KR20210135804A - Use of SCARNA13 for Diagnosis or Treatment of Alzheimer's Disease - Google Patents

Abstract

The present invention relates to a use of SCARNA13 for diagnosis or treatment of Alzheimer's disease. Specifically, the present invention relates to a composition for an Alzheimer's disease diagnostic marker comprising SCARNA13 gene, a composition for diagnosing Alzheimer's disease comprising a substance for measuring an mRNA level of the SCARNA13 gene, a pharmaceutical composition for preventing or treating Alzheimer's disease comprising an SCARNA13 expression inhibitor as an active ingredient, and a method of providing information for predicting or diagnosing an outbreak of Alzheimer's disease. SCARNA13, which is a biomarker gene for Alzheimer's disease, according to the present invention has an expression level that is specially increased in a plasma of a subject induced with Alzheimer's disease as compared with a normal group, such that the outbreak of Alzheimer's disease can be simply and quickly diagnosed through analysis of the expression level of SCARNA13 targeting a plasma sample that can be easily obtained, and an expression regulator of SCARNA13 can be efficiently used as a target for a new therapeutic agent of Alzheimer's disease.

Description

Use of SCARNA13 for Diagnosis or Treatment of Alzheimer's Disease

The present invention relates to the novel use of SCARNA13 for the diagnosis or treatment of Alzheimer's disease.

Degenerative brain disease refers to a disease that occurs in the brain among degenerative diseases that occur with advancing age, and can be classified by considering the main symptoms and affected brain regions. Representative Alzheimer's disease and Parkinson's disease are included .

Alzheimer's disease, a representative degenerative brain disease, is one of the diseases that cause dementia, and is a disease in which cognitive function including memory is progressively deteriorated by gradually onset with aging. Although the exact pathogenesis of Alzheimer's disease is not known, it is known as a general mechanism that beta-amyloid protein is excessively produced and deposited in the brain, which has a detrimental effect on brain cells.

As drugs for the treatment of Alzheimer's disease, acetylcholinesterase (AChE) inhibitors or NMDA (N-Methyl-D-aspartate) receptor antagonists are used, but most of these drugs are for patients with early-stage Alzheimer's disease. It is known to be effective against

Also, for the diagnosis of Alzheimer's disease, methods such as clinical exam and brain imaging are used, but it is very difficult to diagnose early stage Alzheimer's disease by such a diagnostic method.

In particular, through analysis of the brains of people with Alzheimer's disease, pathologies such as the presence of extracellular aggregates of Amyloid-β peptide and abnormal nerve fiber entanglement of Tau, a microtubule protein However, there is no clear biomarker that can confirm the possibility of Alzheimer's disease other than a tissue biopsy that requires direct collection of brain tissue, so there is a very big limitation in effectively preventing Alzheimer's disease.

Therefore, although early diagnosis of the disease is essential for effective treatment of Alzheimer's disease, there are few methods for accurately and rapidly diagnosing Alzheimer's disease until now.

On the other hand, SCARNA13 is known as an RNA gene as Small Cajal Body-Specific RNA 13. SCARNA13 is a gene corresponding to snoRNA (small nucleolar RNA) and is known as an RNA that causes a primary chemical change of other RNAs. Representatively, it is known to be related to RNA that has an important effect on protein translation, such as ribosomal RNA and transfer RNA. Moreover, snoRNA affects the expression of proteins that act as transcription factors in mammalian cells, so that the Regulates the expression of genes whose transcription is regulated under influence. SCARNA13, one of these snoRNAs, is known to be involved in hyperglycineemia, which is caused by the accumulation of large amounts of glycine, a kind of amino acid, in blood, urine, brain, and spinal cord in relation to human diseases.

However, the relationship between SCARNA13 and Alzheimer's has not yet been studied.

International Patent Publication WO11109440

Cancer Res; 79(13) July 1, 2019

Accordingly, the present inventors confirmed that SCARNA13 can be used as a new biomarker for the diagnosis of Alzheimer's disease. The present invention was completed by confirming that it can be used as a target of a biomarker and a new therapeutic agent for

Accordingly, it is an object of the present invention to provide a composition for a diagnostic marker for Alzheimer's disease, containing the SCARNA13 gene.

Another object of the present invention is to provide a composition for diagnosing Alzheimer's disease, comprising a substance for measuring the mRNA level of the SCARNA13 gene.

Another object of the present invention is to provide a kit for diagnosing Alzheimer's disease, comprising the composition for diagnosing Alzheimer's disease of the present invention.

Another object of the present invention is to provide a pharmaceutical composition for preventing or treating Alzheimer's disease, comprising an SCARNA13 expression inhibitor as an active ingredient.

Another object of the present invention is to provide an information providing method for predicting or diagnosing the onset of Alzheimer's disease.

