Arch. Opthal. 108:1751 -1757 (1990) have been used to ameliorate the damaging effects of constant light. There is no evidence, however, that these compounds will act to ameliorate other forms of photoreceptor degeneration and their administration can potentiate harmful side effects. Further, these studies are limited because they utilize systemic delivery, which does not provide an adequate means of assessing the effectiveness of a particular factor. As a result, it is nearly impossible to assess the amount of agent that actually reaches the retina. A large amount of agent must be injected to attain a sufficient concentration at the site of the retina. In addition, systemic toxic effects may result from the injection of certain agents.
Traditional approaches to treating the loss of vision due to photoreceptor cell death has taken at least two routes: (1) replacing the defective cells by physical transplantation; and (2) slowing, arresting or preventing the process of degeneration. The transplantation of healthy pigment epithelium cells into a degenerating retina or one which has defective epithelium cells can rescue photoreceptor cells from dying. Sheedlo et al., Int. Rev. Cytol. 138: 1-49 (1992); Lavail et al., Exp. Eye Res. 55: 555-562 (1992); and Lavail et al., PNAS 89: 11249-11253 (1992) PE transplants in humans have been attempted, but the results have been less than satisfactory. Peyman et al., Opthal. Surg. 22: 102-108 (1991 ). More promising, but as yet unproven is the transfer of embryonic retina containing mostly undifferentiated progenitor cells, which can differentiate in response to environmental cues into appropriate missing cell types. Cepko, Ann. Rev. Neurosci. 12: 47-65 (1989). In conclusion, therapy via functional integration of transplanted retinal cells into a human host retinas remain unproven. Other strategies have focused on "rescuing" or slowing the loss of visual cells. These techniques include corrective gene therapy, limiting the exposure to normal light during disease, vitamin A supplemented diets and the administration of growth factors to damaged or degenerating eyes. However, these treatment schemes have several limitations. For example, gene therapy or the insertion of a replacement allele into the cells carrying the known mutation may prove problematic. Milam, Curr. Opin. Neurobiology 3: 797-804 (1993). Since rods and cones are somewhat inaccessible, it might be difficult to deliver replacement genes to them. Moreover, the use of retroviral vectors for insertion of replacement genes is limited to dividing cells, such as cultured PE, whereas post-mitotic neurons, e.g. photoreceptors, will require other viral vectors such as HSV (Herpes simplex virus) for effective delivery. Finally, gene replacement may not correct a disease where the mutant gene product is deleterious to the cell, but may be more useful for correcting defects due to the loss-of-function of a gene product, as is found in most recessive disorders.
Limiting light exposure, a low technology conventional approach to attenuating vision loss, typically using such approaches as eye-patches, dark goggles, etc. is impractical, since the practical effect of the treatment is the same as the disease itself: blindness and inability to detect light.
Vitamin A has been observed to halt the decline of retinal function by over 20% as administered over the course of 4-6 years in the progression of patients with retinitis pigmentosa (RP). Berson, E.L. et al., Arch Ophthalmol. I l l : 761-772 (1993). While this study did indicate a potential lengthening of years of useful vision, several criticisms of vitamin A therapy exist: (1) the mechanism by which vitamin A (and even vitamin E) alter the progression of RP is unknown; (2) it is not known whether or not patients with different genetic forms of RP will respond to vitamin A therapy; (3) it is not apparent whether or not quantifiable measurements of visual function (i.e., perimetry and visual acuity) revealed any significant benefit from vitamin A therapy; and (4) long term ingestion of vitamin A may have detrimental side effects in other organ systems.
A number of agents, when administered systemically (intraperitoneally) can be used to ameliorate retinal cell death or injury caused by exposure to light. In general, exposure to light generates oxygen free radicals and lipid peroxidation products. It has been suggested that genetically defective photoreceptors are abnormally sensitive to photooxidation from light levels as encountered normally in the environment. Hargrave, PA. & O'Brien, PJ., Retinal Degenerations, Anderson RE et al. eds., Boca Raton, FL, CRC Press, p. 517-528 (1991). Compounds that act as antioxidants or as scavengers of oxygen free radicals reduce photoreceptor degeneration. Anti-oxidants or calcium overload blockers (e.g. flunarizine) have been reported to prevent degeneration of normal photoreceptors after exposure to high light levels. Rosner et al, Arch. Ophthalmol HO: 857-861 (1992); Li et al. Exp. Eye Res. 56: 71-78 (1993). Additional success in reducing photoreceptor degeneration has been observed through administration of ascorbate (Organisciak et al., Invest. Ophthal. & Vis. Sci. 26: 1580-1588 (1985)), flunarizine (Edward et al., Arch. Ophthalmol. 109: 554-562 (1991)), and dimethylthiourea (Lam et al., Arch. Ophthal. 108: 1751-1757 (1990)). However, there is no evidence that administration of these compounds will reduce photoreceptor degeneration induced by other than intense light exposure. Moreover, there is great concern that their administration can generate potentially harmful side effects. As a result, the search continues for factors which can somehow protect photoreceptors or even promote their regeneration after light-induced damage.
A particular area of interest is the administration of growth factors. Growth factors have been found to participate in diverse roles such as neuronal differentiation, transmitter specificity, regulation of programmed cell death, and neurite growth in several regions of the central nervous system. However, only recently has their role been studied during retinal development and disease. An early study indicating that diffusible growth factors can rescue photoreceptor cells from dying was based on a chimeric rat constructed to contain both normal and RCS pigment epithelial cells. The animals were produced by fusing blastula from both normal and RCS rat embryos. Mullen and La Vail, supra. In the retina of these chimeras, photoreceptor cells adjacent to RCS PE showed degeneration, and those that were lying next to normal PE were healthy. However, photoreceptor cells that were lying just beyond the immediate contact site of normal PE also appeared healthy, suggesting that photoreceptor-PE contact was not needed, and that normal PE were secreting a putative survival promoting factor. Among the best characterized growth factors in the retina are the acidic and basic fibroblast growth factors (aFGF and bFGF). FGF can be detected through immunohistochemical, biochemical or molecular approaches on a variety of retinal cells including PE, photoreceptor cells and the interphotoreceptor cell matrix (IPM), and a collection of extracellular matrix molecules surrounding photoreceptor cells. Jacquemin et al, Neurosci. Lett. 116: 23-28 (1990); Caruelle et al., J. Cell Biol. 39: 117-128 (1989); Hageman et al, PNAS 88: 6706-6710 (1991); Connolly et al., IOVS 32 (suppl.): 754 (1991). Intravitreal injection of basic fibroblast growth factor (bFGF) in the RCS rat or rats with light damaged retina prevents photoreceptor cell degeneration for several month, even as outersegment debris accumulates. Faktorovich et al., Nature 347: 83-86 (1990). Similar results have been seen when bFGF is injected into the subretinal space, the area between the photoreceptors and the PE. However, even sham operations, or injections of phosphate buffered saline (PBS) in both the RCS rat and light damaged retina can delay photoreceptor cell death.
However, the rescue effect is small and localized to the needle track, and differs quantitatively from the effect obtained from bFGF. Faktrorovich et al., supra; Silverman and Hughes, Curr. Eye Res. 9: 183-191 (1990); Sheedlo H.J. et al., Int. Rev. Cyto. 138: 1-49 (1992). In these experiments it is likely that various growth factors derived from damaged retinal tissues or macrophages present in the damaged area were locally released. Sheedlo et al., supra.; Silverman and Hughes, supra. Macrophages themselves are known to produce many different growth factors or cytokines, some of which could have photoreceptor survival activity. Rappolee and Werb, Curr. Top. Microbiol. Immunol. 181 : 87-140 (1992).
Various agents disclosed to have survival-enhancing and/or growth activity on retinal neurons are described in certain issued patents and pending patent applications. These include Transforming Growth Factor-β (TGF-β) (WO 94/01 124), brain derived neurotrophic factors (BDNF) (U.S.P. 5,180,820) (U.S.P.
5,438,121) and (WO 91/03568), neurotrophin-4 ( T-4) (WO 93/25684), and insulin-like growth factors (IGF) (WO 93/08826).
Other experiments have shown that intravitreal injections of human subretinal fluid as well as other growth factors can rescue dying photoreceptor cells. For example, one recent study tested eight different factors injected into the retina of rats exposed to constant high intensity light, all showing the ability to delay the degeneration of photoreceptor cells. These include FGF (both acidic and basic forms), brain derived neurotrophic factor (BDNF), ciliary neurotrophic factor (CNTF), and interleukin 1 (IL-1 ). Neurotrophin 3 (NT 3), insulin-like growth factor II (IGF-II), Transforming Growth Factor beta (TGF-β) and the tumor necrosis factors alpha and beta (TNF-α, TNF-β) also showed survival activity, but to a much lesser degree than the other factors. NGF has been reported to reduce the incidence of apoptosis in diabetic rats in addition to minimizing pericyte loss and acellular occluded capillaries, conditions associated with diabetic retinopathy. Ham es, HP et al., Molecular Med. 1(5): 527-534 (1995). However, while it does appear that growth factors can enhance survival of photoreceptors, some of these factors may promote detrimental side effects. For example, injections of bFGF results in an increased incidence of macrophages and cataracts. In addition, bFGF is mitogenic for PE, Mϋller cells and retinal vascular cells. Faktorovich et al., supra.; La Vail et al., supra. As a result, suitable growth factors which will not only promote the survival of retinal cells, but lack undesired side effects have yet to be discovered.
SUMMARY A. Embodiments
The present invention relates to a method of delaying, preventing or rescuing photoreceptor cells from injury or death in a mammal comprising administrating a therapeutically effective amount of a PRO polypeptide to said mammal.
In another embodiment, the present invention relates to the use of PRO polypeptides to delay, prevent or rescue retinal cells (including retinal neurons; e.g., photoreceptor cells, other retinal neurons, and supportive cells from injury or death. Other retinal neurons include, but are not limited to retinal ganglion cells, displaced retinal ganglion cells, amacrine cells, displaced amacrine cells, horizontal and bipolar neurons. Supportive cells include, e.g., Miiller cells or RPE cells. Additionally, the invention relates to the use of PRO to stimulate the regeneration of such cells. In one aspect, the PRO polypeptide is an active polypetide which is at least 80% identical to a native sequence PRO molecule.
In yet another embodiment, the present invention relates to the use of PRO polypeptides to treat any condition which results in injury or death or photoreceptor cells or other retinal cells. Examples of such conditions include: retinal detachment; age-related and other maculopathies; photic retinopathies, surgery- induced retinopathies (either mechanically or light-induced), toxic retinopathies including those resulting from foreign bodies in the eye; diabetic retinopathies; retinopathy of prematurity; viral retinopathies such as CMV or HIV retinopathy related to AIDS; uveitis; ischemic retinopathies due to venous or arterial occlusion or other vascular disorder; retinopathies due to trauma or penetrating lesions of the eye; peripheral vitreoretinopathy; and inherited retinal degenerations. Exemplery retinal degenerations include e.g., hereditary spastic paraplegia with retinal degeneration (Kjellin and Barnard-Scholtz syndromes), retinitis pigmentosa, Stargardt disease, Usher syndrome (retinitis pigmentosa with congenital hearing loss), and Refsum syndrome (retinitis pigmentosa, hereditary hearing loss and polyneuropathy). Additional disorders which result in death or retinal neurons include, retinal tears, detachment of the retina and pigment epithelium, degenerative myopia, acute retinal necrosis syndrome (ARN), traumatic chorioretinopathies or contusion (Purtscher's Retinopathy) and edema.
In yet another embodiment, the present invention provides a method of delaying, preventing or rescuing retinal neurons (e.g., photoreceptors) or other retinal cells from injury or death resulting from disease or injury in a mammal comprising administrating a composition comprising a PRO polypeptide and a pharmaceutically-acceptable carrier to said mammal. In one aspect, the composition comprises a therapeutically effective amount of PRO polypeptide. In another aspect, the composition comprises a further reactive ingredient, which may, for example, be a neuronal survival agent. Preferably the composition is sterile. In yet a further aspect, the method comprising contacting said retinal neurons with a therapeutically effective amount of a composition of PRO polypeptide and a pharmaceutically-acceptable carrier. The contact may be effected intraocularly, intravitreally, injection into the subretinal space or by means of an implant. In one aspect, the composition comprises a therapeutically effective amount of PRO. In another, the composition comprises a further active ingredient, which may, for example, be a neuronal survival agent.
In yet another embodiment, the present invention provides articles of manufacture and kits that comprise a PRO polypeptide. The articles of manufacture comprise a container, an instruction on the container, and a composition contained within the container. The instruction on the container may indicate that the compositions can be used to delay, prevent or rescue retinal neurons or other retinal cells from injury or death. The composition may contain an active agent, the active agent may comprise a PRO polypeptide.
In yet another embodiment, the present invention provides a method for delaying or preventing the death of retinal cells in a mammal comprising administering a therapeutically effective amount of: (a) a PRO polypeptide or (b) an agonist of a PRO polypeptide, wherein the death of retinal cells in the mammal is reduced or prevented.
In yet another embodiment, the present invention provides a method for rescuing or preventing the death or injury to retinal cells in a mammal comprising administering a therapeutically effective amount of: (a) a PRO polypeptide; or (b) an agonist of a PRO polypeptide, wherein the death and/or injury to said cells is prevented or reduced. In yet another embodiment, the present invention provides a method for delaying or preventing the death of retinal neurons comprising contacting said neurons with an effective amount of a PR0175, PRO220, PR0216, PRO306, PR0322, PR0346, PRO840, PR0826, PR0828, PRO1068 or PROH32 polypeptide.
In yet another aspect, the present invention provides a method for delaying or preventing the death of photoreceptor cells comprising contacting said cells with an effective amount of a PR0175, PR0216,
PRO220 or PRO243.
In yet another embodiment, the present invention is directed to a composition of matter useful for the production of a medicament useful for delaying, preventing or rescuing retinal cells (e.g., retinal neurons, photoreceptor cells) from injury or death, wherein the composition comprises a PRO polypeptide.
B. Additional Embodiments
In other embodiments of the present invention, the invention provides vectors comprising DNA encoding any of the herein described polypeptides. Host cell comprising any such vector are also provided. By way of example, the host cells may be CHO cells, E. coli, or yeast. A process for producing any of the herein described polypeptides is further provided and comprises culturing host cells under conditions suitable for expression of the desired polypeptide and recovering the desired polypeptide from the cell culture.
In other embodiments, the invention provides chimeric molecules comprising any of the herein described polypeptides fused to a heterologous polypeptide or amino acid sequence. Example of such chimeric molecules comprise any of the herein described polypeptides fused to an epitope tag sequence or a Fc region of an immunoglobulin.
In another embodiment, the invention provides an antibody which specifically binds to any of the above or below described polypeptides. Optionally, the antibody is a monoclonal antibody, humanized antibody, antibody fragment or single-chain antibody.
In yet other embodiments, the invention provides oligonucleotide probes useful for isolating genomic and cDNA nucleotide sequences or as antisense probes, wherein those probes may be derived from any of the above or below described nucleotide sequences.
In other embodiments, the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence that encodes a PRO polypeptide.
In one aspect, the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about
95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity and alternatively at least about 99% nucleic acid sequence identity to (a) a DNA molecule encoding a PRO polypeptide having a full-length amino acid sequence as disclosed herein, an amino acid sequence lacking the signal peptide as disclosed herein, an extracellular domain of a transmembrane protein, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of the full- length amino acid sequence as disclosed herein, or (b) the complement of the DNA molecule of (a).
In other aspects, the isolated nucleic acid molecule comprises a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity and alternatively at least about 99% nucleic acid sequence identity to (a) a DNA molecule comprising the coding sequence of a full-length PRO polypeptide cDNA as disclosed herein, the coding sequence of a PRO polypeptide lacking the signal peptide as disclosed herein, the coding sequence of an extracellular domain of a transmembrane PRO polypeptide, with or without the signal peptide, as disclosed herein or the coding sequence of any other specifically defined fragment of the full-length amino acid sequence as disclosed herein, or (b) the complement of the DNA molecule of (a).
In a further aspect, the invention concerns an isolated nucleic acid molecule comprising a nucleotide sequence having at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83% nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about
86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88% nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity and alternatively at least about 99% nucleic acid sequence identity to (a) a DNA molecule that encodes the same mature polypeptide encoded by any of the human protein cDNAs deposited with the ATCC as disclosed herein, or (b) the complement of the DNA molecule of (a).
Another aspect the invention provides an isolated nucleic acid molecule comprising a nucleotide sequence encoding a PRO polypeptide which is either transmembrane domain-deleted or transmembrane domain-inactivated, or is complementary to such encoding nucleotide sequence, wherein the transmembrane domain(s) of such polypeptide are disclosed herein. Therefore, soluble extracellular domains of the herein described PRO polypeptides are contemplated.
Another embodiment is directed to fragments of a PRO polypeptide coding sequence, or the complement thereof, that may find use as, for example, hybridization probes, for encoding fragments of a PRO polypeptide that may optionally encode a polypeptide comprising a binding site for an anti-PRO antibody or as antisense oligonucleotide probes. Such nucleic acid fragments are usually at least about 20 nucleotides in length, alternatively at least about 30 nucleotides in length, alternatively at least about 40 nucleotides in length, alternatively at least about 50 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 70 nucleotides in length, alternatively at least about 80 nucleotides in length, alternatively at least about 90 nucleotides in length, alternatively at least about 100 nucleotides in length, alternatively at least about 110 nucleotides in length, alternatively at least about 120 nucleotides in length, alternatively at least about 130 nucleotides in length, alternatively at least about 140 nucleotides in length, alternatively at least about 150 nucleotides in length, alternatively at least about 160 nucleotides in length, alternatively at least about 170 nucleotides in length, alternatively at least about 180 nucleotides in length, alternatively at least about 190 nucleotides in length, alternatively at least about 200 nucleotides in length, alternatively at least about 250 nucleotides in length, alternatively at least about 300 nucleotides in length, alternatively at least about 350 nucleotides in length, alternatively at least about 400 nucleotides in length, alternatively at least about 450 nucleotides in length, alternatively at least about 500 nucleotides in length, alternatively at least about 600 nucleotides in length, alternatively at least about 700 nucleotides in length, alternatively at least about 800 nucleotides in length, alternatively at least about 900 nucleotides in length and alternatively at least about 1000 nucleotides in length, wherein in this context the term "about" means the referenced nucleotide sequence length plus or minus 10% of that referenced length. It is noted that novel fragments of a PRO polypeptide-encoding nucleotide sequence may be determined in a routine manner by aligning the PRO polypeptide-encoding nucleotide sequence with other known nucleotide sequences using any of a number of well known sequence alignment programs and determining which PRO polypeptide-encoding nucleotide sequence fragment(s) are novel. All of such PRO polypeptide-encoding nucleotide sequences are contemplated herein. Also contemplated are the PRO polypeptide fragments encoded by these nucleotide molecule fragments, preferably those PRO polypeptide fragments that comprise a binding site for an anti-PRO antibody.
In another embodiment, the invention provides isolated PRO polypeptide encoded by any of the isolated nucleic acid sequences hereinabove identified.
In a certain aspect, the invention concerns an isolated PRO polypeptide, comprising an amino acid sequence having at least about 80% amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91% amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid sequence identity and alternatively at least about 99% amino acid sequence identity to a PRO polypeptide having a full-length amino acid sequence as disclosed herein, an amino acid sequence lacking the signal peptide as disclosed herein, an extracellular domain of a transmembrane protein, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of the full-length amino acid sequence as disclosed herein.
In a further aspect, the invention concerns an isolated PRO polypeptide comprising an amino acid sequence having at least about 80% amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84% amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91% amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94% amino acid sequence identity, alternatively at least about 95% amino acid sequence identity, alternatively at least about 96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid sequence identity and alternatively at least about 99% amino acid sequence identity to an amino acid sequence encoded by any of the human protein cDNAs deposited with the ATCC as disclosed herein.
In a specific aspect, the invention provides an isolated PRO polypeptide without the N-terminal signal sequence and/or the initiating methionine and is encoded by a nucleotide sequence that encodes such an amino acid sequence as hereinbefore described. Processes for producing the same are also herein described, wherein those processes comprise culturing a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide and recovering the PRO polypeptide from the cell culture.
Another aspect the invention provides an isolated PRO polypeptide which is either transmembrane domain-deleted or transmembrane domain-inactivated. Processes for producing the same are also herein described, wherein those processes comprise culturing a host cell comprising a vector which comprises the appropriate encoding nucleic acid molecule under conditions suitable for expression of the PRO polypeptide and recovering the PRO polypeptide from the cell culture.
In yet another embodiment, the invention concerns agonists and antagonists of a native PRO polypeptide as defined herein. In a particular embodiment, the agonist or antagonist is an anti-PRO antibody or a small molecule.
In a further embodiment, the invention concerns a method of identifying agonists or antagonists to a PRO polypeptide which comprise contacting the PRO polypeptide with a candidate molecule and monitoring a biological activity mediated by said PRO polypeptide. Preferably, the PRO polypeptide is a native PRO polypeptide.
In a still further embodiment, the invention concerns a composition of matter comprising a PRO polypeptide, or an agonist or antagonist of a PRO polypeptide as herein described, or an anti-PRO antibody, in combination with a carrier. Optionally, the carrier is a pharmaceutically acceptable carrier.
Another embodiment of the present invention is directed to the use of a PRO polypeptide, or an agonist or antagonist thereof as hereinbefore described, or an anti-PRO antibody, for the preparation of a medicament useful in the treatment of a condition which is responsive to the PRO polypeptide, an agonist or antagonist thereof or an anti-PRO antibody.
Other aspects of the invention will become apparent from the following detailed description and the claims. Brief Description of the Drawings
Figure 1 shows DNA19355-1150 (SEQ ID NO:l ).
Figure 2 shows a native sequence PR0175 polypeptide (SEQ ID NO:2).
Figure 3 shows DNA32298-1132 (SEQ ID NO:7). Figure 4 shows a native sequence PRO220 polypeptide (SEQ ID NO:8).
Figure 5 shows DNA33087-1158 (SEQ ID NO:9).
Figure 6 shows a native sequence PR0216 polypeptide (SEQ ID NO: 10).
Figure 7 is a pictoral representation of the genomic clones used in the cloning of DNA35917 (SEQ ID
NO: 14) described in Example 1. Figure 8 shows DNA35917-1207 (SEQ ID NO: 14).
Figure 9 shows a native sequence PR0243 polypeptide (SEQ ID NO: 15).
Figure 10 shows DNA39984-1221 (SEQ ID NO:27).
Figure 11 shows a native sequence PRO306 polypeptide (SEQ ID NO:28).
Figure 12 shows DNA44167-1243 (SEQ ID NO:30). Figure 13 shows a native sequence PR0346 polypeptide (SEQ ID NO:31).
Figure 14 shows DNA48336-1309 (SEQ ID NO:41).
Figure 15 shows a native sequence PR0322 polypeptide (SEQ ID NO:42).
Figure 16 shows DNA49142-1430 (SEQ ID NO:43).
Figure 17 shows a native sequence PR0536 polypeptide (SEQ ID NO:46). Figure 18 shows DNA52192- 1369 (SEQ ID NO:49).
Figure 19 shows a native sequence PR0943 polypeptide (SEQ ID NO:48).
Figure 20 shows DNA53987-1438 (SEQ ID NO:53).
Figure 21 shows a native sequence PRO840 polypeptide (SEQ ID NO:54).
Figure 22 shows DNA57037-1444 (SEQ ID NO:59). Figure 23 shows a native sequence PR0828 polypeptide (SEQ ID NO:60).
Figure 24 shows DNA57694-1341 (SEQ ID NO:64).
Figure 25 shows a native sequence PR0826 polypeptide (SEQ ID NO:65).
Figure 26 shows DNA59214-1449 (SEQ ID NO:66).
Figure 27 shows a native sequence PRO1068 polypeptide (SEQ ID NO:70). Figure 28 shows DNA59767-1489 (SEQ ID NO:75).
Figure 29 shows a native sequence PROl 132 polypeptide (SEQ ID NO:76).
Detailed Description of the Invention I. Definitions: The terms employed throughout this application are to be construed with the normal meaning to those of ordinary skill in the art. However, applicants desire that the following terms be construed with the particular definitions as described. All references mentioned in this application should be inteφreted and read as being incoφorated by reference. The terms "protein" or "polypeptide" are intended to be used interchangeably. They refer to a chain of two (2) or more amino acids which are linked together with peptide or amide bonds, regardless of post-translational modification (e.g., glycosylation or phosphorylation). The polypeptides of this invention may comprise more than one subunit, where each subunit is encoded by a separate DNA sequence. "Active" or "activity" for the puφoses herein refers to form(s) of PRO polypeptide which retain a biological and/or an immunological activity of native or naturally-occurring PRO wherein "biological" activity refers to a biological function (either inhibitory or stimulatory) caused by a native or naturally- occurring PRO, respectively, other than the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally-occurring PRO. An "immunological" activity refers to the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally-occurring PRO polypeptide. Preferably, a biological activity of a PRO polypeptide is the promotion of the survival of, or the delaying or prevention of injury and/or death of retinal cells, e.g., photoreceptor cells or other supportive cells.
"Promoting the survival of, or the "delaying or preventing of injury and or death of retinal cells", e.g., photoreceptor cells or other supportive cells which occurs as a result of the method of the invention refers to the ability to keep such retinal cells viable or alive for a period of time greater than is observed without application of said method. Retinal cell death can result from injury, disease or even aging. Retinal cell injury can also result in degradated cells or those having a limited capacity for normal physiological operation. The effect can be measured either in vitro with isolated retinal cells or in vivo with subjects having compromised retinal cells due to injury or disease.
An "ocular disorder" is any condition that would benefit from treatment with the PRO polypeptides. This includes both chronic and acute disorders, as well as those pathological conditions which predispose the mammal to the disorder in question. Non-limiting examples of disorders to be treated herein include any condition which results in injury or death of photoreceptor or other retinal cells. Examples of conditions include: retinal detachment, age-related and other maculopathies, photic retinopathies, surgery- induced retinopathies (either mechanically or light-induced), toxic retinopathies including those resulting from foreign bodies in the eye, diabetic retinopathies, retinopathy of prematurity, viral retinopathies such as CMV or HIV retinopathy related to AIDS, uveitis, ischemic retinopathies due to venous or arterial occlusion or other vascular disorder, retinopathies due to trauma or penetrating lesions of the eye, peripheral vitreoretinopathy, and inherited retinal degenerations. Exemplary retinal degenerations include e.g., hereditary spastic paraplegia with retinal degeneration (Kjellin and Barnard-Scholz syndromes), retinitis pigmentosa, Stargardt disease, Usher's syndrome (retinitis pigmentosa with congenital hearing loss), and Refsum's syndrome (retinitis pigmentosa, hereditary hearing loss, and polyneuropathy). Additional disorders which result in death of retinal neurons include, retinal tears, detachment of the retina and pigment epithelium, degenerative myopia, acute retinal necrosis syndrome (ARN), traumatic chorioretinopathies or contusion (Purtscher's Retinopathy) and edema.
The term "effective amount" is a quantity which is at least the minimum concentration or amount or a PRO polypeptide and/or antagonist/agonist which causes, induces or results in a measurable promotion in the survival or delay or prevention of injury and/or death to retinal cells as measured in an in vitro assay. Furthermore, a "therapeutically effective amount" is the minimum concentration or amount or a PRO polypeptide and/or agonist/antagonist which is required to achieve measurable improvement in the survival of or delay or prevention of injury and or death to retinal cells which is manifested in an ocular disorder.
A "neuronal survival agent" is an agent, other than the PRO polypeptides described herein, which possesses the ability to delay, prevent or rescue retinal cells from injury or death in a readily quantifiable manner when administered either singularly or in combination with another chemical and/or biological molecule. For example, Vitamin A, antioxidants (e.g., Vitamin E, ascorbate, etc.), calcium overload blockers (flunarizine) and growth factors (e.g., aFGF, bFGF, TGB-β, BDNF, NT-4, IGF-I, CNTF, IL-1, NT- 3, IGF-II, TNF-α, TNF-β and NGF.
II. Additional Definitions
The terms "PRO polypeptide" and "PRO" as used herein and when immediately followed by a numerical designation refer to various polypeptides, wherein the complete designation (i.e., PRO/number) refers to specific polypeptide sequences as described herein. The terms "PRO/number polypeptide" and "PRO/number" wherein the term "number" is provided as an actual numerical designation as used herein encompass native sequence polypeptides and polypeptide variants (which are further defined herein). The
PRO polypeptides described herein may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods. The term "PRO polypeptide" refers to each individual PRO/number polypeptide disclosed herein. All disclosures in this specification which refer to the "PRO polypeptide" refer to each of the polypeptides individually as well as jointly. For example, descriptions of the preparation of, purification of, derivation of, formation of antibodies to or against, administration of, compositions containing, treatment of a disease with, etc., pertain to each polypeptide of the invention individually. The term "PRO polypeptide" also includes variants of the PRO/number polypeptides disclosed herein.
A "native sequence PRO polypeptide" comprises a polypeptide having the same amino acid sequence as the corresponding PRO polypeptide derived from nature. Such native sequence PRO polypeptides can be isolated from nature or can be produced by recombinant or synthetic means. The term "native sequence PRO polypeptide" specifically encompasses naturally-occurring truncated or secreted forms of the specific PRO polypeptide (e.g., an extracellular domain sequence), naturally-occurring variant forms (e.g., alternatively spliced forms) and naturally-occurring allelic variants of the polypeptide. In various embodiments of the invention, the native sequence PRO polypeptides disclosed herein are mature or full-length native sequence polypeptides comprising the full-length amino acids sequences shown in the accompanying figures. Start and stop codons are shown in bold font and underlined in the figures. However, while the PRO polypeptide disclosed in the accompanying figures are shown to begin with methionine residues designated herein as amino acid position 1 in the figures, it is conceivable and possible that other methionine residues located either upstream or downstream from the amino acid position 1 in the figures may be employed as the starting amino acid residue for the PRO polypeptides.
The PRO polypeptide "extracellular domain" or "ECD" refers to a form of the PRO polypeptide which is essentially free of the transmembrane and cytoplasmic domains. Ordinarily, a PRO polypeptide ECD will have less than 1% of such transmembrane and/or cytoplasmic domains and preferably, will have less than 0.5%o of such domains. It will be understood that any transmembrane domains identified for the PRO polypeptides of the present invention are identified pursuant to criteria routinely employed in the art for identifying that type of hydrophobic domain. The exact boundaries of a transmembrane domain may vary but most likely by no more than about 5 amino acids at either end of the domain as initially identified herein. Optionally, therefore, an extracellular domain of a PRO polypeptide may contain from about 5 or fewer amino acids on either side of the transmembrane domain/extracellular domain boundary as identified in the Examples or specification and such polypeptides, with or without the associated signal peptide, and nucleic acid encoding them, are comtemplated by the present invention.
The approximate location of the "signal peptides" of the various PRO polypeptides disclosed herein are shown in the present specification and/or the accompanying figures. It is noted, however, that the C-terminal boundary of a signal peptide may vary, but most likely by no more than about 5 amino acids on either side of the signal peptide C-terminal boundary as initially identified herein, wherein the C-terminal boundary of the signal peptide may be identified pursuant to criteria routinely employed in the art for identifying that type of amino acid sequence element (e.g., Nielsen et al., Prot. Eng. 10:1 -6 (1997) and von Heinje et al., Nucl. Acids. Res. 14:4683-4690 (1986)). Moreover, it is also recognized that, in some cases, cleavage of a signal sequence from a secreted polypeptide is not entirely uniform, resulting in more than one secreted species. These mature polypeptides, where the signal peptide is cleaved within no more than about 5 amino acids on either side of the C-terminal boundary of the signal peptide as identified herein, and the polynucleotides encoding them, are contemplated by the present invention.
"PRO polypeptide variant" means an active PRO polypeptide as defined above or below having at least about 80% amino acid sequence identity with a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein. Such PRO polypeptide variants include, for instance, PRO polypeptides wherein one or more amino acid residues are added, or deleted, at the N- or C-terminus of the full-length native amino acid sequence. Ordinarily, a PRO polypeptide variant will have at least about 80%o amino acid sequence identity, alternatively at least about 81% amino acid sequence identity, alternatively at least about 82% amino acid sequence identity, alternatively at least about 83% amino acid sequence identity, alternatively at least about 84%) amino acid sequence identity, alternatively at least about 85% amino acid sequence identity, alternatively at least about 86% amino acid sequence identity, alternatively at least about 87% amino acid sequence identity, alternatively at least about 88% amino acid sequence identity, alternatively at least about 89% amino acid sequence identity, alternatively at least about 90% amino acid sequence identity, alternatively at least about 91% amino acid sequence identity, alternatively at least about 92% amino acid sequence identity, alternatively at least about 93% amino acid sequence identity, alternatively at least about 94%) amino acid sequence identity, alternatively at least about 95%> amino acid sequence identity, alternatively at least about
96% amino acid sequence identity, alternatively at least about 97% amino acid sequence identity, alternatively at least about 98% amino acid sequence identity and alternatively at least about 99% amino acid sequence identity to a full-length native sequence PRO polypeptide sequence as disclosed herein, a PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other specifically defined fragment of a full-length PRO polypeptide sequence as disclosed herein. Ordinarily, PRO variant polypeptides are at least about 10 amino acids in length, alternatively at least about 20 amino acids in length, alternatively at least about 30 amino acids in length, alternatively at least about 40 amino acids in length, alternatively at least about 50 amino acids in length, alternatively at least about 60 amino acids in length, alternatively at least about 70 amino acids in length, alternatively at least about 80 amino acids in length, alternatively at least about 90 amino acids in length, alternatively at least about 100 amino acids in length, alternatively at least about 150 amino acids in length, alternatively at least about 200 amino acids in length, alternatively at least about 300 amino acids in length, or more.
"Percent (%) amino acid sequence identity" with respect to the PRO polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific PRO polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for puφoses of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or
Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For puφoses herein, however, % amino acid sequence identity values are generated using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1 below. The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc. and the source code shown in Table 1 below has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, California or may be compiled from the source code provided in Table 1 below. The ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX
V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
In situations where ALIGN-2 is employed for amino acid sequence comparisons, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows:
100 times the fraction X/Y
where X is the number of amino acid residues scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the % amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A. As examples of % amino acid sequence identity calculations using this method, Tables 2 and 3 demonstrate how to calculate the %> amino acid sequence identity of the amino acid sequence designated "Comparison Protein" to the amino acid sequence designated "PRO", wherein "PRO" represents the amino acid sequence of a hypothetical PRO polypeptide of interest, "Comparison Protein" represents the amino acid sequence of a polypeptide against which the "PRO" polypeptide of interest is being compared, and "X, "Y" and "Z" each represent different hypothetical amino acid residues.
Unless specifically stated otherwise, all % amino acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.
However, % amino acid sequence identity values may also be obtained as described below by using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266:460-480 (1996)). Most of the WU-BLAST-2 search parameters are set to the default values. Those not set to default values, i.e., the adjustable parameters, are set with the following values: overlap span = 1, overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When WU-BLAST-2 is employed, a % amino acid sequence identity value is determined by dividing (a) the number of matching identical amino acid residues between the amino acid sequence of the PRO polypeptide of interest having a sequence derived from the native PRO polypeptide and the comparison amino acid sequence of interest (i.e., the sequence against which the PRO polypeptide of interest is being compared which may be a PRO variant polypeptide) as determined by WU-BLAST-2 by (b) the total number of amino acid residues of the PRO polypeptide of interest. For example, in the statement "a polypeptide comprising an the amino acid sequence A which has or having at least 80% amino acid sequence identity to the amino acid sequence B", the amino acid sequence A is the comparison amino acid sequence of interest and the amino acid sequence B is the amino acid sequence of the PRO polypeptide of interest. Percent amino acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program may be downloaded from http://www.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Health, Bethesda, MD. NCBI-BLAST2 uses several search parameters, wherein all of those search parameters are set to default values including, for example, unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0.01, constant for multi-pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62.
In situations where NCBI-BLAST2 is employed for amino acid sequence comparisons, the % amino acid sequence identity of a given amino acid sequence A to, with, or against a given amino acid sequence B (which can alternatively be phrased as a given amino acid sequence A that has or comprises a certain % amino acid sequence identity to, with, or against a given amino acid sequence B) is calculated as follows:
100 times the fraction X Y
where X is the number of amino acid residues scored as identical matches by the sequence alignment program NCBI-BLAST2 in that program's alignment of A and B, and where Y is the total number of amino acid residues in B. It will be appreciated that where the length of amino acid sequence A is not equal to the length of amino acid sequence B, the %> amino acid sequence identity of A to B will not equal the % amino acid sequence identity of B to A. "PRO variant polynucleotide" or "PRO variant nucleic acid sequence" means a nucleic acid molecule which encodes an active PRO polypeptide as defined below and which has at least about 80% nucleic acid sequence identity with a nucleotide acid sequence encoding a full-length native sequence PRO polypeptide sequence as disclosed herein, a full-length native sequence PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal peptide, as disclosed herein or any other fragment of a full-length PRO polypeptide sequence as disclosed herein. Ordinarily, a PRO variant polynucleotide will have at least about 80% nucleic acid sequence identity, alternatively at least about 81% nucleic acid sequence identity, alternatively at least about 82% nucleic acid sequence identity, alternatively at least about 83%> nucleic acid sequence identity, alternatively at least about 84% nucleic acid sequence identity, alternatively at least about 85% nucleic acid sequence identity, alternatively at least about 86% nucleic acid sequence identity, alternatively at least about 87% nucleic acid sequence identity, alternatively at least about 88%> nucleic acid sequence identity, alternatively at least about 89% nucleic acid sequence identity, alternatively at least about 90% nucleic acid sequence identity, alternatively at least about 91% nucleic acid sequence identity, alternatively at least about 92% nucleic acid sequence identity, alternatively at least about 93% nucleic acid sequence identity, alternatively at least about 94% nucleic acid sequence identity, alternatively at least about 95% nucleic acid sequence identity, alternatively at least about 96% nucleic acid sequence identity, alternatively at least about 97% nucleic acid sequence identity, alternatively at least about 98% nucleic acid sequence identity and alternatively at least about 99% nucleic acid sequence identity with a nucleic acid sequence encoding a full- length native sequence PRO polypeptide sequence as disclosed herein, a full-length native sequence PRO polypeptide sequence lacking the signal peptide as disclosed herein, an extracellular domain of a PRO polypeptide, with or without the signal sequence, as disclosed herein or any other fragment of a full-length