In order to achieve the above object, the present invention provides a composition for a diagnostic marker for Alzheimer's disease, containing the SCARNA13 gene.

In one embodiment of the present invention, the SCARNA13 gene may include a nucleotide sequence consisting of SEQ ID NO: 1.

The present invention also provides a composition for diagnosing Alzheimer's disease, comprising a substance for measuring the mRNA level of the SCARNA13 gene.

In one embodiment of the present invention, the SCARNA13 gene may include a nucleotide sequence consisting of SEQ ID NO: 1.

In one embodiment of the present invention, the substance may be a primer or probe capable of specifically binding to SCARNA13.

In one embodiment of the present invention, the primer may be a primer set of SEQ ID NO: 3 and SEQ ID NO: 4.

The present invention also provides a kit for diagnosing Alzheimer's disease, comprising the composition for diagnosing Alzheimer's disease of the present invention.

The present invention also provides a pharmaceutical composition for preventing or treating Alzheimer's disease, comprising an SCARNA13 expression inhibitor as an active ingredient.

In one embodiment of the present invention, the expression inhibitor may be an antisense oligonucleotide, siRNA or shRNA for the gene of SCARNA13.

In addition, the present invention, (a) measuring the mRNA level of the SCARNA13 gene from a biological sample of a patient suspected of Alzheimer's disease; and (b) comparing the mRNA level of the SCARNA13 gene with the mRNA level of the corresponding gene in a normal control sample, providing an information providing method for predicting or diagnosing the onset of Alzheimer's disease.

In one embodiment of the present invention, when the mRNA level of the SCARNA13 gene increases as a result of measuring the mRNA level of the SCARNA13 gene compared to a normal control, the step of determining that Alzheimer's disease has occurred may be further added.

In one embodiment of the present invention, the biological sample may be blood, plasma or brain tissue.

In one embodiment of the present invention, the measurement may be reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, or Northern blot.

SCARNA13, a marker gene for Alzheimer's disease according to the present invention, is specifically increased in the plasma or brain tissue of an individual with Alzheimer's compared to the normal group. It has an effect that it can be used as a new biomarker that can In addition, the expression regulator of SCARNA13 can be usefully used as a new therapeutic target for the treatment of Alzheimer's disease.

1 is a linear graph showing changes in the expression of lncRNA obtained by performing whole genome analysis on blood-derived plasma obtained from Alzheimer's disease-induced mice and normal mice.
Figure 2 shows the results of identifying the SCARNA13 gene with increased Alzheimer's disease-specific expression through Total RNA-sequencing after extracting total RNA from plasma obtained from Alzheimer's disease-induced and normal mice, respectively.
3 is a graph showing the analysis result of the FPKM value of the SCARNA13 gene quantified based on the genome analysis result of FIG. 2 .
4 shows the nucleotide sequence of the SCARNA13 gene of the present invention, and the black bold sequence in the green box corresponds to the region in which SCARNA13 gene expression is strongest and shows the region amplified by the primer set designed in the present invention.
5 is a result of comparing the expression level of the SCARNA13 gene by performing RT-qPCR on plasma samples obtained from Alzheimer's disease-induced mice and normal mice using the primer set designed in an embodiment of the present invention. will be.
Figure 6 shows the results of confirming that the expression of SCARNA13 gene is increased in the brain tissue of Alzheimer's disease mice through Total RNA-sequencing after each extraction of total RNA from tissue samples obtained from Alzheimer's disease-induced mice and normal mice. it has been shown
7 shows the results of analyzing the expression level of CBP mRNA and the expression level of SCARNA13 mRNA in neurons in which the CBP gene is knocked down by performing RT-qPCR.

The present invention is characterized in that the novel use of SCARNA13 as a new biomarker for the diagnosis of Alzheimer's disease was first identified.

SCARNA13 is a gene corresponding to snoRNA (small nucleolar RNA) and is known to be related to RNA that affects protein translation, such as ribosomal RNA and transfer RNA, but there has been no report on the relevance to Alzheimer's yet.

On the other hand, conventional methods for diagnosing Alzheimer's disease include neurocognitive testing, magnetic resonance imaging (MRI), and pathological analysis through brain tissue biopsy, but this is a method through biopsy through surgery as well as economic aspects. Therefore, there is a problem that may place a great burden on the patient.

Therefore, the present inventors were conducting research to discover a new biomarker that can diagnose Alzheimer's disease simply and quickly while solving the inconvenience of tissue analysis, while measuring the expression level of SCARNA13 mRNA from easily obtainable blood or plasma samples. Through this study, it was confirmed that the onset of Alzheimer's disease can be diagnosed.

In this regard, in one embodiment of the present invention, after blood was isolated from Alzheimer's disease-induced and normal mice, plasma was separated from blood, and total RNA was extracted from plasma, and whole genome analysis was performed. Thus, genes showing differences in expression levels in the disease group and the normal group were screened.

As a result, it was specifically confirmed that the expression level of SCARNA13 mRNA was significantly increased in the Alzheimer's disease group compared to the normal group.

Therefore, through these results, when Alzheimer's disease is induced, the expression of SCARNA13 gene is significantly increased compared to normal, and this confirmation can be easily detected in blood, preferably plasma, not tissue. was found to be usable as a new biomarker for the diagnosis of Alzheimer's disease.

In addition, in another embodiment of the present invention, it was confirmed that the expression of SCARNA13 in the brain tissue as well as in the plasma sample was more increased in the Alzheimer's disease-inducing group than in the normal group.

Furthermore, the present inventors analyzed whether there is a region with a high expression level in the gene sequence of SCARNA13 for more efficient diagnosis of Alzheimer's disease.

SCARNA13 is composed of one exon, SCARNA13 is a gene corresponding to snoRNA, and snoRNA is a non-coding RNA (ncRNA) group, so it cannot make a protein. Therefore, the SCARNA13 gene does not have a start codon and a stop codon.

In the present invention, the SCARNA13 gene may consist of the nucleotide sequence of SEQ ID NO: 2, and in particular, it was confirmed that the nucleotide sequence region corresponding to SEQ ID NO: 1 is the site where the highest expression occurs.

Accordingly, the present inventors prepared a primer for detecting the gene region of SCARNA13, which has the strongest expression, and the primer may be a primer set consisting of the nucleotide sequences of SEQ ID NOs: 3 and 4.

Furthermore, the present inventors analyzed the expression level of SCARNA13 through RT-qPCR analysis on the plasma of Alzheimer's-induced mice and normal mice with the primer sets of SEQ ID NOs: 3 and 4 designed in the present invention. In comparison, it was confirmed that the expression of SCARNA13 in the plasma of the disease group was significantly increased, and as a result of the nucleotide sequence analysis of the reaction product amplified with the primer set of the present invention, it was confirmed that it was the gene fragment of SEQ ID NO: 2 having a size of 107 bp.

Therefore, the primer sets of SEQ ID NOs: 3 and 4 of the present invention can specifically and accurately detect SCARNA13, and thus can be usefully used in a composition for diagnosing Alzheimer's disease.

Therefore, the present invention can provide a composition for an Alzheimer's disease diagnostic marker containing the SCARNA13 gene, and a composition for Alzheimer's disease diagnostic comprising a substance for measuring the mRNA level of the SCARNA13 gene.

A material capable of measuring the mRNA level may include a primer or probe specific for the SCARNA13 gene. In the present invention, the primer or probe specific for the SCARNA13 gene may be a primer or probe capable of specifically amplifying the entire SCARNA13 gene or a partial region of the gene, and the primer or probe is designed through a method known in the art. can do.

In addition, the marker for the diagnosis of Alzheimer's disease in the present invention may be the SCARNA13 gene consisting of SEQ ID NO: 2, preferably the SCARNA13 gene consisting of SEQ ID NO: 1.

In the present invention, the term "primer" refers to a single compound capable of serving as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and a polymerase) in a suitable temperature and in a suitable buffer. -stranded oligonucleotides. The suitable length of the primer may vary depending on various factors, such as temperature and the use of the primer. In addition, the sequence of the primer does not need to have a completely complementary sequence to a partial sequence of the template, it is sufficient as long as it has sufficient complementarity within a range capable of hybridizing with the template to perform an intrinsic function of the primer. Therefore, the primer in the present invention does not need to have a sequence that is perfectly complementary to the nucleotide sequence of the gene as a template, and it is sufficient as long as it has sufficient complementarity within the range that can hybridize to this gene sequence and act as a primer. In addition, it is preferable that the primer according to the present invention can be used in a gene amplification reaction.

The amplification reaction refers to a reaction for amplifying a nucleic acid molecule, and amplification reactions of such genes are well known in the art, for example, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), ligase enzyme chain reaction (LCR), electron mediated amplification (TMA), nucleic acid sequence substrate amplification (NASBA), and the like.