PRO polypeptide sequence as disclosed herein. Variants do not encompass the native nucleotide sequence.
Ordinarily, PRO variant polynucleotides are at least about 30 nucleotides in length, alternatively at least about 60 nucleotides in length, alternatively at least about 90 nucleotides in length, alternatively at least about 120 nucleotides in length, alternatively at least about 150 nucleotides in length, alternatively at least about 180 nucleotides in length, alternatively at least about 210 nucleotides in length, alternatively at least about 240 nucleotides in length, alternatively at least about 270 nucleotides in length, alternatively at least about 300 nucleotides in length, alternatively at least about 450 nucleotides in length, alternatively at least about 600 nucleotides in length, alternatively at least about 900 nucleotides in length, or more.
"Percent (%) nucleic acid sequence identity" with respect to PRO-encoding nucleic acid sequences identified herein is defined as the percentage of nucleotides in a candidate sequence that are identical with the nucleotides in the PRO nucleic acid sequence of interest, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for puφoses of determining percent nucleic acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. For puφoses herein, however, % nucleic acid sequence identity values are generated using the sequence comparison computer program ALIGN-2, wherein the complete source code for the ALIGN-2 program is provided in Table 1 below. The ALIGN-2 sequence comparison computer program was authored by Genentech, Inc. and the source code shown in Table 1 below has been filed with user documentation in the U.S. Copyright Office, Washington D.C., 20559, where it is registered under U.S. Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, California or may be compiled from the source code provided in Table 1 below. The ALIGN-2 program should be compiled for use on a UNIX operating system, preferably digital UNIX V4.0D. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
In situations where ALIGN-2 is employed for nucleic acid sequence comparisons, the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) is calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the sequence alignment program ALIGN-2 in that program's alignment of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C. As examples of % nucleic acid sequence identity calculations, Tables 4 and 5, demonstrate how to calculate the % nucleic acid sequence identity of the nucleic acid sequence designated "Comparison DNA" to the nucleic acid sequence designated "PRO-DNA", wherein "PRO-DNA" represents a hypothetical PRO-encoding nucleic acid sequence of interest, "Comparison DNA" represents the nucleotide sequence of a nucleic acid molecule against which the "PRO-DNA" nucleic acid molecule of interest is being compared, and "N", "L" and "V" each represent different hypothetical nucleotides.
Unless specifically stated otherwise, all % nucleic acid sequence identity values used herein are obtained as described in the immediately preceding paragraph using the ALIGN-2 computer program.
However, % nucleic acid sequence identity values may also be obtained as described below by using the WU-BLAST-2 computer program (Altschul et al., Methods in Enzymology 266:460-480 (1996)). Most of the WU-BLAST-2 search parameters are set to the default values. Those not set to default values, i.e., the adjustable parameters, are set with the following values: overlap span = 1 , overlap fraction = 0.125, word threshold (T) = 11, and scoring matrix = BLOSUM62. When WU-BLAST-2 is employed, a % nucleic acid sequence identity value is determined by dividing (a) the number of matching identical nucleotides between the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest having a sequence derived from the native sequence PRO polypeptide-encoding nucleic acid and the comparison nucleic acid molecule of interest (i.e., the sequence against which the PRO polypeptide-encoding nucleic acid molecule of interest is being compared which may be a variant PRO polynucleotide) as determined by
WU-BLAST-2 by (b) the total number of nucleotides of the PRO polypeptide-encoding nucleic acid molecule of interest. For example, in the statement "an isolated nucleic acid molecule comprising a nucleic acid sequence A which has or having at least 80% nucleic acid sequence identity to the nucleic acid sequence B", the nucleic acid sequence A is the comparison nucleic acid molecule of interest and the nucleic acid sequence B is the nucleic acid sequence of the PRO polypeptide-encoding nucleic acid molecule of interest.
Percent nucleic acid sequence identity may also be determined using the sequence comparison program NCBI-BLAST2 (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)). The NCBI-BLAST2 sequence comparison program may be downloaded from http://www.ncbi.nlm.nih.gov or otherwise obtained from the National Institute of Health, Bethesda, MD. NCBI-BLAST2 uses several search parameters, wherein all of those search parameters are set to default values including, for example, unmask = yes, strand = all, expected occurrences = 10, minimum low complexity length = 15/5, multi-pass e-value = 0.01 , constant for multi-pass = 25, dropoff for final gapped alignment = 25 and scoring matrix = BLOSUM62. In situations where NCBI-BLAST2 is employed for sequence comparisons, the % nucleic acid sequence identity of a given nucleic acid sequence C to, with, or against a given nucleic acid sequence D (which can alternatively be phrased as a given nucleic acid sequence C that has or comprises a certain % nucleic acid sequence identity to, with, or against a given nucleic acid sequence D) is calculated as follows:
100 times the fraction W/Z
where W is the number of nucleotides scored as identical matches by the sequence alignment program NCBI-BLAST2 in that program's alignment of C and D, and where Z is the total number of nucleotides in D. It will be appreciated that where the length of nucleic acid sequence C is not equal to the length of nucleic acid sequence D, the % nucleic acid sequence identity of C to D will not equal the % nucleic acid sequence identity of D to C.
In other embodiments, PRO variant polynucleotides are nucleic acid molecules that encode an active PRO polypeptide and which are capable of hybridizing, preferably under stringent hybridization and wash conditions, to nucleotide sequences encoding a full-length PRO polypeptide as disclosed herein. PRO variant polypeptides may be those that are encoded by a PRO variant polynucleotide.
"Isolated," when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In preferred embodiments, the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (2) to homogeneity by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain. Isolated polypeptide includes polypeptide in situ within recombinant cells, since at least one component of the PRO polypeptide natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
An "isolated" PRO polypeptide-encoding nucleic acid or other polypeptide-encoding nucleic acid is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated in the natural source of the polypeptide-encoding nucleic acid. An isolated polypeptide-encoding nucleic acid molecule is other than in the form or setting in which it is found in nature. Isolated polypeptide-encoding nucleic acid molecules therefore are distinguished from the specific polypeptide-encoding nucleic acid molecule as it exists in natural cells. However, an isolated polypeptide-encoding nucleic acid molecule includes polypeptide-encoding nucleic acid molecules contained in cells that ordinarily express the polypeptide where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells. The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences being linked are contiguous, and, in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.
The term "antibody" is used in the broadest sense and specifically covers, for example, single anti- PRO monoclonal antibodies (including agonist, antagonist, and neutralizing antibodies), anti-PRO antibody compositions with polyepitopic specificity, single chain anti-PRO antibodies, and fragments of anti-PRO antibodies (see below). The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present in minor amounts. "Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures. Hybridization generally depends on the ability of denatured DNA to reanneal when complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al.. Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995). "Stringent conditions" or "high stringency conditions", as defined herein, may be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50%> (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1 % polyvinylpyrrolidone/50mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) employ 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1% sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μg/ml), 0.1%> SDS, and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) and 50% formamide at 55°C, followed by a high-stringency wash consisting of 0.1 x SSC containing EDTA at 55°C. "Moderately stringent conditions" may be identified as described by Sambrook et al., Molecular
Cloning: A Laboratory Manual, New York: Cold Spring Harbor Press, 1989, and include the use of washing solution and hybridization conditions (e.g., temperature, ionic strength and %SDS) less stringent that those described above. An example of moderately stringent conditions is overnight incubation at 37°C in a solution comprising: 20% formamide, 5 x SSC (150 mM NaCI, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5 x Denhardt's solution, 10% dextran sulfate, and 20 mg/ml denatured sheared salmon sperm DNA, followed by washing the filters in 1 x SSC at about 37-50°C. The skilled artisan will recognize how to adjust the temperature, ionic strength, etc. as necessary to accommodate factors such as probe length and the like.
The term "epitope tagged" when used herein refers to a chimeric polypeptide comprising a PRO polypeptide fused to a "tag polypeptide". The tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the polypeptide to which it is fused. The tag polypeptide preferably also is fairly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least six amino acid residues and usually between about 8 and 50 amino acid residues (preferably, between about 10 and 20 amino acid residues).
As used herein, the term "immunoadhesin" designates antibody-like molecules which combine the binding specificity of a heterologous protein (an "adhesin") with the effector functions of immunoglobulin constant domains. Structurally, the immunoadhesins comprise a fusion of an amino acid sequence with the desired binding specificity which is other than the antigen recognition and binding site of an antibody (i.e., is "heterologous"), and an immunoglobulin constant domain sequence. The adhesin part of an immunoadhesin molecule typically is a contiguous amino acid sequence comprising at least the binding site of a receptor or a ligand. The immunoglobulin constant domain sequence in the immunoadhesin may be obtained from any immunoglobulin, such as IgG-1, IgG-2, IgG-3, or IgG-4 subtypes, IgA (including IgA-1 and IgA-2), IgE, IgD or IgM. "Active" or "activity" for the puφoses herein refers to form(s) of a PRO polypeptide which retain a biological and/or an immunological activity of native or naturally-occurring PRO, wherein "biological" activity refers to a biological function (either inhibitory or stimulatory) caused by a native or naturally- occurring PRO other than the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally-occurring PRO and an "immunological" activity refers to the ability to induce the production of an antibody against an antigenic epitope possessed by a native or naturally- occurring PRO.
The term "antagonist" is used in the broadest sense, and includes any molecule that partially or fully blocks, inhibits, or neutralizes a biological activity of a native PRO polypeptide disclosed herein. In a similar manner, the term "agonist" is used in the broadest sense and includes any molecule that mimics a biological activity of a native PRO polypeptide disclosed herein. Suitable agonist or antagonist molecules specifically include agonist or antagonist antibodies or antibody fragments, fragments or amino acid sequence variants of native PRO polypeptides, peptides, antisense oligonucleotides, small organic molecules, etc. Methods for identifying agonists or antagonists of a PRO polypeptide may comprise contacting a PRO polypeptide with a candidate agonist or antagonist molecule and measuring a detectable change in one or more biological activities normally associated with the PRO polypeptide.
"Treatment" refers to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the targeted pathologic condition or disorder. Those in need of treatment include those already with the disorder as well as those prone to have the disorder or those in whom the disorder is to be prevented. "Chronic" administration refers to administration of the agent(s) in a continuous mode as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time. "Intermittent" administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.
"Mammal" for puφoses of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, cats, cattle, horses, sheep, pigs, goats, rabbits, etc. Preferably, the mammal is human.
Administration "in combination with" one or more further therapeutic agents includes simultaneous (concurrent) and consecutive administration in any order.
"Carriers" as used herein include pharmaceutically acceptable carriers, excipients, or stabilizers which are nontoxic to the cell or mammal being exposed thereto at the dosages and concentrations employed. Often the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptide; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN™, polyethylene glycol (PEG), and PLURONICS™.
"Antibody fragments" comprise a portion of an intact antibody, preferably the antigen binding or variable region of the intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies (Zapata et al, Protein Eng. 8(10): 1057-1062 [1995]); single-chain antibody molecules; and multispecific antibodies formed from antibody fragments.
Papain digestion of antibodies produces two identical antigen-binding fragments, called "Fab" fragments, each with a single antigen-binding site, and a residual "Fc" fragment, a designation reflecting the ability to crystallize readily. Pepsin treatment yields an F(ab')2 fragment that has two antigen-combining sites and is still capable of cross-linking antigen.
"Fv" is the minimum antibody fragment which contains a complete antigen-recognition and - binding site. This region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. It is in this configuration that the three CDRs of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six CDRs confer antigen- binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three CDRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.
The Fab fragment also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain. Fab fragments differ from Fab' fragments by the addition of a few residues at the carboxy terminus of the heavy chain CHI domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.
The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa and lambda, based on the amino acid sequences of their constant domains.
Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins:
IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgGl , IgG2, IgG3, IgG4, IgA, and IgA2.
"Single-chain Fv" or "sFv" antibody fragments comprise the VH and VL domains of antibody, wherein these domains are present in a single polypeptide chain. Preferably, the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the sFv to form the desired structure for antigen binding. For a review of sFv, see Pluckthun in 77ιe Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds., Springer- Verlag, New York, pp. 269-315 (1994).
The term "diabodies" refers to small antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) in the same polypeptide chain (VH-VL). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies are described more fully in, for example, EP 404,097; WO 93/11161; and Hollinger et al, Proc. Nat Acad. Sci. USA, 90:6444-6448 (1993).
An "isolated" antibody is one which has been identified and separated and/or recovered from a component of its natural environment. Contaminant components of its natural environment are materials which would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In preferred embodiments, the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and most preferably more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N- terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by
SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or, preferably, silver stain. Isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibody's natural environment will not be present. Ordinarily, however, isolated antibody will be prepared by at least one purification step. An antibody that "specifically binds to" or is "specific for" a particular polypeptide or an eptiope on a particular polypeptide is one that binds to that particular polypeptide or epitope on a particular polypeptide without substantially binding to any other polypeptide or polypeptide epitope.
The word "label" when used herein refers to a detectable compound or composition which is conjugated directly or indirectly to the antibody so as to generate a "labeled" antibody. The label may be detectable by itself (e.g. radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.
By "solid phase" is meant a non-aqueous matrix to which the antibody of the present invention can adhere. Examples of solid phases encompassed herein include those formed partially or entirely of glass (e.g., controlled pore glass), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicones. In certain embodiments, depending on the context, the solid phase can comprise the well of an assay plate; in others it is a purification column (e.g., an affinity chromatography column). This term also includes a discontinuous solid phase of discrete particles, such as those described in U.S. Patent No. 4,275,149. A "liposome" is a small vesicle composed of various types of lipids, phospholipids and/or surfactant which is useful for delivery of a drug (such as a PRO polypeptide or antibody thereto) to a mammal. The components of the liposome are commonly arranged in a bilayer formation, similar to the lipid arrangement of biological membranes.
A "small molecule" is defined herein to have a molecular weight below about 500 Daltons.
Table 1
* C-C increased from 12 to 15
* Z is average of EQ
* B is average of ND
* match with stop is _M; stop-stop 0; J (joker) match = 0
*/ #define M /* value of a match with a stop */
Figure imgf000028_0001
H I J K L M N O P Q R S T U V W X Y Z*/
/* A*/ 2, 0,-2, 0, 0, -4, 1, -1, -1, 0,-1,-2,-1, 0,_M, 1, 0,-2, 1, 1, 0, 0,-6, 0,-3, 0},
/* B*/ 0, 3,-4 2, -5, 0, 1, -2, 0, 0,-3,-2, 2,_M,-1, 1, 0, 0, 0, 0,-2,-5, 0,-3, 1},
/* C*/ •2,-4,15 -5 ,-4 ,-3 ,-3 ,-2 , 0,-5,-6,-5, -4,_M, -3,-5, -4, 0,-2, 0,-2,-8, 0, 0,-5},
/* D*/ 0, 3,-5 3, -6, 1, 1, -2, 0, 0,-4,-3, 2,_M,-1, 2,-1, 0, 0, 0,-2,-7, 0,-4, 2},
/* E*/ 0, 2,-5 4, -5, 0, 1, -2, 0, 0,-3,-2, 1,_M,-1, 2,-1, 0, 0, 0,-2,-7, 0,-4, 3},
/* F*/ ■4,-5,-4 -5 9 -5 -2 1, 0,-5, 2, 0,-4,_M,-5, -5,-4,-3, -3, 0,-1, 0, 0, 7,-5},
/* G*/ 1,0,-3. 0, -5, 5, -2, -3, 0,-2,-4,-3, 0,_M,-l,-l,-3, 1, 0, 0,-1,-7, 0,-5, 0},
/* H*/ •1, 1,-3 1, -2, -2, 6, -2, 0, 0,-2,-2, 2,_M, 0, 3, 2,-1,-1, 0,-2,-3, 0, 0, 2},
/* I */ ■1,-2,-2 -2 1 -3 -2 5, 0,-2, 2, 2, -2,_M,-2, -2,-2,-1, 0, 0, 4,-5, 0,-1,-2},
/* J*/ 0,0,0 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,_M, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0},
/* K*/ 1, 0,-5 0, -5, -2, 0, -2, 0, 5,-3, 0, 1,_M,-1, 1, 3, 0, 0, 0,-2,-3, 0,-4, 0},
/* L*/ •2,-3,-6 -3 2 -4 -2 2, 0,-3, 6, 4,-3,_M,-3, -2,-3, -3,-1, 0, 2,-2, 0,-1,-2},
/* M*/ ■1,-2,-5 -2 0 -3 -2 2, 0, 0, 4, 6,-2,_M,-2,-l, 0,-2,-1, 0, 2,-4, 0,-2,-1},
/* N*/ 0, 2,-4 1, -4, 0, 2, -2, 0, 1,-3,-2, 2,_M,-1, 1, 0, 1, 0, 0,-2,-4, 0,-2, 1},
/* O*/ M,_M, M , M, M, M ,_M,_M,_M,_M,_M,_M,_M, 0,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M,_M},
/* P*/ 1,-1,-3 -1 -5 -1 0 -2 0 -1 -3 -2 -1 M 6,,0,0, 1,0,0,-1,-6,0,-5,0},
/* Q*/ 0, 1,-5 2, -5, -1, 3, -2, 0, 1, -2, -1, 1, M, 0, 4, 1,-1,-1,0,-2,-5,0,-4, 3},
/* R*/ ■2, 0,-4 -1 -4 -3 2 -2 0 3 -3 0 0, M 0, 1,6,0,-1,0,-2,2,0,-4,0},
/* S*/ 1,0,0 0, -3, 1, -1, -1, 0, o, -3, -2, 1, M, 1,- 1,0,2, 1,0,-1,-2,0,-3,0},
/* τ*ι 1, 0,-2 0, -3, 0, -1, 0, o, o, -1, -1, o, M, o,- 1,-1, 1,3,0,0,-5,0,-3,0},
/* u */ 0,0,0 0, 0, 0, 0, 0, 0, 0, 0, 0, o, M, 0, 0,0,0,0,0,0,0,0,0,0},
/* V*/ 0,-2,-2 -2 -1 -1 -2 4 0 -2 2 2 -2, "M -1, 2,-2,-1, 0, 0, 4,-6, 0,-2,-2},
/* w*/ -6,-5,-8 -7 0 -7 -3 -5 0 -3 -2 -4 ,-4 M ,-6 ,-5,2,-2,-5,0,-6,17,0,0,-6},
/* x*ι 0,0,0 0, o, 0, 0, 0, 0, 0, 0, 0, 0, M, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0},
/* Y*/ -3,-3, 0 -4 7, -5 0 -1 0 -4 -1 -2 -2 " M -5, -4,-4,-3,-3,0,-2,0,0,10,-4},
/* z*/ 0, 1,-5 3, -5, 0, 2, -2, 0, 0, -2, -1, 1, M, 0, 3, 0, 0, 0, 0,-2,-6, 0,-4, 4}
Page 1 of day. h Table 1 (conf)
/* */
^include < stdio.h > ^include <ctype.h >
#defϊne MAXJMP 16 /* max jumps in a diag */
#define MAXGAP 24 /* don't continue to penalize gaps larger than this */
#define JMPS 1024 /* max jmps in an path */
#defϊne MX 4 /* save if there's at least MX-1 bases since last jmp */
#define DMAT 3 /* value of matching bases */
#define DMIS 0 /* penalty for mismatched bases */
#defϊne DINSO 8 /* penalty for a gap */
#defϊne DINS1 1 /* penalty per base */
#define PINSO 8 /* penalty for a gap */
#define PINS1 4 /* penalty per residue */ struct jmp { short n[MAXJMP]; /* size of jmp (neg for dely) */ unsigned short x[MAXJMP]; /* base no. of jmp in seq x */
/* limits seq to 2" 16 -1 */ struct diag { int score; /* score at last jmp */ long offset; /* offset of prev block */ short ijmp; /* current jmp index */ struct jmp jp; /* list of jmps */
}; struct path { int spc; /* number of leading spaces */ short n[JMPS]; /* size of jmp (gap) */ int x[JMPS]; /* loc of jmp (last elem before gap) */
}; char *ofile; /* output file name */ char *namex[2]; /* seq names: getseqs() */ char *prog; /* prog name for err msgs */ char *seqx[2]; /* seqs: getseqsO */ int dmax; /* best diag: nw() */ int dmaxO; /* final diag */ int dna; /* set if dna: main() */ int endgaps; /* set if penalizing end gaps */ int gapx, gapy; /* total gaps in seqs */ int lenO, lenl; /* seq lens */ int ngapx, ngapy; /* total size of gaps */ int smax; /* max score: nw() */ int *xbm; /* bitmap for matching */ long offset; /* current offset in jmp file */ struct diag *dx; /* holds diagonals */ struct path PP[2] ; /* holds path for seqs */ char *calloc(), *malloc0, *index(), *strcpy(); char *getseq(), *g_calloc();
Page 1 of nw.h Table 1 (conf)
/* Needleman-Wunsch alignment program
* usage: progs filel fιle2
* where filel and file2 are two dna or two protein sequences.
* The sequences can be in upper- or lower-case an may contain ambiguity
* Any lines beginning with ';', '>' or '< ' are ignored
* Max file length is 65535 (limited by unsigned short x in the jmp struct)
* A sequence with 1/3 or more of its elements ACGTU is assumed to be DNA
* Output is in the file "align. out" *
* The program may create a tmp file in /tmp to hold info about traceback.
* Original version developed under BSD 4.3 on a vax 8650 */
^include "nw.h" ^include "day.h" static _dbval[26] = { 1,14,2,13,0,0,4,11,0,0,12,0,3,15,0,0,0,5,6,8,8,7,9,0,10,0
}; static _pbval[26] = {
1,2|(1<<('D'-'A'))|(1<<('N'-'A')), 4, 8, 16,32,64,
128, 256, OxFFFFFFF, 1< < 10, 1< < 11, 1< < 12, 1< < 13, 1< < 14,
1<<15, 1<<16, 1<<17, 1<<18, 1< < 19, 1< <20, 1< <21, 1< <22,
1< <23, 1< <24, 1< <25|(1< <(Ε'-'A'))|(1< <('Q,-'A'))
}; main(ac, av) main int ac; char *av[|; prog = av[0]; if (ac ! = 3) { fprintf(stderr, "usage: s filel fιle2\n", prog); fprintf(stderr, "where filel and file2 are two dna or two protein sequences. \n"); fbrintf(stderr,"The sequences can be in upper- or lower-case\n"); fprintf(stderr, " Any lines beginning with ';' or ' < ' are ignored\n"); fprintf(stderr, "Output is in the file \"align.out\"\n"); exit(l);
} namex[0] = av[l]; namex[l] = av[2]; seqx[0] = getseq(namex[0], &len0); seqx[l] = getseq(namex[l], &lenl); xbm = (dna)? _dbval : pbval; endgaps = 0; /* 1 to penalize endgaps */ ofile = "align. out"; /* output file */ nw(); / fill in the matrix, get the possible jmps */ readjmpsO; / get the actual jmps */ printO; / print stats, alignment */ cleanup(O); /* unlink any tmp files */
Page 1 of nw.c Table 1 (conf)
/* do the alignment, return best score: main()
* dna: values in Fitch and Smith, PNAS, 80, 1382-1386, 1983
* pro: PAM 250 values
* When scores are equal, we prefer mismatches to any gap, prefer
* a new gap to extending an ongoing gap, and prefer a gap in seqx
* to a gap in seq y.
*/ nw() nw
{ char *px, *py; /* seqs and ptrs */ int *ndely, *dely; /* keep track of dely */ int ndelx, delx; /* keep track of delx */ int *tmp; /* for swapping rowO, rowl */ int mis; /* score for each type */ int insO, insl; /* insertion penalties */ register id; /* diagonal index */ register ϋ; /* jmp index */ register *col0, *coll; /* score for curr, last row */ register xx, yy; /* index into seqs */ dx = (struct diag *)g_calloc("to get diags", lenO + lenl + l, sizeof(struct diag)); ndely = (int *)g_calloc("to get ndely", lenl + 1, sizeof(int)); dely = (int *)g_calloc("to get dely", lenl + 1, sizeof(int)); colO = (int *)g_calloc("to get colO", lenl + 1, sizeofønt)); coll = (int *)g_calloc("to get coll", lenl + 1, sizeof(int)); insO = (dna)? DINSO : PINS0; insl = (dna)? DINS1 : PINS1; smax = -10000; if (endgaps) { for (col0[0] = dely[0] = -insO, yy = 1; yy < = lenl; yy+ +) { colOfyy] = dely[yy] = col0[yy-l] - insl; ndely[yy] = yy;
} col0[0] = 0; /* Waterman Bull Math Biol 84 */
} else for (yy = 1; yy < = lenl ; yy + +) dely[yy] = -insO;
/* fill in match matrix */ for (px = seqx[0], xx = 1; xx < = lenO; px+ + , xx+ +) { /* initialize first entry in col */ if (endgaps) { if (xx = = 1) coll[0] = delx = -(insO+insl); else coll[0] = delx = col0[0] - insl ; ndelx = xx;
} else { col l[0] = 0; delx = -insO; ndelx = 0;
Page 2 of nw.c Table 1 (conf)
...nw for (py = seqxfl], yy = 1; yy < = lenl ; py+ + , yy+ +) { mis = col0[yy-l]; if (dna) mis + = (xbm[*px-'A']&xbm[*py-'A'])? DMAT : DMIS; else mis + = _day[*px-'A'][*py-'A'];
10
/* update penalty for del in x seq;
* favor new del over ongong del
* ignore MAXGAP if weighting endgaps */
15 if (endgaps | | ndely [yy] < MAXGAP) { if (coI0[yy] - insO > = dely[yy]) { delyfyy] = col0[yy] - (insO+insl); ndely [yy] = 1; } else { 20 delyfyy] -= insl; ndely [yy] + + ;
} } else { if (colOfyy] - (insO+insl) > = dely[yy]) { 25 dely[yy] = col0[yy] - (insO + insl); ndely[yy] = 1 ; } else ndely[yy] + + ;
30
/* update penalty for del in y seq; * favor new del over ongong del */ if (endgaps | | ndelx < MAXGAP) { 35 if (coll[yy-l] - insO > = delx) { delx = coll[yy-l] (insO + insl); ndelx = 1;
} else { delx -= insl; 40 ndelx+ + ;
} } else { if (col l[yy-l] - (insO + insl) > = delx) { delx = coll[yy-l] - (insO + insl); 45 ndelx = 1;
} else ndelx + + ;
50 /* pick the maximum score; we're favoring
* mis over any del and delx over dely
*/
55
60
Page 3 of nw.c Table 1 (conf) id = xx - yy + lenl - 1; ...nw if (mis > = delx && mis > = delyfyy]) collfyy] = mis; else if (delx > = delyfyy]) { collfyy] = delx; ij = dx[id].ijmp; if (dx[id].jp.n[0] && (!dna | | (ndelx > = MAXJMP
&& xx > dxfid].jp.x[ij] + MX) | | mis > dx fid], score +DINS0)) { dx[id].ijmp+ + ; if (+ +ij > = MAXJMP) { writejmps(id); ij = dx[id].ijmp = 0; dx fid], offset = offset; offset + = sizeof (struct jmp) + sizeof(offset); } } dx[id].jp.nfij] = ndelx; dx[id].jp. xfij] = xx; dx [id], score = delx;
} else { col lfyy] = delyfyy]; ij = dx[id] .ijmp; if (dxfid].jp.n[0] && (!dna | | (ndelyfyy] > = MAXJMP
&& xx > dx[id].jp.x[ij] +MX) | | mis > dx [id], score + DINS0)) { dx[id].ijmp+ + ; if (+ +ij > = MAXJMP) { writejmps(id); ij = dx[id] .ijmp = 0; dx[id]. offset = offset; offset + = sizeof (struct jmp) + sizeof (off set); }
} dxfid].jp.nfij] = -ndelyfyy]; dx[id].jp.xfij] = xx; dx [id], score = dely[yy];
} if (xx = = lenO && yy < lenl) {
/* last col */ if (endgaps) collfyy] -= insO + insl *(lenl-yy); if (col 1 [yy] > smax) { smax = coll[yy]; dmax = id; } } } if (endgaps && xx < lenO) coll[yy-l] -= ins0+insl*(len0-xx); if (collfyy- 1] > smax) { smax = coll[yy-l]; dmax = id;
} tmp = colO; colO = coll; col l = tmp;
}
(void) free((char *)ndely);
(void) free((char *)dely);
(void) free((char *)col0);
(void) free((char *)coll);
Page 4 of nw.c Table 1 (conf)
/* * * printO — only routine visible outside this module
*
* static:
* getmatO — trace back best path, count matches: printO
* pr_align() — print alignment of described in array pfj: print() * dumpblockO — dump a block of lines with numbers, stars: pr_align()
* numsO -- put out a number line: dumpblockO
* putlineO ~ put out a line (name, [num], seq, [num]): dumpblockO
* starsO - -put a line of stars: dumpblockO
* stripname() — strip any path and prefix from a seqname */
^include "nw.h"
#defϊne SPC 3 #defιne P LINE 256 /* maximum output line */
#define P SPC 3 /* space between name or num and seq */ extern day [26] [26]; int olen; /* set output line length */ FILE *fx; /* output file */ printO print
{ int lx, ly, firstgap, lastgap; /* overlap */ if ((fx = fopen(ofile, "w")) = = 0) { fprintf(stderr," %s: can't write %s\n", prog, ofile); cleanup(l); } fprintf(fx, " < first sequence: %s (length = %d)\n", namex[0], lenO); fprintf(fx, " < second sequence: %s (length = %d)\n", namexfl], lenl); olen = 60; lx = lenO; ly = lenl ; firstgap = lastgap = 0; if (dmax < lenl - 1) { /* leading gap in x */ pp[0].spc = firstgap = lenl - dmax - 1 ; ly -= pp[0].spc; } else if (dmax > lenl - 1) { /* leading gap in y */ pp[l].spc = firstgap = dmax - (lenl - 1); lx -= pp[l].spc;
} if (dmaxO < lenO - 1) { /* trailing gap in x */ lastgap = lenO - dmaxO - 1 ; lx -= lastgap;
} else if (dmaxO > lenO - 1) { /* trailing gap in y */ lastgap = dmaxO - (lenO - 1); ly -= lastgap;
} getmat(lx, ly, firstgap, lastgap); pr_align(); }
Page 1 of nwprint.c Table 1 (conf)
/*
* trace back the best path, count matches */ static getmat(lx, ly, firstgap, lastgap) getmat int lx, ly; /* "core" (minus endgaps) */ int firstgap, lastgap; /* leading trailing overlap */
{ int nm, iO, il, sizO, sizl char outx[32]; double pet; register nO, nl; register char *p0, *pl;
/* get total matches, score */ iO = il = sizO = sizl = 0; pO = seqxfO] + pp[l].spc; pi = seqxfl] + pp[0].spc; nO = pp[l].spc + 1; nl = pp[0].spc + 1; nm = 0; while ( *p0 && *pl ) { if (sizO) { pl + + ; nl + + ; sizO--;
} else if (sizl) { p0+ + ; n0 + + ; sizl—;
} else { if (xbm[*pO-'A,]&xbm[*pl-'A']) nm+ +; if (n0+ + = = pp[0].x[iO]) sizO = pp[0].n[iO+ +]; if (nl + + = = pp[l].x[il]) sizl = pp[l].n[il + +]; p0+ + ; pl + + ;
} /* pet homology:
* if penalizing endgaps, base is the shorter seq
* else, knock off overhangs and take shorter core */ if (endgaps) lx = (lenO < lenl)? lenO : lenl; else lx = (lx < ly)? lx : ly; pet = 100.*(double)nm/(double)lx; fprintf(fx, "\n"); fprintf(fx, " < %d match%s in an overlap of %d: % .2f percent similarity\n" nm, (nm = = 1)? "" : "es", lx, pet);
Page 2 of nwprint.c Table 1 (conf)
.get mat fprintf(fx, " < gaps in first sequence: %d", gapx); if (gapx) {
(void) sprintf(outx, " (%d %s%s)", ngapx, (dna)? "base":"residue", (ngapx "s"); fprintf(fx," %s", outx); fprintf(fx, ", gaps in second sequence: %d", gapy); if (gapy) {
(void) sprintf(outx, " (%d %s%s)", ngapy, (dna)? "base": "residue", (ngapy l)? "": "s"); fprintf(fx," %s", outx);
} if (dna) fprintf(fx,
"\n < score: %d (match = %d, mismatch = %d, gap penalty = %d + %d per base)\n", smax, DMAT, DMIS, DINS0, DINS1); else
• fprintf(fx,
"\n < score: %d (Dayhoff PAM 250 matrix, gap penalty = d + %d per residue)\n", smax, PINS0, PINS1); if (endgaps) fprintf(fx,
" < endgaps penalized, left endgap: %d %s%s, right endgap: %d %s s\n", firstgap, (dna)? "base" : "residue", (firstgap = = 1)? "" : "s", lastgap, (dna)? "base" : "residue", (lastgap = = 1)? "" : "s"); else fprintf(fx, " < endgaps not penalizedW);
static nm; /* matches in core — for checking */ static lmax; /* lengths of stripped file names */ static UP]; /* jmp index for a path */ static nc[2]; /* number at start of current line */ static nip]; /* current elem number ~ for gapping */ static siz[2]; static char *ps[2]; /* ptr to current element */ static char *po[2]; /* ptr to next output char slot */ static char out[2][P_LINE]; /* output line */ static char star[P LINE]; /* set by starsO */
* print alignment of described in struct path ppQ
*/ static pr_align() pr_align { int nn; /* char count */ int more; register for (i 0, lmax = 0; i < 2; i+ +) { nn = stripname(namex[i]); if (nn > lmax) lmax = nn; nc[i] = 1; ni[i] = 1; siz[i] = ij[i] = 0; ps[i] = seqx[i]; po[il = outfj];
Page 3 of nwprint.c Table 1 (conf) for (nn = nm = 0, more = 1; more; ) { ..pr_align for (i = more = 0; i < 2; i+ +) {
/*
* do we have more of this sequence? */ -f (l*ps[i]) continue; more+ + ; if (pp[i] spc) { /* leading space */ *po[i] + + = ' '; ppffj.spc-;
} else if (siz[i]) { /* in a gap */
*po[i] + + = '-'; siz[i]~;
} else { /* we're putting a seq element
*/ *po[i] = *ps[i]; if (islower(*ps[i]))
*ps[i] = toupper(*ps[i]); po[i] + + ; ps[i] + +;
/*
* are we at next gap for this seq?
*/ if (ni[i] = = pp[i].x[ij[i]]) { /*
* we need to merge all gaps
* at this location */ siz[i] = pp[i].n[ij[i] + +]; while (ni[i] = = pp[i].x[ijfi]]) siz[i] + = pp[il.n[ij[i] + +];
} ni[i] + + ;
}
} if (+ +nn = = olen | | Imore && nn) { dumpblockO; for (i = 0; i < 2; i+ +) po[i] = out[i]; nn = 0; }
* dump a block of lines, including numbers, stars: pr_align0 */ static dumpblockO dumpblock
{ register i; for (i = 0; i < 2; i+ +) *po[i]~ = '\0';
Page 4 of nwprint.c Table 1 (conf)
.dumpblock
(void) putc('\n', fx); for (i = 0; i < 2; i++) { if (*out[i] && (*out[i] ! = *(po[i]) ')){ if(i==0) nums(i); if(i ==0&&*out[l]) stars(); putline(i); if (i = = 0 && *out[l]) fprintf(fx, star); if(i == 1) nums(i);
* put out a number line: dumpblockO
*/ static nums(ix) minis int ix; /* index in outfj holding seq line */ char nline[P_LINE]; register '.j; register char *pn, *px, *py; for (pn = nline, i = 0; i < lmax + P_SPC; i + + , pn++)
*pn = ' '; for (i = nc[ix], py = outfix]; *py; py+ + , pn+ +) { if (*py == ' ' I j *py == '-') else { if (i%10 == 0 I I (i == 1 &&nc[ix] != 1)) { j = (i < 0)? -i : i; for(px = pn; j; j /= 10, px-) *px = j% 10 + '0'; if (i < 0)
*px = '-';
} else
*pn = ι++;
}
*pn = '\0'; nc[ix] = i; for (pn = nline; *pn; pn+ +) (void) putc(*pn, fx); (void) putc('\n', fx);
/*
* put out a line (name, [num], seq, [num]): dumpblockO */ static putline(ix) putline int ix;
{ Page 5 of nwprint.c Table 1 (conf)
...putline int i; register char *px; for (px = namex[ix], i = 0; *px && *px != ':'; px+ + , i++)
(void) putc(*px, fx); for (; i < lmax+P_SPC; i++) (void)putc(' ', fx);
/* these count from 1 :
* ni[] is current element (from 1)
* nc[] is number at start of current line */ for (px = out[ix]; *px; px++)
(void) putc(*px&0x7F, fx); (void) putc('\n', fx);
}
/* * put a line of stars (seqs always in out[0], out[l]): dumpblockO
*/ static starsQ stars int i; register char *p0, *pl, ex, *px; if (!*out[0] I I (*out[0] == ' '&& *(po[0]) == ' ') | | !*out[l] I I (*out[l] == ' '&& *(po[l]) == ' ')) return; px = star; for (i = lmax + P_SPC; i; i~) *px++ = ' '; for (pO = out[0], pi = out[l]; *p0 && *pl; p0+ + , pl + +) { if (isalpha(*p0) && isalpha(*pl)) { if (xbm[*pO-'A']&xbm[*pl-'A']) { ex = '*'; nm+ + ; } else if (!dna && _day[*pO-'A'][*pl-'A'] > 0) ex = '.'; else ex = ' '; } else ex = ' '; *px++ = ex;
} *px++ = '\n';
*px = '\0';
Page 6 of nwprint.c Table 1 (conf)
/*
* strip path or prefix from pn, return len: pr_alignO */ static stripname(pn) stripname char *pn; /* file name (may be path) */
{ register char *px, *py; py = 0; for (px = pn; *px; px+ +) if (*px = = = '/') py = px + 1 if (py)
(void) strcpy(pn, py); return(s ιtrlen(pn));
Page 7 of nwprint.c Table 1 (conf)
/*
* cleanupO — cleanup any tmp file
* getseqO — read in seq, set dna, len, maxlen
* g_callocO — calloc() with error checkin
* readjmpsO — et the good jmps, from tmp file if necessary
* writejmpsO — write a filled array of jmps to a tmp file: nwO */
^include "nw.h" ^include < sys/fιle.h > char *jname = "/tmp/ho gXXXXXX"; /* tmp file for jmps */
FILE *fj; int cleanupO; /* cleanup tmp file */ long lseekO;
/*
* remove any tmp file if we blow
*/ cleanup(i) cleanup int if (fj)
(void) unlink(jname); exit(i);
/*
* read, return ptr to seq, set dna, len, maxlen
* skip lines starting with ' ; ' , ' < ' , or ' > '
* seq in upper or lower case */ char * getseq(file, len) getseq char *file; /* file name */ int *len; /* seq len */ char line[1024], *pseq register char *px, *py; int natgc, tlen;
FILE *fp; if ((fp = fopen(fιle,"r")) = = 0) { fprintf(stderr," %s: can't read %s\n", prog, file); exit(l);
} tlen = natgc = 0; while (fgets(line, 1024, fp)) { if (*line = = ';' | | *line = = ' < ' | | *line = = ' > ') continue; for (px = line; *px ! = '\n'; px+ +) if (isupper(*px) | | islower(*px)) tlen+ + ;
} if ((pseq = malloc((unsigned)(tlen + 6))) = = 0) { fprintf(stderr," %s: mallocO failed to get %d bytes for %s\n", prog, tlen+6, file); exit(l);
} pseq[0] = pseq[l] = pseq[2] = pseq[3] = '\0';
Page 1 of nwsubr.c Table 1 (conf)
.getseq py = pseq + 4; *len = tlen; rewind(fp); while (fgets(line, 1024, fp)) { if (*line = = ' ;' | | *line = = ' < ' | | *line = = ' > ') continue; for (px = line; *px ! = '\n' ; px+ +) { if (isupper(*px))
*py+ + = *px; else if (islower(*px))
*py+ + = toupper(*px); if (index("ATGCU",*(py-l))) natgc+ + ; } }
*py+ + = '\0'; *py = '\0'; (void) fclose(fp); dna = natgc > (tlen/3); return(pseq+4);
} char * g_calloc(msg, nx, sz) g^calloc char *msg; /* program, calling routine */ int nx, sz; /* number and size of elements */
{ char *px, *calloc0; if ((px = calloc((unsigned)nx, (unsigned)sz)) = = 0) { if (*msg) { fprintf(stderr, "%s: g_calloc() failed %s (n= %d, sz= %d)\n", prog, msg, nx, sz); exit(l); } } return(px);
get final jmps from dx[] or tmp file, set ppfj, reset dmax: mainO
*/ readjmpsO readjmps int fd = -1; int siz, iO, il register i, j, xx; if (fj) {
(void) fclose(fj); if ((fd = open(jname, 0_RDONLY, 0)) < 0) { fprintf(stderr, " %s: can't openO %s\n", prog, jname); cleanup(l); } } for (i = iO = il = 0, dmaxO = dmax, xx = lenO; ; i + +) { while (1) { for (j = dx[dmax].ijmp; j > = 0 && dx[dmax].jp.x[j] > = xx; j— )
Page 2 of nwsubr.c Table 1 (conf)
...readjmps if (j < 0 && dxfdmax]. offset && fj) {
(void) lseek(fd, dx [dmax]. offset, 0); (void) read(fd, (char *)&dx[dmax].jp, sizeof (struct jmp));
(void) read(fd, (char *)&dx[dmax]. offset, sizeof(dx[dmax]. offset)); dxrdmax].ijmp = MAXJMP-1 ;
} else break;
} if (i > = JMPS) { fprintf(stderr, " s: too many gaps in alignmenfΛn", prog); cleanup(l); } if (j > = 0) { siz = dx[dmax].jp.n[j]; xx = dx[dmax].jp.x[j]; dmax + = siz; if (siz < 0) { /* gap in second seq */ pp[l].n[il] = -siz; xx + = siz;
/* id = xx - yy + lenl - 1 */ pp[l] x[il] = xx - dmax + lenl - 1; gaρy+ + ; ngapy -= siz; /* ignore MAXGAP when doing endgaps */ siz = (-siz < MAXGAP | | endgaps)? -siz : MAXGAP; il + + ;
} else if (siz > 0) { /* gap in first seq */ pp[0].n[i0] = siz; pp[0].x[i0] = xx; gapx+ +; ngapx + = siz; /* ignore MAXGAP when doing endgaps */ siz = (siz < MAXGAP | | endgaps)? siz : MAXGAP; i0+ + ; }
} else break;
} /* reverse the order of jmps
*/ for (j = 0, i0~; j < iO; j + + , iO-) { i = pp[0].n[j]; pp[0].n[j] = pp[0].n[i0]; pp[0].n[i0] = i; i = pp[0].x[j]; pp[0].x[j] = pp[0].x[i0]; pp[0].x[i0] = i; } for (j = 0, il--; j < il; j + +, il--) { i = PPLl].n[j]; PP[l]-n[j] = pp[l].n[il]; pp[l].n[il] = i; i = PPlH xu']; PP[i].χ[j] = pp[i] χ[ii]; pp[i].χ[ii] = i;
} if (fd > = 0)
(void) close(fd); if (fj) {
(void) unlink(jname); fj = 0; offset = 0;
} }
Page 3 of nwsubr.c Table 1 (conf)
/*
* write a filled jmp struct offset of the prev one (if any): nwO
*/ writejmps(ix) writejmps int ix;
{ char *mktemp0; if (!fj) { if (mktemp(jname) < 0) { fprintf(stderr, "%s: can't mktempO %s\n", prog, jname); cleanup(l); } if ((fj = fopen(jname, "w")) = = 0) { fprintf(stderr, " %s: can't write %s\n" , prog, jname); exit(l);
} }
(void) fwrite((char *)&dx[ix].jp, sizeof (struct jmp), 1, fj); (void) fwrite((char *)&dx[ix]. offset, sizeof(dx[ix] . offset), 1, fj);
Page 4 of nwsubr.c Table 2
PRO XXXXXXXXXXXXXXX (Length = 15 amino acids)
Comparison Protein XXXXXYYYYYYY (Length = 12 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two polypeptide sequences as determined by ALIGN-2) divided by (the total number of amino acid residues of the PRO polypeptide) =
5 divided by 15 = 33.3%
Table 3
PRO XXXXXXXXXX (Length = 10 amino acids)
Comparison Protein XXXXXYYYYYYZZYZ (Length = 15 amino acids)
% amino acid sequence identity =
(the number of identically matching amino acid residues between the two polypeptide sequences as determined by ALIGN-2) divided by (the total number of amino acid residues of the PRO polypeptide) =
5 divided by 10 = 50% Table 4
PRO-DNA NNNNNNNNNNNNNN (Length = 14 nucleotides) Comparison DNA NNNNNNLLLLLLLLLL (Length = 16 nucleotides)
% nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid sequences as determined by ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic acid sequence) =
6 divided by 14 = 42.9%
Table 5
PRO-DNA NNNNNNNNNNNN (Length = 12 nucleotides) Comparison DNA NNNNLLLVV (Length = 9 nucleotides)
% nucleic acid sequence identity =
(the number of identically matching nucleotides between the two nucleic acid sequences as determined by ALIGN-2) divided by (the total number of nucleotides of the PRO-DNA nucleic acid sequence) =
4 divided by 12 = 33.3% III. Compositions and Methods of the Invention
A. Full-Length PRO polypeptides
The present invention provides newly identified and isolated nucleotide sequences encoding polypeptides referred to in the present application as PRO polypeptides. In particular, cDNAs encoding various PRO polypeptides have been identified and isolated, as disclosed in further detail in the Examples below. It is noted that proteins produced in separate expression rounds may be given different PRO numbers but the UNQ number is unique for any given DNA and the encoded protein, and will not be changed. However, for sake of simplicity, in the present specification the protein encoded by the full length native nucleic acid molecules disclosed herein as well as all further native homologues and variants included in the foregoing definition of PRO, will be referred to as "PRO/number", regardless of their origin or mode of preparation.
As disclosed in the Examples below, various cDNA clones have been deposited with the ATCC. The actual nucleotide sequences of those clones can readily be determined by the skilled artisan by sequencing of the deposited clone using routine methods in the art. The predicted amino acid sequence can be determined from the nucleotide sequence using routine skill. For the PRO polypeptides and encoding nucleic acids described herein, Applicants have identified what is believed to be the reading frame best identifiable with the sequence information available at the time.
B. PRO Polypeptide Variants
In addition to the full-length native sequence PRO polypeptides described herein, it is contemplated that PRO variants can be prepared. PRO variants can be prepared by introducing appropriate nucleotide changes into the PRO DNA, and/or by synthesis of the desired PRO polypeptide. Those skilled in the art will appreciate that amino acid changes may alter post-translational processes of the PRO, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics.
Variations in the native full-length sequence PRO or in various domains of the PRO described herein, can be made, for example, using any of the techniques and guidelines for conservative and non- conservative mutations set forth, for instance, in U.S. Patent No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding the PRO that results in a change in the amino acid sequence of the PRO as compared with the native sequence PRO. Optionally the variation is by substitution of at least one amino acid with any other amino acid in one or more of the domains of the PRO. Guidance in determining which amino acid residue may be inserted, substituted or deleted without adversely affecting the desired activity may be found by comparing the sequence of the PRO with that of homologous known protein molecules and minimizing the number of amino acid sequence changes made in regions of high homology. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e., conservative amino acid replacements. Insertions or deletions may optionally be in the range of about 1 to 5 amino acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity exhibited by the full-length or mature native sequence. PRO polypeptide fragments are provided herein. Such fragments may be truncated at the N- terminus or C-terminus, or may lack internal residues, for example, when compared with a full length native protein. Certain fragments lack amino acid residues that are not essential for a desired biological activity of the PRO polypeptide.
PRO fragments may be prepared by any of a number of conventional techniques. Desired peptide fragments may be chemically synthesized. An alternative approach involves generating PRO fragments by enzymatic digestion, e.g., by treating the protein with an enzyme known to cleave proteins at sites defined by particular amino acid residues, or by digesting the DNA with suitable restriction enzymes and isolating the desired fragment. Yet another suitable technique involves isolating and amplifying a DNA fragment encoding a desired polypeptide fragment, by polymerase chain reaction (PCR). Oligonucleotides that define the desired termini of the DNA fragment are employed at the 5' and 3' primers in the PCR. Preferably, PRO polypeptide fragments share at least one biological and/or immunological activity with the native PRO polypeptide disclosed herein.
In particular embodiments, conservative substitutions of interest are shown in Table 6 under the heading of preferred substitutions. If such substitutions result in a change in biological activity, then more substantial changes, denominated exemplary substitutions in Table 6, or as further described below in reference to amino acid classes, are introduced and the products screened.