In the present invention, the term "probe" refers to a linear oligomer of natural or modified monomers or linkages, includes deoxyribonucleotides and ribonucleotides, and can hybridize specifically to a target nucleotide sequence, It means that it exists or is artificially synthesized. The probe according to the present invention may be single-stranded, preferably an oligodeoxyribonucleotide. Probes of the invention may include native dNMPs (ie, dAMP, dGMP, dCMP and dTMP), nucleotide analogs or derivatives. In addition, the probe of the present invention may also contain ribonucleotides. For example, the probes of the present invention include backbone modified nucleotides, such as peptide nucleic acids (PNA) (M. Egholm et al., Nature, 365:566-568 (1993)), phosphorothioate DNA, phosphorodithioate DNA, phosphoroamidate DNA, amide-linked DNA, MMI-linked DNA, 2′-O-methyl RNA, alpha-DNA and methylphosphonate DNA, sugar modified nucleotides such as 2′-O-methyl RNA, 2'-fluoro RNA, 2'-amino RNA, 2'-O-alkyl DNA, 2'-O-allyl DNA, 2'-O-alkynyl DNA, hexose DNA, pyranosyl RNA and anhydrohexy Tall DNA, and nucleotides with base modifications such as C-5 substituted pyrimidines (substituents are fluoro-, bromo-, chloro-, iodo-, methyl-, ethyl-, vinyl-, formyl-, Tityl-, propynyl-, alkynyl-, thiazolyl-, imidazoryl-, pyridyl- including), 7-deazapurine having a C-7 substituent (substituents are fluoro-, bromo-, chloro- , iodo-, methyl-, ethyl-, vinyl-, formyl-, alkynyl-, alkenyl-, thiazolyl-, imidazoryl-, pyridyl-), inosine and diaminopurine. .

The present invention also provides a kit for diagnosing Alzheimer's disease, comprising the marker for diagnosing Alzheimer's disease or the composition for diagnosing Alzheimer's disease according to the present invention.

The kit for diagnosing Alzheimer's disease of the present invention may include a primer or probe capable of measuring the mRNA level of the SCARNA13 gene, which is the marker gene, and the definitions thereof are as described above.

If the kit of the present invention is applied to a PCR amplification process, the kit of the present invention may optionally contain reagents necessary for PCR amplification, such as a buffer, a DNA polymerase (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermostable DNA polymerase obtained from Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), DNA polymerase cofactor and dNTPs.

Furthermore, the kit according to the present invention may be manufactured as a plurality of separate packaging or compartments including reagent components, and the kit of the present invention may be a diagnostic kit including essential elements necessary for performing a DNA chip.

The DNA chip kit may include a substrate to which cDNA corresponding to a gene or fragment thereof is attached as a probe, and reagents, agents, enzymes, and the like for preparing a fluorescently-labeled probe. In addition, the substrate may include cDNA corresponding to a quantitative control gene or a fragment thereof.

In addition, the present invention, (a) measuring the mRNA level of the SCARNA13 gene from a biological sample of a patient suspected of Alzheimer's disease; and (b) comparing the mRNA level of the SCARNA13 gene with the mRNA level of the corresponding gene in a normal control sample, providing an information providing method for predicting or diagnosing the onset of Alzheimer's disease.

The method for measuring the mRNA level of a gene in the above may be performed including a known process for isolating mRNA from a biological sample using a known technique.

In the present invention, the "biological sample" refers to a sample collected from a living body, wherein the expression level of the gene according to the occurrence or progression of Alzheimer's disease is different from that of a normal control, and the sample includes, for example, but is not limited thereto. However, cells, blood, serum, plasma, saliva, tissue, urine, etc. may be included, preferably plasma.

Measurement of the expression level of the gene is preferably to measure the level of mRNA, as a method for measuring the level of mRNA, reverse transcription polymerase chain reaction (RT-PCR), real-time reverse transcription polymerase chain reaction, RNase protection assay, Northern blots and DNA chips, but are not limited thereto.

Therefore, the present invention can check the mRNA expression level of the marker gene in the control group and the mRNA expression level of the marker gene in the Alzheimer's disease patient or suspected patient through the detection methods as described above, and by comparing the expression level with the control group, Alzheimer's disease It is possible to predict and diagnose the onset of the disease, the stage of progression, or the prognosis.

More specifically, when the mRNA level of the SCARNA13 gene is increased as a result of measuring the mRNA level of the SCARNA13 gene compared to a normal control, it may be determined that Alzheimer's disease has occurred.

Furthermore, the present inventors have confirmed that, in addition to the fact that SCARNA13 is expressed at a high level compared to the normal group in the plasma of Alzheimer's disease, when the expression of the SCARNA13 gene is suppressed, Alzheimer's can be prevented, improved or treated.

Therefore, the present invention can provide a pharmaceutical composition for preventing or treating Alzheimer's disease comprising an inhibitor for suppressing the expression of SCARNA13 as an active ingredient.

Preferably, the oligonucleotide for inhibiting the expression of SCARNA13 may be an antisense oligonucleotide, RNAi, siRNA or shRNA for the gene of SCARNA13.