Table 6
Original Exemplary Preferred Residue Substitutions Substitutions
Ala (A) val; leu; ile val Arg (R) lys; gin; asn lys Asn (N) gin; his; lys; arg gin Asp (D) glu glu Cys (C) ser ser Gin (0) asn asn Glu (E) asp asp Gly (G) pro; ala ala His (H) asn; gin; lys; arg arg He (I) leu; val; met; ala; phe; norleucine leu
Leu (L) norleucine; ile; val; met; ala; phe ile
Lys (K) arg; gin; asn arg Met (M) leu; phe; ile leu Phe (F) leu; val; ile; ala; tyr leu Pro (P) ala ala Ser (S) thr thr Thr (T) ser ser Trp (W) tyr; phe tyr Tyr (Y) trp; phe; thr; ser phe
Val (V) ile; leu; met; phe; ala; norleucine leu
Substantial modifications in function or immunological identity of the PRO polypeptide are accomplished by selecting substitutions that differ significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. Naturally occurring residues are divided into groups based on common side-chain properties: (1) hydrophobic: norleucine, met, ala, val, leu, ile;
(2) neutral hydrophilic: cys, ser, thr;
(3) acidic: asp, glu;
(4) basic: asn, gin, his, lys, arg;
(5) residues that influence chain orientation: gly, pro; and (6) aromatic: trp, tyr, phe.
Non-conservative substitutions will entail exchanging a member of one of these classes for another class. Such substituted residues also may be introduced into the conservative substitution sites or, more preferably, into the remaining (non-conserved) sites.
The variations can be made using methods known in the art such as oligonucleotide-mediated (site- directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al,
Nucl. Acids Res., .13:4331 (1986); Zoller et al, Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [Wells et al, Gene, 34:315 (1985)], restriction selection mutagenesis [Wells et al, Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or other known techniques can be performed on the cloned DNA to produce the PRO variant DNA. Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence. Among the preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant [Cunningham and Wells, Science, 244: 1081-1085 (1989)]. Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Moi Biol, 150:1 (1976)]. If alanine substitution does not yield adequate amounts of variant, an isoteric amino acid can be used.
C. Modifications of PRO
Covalent modifications of PRO are included within the scope of this invention. One type of covalent modification includes reacting targeted amino acid residues of a PRO polypeptide with an organic derivatizing agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the PRO. Derivatization with bifunctional agents is useful, for instance, for crosslinking PRO to a water- insoluble support matrix or surface for use in the method for purifying anti-PRO antibodies, and vice-versa. Commonly used crosslinking agents include, e.g., l,l-bis(diazoacetyl)-2-phenylethane, glutaraldehyde, N- hydroxysuccinimide esters, for example, esters with 4-azidosalicylic acid, homobifunctional imidoesters, including disuccinimidyl esters such as 3,3'-dithiobis(succinimidylpropionate), bifunctional maleimides such as bis-N-maIeimido-l ,8-octane and agents such as methyl-3-[(p-azidophenyl)dithio]propioimidate. Other modifications include deamidation of glutaminyl and asparaginyl residues to the corresponding glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the α-amino groups of lysine, arginine, and histidine side chains [T.E. Creighton, Proteins: Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79-86 (1983)], acetylation of the N-terminal amine, and amidation of any C-terminal carboxyl group.
Another type of covalent modification of the PRO polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found in native sequence PRO (either by removing the underlying glycosylation site or by deleting the glycosylation by chemical and/or enzymatic means), and/or adding one or more glycosylation sites that are not present in the native sequence PRO. In addition, the phrase includes qualitative changes in the glycosylation of the native proteins, involving a change in the nature and proportions of the various carbohydrate moieties present.
Addition of glycosylation sites to the PRO polypeptide may be accomplished by altering the amino acid sequence. The alteration may be made, for example, by the addition of, or substitution by, one or more serine or threonine residues to the native sequence PRO (for O-linked glycosylation sites). The PRO amino acid sequence may optionally be altered through changes at the DNA level, particularly by mutating the DNA encoding the PRO polypeptide at preselected bases such that codons are generated that will translate into the desired amino acids. Another means of increasing the number of carbohydrate moieties on the PRO polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Such methods are described in the art, e.g., in WO 87/05330 published 11 September 1987, and in Aplin and Wriston, CRC Crit. Rev. Biochem., pp. 259-306 (1981).
Removal of carbohydrate moieties present on the PRO polypeptide may be accomplished chemically or enzymatically or by mutational substitution of codons encoding for amino acid residues that serve as targets for glycosylation. Chemical deglycosylation techniques are known in the art and described, for instance, by Hakimuddin, et al, Arch. Biochem. Biophys., 259:52 (1987) and by Edge et al, Anal. Biochem., 118:131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al, Meth. Enzymol, 138:350 (1987).
Another type of covalent modification of PRO comprises linking the PRO polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol (PEG), polypropylene glycol, or polyoxyalkylenes, in the manner set forth in U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791,192 or 4,179,337. The PRO of the present invention may also be modified in a way to form a chimeric molecule comprising PRO fused to another, heterologous polypeptide or amino acid sequence.
In one embodiment, such a chimeric molecule comprises a fusion of the PRO with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the amino- or carboxyl- terminus of the PRO. The presence of such epitope-tagged forms of the PRO can be detected using an antibody against the tag polypeptide. Also, provision of the epitope tag enables the PRO to be readily purified by affinity purification using an anti-tag antibody or another type of affinity matrix that binds to the epitope tag. Various tag polypeptides and their respective antibodies are well known in the art. Examples include poly-histidine (poly-his) or poly-histidine-glycine (poly-his-gly) tags; the flu HA tag polypeptide and its antibody 12CA5 [Field et al, Moi Cell. Biol,
8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto [Evan et al, Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes Simplex virus glycoprotein D
(gD) tag and its antibody [Paborsky et al, Protein Engineering, 3(6):547-553 (1990)]. Other tag polypeptides include the Flag-peptide [Hopp et al, BioTechnology, 6:1204-1210 (1988)]; the K.T3 epitope peptide [Martin et al, Science, 255:192-194 (1992)]; an α-tubulin epitope peptide [Skinner et al, J. Biol
Chem., 266: 15163-15166 (1991)]; and the T7 gene 10 protein peptide tag [Lutz-Freyermuth et al, Proc.
Natl. Acad. Sci. USA, 87:6393-6397 (1990)].
In an alternative embodiment, the chimeric molecule may comprise a fusion of the PRO with an immunoglobulin or a particular region of an immunoglobulin. For a bivalent form of the chimeric molecule (also referred to as an "immunoadhesin"), such a fusion could be to the Fc region of an IgG molecule. The
Ig fusions preferably include the substitution of a soluble (transmembrane domain deleted or inactivated) form of a PRO polypeptide in place of at least one variable region within an Ig molecule. In a particularly preferred embodiment, the immunoglobulin fusion includes the hinge, CH2 and CH3, or the hinge, CHI, CH2 and CH3 regions of an IgGl molecule. For the production of immunoglobulin fusions see also US Patent No. 5,428,130 issued June 27, 1995.
D. Preparation of PRO
The description below relates primarily to production of PRO by culturing cells transformed or transfected with a vector containing PRO nucleic acid. It is, of course, contemplated that alternative methods, which are well known in the art, may be employed to prepare PRO. For instance, the PRO sequence, or portions thereof, may be produced by direct peptide synthesis using solid-phase techniques [see, e.g., Stewart et al, Solid-Phase Peptide Synthesis, W.H. Freeman Co., San Francisco, CA (1969); Merrifield, J. Am. Chem. Soc, 85:2149-2154 (1963)]. In vitro protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be accomplished, for instance, using an Applied Biosystems Peptide Synthesizer (Foster City, CA) using manufacturer's instructions. Various portions of the PRO may be chemically synthesized separately and combined using chemical or enzymatic methods to produce the full-length PRO. 1. Isolation of DNA Encoding PRO
DNA encoding PRO may be obtained from a cDNA library prepared from tissue believed to possess the PRO mRNA and to express it at a detectable level. Accordingly, human PRO DNA can be conveniently obtained from a cDNA library prepared from human tissue, such as described in the Examples. The PRO-encoding gene may also be obtained from a genomic library or by known synthetic procedures
(e.g., automated nucleic acid synthesis).
Libraries can be screened with probes (such as antibodies to the PRO or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described in Sambrook et al, Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor
Laboratory Press, 1989). An alternative means to isolate the gene encoding PRO is to use PCR methodology [Sambrook et al, supra; Dieffenbach et al, PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)].
The Examples below describe techniques for screening a cDNA library. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA in the library being screened. Methods of labeling are well known in the art, and include the use of radiolabels like 32P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency and high stringency, are provided in Sambrook et al, supra. Sequences identified in such library screening methods can be compared and aligned to other known sequences deposited and available in public databases such as GenBank or other private sequence databases. Sequence identity (at either the amino acid or nucleotide level) within defined regions of the molecule or across the full-length sequence can be determined using methods known in the art and as described herein. Nucleic acid having protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced amino acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al, supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.
2. Selection and Transformation of Host Cells
Host cells are transfected or transformed with expression or cloning vectors described herein for PRO production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences. The culture conditions, such as media, temperature, pH and the like, can be selected by the skilled artisan without undue experimentation. In general, principles, protocols, and practical techniques for maximizing the productivity of cell cultures can be found in Mammalian Cell Biotechnology: A Practical Approach, M. Butler, ed. (IRL Press, 1991) and Sambrook et al, supra.
Methods of eukaryotic cell transfection and prokaryotic cell transformation are known to the ordinarily skilled artisan, for example, CaCl2, CaP04, liposome-mediated and electroporation. Depending on the host cell used, transformation is performed using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described in Sambrook et al, supra, or electroporation is generally used for prokaryotes. Infection with Agrobacterium tumefaciens is used for transformation of certain plant cells, as described by Shaw et al, Gene, 23:315 (1983) and WO 89/05859 published 29 June 1989. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, 52:456-457 (1978) can be employed. General aspects of mammalian cell host system transfections have been described in U.S. Patent No. 4,399,216. Transformations into yeast are typically carried out according to the method of Van Solingen et al, J. Bad., 130:946 (1977) and Hsiao et al, Proc. Natl. Acad. Sci. (USA), 76:3829 (1979). However, other methods for introducing DNA into cells, such as by nuclear microinjection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g., polybrene, polyornithine, may also be used. For various techniques for transforming mammalian cells, see Keown et al, Methods in Enzymology, 185:527-537 (1990) and Mansour et al. Nature, 336:348-352 (1988).
Suitable host cells for cloning or expressing the DNA in the vectors herein include prokaryote, yeast, or higher eukaryote cells. Suitable prokaryotes include but are not limited to eubacteria, such as Gram-negative or Gram-positive organisms, for example, Enterobacteriaceae such as E. coli. Various E. coli strains are publicly available, such as E. coli K12 strain MM294 (ATCC 31,446); E. coli XI 776 (ATCC 31,537); E. coli strain W31 10 (ATCC 27,325) and K5 772 (ATCC 53,635). Other suitable prokaryotic host cells include Enterobacteriaceae such as Escherichia, e.g., E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, e.g., Salmonella typhimurium, Serratia, e.g., Serratia marcescans, and Shigella, as well as Bacilli such as B. subtilis and B. licheniformis (e.g., B. licheniformis 41P disclosed in DD 266,710 published 12 April 1989), Pseudomonas such as P. aeniginosa, and Streptomyces. These examples are illustrative rather than limiting. Strain W3110 is one particularly preferred host or parent host because it is a common host strain for recombinant DNA product fermentations. Preferably, the host cell secretes minimal amounts of proteolytic enzymes. For example, strain W3110 may be modified to effect a genetic mutation in the genes encoding proteins endogenous to the host, with examples of such hosts including E. coli W31 10 strain 1A2, which has the complete genotype tonA ; E. coli W31 10 strain 9E4, which has the complete genotype tonA ptr3; E. coli W3110 strain 27C7 (ATCC 55,244), which has the complete genotype tonA ptr3 phoA El 5 (argF-lac)169 degP ompT kanr; E. coli W31 10 strain 37D6, which has the complete genotype tonA ptr 3 pho A El 5 (argF-lac)169 degP ompT rbs7 ilvG lan'; E. coli W3110 strain 40B4, which is strain 37D6 with a non-kanamycin resistant degP deletion mutation; and an E. coll strain having mutant periplasmic protease disclosed in U.S. Patent No. 4,946,783 issued 7 August 1990. Alternatively, in vitro methods of cloning, e.g., PCR or other nucleic acid polymerase reactions, are suitable.
In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for PRO-encoding vectors. Saccharomyces cerevisiae is a commonly used lower eukaryotic host microorganism. Others include Schizosaccharomyces pombe (Beach and Nurse,
Nature, 290: 140 [1981 ]; EP 139,383 published 2 May 1985); Kluyveromyces hosts (U.S. Patent No. 4,943,529; Fleer et al, Bio/Technology, 9:968-975 (1991)) such as, e.g., K. lactis (MW98-8C, CBS683, CBS4574; Louvencourt et al, J. Bacteriol, 154(2):737-742 [1983]), K. fragilis (ATCC 12,424), K. bulgaricus (ATCC 16,045), K. wickeramii (ATCC 24,178), K. waltii (ATCC 56,500), K. drosophilarum (ATCC 36,906; Van den Berg et al, Bio/Technology, 8: 135 (1990)), K. thermotolerans, and K. marxianus; yarrowia (EP 402,226); Pichia pastoris (EP 183,070; Sreekrishna et al, J. Basic Microbiol, 28:265-278 [1988]); Candida: Trichoderma reesia (EP 244,234); Neurospora crassa (Case et al, Proc. Natl. Acad. Sci. USA, 76:5259-5263 [1979]); Schwanniomyces such as Schwanniomyces occidentalis (EP 394,538 published 31 October 1990); and filamentous fungi such as, e.g., Neurospora, Penicillium, Tolypocladium (WO 91/00357 published 10_ January 1991), and Aspergillus hosts such as A. nidulαns (Ballance et αl, Biochem.
Biophys. Res. Commun., 112:284-289 [1983]; Tilburn et αl., Gene, 26:205-221 [1983]; Yelton et αl., Proc. Nαtl Acαd. Sci. USA, 81 : 1470-1474 [1984]) and A. niger (Kelly and Hynes, EMBO J., 4:475-479 [1985]). Methylotropic yeasts are suitable herein and include, but are not limited to, yeast capable of growth on methanol selected from the genera consisting of Hαnsenulα, Candida, Kloeckera, Pichia, Saccharomyces, Torulopsts, and Rhodotorula. A list of specific species that are exemplary of this class of yeasts may be found in C. Anthony, The Biochemistry of Methylotrophs, 269 (1982).
Suitable host cells for the expression of glycosylated PRO are derived from multicellular organisms. Examples of invertebrate cells include insect cells such as Drosophila S2 and Spodoptera Sf9, as well as plant cells. Examples of useful mammalian host cell lines include Chinese hamster ovary (CHO) and COS cells. More specific examples include monkey kidney CV1 line transformed by SV40 (COS-7, ATCC
CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al, J. Gen Virol, 36:59 (1977)); Chinese hamster ovary cells/-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod., 23:243-251 (1980)); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); and mouse mammary tumor (MMT 060562, ATCC CCL51). The selection of the appropriate host cell is deemed to be within the skill in the art.
3. Selection and Use of a Replicable Vector
The nucleic acid (e.g., cDNA or genomic DNA) encoding PRO may be inserted into a replicable vector for cloning (amplification of the DNA) or for expression. Various vectors are publicly available. The vector may, for example, be in the form of a plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art. Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard ligation techniques which are known to the skilled artisan.
The PRO may be produced recombinantly not only directly, but also as a fusion polypeptide with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide. In general, the signal sequence may be a component of the vector, or it may be a part of the PRO-encoding DNA that is inserted into the vector. The signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, lpp, or heat-stable enterotoxin II leaders. For yeast secretion the signal sequence may be, e.g., the yeast invertase leader, alpha factor leader (including Saccharomyces and Kluyveromyces α- factor leaders, the latter described in U.S. Patent No. 5,010,182), or acid phosphatase leader, the C. albicans glucoamylase leader (EP 362,179 published 4 April 1990), or the signal described in WO 90/13646 published 15 November 1990. In mammalian cell expression, mammalian signal sequences may be used to direct secretion of the protein, such as signal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders. Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for cloning vectors in mammalian cells. Expression and cloning vectors will typically contain a selection gene, also termed a selectable marker. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
An example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the PRO-encoding nucleic acid, such as DHFR or thymidine kinase. An appropriate host cell when wild-type DHFR is employed is the CHO cell line deficient in DHFR activity, prepared and propagated as described by Urlaub et al, Proc. Natl. Acad. Sci. USA, 77:4216 (1980). A suitable selection gene for use in yeast is the trp\ gene present in the yeast plasmid YRp7 [Stinchcomb et al, Nature, 282:39 (1979); Kingsman et al, Gene, 7: 141 (1979); Tschemper et al, Gene, 10: 157 (1980)]. The trp\ gene provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, 85:12 (1977)].
Expression and cloning vectors usually contain a promoter operably linked to the PRO-encoding nucleic acid sequence to direct mRNA synthesis. Promoters recognized by a variety of potential host cells are well known. Promoters suitable for use with prokaryotic hosts include the β-lactamase and lactose promoter systems [Chang et al, Nature, 275:615 (1978); Goeddel et al, Nature, 281_:544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., 8:4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al, Proc. Natl. Acad. Sci. USA, 80:21-25 (1983)]. Promoters for use in bacterial systems also will contain a Shine-Dalgarno (S.D.) sequence operably linked to the DNA encoding PRO. Examples of suitable promoting sequences for use with yeast hosts include the promoters for 3- phosphoglycerate kinase [Hitzeman et al, J. Biol. Chem., 255:2073 (1980)] or other glycolytic enzymes [Hess et al, J. Adv. Enzyme Reg., 7: 149 (1968); Holland, Biochemistry, 17:4900 (1978)], such as enolase, glyceraldehyde-3 -phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3 -phosphoglycerate utase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochro e C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, metallothionein, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use in yeast expression are further described in EP 73,657.
PRO transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and Simian Virus 40 (SV40), from heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin promoter, and from heat-shock promoters, provided such promoters are compatible with the host cell systems.
Transcription of a DNA encoding the PRO by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription. Many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, α-fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. The enhancer may be spliced into the vector at a position 5' or 3' to the PRO coding sequence, but is preferably located at a site 5' from the promoter.
Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular organisms) will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding PRO.
Still other methods, vectors, and host cells suitable for adaptation to the synthesis of PRO in recombinant vertebrate cell culture are described in Gething et al, Nature, 293:620-625 (1981); Mantei et al, Nature, 281:40-46 (1979); EP 1 17,060; and EP 117,058.
4. Detecting Gene Amplification/Expression
Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA, 77:5201-5205 (1980)], dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes. The antibodies in turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can be detected.
Gene expression, alternatively, may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence PRO polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to PRO DNA and encoding a specific antibody epitope.
5. Purification of Polypeptide Forms of PRO may be recovered from culture medium or from host cell lysates. If membrane- bound, it can be released from the membrane using a suitable detergent solution (e.g. Triton-X® 100) or by enzymatic cleavage. Cells employed in expression of PRO can be disrupted by various physical or chemical means, such as freeze-thaw cycling, sonication, mechanical disruption, or cell lysing agents.
It may be desired to purify PRO from recombinant cell proteins or polypeptides. The following procedures are exemplary of suitable purification procedures: by fractionation on an ion-exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G-75; protein A Sepharose columns to remove contaminants such as IgG; and metal chelating columns to bind epitope-tagged forms of the PRO. Various methods of protein purification may be employed and such methods are known in the art and described for example in Deutscher, Methods in
Enzymology, 182 (1990); Scopes, Protein Purification: Principles and Practice, Springer- Verlag, New York (1982). The purification step(s) selected will depend, for example, on the nature of the production process used and the particular PRO produced.
Many heterogeneous proteins expressed in E. coll require refolding in order to impart activity. When this is necessary, the following procedure can be used. For a general discussion of procedures suitable for refolding of recombinant or synthetic PRO polypeptide including any N- or C-terminal extended forms, the reader is referred to the following patents: Builder et al, U.S. Patent No. 4,511,502; Jones et al, U.S. Patent 4,512,922; Olson, U.S. Patent No. 4,518,526; Builder et al, U.S. Patent 4,620,948.
IV. Therapeutic Indications
Various ocular disorders can result in the death of retinal cells. These include such widely disparate conditions as detachment of the retina and pigment epithelium, degenerative myopia, acute retinal necrosis syndrome (ARN), and traumatic chorioretinopathies or contusion (Purtscher's Retinopathy). Retinal tears is a condition characterized by where the retina tears or separates from the underlying choroid, which can sometimes result in rupturing of the choroid. Retinal tears may occur for a wide variety of reasons. Particularly troublesome are macular holes which produce blurred central vision or metamorpfiopsia.
While the direct cause of most macular holes is unknown, they have been associated with trauma, cystic degeneration and vitreoretinal traction. Also, full thickness macular holes have appeared following myopic degeneration, laser photocoagulation, lightning strike and pilocarpine administration. Macular holes are also present in high frequency after cataract extraction. A particular form of acute macular holes is idiopathic senile macular hole, which involves a full thickness hole through the macula surrounded by annular retinal detachment. It is believed that macular holes begin with central or foveolar detachment, which then eventually develops into a full-depth macular hole. Gass et al, Arch. Ophthalmol. 106: 629-639 (1988). While surgical procedures, such as tτans-para plana vitrectomy may interrupt the progress of macular degeneration to a full blown macular hole, this operation can permanently damage central vision, and typically only improves vision 40% of the time.
Other ocular disorders which can result in photoreceptor cell death include edema, ischemic conditions and uveitis. Macular and retinal edema are often associated with metabolic illnesses such as diabetes mellitus. Retinal edema is found in a large percentage of individuals who have undergone cataract extraction and other surgical procedures upon the eye. Edema is also found with accelerated or malignant hypertension. Macular edema is a common complication of prolonged inflammation due to uveitis, Eales disease, or other diseases. Local edema is associated with multiple cystoid bodies ("cotton bodies") as a result of AIDS. Retinal ischemia can occur from either choroidal or retinal vascular diseases, such as central or branch retinal vision occlusion, collagen vascular diseases and thrombocytopenic purpura. Retinal vasculitis and occlusion is seen with Eales disease and systemic lupus erythematosus.
Age-related macular degeneration (AMD) is the major cause of severe visual loss in United States citizens over the age of 55. AMD may occur either in an atrophic or exudative form. Most AMD patients have a build up of deposits within and under the retinal pigment epithelium in the macular region resulting in atrophy of the retina and the retinal pigment epithelium. The retinal pigment scavenge for photoreceptor discs from the rods and cones for years and accumulate intracellular wastes. The incompletely digested residues reduce cytoplasmic space and interfere with metabolism. Feeny-Burns, et al, Invest Ophthal. Moi Vis. Sci. (1984), 25: 195-200. As the cell volume available to the organelles diminishes, the capacity to digest photoreceptors decreases, which may be the basis for macular degeneration.
Exudative AMD is characterized by the growth of blood vessels from the choriocapillaris through defects in Bruch's membrane, and in some cases the underlying retinal pigment epithelium (RPE). The accumulation of serous or hemorrhagic exudates escaping from these vessels results in fibrous scarring of the macular region with attendant degeneration of the neuroretina and permanent loss of central vision. Exudative AMD has also been associated with choroidal neovascularization, detachment and tears of the retinal pigment epithelium. The cascade retinal events is responsible for more than 80% of cases of significant visual loss in patients with AMD.
Laser photocoagulation has been attempted in an effort to ameliorate the initial or recurrent neovascular lesions associated with AMD. Arch. Ophthalmol (1991) 109: 1220; Arch. Ophthalmol. (1991) 109: 1232; Arch. Ophthalmol. (1991) 109:1242. Unfortunately, AMD patients with subfoveal lesions subjected to laser treatment experienced a severe reduction in visual acuity (mean 3 lines) at 3 months follow-up. Moreover, at two years post-treatment treated eyes had only marginally better visual acuity than their untreated counterparts (means of 20/320 and 20/400, respectively). Another drawback of the procedure is that vision immediately after surgery is worse. As a result, the retinal neuron survival agents of the present invention are promising candidates for the treatment of retinal detachment, retinal tears, degenerative myopia, acute retinal necrosis syndrome (ARN), and traumatic chorioretinopathies or contusion (including Purtscher's retinopathy), macular holes (including idiopathic senile macular holes), macular and retinal edema, macular degeneration (including age- related macular degeneration or AMD), edema, ischemic conditions (e.g., central or branch retinal vision occlusion, colagen vacuolar diseases, thrombocytompenic purpura), uveitis and retinal vasculitis and occlusion associated with Eales disease and systemic lupus erythematosus.
V. Modes For Carrying Out The Invention:
A. Retinal Neuron (including photoreceptor) Survival assays:
In these assays, neural retinas are removed from pigment epithelium and dissociated into a single cell suspension using 0.25% trypsin in Ca2+, Mg2+-free PBS. The cells are then plated out in 96-well plates at 100,000 cells per well in DMEM/F12 supplemented with N2. After 2-3 days in culture, the cells are fixed and stained. Since death typically occurs upon detachment of neural retinal cells from the underlying pigment epithelium the relative survival enhancing effect of the tested agent can be readily determined by comparison with the untreated control wells.
The procedure is described in greater detail in the examples.
B. Age-related macular degeneration (AMD):
In this assay, the effectiveness and safety of locally administered PRO polypeptide can be examined using a procedure substantially similar to that outlined in WO 94/01124, filed 8 July 1993 which describes subretinal or intravitreal injections of retinal survival promoting therapeutic agents. Briefly, patients with visual acuity of 20/160 or better with a recent diagnosis of AMD are examined for change in visual acuity from baseline and stabilization. Study parameters should measure best corrected visual acuity for both distance and near vision, intraocular pressure, lens status and refraction. The amount of serous and hyperfluorescence from classic/occult neovascularization, total lesion size and foveal involvement are also measured on fluorescein angiography and ICG (indocyanine green) angiography.
C. Macular holes:
In this assay, the safety and effectiveness of locally administered PRO polypeptide can be examined using a procedure substantially similar to that outlined in WO 94/01124, filed 8 July 1993 which describes subretinal or intravitreal injection of retinal survival promoting therapeutic agents. Briefly, patients with confirmed macular holes are examined for visual acuity and analyzed by intraocular pressure, fundus photographs, and fluorescein angiography.
The rational for treatment is to induce the flattening of the edges of the macular hoes in order to resolve retinal detachment and thickening surrounding the hole. It is believed that a reduction in the traction force which elevates the retina around the hole coupled with and induction of the chorioretinal adhesion along the edge of the hole is necessary for therapeutic effect. The procedure is described in more detail in the examples. D. Light-induced photoreceptor injury:
In this assay, an albino rat is maintained in first a cyclic light environment followed by exposure to a constant light source with and without administration of the tested photoreceptor survival agent. The intravitreal administration of factors into the eyes of albino rats enables the assessment of both the ability of the factors to rescue photoreceptors from degeneration as well as the side effects, such as incidence of macrophages, associated with each factor.
Briefly, rats are given intraocular injections prior to constant light exposure and compared to control animals who received sham and no injections. Subsequent to constant light exposure, the eyes are removed, embedded in epoxy resin and sectioned along the vertical meridian. The degree of light-induced retinal degeneration can be measured first by examining the outer nuclear layer thickness and second by a subjective score assigned to the relative integrity of the retina.
E. Light ablation:
In this assay, the degree of photoreceptor rescue is measured in female Sprague-Dawley rats in a modification of the procedure described in Reme et al, Degen. Dis. Retina, Ch. 3, Ed. R.E. Anderson et al,
Plenum Press, New York (1995). Briefly, animals are first acclimated to cyclical lighting, followed by immersion in total darkness. Animals are injected with test factor prior to intermittent light exposure. The degree of retinal degeneration or survival promoting activity of the tested factors is reported as the thickness of the photoreceptor cell layer or number of TUNEL labeled photoreceptor cell nuclei. F. Corneal Pocket assay:
In this assay, particular agents are tested to determine whether they are angiogenic under a procedure adapted from Polverini et al, Methods Enzymol 198: 440-450 (1991). Briefly, Sprague-Dawley are anesthetized, secured and an incision is made in their corneas into which is placed a pellet of the test factor in combination with sucralfate and Hydron.
G. Vascular Endothelial Cell Mitogenicity Assay:
This particular assay measures the mitogenicity (e.g., angiogenesis) of the test factor on vascular endothelial cells. It was developed as a reliable means of measuring the purification of bFGF (SEQ ID
NO:3) as described by Ferrara, et al, Methods of Enzymology 198: 391-405 (1991). Briefly, bovine adrenal cortex-derived cells are grown and maintained in culture in the presence of low glucose DMEM, the test factor is administered and test cultures vs. controls are measured.
H. Administration Methods:
The PRO polypeptides of the present invention can be delivered to the eye through a variety of routes. Methods of introduction include any mode of administration known in the art, including but not limited to intravenously, intraarterially, intrathecally, subcutaneously, intradermally, by injection into involved tissue, intranasally, intramuscularly, intraperitoneally, orally, or via an implanted device. They may be delivered intraocularly, by topical application to the eye or by intraocular injection into, for example the vitreous or subretinal (interphotoreceptor) space. Alternatively, they may be delivered locally by insertion or injection into the tissue surrounding the eye. They may be delivered systemically through an oral route or by subcutaneous, intravenous or intramuscular injection. Alternatively, they may be delivered by means of a catheter or by means of an implant, wherein such an implant is made of a porous, non-porous or gelatinous material, including membranes such as silastic membrane or fibers, biodegradable polymers, or proteinaceous material. All of the above delivery methods may also be carried out by means of a sustained release delivery system. The factors may be administered prior to the onset of the condition, to prevent its occurrence, for example, during surgery on the eye, or immediately after the onset of the pathological condition or during the occurrence of an acute or protracted condition. Intravitreal injection of potential retinal neuron survival promoting factors has several advantages over systemic applications. The amount of any specific agent that reaches the retina can be more accurately determined, since the eye is a round, relatively contained structure and the agent is injected directly into it. Moreover, the amount of agent that needs to be injected is minuscule compared to systemic injections. For example, a single microliter in volume (about 1 microgram of agent) is used for intravitreal injection, as compared to one to several milliliters (ten to several hundred milligrams of agent) necessary for systemic injections. In addition, the intravitreal route of administration avoids the potentially toxic effect of some agents.
Further, it may be desirable to administer the pharmaceutical compositions of the invention locally to the area in need of treatment, this may be achieved by, for example, local infusion during surgery, by injection, by means of a catheter, or by means of an implant, wherein such implant can be of a porous, non- porous, or gelatinous material, including membranes, such as silastic membranes or fibers.
The factors of the present invention may be modified to enhance their ability to penetrate the blood-retinal barrier. Such modification may include increasing their lipophilicity by, for example, glycosylation, or increasing their net charge by methods known in the art. The factors may be delivered alone or in combination, and may be delivered along with a pharmaceutically acceptable vehicle. Ideally, such a vehicle would enhance the stability and/or delivery properties. The invention also provides for pharmaceutical compositions containing the active factor or fragment or derivative thereof, which can be administered using a suitable vehicle such as liposomes, microparticles or microcapsules. In various embodiments of the invention, it may be useful to use such compositions to achieve sustained release of the active component.
I. Pharmaceutical Compositions and Dosages
Therapeutic formulations of the polypeptide or antibody are prepared for storage as lyophilized formulations or aqueous solutions by mixing the polypeptide having the desired degree of purity with optional "pharmaceutically-acceptable" or "physiologically-acceptable" carriers, excipients or stabilizers typically employed in the art (all of which are termed "excipients"). For example, buffering agents, stabilizing agents, preservatives, isotonifiers, non-ionic detergents, antioxidants and other miscellaneous additives. (See Remington 's Pharmaceutical Sciences, 16th edition, A. Osol, Ed. (1980)). Such additives must be nontoxic to the recipients at the dosages and concentrations employed. Buffering agents help to maintain the pH in the range which approximates physiological conditions. They are preferably present at concentration ranging from about 2mM to about 50 mM. Suitable buffering agents for use with the present invention include both organic and inorganic acids and salts thereof such as citrate buffers (e.g., monosodium citrate-disodium citrate mixture, citric acid-trisodium citrate mixture, citric acid-monosodium citrate mixture, etc.), succinate buffers (e.g., succinic acid-monosodium succinate mixture, succinic acid-sodium hydroxide mixture, succinic acid-disodium succinate mixture, etc.), tartrate buffers (e.g., tartaric acid-sodium tartrate mixture, tartaric acid-potassium tartrate mixture, tartaric acid-sodium hydroxide mixture, etc.), fumarate buffers (e.g., fumaric acid-monosodium fumarate mixture, etc.), fumarate buffers (e.g., fumaric acid-monosodium fumarate mixture, fumaric acid-disodium fumarate mixture, monosodium fumarate-disodium fumarate mixture, etc.), gluconate buffers (e.g., gluconic acid- sodium glyconate mixture, gluconic acid-sodium hydroxide mixture, gluconic acid-potassium glyconate mixture, etc.), oxalate buffer (e.g., oxalic acid-sodium oxalate mixture, oxalic acid-sodium hydroxide mixture, oxalic acid-potassium oxalate mixture, etc.), lactate buffers (e.g., lactic acid-sodium lactate mixture, lactic acid-sodium hydroxide mixture, lactic acid-potassium lactate mixture, etc.) and acetate buffers (e.g., acetic acid-sodium acetate mixture, acetic acid-sodium hydroxide mixture, etc.). Additionally, there may be mentioned phosphate buffers, histidine buffers and trimethylamine salts such as Tris.
Preservatives are added to retard microbial growth, and are added in amounts ranging from 0.2% - 1% (w/v). Suitable preservatives for use with the present invention include phenol, benzyl alcohol, meta- cresol, methyl paraben, propyl paraben, octadecyldimethylbenzyl ammonium chloride, benzalconium halides (e.g., chloride, bromide, iodide), hexamethonium chloride, alkyl parabens such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol, and 3-pentanol.
Isotonicifiers sometimes known as "stabilizers" are present to ensure isotonicity of liquid compositions of the present invention and include polyhydric sugar alcohols, preferably trihydric or higher sugar alcohols, such as glycerin, erythritol, arabitol, xylitol, sorbitol and mannitol. Polyhydric alcohols can be present in an amount between 0.1% to 25% by weight, preferably 1% to 5% taking into account the relative amounts of the other ingredients.
Stabilizers refer to a broad category of excipients which can range in function from a bulking agent to an additive which solubilizes the therapeutic agent or helps to prevent denaturation or adherence to the container wall. Typical stabilizers can be polyhydric sugar alcohols (enumerated above); amino acids such as arginine, lysine, glycine, glutamine, asparagine, histidine, alanine, ornithine, L-leucine, 2-phenylalanine, glutamic acid, threonine, etc., organic sugars or sugar alcohols, such as lactose, trehalose, stachyose, mannitol, sorbitol, xylitol, ribitol, myoinisitol, galactitol, glycerol and the like, including cyclitols such as inositol; polyethylene glycol; amino acid polymers; sulfur containing reducing agents, such as urea, glutathione, thioctic acid, sodium thioglycolate, thioglycerol, α-monothioglycerol and sodium thio sulfate; low molecular weight polypeptides (i.e. < 10 residues); proteins such as human serum albumin, bovine serum albumin, gelatin or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone monosaccharides, such as xylose, mannose, fructose, glucose; disaccharides such as lactose, maltose, sucrose and trisaccacharides such as raffinose; polysaccharides such as dextran. Stabilizers can be present in the range from 0.1 to 10,000 weights per part of weight active protein. Non-ionic surfactants or detergents (also known as "wetting agents") are present to help solubilize the therapeutic agent as well as to protect the therapeutic protein against agitation-induced aggregation, which also permits the formulation to be exposed to shear surface stressed without causing denaturafion of the protein. Suitable non-ionic surfactants include polysorbates (20, 80, etc.), polyoxamers (184, 188 etc.), Pluronic® polyols, polyoxyethylene sorbitan monoethers (Tween®-20, Tween®-80, etc.). Non-ionic surfactants are present in a range of about 0.05 mg/ml to about 1.0 mg/ml, preferably about 0.07 mg/ml to about 0.2 mg/ml.
Additional miscellaneous excipients include bulking agents, (e.g. starch), chelating agents (e.g. EDTA), antioxidants (e.g., ascorbic acid, methionine, vitamin E), and cosolvents. The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. For example, it may be desirable to further provide an immunosuppressive agent. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
The active ingredients may also be entrapped in microcapsule prepared, for example, by coascervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin- microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington 's Pharmaceutical Sciences, 16th edition, A. Osal, Ed. (1980). The formulations to be used for in vivo administration must be sterile. This is readily accomplished, for example, by filtration through sterile filtration membranes.
Where sustained release administration of a PRO polypeptide is desired in a formulation with release characteristics suitable for the treatment of any disease or disorder requiring administration of the respective polypeptide, microencapsulation of the respective PRO polypeptide is contemplated. Microencapsulation of recombinant proteins for sustained release had been successfully performed with human growth hormone (rhGH), interferon (rhIFN), interleukin-2, and MN rgpl20. Johnson et al, Nat. Med., 2: 795-799 (1996); Yasuda, Biomed. Ther. 27: 1221-1223 (1993); Hora et al, Bio/Technology 8: 755- 758 (1990); Cleland, "Design and Production of Single Immunization Vaccines Using Polylactide Polyglycolide Microsphere Systems," in Vaccine Design: The Subunit and Adjuvant Approach, Powell and Newman , eds. (Plenum Press: New York, 1995), pp. 439-462; WO 97/03692, WO 96/40072, WO
96/07399; and U.S. Pat. No. 5,654,010.
Sustained-release formulations may be employed with the method of this invention, alternatively through the use of poly-lactic-coglycolic acid (PLGA) polymer due to its biocompatibility and wide range of biodegradable properties. The degradation products of PLGA, lactic and glycolic acids, can be cleared quickly within the human body. Moreover, the degradability of this polymer can be adjusted from months to years depending on its molecular weight and composition. Lewis, "Controlled Release of Bioactive Agents from Lactide/Glycolide Polymer," in: M. Chasin and R. Langer (Eds.), Biodegradable Polymers as Drug Delivery Systems (Marcel Dekker: New York, 1990), pp. 1-41.
Alternatively still, suitable examples of sustained-release preparations include semi-permeable matrices of solid hydrophobic polymers containing the antibody mutant, which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No.3,773,919), copolymers of L-glutamic acid and ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3- hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved.
For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions. The amount of therapeutic polypeptide, antibody or fragment thereof which will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. Where possible, it is desirable to determine the dose- response curve and the pharmaceutical compositions of the invention first in vitro, and then in useful animal model systems prior to testing in humans. However, based on common knowledge of the art, a pharmaceutical composition effective in promoting the survival of sensory neurons may provide a local therapeutic agent concentration of between about 5 and 20 ng/ml, and, preferably, between about 10 and 20 ng/ml. In an additional specific embodiment of the invention, a pharmaceutical composition effective in promoting the growth and survival of retinal neurons may provide a local therapeutic agent concentration of between about 10 ng/ml and 100 ng/ml. In a preferred embodiment, an aqueous solution of therapeutic polypeptide, antibody or fragment thereof is administered by subcutaneous injection. Each dose may range from about 0.5 μg to about 50 μg per kilogram of body weight, or more preferably, from about 3 μg to about 30 μg per kilogram body weight.
The dosing schedule for subcutaneous administration may vary form once a week to daily depending on a number of clinical factors, including the type of disease, severity of disease, and the subject's sensitivity to the therapeutic agent.
The amount of PRO protein which will be effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. Where possible, it is desirable to determine the dose-response curve and the pharmaceutical compositions of the invention first in vitro, and then in useful animal model systems prior to testing in humans. Animal experiments provide reliable guidance for the determination of effective doses for human therapy. Interspecies scaling of effective doses can be performed following the principles laid down by Mordenti, J. and Chappell, W., "The Use of Interspecies Scaling in Toxicokinetics" , In Toxicokinetics and New Drug Development, Yacobi et al, Eds. Pergamon Press, New York 1989, pp.42-96.
However, based on common knowledge of the art, a pharmaceutical composition effective in promoting the survival of sensory neurons may provide a local PRO protein concentration of between about 10 and 1000 ng/ml, preferably between 100 and 800 ng/ml and most preferably between about 200 ng ml and 600 ng/ml of PRO polypeptide. Guidance as to particular dosages and methods of delivery is provided in the literature; see, for example, U.S. Pat. Nos. 4,657,760; 5,206,344; or 5,224,212. It is contemplated that different formulations will be effective for different treatment compounds and different disorders, that administration targeting one organ or tissue, for example, may necessitate delivery in a manner different from that to another organ or tissue.
The dosing schedule for subvitreous administration of PRO may vary from once a week to daily depending on a number of clinical factors, including the type of disease, severity of disease, and the subject's sensitivity to PRO, respectively. Nonlimiting examples of dosing schedules are 3 μg/kg administered twice a week, three times a week or daily, a dose of 7 μg/kg twice a week, three times a week or daily, a dose of 10 μg kg twice a week, three times a week or daily.
Effective doses of additional neurotrophic factors administered in combination with PRO polypeptide are in the same dose ranges as the effective dose of the principle respective active compound described herein. The active compound of the present method, PRO polypeptide may optionally be formulated with a second agent, such as a neurotrophic factor. Exemplary neurotrophic factors include: nerve growth factor (NGF), aGF, ciliary neurotrophic factor (CNTF), bovine-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), neurotrophin-4 (NT-4), aFGF, IL-lβ, TNFα, Insulin-like growth factor (IGF-1, IGF-2), transforming growth factor beta (TGF-β, TGF-β 1) or skeletal muscle extract, may be administered in any sterile biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. However, certain factors such as bFGF, CNTF or IL-lβ should be employed cautiously, as these agents may cause undesirable retinal complications such as macrophage proliferation, disorganization or the retinal structure, cell proliferation or inflammation.
If the subject manifests undesired side effects such as temperature elevation, cold or flu-like symptoms, fatigue, etc., it may be desirable to administer a lower dose at more frequent intervals. One or more additional drugs may be administered in combination with PRO polypeptideto alleviate such undesired side effects, for example, an anti-pyretic, anti-inflammatory or analgesic agent.
J. PRO Agonists/ Antagonists
This invention encompasses methods of screening compounds to identify those that mimic the PRO polypeptide (agonists) or prevent the effect of the respective polypeptide (antagonists). Screening assays for antagonist drug candidates are designed to identify compounds that bind or complex with the PRO polypeptides encoded by the genes identified herein, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins. Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates.
The assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays, and cell-based assays, which are well characterized in the art. All assays for antagonists are common in that they call for contacting the drug candidate with a PRO polypeptide encoded by a nucleic acid identified herein under conditions and for a time sufficient to allow these two components to interact. In binding assays, the interaction is binding and the complex formed can be isolated or detected in the reaction mixture. In a particular embodiment, the PROpolypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e.g., on a microtiter plate, by covalent or non-covalent attachments. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the PRO polypeptide and drying. Alternatively, an immobilized antibody, e.g., a monoclonal antibody, specific for the PRO polypeptide to be immobilized can be used to anchor it to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g., the coated surface containing the anchored component. When the reaction is complete, the non-reacted components are removed, e.g., by washing, and complexes anchored on the solid surface are detected. When the originally non-immobilized component carries a detectable label, the detection of label immobilized on the surface indicates that complexing occurred. Where the originally non-immobilized component does not carry a label, complexing can be detected, for example, by using a labeled antibody specifically binding the immobilized complex. If the candidate compound interacts with but does not bind to a particular PRO polypeptide encoded by a gene identified herein, its interaction with that polypeptide can be assayed by methods well known for detecting protein-protein interactions. Such assays include traditional approaches, such as, e.g., cross-linking, co-immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workers (Fields and Song, Nature (London) 340: 245-246 (1989); Chien et al, Proc. Natl.
Acad. Sci. USA 88: 9578-9582 (1991)) as disclosed by Chevray and Nathans, Proc. Natl. Acad. Sci. USA 89: 5789-5793 (1991). Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domain, one acting as the DNA-binding domain, the other one functioning as the transcription- activation domain. The yeast expression system described in the foregoing publication (generally referred to as the "two-hybrid system") takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain. The expression of a GALl-/αcZ reporter gene under control of GAL4-activated promoter depends on reconstitution of GAL4 activity via protein-protein interaction. Colonies containing interacting polypeptides are detected with a chromogenic substrate for β-galactosidase. A complete kit (MATCHMAKER™) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech. This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions.
Compounds that interfere with the interaction of a gene encoding a PRO polypeptide identified herein and other intra- or extracellular components can be tested as follows: usually a reaction mixture is prepared containing the product of the gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products. To test the ability of a candidate compound to inhibit binding, the reaction is run in the absence and in the presence of the test compound. In addition, a placebo may added to a third reaction mixture, to serve as a positive control. The binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described hereinabove. The formation of a complex in the control reaction(s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner.
To assay for antagonists, the PRO polypeptide may be added to a cell along with the compound to be screened for a particular activity and the ability of the compound to inhibit the activity of interest in the presence of the respective PRO polypeptide indicates that the compound is an antagonist of the respective polypeptide. Alternatively, antagonists may be detected by combining the respective polypeptide and a potential antagonists with membrane-bound PRO polypeptide receptors or recombinant receptors under appropriate conditions for a competitive inhibition assay. The PRO polypeptide can be labeled, such as by radioactivity, such that the number of respective polypeptide molecules bound to the receptor can be used to determine the effectiveness of the potential antagonist. The gene encoding the receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Coligan et al, Current Protocols in Immunol. 1(2): Ch. 5 (1991). Preferably, expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the PRO polypeptide and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to respective labeled polypeptide. The PRO polypeptide can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an interactive sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor.
In another assay for antagonists, mammalian cells or a membrane preparation expressing the receptor would be included with labeled PRO polypeptide, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments. Alternatively, a potential antagonist may be a closely related protein, for example, a mutated form of the PRO polypeptide that recognizes the receptor but imparts no effect, thereby competitively inhibiting the action of the PRO polypeptide, respectively.
Another potential PRO polypeptide antagonist is an antisense RNA or DNA construct prepared using antisense technology, where, e.g., an antisense RNA or DNA molecule acts to block directly the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, of which both methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5'- coding portion of the polynucleotide sequence, which encodes the mature PRO polypeptides herein, is used to design an antisense RNA oligonucleotide from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix - see Lee et al, Nucl Acids Res. 6: 3073 (1979); Cooney et al, Science TAX: 456 (1988); Dervan et al, Science 251: 1360 (1991)), thereby preventing transcription and the production of the PRO polypeptide. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the PRO polypeptide (antisense - Okano, Neurochem. 56: 560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression (CRC Press: Boca Raton, FL, 1988). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the PRO polypeptide. When antisense DNA is used, oligodeoxylribonucleotides derived from the translation-initiation site, e.g., between about -10 and +10 positions of the target gene sequence, are preferred. Potential antagonists include small molecules that bind to the active site, the receptor binding site, or growth factor or other relevant binding site of the PRO polypeptide, thereby blocking the normal biological activity of the respective polypeptide. Examples of small molecules include, but are not limited to, small peptides or peptide-like molecules, preferably soluble peptides, and synthetic non-peptidyl organic or inorganic compounds. Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
Ribozymes act by sequence-specific hybridization to the complementary target RNA, followed by endonucleolytic cleavage. Specific ribozyme cleavage sites within a potential RNA target can be identified by known techniques. For further details, see, e.g., Rossi, Current Biology 4: 469-471 (1994), and PCT publication No. WO 97/33551 (published September 18, 1997). Nucleic acid molecules in triple-helix formation used to inhibit transcription should be single- stranded and composed of deoxynucleotides. The base composition of these oligonucleotides is designed such that it promotes triple-helix formation via Hoogsteen base-pairing rules, which generally require sizeable stretches of purines of pyrimidines on one strand of a duplex. For further details see, e.g., PCR publication No. WO 97/33551, supra. These small molecules can be identified by any one of the screening assays discussed hereinabove and/or by any other screening techniques well known for those skilled in the art.
K. Anti-PRO Antibodies
The present invention further provides anti-PRO antibodies. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies.
1. Polyclonal Antibodies
The anti-PRO antibodies may comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised in a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected in the mammal by multiple subcutaneous or intraperitoneal injections.
The immunizing agent may include the PRO polypeptide or a fusion protein thereof. It may be useful to conjugate the immunizing agent to a protein known to be immunogenic in the mammal being immunized. Examples of such immunogenic proteins include but are not limited to keyhole limpet hemocyanin, serum albumin, bovine thyroglobulin, and soybean trypsin inhibitor. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate). The immunization protocol may be selected by one skilled in the art without undue experimentation. 2. Monoclonal Antibodies
The anti-PRO antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, Nature, 256:495 (1975). In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunized with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vitro.
The immunizing agent will typically include the PRO polypeptide or a fusion protein thereof. Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovine and human origin. Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl transferase (HGPRT or HPRT), the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells. Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection, Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J. Immunol, 133:3001 (1984); Brodeur et al,
Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63].
The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against PRO. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA). Such techniques and assays are known in the art. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal. Biochem., 107:220 (1980).
After the desired hybridoma cells are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra]. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal.
The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography.
The monoclonal antibodies may also be made by recombinant DNA methods, such as those described in U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences [U.S. Patent No. 4,816,567; Morrison et al, supra] or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide. Such a non-immunoglobulin polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody.
The antibodies may be monovalent antibodies. Methods for preparing monovalent antibodies are well known in the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point in the Fc region so as to prevent heavy chain crosslinking. Alternatively, the relevant cysteine residues are substituted with another amino acid residue or are deleted so as to prevent crosslinking.
In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art.
3. Human and Humanized Antibodies
The anti-PRO antibodies of the invention may further comprise humanized antibodies or human antibodies. Humanized forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
Humanized antibodies include human immunoglobulins (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non- human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin [Jones et al, Nature, 321 :522-525 (1986); Riechmann et al, Nature, 332:323-329 (1988); and Presta, Curr. Op. Struct. Biol, 2:593-596 (1992)].
Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an
"import" variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al, Nature, 321 :522-525 (1986); Riechmann et al, Nature, ΥΩ,:'i21>-l>21 (1988); Verhoeyen et al, Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Moi Biol, 227:381 (1991); Marks et al, J. Moi Biol,
222:581 (1991)]. The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al, J. Immunol, 147(1 ):86-95 (1991)]. Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge, human antibody production is observed, which closely resembles that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. This approach is described, for example, in U.S. Patent Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications: Marks et al, Bio/Technology 10, 779-783 (1992); Lonberg et al, Nature 368 856-859 (1994); Morrison, Nature 368, 812-13 (1994); Fishwild et al, Nature Biotechnology 14, 845-51 (1996); Neuberger,
Nature Biotechnology 14, 826 (1996); Lonberg and Huszar, Intern. Rev. Immunol. Y5 65-93 (1995).
The antibodies may also be affinity matured using known selection and/or mutagenesis methods as described above. Preferred affinity matured antibodies have an affinity which is five times, more preferably 10 times, even more preferably 20 or 30 times greater than the starting antibody (generally murine, humanized or human) from which the matured antibody is prepared.
4. Bispecific Antibodies
Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for the PRO, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit.
Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light- chain pairs, where the two heavy chains have different specificities [Milstein and Cuello, Nature, 305:537- 539 (1983)]. Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture often different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and in Traunecker et al, EMBOJ., 10:3655-3659 (1991). Antibody variable domains with the desired binding specificities (antibody-antigen combining sites) can be fused to immunoglobulin constant domain sequences. The fusion preferably is with an immunoglobulin heavy-chain constant domain, comprising at least part of the hinge, CH2, and CH3 regions. It is preferred to have the first heavy-chain constant region (CHI) containing the site necessary for light- chain binding present in at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin light chain, are inserted into separate expression vectors, and are co-transfected into a suitable host organism. For further details of generating bispecific antibodies see, for example, Suresh et al, Methods in Enzymology, 121:210 (1986).
According to another approach described in WO 96/27011, the interface between a pair of antibody molecules can be engineered to maximize the percentage of heterodimers which are recovered from recombinant cell culture. The preferred interface comprises at least a part of the CH3 region of an antibody constant domain. In this method, one or more small amino acid side chains from the interface of the first antibody molecule are replaced with larger side chains (e.g. tyrosine or tryptophan). Compensatory "cavities" of identical or similar size to the large side chain(s) are created on the interface of the second antibody molecule by replacing large amino acid side chains with smaller ones (e.g. alanine or threonine). This provides a mechanism for increasing the yield of the heterodimer over other unwanted end-products such as homodimers.
Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g. F(ab')2 bispecific antibodies). Techniques for generating bispecific antibodies from antibody fragments have been described in the literature. For example, bispecific antibodies can be prepared can be prepared using chemical linkage. Brennan et al, Science 229:81 (1985) describe a procedure wherein intact antibodies are proteolytically cleaved to generate F(ab')2 fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize vicinal dithiols and prevent intermolecular disulfide formation. The Fab' fragments generated are then converted to thionitrobenzoate (TNB) derivatives. One of the Fab'-TNB derivatives is then reconverted to the Fab'-thiol by reduction with mercaptoethylamine and is mixed with an equimolar amount of the other Fab'-TNB derivative to form the bispecific antibody. The bispecific antibodies produced can be used as agents for the selective immobilization of enzymes.
Fab' fragments may be directly recovered from E. coli and chemically coupled to form bispecific antibodies. Shalaby et al, J. Exp. Med. 175:217-225 (1992) describe the production of a fully humanized bispecific antibody F(ab')2 molecule. Each Fab' fragment was separately secreted from E. coli and subjected to directed chemical coupling in vitro to form the bispecific antibody. The bispecific antibody thus formed was able to bind to cells overexpressing the ErbB2 receptor and normal human T cells, as well as trigger the lytic activity of human cytotoxic lymphocytes against human breast tumor targets.
Various technique for making and isolating bispecific antibody fragments directly from recombinant cell culture have also been described. For example, bispecific antibodies have been produced using leucine zippers. Kostelny et al, J. Immunol. 148(5): 1547-1553 (1992). The leucine zipper peptides from the Fos and Jun proteins were linked to the Fab' portions of two different antibodies by gene fusion. The antibody homodimers were reduced at the hinge region to form monomers and then re-oxidized to form the antibody heterodimers. This method can also be utilized for the production of antibody homodimers. The "diabody" technology described by Hollinger et al, Proc. Natl. Acad. Sci. USA 90:6444-6448 (1993) has provided an alternative mechanism for making bispecific antibody fragments. The fragments comprise a heavy-chain variable domain (VH) connected to a light-chain variable domain (VL) by a linker which is too short to allow pairing between the two domains on the same chain. Accordingly, the VH and VL domains of one fragment are forced to pair with the complementary VL and VH domains of another fragment, thereby forming two antigen-binding sites. Another strategy for making bispecific antibody fragments by the use of single-chain Fv (sFv) dimers has also been reported. See, Gruber et al., J. Immunol. 152:5368 (1994).
Antibodies with more than two valencies are contemplated. For example, trispecific antibodies can be prepared. Tutt et al, J. Immunol. 147:60 (1991).
Exemplary bispecific antibodies may bind to two different epitopes on a given PRO polypeptide herein. Alternatively, an anti-PRO polypeptide arm may be combined with an arm which binds to a triggering molecule on a leukocyte such as a T-cell receptor molecule (e.g. CD2, CD3, CD28, or B7), or Fc receptors for IgG (FcγR), such as FcγRl (CD64), FcγRII (CD32) and FcγRIII (CD16) so as to focus cellular defense mechanisms to the cell expressing the particular PRO polypeptide. Bispecific antibodies may also be used to localize cytotoxic agents to cells which express a particular PRO polypeptide. These antibodies possess a PRO-binding arm and an arm which binds a cytotoxic agent or a radionuclide chelator, such as EOTUBE, DPT A, DOT A, or TETA. Another bispecific antibody of interest binds the PRO polypeptide and further binds tissue factor (TF).
5. Heteroconjugate Antibodies
Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [U.S. Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO 92/200373; EP 03089]. It is contemplated that the antibodies may be prepared in vitro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No. 4,676,980.
6. Effector Function Engineering
It may be desirable to modify the antibody of the invention with respect to effector function, so as to enhance, e.g., the effectiveness of the antibody in treating cancer. For example, cysteine residue(s) may be introduced into the Fc region, thereby allowing interchain disulfide bond formation in this region. The homodimeric antibody thus generated may have improved internalization capability and/or increased complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). See Caron et al, J. Exp Med., 176: 1191-1195 (1992) and Shopes, J. Immunol, 148: 2918-2922 (1992). Homodimeric antibodies with enhanced anti-tumor activity may also be prepared using heterobifunctional cross-linkers as described in Wolff et al. Cancer Research, 53: 2560-2565 (1993). Alternatively, an antibody can be engineered that has dual Fc regions and may thereby have enhanced complement lysis and ADCC capabilities. See Stevenson et al, Anti-Cancer Drug Design, 3: 219-230 (1989).
7. Immunoconjugates
The invention also pertains to immunoconjugates comprising an antibody conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g., an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (i.e., a radioconjugate).
Chemotherapeutic agents useful in the generation of such immunoconjugates have been described above. Enzymatically active toxins and fragments thereof that can be used include diphtheria A chain, nonbinding active fragments of diphtheria toxin, exotoxin A chain (from Pseudomonas aeniginosa), ricin A chain, abrin A chain, modeccin A chain, alpha-sarcin, Aleurites fordii proteins, dianthin proteins, Phytolaca americana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcin, crotin, sapaonaria officinalis inhibitor, gelonin, mitogellin, restrictocin, phenomycin, enomycin, and the tricothecenes. A variety of radionuclides are available for the production of radioconjugated antibodies. Examples include ,2Bi, 1 1I, u,In, 90Y, and 186Re. Conjugates of the antibody and cytotoxic agent are made using a variety of bifunctional protein-coupling agents such as N-succinimidyl-3-(2-pyridyldithiol) propionate (SPDP), iminothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL), active esters (such as disuccinimidyl suberate), aldehydes (such as glutareldehyde), bis-azido compounds (such as bis (p- azidobenzoyl) hexanediamine), bis-diazonium derivatives (such as bis-(p-diazoniumbenzoyl)- ethylenediamine), diisocyanates (such as tolyene 2,6-diisocyanate), and bis-active fluorine compounds (such as l ,5-difluoro-2,4-dinitrobenzene). For example, a ricin immunotoxin can be prepared as described in Vitetta et al, Science, 238: 1098 (1987). Carbon-14-labeled l-isothiocyanatobenzyl-3-methyldiethylene triaminepentaacetic acid (MX-DTPA) is an exemplary chelating agent for conjugation of radionucleotide to the antibody. See W094/11026.
In another embodiment, the antibody may be conjugated to a "receptor" (such streptavidin) for utilization in tumor pretargeting wherein the antibody-receptor conjugate is administered to the patient, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand" (e.g., avidin) that is conjugated to a cytotoxic agent (e.g., a radionucleotide).
8. Immunoliposomes
The antibodies disclosed herein may also be formulated as immunoliposomes. Liposomes containing the antibody are prepared by methods known in the art, such as described in Epstein et al, Proc. Natl. Acad. Sci. USA, 82: 3688 (1985); Hwang et al, Proc. Natl Acad. Sci. USA, 77: 4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Patent
No. 5,013,556.
Particularly useful liposomes can be generated by the reverse-phase evaporation method with a lipid composition comprising phosphatidylcholine, cholesterol, and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter. Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described in Martin et al .,_J. Biol. Chem., 257: 286-288 (1982) via a disulfide-interchange reaction. A chemotherapeutic agent (such as Doxorubicin) is optionally contained within the liposome. See Gabizon et al, J. National Cancer Inst., 81(19): 1484 (1989).
9. Pharmaceutical Compositions of Antibodies
Antibodies specifically binding a PRO polypeptide identified herein, as well as other molecules identified by the screening assays disclosed hereinbefore, can be administered for the treatment of various disorders in the form of pharmaceutical compositions.
If the PRO polypeptide is intracellular and whole antibodies are used as inhibitors, internalizing antibodies are preferred. However, lipofections or liposomes can also be used to deliver the antibody, or an antibody fragment, into cells. Where antibody fragments are used, the smallest inhibitory fragment that specifically binds to the binding domain of the target protein is preferred. For example, based upon the variable-region sequences of an antibody, peptide molecules can be designed that retain the ability to bind the target protein sequence. Such peptides can be synthesized chemically and/or produced by recombinant DNA technology. See, e.g., Marasco et al, Proc. Natl. Acad. Sci. USA, 90: 7889-7893 (1993). The formulation herein may also contain more than one active compound as necessary for the particular indication being treated, preferably those with complementary activities that do not adversely affect each other. Alternatively, or in addition, the composition may comprise an agent that enhances its function, such as, for example, a cytotoxic agent, cytokine, chemotherapeutic agent, or growth-inhibitory agent. Such molecules are suitably present in combination in amounts that are effective for the purpose intended.
The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin- microcapsules and poly-(methylmethacylate) microcapsules, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles, and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences, supra.
The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
Sustained-release preparations may be prepared. Suitable examples of sustained-release preparations include semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, or microcapsules. Examples of sustained-release matrices include polyesters, hydrogels (for example, poly(2-hydroxyethyl-methacrylate), or poly(vinylalcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and γ ethyl-L- glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as the LUPRON DEPOT ™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), and poly-D-(-)-3-hydroxybutyric acid. While polymers such as ethylene-vinyl acetate and lactic acid-glycolic acid enable release of molecules for over 100 days, certain hydrogels release proteins for shorter time periods. When encapsulated antibodies remain in the body for a long time, they may denature or aggregate as a result of exposure to moisture at 37?C, resulting in a loss of biological activity and possible changes in immunogenicity. Rational strategies can be devised for stabilization depending on the mechanism involved. For example, if the aggregation mechanism is discovered to be intermolecular S-S bond formation through thio-disulfide interchange, stabilization may be achieved by modifying sulfhydryl residues, lyophilizing from acidic solutions, controlling moisture content, using appropriate additives, and developing specific polymer matrix compositions.
L. Tissue Distribution
The location of tissues expressing the PRO can be identified by determining mRNA expression in various human tissues. The location of such genes provides information about which tissues are most likely to be affected by the stimulating and inhibiting activities of the PRO polypeptides. The location of a gene in a specific tissue also provides sample tissue for the activity blocking assays discussed below. As noted before, gene expression in various tissues may be measured by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA (Thomas, Proc. Natl. Acad. Sci. USA, 77:5201-5205 [1980]), dot blotting (DNA analysis), or in situ hybridization, using an appropriately labeled probe, based on the sequences provided herein. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-protein duplexes.
Gene expression in various tissues, alternatively, may be measured by immunological methods, such as immunohistochemical staining of tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence of a PRO polypeptide or against a synthetic peptide based on the DNA sequences encoding the PRO polypeptide or against an exogenous sequence fused to a DNA encoding a PRO polypeptide and encoding a specific antibody epitope. General techniques for generating antibodies, and special protocols for Northern blotting and in situ hybridization are provided below.
M. Antibody Binding Studies
The activity of the PRO polypeptides can be further verified by antibody binding studies, in which the ability of an anti-PRO antibody to inhibit the effect of the respective PRO polypeptide on tissue cells is tested. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies, the preparation of which will be described hereinbelow.
Antibody binding studies may be carried out in any known assay method, such as competitive binding assays, direct and indirect sandwich assays, and immunoprecipitation assays. Zola, Monoclonal Antibodies: A Manual of Techniques, pp.147-158 (CRC Press, Inc., 1987).
Competitive binding assays rely on the ability of a labeled standard to compete with the test sample analyte for binding with a limited amount of antibody. The amount of target protein in the test sample is inversely proportional to the amount of standard that becomes bound to the antibodies. To facilitate determining the amount of standard that becomes bound, the antibodies preferably are insolubilized before or after the competition, so that the standard and analyte that are bound to the antibodies may conveniently be separated from the standard and analyte which remain unbound. Sandwich assays involve the use of two antibodies, each capable of binding to a different immunogenic portion, or epitope, of the protein to be detected. In a sandwich assay, the test sample analyte is bound by a first antibody which is immobilized on a solid support, and thereafter a second antibody binds to the analyte, thus forming an insoluble three-part complex. See, e.g., US Pat No. 4,376,1 10. The second antibody may itself be labeled with a detectable moiety (direct sandwich assays) or may be measured using an anti-immunoglobulin antibody that is labeled with a detectable moiety (indirect sandwich assay). For example, one type of sandwich assay is an ELISA assay, in which case the detectable moiety is an enzyme.
For immunohistochemistry, the tissue sample may be fresh or frozen or may be embedded in paraffin and fixed with a preservative such as formalin, for example.
N. Screening Assays for Drug Candidates
Screening assays for drug candidates are designed to identify compounds that bind to or complex with the polypeptides encoded by the genes identified herein or a biologically active fragment thereof, or otherwise interfere with the interaction of the encoded polypeptides with other cellular proteins. Such screening assays will include assays amenable to high-throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Small molecules contemplated include synthetic organic or inorganic compounds, including peptides, preferably soluble peptides, (poly)peptide-immunoglobulin fusions, and, in particular, antibodies including, without limitation, poly- and monoclonal antibodies and antibody fragments, single-chain antibodies, anti-idiotypic antibodies, and chimeric or humanized versions of such antibodies or fragments, as well as human antibodies and antibody fragments. The assays can be performed in a variety of formats, including protein-protein binding assays, biochemical screening assays, immunoassays and cell based assays, which are well characterized in the art.
All assays are common in that they call for contacting the drug candidate with a polypeptide encoded by a nucleic acid identified herein under conditions and for a time sufficient to allow these two components to interact. In binding assays, the interaction is binding and the complex formed can be isolated or detected in the reaction mixture. In a particular embodiment, the polypeptide encoded by the gene identified herein or the drug candidate is immobilized on a solid phase, e.g., on a microtiter plate, by covalent or non-covalent attachments. Non-covalent attachment generally is accomplished by coating the solid surface with a solution of the polypeptide and drying. Alternatively, an immobilized antibody, e.g., a monoclonal antibody, specific for the polypeptide to be immobilized can be used to anchor it to a solid surface. The assay is performed by adding the non-immobilized component, which may be labeled by a detectable label, to the immobilized component, e.g., the coated surface containing the anchored component. When the reaction is complete, the non-reacted components are removed, e.g., by washing, and complexes anchored on the solid surface are detected. When the originally non-immobilized component carries a detectable label, the detection of label immobilized on the surface indicates that complexing occurred. Where the originally non-immobilized component does not carry a label, complexing can be detected, for example, by using a labelled antibody specifically binding the immobilized complex.
If the candidate compound interacts with but does not bind to a particular protein encoded by a gene identified herein, its interaction with that protein can be assayed by methods well known for detecting protein-protein interactions. Such assays include traditional approaches, such as, cross-linking, co- immunoprecipitation, and co-purification through gradients or chromatographic columns. In addition, protein-protein interactions can be monitored by using a yeast-based genetic system described by Fields and co-workers [Fields and Song, Nature (London) 340, 245-246 (1989); Chien et al, Proc. Natl. Acad. Sci. USA 88, 9578-9582 (1991)] as disclosed by Chevray and Nathans, Proc. Natl. Acad. Sci. USA 89, 5789- 5793 (1991). Many transcriptional activators, such as yeast GAL4, consist of two physically discrete modular domains, one acting as the DNA-binding domain, while the other one functioning as the transcription activation domain. The yeast expression system described in the foregoing publications (generally referred to as the "two-hybrid system") takes advantage of this property, and employs two hybrid proteins, one in which the target protein is fused to the DNA-binding domain of GAL4, and another, in which candidate activating proteins are fused to the activation domain. The expression of a GALl-føcZ reporter gene under control of a GAL4-activated promoter depends on reconstitution of GAL4 activity via protein-protein interaction. Colonies containing interacting polypeptides are detected with a chromogenic substrate for β-galactosidase. A complete kit (MATCHMAKER™) for identifying protein-protein interactions between two specific proteins using the two-hybrid technique is commercially available from Clontech. This system can also be extended to map protein domains involved in specific protein interactions as well as to pinpoint amino acid residues that are crucial for these interactions.
In order to find compounds that interfere with the interaction of a gene identified herein and other intra- or extracellular components can be tested, a reaction mixture is usually prepared containing the product of the gene and the intra- or extracellular component under conditions and for a time allowing for the interaction and binding of the two products. To test the ability of a test compound to inhibit binding, the reaction is run in the absence and in the presence of the test compound. In addition, a placebo may be added to a third reaction mixture, to serve as positive control. The binding (complex formation) between the test compound and the intra- or extracellular component present in the mixture is monitored as described above. The formation of a complex in the control reaction(s) but not in the reaction mixture containing the test compound indicates that the test compound interferes with the interaction of the test compound and its reaction partner.
O. Articles of Manufacture
In another embodiment of the invention, an article of manufacture containing materials (e.g., comprising a PRO molecule) useful for the diagnosis or treatment of the disorders described above is provided. The article of manufacture comprises a container and an instruction. Suitable containers include, for example, bottles, vials, syringes, and test tubes. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which is effective for diagnosing or treating the condition and may have a sterile access port (for example the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle). The active agent in the composition is usually a polypeptide or an antibody of the invention. An instruction or label on, or associated with, the container indicates that the composition is used for diagnosing or treating the condition of choice. The article of manufacture may further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
VI. Assay characterizations: Correlation between in vitro assays and in vivo therapeutic effect
Recent studies using agarose gel electrophoresis and terminal dUTP nick-end labeling (TUNEL) indicate that photoreceptor cell death occurs principally by apoptosis. Chang, G-Q, Hao Y., Wong F.,
Neuron I L: 595-605 (1993); Portera-Cailliau, C. et al, Proc. Nat 'I Acad. Sci. USA 9 974-97 (1993); Adler R., Curr. Top. Dev. Biol. 1 5 207-252 (1980). These studies examined mouse models of human retinal degeneration (retinitis pigmentosa): rd mice (which have a mutation in the b subunit of cGMP phosphodiesterase); rds mice (which have a mutation in peripherin); and transgenic mice, which have a mutation in rhodopsin. In all three models there is a substantial increase in apoptosis at the time of photoreceptor cell death. Apoptosis is also known to be prominent in the RCS rat, as well as in the light- damaged rat retina. Tso M, et al, Invest. Opththalmol Vis. Sci. 35: 2693-2699 (1994); Shahinfar S., et al, Curr. Eye Res. 10: 47-59 (1991 ).
Apoptosis appears to be a tightly controlled "shutdown" process or self-selecting cell suicide which by preventing the leakage of destructive enzymes, allows healthy neighboring cells to continue their normal functioning. Wong, F., Arch. Ophthalmol. 113: 1245-47 (1995). During this process, the cell's outer membrane remains intact as the cell undergoes nuclear condensation, cytoplasmic shrinkage, membrane blebbing, formation of apoptotic bodies, and sometimes DNA fragmentation.
Apoptosis is now believed to play a key role in degenerative diseases of the eye, such as retinitis pigmentosa (rp). Rp is believed to be caused by mutations in the rhodopsin gene, Dryja, TP, Nature 343:
364-366 (1990). In addition, other photoreceptor-specific genetic mutations have been uncovered which induce rp, among them the mutants known as retinal degeneration (rd), McLaughlin ME, et al. Nat. Genet. 4: 30-134 (1993), and retinal degeneration slow (rds), Farrar G.J. et al, Nature, 354: 478-80 (1991 ); Kajiwara K. et al, Nature 354: 480-83 (1991). It has further been discovered that the autosomal dominant types of rp may be caused by any one of more than 70 mutations of the rhodopsin gene. Humphries, P. et al, Science 256: 804-808 (1992); Dryja, T.P et al, Invest. Ophthalmol Vis. Sci. (1995), 36: 1 197-1200 (1995). Rhodopsin mutations are known to be the basis of autosomal recessive rp in some families as well. Rosenfeld, P.J. et al, Nat. Genet. I : 209-13 (1992); Kumaramanickavel, G. et al, 8: 10-11 (1994). As a result, the rhodopsin gene is now considered an archetypal model for the study of rp. The role of apoptosis in rp has been observed in mouse photoreceptors. Several lines of transgenic mice which express mutant rhodopsin have been created, and as a result, can simulate a form of the autosomal dominant rp found in humans. These animal models exhibit dying photoreceptors through various characteristics of apoptosis, including morphological changes and DNA fragmentation. Chang C-G et al, Neuron (1993), U : 595-605; Portera-Cailliau C. et al, Proc. Natl. Acad. Sci. USA (1994), 91 : 974- 978. Along with other experimental results, these findings have led researches to the conclusion that apoptosis is a major mechanism of murine photoreceptor death, as it is induced not only by mutations in the rhodopsin gene, but also by mutations in the rd and rds genes. Chang C-G et al, supra, Portera-Cailliau C. et al, supra, Lolley R.N. et al, Invest. Ophthalmol. Vis. Sci. (1994), 35: 358-362. Of great interest is the observation that photoreceptor degeneration occurs through apoptosis in response not only to genetic abnormalities, but also after experimental retina detachment. Cook, BE et al, Invest. Ophthalmol Vis. Sci. (1995), 36: 990-996. Moreover, apoptotic cell death was also observed in acute retinal lesions in the albino rat induced by relatively low light levels and short exposure duration (1000 & 3000 lux, diffuse, white light for 2 hours), Reme et al, Degenerative Diseases of the Retina,
Anderson R.E. et al, eds, Plenum Press, pp. 19-25 (1995). This discovery has lead to the search for survival-promoting trophic factors, factors which are believed to become unavailable to photoreceptors when the subretinal space expands and the composition of the interphotoreceptor matrix changes as a consequence of retinal detachment. Chader G.J. (1989), Invest. Ophthalmol. Vis. Sci. 30 7-22; Berman E.R., Biochemistry of the Eye (1991), New York, NY, Plenum Press; Steinberg R.H., Curr. Opin. Neurobiol
4: 515-24.
The death of photoreceptor cells through apoptosis is indicative that rather than being passive victims of the cumulative effects of mutations, photoreceptors die in genetic disorders such as retinitis pigmentosa by activation of their own "cell-death program." Adler, R. (1996) Arch. Ophthalmol. 114: 79- 83. This implies that there is a role which certain neurotrophic factors and related molecules play in the degeneration of cones resulting from mutations in rod proteins.
The following examples are demonstrative of therapeutic utility because cell death occurs via apoptosis, the same mechanism as has been shown to occur in various retinal degenerative disorders. The knowledge that known growth factors prevented apoptosis correlated with preserved vision in animal models is indicative that prospective factors which prevent apoptosis would also have therapeutic utility in retinal degenerative disorders.
The following examples are offered by way of illustration and not by way of limitation. The disclosures of all citations in the specification are expressly incorporated herein by reference.
EXAMPLES
Example 1
A. Isolation of cDNA Clones Encoding Human PRQ175 (UNQ149)
The native sequence PRO 175 polypeptide of Figure 2 (SEQ ID NO:2) is described and characterized in Gurney et al, Curr. Biol 9(4): 215-8 (1999). A DNA sequence encoding SEQ ID NO:2 is further available as GenBank Accession number AF125303.