In the present invention, the term "antisense oligonucleotide" refers to DNA or RNA or a derivative thereof containing a nucleic acid sequence complementary to a specific mRNA sequence, and binds to a complementary sequence in mRNA to convert mRNA into protein. The antisense sequence of the present invention is complementary to the mRNA of the gene and refers to a DNA or RNA sequence capable of binding to the mRNA, and translation of the mRNA, translocation into the cytoplasm, and maturation ) or all other essential activities for overall biological functions.

In addition, the antisense nucleic acid may be modified at one or more bases, sugars or backbone positions to enhance efficacy (De Mesmaeker et al., Curr Opin Struct Biol., 5, 3, 343-55, 1995). ). The nucleic acid backbone may be modified with phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyls, cycloalkyls, short chain heteroatomics, heterocyclic intersugar linkages, and the like. Antisense nucleic acids may also include one or more substituted sugar moieties. Antisense nucleic acids may include modified bases. Modified bases include hypoxanthine, 6-methyladenine, 5-methylpyrimidine (particularly 5-methylcytosine), 5-hydroxymethylcytosine (HMC), glycosyl HMC, gentobiosyl HMC, 2-aminoadenine, 2 -Thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7-deazaguanine, N6 (6-aminohexyl) adenine, 2,6-diaminopurine, etc. There is this. In addition, the antisense nucleic acid of the present invention may be chemically bound to one or more moieties or conjugates that enhance the activity and cell adsorption properties of the antisense nucleic acid. Cholesterol moiety, cholesteryl moiety, cholic acid, thioether, thiocholesterol, fatty chain, phospholipid, polyamine, polyethylene glycol chain, adamantane acetic acid, palmityl moiety, octadecylamine, hexylamino-carbonyl-oxy fat soluble moieties such as cholesterol moieties, and the like. Oligonucleotides comprising a fat-soluble moiety and methods of preparation are well known in the art (US Pat. Nos. 5,138,045, 5,218,105 and 5,459,255). The modified nucleic acid may increase the stability to nucleases and increase the binding affinity between the antisense nucleic acid and the target mRNA.

Antisense oligonucleotides can be synthesized in vitro by a conventional method and administered in vivo, or antisense oligonucleotides can be synthesized in vivo. An example of synthesizing antisense oligonucleotides in vitro is using RNA polymerase I. One example of allowing antisense RNA to be synthesized in vivo is to use a vector with the origin of the recognition site (MCS) in the opposite direction to allow the antisense RNA to be transcribed. Such antisense RNA preferably has a translation stop codon in the sequence so that it is not translated into the peptide sequence.

In the present invention, "RNAi" refers to RNA interference, and when translated into Korean, it has the meaning of RNA interference. RNA interference is a specific gene repression phenomenon that is well conserved among most organisms. It is thought to be a kind of gene monitoring mechanism used by cells to protect against viral infection, to suppress transposon, or to remove abnormal mRNA. In particular, gene suppression by small RNA is called RNA interference in a broad sense, and RNA interference in a narrow sense means mRNA degradation by siRNA. RNA interference also refers to gene suppression experimental technology using siRNA.

In the present invention, the term "siRNA" refers to a nucleic acid molecule capable of mediating RNA interference or gene silencing (International Patent Publication Nos. 00/44895, 01/36646, 99/32619, 01/29058, 99/07409 and 00 /44914) Since siRNA can inhibit the expression of a target gene, it is provided as an efficient gene knock-down method or as a gene therapy method.

In addition, the pharmaceutical composition for preventing or treating Alzheimer's disease according to the present invention may further include a pharmaceutically acceptable carrier. As used herein, "pharmaceutically acceptable" refers to a composition that is physiologically acceptable and does not normally cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans. Pharmaceutically acceptable carriers include, for example, carriers for oral administration such as lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like, and carriers for parenteral administration such as water, suitable oils, saline, aqueous glucose and glycols, and the like. and the like, and may further include a stabilizer and a preservative. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite or ascorbic acid. Suitable preservatives are benzalkonium chloride, methyl- or propyl-paraben and chlorobutanol. As other pharmaceutically acceptable carriers, reference may be made to those described in the following literature (Remington's Pharmaceutical Sciences, 19th ed., Mack Publishing Company, Easton, PA, 1995).

The pharmaceutical composition according to the present invention may be formulated in a suitable form according to a method known in the art together with a pharmaceutically acceptable carrier as described above. That is, the pharmaceutical composition of the present invention can be prepared in various parenteral or oral dosage forms according to known methods, and as a representative dosage form for parenteral administration, an isotonic aqueous solution or suspension is preferred as an injectable dosage form. Formulations for injection may be prepared according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. For example, each component may be formulated for injection by dissolving it in saline or buffer. In addition, formulations for oral administration include, but are not limited to, powders, granules, tablets, pills and capsules.