The nucleotide sequence of DNA19355-1150 is shown in Figure 1 (SEQ ID NO:l). Clone DNA19355-1150 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 21 -23 (Fig. 1; SEQ ID NO: l ). The predicted polypeptide precursor is 177 amino acids long and has a calculated molecular weight of approximately 20,308 daltons (Figure 2). Hydropathy analysis suggests the presence of a signal sequence about amino acid residues 1 to 44. Two potential N- linked glycosylation sites have been identified at position 129 (Asn) and position 161 (Asn) of the sequence shown in Fig. 2 (SEQ ID NO:2). Clone DNA19355-1150 has been deposited with ATCC on November 18, 1997 and is assigned ATCC deposit no. 209466. The native sequence PR0175 polypeptide of SEQ ID NO:2 is obtained or obtainable by expressing the molecule encoded by the cDNA insert of the sequence ATCC 209466.
B. Isolation of cDNA Clones Encoding Human PRO220 (UNQ194) The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about
950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzymology 266:460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence. Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington).
A consensus DNA sequence was assembled relative to the other identified EST sequences, which was designated herein as DNA28749 (SEQ ID NO:3). Based on the DNA28749 (SEQ ID NO:3), oligonucleotides were synthesized to identify by PCR a cDNA library that contained the sequence of interest and for use as probes to isolate a clone of the corresponding full-length PRO220 encoding sequence.
The oligonucleotide primers and probes used in the above procedure were: forward PCR primer: 5'-TCACCTGGAGCCTTTATTGGCC-3' (SEQ ID NO:4) reverse PCR primer: 5'-ATACCAGCTATAACCAGGCTGCG-3' (SEQ ID NO:5) hybridization probe: (SEQ ID NO:6)
5'-CAACAGTAAGTGGTTTGATGCTCTTCCAAATCTAGAGATTCTGATGATTGGG-3'
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PRO220 gene using the probe oligonucleotide and one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; Holmes et al, Science, 253:1278-1280 (1991)) in the unique Xhol and Notl sites.
DNA sequencing of the clones isolated as described above gave the full-length DNA sequence DNA32298-1132 (SEQ ID NO:7), which encodes the native sequence PRO220 protein of Figures 4 (SEQ ID NO:8).
The entire nucleotide sequence of DNA32298-1 132 is shown in Figure 3 (SEQ ID NO:7). Clone DNA32298-1 132 (SEQ ID NO:7) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 480-482 and ending at the stop codon at nucleotide positions 2604- 2606. The predicted polypeptide precursor is 708 amino acids long (Figure 4). Hydropathy analysis suggests the presence of a signal peptide as residues 1 -22, a transmembrane domain at about amino acid residues 632 to 651, and a tyrosine kinase phosphorylation site at about amino acid residue 570 and a cell attachment sequence site is present at residue 277. Clone DNA32298-1133 has been deposited with the ATCC on September 16, 1997 and is assigned ATCC deposit no. 209257.
C. Isolation of cDNA Clones Encoding Human PRQ216 (UNO 190) A procedure analogous to the one above for the isolation of native sequence PRO220 (SEQ ID
NO:8) can be employed to isolate DNA33087-1 158 (SEQ ID NO:9) (Figure 5) which encodes the native sequence PR0216 protein of Figure 6 (SEQ ID NO:10). Hydropathy analysis suggests the presence of a signal sequence at amino acid residues 1 to 20, tyrosine kinase phosphorylation sites at amino acid residues 268-274 and 300-306, and N-myristoylation site residue 230-235, and leucine zippers at residues 146 to 167 and 217 to 238. An alternative to a traditional isolation technique, the DNA sequence is publicly available from GenBank as accession number AB000114 which encodes Dayhoff protein AB000114_1. Alternatively still, the sequence is described in Ohno et al, Biochem. Biophys. Res. Commun. 228(2): 411 -414 (1996). Clone DNA33087-1 158 has been deposited with the American Type Culture Collection (ATCC) on September 16, 1997 and has been assigned ATCC Dep. No. 209381.
D. Isolation of cDNA Clones Encoding Human PRQ243 (UNQ217) Introduction:
Three PI clones and one PAC clones (Genome Systems Inc., St. Louis, MO; cat. Nos. Pl-2535 and PAC-6539) encompassing the human thrombopoietin (THPO) locus were isolated and a 140 kb region was sequenced using the ordered shotgun strategy (Chen et al, Genomics \1_: 651-656 (1993)), coupled with a
PCR-based gap filling approach. Analysis revealed that the region is gene-rich with four additional genes located very close to THPO: tumor necrosis factor-receptor type 1 associated protein 2 (TRAP2) and elongation initiation factor gamma (elF4g), chloride channel 2 (CLCN2) and RNA polymerase II subunit hRPB17. While no THPO homolog was found in the region, four novel genes have been predicted by computer-assisted gene detection (GRAIL)(Xu et al, Gen. Engin. 16: 241-253 (1994), the presence of CpG islands (Cross, S. and Bird, A., Curr. Opin. Genet. & Devel 5: 109-314 (1995), and homology to known genes (as detected by WU-BLAST2.0)(Altschul and Gish, Methods Enzymol 266: 460-480 (1996). Procedures: PI and PAC clones: The initial human PI clone was isolated from a genomic PI library (Genome Systems Inc., St.
Louis, MO; cat. no.: Pl -2535) screened with PCR primers designed from the THPO genomic sequence (A.L. Gurney, et al, Blood 85: 981-88 (1995). PCR primers were designed from the end sequences derived from this PI clone were then used to screen PI and PAC libraries (Genome Systems, Cat. Nos.: Pl-2535 & PAC-6539) to identify overlapping clones. Ordered Shotgun Strategy:
The Ordered Shotgun Strategy (OSS) (Chen et al, Genomics 17: 651-656 (1993)) involves the mapping and sequencing of large genomic DNA clones with a hierarchical approach. The PI or PAC clone was sonicated and the fragments subcloned into lambda vector (λBluestar) (Novagen, Inc., Madison, WI; cat. no. 69242-3). The lambda subclone inserts were isolated by long-range PCR (Barnes, W. Proc. Natl. Acad. Sci. USA 91 : 2216-2220 (1994) and the ends sequenced. The lambda-end sequences were overlapped to create a partial map of the original clone. Those lambda clones with overlapping end-sequences were identified, the insets subcloned into a plasmid vector (pUC9 or pUC18) and the ends of the plasmid subclones were sequenced and assembled to generate a contiguous sequence. This directed sequencing strategy minimizes the redundancy required while allowing one to scan for and concentrate on interesting regions.
In order to define better the THPO locus and to search for other genes related to the hematopoietin family, four genomic clones were isolated from this region by PCR screening of human PI and PAC libraries (Genome System, Inc., Cat. Nos.: Pl-2535 and PAC-6539). The sizes of the genomic fragments are as follows: Pl .t is 40 kb; Pl .g is 70 kb; Pl .u is 70 kb; and PAC.z is 200 kb. The relationships between these four genomic clones are illustrated in Figure 7. Approximately 80% of the 200 kb genomic DNA region was sequenced by the Ordered Shotgun Strategy (OSS) (Chen et al, Genomics \1_: 651 -56 (1993) (Figure 9), and assembled into contigs using Auto Assembler™ (Applied Biosystems, Perkin Elmer, Foster City, CA, cat. no. 903227). The preliminary order of these contigs was determined by manual analysis. There were 46 contigs and gap filling was employed. Table 7 summarized the number and sizes of the gaps. Table 7:
Summary of the gaps in the 140 kb region
Size of gap number
<50 bp 13
50-150 bp 7 150-300 bp 7
300-1000 bp 10
1000-5000 bp 7
> 5000 bp 2 (= 15,000 bp)
DNA sequencing: ABI DYE-primer™ chemistry (PE Applied Biosystems, Foster City, CA; Cat. No.: 402112) was used to end-sequence the lambda and plasmid subclones. ABI DYE-terminater™ chemistry (PE Applied Biosystems, Foster City, CA, Cat. No: 403044) was used to sequence the PCR products with their respective PCR primers. The sequences were collected with an ABI377 instrument. For PCR products larger than lkb, walking primers were used. The sequences of contigs generated by the OSS strategy in AutoAssembler™ (PE Applied Biosystems, Foster City, CA; Cat. No: 903227) and the gap-filling sequencing trace files were imported into Sequencher™ (Gene Codes Corp., Ann Arbor, MI) for overlapping and editing. PCR-Based gap filling Strategy:
Primers were designed based on the 5'- and 3'-end sequenced of each contig, avoiding repetitive and low quality sequence regions. All primers were designed to be 19-24-mers with 50-70% G/C content. Oligos were synthesized and gel-purified by standard methods.
Since the orientation and order of the contigs were unknown, permutations of the primers were used in the amplification reactions. Two PCR kits were used: first, XL PCR kit (Perkin Elmer, Norwalk,
CT; Cat. No.: N8080205), with extension times of approximately 10 minutes; and second, the Taq polymerase PCR kit (Qiagen Inc., Valencia, CA; Cat. No.: 201223) was used under high stringency conditions if smeared or multiple products were observed with the XL PCR kit. The main PCR product from each successful reactions was extracted from a 0.9% low melting agarose gel and purified with the
Geneclean DNA Purification kit prior to sequencing.
Analysis:
The identification and characterization of coding regions was carried out as follows: First, repetitive sequences were masked using RepeatMasker (A.F.A. Smit & P. Green, http://ftp.genome. washington.edu) which screens DNA sequences in FastA format against a library of repetitive elements and returns a masked query sequence. Repeats not masked were identified by comparing the sequence to the GenBank database using WUBLAST (Altschul, S & Gish, W., Methods Enzymol 2 L- 460-480 (1996) and were masked manually. Next, known genes were revealed by comparing the genomic regions against Genentech's protein database using the WUBLAST2.0 algorithm and then annotated by aligning the genomic and cDNA sequences for each gene, respectively, using a Needleman-Wunch (Needleman and Wunsch, J. Moi Biol. 48: 443-453 (1970) algorithm to find regions of local identity between sequences which are otherwise largely dissimilar. The strategy results in detection of all exons of the five known genes in the region, THPO, TRAP2, elF4g, CLCN2 and hRPB17 (Table 8).
Table 8:
Summary of known genes located in the 140 kb region analyzed Known genes Map position eukaryotic translation initiation factor 4 gamma 3q27-qter thrombopoietin 3q26-q27 chloride channel 2 3q26-qter
TNF receptor associated protein 2 not previously mapped
RNA polymerase II subunit hRPBl 7 not previously mapped Finally, novel transcription units were predicted using a number of approaches. CpG islands (S. Cross &
Bird, A., Curr. Opin. Genet. Dev. 5: 109-314 (1995) islands were used to define promoter regions and were identified as clusters of sites cleaved by enzymes recognizing GC-rich, 6 or 8-mer palidromic sequences. CpG islands are usually associated with promoter regions of genes. WUBLAST2.0 analysis of short genomic regions (10-20 kb) versus GenBank revealed matches to ESTs. The individual EST sequences (or where possible, their sequence chromatogram files) were retrieved and assembled with Sequencher to provide a theoretical cDNA sequence (DNA34415). GRAIL2 (ApoCom Inc., Knoxville, TN, command line version for the DEC alpha) was used to predict a novel exon. The five known genes in the region served as internal controls for the success of the GRAIL algorithm. Isolation: Chordin cDNA clones were isolated from an oligo-dT-primed human fetal lung library. Human fetal lung polyA+ RNA was purchased from Clontech (cat #6528-1, lot #43777) and 5 mg used to construct a cDNA library in pKR5B (Genentech, LIB26). The 3'-primer
(pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT) (SEQ ID NO: l l ) and the 5'- linker (pCGGACGCGTGGGGCCTGCGCACCCAGCT) (SEQ ID NO: 12) were designed to introduce Sail and Notl restriction sites. Clones were screened with oligonucleotide probes designed from the putative human chordin cDNA sequence (DNA34415) (SEQ ID NO:13) deduced by manually "splicing" together the proposed genomic exons of the gene. PCR primers flanking the probes were used to confirm the identity of the cDNA clones prior to sequencing, resulting in the isolation of DNA35917-1207 (SEQ ID NO: 14) and the encoded native sequence PR0243 polypeptide of Figure 9 (SEQ ID NO: 15). The screening oligonucleotides probes used were the following:
OLI5640 34415.pl 5'-GCCGCTCCCCGAACGGGCAGCGGCTCCTTCTCAGAA-3' (SEQ ID NO: 16)
OLI5642 34415.p2 5'-GGCGCACAGCACGCAGCGCATCACCCCGAATGGCTC-3' (SEQ ID NO: 17); and the flanking probes used were the following: OLI5639 34415.fl 5'-GTGCTGCCCATCCGTTCTGAGAAGGA-3' (SEQ ID NO: 18) OL15643 34415.r 5'-GCAGGGTGCTCAAACAGGACAC-3' (SEQ ID NO: 19).
The native sequence PR0243 polypeptide of Figure 9 (SEQ ID NO: 15) contains a putative signal peptide at amino acid residues 1-23, tyrosine kinase phosphorylation sites at amino acid residues 145 to 152 and 778 to 785, a cell attachment sequence at residues 87-90, a cell attachment sequence at residues 165-167 and a leucine zipper at residues 315-336. Clone DNA35917-1207 has been deposited with the ATCC on December 3, 1997 and has been assigned ATCC Dep. No. 209508.
E. Isolation of cDNA Clones Encoding Human PRO306 OJN0269)
The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altschul et al, Methods in Enzymology 266: 460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington).
A consensus DNA sequence was assembled relative to other EST sequences using phrap. This consensus sequence was designated DNA36458 (SEQ ID NO:20). This consensus DNA sequence was extended using repeated cycles of BLAST and phrap to extend DNA36458 (SEQ ID NO:20) as far as possible using the sources of EST sequences discussed above. The extended assembly and DNA36458 (SEQ ID NO:20) were used as templates to synthesize oligonucleotides to: 1) identify by PCR cDNA library that contained the sequence of interest, and 2) use as probes to isolate a clone of the full-length coding sequence for PRO306. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe sequences are typically
40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al, Current Protocols in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning procedures using the probe oligonucleotide and one of the primer paris. The forward, reverse and hybridization probes in the above procedure were the following: forward PCR primer (.fl): 5'-CAGGTCGAACCCAGACCACGATGC-3' (SEQ ID NO:21 ) forward PCR primer (.12): 5'-GCCACATGGCCCAGCTTG-3' (SEQ ID NO:22) forward PCR primer (.G): 5'-GAGACGGAGGAAGCAGGC-3' (SEQ ID NO:23) forward PCR primer (.fll): 5'-GGCCACACTTACAGCTCTG-3' (SEQ ID NO:24) reverse PCR primer (.rl): 5'-AGCCGGCTTCTGAGGGCGTCTACC-3' (SEQ ID NO:25) hybridization probe: (SEQ ID NO:26)
5'-TGGTGCTGCCGCTGCTGCTCCTGGCCGCGGCAGCCCTGGCCGAAG-3'
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with one of the PCR primer pairs identified above. A positive library was then used to isolate clones encoding the PRO306 gene using the probe oligonucleotide and one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al, Science 253: 1278-1280 (1991)) in the unique Xhol and Notl sites. DNA sequencing of the clones isolated as described above gave the full-length sequence
DNA39984-1221 (SEQ ID NO:27) and the derived native sequence PRO306 polypeptide of Figure 11 (SEQ ID NO:28). DNA39984-1221 (SEQ ID NO:27) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 199-201 and ending at the stop codon at nucleotide positions 1471-1473 (Figure 10). The predicted native sequence PRO306 polypeptide precursor is 424 amino acids long (Figure 22). The native sequence PRO306 polypeptide of Figure 11 (SEQ ID NO:28) contains a putative signal peptide at amino acid residues 1-22, glycosaminoglycan attachment sites at residues 388 to 390 and tyrosine kinase phosphorylation sites at residues 62-69. Clone DNA39984-1221 has been deposited with the ATCC on November 7, 1997 as ATCC Dep. No. 209435.
Alternatively, DNA encoding a polypeptide matching 423 amino acid residues of SEQ ID NO:28) is available from GenBank as accession number D87465 which encodes the Dayhoff polypeptide
D87465 1. This sequence is further described and characterized in Vannahme et al, J. Neurochem. 73(1): 12-20 (1999). This same sequence has also been submitted to GenBank as accession number HSAJ1453 which encodes the Dayhoff polypeptide HSAJ1453_1. This sequence is also discussed in the publication Nagase et al, DNA Res. 3 (5): 321-329 (1996).
F. Isolation of cDNA Clones Encoding Human PRQ346 (UNO305)
The extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search Expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank, Dayhoff), and proprietary ESTs from Genentech isolated using the procedure described previously. The search was performed using the computer program BLAST or BLAST2 [Altschul et al, Methods in Enzymology, 266:460-480 (1996)] as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons resulting in a BLAST score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington).
The EST sequence (H68654, DNA 38240)(SEQ ID NO:29) was identified. A consensus DNA sequence was isolated using repeated cycles of blast and phrap to extend the consensus sequence as far as possible using the public databases GenBank, Dayhoff as well as a proprietary Genentech database comprised of sequencing isolated the procedure described previously. The consensus and extended consensus assembly served as a basis for the creation of oligonucleotides. These oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence. Forward and reverse PCR primers (notated as *.f and *.r, respectively) may range from 20 to 30 nucleotides (typically about 24), and are designed to give a PCR product of 100-1000 bp in length. The probe sequences (notated as *.p) are typically 40-55 bp (typically about 50) in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than 1-1.5 kbp. In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al, Current Protocols in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest by the in vivo cloning procedure using the probe oligonucleotide and one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal liver. The cDNA libraries used to isolated the cDNA clones were constructed by standard methods using commercially available reagents (e.g., Invitrogen, San Diego, CA; Clontech, etc.) The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al, Science, 253:1278-1280 (1991)) in the unique Xhol and Notl sites.
A cDNA clone was isolated and sequenced in entirety. The entire nucleotide sequence of DNA44167-1243 is shown in Figure 12 (SEQ ID NO:30). Clone DNA44167-1243 (SEQ ID NO:30) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 64-
66 (Fig. 12; SEQ ID NO:30). The predicted polypeptide precursor is 450 amino acids long (Figure 13)(SEQ ID NO:31). SEQ ID NO:31 has a putative signal peptide at amino acid residues 1-18, a transmembrane domain at about residues 340 to 358, a tyrosine kinase phosphorylation site at residues 272 to 279 and a prokaryotic membrane lipoprotein lipid attachment site at residues 7 to 17. Clone DNA44167-1243 has been deposited with ATCC on November 7, 1997 and is assigned
ATCC deposit no. 209434. The oligonucleotide sequences used in the above procedure were the following:
OLI2691 (38240.A) (SEQ ID NO:32)
5'-GATCCTGTCACAAAGCCAGTGGTGC-3'
OLI2693 (38240.rl) (SEQ ID NO:33)
5'-CACTGACAGGGTTCCTCACCCAGG-3' OLI2692 (38240.pl) (SEQ ID NO:34)
5'-CTCCCTCTGGGCTGTGGAGTATGTGGGGAACATGACCCTGACATG-3'
G. Isolation of cDNA Clones Encoding Hman PRQ322 (UNQ283) The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about
950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzymology 266:460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence. Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington).
A consensus DNA sequence was assembled relative to two EST sequences using phrap. This consensus sequence is herein designated DNA36951 (SEQ ID NO:35). Also used were the two EST sequences, "2604309" (SEQ ID NO:36) and "1968970" (SEQ ID NO:37), both from Incyte Pharmaceuticals. In addition, the consensus DNA sequence was extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above.
Based on the consensus sequence DNA36951 (SEQ ID NO:35), oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length coding sequence for the PR0322. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe sequences are typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about l-1.5kbp. In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al, Current Protocols in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.
A pair of PCR primers (forward and reverse) were synthesized: forward PCR primer 5'-CAGCCTACAGAATAAAGATGGCCC-3' (SEQ ID NO:38) reverse PCR primer 5'-GGTGCAATGATCTGCCAGGCTGAT-3' (SEQ ID NO:39)
Additionally, a synthetic oligonucleotide hybridization probe was constructed from the consensus sequence which had the following nucleotide sequence: hybridizaton probe (SEQ ID NO:40) 5'-AGAAATACCTGTGGTTCAGTCCATCCCAAACCCCTGCTACAACAGCAG-3'
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0322 gene using the probe oligonucleotide and one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal kidney tissue (LIB227). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al, Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites. DNA sequencing of the clones isolated as described above gave the full-length DNA sequence
DNA48336-1309 (SEQ ID N0:41 ) and the encoded native sequence PR0322 protein sequence of Figure 15 (SEQ ID NO:42). The entire nucleotide sequence of DNA48336-1309 is shown in Figure 14 (SEQ ID NO:41 ). Clone DNA48336-1309 (SEQ ID NO:41) contains a single open reading frame with an apparent translational initiation site at about nucleotide positions 166-168 and ending at the stop codon at about nucleotide positions 946-948 (Figure 14). The predicted polypeptide precursor is 260 amino acids long
(Figure 15). The full-length, native sequence PR0322 protein shown in Figure 15 (SEQ ID NO:42) has an estimated molecular weight of about 28,028 daltons and a pi of about 7.87. Clone DNA48336-1309 has been deposited with ATCC on March 11, 1998 and is assigned ATCC deposit no. 209669.
SEQ ID NO:42 contains a potential N-glycosylation site is at amino acid residue 110. A serine protease, trypsin family and histidine active site is believed to be present at about amino acid residues about
69 through about 74. A kringle domain proteins motif is at about amino acids about 205 through about 217. A region having homology to serine protease is present about residues 207 to 217 while a tyrosine kinase phophorylation site is believed present at residues 182 to 188. The putative signal peptide is encoded at about amino acid residues 1-23.
H. Isolation of cDNA Clones Encoding Human PRQ536 (UNQ337)
DNA49142-1430 (SEQ ID NO:43) was identified by applying a proprietary signal sequence finding algorithm developed by Genentech, Inc. (South San Francisco, CA) upon ESTs as well as clustered and assembled EST fragments from public (e.g., GenBank) and/or private (LIFESEQ®, Incyte Pharmaceuticals, Inc., Palo Alto, CA) databases. The signal sequence algorithm computes a secretion signal score based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codon(s) (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codons. If the first ATG has the required amino acids, the second is not examined. If neither meets the requirement, the candidate sequence is not scored. In order to determine whether the EST sequence contains an authentic signal sequence, the DNA and corresponding amino acid sequences surrounding the ATG codon are scored using a set of seven sensors (evaluation parameters) known to be associated with secretion signals.
Use of the above described signal sequence algorithm allowed identification of an EST cluster sequence from the Incyte database, designated DNA48351 (SEQ ID NO:44). This EST cluster sequence was then compared to a variety of expressed sequence tag (EST) databases which included public EST databases (e.g., GenBank) and a proprietary EST DNA database (Lifeseq®, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzymology 266:460-480 (1996)). Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into a consensus DNA sequence with the program "phrap" (Phil Green, University of Washington, Seattle, Washington. In light of the sequence homology between the DNA48351 sequence (SEQ ID NO:44) and the Merck EST clone no. HI 1129 (SEQ ID NO:45), the Merck EST clone HI 1129 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 16 and is herein designated as DNA49142-1430 (SEQ ID NO:43).
DNA49142-1430 (SEQ ID NO:43) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 48-50 and ending at the stop codon at nucleotide positions 987-989 (Figure 16). The predicted polypeptide precursor is 313 amino acids long (Figure 17)(SEQ ID NO:46). The full-length, native sequence PR0536 protein shown in Figure 17 has an estimated molecular weight of about 34,189 daltons and a pi of about 4.8. Analysis of the full-length, native sequence PR0536 polypeptide (SEQ ID NO:46) shown in Figure 17 evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 25, a potential N-glycosylation site from about amino acid 45 to about amino acid 48 and an amino acid sequence block having homology to sulfatase proteins from about amino acid 16 to about amino acid 26. Clone DNA49142-1430 has been deposited with ATCC on June 23, 1998 and is assigned ATCC deposit no. 203002.
I. Isolation of cDNA Clones Encoding Human PRQ943 (UNO480)
The extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST database
(LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 [Altschul et al, Methods in Enzymology, 266:460-480 (1996)] as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons resulting in a BLAST score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil
Green, University of Washington, Seattle, Washington).
A consensus DNA sequence encoding was assembled relative to other EST sequences related by homology using phrap. This consensus sequence was then extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above. The extended consensus sequence was designated DNA36360 (SEQ ID NO:47).
Based on the DNA36360 consensus sequence (SEQ ID NO:47), oligonucleotides were synthesized: 1) to identify by PCR a cDNA library that contained the sequence of interest; and 2) for use as probes to isolate the full-length, native sequence PR0943 clone (SEQ ID NO:48) of Figure 19. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe sequences are typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about 1-1.5 kbp. In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al, Current Protocols in Molecular Biology, supra, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs. The identity of the amplified DNA was confirmed with a hybridization probe.
The PCR primers (forward and reverse) and hybridization probe synthesized for use in the above procedure were: forward PCR primer (36360.fl) 5'-CGAGATGACGCCGAGCCCCC-3' (SEQ ID NO:50) reverse PCR primer (3636Q.rl) 5'-CGGTTCGACACGCGGCAGGTG-3' (SEQ ID NO:51) hybridization probe (36360.pl) 5'-TGCTGCTCCTGCTGCCGCCGCTGCTGCTGGGGGCCTTCCCGCCGG-3' (SEQ ID NO:52)
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0943 gene using the probe oligonucleotide and one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal brain tissue. The cDNA libraries used to isolated the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al, Science, 253:1278-1280 (1991)) in the unique Xhol and Notl sites.
DNA sequencing of the clones isolated as described above gave a full-length DNA sequence DNA52192-1369 (SEQ ID NO:49) (Figure 18). Clone DNA52192-1369 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 150-152 and ending at the stop codon at nucleotide positions 1662-1664 (Figure 19)(SEQ ID NO:49). The predicted polypeptide precursor is 504 amino acids long (Figure 19)(SEQ ID NO:48). The full-length, native sequence PR0943 protein shown in Figure 50 (SEQ ID NO:48) has an estimated molecular weight of about 54,537 daltons and a pl of about 10.04. Further analysis of SEQ ID NO:48 evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 17, a transmembrane domain from about amino acid 376 to about amino acid 396 (i.e., extracellular domain from about 18-375; intracellular domain 376-504), tyrosine kinase phosphorylation sites from about amino acid 212 to about amino acid 219 and from about amino acid
329 to about amino acid 336, potential N-glycosylation sites from about amino acid 111 to about amino acid 114, from about amino acid 231 to about amino acid 234, from about amino acid 255 to about amino acid
258 and from about amino acid 293 to about amino acid 296 and an immunoglobulin and MHC protein sequence homology block from about amino acid 219 to about amino acid 236. Clone DNA52192-1369 has been deposited with ATCC on July 1, 1998 and is assigned ATCC deposit no. 203042.
J. Isolation of cDNA Clones Encoding Human PRO840 (UNQ433)
A procedure analogous to the one described above for the isolation of PRO220 can be employed to isolate the DNA53987-1438 (SEQ ID NO:53) (Figure 20) which encodes the PRO840 native sequence protein of Figure 21 (SEQ ID NO:54). Hydropathy analysis of SEQ ID NO:54) suggests a signal peptide at about amino acid residues 1-46, a transmembrane domain at about residues 319-339 and a tyrosine kinase phosphorylation site at residues 43-51. Alternatively, similar DNA sequences are available from GenBank as accession number AF036364 and AJ000534. The GenBank sequence AF036364 is also described by McNally et al, in FEBS Lett. 422 (1), 27-32 (1998). Clone DNA53987-1438 has been deposited with the American Type Culture Collection (ATCC) on May 12, 1998 and has been assigned ATCC Dep. No. 209858.
K. Isolation of cDNA Clones Encoding Human PRQ828 (UNQ469)
The extracellular domain (ECD) sequences (including the secretion signal, if any) of from about 950 known secreted proteins from the Swiss-Prot public protein database were used to search expressed sequence tag (EST) databases. The EST databases included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzymology 266:460-480 (1996)) as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequence. Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington).
A consensus DNA sequence was identified using the above described analysis which appeared to encode a fragment of a potential secreted protein. This sequence was extended using repeated cycles of BLAST and phrap to extend the consensus sequence as far as possible using the sources of EST sequences discussed above. The extended assembly sequence is referred to herein as DNA35717 (SEQ ID NO:55). The DNA35717 consensus sequence (SEQ ID NO:55) served as a basis to for oligonucleotide synthesis: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a clone of the full-length PR0828 encoding sequence. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe sequences are typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about l-1.5kbp. In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al, Current Protocols in Molecular Biology, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs. The synthesized forward and reverse PCR primers, and the hybridization probe for use with the above isolation method were: forward PCR primer (35717.fl): 5'-GCAGGACTTCTACGACTTCAAGGC-3' (SEQ ID NO:56) reverse PCR primer (35717.rl): 5'-AGTCTGGGCCAGGTACTTGAAGGC-3' (SEQ ID NO:57) hybridization probe (35717.pl): (SEQ ID NO:58) 5'-CAACATCCGGGGCAAACTGGTGTCGCTGGAGAAGTACCGCGGATCGGTGT-3'
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the PR0828 gene using the probe oligonucleotide and one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal lung tissue (L1B25). The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al. Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.
DNA sequencing of the clones isolated as described above gave DNA57037-1444 (SEQ ID NO:59) and the encoded native sequence PR0828 protein sequence of Figure 23 (SEQ ID NO:60).
The entire nucleotide sequence of DNA57037-1444 is shown in Figure 22 (SEQ ID NO:59). Clone DNA57037-1444 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 34-36 and ending at the stop codon at nucleotide positions 595-597 (Figure 22)(SEQ ID
NO:59). The predicted polypeptide precursor is 187 amino acids long (Figure 23)(SEQ ID NO:60). The full-length, native sequence PR0828 protein shown in Figure 23 (SEQ ID NO:60) has an estimated molecular weight of about 20,996 daltons and a pi of about 8.62. Analysis of SEQ ID NO:60 evidences the presence of the following: a signal peptide at about amino acids 1-21; sequences identity to glutathione peroxidases signature 2 at about amino acids 82-89; sequence identity to glutathione peroxidases selenocysteine proteins at about amino acids 35-60, 63-100, 107-134, and 138-159.
Clone DNA57037-1444 has been deposited with ATCC on May 27, 1998, and has been assigned ATCC deposit no. 209903.
L. Isolation of cDNA Clones Encoding Human PRQ826 (UNQ467)
DNA57694-1341 (SEQ ID NO:64) was identified by applying a proprietary signal sequence finding algorithm developed by Genentech, Inc. (South San Francisco, CA) upon ESTs as well as clustered and assembled EST fragments from public (e.g., GenBank) and or private (LIFESEQ®, Incyte Pharmaceuticals, Inc., Palo Alto, CA) databases. The signal sequence algorithm computes a secretion signal score based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codon(s) (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codons. If the first ATG has the required amino acids, the second is not examined. If neither meets the requirement, the candidate sequence is not scored. In order to determine whether the EST sequence contains an authentic signal sequence, the DNA and corresponding amino acid sequences surrounding the ATG codon are scored using a set of seven sensors (evaluation parameters) known to be associated with secretion signals.
Use of the above described signal sequence algorithm allowed identification of an EST cluster sequence from the Incyte database, designated 47283 (SEQ ID NO:62). This EST cluster sequence was then compared to a variety of expressed sequence tag (EST) databases which included public EST databases
(e.g., GenBank) and a proprietary EST DNA database (Lifeseq®, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzymology 266:460-480 (1996)). Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into a consensus DNA sequence with the program "phrap" (Phil Green, University of Washington, Seattle, Washington. The consensus sequence obtained therefrom was designated DNA56000 (SEQ ID NO:63). In light of the sequence homology between the DNA56000 sequence and the Merck EST clone no. W69233 (SEQ ID NO:61), the Merck clone corresponding to W69233 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 24 and is herein designated as DNA57694-1341 (SEQ ID NO:64).
Clone DNA57694-1341 (SEQ ID NO:64) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 13-15 and ending at the stop codon at nucleotide positions 310-312 (Figure 24). The predicted polypeptide precursor is 99 amino acids long (Figure 25). The full- length, native sequence PR0826 protein shown in Figure 25 (SEQ ID NO:65) has an estimated molecular weight of about 11,050 daltons and a pi of about 7.47. Analysis of SEQ ID NO:65 evidences the presence of the following: a signal peptide from about amino acid 1 to about amino acid 22, potential N- myristoylation sites from about amino acid 22 to about amino acid 27 and from about amino acid 90 to about amino acid 95 and an amino acid sequence block having homology to peroxidase from about amino acid 16 to about amino acid 48. Clone DNA57694-1341 has been deposited with ATCC on June 23, 1998 and has been assigned ATCC deposit no. 203017.
M. Isolation of cDNA Clones Encoding Human PRO1068 (UNQ525)
DNA59214-1449 (SEQ ID NO:66) was identified by applying a proprietary signal sequence finding algorithm developed by Genentech, Inc. (South San Francisco, CA) upon ESTs as well as clustered and assembled EST fragments from public (e.g., GenBank) and or private (LIFESEQ®, Incyte
Pharmaceuticals, Inc., Palo Alto, CA) databases. The signal sequence algorithm computes a secretion signal score based on the character of the DNA nucleotides surrounding the first and optionally the second methionine codon(s) (ATG) at the 5'-end of the sequence or sequence fragment under consideration. The nucleotides following the first ATG must code for at least 35 unambiguous amino acids without any stop codons. If the first ATG has the required amino acids, the second is not examined. If neither meets the requirement, the candidate sequence is not scored. In order to determine whether the EST sequence contains an authentic signal sequence, the DNA and corresponding amino acid sequences surrounding the ATG codon are scored using a set of seven sensors (evaluation parameters) known to be associated with secretion signals. Use of the above described signal sequence algorithm allowed identification of an EST cluster sequence from the LIFESEQ"" database, designated Incyte cluster no. 141736 (SEQ ID NO:67). This EST cluster sequence was then compared to a variety of expressed sequence tag (EST) databases which included public EST databases (e.g., GenBank) and a proprietary EST DNA database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA) to identify existing homologies. One or more of the ESTs was derived from a human mast cell line from a patient with mast cell leukemia. The homology search was performed using the computer program BLAST or BLAST2 (Altshul et al, Methods in Enzymology 266:460-480 (1996)). Those comparisons resulting in a BLAST score of 70 (or in some cases 90) or greater that did not encode known proteins were clustered and assembled into a consensus DNA sequence with the program "phrap" (Phil Green, University of Washington, Seattle, Washington). The consensus sequence obtained therefrom was DNA56094 (SEQ ID NO:68). In light of the sequence homology between the DNA56094 sequence and Incyte EST clone no. 004974 (SEQ ID NO:69), Incyte EST clone no. 004974 was purchased and the cDNA insert was obtained and sequenced. The sequence of this cDNA insert is shown in Figure 26 and is herein designated as DNA592141449 (SEQ ID NO:66).
The full length clone shown in Figure 26 (SEQ ID NO:66) contains a single open reading frame with an apparent translational initiation site at about nucleotide positions 42-44 and ending at the stop codon found at nucleotide positions 14-16. The predicted native sequence PRO1068 polypeptide precursor (SEQ ID NO:70) encoded therefrom is 124 amino acids long, and has a calculated molecular weight of approximately 14,284 Daltons and an estimated pi of approximately 8.14. SEQ ID NO:70 has the following additional features: a signal peptide sequence at about amino acids 1-20, a urotensin II signature sequence at about amino acids 1 18-123, a cell attachment sequence at about amino acids 64-66, and a potential cAMP- and cGMP-dependent protein kinase phosphorylation site at about amino acids 1 12-115.
Clone DNA59214-1449 was deposited with the ATCC on July 1, 1998 and is assigned ATCC deposit no. 203046.
N. Isolation of cDNA Clones Encoding Human PRQ1132 (UNO570)
The extracellular domain (ECD) sequences (including the secretion signal sequence, if any) from about 950 known secreted proteins from the Swiss-Prot public database were used to search EST databases. The EST databases included public EST databases (e.g., GenBank), and a proprietary EST database (LIFESEQ®, Incyte Pharmaceuticals, Palo Alto, CA). The search was performed using the computer program BLAST or BLAST2 [Altschul et al, Methods in Enzymology, 266:460-480 (1996)] as a comparison of the ECD protein sequences to a 6 frame translation of the EST sequences. Those comparisons resulting in a BLAST score of 70 (or in some cases, 90) or greater that did not encode known proteins were clustered and assembled into consensus DNA sequences with the program "phrap" (Phil Green, University of Washington, Seattle, Washington). A consensus DNA sequence was assembled relative to other EST sequences using phrap. This consensus sequence was designated herein DNA35934 (SEQ ID NO:71).
The DNA35934 consensus sequence (SEQ ID NO:71) served as a template for the creation of oligonucleotides: 1) to identify by PCR a cDNA library that contained the sequence of interest, and 2) for use as probes to isolate a full-length PR01132 encoding sequence. Forward and reverse PCR primers generally range from 20 to 30 nucleotides and are often designed to give a PCR product of about 100-1000 bp in length. The probe sequences are typically 40-55 bp in length. In some cases, additional oligonucleotides are synthesized when the consensus sequence is greater than about l -1.5kbp. In order to screen several libraries for a full-length clone, DNA from the libraries was screened by PCR amplification, as per Ausubel et al, Current Protocols in Molecular Biology, supra, with the PCR primer pair. A positive library was then used to isolate clones encoding the gene of interest using the probe oligonucleotide and one of the primer pairs.
The forward and reverse PCR primers and hyridization probes employed with the above procedure were: forward PCR primer: 5'-TCCTGTGACCACCCCTCTAACACC3' (SEQ ID NO:72) reverse PCR primer: 5'-CTGGAACATCTGCTGCCCAGATTC3' (SEQ ID NO:73). hybridization probe: (SEQ ID NO:74).
5'-GTCGGATGACAGCAGCAGCCGCATCATCAATGGATCCGACTGCGATATGC-3'
In order to screen several libraries for a source of a full-length clone, DNA from the libraries was screened by PCR amplification with the PCR primer pair identified above. A positive library was then used to isolate clones encoding the native sequence PROl 132 sequence of Figure 29 (SEQ ID NO:76) using the probe oligonucleotide and one of the PCR primers.
RNA for construction of the cDNA libraries was isolated from human fetal kidney. The cDNA libraries used to isolate the cDNA clones were constructed by standard methods using commercially available reagents such as those from Invitrogen, San Diego, CA. The cDNA was primed with oligo dT containing a Notl site, linked with blunt to Sail hemikinased adaptors, cleaved with Notl, sized appropriately by gel electrophoresis, and cloned in a defined orientation into a suitable cloning vector (such as pRKB or pRKD; pRK5B is a precursor of pRK5D that does not contain the Sfil site; see, Holmes et al, Science, 253: 1278-1280 (1991)) in the unique Xhol and Notl sites.
DNA sequencing of the clones isolated as described above gave the full-length DNA sequence DNA59767-1489 of Figure 28 (SEQ ID NO:75), and the encoded native sequence PROl 132 sequence of
Figure 29 (SEQ ID NO:76). The entire nucleotide sequence of DNA59767-1489 (SEQ ID NO:75) is shown in Figure 28. Clone DNA59767-1489 contains a single open reading frame with an apparent translational initiation site at nucleotide positions about 354-356, and a stop codon at nucleotide positions about 1233-
1235 (Fig. 28; SEQ ID NO:75). The predicted polypeptide precursor is 293 amino acids long. The signal peptide is at about amino acid residues 1-22 and the histidine active site is at about amino acid residues 104-
109 of Figure 29 (SEQ ID NO:76). Additionally, regions homologous to serine protease have been identified at about residues 241-251, 93-109, 262-285 and 187-193. Clone DNA59767-1489 has been deposited with ATCC (having the actual sequence rather than representations based on sequencing techniques as presented herein) on August 11, 1998 and was assigned ATCC deposit no. 203108. The full- length PROl 132 protein shown in Figure 29 (SEQ ID NO:76) has an estimated molecular weight of about
32,020 daltons and a pi of about 8.7.
Example 2 Macular holes A patient pool with varying stages of macular holes (i.e., 2, 3 or 4) of varying ages are chosen and the presence of macular holes is confirmed. The pool is selected so as to exclude patients with histories of cystoid macula edema, diabetic retinopathy or exudative age-related macular degeneration.
Vision is examined in each subject to determine the best Snellen visual acuity and analyzed by intraocular pressure, fundus photographs, and fluorescein angiography. Each macular hole is graded according to the criteria described by Gass, Arch. Ophthalmol. (1988), 106: 629-39. Eyes with Stage 2 holes have a retinal dehiscence along the margin of the areas of deep retinal cyst formation. Stage 3 is characterized by a full-thickness hole with overlying operculum. Macular holes are classified as Stage 4 when a posterior vitreous detachment is present. Treatment is scheduled within 2 weeks of the baseline examination. Under the criteria, patients should be excluded if they had greater than 2+ nuclear sclerotic or posterior subcapsular lens changes. Patients are followed for 6-10 months, with mean follow-up of 8 months. Doses are determined at a level below therapeutic effectiveness, in the middle of the effective range, and at a level well above the minimal effective range.
Eyes are randomly chosen for the indicated level of PRO polypeptide. In addition, some eyes may separately receive 100 μl of intravitreal hyaluronic acid at the time of administration of PRO in an attempt to delay clearance of the PRO polypeptide from the area of the macular hole.
Surgical procedure:
All surgery can be done under local anesthesia with sedation. After the eyes are prepped and draped, a standard three-port vitrectomy may be performed. In eyes with Stage 2 and Stage 3 macular holes, a core vitrectomy is performed. In Stage 4 macular hole, a complete pars plana vitrectomy is performed. If encountered, an epiretinal membrane may be peeled from the surface of the retina and removed from the eye. In other cases, some gelatinous condensation on the inner surface of the retina surrounding the macular hole for about 200-400 μm, with a firm adhesion along the margin of the macular hole. This was carefully dissected where possible, taking care to limit traction on the edges of the macular hole and damage to the nerves. After allowing for peripheral fluid to drain posteriorly, any fluid which migrates posteriorly is also aspirated. A tapered, bent-tipped cannula is then connected to a 1 cc syringe containing a solution of PRO polypeptide. The reconstituted formulation contains the desired concentration of the test material after dilution. Eyes are randomly assigned a dose of PRO, and about 0.1 cc of the test material solution is gently infused into the macular hole. The same volume of hyaluronic acid may also be administered. After surgery, the patient should lie in a supine position for the first 24 hours following surgery.
Thereafter, each patient should remain in a face-down position as much as possible for a 2 week period.
Patients are examined at 1 day, 2 weeks, 4-6 weeks, and monthly post surgery. Fluorescein angiography is performed at 4 to 6 weeks, 3 months, and 6 months. Best corrected Snellen visual acuity, intraocular pressure, lens status, bubble size, status of macular hole and occurrence of adverse effects are determined at each examination.
Discussion:
The rational for treatment in this example is to induce the flattening of the edges of the macular hole in order to resolve retinal detachment and thickening surrounding the hole. It has been suggested that a reduction in the traction force which elevates the retina around the hole coupled with and induction of the chorioretinal adhesion along the edge of the hole is necessary for therapeutic effect. Unlike peripheral retinal holes where surgical techniques can be used to reattach the retina and a small area of destruction is not noticeable, macular holes require gentle induction of chorioretinal adhesion to avoid the destruction of adjacent neurosensory tissue and permanent destruction of central vision.
Example 3
Light Induced Photoreceptor Injury
Albino rats (F344 of Sprague-Dawley) of 2-5 months of age are maintained in a cyclic light environment (12 hours on followed by 12 hours off from an in-cage illuminance of less than 25 ft-c) for 9 days or more days before exposure to a constant light source. The constant light source is maintained at an illuminance level of 1 15-200 ft-c. For example, 2 40 watt white reflector fluorescent bulbs suspended 60 cm above the floor of a transparent polycarbonate cage with stainless steel wire-bar covers.
Two days before the constant light exposure, the rats are anesthetized with a ketamine-xylazine mixture which is administered intravitreally with 1 μl of the tested factor dissolved in phosphate buffered saline (PBS) at a concentration of 50-1000 ng μl. The injections were made with the insertion of a 32 gauge needle through the sclera, choroid and retina approximately midway between the ora serrata and equator of the eye. The factor-injected animals are compared to either uninjected littermates of those that receive control injections, and to control animals who are not exposed to constant light. Controls should include an injection of PBS alone, or a sham injection (insertion of needle with no injection). In all cases, the injections are made into the superior hemisphere of the eye.
Immediately following the constant light exposure, the rats are killed by any suitable means, e.g., carbon dioxide anesthetization followed by vascular perfusion of mixed aldehydes. The eyes are embedded in epoxy resin and sectioned into 1 μm thick sections of the entire retina along the vertical meridian of the eye. The degree of light-induced retinal degeneration is then quantified by two methods. The first is through measurement of the outer nuclear layer (ONL) thickness, which is used as an index of photoreceptor cell loss. A mean ONL thickness is obtained from a single section of each animal with the aid of a Bioquant morphometry system. In each of the superior and inferior hemispheres, ONL thickness is measured in 9 sets of 3 measurements each (total of 27 measurements in each hemisphere). Each set is centered on adjacent 440-μm lengths of retina (the diameter of the microscope field at 400X magnification). The first set of measurements is taken at approximately 440 μm from the optic nerve head, with subsequent sets taken more peripherally. Within each 440-μm length of the retina, the 3 measurements are made at defined points separated from one another by 75 μm. In all, 54 measurements are taken in the two hemispheres which sample representative regions of almost the entire retinal section. The second method of assessing the degree of photoreceptor rescue is through a subjective evaluation by an examining pathologist on a scale of 0-4+, wherein 4+ is maximal rescue and nearly normal retinal integrity. The degree of photoreceptor rescue in each section, based in comparison to the control eye in the same rat, is scored by four individuals. This method not only takes into account the ONL thickness, but also more subtle degenerative changes to the photoreceptor inner and outer segments, as well as degenerative gradients within the eye.
Discussion:
The intravitreal administration of various factors into the eyes of albino rats can enable the rapid assessment of both the ability of the factors to rescue photoreceptors from degeneration and the side effects, such as incidence of macrophages, associated with each factor. Although the model described herein is the albino rat, the eyes of other albino mammals, such as mice and rabbits, are also useful for this purpose. Example 4 Retinal Neuron Survival
Sprague Dawley rat pups at postnatal day 7 (mixed population: glia and retinal neuronal types) are killed by decapitation following C02 anesthesia and the eyes are removed under sterile conditions. The neural retina is dissected away from the pigment epithelium and other ocular tissue and then dissociated into a single cell suspension using 0.25% trypsin in Ca2+, Mg2l-free PBS. The retinas are incubated at 37°C for 7-10 minutes after which the trypsin is inactivated by adding l ml soybean trypsin inhibitor. The cells are plated at 100,000 cells per well in 96 well plates in DMEM/F12 supplemented with N2. Cells for all experiments are grown at 37°C in a water saturated atmosphere of 5% C02. After 2-3 days in culture, cells are stained with calcein AM or CellGracker Green CMFDA then fixed using 4% paraformaldehyde and stained with DAPI for determination of total cell count. The total cells (fluorescent) are quantified at 20X objective magnification using CCD camera and NIH image software for Macintosh. Fields in the well are chosen at random. The datapoints are reported as % survival which is the fraction of total number of celcein/CellTracker positive cells after 2-3 days in culture divided by the total number of cells (DAPI- labeled) after 2-3 days in culture.
The effect of various concentration of PRO polypeptide are reported Table 9.
Table 9 Retinal Neuron Survival
Figure imgf000099_0001
Figure imgf000100_0001
Example 5
Rod Photoreceptor Survival
Sprague Dawley rat pups at 7 day postnatal (mixed population: glia and retinal neuronal cell types) are killed by decapitation following C02 anesthesia and the eyes are removed under sterile conditions. The neural retina is dissected away form the pigment epithelium and other ocular tissue and then dissociated into a single cell suspension using 0.25% trypsin in Ca2+, Mg2+-free PBS. The retinas are incubated at 37°C for 7-10 minutes after which the trypsin is inactivated by adding 1 ml soybean trypsin inhibitor. The cells are plated at 100,000 cells per well in 96 well plates in DMEM/F12 supplemented with N2. Cells for all experiments are grown at 37°C in a water saturated atmosphere of 5% C02. After 2-3 days in culture, cells are stained using calcein AM or CellTracker Green CMFDA and then fixed using 4% paraformaldehyde. Rho 4D2 (ascites or IgG 1 :100), a monoclonal antibody directed towards the visual pigment rhodopsin is used to detect rod photoreceptor cells by indirect immunofluorescence. The results are reported as % survival: total number of calcein - rhodopsin positive cells at 2-3 days in culture, divided by the total number of rhodopsin positive cells at time 2-3 days in culture. The total cells (fluorescent) are quantified at 20x objective magnification using a CCD camera and NIH image software for Macintosh. Fields in the well are chosen at random.
The effect of various concentration of PRO are reported in Table 10.
Table 10 Rod Photoreceptor Cell Survival
Figure imgf000101_0001
Figure imgf000102_0001
Example 6 Light Ablation Study
Introduction:
As indicated by Reme C.E. et al, Degen. Dis. Retina, Ch. 3, Ed. R.E. Anderson et al, Plenum Press, New York (1995), retina degeneration can be induced by exposure to strong light. This light ablation model permits a quantitative comparison of photoreceptor survival promoting activity of a tested substance. Methods:
Adult female Sprague-Dawley rats are kept in "normal" fluorescent light environment (50 foot candles) for 12 hours on/off until the beginning of the experimental period. Light-induced degeneration is initiated by placing dark adapted (rats kept in 24 hour total darkness). About 5-10 animals in each treatment group are placed into a 5' x 3' chamber illuminated with 490-580 nm (green) light at 300-400 foot candles. Light exposure should be intermittent, 1 hour on, 2 hours off, for a total of eight cycles. Both eyes of each animal should receive 1-2 μl vitreal injections of test factor two days prior to the light exposure. Test factors employed are 0.5 -1.0 μg/μl of bFGF (SEQ ID NO:67) or PRO polypeptide and controls of phosphate buffered saline with and without bovine serum albumin (0.1 %).
Tdt-mediated dUTP nick-end labeling (TUNEL) (Gavrieli, Y et al, J. Cell Biol. U9: 493-501 (1992), is performed with modifications using the ApopTag® In situ Apoptosis Detection Kit (Oncor®, cat. no. S7110-KIT) on a 4 μm thick paraffin sections. The DNA strand breaks (fragments) were labeled with fluorescein while intact DNA were labeled with DAPI (4',6-diamidino-2-phenylindole) and visualized with a FITC/DAP1 filter on a Vanox AH-3 Olympus microscope.
Results:
The degree of retinal degeneration or survival promoting activity of the tested factors is reported as the thickness of the photoreceptor cell layer or number of TUNEL labeled photoreceptor cell nuclei. Three transverse sections through the central retina (approx. 10 μm intervals) were used for the analysis. For each section, the entire retinal surface area was digitized using a cooled CCD camera and NIH image software
(Macintosh) to derive the quantitative data.
Example 7 Corneal Pocket Assay Introduction:
This experiment is intended to determine whether the tested agent is angiogenic in this rodent in vivo model. Sample are formulated and pelleted with a delivery vehicle and stability and then transplanted into the cornea and then observed for angiogenic effect. The procedure is adapted from Polverini et al, Methods in Enzymology 198: 440-450 (1991). Methods:
Sprague-Dawley rats (250 g, male) are maintained in plastic carriers under darkened conditions 24 hours prior to treatment and then anesthetized. Each animal's eyes are gently proptosed and secured in place with nontraumatic forceps (e.g., BRI-1725). Using an appropriate blade (e.g., No. 15 blade Bard-Parker), a 1.5 mm incision is made approximately 1 mm from the center of the cornea into the stroma, but not through it. A curved spatula (2 mm wide) is then inserted under the lip of the incision and gently blunt-dissected through the stroma toward the outer canthus of the eye. The final distance between the base of the pocket and the limbus should be at least 1 mm. Pellets are prepared by mixing together tested growth factor (100 ng), sucralfate (50 μg) and
Hydron (e.g., Interferon Sciences, New Brunswick, N.J., Lot # 90005) in a 500:1 ratio of growth factor to sucralfate and Hydron (4 μl). The sucralfate is present to stabilize the molecule by interacting with the heparin-binding region. The control pellet is composed of Hydron and sucralfate vehicles only. Suggested treatment groups tested are composed of: 1) bovine bFGF (SEQ ID NO:67) (Calbiochem, 10 μg 50 μl) PBS + sucralfate (6 animals); 2) sucralfate; and 3) sucralfate mixed with PRO polypeptide.
A Hydron pellet (2 x 2 mm) is prepared as described in the previous paragraph and inserted into the base of incision whereupon the pocket should reseal spontaneously. The eyes are coated with artificial tears ointment and then the animals were returned to their plastic carriers, then permitted to awaken and returned to their cages. The assay is terminated on day 5. At time of sacrifice, the animals are perfused with FITC dextran
(2 x IO6 m.w.) and corneal whole mounts are prepared by careful dissection of the cornea from the eyes, followed by strategic placement of 2-3 cuts to permit permitting the cornea to lie flat, followed by placement under a coverslip. The image is captured through a lx objective mounted on an inverted fluorescent scope (e.g., Nikon®). Image-Pro® software-edge detection routine can be used to evaluate growth areas.
Example 8 Vascular Endothelial Cell Mitogenecity Assay Introduction:
Mitogenic assays on vascular endothelial cells were initially developed in order to monitor the purification of bFGF growth factor. However, they are also a useful measure to determine the presence of mitogenicity in the tested substance. Materials and Methods:
Bovine adrenal cortex-derived capillary endothelial (ACE) cells are established according to known procedures as described by Ferrara et al, Enzymology 198. 391-405 (1991). Stock plates of ACE cells are were maintained in 10 cm tissue culture dishes in the presence of low glucose DMEM supplemented with 10% calf serum, 2 M glutamine and penicillin G (1000 Units/mL) and streptomycin
(1000 μg/mL) and basic FGF (SEQ ID NO:67) at a final concentration of 1 ng/ml and weekly passaged at a split ratio of 1 :10. Mitogenic controls are prepared by adding basic FGF at final concentrations of 1 ng/ml and 5 ng/ml and culturing for 5-6 days. ACE cells can be passaged 10-12 times before showing signs of senescence.
For each of the test substances, the stock cultures are trypsinized, resuspended in growth media, and seeded at a density of 1.0 x IO4 cells/well in 6-well plates (Costar, Cambridge MA), at a plating volume of 2 ml. PRO samples to be tested are added to duplicate or triplicate wells in 10 μl aliquots, shortly after plating. After 5 or 6 days, cells are trypsinized and counted in a Coulter Counter (Coulter Electronics, Hialeah, FL).
EXAMPLE 9 Use of PRO as a hybridization probe
The following method describes use of a nucleotide sequence encoding PRO as a hybridization probe.
DNA comprising the coding sequence of full-length or mature PRO as disclosed herein is employed as a probe to screen for homologous DNAs (such as those encoding naturally-occurring variants of PRO) in human tissue cDNA libraries or human tissue genomic libraries.
Hybridization and washing of filters containing either library DNAs is performed under the following high stringency conditions. Hybridization of radiolabeled PRO-derived probe to the filters is performed in a solution of 50% formamide, 5x SSC, 0.1% SDS, 0.1% sodium pyrophosphate, 50 mM sodium phosphate, pH 6.8, 2x Denhardt's solution, and 10% dextran sulfate at 42°C for 20 hours. Washing of the filters is performed in an aqueous solution of O. lx SSC and 0.1% SDS at 42°C.
DNAs having a desired sequence identity with the DNA encoding full-length native sequence PRO can then be identified using standard techniques known in the art.
EXAMPLE 10 Expression of PRO in E. coli
This example illustrates preparation of an unglycosylated form of PRO by recombinant expression in E. coli.
The DNA sequence encoding PRO is initially amplified using selected PCR primers. The primers should contain restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector. A variety of expression vectors may be employed. An example of a suitable vector is pBR322 (derived from E. coli; see Bolivar et al, Gene, 2:95 (1977)) which contains genes for ampicillin and tetracycline resistance. The vector is digested with restriction enzyme and dephosphorylated. The PCR amplified sequences are then ligated into the vector. The vector will preferably include sequences which encode for an antibiotic resistance gene, a trp promoter, a polyhis leader (including the first six STII codons, polyhis sequence, and enterokinase cleavage site), the PRO coding region, lambda transcriptional terminator, and an argU gene.
The ligation mixture is then used to transform a selected E. coli strain using the methods described in Sambrook et al, supra. Transformants are identified by their ability to grow on LB plates and antibiotic resistant colonies are then selected. Plasmid DNA can be isolated and confirmed by restriction analysis and DNA sequencing.
Selected clones can be grown overnight in liquid culture medium such as LB broth supplemented with antibiotics. The overnight culture may subsequently be used to inoculate a larger scale culture. The cells are then grown to a desired optical density, during which the expression promoter is turned on. After culturing the cells for several more hours, the cells can be harvested by centrifugation. The cell pellet obtained by the centrifugation can be solubilized using various agents known in the art, and the solubilized PRO protein can then be purified using a metal chelating column under conditions that allow tight binding of the protein. PRO may be expressed in E. coli in a poly-His tagged form, using the following procedure.
The DNA encoding PRO is initially amplified using selected PCR primers. The primers will contain restriction enzyme sites which correspond to the restriction enzyme sites on the selected expression vector, and other useful sequences providing for efficient and reliable translation initiation, rapid purification on a metal chelation column, and proteolytic removal with enterokinase. The PCR- amplified, poly-His tagged sequences are then ligated into an expression vector, which is used to transform an E. coli host based on strain 52 (W3110 fuhA(tonA) Ion galE rpoHts(htpRts) clpP(lacIq). Transformants are first grown in LB containing 50 mg/ml carbenicillin at 30°C with shaking until an O.D.600 of 3-5 is reached. Cultures are then diluted 50-100 fold into CRAP media (prepared by mixing 3.57 g (NH4)2S04, 0.71 g sodium citrate«2H20, 1.07 g KC1, 5.36 g Difco yeast extract, 5.36 g Sheffield hycase SF in 500 mL water, as well as 110 mM MPOS, pH 7.3, 0.55% (w/v) glucose and 7 mM MgS04) and grown for approximately 20-30 hours at 30°C with shaking. Samples are removed to verify expression by SDS-PAGE analysis, and the bulk culture is centrifuged to pellet the cells. Cell pellets are frozen until purification and refolding.
E. coli paste from 0.5 to 1 L fermentations (6-10 g pellets) is resuspended in 10 volumes (w/v) in 7 M guanidine, 20 mM Tris, pH 8 buffer. Solid sodium sulfite and sodium tetrathionate is added to make final concentrations of 0.1M and 0.02 M, respectively, and the solution is stirred overnight at 4°C. This step results in a denatured protein with all cysteine residues blocked by sulfitolization. The solution is centrifuged at 40,000 rpm in a Beckman Ultracentifuge for 30 min. The supernatant is diluted with 3-5 volumes of metal chelate column buffer (6 M guanidine, 20 mM Tris, pH 7.4) and filtered through 0.22 micron filters to clarify. The clarified extract is loaded onto a 5 ml Qiagen
Ni-NTA metal chelate column equilibrated in the metal chelate column buffer. The column is washed with additional buffer containing 50 mM imidazole (Calbiochem, Utrol grade), pH 7.4. The protein is eluted with buffer containing 250 mM imidazole. Fractions containing the desired protein are pooled and stored at 4°C. Protein concentration is estimated by its absorbance at 280 nm using the calculated extinction coefficient based on its amino acid sequence.
The proteins are refolded by diluting the sample slowly into freshly prepared refolding buffer consisting of: 20 mM Tris, pH 8.6, 0.3 M NaCl, 2.5 M urea, 5 mM cysteine, 20 M glycine and 1 mM EDTA. Refolding volumes are chosen so that the final protein concentration is between 50 to 100 micrograms/ml. The refolding solution is stirred gently at 4°C for 12-36 hours. The refolding reaction is quenched by the addition of TFA to a final concentration of 0.4% (pH of approximately 3). Before further purification of the protein, the solution is filtered through a 0.22 micron filter and acetonitrile is added to 2-10% final concentration. The refolded protein is chromatographed on a Poros Rl/H reversed phase column using a mobile buffer of 0.1% TFA with elution with a gradient of acetonitrile from 10 to 80%. Aliquots of fractions with A280 absorbance are analyzed on SDS polyacrylamide gels and fractions containing homogeneous refolded protein are pooled. Generally, the properly refolded species of most proteins are eluted at the lowest concentrations of acetonitrile since those species are the most compact with their hydrophobic interiors shielded from interaction with the reversed phase resin. Aggregated species are usually eluted at higher acetonitrile concentrations. In addition to resolving misfolded forms of proteins from the desired form, the reversed phase step also removes endotoxin from the samples.
Fractions containing the desired folded PRO polypeptide are pooled and the acetonitrile removed using a gentle stream of nitrogen directed at the solution. Proteins are formulated into 20 mM Hepes, pH 6.8 with 0.14 M sodium chloride and 4% mannitol by dialysis or by gel filtration using G25 Superfine (Pharmacia) resins equilibrated in the formulation buffer and sterile filtered.
Many of the PRO polypeptides disclosed herein were successfully expressed as described above.
EXAMPLE 11 Expression of PRO in mammalian cells
This example illustrates preparation of a potentially glycosylated form of PRO by recombinant expression in mammalian cells.
The vector, pRK5 (see EP 307,247, published March 15, 1989), is employed as the expression vector. Optionally, the PRO DNA is ligated into pRK5 with selected restriction enzymes to allow insertion of the PRO DNA using ligation methods such as described in Sambrook et al, supra. The resulting vector is called pRK5-PRO.
In one embodiment, the selected host cells may be 293 cells. Human 293 cells (ATCC CCL 1573) are grown to confluence in tissue culture plates in medium such as DMEM supplemented with fetal calf serum and optionally, nutrient components and/or antibiotics. About 10 μg pRK5-PRO DNA is mixed with about 1 μg DNA encoding the VA RNA gene [Thimmappaya et al, Cell, 31:543 (1982)] and dissolved in 500 μl of 1 mM Tris-HCl, 0.1 mM EDTA, 0.227 M CaCl2. To this mixture is added, dropwise, 500 μl of 50 mM HEPES (pH 7.35), 280 mM NaCl, 1.5 mM NaP04, and a precipitate is allowed to form for 10 minutes at 25°C. The precipitate is suspended and added to the 293 cells and allowed to settle for about four hours at 37°C. The culture medium is aspirated off and 2 ml of 20% glycerol in PBS is added for 30 seconds. The 293 cells are then washed with serum free medium, fresh medium is added and the cells are incubated for about 5 days.
Approximately 24 hours after the transfections, the culture medium is removed and replaced with culture medium (alone) or culture medium containing 200 μCi/ml 35S-cysteine and 200 μCi/ml 35S-methionine. After a 12 hour incubation, the conditioned medium is collected, concentrated on a spin filter, and loaded onto a 15% SDS gel. The processed gel may be dried and exposed to film for a selected period of time to reveal the presence of PRO polypeptide. The cultures containing transfected cells may undergo further incubation (in serum free medium) and the medium is tested in selected bioassays. In an alternative technique, PRO may be introduced into 293 cells transiently using the dextran sulfate method described by Somparyrac et al, Proc. Natl. Acad. Sci., 12:7575 (1981). 293 cells are grown to maximal density in a spinner flask and 700 μg pRK5-PRO DNA is added. The cells are first concentrated from the spinner flask by centrifugation and washed with PBS. The DNA- dextran precipitate is incubated on the cell pellet for four hours. The cells are treated with 20% glycerol for 90 seconds, washed with tissue culture medium, and re-introduced into the spinner flask containing tissue culture medium, 5 μg/ml bovine insulin and 0.1 μg/ml bovine transferrin. After about four days, the conditioned media is centrifuged and filtered to remove cells and debris. The sample containing expressed PRO can then be concentrated and purified by any selected method, such as dialysis and/or column chromatography.
In another embodiment, PRO can be expressed in CHO cells. The pRK5-PRO can be transfected into CHO cells using known reagents such as CaP04 or DEAE-dextran. As described above, the cell cultures can be incubated, and the medium replaced with culture medium (alone) or medium containing a radiolabel such as 35S-methionine. After determining the presence of PRO polypeptide, the culture medium may be replaced with serum free medium. Preferably, the cultures are incubated for about 6 days, and then the conditioned medium is harvested. The medium containing the expressed PRO can then be concentrated and purified by any selected method.
Epitope-tagged PRO may also be expressed in host CHO cells. The PRO may be subcloned out of the pRK5 vector. The subclone insert can undergo PCR to fuse in frame with a selected epitope tag such as a poly-his tag into a Baculovirus expression vector. The poly-his tagged PRO insert can then be subcloned into a SV40 driven vector containing a selection marker such as DHFR for selection of stable clones. Finally, the CHO cells can be transfected (as described above) with the SV40 driven vector. Labeling may be performed, as described above, to verify expression. The culture medium containing the expressed poly-His tagged PRO can then be concentrated and purified by any selected method, such as by Ni2+-chelate affinity chromatography.
PRO may also be expressed in CHO and/or COS cells by a transient expression procedure or in CHO cells by another stable expression procedure.
Stable expression in CHO cells is performed using the following procedure. The proteins are expressed as an IgG construct (immunoadhesin), in which the coding sequences for the soluble forms (e.g. extracellular domains) of the respective proteins are fused to an IgGl constant region sequence containing the hinge, CH2 and CH2 domains and or is a poly-His tagged form.
Following PCR amplification, the respective DNAs are subcloned in a CHO expression vector using standard techniques as described in Ausubel et al, Current Protocols of Molecular Biology, Unit 3.16, John Wiley and Sons (1997). CHO expression vectors are constructed to have compatible restriction sites 5' and 3' of the DNA of interest to allow the convenient shuttling of cDNA's. The vector used expression in CHO cells is as described in Lucas et al, Nucl. Acids Res. 24:9 (1774-1779 (1996), and uses the SV40 early promoter/enhancer to drive expression of the cDNA of interest and dihydrofolate reductase (DHFR). DHFR expression permits selection for stable maintenance of the plasmid following transfection. Twelve micrograms of the desired plasmid DNA is introduced into approximately 10 million
CHO cells using commercially available transfection reagents Superfect® (Quiagen), Dosper® or
Fugene® (Boehringer Mannheim). The cells are grown as described in Lucas et al, supra.
Approximately 3 x IO"7 cells are frozen in an ampule for further growth and production as described below.
The ampules containing the plasmid DNA are thawed by placement into water bath and mixed by vortexing. The contents are pipetted into a centrifuge tube containing 10 mLs of media and centrifuged at 1000 rpm for 5 minutes. The supernatant is aspirated and the cells are resuspended in 10 mL of selective media (0.2 μm filtered PS20 with 5% 0.2 μm diafiltered fetal bovine serum). The cells are then aliquoted into a 100 mL spinner containing 90 mL of selective media. After 1-2 days, the cells are transferred into a 250 mL spinner filled with 150 mL selective growth medium and incubated at 37°C. After another 2-3 days, 250 mL, 500 mL and 2000 mL spinners are seeded with 3 x 105 cells/mL. The cell media is exchanged with fresh media by centrifugation and resuspension in production medium. Although any suitable CHO media may be employed, a production medium described in U.S. Patent No. 5,122,469, issued June 16; 1992 may actually be used. A 3L production spinner is seeded at 1.2 x IO6 cells/mL. On day 0, the cell number pH ie determined. On day 1, the spinner is sampled and sparging with filtered air is commenced. On day 2, the spinner is sampled, the temperature shifted to 33°C, and 30 mL of 500 g/L glucose and 0.6 mL of 10% antifoam (e.g., 35% polydimethylsiloxane emulsion, Dow Corning 365 Medical Grade Emulsion) taken. Throughout the production, the pH is adjusted as necessary to keep it at around 7.2. After 10 days, or until the viability dropped below 70%, the cell culture is harvested by centrifugation and filtering through a 0.22 μm filter. The filtrate was either stored at 4CC or immediately loaded onto columns for purification.
For the poly-His tagged constructs, the proteins are purified using a Ni-NTA column (Qiagen). Before purification, imidazole is added to the conditioned media to a concentration of 5 mM. The conditioned media is pumped onto a 6 ml Ni-NTA column equilibrated in 20 mM Hepes, pH
7.4, buffer containing 0.3 M NaCl and 5 mM imidazole at a flow rate of 4-5 ml min. at 4°C. After loading, the column is washed with additional equilibration buffer and the protein eluted with equilibration buffer containing 0.25 M imidazole. The highly purified protein is subsequently desalted into a storage buffer containing 10 mM Hepes, 0.14 M NaCl and 4% mannitol, pH 6.8, with a 25 ml G25 Superfine (Pharmacia) column and stored at -80°C.
Immunoadhesin (Fc-containing) constructs are purified from the conditioned media as follows. The conditioned medium is pumped onto a 5 ml Protein A column (Pharmacia) which had been equilibrated in 20 M Na phosphate buffer, pH 6.8. After loading, the column is washed extensively with equilibration buffer before elution with 100 mM citric acid, pH 3.5. The eluted protein is immediately neutralized by collecting 1 ml fractions into tubes containing 275 μL of 1 M
Tris buffer, pH 9. The highly purified protein is subsequently desalted into storage buffer as described above for the poly-His tagged proteins. The homogeneity is assessed by SDS polyacrylamide gels and by N-terminal amino acid sequencing by Edman degradation. Many of the PRO polypeptides disclosed herein were successfully expressed as described above.
EXAMPLE 12 Expression of PRO in Yeast
The following method describes recombinant expression of PRO in yeast.
First, yeast expression vectors are constructed for intracellular production or secretion of PRO from the ADH2/GAPDH promoter. DNA encoding PRO and the promoter is inserted into suitable restriction enzyme sites in the selected plasmid to direct intracellular expression of PRO. For secretion, DNA encoding PRO can be cloned into the selected plasmid, together with DNA encoding the ADH2/GAPDH promoter, a native PRO signal peptide or other mammalian signal peptide, or, for example, a yeast alpha-factor or invertase secretory signal/leader sequence, and linker sequences (if needed) for expression of PRO.
Yeast cells, such as yeast strain ABI 10, can then be transformed with the expression plasmids described above and cultured in selected fermentation media. The transformed yeast supernatants can be analyzed by precipitation with 10% trichloroacetic acid and separation by SDS-PAGE, followed by staining of the gels with Coomassie Blue stain.
Recombinant PRO can subsequently be isolated and purified by removing the yeast cells from the fermentation medium by centrifugation and then concentrating the medium using selected cartridge filters. The concentrate containing PRO may further be purified using selected column chromatography resins.
Many of the PRO polypeptides disclosed herein were successfully expressed as described above.
EXAMPLE 13
Expression of PRO in Baculovirus-Infected Insect Cells
The following method describes recombinant expression of PRO in Baculovirus-infected insect cells.
The sequence coding for PRO is fused upstream of an epitope tag contained within a baculovirus expression vector. Such epitope tags include poly-his tags and immunoglobulin tags (like
Fc regions of IgG). A variety of plasmids may be employed, including plasmids derived from commercially available plasmids such as pVL1393 (Novagen). Briefly, the sequence encoding PRO or the desired portion of the coding sequence of PRO such as the sequence encoding the extracellular domain of a transmembrane protein or the sequence encoding the mature protein if the protein is extracellular is amplified by PCR with primers complementary to the 5' and 3' regions. The 5' primer may incorporate flanking (selected) restriction enzyme sites. The product is then digested with those selected restriction enzymes and subcloned into the expression vector.
Recombinant baculovirus is generated by co-transfecting the above plasmid and BaculoGold™ virus DNA (Pharmingen) into Spodoptera frugiperda ("Sf9") cells (ATCC CRL 1711) using lipofectin (commercially available from GIBCO-BRL). After 4 - 5 days of incubation at 28°C, the released viruses are harvested and used for further amplifications. Viral infection and protein expression are performed as described by O'Reilley et al, Baculovirus expression vectors: A Laboratory Manual, Oxford: Oxford University Press (1994). Expressed poly-his tagged PRO can then be purified, for example, by Ni +-chelate affinity chromatography as follows. Extracts are prepared from recombinant virus-infected Sf9 cells as described by Rupert et al, Nature, 362:175-179 (1993). Briefly, Sf cells are washed, resuspended in sonication buffer (25 mL Hepes, pH 7.9; 12.5 mM MgCl2; 0.1 mM EDTA; 10% glycerol; 0.1% NP-40; 0.4 M KC1), and sonicated twice for 20 seconds on ice. The sonicates are cleared by centrifugation, and the supernatant is diluted 50-fold in loading buffer (50 mM phosphate, 300 mM NaCl, 10% glycerol, pH 7.8) and filtered through a 0.45 μm filter. A Ni2+-NTA agarose column (commercially available from Qiagen) is prepared with a bed volume of 5 mL, washed with 25 mL of water and equilibrated with 25 L of loading buffer. The filtered cell extract is loaded onto the column at 0.5 mL per minute. The column is washed to baseline A280 with loading buffer, at which point fraction collection is started. Next, the column is washed with a secondary wash buffer (50 mM phosphate;
300 mM NaCl, 10% glycerol, pH 6.0), which elutes nonspecifically bound protein. After reaching A280 baseline again, the column is developed with a 0 to 500 mM Imidazole gradient in the secondary wash buffer. One mL fractions are collected and analyzed by SDS-PAGE and silver staining or Western blot with Ni2+-NTA-conjugated to alkaline phosphatase (Qiagen). Fractions containing the eluted His,0- tagged PRO are pooled and dialyzed against loading buffer.
Alternatively, purification of the IgG tagged (or Fc tagged) PRO can be performed using known chromatography techniques, including for instance, Protein A or protein G column chromatography.
Many of the PRO polypeptides disclosed herein were successfully expressed as described above.
EXAMPLE 14 Preparation of Antibodies that Bind PRO
This example illustrates preparation of monoclonal antibodies which can specifically bind PRO.
Techniques for producing the monoclonal antibodies are known in the art and are described, for instance, in Goding, supra. Immunogens that may be employed include purified PRO, fusion proteins containing PRO, and cells expressing recombinant PRO on the cell surface. Selection of the immunogen can be made by the skilled artisan without undue experimentation. Mice, such as Balb/c, are immunized with the PRO immunogen emulsified in complete
Freund's adjuvant and injected subcutaneously or intraperitoneally in an amount from 1-100 micrograms. Alternatively, the immunogen is emulsified in MPL-TDM adjuvant (Ribi Immunochemical Research, Hamilton, MT) and injected into the animal's hind foot pads. The immunized mice are then boosted 10 to 12 days later with additional immunogen emulsified in the selected adjuvant. Thereafter, for several weeks, the mice may also be boosted with additional immunization injections. Serum samples may be periodically obtained from the mice by retro-orbital bleeding for testing in ELISA assays to detect anti-PRO antibodies.
After a suitable antibody titer has been detected, the animals "positive" for antibodies can be injected with a final intravenous injection of PRO. Three to four days later, the mice are sacrificed and the spleen cells are harvested. The spleen cells are then fused (using 35% polyethylene glycol) to a selected murine myeloma cell line such as P3X63AgU.l, available from ATCC, No. CRL 1597. The fusions generate hybridoma cells which can then be plated in 96 well tissue culture plates containing HAT (hypoxanthine, aminopterin, and thymidine) medium to inhibit proliferation of non-fused cells, myeloma hybrids, and spleen cell hybrids.
The hybridoma cells will be screened in an ELISA for reactivity against PRO. Determination of "positive" hybridoma cells secreting the desired monoclonal antibodies against PRO is within the skill in the art.
The positive hybridoma cells can be injected intraperitoneally into syngeneic Balb/c mice to produce ascites containing the anti-PRO monoclonal antibodies. Alternatively, the hybridoma cells can be grown in tissue culture flasks or roller bottles. Purification of the monoclonal antibodies produced in the ascites can be accomplished using ammonium sulfate precipitation, followed by gel exclusion chromatography. Alternatively, affinity chromatography based upon binding of antibody to protein A or protein G can be employed.
EXAMPLE 15
Purification of PRO Polypeptides Using Specific Antibodies
Native or recombinant PRO polypeptides may be purified by a variety of standard techniques in the art of protein purification. For example, pro-PRO polypeptide, mature PRO polypeptide, or pre- PRO polypeptide is purified by immunoaffinity chromatography using antibodies specific for the PRO polypeptide of interest. In general, an immunoaffinity column is constructed by covalently coupling the anti-PRO polypeptide antibody to an activated chromatographic resin.
Polyclonal immunoglobulins are prepared from immune sera either by precipitation with ammonium sulfate or by purification on immobilized Protein A (Pharmacia LKB Biotechnology, Piscataway, N.J.). Likewise, monoclonal antibodies are prepared from mouse ascites fluid by ammonium sulfate precipitation or chromatography on immobilized Protein A. Partially purified immunoglobulin is covalently attached to a chromatographic resin such as CnBr-activated SEPHAROSE™ (Pharmacia LKB Biotechnology). The antibody is coupled to the resin, the resin is blocked, and the derivative resin is washed according to the manufacturer's instructions. Such an immunoaffinity column is utilized in the purification of PRO polypeptide by preparing a fraction from cells containing PRO polypeptide in a soluble form. This preparation is derived by solubilization of the whole cell or of a subcellular fraction obtained via differential centrifugation by the addition of detergent or by other methods well known in the art. Alternatively, soluble PRO polypeptide containing a signal sequence may be secreted in useful quantity into the medium in which the cells are grown.
A soluble PRO polypeptide-containing preparation is passed over the immunoaffinity column, and the column is washed under conditions that allow the preferential absorbance of PRO polypeptide (e g-, high ionic strength buffers in the presence of detergent). Then, the column is eluted under conditions that disrupt antibody/PRO polypeptide binding (e.g. , a low pH buffer such as approximately pH 2-3, or a high concentration of a chaotrope such as urea or thiocyanate ion), and PRO polypeptide is collected.
EXAMPLE 16
Drug Screening
This invention is particularly useful for screening compounds by using PRO polypeptides or binding fragment thereof in any of a variety of drug screening techniques. The PRO polypeptide or fragment employed in such a test may either be free in solution, affixed to a solid support, borne on a cell surface, or located intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the PRO polypeptide or fragment. Drugs are screened against such transformed cells in competitive binding assays. Such cells, either in viable or fixed form, can be used for standard binding assays. One may measure, for example, the formation of complexes between PRO polypeptide or a fragment and the agent being tested. Alternatively, one can examine the diminution in complex formation between the
PRO polypeptide and its target cell or target receptors caused by the agent being tested.
Thus, the present invention provides methods of screening for drugs or any other agents which can affect a PRO polypeptide-associated disease or disorder. These methods comprise contacting such an agent with an PRO polypeptide or fragment thereof and assaying (I) for the presence of a complex between the agent and the PRO polypeptide or fragment, or (ii) for the presence of a complex between the PRO polypeptide or fragment and the cell, by methods well known in the art. In such competitive binding assays, the PRO polypeptide or fragment is typically labeled. After suitable incubation, free PRO polypeptide or fragment is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of the particular agent to bind to PRO polypeptide or to interfere with the PRO polypeptide/cell complex.
Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to a polypeptide and is described in detail in WO 84/03564, published on September 13, 1984. Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. As applied to a PRO polypeptide, the peptide test compounds are reacted with PRO polypeptide and washed. Bound PRO polypeptide is detected by methods well known in the art. Purified PRO polypeptide can also be coated directly onto plates for use in the aforementioned drug screening techniques. In addition, non-neutralizing antibodies can be used to capture the peptide and immobilize it on the solid support.
I l l This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding PRO polypeptide specifically compete with a test compound for binding to PRO polypeptide or fragments thereof. In this manner, the antibodies can be used to detect the presence of any peptide which shares one or more antigenic determinants with PRO polypeptide.
EXAMPLE 17 Rational Drug Design
The goal of rational drug design is to produce structural analogs of biologically active polypeptide of interest (i.e., a PRO polypeptide) or of small molecules with which they interact, e.g., agonists, antagonists, or inhibitors. Any of these examples can be used to fashion drugs which are more active or stable forms of the PRO polypeptide or which enhance or interfere with the function of the PRO polypeptide in vivo (c.f, Hodgson, Bio/Technology, 9: 19-21 (1991)).
In one approach, the three-dimensional structure of the PRO polypeptide, or of an PRO polypeptide-inhibitor complex, is determined by x-ray crystallography, by computer modeling or, most typically, by a combination of the two approaches. Both the shape and charges of the PRO polypeptide must be ascertained to elucidate the structure and to determine active site(s) of the molecule. Less often, useful information regarding the structure of the PRO polypeptide may be gained by modeling based on the structure of homologous proteins. In both cases, relevant structural information is used to design analogous PRO polypeptide-like molecules or to identify efficient inhibitors. Useful examples of rational drug design may include molecules which have improved activity or stability as shown by Braxton and Wells, Biochemistry:, 31:7796-7801 (1992) or which act as inhibitors, agonists, or antagonists of native peptides as shown by Athauda et al, J. Biochem., 113:742-746 (1993).
It is also possible to isolate a target-specific antibody, selected by functional assay, as described above, and then to solve its crystal structure. This approach, in principle, yields a pharmacore upon which subsequent drug design can be based. It is possible to bypass protein crystallography altogether by generating anti-idiotypic antibodies (anti-ids) to a functional, pharmacologically active antibody. As a mirror image of a mirror image, the binding site of the anti-ids would be expected to be an analog of the original receptor. The anti-id could then be used to identify and isolate peptides from banks of chemically or biologically produced peptides. The isolated peptides would then act as the pharmacore.
By virtue of the present invention, sufficient amounts of the PRO polypeptide may be made available to perform such analytical studies as X-ray crystallography. In addition, knowledge of the PRO polypeptide amino acid sequence provided herein will provide guidance to those employing computer modeling techniques in place of or in addition to x-ray crystallography.
Deposit of Material The following materials have been deposited with the American Type Culture Collection, 10801 University Blvd., Manassas, VA 20110-2209, USA (ATCC).
Material ATCC Deposit No. Deposit Date DNA19355-1150 209466 November 18, 1997
DNA32298-1132 209257 September 16, 1997 DNA33087-1158 209381 September 16, 1997 DNA35917-1207 209508 December 3, 1997 DNA39984-1221 209435 November 7, 1997 DNA44167- 1243 209434 November 7, 1997
DNA48336-1309 209669 March 11, 1998 DNA49142-1430 203002 June 23, 1998 DNA52192-1369 203042 July 1, 1998 DNA53987-1438 209858 May 12, 1998 DNA57037-1444 209903 May 27, 1998
DNA57694-1341 203017 June 23, 1998 DNA59214-1449 203046 July 1, 1998 DNA59767-1489 203108 August 11, 1998
These deposits were made under the provisions of the Budapest Treaty on the International
Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty). This assures the maintenance of a viable culture of the deposit for 30 years from the date of deposit. The deposit will be made available by the ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc. and the ATCC, which assures permanent and unrestricted availability of the progeny of the culture of the deposit to the public upon issuance of the pretinent U.S. patent or upon laying open to the public of any U.S. or foreign patent application, whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner's rules pursuant thereto (including 37 C.F.R. § 1.14 with particular reference to 886 OG 638).
The assignee of the present application has agreed that if a culture of the materials on deposit should die or be lost or destroyed when cultivated under suitable conditions, the materials will be promptly replaced on notification with another of the same. Availability of the deposited material is not to be construed as a license to practice the invention in contravention of the rights granted under the authority of any government in accordance with its patent laws.
The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present inventions are not to be limited in scope by the construct deposited., since the deposited embodiment is intended as a single illustration of certain aspects of the invention and any constructs that are functionally equivalent are within the scope of this invention. The deposit of material herein does not constitute an admission that the written description herein contained is inadequate to enable the practice of any aspect of the invention, including the best mode thereof, nor is it to be construed as limiting the scope of the claims to the specific illustrations that it represents. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims.