The pharmaceutical composition formulated in the above manner may be administered in an effective amount through various routes including oral, transdermal, subcutaneous, intravenous or intramuscular, wherein the administration refers to the introduction of a predetermined substance into the patient by any suitable method. means, and the route of administration of the substance may be administered through any general route as long as it can reach the target tissue.

In addition, in the above, the effective amount refers to an amount exhibiting a prophylactic or therapeutic effect when administered to a patient. The dosage of the pharmaceutical composition according to the present invention may vary depending on various factors such as the type and severity of the patient's disease, age, sex, weight, sensitivity to drugs, the type of current treatment, administration method, target cell, etc. can be easily determined by experts in

In addition, the pharmaceutical composition of the present invention may be administered in combination with a conventional therapeutic agent, may be administered sequentially or simultaneously with the conventional therapeutic agent, and may be administered single or multiple. Preferably, taking all of the above factors into consideration, an amount capable of obtaining the maximum effect with a minimum amount without side effects may be administered, more preferably from 1 to 10000 μg/weight kg/day, even more preferably from 10 to 1000 mg It can be administered repeatedly several times a day at an effective dose of /kg body weight /day.

Hereinafter, the present invention will be described in more detail by way of Examples. These examples are merely for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited to these examples.

<Example 1>

Discovery of SCARNA13 as a diagnostic biomarker for Alzheimer's disease

<1-1> Isolation of plasma and total RNA from the blood of Alzheimer's disease-inducing mice

In order to discover a new biomarker that can easily diagnose the onset of Alzheimer's disease, the present inventors extracted blood from a 12-week-old Alzheimer's disease-induced animal model 5XFDA mouse, and then used an ultracentrifuge at 100,000 xg. Only plasma was separated by centrifugation at a speed of 4°C for 1 hour. Then, in order to extract the total RNA in the obtained plasma, total RNA was extracted by the Trizol method, and the following procedure was further performed to obtain high-purity RNA. Trizol reagent was added in the ratio of the obtained plasma volume and the same volume (1:1), carefully mixed with a micropipette, and then incubated at room temperature for about 1 hour. Thereafter, RNA extraction was performed by adding high-purity chloroform of about 1/5 of the total volume. In particular, when purifying RNA from plasma, RNA was precipitated by adding 100% isopropanol. This step is an important step to obtain RNA capable of genomic analysis from a small amount of plasma. The precipitation step using isopropanol is performed once. Further iterations were performed for a total of two times. The purified RNA was measured for concentration and purity using a nano drop, and it was confirmed that the 260/280 ratio of the extracted RNA was maintained between 1.8 and 2.0.

<1-2> Genome analysis of total RNA in plasma and discovery of SCARNA13

In order to identify new genes that are increased dependently on Alzheimer's disease using blood-derived plasma as a sample, a whole-genome analysis method was performed on the total RNA of plasma derived from Alzheimer's disease mouse blood obtained in <1-1>. To this end, a library for whole genome analysis was prepared using the TruSeq Stranded Total RNA LT Kit known in the art, and the expression change of IncRNA in the blood-derived plasma was analyzed through Illumina HiSeq 4000 Next Generation sequencing analysis, The results are shown in FIG. 1 .

Here, the IncRNA (long non-coding RNA) is a recently discovered new class of transcripts that are invasively transcribed into the genome, and are known as important regulators of the epigenome. These long noncoding RNAs (lncRNAs) have recently been re-emerged as Regulatory RNAs, and in particular, play a major role in epigenetic, regulation of transcription, cancer formation or embryonic development, nervous system disorders, or other essential biological processes. is known However, the function of lncRNA is still only partially understood, and studies to discover specific lncRNAs that can be used as biomarkers for specific diseases are lacking.

In addition, as a result of gene analysis showing a change in the expression level in the plasma of the Alzheimer's-affected group compared to the normal group through sequencing analysis, it was confirmed that the amount of RNA of SCARNA13 was significantly increased in the Alzheimer's-affected group (see FIG. 2). Furthermore, as a result of calculating the expression value by extracting the FPKM (Fragment per kilobase of trasncript per million) value from the derived genome analysis information, the expression level of the SCARNA13 gene was increased by about 250% in the Alzheimer's disease group compared to the normal group. was found (see Fig. 3).