Claims

WHAT IS CLAIMED IS:
1. A method of promoting the survival of retinal cells, said method comprising contacting said retina! cells with an effective amount of an active PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide.
2. The method of Claim 1, wherein the active PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide has at least 80% amino acid sequence identity to the sequence of amino acid residues from about: (a) 1 or about 45 to 177 of Figure 2 (SEQ ID NO:2); (b) 1 or about 23 to 708 of Figure 4 (SEQ ID NO:8); (c) 1 or about 21 to 421 of Figure 6 (SEQ ID NO: 10); (d) 1 or about 24 to 954 of Figure 9 (SEQ ID NO: 15); (e) 1 or about 23 to 424 of Figure 11 (SEQ ID NO: 18); (f) 1 or about 19 to 450 of Figure 13 (SEQ ID NO:21); (g) 1 or about 24 to 260 of Figure 15 (SEQ ID NO:32); (h) 1 or about 26 to 313 of Figure 17 (SEQ ID NO:36); (i) 1 or about 18 to 504 of Figure 19 (SEQ ID NO:38); (j) 1 or about 47 to 437 of Figure 21 (SEQ ID NO:44); (k) 1 or about 22 to 187 of Figure 23 (SEQ ID NO:50); (1) 1 or about 23 to 99 of Figure 25 (SEQ ID NO:55); (m) 1 or about 21 to 124 of Figure 27 (SEQ ID NO:60) or (n) 1 or about 23 to 293 of Figure 29 (SEQ ID NO:66), respectively.
3. The method of Claim 1, wherein the active PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide comprises amino acids: (a) 1 or about 45 to 177 of Figure 2 (SEQ ID NO:2); (b) 1 or about 23 to 708 of Figure 4 (SEQ ID NO: 8); (c) 1 or about 21 to 421 of Figure 6 (SEQ ID NO: 10); (d) 1 or about 24 to 954 of Figure 9 (SEQ ID NO: 15); (e) 1 or about 23 to 424 of Figure 11 (SEQ ID NO: 18); (f) 1 or about 19 to 450 of Figure 13 (SEQ ID NO:21); (g) 1 or about 24 to 260 of Figure 15 (SEQ ID NO:32); (h) 1 or about 26 to 313 of Figure 17 (SEQ ID NO:36); (i) 1 or about 18 to 504 of Figure 19 (SEQ ID NO:38); (j) 1 or about 47 to 437 of Figure 21 (SEQ ID NO:44); (k) 1 or about 22 to 187 of Figure 23 (SEQ ID NO:50); (1) 1 or about 23 to 99 of Figure 25 (SEQ ID NO:55); (m) 1 or about 21 to 124 of Figure 27 (SEQ ID NO:60) or (n) 1 or about 23 to 293 of Figure 29 (SEQ ID NO:66), respectively.
4. The method of Claim 1 , wherein the active PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide consists of amino acids: (a) 1 or about 45 to 177 of Figure 2 (SEQ ID NO:2); (b) 1 or about 23 to 708 of Figure 4 (SEQ ID NO:8); (c) 1 or about 21 to 421 of Figure 6 (SEQ ID NO: 10); (d) 1 or about 24 to 954 of Figure 9 (SEQ ID NO: 15); (e) 1 or about 23 to 424 of Figure 11 (SEQ ID NO: 18); (f) 1 or about 19 to 450 of Figure 13 (SEQ ID NO:21); (g) 1 or about 24 to 260 of Figure 15 (SEQ ID NO:32); (h) 1 or about 26 to 313 of Figure 17 (SEQ ID NO:36); (i) 1 or about 18 to 504 of Figure 19 (SEQ ID NO:38); (j) 1 or about 47 to 437 of Figure 21 (SEQ ID NO:44); (k) 1 or about 22 to 187 of Figure 23 (SEQ ID NO:50); (1) 1 or about 23 to 99 of Figure 25 (SEQ ID NO:55); (m) 1 or about 21 to 124 of Figure 27 (SEQ ID NO:60) or (n) 1 or about 23 to 293 of Figure 29 (SEQ ID NO:66), respectively.
5. The method of Claim 1 , wherein the active PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide has at least about 80% amino acid sequence identity to the polypeptide encoded by the cDNA insert of the vector deposited with the ATCC under ATCC deposit number 209466, 209257, 209381, 209508, 209435, 209434, 209669, 203002, 203042, 209858, 209903, 203017, 203046 or 203108, respectively.
6. The method of Claim 1, wherein the active PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide comprises the amino acid sequence encoded by the cDNA insert of the vector deposited with the ATCC under ATCC deposit number 209466, 209257, 209381, 209508, 209435, 209434, 209669, 203002, 203042, 209858, 209903, 203017, 203046 or 203108, respectively.
7. The method of Claim 1 , wherein the active PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide consists of the amino acid sequence encoded by the cDNA insert of the vector deposited with the ATCC under ATCC deposit number 209466, 209257, 209381, 209508, 209435, 209434, 209669, 203002, 203042, 209858, 209903, 203017, 203046 or 203108, respectively.
8. The method of Claim 1, wherein said contacting is performed in vivo and wherein said retinal cells are contacted with a therapeutically effective amount of said PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide.
9. The method of Claim 1, wherein said retinal cells are retinal neurons, rod photoreceptors or supportive cells.
10. The method of Claim 9, wherein said retinal neurons are retinal ganglion cells, displaced retinal ganglion cells, amacrine cells, displaced amacrine cells, horizontal neurons or bipolar neurons.
11. The method of Claim 9, wherein said supportive cells are Miiller cells or pigment epithelial cells.
12. The method of Claim 1, wherein said contacting is intraocular.
13. The method of Claim 1 , wherein the polypeptide is administered into the vitreous or into the subretinal space.
14. The method of Claim 1, wherein said contacting is intravitreal.
15. The method of Claim 1 , wherein said contacting is performed by means of an implant.
16. The method of Claim 1, wherien the method further comprises contacting said retinal cells with an effective amount of an active neuronal survival agent.
17. The method of claim 16 wherein the neuronal survival agent is selected from the group consisting of: Vitamin A, an antioxidant, a calcium overload blockers, aFGF, bFGF, TGB-β, BDNF, NT-4, IGF-I, CNTF, IL-1 , NT-3, IGF-II, TNF-α, TNF-β and NGF.
18. A method of delaying or preventing retinal cell injury or death, said method comprising contacting said retinal cells with an effective amount of an active PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide.
19. The method of Claim 18, wherein said contacting is performed in vivo and wherein said retinal cells are contacted with a therapeutically effective amount of said PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PROl 068 or PROl 132 polypeptide.
20. The method of Claim 18, wherein said retinal cells are retinal neurons, rod photoreceptors or supportive cells.
21. The method of Claim 18, wherein said contacting is intraocular.
22. The method of Claim 18, wherein the polypeptide is administered into the vitreous or into the subretinal space.
23. The method of Claim 18, wherein said contacting is performed by means of an implant.
24. The method of Claim 18, wherein said retinal cell injury or death is caused by an ocular disease, retinal injury or environmental trauma.
25. The method of Claim 18, wherein the method further comprises contacting said retinal cells with a therapeutically effective amount of an active neuronal survival agent.
26. The method of Claim 25 wherein the neuronal survival agent is selected from the group consisting of: Vitamin A, an antioxidant, a calcium overload blockers, aFGF, bFGF, TGB-β, BDNF, NT-4, IGF-I, CNTF, IL-1, NT-3, IGF-II, TNF-α, TNF-β and NGF.
27. The method of Claim 24, wherein said ocular disease is or is associated with retinitis pigmentosa, macular degeneration, retinal detachment, a retinal tear, retinopathy, a retinal degenerative disease, a macular hole, degenerative myopia, acute retinal necrosis syndrome, a traumatic chorioretinopathy or contusion, Purtscher's retinopathy, edema, an ischemic conditions, central or branch retinal vision occlusion, a collagen vascular disease, thrombocytompenic purpura, uveitis, retinal vasculitis, an occlusion associated with Eales disease or systemic lupus erythematosus.
28. The method of Claim 18 which does not substantially cause angiogenesis or mitogenesis.
29. An article of manufacture, comprising:
(a) a container;
(b) a label on said container; and
(c) a composition contained within said container; wherein the composition comprises an active agent effective for promoting the survival of retinal cells, the label on said container indicates that the composition is useful for promoting the survival of retinal cells, and said active agent is an active PROl 75, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PROl 068 or PROl 132 polypeptide.
30. The article of manufacture of Claim 29 further comprising instructions for administering the PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide to a mammal.
31. An article of manufacture, comprising:
(a) a container;
(b) a label on said container; and
(c) a composition contained within said container; wherein the composition comprises an active agent effective for delaying or preventing retinal cell injury or death, the label on said container indicates that the composition is useful for delaying or preventing retinal cell injury or death, and said active agent is an active PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide.
32. The article of manufacture of Claim 31 further comprising instructions for administering the PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide to a mammal.
33. Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence that encodes an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 1 (SEQ ID NO:l), Figure 3 (SEQ ID NO:7), Figure 5 (SEQ ID NO:9), Figure 8 (SEQ ID NO:14), Figure 10 (SEQ ID NO:27), Figure 12 (SEQ ID NO:30), Figure 14 (SEQ ID NO:41), Figure 16 (SEQ ID NO:43), Figure 18 (SEQ ID NO:49), Figure 20 (SEQ ID NO:53), Figure 22 (SEQ ID NO:59), Figure 24 (SEQ ID NO:64), Figure 26 (SEQ ID NO:66) or Figure 28 (SEQ ID NO:75).
34. Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequence shown in Figure 1 (SEQ ID NO:l), Figure 3 (SEQ ID NO:7), Figure 5 (SEQ ID NO:9), Figure 8 (SEQ ID NO:14), Figure 10 (SEQ ID NO:27), Figure 12 (SEQ ID NO:30), Figure 14 (SEQ ID NO:41), Figure 16 (SEQ ID NO:43), Figure 18 (SEQ ID NO:49), Figure 20 (SEQ ID NO:53), Figure 22 (SEQ ID NO:59), Figure 24 (SEQ ID NO:64), Figure 26 (SEQ ID NO:66) or Figure 28 (SEQ ID NO:75).
35. Isolated nucleic acid having at least 80% nucleic acid sequence identity to a nucleotide sequence selected from the group consisting of the full-length coding sequence of the nucleotide sequence shown in Figure 1 (SEQ ID NO:l), Figure 3 (SEQ ID NO:7), Figure 5 (SEQ ID NO:9), Figure 8 (SEQ ID NO:14), Figure 10 (SEQ ID NO:27), Figure 12 (SEQ ID NO:30), Figure 14 (SEQ ID NO:41), Figure 16 (SEQ ID NO:43), Figure 18 (SEQ ID NO:49), Figure 20 (SEQ ID NO:53), Figure 22 (SEQ ID NO:59), Figure 24 (SEQ ID NO:64), Figure 26 (SEQ ID NO:66) or Figure 28 (SEQ ID NO:75).
36. Isolated nucleic acid having at least 80% nucleic acid sequence identity to the full-length coding sequence of the DNA deposited under ATCC accession number 209466, 209257, 209381 , 209508, 209435, 209434, 209669, 203002, 203042, 209858, 209903, 203017, 203246 or 203108.
37. A vector comprising the nucleic acid of any one of Claims 33 to 36.
38. The vector of Claim 37 operably linked to control sequences recognized by a host cell transformed with the vector.
39. A host cell comprising the vector of Claim 37.
40. The host cell of Claim 39 wherein said cell is a CHO cell.
41. The host cell of Claim 39, wherein said cell is an E. coli.
42. The host cell of Claim 39, wherein said cell is a yeast cell.
43. A process for producing a PR0175, PRO220, PR0216, PR0243, PRO306, PR0346, PR0322, PR0536, PR0943, PRO840, PR0828, PR0826, PRO1068 or PROl 132 polypeptide comprising culturing the host cell of Claim 39 under conditions suitable for expression of said polypeptide and recovering said polypeptide from the cell culture.
44. An isolated polypeptide having at least 80% amino acid sequence identity to an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:8), Figure 6 (SEQ ID NO: 10), Figure 9 (SEQ ID NO: 15, Figure 11 (SEQ ID NO:28), Figure 13 (SEQ ID NO:31), Figure 15 (SEQ ID NO:42), Figure 17 (SEQ ID NO:46), Figure 19 (SEQ ID NO:48), Figure 21 (SEQ ID NO:54), Figure 23 (SEQ ID NO:60), Figure 25 (SEQ ID NO:65), Figure 27 (SEQ ID NO:70) or Figure 29 (SEQ ID NO:76).
45. An isolated polypeptide scoring at least 80% positives when compared to an amino acid sequence selected from the group consisting of the amino acid sequence shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:8), Figure 6 (SEQ ID NO: 10), Figure 9 (SEQ ID NO: 15, Figure 11 (SEQ ID NO:28), Figure 13 (SEQ ID NO:31), Figure 15 (SEQ ID NO:42), Figure 17 (SEQ ID NO:46), Figure 19 (SEQ ID NO:48), Figure 21 (SEQ ID NO:54), Figure 23 (SEQ ID NO:60), Figure 25 (SEQ ID NO:65), Figure 27 (SEQ ID NO:70) or Figure 29 (SEQ ID NO:76).
46. An isolated polypeptide having at least 80% amino acid sequence identity to an amino acid sequence encoded by the full-length coding sequence of the DNA deposited under ATCC accession number 209466, 209257, 209381, 209508, 209435, 209434, 209669, 203002, 203042, 209858, 209903, 203017, 203246 or 203108.
47. A chimeric molecule comprising a polypeptide according to any one of Claims 44 to 46 fused to a heterologous amino acid sequence.
48. The chimeric molecule of Claim 47, wherein said heterologous amino acid sequence is an epitope tag sequence.
49. The chimeric molecule of Claim 47, wherein said heterologous amino acid sequence is a Fc region of an immunoglobulin.
50. An antibody which specifically binds to a polypeptide according to any one of Claims 44 to 46.
51. The antibody of Claim 50, wherein said antibody is a monoclonal antibody, a humanized antibody or a single-chain antibody.
52. Isolated nucleic acid having at least 80% nucleic acid sequence identity to:
(a) a nucleotide sequence encoding the polypeptide shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:8), Figure 6 (SEQ ID NO:10), Figure 9 (SEQ ID NO:15, Figure 11 (SEQ ID NO:28), Figure 13 (SEQ ID NO:31), Figure 15 (SEQ ID NO:42), Figure 17 (SEQ ID NO:46), Figure 19 (SEQ ID NO:48), Figure 21 (SEQ ID NO:54), Figure 23 (SEQ ID NO:60), Figure 25 (SEQ ID NO:65), Figure 27 (SEQ ID NO:70) or Figure 29 (SEQ ID NO:76) lacking its associated signal peptide;
(b) a nucleotide sequence encoding an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:8), Figure 6 (SEQ ID NO:10), Figure 9 (SEQ ID NO:15, Figure 11 (SEQ ID NO:28), Figure 13 (SEQ ID N0:31), Figure 15 (SEQ ID NO:42), Figure 17 (SEQ ID NO:46), Figure 19 (SEQ ID NO:48), Figure 21 (SEQ ID NO:54), Figure 23 (SEQ ID NO:60), Figure 25 (SEQ ID NO:65), Figure 27 (SEQ ID NO:70) or Figure 29 (SEQ ID NO:76) with its associated signal peptide; or
(c) a nucleotide sequence encoding an extracellular domain of the polypeptide shown in
Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:8), Figure 6 (SEQ ID NO: 10), Figure 9 (SEQ ID NO: 15, Figure 11 (SEQ ID NO:28), Figure 13 (SEQ ID NO:31), Figure 15 (SEQ ID NO:42), Figure 17 (SEQ ID NO:46), Figure 19 (SEQ ID NO:48), Figure 21 (SEQ ID NO:54), Figure 23 (SEQ ID NO:60), Figure 25 (SEQ ID NO:65), Figure 27 (SEQ ID NO:70) or Figure 29 (SEQ ID NO:76) lacking its associated signal peptide.
53. An isolated polypeptide having at least 80% amino acid sequence identity to:
(a) the polypeptide shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:8), Figure 6 (SEQ ID NO:10), Figure 9 (SEQ ID NO: 15, Figure 11 (SEQ ID NO:28), Figure 13 (SEQ ID NO:31), Figure 15 (SEQ ID NO:42), Figure 17 (SEQ ID NO:46), Figure 19 (SEQ ID NO:48), Figure 21 (SEQ ID NO:54), Figure 23 (SEQ ID NO:60), Figure 25 (SEQ ID NO:65), Figure 27 (SEQ ID NO:70) or Figure 29 (SEQ ID NO:76) lacking its associated signal peptide;
(b) an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:8), Figure 6 (SEQ ID NO: 10), Figure 9 (SEQ ID NO:15, Figure 11 (SEQ ID NO:28), Figure 13 (SEQ ID NO:31), Figure 15 (SEQ ID NO:42), Figure 17 (SEQ ID NO:46), Figure 19 (SEQ ID NO:48), Figure 21 (SEQ ID NO:54), Figure 23 (SEQ ID NO:60), Figure 25 (SEQ ID NO:65), Figure 27 (SEQ ID NO:70) or Figure 29 (SEQ ID NO:76), with its associated signal peptide; or
(c) an extracellular domain of the polypeptide shown in Figure 2 (SEQ ID NO:2), Figure 4 (SEQ ID NO:8), Figure 6 (SEQ ID NO:10), Figure 9 (SEQ ID NO: 15, Figure 11 (SEQ ID NO:28), Figure 13 (SEQ ID NO:31), Figure 15 (SEQ ID NO:42), Figure 17 (SEQ ID NO:46), Figure 19 (SEQ ID NO:48), Figure 21 (SEQ ID NO:54), Figure 23 (SEQ ID NO:60), Figure 25 (SEQ ID NO:65), Figure 27 (SEQ ID NO:70) or Figure 29 (SEQ ID NO:76), lacking its associated signal peptide.
PCT/US2000/020710 1994-09-08 2000-07-28 Method of preventing the injury or death of retinal cells and treating ocular diseases WO2001009327A2 (en)

Priority Applications (774)

Application Number Priority Date Filing Date Title
AU63910/00A AU6391000A (en) 1999-07-28 2000-07-28 Method of preventing the injury or death of retinal cells and treating ocular diseases
PCT/US2000/022031 WO2001040464A1 (en) 1999-11-30 2000-08-11 Interleukin-1-receptor associated kinase-3 (irak3) and its use in promotion or inhibition of angiogenesis and cardiovascularization
AU69018/00A AU6901800A (en) 1999-11-30 2000-08-11 Interleukin-1-receptor associated kinase-3 (irak3) and its use in promotion or inhibition of angiogenesis and cardiovascularization
AU19167/01A AU1916701A (en) 2000-01-06 2000-11-08 Methods and compositions for inhibiting neoplastic cell growth
PCT/US2000/030952 WO2001049715A2 (en) 2000-01-06 2000-11-08 Methods and compositions for inhibiting neoplastic cell growth
CA002390685A CA2390685C (en) 2000-01-06 2000-11-08 Methods and compositions for inhibiting neoplastic cell growth
EP00982096A EP1244784A2 (en) 2000-01-06 2000-11-08 Methods and compositions for inhibiting neoplastic cell growth
JP2001550255A JP4280444B2 (en) 2000-01-06 2000-11-08 Compositions and methods for inhibiting neoplastic cell growth
AU6802801A AU6802801A (en) 2000-03-01 2000-11-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA2709291A CA2709291A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002496312A CA2496312A1 (en) 1999-12-01 2000-12-01 Colon tumour marker pro4799 polypeptides and nucleic acids encoding the same
EP06000586A EP1688497A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000584A EP1669371A3 (en) 1999-12-01 2000-12-01 Composition and methods for the diagnosis of tumours
CA002491433A CA2491433A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000582A EP1666495A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US2000/032678 WO2001040466A2 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000588A EP1690873A3 (en) 1999-12-01 2000-12-01 Composition and methods for the diagnosis of tumours
EP06000587A EP1690872A3 (en) 1999-12-01 2000-12-01 Composition and methods for the diagnosis of tumours
EP06000589A EP1661997A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002492070A CA2492070A1 (en) 1999-12-01 2000-12-01 Lung tumor marker pro4329 polypeptides and nucleic acids encoding the same
CA002492049A CA2492049A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002490853A CA2490853A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000581A EP1666494A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002391455A CA2391455A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP10005292A EP2228446A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptieds and nucleic acids encoding the same
JP2001542531A JP2004522404A (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding them
EP06000585A EP1661996A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP06000583A EP1686134A3 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
AU20554/01A AU2055401A (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002494705A CA2494705A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002491258A CA2491258A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002490909A CA2490909A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05025102A EP1672070A3 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002491610A CA2491610A1 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP00983846A EP1250426A2 (en) 1999-12-01 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding same
CA002534030A CA2534030A1 (en) 2000-03-01 2001-02-28 Screted and transmembrane polypeptides and nucleic acids encoding the same
AU2001268028A AU2001268028A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002534186A CA2534186A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002534018A CA2534018A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002533991A CA2533991A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002533831A CA2533831A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002534391A CA2534391A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002401448A CA2401448A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002533903A CA2533903A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2001567332A JP2004508805A (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding them
PCT/US2001/006520 WO2001068848A2 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP01945919A EP1259614A2 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002531917A CA2531917A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002539214A CA2539214A1 (en) 2000-03-01 2001-02-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/866,028 US6642360B2 (en) 1997-12-03 2001-05-25 Secreted polypeptides that stimulate release of proteoglycans from cartilage
AU6531101A AU6531101A (en) 2000-06-02 2001-05-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US2001/017800 WO2001093983A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024038A EP1702928A3 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002410162A CA2410162A1 (en) 2000-06-02 2001-06-01 Breast, rectal, colon and lung tumor marker pro 4332 polypeptide and encoding nucleic acid
EP05024025A EP1666597A3 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024027A EP1666596A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002591841A CA2591841A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024031A EP1666492A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002594659A CA2594659A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024035A EP1666594A3 (en) 2000-06-02 2001-06-01 Polypeptide, nucleic acid encoding it, and their use for the diagnosis of cancer
CA002591590A CA2591590A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024037A EP1700867A3 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP01939834A EP1286749A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024030A EP1666491A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002591930A CA2591930A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024034A EP1666497A3 (en) 2000-06-02 2001-06-01 Polypeptide, nucleic acid encoding it, and their use for the diagnosis of cancer
EP04005726A EP1489095A1 (en) 2000-06-02 2001-06-01 Polypeptide, nucleic acid encoding it, and their use for the diagnosis of cancer
AU2001265311A AU2001265311A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024023A EP1683864A3 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002591929A CA2591929A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024032A EP1659177A3 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids ancoding the same
CA002591630A CA2591630A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP05024028A EP1686174A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002591583A CA2591583A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2002501551A JP2004510409A (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding them
EP05024033A EP1666493A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids ancoding the same
CA002591656A CA2591656A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002591814A CA2591814A1 (en) 2000-06-02 2001-06-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002585822A CA2585822A1 (en) 2000-06-02 2001-06-01 Breast, rectal, colon and lung tumour marker pro19628 polypeptide and encoding nucleic acid
EP08019420.2A EP2042597B1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
EP14166919.2A EP2792747A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
EP10182597A EP2275549A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
EP09004417A EP2077276A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogensis
EP09004418A EP2075253A1 (en) 2000-06-23 2001-06-20 Compositions and methds for the diagnosis and treatment of disorders involving angiogensis
CA002648048A CA2648048A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
EP09004415A EP2168980A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogensis
JP2002505812A JP2004506413A (en) 2000-06-23 2001-06-20 Compositions and methods for diagnosis and treatment of diseases involving angiogenesis
DK08019420.2T DK2042597T3 (en) 2000-06-23 2001-06-20 COMPOSITIONS AND PROCEDURES FOR DIAGNOSIS AND TREATMENT OF DISEASES INVOLVING ANGIOGENESIS
CA2709771A CA2709771A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
AU2001278852A AU2001278852A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
CA002648046A CA2648046A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
CA002412211A CA2412211A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
PCT/US2001/019692 WO2002000690A2 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
EP01957073A EP1309620A2 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
CA002648051A CA2648051A1 (en) 2000-06-23 2001-06-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
AU2001273150A AU2001273150A1 (en) 2000-07-20 2001-06-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
EP01952391A EP1354040A2 (en) 2000-07-20 2001-06-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
CA002416456A CA2416456A1 (en) 2000-07-20 2001-06-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2002514192A JP2004514420A (en) 2000-07-20 2001-06-29 Secreted and transmembrane polypeptides and nucleic acids encoding them
PCT/US2001/021066 WO2002008288A2 (en) 2000-07-20 2001-06-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
AU7315001A AU7315001A (en) 2000-07-20 2001-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
AU2001271973A AU2001271973A1 (en) 2000-07-20 2001-07-09 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
JP2002514188A JP2004516013A (en) 2000-07-20 2001-07-09 Compositions and methods for diagnosing and treating disorders associated with angiogenesis
EP01951036A EP1309685A2 (en) 2000-07-20 2001-07-09 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
CA002416538A CA2416538A1 (en) 2000-07-20 2001-07-09 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
PCT/US2001/021735 WO2002008284A2 (en) 2000-07-20 2001-07-09 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
US09/902,759 US20030077654A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/902,713 US20030082541A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/902,736 US20030049676A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/902,572 US20030108983A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/902,634 US20030082540A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/902,853 US20020192659A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/902,979 US20030113718A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/902,692 US20030054400A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/902,615 US20030092002A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/902,903 US20030044839A1 (en) 1997-09-17 2001-07-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/903,786 US20030044793A1 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/903,520 US20030054401A1 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,011 US20030003530A1 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/903,925 US20030096233A1 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/903,943 US20030054349A1 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/903,562 US6965015B2 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/903,640 US7208308B2 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/903,749 US7147853B2 (en) 1997-09-17 2001-07-11 Anti-pro211 polypeptide antibodies
US09/903,806 US20030130489A1 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/903,603 US20030148419A1 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,119 US20030049621A1 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids enconding the same
US09/903,823 US20030104381A1 (en) 1997-09-17 2001-07-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,938 US20030211569A1 (en) 1997-09-17 2001-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,786 US7557192B2 (en) 1997-09-17 2001-07-12 Anti-PRO335 antibodies
US09/905,088 US20030073077A1 (en) 1997-09-17 2001-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,877 US20030186358A1 (en) 1997-09-17 2001-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/905,125 US6664376B2 (en) 1997-09-17 2001-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,859 US20030036060A1 (en) 1997-09-17 2001-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,766 US20030152999A1 (en) 1997-09-17 2001-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,992 US20030135025A1 (en) 1997-09-17 2001-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/905,056 US20030054441A1 (en) 1997-09-17 2001-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/905,291 US20020160374A1 (en) 1997-09-17 2001-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,820 US20030036094A1 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,838 US20030148370A1 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/905,075 US7169906B2 (en) 1997-09-17 2001-07-13 PRO211 polypeptides
US09/904,462 US6878807B2 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/905,381 US6818746B2 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,532 US7151160B2 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,485 US20030064367A1 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/905,449 US6965011B2 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,920 US6806352B2 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/905,348 US20030064923A1 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,553 US20030059828A1 (en) 1997-09-17 2001-07-13 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/904,956 US20030049622A1 (en) 1995-12-01 2001-07-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/906,742 US20030023054A1 (en) 1997-09-17 2001-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/906,777 US20030148371A1 (en) 1997-09-17 2001-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/906,815 US7094567B2 (en) 1997-09-17 2001-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/906,838 US7070979B2 (en) 1997-09-17 2001-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/906,618 US6828146B2 (en) 1997-09-17 2001-07-16 Nucleic acid encoding PRO229 polypeptides
US09/906,760 US20030096340A1 (en) 1997-09-17 2001-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/906,700 US6723535B2 (en) 1997-09-17 2001-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/906,722 US6946262B2 (en) 1997-09-17 2001-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/906,646 US6852848B2 (en) 1997-09-17 2001-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,575 US20030073079A1 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,925 US20030054352A1 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,728 US20030190611A1 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,942 US7087738B2 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,841 US7033825B2 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,794 US6635468B2 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,824 US20020197671A1 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,979 US20030082542A1 (en) 1994-09-08 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/908,093 US20030017498A1 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,613 US20030027145A1 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/907,652 US20030104469A1 (en) 1997-09-17 2001-07-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/908,576 US20040005553A1 (en) 1997-09-17 2001-07-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/909,204 US20030036061A1 (en) 1997-09-17 2001-07-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/909,088 US20020146709A1 (en) 1997-09-17 2001-07-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/909,064 US6818449B2 (en) 1997-09-17 2001-07-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/909,320 US7074592B2 (en) 1997-09-17 2001-07-18 Secreted and transmembrane polypeptides nucleic acid encoding
US09/918,585 US20030060406A1 (en) 1997-10-17 2001-07-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/941,992 US20030082546A1 (en) 1996-11-06 2001-08-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,396 US20020132981A1 (en) 1997-12-03 2001-08-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/943,762 US20020142958A1 (en) 1998-09-16 2001-08-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,413 US20020156004A1 (en) 1998-09-16 2001-08-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,432 US20020142419A1 (en) 1998-09-16 2001-08-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/943,851 US20020150976A1 (en) 1997-12-03 2001-08-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,403 US20020165143A1 (en) 1997-12-03 2001-08-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/943,780 US20030096742A1 (en) 1997-12-03 2001-08-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,449 US20020102647A1 (en) 1997-12-03 2001-08-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/943,664 US20040091972A1 (en) 1997-12-03 2001-08-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,457 US6734288B2 (en) 1997-12-03 2001-08-30 Antibodies against a secreted polypeptide that stimulates release of proteoglycans from cartilage
US09/944,929 US7550573B2 (en) 1997-12-03 2001-08-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/945,584 US6908993B2 (en) 1997-12-03 2001-08-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/945,015 US20020132768A1 (en) 1997-12-03 2001-08-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,944 US6929947B2 (en) 1997-12-03 2001-08-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,862 US20020115145A1 (en) 1997-12-03 2001-08-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,907 US20020198147A1 (en) 1997-12-03 2001-08-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,884 US7018837B2 (en) 1997-12-03 2001-08-31 Nucleic acids encoding secreted polypeptides that stimulate release of proteoglycans from cartilage
US09/944,852 US20030083479A1 (en) 1997-12-03 2001-08-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/944,896 US7189566B2 (en) 1997-12-03 2001-08-31 PRO347 nucleic acids
US09/944,654 US20020142959A1 (en) 1998-09-16 2001-08-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/945,587 US6936254B2 (en) 1997-12-03 2001-08-31 Method of inducing fetal hemoglobin synthesis
US09/978,298 US20030134785A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,189 US6972325B2 (en) 1997-10-17 2001-10-15 PRO273 polypeptides
US09/978,193 US20030073624A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,191 US20030050239A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,188 US20030139328A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,295 US20020156006A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,299 US20030199435A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,194 US20030195333A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,192 US20020177553A1 (en) 1997-10-17 2001-10-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,665 US7294700B2 (en) 1997-10-17 2001-10-16 Anti-PRO846 antibodies
US09/978,423 US20030069178A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/981,915 US20030054986A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,757 US20030083248A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,375 US7196165B2 (en) 1997-10-17 2001-10-16 PRO363 polypeptides
US09/978,585 US20030049633A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,564 US7195760B2 (en) 1997-10-17 2001-10-16 Anti-pro363 antibodies
US09/978,802 US20030199674A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/981,915 US7285623B2 (en) 1997-10-17 2001-10-16 PRO337 polypeptides
US09/978,824 US20050124789A9 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,697 US20020169284A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,403 US20030050240A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,643 US20030104998A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,544 US20030199436A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,681 US20030195148A1 (en) 1997-10-17 2001-10-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,824 US20030055216A1 (en) 1997-10-17 2001-10-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/152,388 US20040223964A1 (en) 1998-03-17 2001-10-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/210,028 US20030203446A1 (en) 1998-10-07 2001-10-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/166,709 US20030104536A1 (en) 1998-10-07 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/164,829 US20030194780A1 (en) 1998-04-29 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/145,017 US20030186365A1 (en) 1998-03-26 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/164,929 US20030194781A1 (en) 1998-03-30 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/165,036 US20050227342A1 (en) 1998-10-07 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/145,089 US7208575B2 (en) 1998-10-07 2001-10-19 PRO531 polypeptides
US10/162,521 US7067628B2 (en) 1998-03-17 2001-10-19 PRO788 polypeptides
US10/143,029 US7105640B2 (en) 1997-10-17 2001-10-19 Anti-pro792 antibodies
US10/165,067 US7279553B2 (en) 1998-05-13 2001-10-19 PRO1083 polypeptides
US10/160,502 US7220835B2 (en) 1998-07-30 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/145,124 US20030190701A1 (en) 1998-04-30 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/165,247 US7112657B2 (en) 1998-10-07 2001-10-19 PRO697 polypeptides
US10/164,749 US20040029218A1 (en) 1998-10-07 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/164,728 US20030186368A1 (en) 1998-05-13 2001-10-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,922 US20030195345A1 (en) 1997-10-17 2001-10-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/999,832 US20020192706A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,081 US20030049684A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,084 US20030203402A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,085 US6974696B2 (en) 1997-10-17 2001-10-24 PRO853 nucleic acids
US10/017,083 US20030148376A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/999,832 US7132283B2 (en) 1997-10-17 2001-10-24 PRO273 polypeptides
US09/999,830 US20030077700A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/020,445 US20030198994A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/017,086 US7122375B2 (en) 1997-10-17 2001-10-24 PRO274 nucleic acids
US09/999,834 US20030064407A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/002,967 US20030148373A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/999,833 US6916648B2 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/999,829 US20030195344A1 (en) 1997-10-17 2001-10-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,928 US20030215905A1 (en) 1998-10-07 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,927 US7189529B2 (en) 1997-10-17 2001-10-25 PRO792 nucleic acids
US10/013,923 US7169912B2 (en) 1997-10-17 2001-10-25 PRO1017 nucleic acids
US10/013,920 US20040006219A1 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,917 US7029874B2 (en) 1998-03-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,925 US7037710B2 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,921 US20030068648A1 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,926 US7074593B2 (en) 1998-04-01 2001-10-25 PRO 703 nucleic acids
US10/016,177 US20030073131A1 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/013,929 US7019124B2 (en) 1997-10-17 2001-10-25 PRO788 nucleic acids
US10/013,918 US20030211091A1 (en) 1997-10-17 2001-10-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,427 US20030073809A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,442 US20020132252A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/993,667 US20030022187A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/993,469 US20030068623A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/991,073 US20020127576A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/991,854 US20030059780A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,711 US20030032023A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,443 US20030054987A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,444 US6930170B2 (en) 1997-06-16 2001-11-14 PRO1184 polypeptides
US09/990,456 US20020137890A1 (en) 1997-03-31 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,726 US20030054359A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,438 US20030027754A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,436 US20020198148A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/993,583 US7074897B2 (en) 1997-06-16 2001-11-14 Pro943 polypeptides
US09/990,440 US20030060407A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,562 US20030027985A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/993,687 US20020198149A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/992,521 US20030083461A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/993,748 US20030069403A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/992,598 US6956108B2 (en) 1997-06-16 2001-11-14 PRO1184 antibodies
US09/991,163 US20020132253A1 (en) 1997-06-16 2001-11-14 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,857 US20030064375A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,349 US7034106B2 (en) 1997-06-16 2001-11-15 Pro1159 polypeptides
US09/997,601 US7189814B2 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,585 US20030119055A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/998,041 US7309775B2 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,542 US20030068647A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,614 US20030124531A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,641 US7112656B2 (en) 1997-06-16 2001-11-15 PRO1312 polypeptides
US09/997,440 US20030059833A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,601 US20030054404A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,666 US7244816B2 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,514 US7019116B2 (en) 1997-06-16 2001-11-15 PRO 1387 polypeptides
US09/997,641 US20030224358A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/998,041 US20030119001A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,683 US20030059783A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,428 US20030027162A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,666 US20030027163A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,559 US20030054403A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,628 US20030059782A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,529 US7309761B2 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,585 US7166282B2 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,384 US7119177B2 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,333 US6953836B2 (en) 1997-06-16 2001-11-15 PRO844 polypeptides
US09/998,156 US20030044806A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,573 US20030049682A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,653 US7034122B2 (en) 1997-06-16 2001-11-15 Antibodies to PRO1159 polypeptides
US09/997,384 US20030087305A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/997,529 US20030134284A1 (en) 1997-06-16 2001-11-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/991,172 US20030050457A1 (en) 1997-06-16 2001-11-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/991,150 US20030194760A1 (en) 1997-06-16 2001-11-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/991,157 US7101687B2 (en) 1997-06-16 2001-11-16 Nucleic acids encoding PRO943
US09/991,181 US6913919B2 (en) 1997-06-16 2001-11-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/990,441 US7041804B2 (en) 1997-06-16 2001-11-16 Antibodies to PRO1387 polypeptides
US09/990,437 US20030045463A1 (en) 1997-06-16 2001-11-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,729 US20030059831A1 (en) 1997-06-16 2001-11-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,722 US20020072067A1 (en) 1997-06-16 2001-11-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,862 US20030130182A1 (en) 1997-11-05 2001-11-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,279 US7083978B2 (en) 1997-06-16 2001-11-19 Nucleic acid encoding PRO1111 polypeptides
US09/989,723 US20020072092A1 (en) 1997-06-16 2001-11-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,734 US7491529B2 (en) 1997-06-16 2001-11-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,732 US7037679B2 (en) 1997-06-16 2001-11-19 Nucleic acids encoding PRO1184 polypeptides
US09/989,721 US20020142961A1 (en) 1997-06-16 2001-11-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,726 US7018811B2 (en) 1997-06-16 2001-11-19 Nucleic acids encoding PRO189 polypeptides
US09/989,735 US6972185B2 (en) 1997-06-16 2001-11-19 Nucleic acids encoding PRO844 polypeptides
US09/989,727 US20020072497A1 (en) 1997-06-16 2001-11-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,328 US7056736B2 (en) 1997-06-16 2001-11-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,730 US7157247B2 (en) 1997-06-16 2001-11-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,728 US7029873B2 (en) 1997-06-16 2001-11-20 Nucleic acids to PRO1387 polypeptides
US09/989,725 US20030139329A1 (en) 1997-06-16 2001-11-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,293 US7034136B2 (en) 1997-06-16 2001-11-20 Nucleic acids encoding PRO1159 polypeptides
US09/989,731 US20020103125A1 (en) 1997-06-16 2001-11-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/989,724 US7060812B2 (en) 1997-06-16 2001-11-20 PRO1312 nucleic acids
US10/052,586 US20020127584A1 (en) 1997-09-18 2002-01-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/978,187 US20030096744A1 (en) 1997-10-17 2002-01-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/081,056 US20040043927A1 (en) 1997-09-19 2002-02-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
US10/119,480 US20040087769A1 (en) 1998-09-10 2002-04-09 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,040 US20030082759A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,042 US20030096386A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,059 US20030190721A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,041 US20030077776A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,051 US20030092147A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,047 US20030077778A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,044 US20030190717A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,045 US20030073210A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,046 US20030194791A1 (en) 1997-03-31 2002-04-11 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,054 US20030199054A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,060 US20030190722A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,050 US20030054516A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,053 US20030199053A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,048 US20030199051A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,057 US20030190719A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,043 US7220831B2 (en) 1997-03-31 2002-04-12 PRO235 polypeptides
US10/121,055 US20030190718A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,056 US20030082760A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,062 US20030077779A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,052 US20030199052A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,058 US20030190720A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,049 US20030022239A1 (en) 1997-06-18 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,061 US20030082761A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/121,063 US20030199055A1 (en) 1997-03-31 2002-04-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,157 US20030190725A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,215 US7291329B2 (en) 1997-03-31 2002-04-15 Antibodies against PRO4406
US10/123,108 US7635478B2 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,771 US20030199060A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,155 US20030068794A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,214 US7343721B2 (en) 1997-03-31 2002-04-15 PRO4406 polypeptide
US10/123,292 US20030073211A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,291 US20030199058A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,261 US20030068796A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,213 US7193048B2 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,109 US20030190723A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,236 US20030068795A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,235 US20030082762A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,322 US20030199059A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,156 US20030194792A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,262 US20030049816A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,212 US7276577B2 (en) 1997-03-31 2002-04-15 PRO1866 polypeptides
US10/123,213 US20030199057A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,154 US20030190724A1 (en) 1997-03-31 2002-04-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,912 US20030100087A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,909 US7193049B2 (en) 1997-03-31 2002-04-16 PRO862 polypeptides
US10/123,903 US20030073212A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,907 US7084258B2 (en) 1997-03-31 2002-04-16 Antibodies against the PRO862 polypeptides
US10/123,908 US7335728B2 (en) 1997-03-31 2002-04-16 PRO1310 polypeptides
US10/123,905 US7285625B2 (en) 1997-06-18 2002-04-16 PRO536 polypeptides
US10/123,905 US20030087344A1 (en) 1997-06-18 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,911 US7408032B2 (en) 1997-03-31 2002-04-16 PRO1188 polypeptides
US10/123,902 US20030077781A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,906 US20030190726A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,913 US20030203462A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/123,910 US7329404B2 (en) 1997-03-31 2002-04-16 Antibodies against PRO1310
US10/123,904 US20030022328A1 (en) 1997-03-31 2002-04-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,813 US7312307B2 (en) 1997-03-31 2002-04-17 PRO1056 polypeptides
US10/125,795 US7304131B2 (en) 1997-03-31 2002-04-17 PRO1483 polypeptides
US10/124,819 US7285626B2 (en) 1997-03-31 2002-04-17 PRO1076 polypeptides
US10/124,816 US20030190728A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,817 US20030077786A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/125,704 US7357926B2 (en) 1997-03-31 2002-04-17 Antibodies against PRO1879 and the use thereof
US10/124,823 US20030199062A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/125,805 US20030194794A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,822 US7109305B2 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,820 US20030190729A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,818 US20030082763A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,821 US20030199023A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,824 US20030077659A1 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/124,814 US7105335B2 (en) 1997-03-31 2002-04-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/125,932 US7317079B2 (en) 1997-03-31 2002-04-19 PRO812 polypeptides
US10/125,922 US7309762B2 (en) 1997-03-31 2002-04-19 PRO1360 polypeptides
US10/125,924 US7342097B2 (en) 1997-03-31 2002-04-19 PRO1309 polypeptides
US10/125,931 US20030199063A1 (en) 1997-03-31 2002-04-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/125,927 US20030190731A1 (en) 1997-03-31 2002-04-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/127,831 US20030082689A1 (en) 1997-03-31 2002-04-22 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/128,689 US20030087365A1 (en) 1997-03-31 2002-04-23 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/131,825 US7282566B2 (en) 1997-03-31 2002-04-24 PRO1779 polypeptide
US10/131,817 US7291701B2 (en) 1997-03-31 2002-04-24 PRO1777 polypeptides
US10/131,823 US7304132B2 (en) 1997-03-31 2002-04-24 PRO1693 polypeptides
US10/137,867 US20030207349A1 (en) 1997-03-31 2002-05-03 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/137,865 US20030032155A1 (en) 1997-03-31 2002-05-03 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/137,868 US20030082764A1 (en) 1997-03-31 2002-05-03 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/139,963 US7288625B2 (en) 1997-03-31 2002-05-06 PRO4395 polypeptides
US10/140,024 US20040058424A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/139,980 US7247710B2 (en) 1997-03-31 2002-05-06 PRO4395 antibodies
US10/140,470 US20030022331A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,020 US20030207415A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,023 US20030207416A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,474 US20030032156A1 (en) 1997-03-31 2002-05-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,860 US7307151B2 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,928 US20030068798A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,865 US20030207420A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,805 US20030207417A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,808 US7425621B2 (en) 1997-03-31 2002-05-07 Antibodies against the PRO4401 polypeptide
US10/140,864 US20030207419A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,925 US20030073215A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/140,921 US7317080B2 (en) 1997-03-31 2002-05-07 PRO4303 polypeptides
US10/140,809 US20030207418A1 (en) 1997-03-31 2002-05-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/141,701 US20030207421A1 (en) 1997-03-31 2002-05-08 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/141,760 US7342104B2 (en) 1997-03-31 2002-05-08 Antibodies against the PRO4320 polypeptide
US10/141,756 US7488586B2 (en) 1997-03-31 2002-05-08 PRO4409 polypeptides
US10/141,754 US7361732B2 (en) 1997-03-31 2002-05-08 PRO4400 polypeptides
US10/141,755 US7297764B2 (en) 1997-03-31 2002-05-08 PRO4318 polypeptides
US10/143,114 US20030036180A1 (en) 1997-03-31 2002-05-09 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/142,417 US7304133B2 (en) 1997-03-31 2002-05-09 PRO4389 polypeptides
US10/142,430 US7309766B2 (en) 1997-03-31 2002-05-09 PRO5774 polypeptides
US10/143,113 US7329730B2 (en) 1997-03-31 2002-05-09 PRO4348 polypeptides
US10/142,425 US20030207424A1 (en) 1997-03-31 2002-05-09 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/142,419 US7153941B2 (en) 1997-03-31 2002-05-10 Antibodies that bind PRO4994 polypeptides
US10/142,423 US20030049817A1 (en) 1997-03-31 2002-05-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/142,431 US7285629B2 (en) 1997-03-31 2002-05-10 Pro5005 polypeptides
US10/143,032 US7408033B2 (en) 1997-03-31 2002-05-10 PRO5995 polypeptides
US10/146,730 US20030207427A1 (en) 1997-03-31 2002-05-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/146,792 US20030207428A1 (en) 1997-03-31 2002-05-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/147,528 US20030219885A1 (en) 1997-03-31 2002-05-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/147,519 US20030077791A1 (en) 1997-03-31 2002-05-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/147,492 US20030082765A1 (en) 1997-03-31 2002-05-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/147,536 US20040077064A1 (en) 1997-03-31 2002-05-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/152,395 US7189534B2 (en) 1997-03-31 2002-05-21 PRO4320 polynucleotide
US10/153,934 US20030129695A1 (en) 1997-03-31 2002-05-22 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/156,843 US20030207805A1 (en) 1997-06-18 2002-05-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/157,782 US20030077792A1 (en) 1997-03-31 2002-05-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/157,786 US20030208055A1 (en) 1997-03-31 2002-05-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/158,782 US20030082766A1 (en) 1997-03-31 2002-05-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/158,791 US20030207429A1 (en) 1997-03-31 2002-05-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/160,498 US20030073216A1 (en) 1997-03-31 2002-05-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,693 US20030073169A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,704 US20030170795A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,695 US20030032101A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,705 US20030032103A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,701 US20030104538A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,699 US20030166109A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,707 US20030166110A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,706 US20030022293A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,708 US20030040053A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,700 US20030027262A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,697 US20030032102A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,689 US20030166104A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,694 US20030166107A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,692 US20030166188A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,698 US20030166108A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,702 US20030170793A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,690 US20030166105A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,691 US20030166106A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,703 US20030170794A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/173,696 US20030082767A1 (en) 1997-09-18 2002-06-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,581 US7153939B2 (en) 1997-09-18 2002-06-18 PRO354 antibodies
US10/174,582 US20030027265A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,590 US20030008352A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,572 US20030027263A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,569 US20030166111A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,587 US20030166113A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,740 US20030027268A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,570 US20030211572A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,586 US20030032106A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,578 US20030073170A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,588 US20030027266A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,583 US7211645B2 (en) 1997-09-18 2002-06-18 PRO268 polypeptides
US10/174,585 US20030032105A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,589 US20030166114A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,576 US7125962B2 (en) 1997-09-18 2002-06-18 Anti-Pro268 antibodies
US10/174,591 US20030166115A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,579 US20030027264A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/174,574 US20030170796A1 (en) 1997-09-18 2002-06-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,736 US20030166117A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,735 US20030082715A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,742 US20030166118A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,737 US20030013153A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,746 US20030027270A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,744 US20030166119A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,745 US20030166120A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,752 US20030022295A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,738 US20030022294A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,750 US20030073172A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,754 US20030166123A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,753 US20030077732A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,749 US20050196832A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,739 US20030027267A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,741 US20030073171A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,751 US20030166122A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,747 US20030032107A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,743 US20030027269A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/175,748 US20030166121A1 (en) 1997-09-18 2002-06-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,989 US20030170803A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,747 US20030027273A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,754 US7709602B2 (en) 1997-09-18 2002-06-20 PRO1078 polypeptides
US10/176,483 US20030017541A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,913 US20030022298A1 (en) 1997-09-15 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,990 US20030036119A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,920 US20030166129A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,757 US7317082B2 (en) 1997-09-18 2002-06-20 PRO1018 polypeptides
US10/176,759 US20030166128A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,491 US20030087373A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,746 US20030068680A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,919 US20030032114A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,911 US20030032113A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,918 US7495083B2 (en) 1997-09-18 2002-06-20 PRO940 antibodies
US10/176,921 US20030027276A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,993 US20030027280A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,988 US20030170802A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,914 US20030017543A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,484 US20030059876A9 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,753 US20030044917A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,487 US20030032110A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,749 US20030017542A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,981 US20030170800A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,485 US20030032109A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,482 US20030022296A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,479 US20030040054A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,490 US20030170798A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,917 US20030044918A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,493 US20030032111A1 (en) 1997-09-18 2002-06-20 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,923 US20030068681A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,481 US20030032108A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,488 US20030027271A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,987 US20030027278A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,915 US20030017544A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,925 US20030032115A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,979 US20030087374A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,489 US20030166125A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,760 US7339033B2 (en) 1998-06-26 2002-06-21 Pro1481
US10/176,751 US20030036117A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,985 US20030027277A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,983 US20030170801A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,480 US20030166124A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,755 US20030166127A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,986 US20030073173A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,486 US7354999B2 (en) 1997-09-18 2002-06-21 PRO1481 polypeptides
US10/176,752 US20030170799A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,982 US20030044919A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,924 US20030166131A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,750 US20030027274A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,991 US20030027324A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,748 US20030040055A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,922 US20030166130A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,492 US20030027272A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,758 US20030008353A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,756 US20030032112A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,916 US20030040056A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/176,978 US20030032116A1 (en) 1997-09-18 2002-06-21 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,520 US20030096353A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,507 US20030040057A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,506 US20030044920A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,525 US20030040060A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,523 US20030215909A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,510 US20030032117A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,516 US20030040058A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,509 US20030207392A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,514 US20030044922A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,526 US20030100061A1 (en) 1998-06-26 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,521 US20030170806A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,515 US20030166135A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,519 US7339024B2 (en) 1997-09-18 2002-06-24 PRO1772 polypeptides
US10/179,511 US20030104539A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,517 US20030170805A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,513 US20030044921A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,512 US20030166134A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,518 US20030104540A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,522 US20030044923A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/179,508 US20030166133A1 (en) 1997-09-18 2002-06-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,545 US20030040062A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,555 US20030032123A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,547 US20030032121A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,554 US20050202526A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,548 US7696319B2 (en) 1997-09-18 2002-06-25 PRO1772 antibodies
US10/180,552 US7348415B2 (en) 1997-09-18 2002-06-25 PRO1316 antibodies
US10/180,551 US20030036123A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,540 US20030040061A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,559 US20030032124A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,546 US20030032120A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,544 US20030032119A1 (en) 1998-06-26 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,557 US20030022301A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,543 US20030032118A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,541 US20030036120A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,560 US20030044925A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,556 US7355000B2 (en) 1997-09-18 2002-06-25 PRO1380 polypeptides
US10/180,549 US20030032122A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,542 US20030036121A1 (en) 1998-06-26 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,553 US7365156B2 (en) 1997-09-18 2002-06-25 PRO1316 polypeptides
US10/180,550 US20030064440A1 (en) 1997-09-18 2002-06-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,999 US7297767B2 (en) 1997-09-18 2002-06-26 PRO1374 polypeptides
US10/183,011 US20030068682A1 (en) 1998-06-26 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/183,014 US20030064441A1 (en) 1997-09-18 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/183,009 US7339034B2 (en) 1997-09-18 2002-06-26 PRO1305 antibodies
US10/183,018 US20030104541A1 (en) 1997-09-18 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/180,998 US7087421B2 (en) 1997-09-18 2002-06-26 Pro1278 polypeptides
US10/183,015 US20030044926A1 (en) 1997-09-18 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/183,002 US20030054454A1 (en) 1997-09-18 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/183,012 US7718770B2 (en) 1997-09-18 2002-06-26 PRO1305-polypeptides
US10/183,008 US20030040064A1 (en) 1997-09-18 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/183,013 US7309769B2 (en) 1997-09-18 2002-06-26 PRO1487 polypeptides
US10/183,003 US20030082716A1 (en) 1997-09-18 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/183,010 US20030032126A1 (en) 1997-09-18 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/183,017 US20030040065A1 (en) 1997-09-18 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/183,001 US7084255B2 (en) 1997-09-18 2002-06-26 PRO1278 polypeptides
US10/183,016 US20030082717A1 (en) 1997-09-18 2002-06-26 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/183,005 US7317093B2 (en) 1997-09-18 2002-06-26 PRO1339 antibodies
US10/181,000 US7319137B2 (en) 1997-09-18 2002-06-26 PRO1339 polypeptides
US10/183,006 US7297776B2 (en) 1997-09-18 2002-06-26 PRO1374 antibodies
US10/183,019 US7425605B2 (en) 1997-09-18 2002-06-26 PRO1486 polypeptides
US10/184,633 US20030068683A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,631 US20030036134A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,654 US7378486B2 (en) 1997-09-18 2002-06-27 PRO1482 antibodies
US10/184,627 US7282569B2 (en) 1997-09-18 2002-06-27 PRO1508 antibodies
US10/184,638 US20030054456A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,630 US20030036133A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,613 US20030119105A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,615 US20030044927A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,651 US7291704B2 (en) 1997-09-18 2002-06-27 PRO1758 polypeptides
US10/184,642 US7332573B2 (en) 1997-09-18 2002-06-27 PRO1571 polypeptides
US10/184,616 US20030036128A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,614 US20030032128A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,627 US20030040070A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,630 US7304143B2 (en) 1997-09-18 2002-06-27 PRO1571 antibodies
US10/184,628 US7309770B2 (en) 1997-09-18 2002-06-27 PRO1757 polypeptides
US10/184,640 US7271250B2 (en) 1998-06-26 2002-06-27 PRO1757 antibodies
US10/184,618 US7393917B2 (en) 1997-09-18 2002-06-27 PRO1482 polypeptides
US10/184,652 US20030032134A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,612 US20030036127A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,641 US20030073174A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,619 US20030049738A1 (en) 1997-09-18 2002-06-27 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,620 US20030044928A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,658 US20030027281A1 (en) 1998-06-26 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,655 US20030040073A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,626 US20030040069A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,635 US20030032130A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,637 US20030032131A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,650 US20030036138A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,636 US20030036136A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,646 US20030032132A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,629 US20030036132A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,617 US20030036129A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,647 US20030032133A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,621 US20030054455A1 (en) 1998-06-26 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,623 US20030032129A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,625 US20030040068A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,634 US20030068684A1 (en) 1998-06-26 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,645 US7291718B2 (en) 1998-06-26 2002-06-28 PRO1758 antibodies
US10/184,632 US20030036135A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,656 US20030044931A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,624 US20030104542A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,644 US20030044930A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,643 US20030044929A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,657 US20030104543A1 (en) 1997-09-18 2002-06-28 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/184,622 US20030036130A1 (en) 1997-09-18 2002-06-29 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,594 US7294335B2 (en) 1998-06-26 2002-07-01 PRO19645 antibodies
US10/187,886 US7291708B2 (en) 1997-09-18 2002-07-01 PRO1785 polypeptides
US10/187,598 US20030036142A1 (en) 1997-09-18 2002-07-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,884 US20030036155A1 (en) 1997-09-18 2002-07-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,747 US7291707B2 (en) 1997-09-18 2002-07-01 PRO1337 polypeptides
US10/187,601 US7291705B2 (en) 1997-09-18 2002-07-01 PRO19645 polypeptides
US10/187,739 US7291706B2 (en) 1998-06-26 2002-07-01 PRO4352 polypeptides
US10/187,887 US7285645B2 (en) 1997-09-18 2002-07-01 PRO4356 antibodies
US10/187,588 US7351795B2 (en) 1998-06-26 2002-07-01 PRO19563 polypeptides
US10/187,597 US20030036141A1 (en) 1997-09-18 2002-07-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,745 US7250490B2 (en) 1997-09-18 2002-07-02 PRO1480 polypeptides
US10/187,596 US20030032136A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,751 US20030036151A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,885 US20030032138A1 (en) 1998-06-24 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,747 US20030036150A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/188,769 US20030036157A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/188,780 US7268217B2 (en) 1998-06-26 2002-07-02 PRO4421 polypeptides
US10/187,753 US20030036152A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,757 US7276578B2 (en) 1997-09-18 2002-07-02 PRO4334 polypeptides
US10/187,603 US20030036146A1 (en) 1998-06-26 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/188,767 US7312310B2 (en) 1997-09-18 2002-07-02 PRO6015 polypeptides
US10/187,602 US20030036145A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/188,770 US7358340B2 (en) 1997-09-18 2002-07-02 PRO19563 antibodies
US10/188,766 US7351804B2 (en) 1998-06-26 2002-07-02 Antibodies against PRO4421
US10/187,746 US20030036149A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,600 US20030036143A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,743 US20030036148A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/188,773 US20030036159A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,754 US20030036153A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/188,781 US20030036160A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/188,774 US20030040074A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/187,741 US20030036147A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/188,775 US20030040075A1 (en) 1997-09-18 2002-07-02 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/192,010 US20030044932A1 (en) 1997-09-18 2002-07-09 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/194,462 US7388073B2 (en) 1998-06-26 2002-07-12 PRO9835 polypeptides
US10/194,365 US7381791B2 (en) 1998-06-26 2002-07-12 PRO9739 polypeptides
US10/194,461 US20030054459A1 (en) 1998-06-26 2002-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/194,423 US7339025B2 (en) 1998-06-26 2002-07-12 PRO6246 polypeptides
US10/194,361 US20030036161A1 (en) 1998-06-26 2002-07-12 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/195,893 US20030206188A1 (en) 1998-06-26 2002-07-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/195,883 US20060073544A1 (en) 1998-06-26 2002-07-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/195,892 US7385033B2 (en) 1998-06-26 2002-07-15 PRO12970 polypeptides
US10/195,888 US20060073545A1 (en) 1998-06-26 2002-07-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/195,894 US20030043176A1 (en) 1998-06-26 2002-07-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/195,889 US7534856B2 (en) 1998-06-26 2002-07-15 PRO19624 antibodies
US10/195,897 US20030036164A1 (en) 1997-09-18 2002-07-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/195,901 US20030036165A1 (en) 1998-06-26 2002-07-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/195,902 US20030038826A1 (en) 1998-06-26 2002-07-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/196,743 US20030038827A1 (en) 1998-06-26 2002-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/196,762 US20030040078A1 (en) 1998-06-26 2002-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/196,759 US20030071835A1 (en) 1998-06-26 2002-07-16 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/196,756 US7304145B2 (en) 1998-06-26 2002-07-16 PRO19646 antibodies
US10/196,760 US7408034B2 (en) 1998-06-26 2002-07-16 PRO20025 polypeptides
US10/196,745 US7423120B2 (en) 1997-09-18 2002-07-16 PRO19814 polypeptides
US10/197,942 US20030175882A1 (en) 1998-09-10 2002-07-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/199,464 US20030032140A1 (en) 1997-09-18 2002-07-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/198,768 US20030049756A1 (en) 1998-06-26 2002-07-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/199,316 US20030068726A1 (en) 1998-06-26 2002-07-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/199,462 US20030054468A1 (en) 1998-06-26 2002-07-19 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/205,904 US20030073813A1 (en) 1998-06-26 2002-07-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/429,667 US20030207401A1 (en) 1997-12-03 2003-05-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/735,014 US7442772B2 (en) 1997-12-03 2003-12-12 Antibodies to PRO361 polypeptide
US10/797,366 US7378507B2 (en) 1997-09-18 2004-03-09 PRO217 polypeptides
US10/805,667 US20050037458A1 (en) 1999-03-10 2004-07-23 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/943,353 US20050059115A1 (en) 1997-12-03 2004-09-17 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US11/100,159 US7425613B2 (en) 1997-11-05 2005-04-05 PRO1375 polypeptides
US11/189,442 US20060246465A1 (en) 1998-06-04 2005-07-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2005264293A JP2006068016A (en) 1999-12-01 2005-08-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2005264294A JP2006081548A (en) 2000-03-01 2005-08-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US11/296,155 US20060127983A1 (en) 1997-12-03 2005-12-06 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US11/323,117 US20070092941A1 (en) 1998-09-16 2005-12-29 PRO1298 polypeptides
US11/341,175 US7468427B2 (en) 1997-03-31 2006-01-27 Antibodies to PRO1275 polypeptide
US11/518,609 US20070077623A1 (en) 1997-09-17 2006-09-07 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2006266069A JP2007049999A (en) 2000-06-02 2006-09-28 Secreted and transmembrane polypeptide and nucleic acid encoding the same
JP2007083124A JP2007238619A (en) 2000-01-06 2007-03-27 Composition and method for inhibiting growth of tumorous cell
US11/786,466 US20080182275A1 (en) 1998-12-22 2007-04-10 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2007326609A JP2008148701A (en) 1999-12-01 2007-12-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2007326613A JP2008161190A (en) 1999-12-01 2007-12-18 Secreted and transmembrane polypeptide and nucleic acid encoding the same
JP2007326424A JP2008167749A (en) 1999-12-01 2007-12-18 Secreted and transmembrane polypeptide and nucleic acid encoding the same
JP2007325484A JP2008148699A (en) 1999-12-01 2007-12-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US12/079,178 US20090170158A1 (en) 1997-12-03 2008-03-25 Secreted and transmembrane polypeptides and nucleic acids encoding the same
JP2008153789A JP2008301822A (en) 2000-03-01 2008-06-12 Secreted and transmembrane polypeptide and nucleic acid encoding the same
JP2008194721A JP2009039118A (en) 2000-07-20 2008-07-29 Composition and method for diagnosing and treating lesion associated with angiogenesis
JP2008194678A JP2009039117A (en) 2000-07-20 2008-07-29 Composition and method for diagnosing and treating lesion associated with angiogenesis
JP2008194764A JP2009039119A (en) 2000-07-20 2008-07-29 Composition and method for diagnosing and treating lesion associated with angiogenesis
JP2011173336A JP6033531B2 (en) 2000-07-20 2011-08-08 Compositions and methods for diagnosing and treating disorders associated with angiogenesis
JP2014187275A JP2015037408A (en) 2000-07-20 2014-09-16 Compositions and methods for diagnosis and treatment of disorders involving angiogenesis