Meanwhile, the expression level of other Scarna was also analyzed through the genomic expression analysis and FPKM analysis as described above. The expression of Snhg4, a host gene in which ScaRNA other than SCARNA13 is made, was detected in both the normal group and the Alzheimer's disease group, and between these experimental groups There was no significant difference in the expression level of

Therefore, the present inventors confirmed that when Alzheimer's disease is induced, the expression of SCARNA13 RNA is specifically increased in plasma compared to the normal group, and thus the SCARNA13 gene can be used as a new biomarker to diagnose Alzheimer's disease. could

<Example 2>

Preparation of primers for detection of SCARNA13

In order to easily detect SCARNA13 newly discovered as an Alzheimer's disease diagnostic marker in <Example 1>, a primer set was prepared as follows. For the purified RNA obtained in Example 1, cDNA was synthesized using a random primer and reverse transcriptase, and the synthesized cDNA was 20ng/ After dilution with ul, an amount of 30 ng was used when performing the following experiment. Based on the RNA obtained from the normal group and the Alzheimer's disease-induced mouse group, a primer set for a region capable of specifically detecting the SCARNA13 gene was designed as follows.

SCARNA13 forward primer (SEQ ID NO: 3)

: 5'-CAACAGTACCCAGGCCCTAT-3'

SCARNA13 reverse primer (SEQ ID NO: 4)

: 5'- CACCAGACTTGCAGAGAAAG - 3'

RT-qPCR was performed using the prepared primer set, and as a result of analyzing the amplified DNA product, it was confirmed that the SCARNA13 gene sequence of SEQ ID NO: 1 having a size of 107 bp was amplified, and the expression of the SCARNA13 gene in the present invention The base sequence for the site is shown in SEQ ID NO: 2. SCARNA13 consists of one exon, and the nucleotide sequence indicated by black bold in the green box in FIG. 4 is the nucleotide sequence of the SCARNA13 region that can be amplified and detected with the primer set of the present invention. In addition, snoRNA corresponds to the ncRNA (non coding RNA) group, so it cannot make proteins. Therefore, the SCARNA13 gene does not have a start codon and a stop codon.

<Example 3>

Diagnosis of Alzheimer's disease using primers for detecting SCARNA13 in plasma samples

The present inventors conducted the following experiments to determine whether the onset of Alzheimer's disease can be diagnosed by analyzing the expression level of SCARNA13 in plasma and tissue samples using the primer set for detecting SCARNA13 designed in Example 2 above. was performed.

First, RNA was isolated from plasma obtained from the normal mouse group and Alzheimer's-induced mouse group obtained in the above Example, and then RT-qPCR was performed using the primer set for detecting SCARNA13 of the present invention.

As a result, as shown in FIG. 5 , in the RT-qPCR analysis using the primer set of the present invention, it was confirmed that the expression level of SCARNA13 in the plasma of the Alzheimer's-induced group was significantly increased by about 170% compared to the normal group. there was.

<Example 4>

Analysis of changes in the expression level of SCARNA13 in brain tissue of Alzheimer's-induced mice

The present inventors performed the following experiment in order to confirm whether Alzheimer's disease can be diagnosed by changing the expression level of SCARNA13 even in brain tissue.

After brain tissue was isolated from the Alzheimer's-induced 5XFDA mouse group and the normal mouse group used in Example 1, whole genome analysis was performed, and the expression of the SCARNA13 gene was analyzed whether there was a difference between the normal group and the disease group.

As a result, as shown in FIG. 6 , it was confirmed that the expression of the SCARNA13 gene was specifically increased in the brain tissue of the Alzheimer's-induced mouse compared to the normal brain tissue in the total RNA-sequence analysis result.

<Example 5>

Analysis of expression regulation of SCARNA13 by CBP transcription factor

Furthermore, the present inventors confirmed the fact that the expression of the SCARNA13 gene is increased when Alzheimer's is induced through the results of the above Examples. Therefore, it was found that a substance that inhibits the expression or activity of the SCARNA13 gene can be a therapeutic agent for Alzheimer's disease. Accordingly, the present inventors were able to confirm that the expression of the SCARNA13 gene is regulated by the CBP (CREB-binding protein) transcription factor through the following experiment while researching to find a regulator capable of regulating the expression of the SCARNA13 gene.

Specifically, by knocking down the CBP transcription factor present in the cranial nerve cells, the expression of the CBP transcription factor was suppressed in the cells, and the expression level of SCARNA13 in the cranial nerve cells in which the CBP transcription factor was suppressed was analyzed through RT-qPCR. In this case, lenti-virus-based shRNA was used to knock down the CBP transcription factor in neuronal cells. CBP target shRNA was inserted between HpaI and XhoI restriction enzymes into pLLX lenti-viral vector, and the viral vector into which CBP target shRNA was introduced was transfected into HEK 293T cells together with VSVG and delat-8.9 vector (viral membrane component). After 72 hours, the lenti-virus secreted from the cells was recovered, impurities were removed through a filter having a size of 0.42 um, and then the neuronal cells were infected to knock down the CBP gene in the cells. In addition, the shRNA sequence used for CBP knockdown is as follows.

shRNA sequence for CBP knockdown (SEQ ID NO: 5)

: 5′-AATCCACAGTACCGAGAAATGTT -3′

As a result of the analysis, as shown in FIG. 7 , it was confirmed that the CBP transcription factor was knocked down in the cranial nerve cells (left diagram of FIG. 7 ), and the mRNA level of the SCARNA13 gene was also reduced in the cranial nerve cells in which the CBP transcription factor was knocked down. appeared (right view of FIG. 7).

Therefore, through these experimental results, the present inventors found that SCARNA13 can be used as a new biomarker for the diagnosis of Alzheimer's disease. It was found that the sample alone can easily and quickly diagnose Alzheimer's disease. In addition, it was found that regulators capable of regulating the expression or activity of SCARNA13 could be a new therapeutic target for Alzheimer's disease.

So far, with respect to the present invention, the preferred embodiments have been looked at. Those of ordinary skill in the art to which the present invention pertains will understand that the present invention can be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments are to be considered in an illustrative rather than a restrictive sense. The scope of the present invention is indicated in the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

<110> Korea Brain Research Institute <120> Use of SCARNA13 for Diagnosis or Treatment of Alzheimer's Disease <130> NPDC85949 <160> 5 <170> KoPatentIn 3.0 <210> 1 <211> 107 <212> DNA <213> Artificial Sequence <220> <223> SCARNA13 DNA sequence <400> 1 caacagtacc caggccctat cagaggaaaa ttgcacatgg gcctgctgcc tctcgagcag 60 gcatgcctca gcttcctctg ttgtctgctt tctctgcaag tctggtg 107 <210> 2 <211> 275 <212> DNA <213> Artificial Sequence <220> <223> SCARNA13 DNA sequence <400> 2 ttttgtggca gtacttagtg tccaacagaa accgctccgt ctgctaaaca atatcttgac 60 tgccaagctt ctctgactgt tggtggatcg acaatgacac ggcacagcca ttatcaccgt 120 ggcaacagta cccaggccct atcagaggaa aattgcacat gggcctgctg cctctcgagc 180 aggcatgcct cagcttcctc tgttgtctgc tttctctgca agtctggtgt gctctagggt 240 accgctaacc cagcgcaggg ccaagactgc agatt 275 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCARNA13 F primer sequence <400> 3 caacagtacc caggccctat 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> SCARNA13 R primer sequence <400> 4 caccagactt gcagagaaag 20 <210> 5 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> CBP shRNA sequence <400> 5 aatccacagt accgagaaat gtt 23

Claims (13)

A composition for a diagnostic marker for Alzheimer's disease, containing the SCARNA13 gene. According to claim 1,
The SCARNA13 gene is characterized in that it comprises a nucleotide sequence consisting of SEQ ID NO: 1, Alzheimer's disease diagnostic marker composition. A composition for diagnosing Alzheimer's disease, comprising a material for measuring the mRNA level of the SCARNA13 gene. 4. The method of claim 3,
The SCARNA13 gene is characterized in that it comprises a nucleotide sequence consisting of SEQ ID NO: 1, Alzheimer's disease diagnosis composition. 4. The method of claim 3,
The material is a primer or probe capable of specifically binding to SCARNA13, Alzheimer's disease diagnosis composition. 6. The method of claim 5,
The primer is characterized in that the primer set of SEQ ID NO: 3 and SEQ ID NO: 4, Alzheimer's disease diagnosis composition. A kit for diagnosing Alzheimer's disease, comprising the composition of any one of claims 3 to 6. A pharmaceutical composition for preventing or treating Alzheimer's disease, comprising an SCARNA13 expression inhibitor as an active ingredient. 9. The method of claim 8,
The expression inhibitory agent is an antisense oligonucleotide, siRNA or shRNA for the gene of SCARNA13, a pharmaceutical composition for preventing or treating Alzheimer's disease. (a) measuring the mRNA level of the SCARNA13 gene from a biological sample of a patient suspected of Alzheimer's disease; and
(b) comparing the mRNA level of the SCARNA13 gene with the mRNA level of the corresponding gene in a normal control sample,
A method of providing information for predicting or diagnosing the onset of Alzheimer's disease. 11. The method of claim 10,
As a result of measuring the mRNA level of the SCARNA13 gene, when the mRNA level of the SCARNA13 gene is increased compared to the normal control, further comprising the step of determining that Alzheimer's disease has occurred, for predicting or diagnosing the onset of Alzheimer's disease How to provide information. 11. The method of claim 10,
The biological sample is blood, plasma or brain tissue, characterized in that, information providing method for predicting or diagnosing the onset of Alzheimer's disease. 11. The method of claim 10,
The measurement is information for predicting or diagnosing the onset of Alzheimer's disease, characterized in that reverse transcriptase-polymerase chain reaction, real time-polymerase chain reaction, or Northern blot How to provide.

Images