Applications Claiming Priority (32)

Application Number Priority Date Filing Date Title
US14622299P 1999-07-28 1999-07-28
US60/146,222 1999-07-28
USPCT/US99/20944 1999-09-13
PCT/US1999/020944 WO2000015792A2 (en) 1998-09-14 1999-09-13 Promotion or inhibition of angiogenesis and cardiovascularization
USPCT/US99/21090 1999-09-15
PCT/US1999/021090 WO2000015796A2 (en) 1998-09-16 1999-09-15 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US1999/028214 WO2001019987A1 (en) 1999-09-13 1999-11-29 Promotion or inhibition of angiogenesis and cardiovascularization
USPCT/US99/28214 1999-11-29
USPCT/US99/28313 1999-11-30
PCT/US1999/028313 WO2000032221A2 (en) 1998-12-01 1999-11-30 Promotion or inhibition of angiogenesis and cardiovascularization
PCT/US1999/028301 WO2000032776A2 (en) 1998-12-01 1999-12-01 Secreted amd transmembrane polypeptides and nucleic acids encoding the same
USPCT/US99/28301 1999-12-01
USPCT/US00/00219 2000-01-05
PCT/US2000/000219 WO2000053753A2 (en) 1999-03-08 2000-01-05 Promotion or inhibition of angiogenesis and cardiovascularization
PCT/US2000/000376 WO2000053755A2 (en) 1999-03-08 2000-01-06 Compositions and methods for the treatment of tumor
USPCT/US00/00376 2000-01-06
USPCT/US00/03565 2000-02-11
PCT/US2000/003565 WO2001053486A1 (en) 1999-03-08 2000-02-11 Compositions and methods for the treatment of tumor
USPCT/US00/04341 2000-02-18
PCT/US2000/004341 WO2000053756A2 (en) 1999-03-08 2000-02-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US2000/004414 WO2001004311A1 (en) 1999-07-07 2000-02-22 Secreted and transmembrane polypeptides and nucleic acids encoding the same
USPCT/US00/04414 2000-02-22
USPCT/US00/05004 2000-02-24
PCT/US2000/005004 WO2000053757A2 (en) 1999-03-08 2000-02-24 Promotion or inhibition of angiogenesis and cardiovascularization
PCT/US2000/005841 WO2000053758A2 (en) 1999-03-08 2000-03-02 Compositions and methods for the treatment of immune related diseases
USPCT/US00/05841 2000-03-02
USPCT/US00/06884 2000-03-15
PCT/US2000/006884 WO2001005972A1 (en) 1999-07-20 2000-03-15 Compositions and methods for the treatment of immune related diseases
USPCT/US00/08439 2000-03-30
PCT/US2000/008439 WO2000073454A1 (en) 1999-06-02 2000-03-30 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US2000/013705 WO2000073445A2 (en) 1999-06-02 2000-05-17 Interleukin-1-receptor associated kinase-3 (irak3)
USPCT/US00/13705 2000-05-17

Related Parent Applications (3)

Application Number Title Priority Date Filing Date
PCT/US2000/014042 Continuation WO2000077037A2 (en) 1994-09-08 2000-05-22 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US2000/014042 Continuation-In-Part WO2000077037A2 (en) 1994-09-08 2000-05-22 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US2000/015264 Continuation-In-Part WO2000073452A2 (en) 1994-09-08 2000-06-02 Compositions and methods for the treatment of immune related diseases

Related Child Applications (11)

Application Number Title Priority Date Filing Date
PCT/US2000/023328 Continuation-In-Part WO2001016318A2 (en) 1994-09-08 2000-08-24 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US66535000A Continuation-In-Part 1994-09-08 2000-09-18
US70923800A Continuation-In-Part 1996-11-06 2000-11-08
PCT/US2000/032678 Continuation WO2001040466A2 (en) 1996-11-06 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
PCT/US2000/032678 Continuation-In-Part WO2001040466A2 (en) 1996-11-06 2000-12-01 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US09/866,028 Continuation US6642360B2 (en) 1996-11-06 2001-05-25 Secreted polypeptides that stimulate release of proteoglycans from cartilage
US09/903,749 Continuation US7147853B2 (en) 1997-09-17 2001-07-11 Anti-pro211 polypeptide antibodies
US09/944,862 Continuation US20020115145A1 (en) 1997-12-03 2001-08-31 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/081,056 Continuation US20040043927A1 (en) 1997-09-19 2002-02-20 Compositions and methods for the diagnosis and treatment of disorders involving angiogenesis
US10/119,480 Continuation US20040087769A1 (en) 1998-09-10 2002-04-09 Secreted and transmembrane polypeptides and nucleic acids encoding the same
US10/197,942 Continuation US20030175882A1 (en) 1998-03-27 2002-07-18 Secreted and transmembrane polypeptides and nucleic acids encoding the same

Publications (2)

Publication Number Publication Date
WO2001009327A2 true WO2001009327A2 (en) 2001-02-08
WO2001009327A3 WO2001009327A3 (en) 2001-08-02

Family

ID=22516360

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2000/020710 WO2001009327A2 (en) 1994-09-08 2000-07-28 Method of preventing the injury or death of retinal cells and treating ocular diseases

Country Status (2)

Country Link
AU (1) AU6391000A (en)
WO (1) WO2001009327A2 (en)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001049715A2 (en) * 2000-01-06 2001-07-12 Genentech, Inc. Methods and compositions for inhibiting neoplastic cell growth
EP1163334A1 (en) * 1999-03-25 2001-12-19 Genesis Research & Development Corporation Limited Polynucleotide and deduced amino acid sequences from stromal cells
WO2003002737A1 (en) * 2001-06-27 2003-01-09 Riken Novel human topoisomerase 2α inhibitory protein and utilization thereof
US7083791B2 (en) 1999-03-25 2006-08-01 Genesis Research & Development Corporation Limited Methods for enhancing immune responses by fibroblast growth factor receptor 5 polypeptides
US7312025B2 (en) 2002-07-12 2007-12-25 University Of Washington Methods and systems for extended in vitro culture of neuronal cells
WO2008131368A2 (en) 2007-04-20 2008-10-30 Acucela Inc. Styrenyl derivative compounds for treating ophthalmic diseases and disorders
WO2009005794A2 (en) 2007-06-29 2009-01-08 Acucela, Inc. Alkynyl phenyl derivative compounds for treating ophthalmic diseases and disorders
WO2009045479A1 (en) 2007-10-05 2009-04-09 Acucela Inc. Alkoxy compounds for disease treatment
US7592330B2 (en) 2005-08-08 2009-09-22 Massachusetts Eye And Ear Infirmary Methods and compositions for preserving the viability of photoreceptor cells
US7803375B2 (en) 2005-02-23 2010-09-28 Massachusetts Eye And Ear Infirmary Methods and compositions for treating conditions of the eye
US7811832B2 (en) 2002-01-18 2010-10-12 Massachusetts Eye And Ear Infirmary Methods for preserving the viability of photoreceptor cells by anti-FAS-ligand/anti-FAS-receptor antibodies
RU2532497C1 (en) * 2013-09-18 2014-11-10 Федеральное государственное бюджетное учреждение "Межотраслевой научно-технический комплекс "Микрохирургия глаза" имени академика С.Н. Федорова Министерства здравоохранения Российской Федерации Method for prediction of regression of stage ii and iii retinopathy of prematurity following laser coagulation of retina
RU2547801C1 (en) * 2013-11-20 2015-04-10 Федеральное государственное бюджетное учреждение "Московский научно-исследовательский институт глазных болезней имени Гельмгольца" Министерства здравоохранения Российской Федерации Method of treating terminal degree of scarry phase of retinopathy in premature babies
US9133154B2 (en) 2013-03-12 2015-09-15 Acucela Inc. Substituted 3-phenylpropylamine derivatives for the treatment of ophthalmic diseases and disorders
RU2596721C1 (en) * 2015-09-18 2016-09-10 Государственное бюджетное образовательное учреждение высшего профессионального образования "Российский национальный исследовательский медицинский университет им. Н.И. Пирогова" Министерства здравоохранения Российской Федерации (ГБОУ ВПО РНИМУ им. Н.И. Пирогова Минздрава России) Method of preventing and treating retinopathy of prematurity
US9447078B2 (en) 2012-01-20 2016-09-20 Acucela Inc. Substituted heterocyclic compounds for disease treatment
RU2605495C1 (en) * 2015-09-18 2016-12-20 Федеральное государственное бюджетное образовательное учреждение высшего образования "Российский национальный исследовательский медицинский университет имени Н.И. Пирогова" Министерства здравоохранения Российской Федерации (ФГБОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России) Method of preventing and treating retinopathy in premature newborns with evident fibrin formation and hemorrhages in retina and vitreous body
EP4158645A4 (en) * 2019-10-18 2023-11-22 S-Alpha Therapeutics, Inc. Digital apparatus and application for treating myopia

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993008826A1 (en) * 1991-11-08 1993-05-13 Cephalon, Inc. Treating retinal neuronal disorders by the application of insulin-like growth factors and analogs
WO1994001124A1 (en) * 1992-07-08 1994-01-20 Celtrix Pharmaceuticals, Inc. METHOD OF TREATING OPHTHALMIC DISORDERS USING TGF-$g(b)
WO1998007880A1 (en) * 1996-08-16 1998-02-26 Human Genome Sciences, Inc. Human endokine alpha
WO1999025834A1 (en) * 1997-11-18 1999-05-27 Genentech, Inc. Dna19355 polypeptide, a tumor necrosis factor homolog
WO1999040196A1 (en) * 1998-02-09 1999-08-12 Genentech, Inc. Novel tumor necrosis factor receptor homolog and nucleic acids encoding the same
WO2000053753A2 (en) * 1999-03-08 2000-09-14 Genentech, Inc. Promotion or inhibition of angiogenesis and cardiovascularization

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993008826A1 (en) * 1991-11-08 1993-05-13 Cephalon, Inc. Treating retinal neuronal disorders by the application of insulin-like growth factors and analogs
WO1994001124A1 (en) * 1992-07-08 1994-01-20 Celtrix Pharmaceuticals, Inc. METHOD OF TREATING OPHTHALMIC DISORDERS USING TGF-$g(b)
WO1998007880A1 (en) * 1996-08-16 1998-02-26 Human Genome Sciences, Inc. Human endokine alpha
WO1999025834A1 (en) * 1997-11-18 1999-05-27 Genentech, Inc. Dna19355 polypeptide, a tumor necrosis factor homolog
WO1999040196A1 (en) * 1998-02-09 1999-08-12 Genentech, Inc. Novel tumor necrosis factor receptor homolog and nucleic acids encoding the same
WO2000053753A2 (en) * 1999-03-08 2000-09-14 Genentech, Inc. Promotion or inhibition of angiogenesis and cardiovascularization

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CAYOUETTE M ET AL: "ADENOVIRUS-MEDIATED GENE TRANSFER OF CILIARY NEUROTROPHIC FACTOR CAN PREVENT PHOTORECEPTOR DEGENERATION IN THE RETINAL DEGENERATION (RD) MOUSE" HUMAN GENE THERAPY,XX,XX, vol. 8, no. 4, 1 March 1997 (1997-03-01), pages 423-430, XP000876513 ISSN: 1043-0342 *
GURNEY A L ET AL: "IDENTIFICATION OF A NEW MEMBER OF THE TUMOR NECROSIS FACTOR FAMILY AND ITS RECEPTOR, A HUMAN ORTHOLOG OF MOUSE GITR" CURRENT BIOLOGY,CURRENT SCIENCE,,GB, vol. 9, no. 2, 25 February 1999 (1999-02-25), pages 215-218, XP000938588 ISSN: 0960-9822 *
KWON BYUNGSUK ET AL: "Identification of a novel activation-inducible protein of the tumor necrosis factor receptor superfamily and its ligand" JOURNAL OF BIOLOGICAL CHEMISTRY,THE AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, INC.,,US, vol. 274, no. 10, 5 March 1999 (1999-03-05), pages 6056-6061, XP002147323 ISSN: 0021-9258 *
LAVAIL M M ET AL: "Multiple growth factors, cytokines, and neutrophins rescue photoreceptors from the damaging effects of constant light" PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA,NATIONAL ACADEMY OF SCIENCE. WASHINGTON,US, vol. 89, December 1992 (1992-12), pages 11249-11253, XP002118631 ISSN: 0027-8424 *

Cited By (26)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1163334A1 (en) * 1999-03-25 2001-12-19 Genesis Research & Development Corporation Limited Polynucleotide and deduced amino acid sequences from stromal cells
EP1163334A4 (en) * 1999-03-25 2004-07-28 Genesis Res & Dev Corp Ltd Polynucleotide and deduced amino acid sequences from stromal cells
US7083791B2 (en) 1999-03-25 2006-08-01 Genesis Research & Development Corporation Limited Methods for enhancing immune responses by fibroblast growth factor receptor 5 polypeptides
WO2001049715A3 (en) * 2000-01-06 2002-04-04 Genentech Inc Methods and compositions for inhibiting neoplastic cell growth
WO2001049715A2 (en) * 2000-01-06 2001-07-12 Genentech, Inc. Methods and compositions for inhibiting neoplastic cell growth
WO2003002737A1 (en) * 2001-06-27 2003-01-09 Riken Novel human topoisomerase 2α inhibitory protein and utilization thereof
US7811832B2 (en) 2002-01-18 2010-10-12 Massachusetts Eye And Ear Infirmary Methods for preserving the viability of photoreceptor cells by anti-FAS-ligand/anti-FAS-receptor antibodies
US7312025B2 (en) 2002-07-12 2007-12-25 University Of Washington Methods and systems for extended in vitro culture of neuronal cells
US7803375B2 (en) 2005-02-23 2010-09-28 Massachusetts Eye And Ear Infirmary Methods and compositions for treating conditions of the eye
US7592330B2 (en) 2005-08-08 2009-09-22 Massachusetts Eye And Ear Infirmary Methods and compositions for preserving the viability of photoreceptor cells
US8653142B2 (en) 2007-04-20 2014-02-18 Acucela Inc. Styrenyl derivative compounds for treating ophthalmic diseases and disorders
WO2008131368A2 (en) 2007-04-20 2008-10-30 Acucela Inc. Styrenyl derivative compounds for treating ophthalmic diseases and disorders
US8420863B2 (en) 2007-04-20 2013-04-16 Acucela, Inc. Styrenyl derivative compounds for treating ophthalmic diseases and disorders
US9314467B2 (en) 2007-04-20 2016-04-19 Acucela Inc. Styrenyl derivative compounds for treating ophthalmic diseases and disorders
US9421210B2 (en) 2007-04-20 2016-08-23 Acucela Inc. Styrenyl derivative compounds for treating ophthalmic diseases and disorders
US10201545B2 (en) 2007-04-20 2019-02-12 Acucela Inc. Styrenyl derivative compounds for treating ophthalmic diseases and disorders
WO2009005794A2 (en) 2007-06-29 2009-01-08 Acucela, Inc. Alkynyl phenyl derivative compounds for treating ophthalmic diseases and disorders
WO2009045479A1 (en) 2007-10-05 2009-04-09 Acucela Inc. Alkoxy compounds for disease treatment
EP3210966A1 (en) 2007-10-05 2017-08-30 Acucela, Inc. Alkoxyphenylpropylamines for the treatment of age-related macular degeneration
US9447078B2 (en) 2012-01-20 2016-09-20 Acucela Inc. Substituted heterocyclic compounds for disease treatment
US9133154B2 (en) 2013-03-12 2015-09-15 Acucela Inc. Substituted 3-phenylpropylamine derivatives for the treatment of ophthalmic diseases and disorders
RU2532497C1 (en) * 2013-09-18 2014-11-10 Федеральное государственное бюджетное учреждение "Межотраслевой научно-технический комплекс "Микрохирургия глаза" имени академика С.Н. Федорова Министерства здравоохранения Российской Федерации Method for prediction of regression of stage ii and iii retinopathy of prematurity following laser coagulation of retina
RU2547801C1 (en) * 2013-11-20 2015-04-10 Федеральное государственное бюджетное учреждение "Московский научно-исследовательский институт глазных болезней имени Гельмгольца" Министерства здравоохранения Российской Федерации Method of treating terminal degree of scarry phase of retinopathy in premature babies
RU2605495C1 (en) * 2015-09-18 2016-12-20 Федеральное государственное бюджетное образовательное учреждение высшего образования "Российский национальный исследовательский медицинский университет имени Н.И. Пирогова" Министерства здравоохранения Российской Федерации (ФГБОУ ВО РНИМУ им. Н.И. Пирогова Минздрава России) Method of preventing and treating retinopathy in premature newborns with evident fibrin formation and hemorrhages in retina and vitreous body
RU2596721C1 (en) * 2015-09-18 2016-09-10 Государственное бюджетное образовательное учреждение высшего профессионального образования "Российский национальный исследовательский медицинский университет им. Н.И. Пирогова" Министерства здравоохранения Российской Федерации (ГБОУ ВПО РНИМУ им. Н.И. Пирогова Минздрава России) Method of preventing and treating retinopathy of prematurity
EP4158645A4 (en) * 2019-10-18 2023-11-22 S-Alpha Therapeutics, Inc. Digital apparatus and application for treating myopia

Also Published As

Publication number Publication date
AU6391000A (en) 2001-02-19
WO2001009327A3 (en) 2001-08-02

Similar Documents

Publication Publication Date Title
US20110104170A1 (en) Novel composition and methods for the treatment of immune related diseases
US6551799B2 (en) Interleukin-22 polypeptides, nucleic acids encoding the same and methods for the treatment of pancreatic disorders
US20120171208A1 (en) Anti-PRO87299 Antibodies
US20100166761A1 (en) Compositions and methods for the treatment of immune related diseases
US20090092605A1 (en) Compositions and methods for the treatment of immune related diseases
US8178082B2 (en) Methods for up-regulating PAP1 in animals suffering from pancreatic disorders
US20110142841A1 (en) Compositions and methods for the treatment of systemic lupus erythematosis
WO2001009327A2 (en) Method of preventing the injury or death of retinal cells and treating ocular diseases
US20020155543A1 (en) Fibroblast growth factor-19 (FGF-19) nucleic acids and polypeptides and methods of use for the treatment of obesity and related disorders
US20020042367A1 (en) Fibroblast growth factor-19 (FGF-19) nucleic acids and polypeptides and methods of use for the treatment of obesity and related disorders
US20110097325A1 (en) Modulation of T cell Differentiation for the treatment of T helper cell mediated diseases
US20030054494A1 (en) Novel chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same
US6555343B1 (en) Chimpanzee erythropoietin (CHEPO) polypeptides and nucleic acids encoding the same
US20110177972A1 (en) Compositions and methods for the treatment of immune related diseases
US20020137909A1 (en) Novel cytokine receptors and nucleic acids encoding the same
CA2458751A1 (en) Compositions and methods for the treatement of immune related diseases
US7642242B2 (en) PRO34128 polypeptides
AU2002236618B2 (en) Interleukin-8 homologous polypeptides and therapeutic uses thereof
AU6498499A (en) Compositions and methods for the treatment of immune related diseases
WO2000053760A2 (en) Method of preventing the death of retinal neurons and treating ocular diseases
US20040002088A1 (en) Novel polypeptides having sequence similarity to GDNFR and nucleic acids encoding the same
EP1177285A1 (en) Chimpanzee erythropoietin (chepo) polypeptides and nucleic acids encoding the same
US20100285016A1 (en) PRO34128 nucleic acids
US20070179088A1 (en) Foggy
WO2002038601A2 (en) Foggy

Legal Events

Date Code Title Description
ENP Entry into the national phase in:

Ref country code: US

Ref document number: 1999 423844

Date of ref document: 19991112

Kind code of ref document: A

Format of ref document f/p: F

ENP Entry into the national phase in:

Ref country code: US

Ref document number: 2000 664610

Date of ref document: 20000918

Kind code of ref document: A

Format of ref document f/p: F

AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
DFPE Request for preliminary examination filed prior to expiration of 19th month from priority date (pct application filed before 20040101)
AK Designated states

Kind code of ref document: A3

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BY BZ CA CH CN CR CU CZ DE DK DM DZ EE ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NO NZ PL PT RO RU SD SE SG SI SK SL TJ TM TR TT TZ UA UG US UZ VN YU ZA ZW

AL Designated countries for regional patents

Kind code of ref document: A3

Designated state(s): GH GM KE LS MW MZ SD SL SZ TZ UG ZW AM AZ BY KG KZ MD RU TJ TM AT BE CH CY DE DK ES FI FR GB GR IE IT LU MC NL PT SE BF BJ CF CG CI CM GA GN GW ML MR NE SN TD TG

REG Reference to national code

Ref country code: DE

Ref legal event code: 8642

122 Ep: pct application non-entry in european phase
NENP Non-entry into the national phase in:

Ref country code: JP