CN107029238B - Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis - Google Patents
Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis Download PDFInfo
- Publication number
- CN107029238B CN107029238B CN201611053234.8A CN201611053234A CN107029238B CN 107029238 B CN107029238 B CN 107029238B CN 201611053234 A CN201611053234 A CN 201611053234A CN 107029238 B CN107029238 B CN 107029238B
- Authority
- CN
- China
- Prior art keywords
- linc01094
- cerebral apoplexy
- arterial thrombosis
- expression
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Pathology (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to LINC01094 diagnosis and treatment cerebral arterial thrombosis application.Invention carries out high-flux sequence by acquiring in ischemic cerebral apoplexy with healthy population peripheral blood, it is analyzed with bioinformatics tools, preliminary screening selects part candidate gene and carries out large sample verification and preliminary interference experiment to the mRNA and 1ncRNA in cerebral apoplexy group differential expression.LINC01094 provided by the present invention is that clinical early stage cerebral arterial thrombosis Molecular Detection lays the foundation.
Description
Technical field
The present invention relates to biomedicine technical fields, and in particular to the Molecular biomarkers of cerebral arterial thrombosis, more
Body is related to the application of LINC01094 and its related gene in diagnosis and treatment cerebral arterial thrombosis.
Background technology
It is more than 200 cores that long-chain non-coding RNA (long non-coding RNA, lncRNA), which is a kind of transcript length,
The non-coding RNA of thuja acid can be divided into five types according to its gene location：Just lncRNA (sense lncRNA), antisense
LncRNA (antisense lncRNA), two-way lncRNA (bidirectional lncRNA), lncRNA in gene
LncRNA (intergenic lncRNA) between (intronic lncRNA) and gene.Future, lncRNA are expected to examine as tumour
Break, the marker that treatment and prognosis are new, while also providing new target spot for the treatment of tumour.But post-stroke 1ncRNAs
Expression variation how, 1ncRNAs whether participate in cerebral apoplexy the course of disease regulation and control, it is not immediately clear.
Cerebral apoplexy is a kind of cranial vascular disease seriously endangering human health and life security, has incidence height, disables
The features such as rate height and the high death rate, data are shown, about 2,000,000 people of patients with cerebral apoplexy is newly sent out in China every year, wherein 70%-80%'s
Patients with cerebral apoplexy brings huge life stress and stress because deformity cannot live on one's own life, to family, and the whole nation is annual to be used
As many as 10,000,000,000 yuan are up in the medical expense of the disease, heavy financial burden is caused to country.Seek the morbidity machine of cerebral apoplexy
System and the research for effectively preventing and treating method in advance more show important.Brain trunk blood caused by being fallen off by thrombosis or embolus
Cerebral arterial thrombosis caused by pipe or its branch vessel obstruction accounts for about 80% or so of whole cerebral apoplexies.Search out effective point
Sub- target for modulation, early diagnosing cerebral arterial thrombosis by blood testing can make patient benefit a great deal, and be examined with blood markers early stage
Disconnected cerebral arterial thrombosis will be expected to become an aided diagnosis method with actual application value.
The express spectra that the present invention detects mRNA and 1ncRNAs in cerebral apoplexy and normal control population by high-flux sequence becomes
Change, with bioinformatics tools analysis in the mRNA and 1ncRNAs of cerebral apoplexy group differential expression, filters out candidate gene
LINC01094 then uses RT-PCR experiments to carry out large sample verification and correlation analysis and preliminary interference experiment, as a result
Show that the LINC01094 selected and cerebral arterial thrombosis of the invention are closely related, for clinical early stage cerebral arterial thrombosis molecule inspection
Survey lays the foundation.
Invention content
The purpose of the present invention is to provide a kind of reagent of prevention cerebral apoplexy, the reagent includes：
(a) inhibitor and/or inhibitor combination, the inhibitor and/or inhibitor combination lower LINC01094's
Transcription and/or the activity for blocking LINC01094；
(b) receptible carrier in pharmacy.
Further, the cerebral apoplexy is cerebral arterial thrombosis.
Preferably, the transcription and/or blocking of LINC01094 are lowered by the methods of siRNA, shRNA, antisense nucleic acid
The activity of LINC01094.
Preferably, siRNA target sequences used are SEQ ID NO.8 and SEQ ID NO.11.
Preferably, siRNA sequence used is SEQ ID NO.9 and SEQ ID NO.10；Or SEQ ID NO.12 and SEQ
ID NO.13。
The purpose of the present invention is to provide the preparations of regulation and control LINC01094 expression to prepare answering in preventing cerebral apoplexy reagent
With.
Further, prevention cerebral apoplexy reagent includes lowering the transcription of LINC01094, or inhibit the active examinations of LINC01094
Agent.
The purpose of the present invention is to provide a kind of cerebral apoplexy diagnostic preparation, which detects LINC01094 expression.
Further, cerebral apoplexy diagnostic preparation can detect the transcription of LINC01094 or immune detection side in cerebral apoplexy sample
Method detects the expression for the gene that LINC01094 regulates and controls in cerebral apoplexy sample.
Further, the cerebral apoplexy is cerebral arterial thrombosis.
Preferably, cerebral arterial thrombosis sample is peripheral blood.
Further, diagnosing ischemia cerebral apoplexy reagent includes based on high-flux sequence method and/or being based on quantifying PCR method
And/or it is examined based on LINC01094 transcriptions in probing procedure detection cerebral arterial thrombosis sample or based on immunologic detection method
Survey the expression for the gene that LINC01094 regulates and controls in cerebral arterial thrombosis sample.
Preferably, include the primer of specific amplification LINC01094 based on quantifying PCR method, further preferably, specificity
The primer sequence for expanding LINC01094 is SEQ ID NO.1 and SEQ ID NO.2；Based on probing procedure include with
The probe of the nucleic acid array hybridizing of LINC01094；Immunologic detection method includes special with LINC01094 controlling genes expression albumen
Property combine antibody.
The purpose of the present invention is to provide application of the above-mentioned cerebral apoplexy diagnostic preparation in preparing cerebral apoplexy detection instrument.
Those skilled in the art are known, and lncRNA sequences provided by the invention can not only be obtained by biological method, but also can be passed through
Chemical synthesis process obtains, if being prepared by chemical synthesis process, as long as its nucleotide sequence is supplied to related specialized company,
It is entrusted to synthesize.LncRNA also contains other or interchangeable base modification body or substitution body, as thio-modification or/
The nucleotide sequence modified with methoxyl group.With its 90% or more homologous nucleotide sequence also the scope of the present invention it
It is interior.
The purpose of the present invention is to provide a kind of diagnosis cerebral apoplexy biological agent, the Biopreparate detection and LINC01094
Express relevant gene.
It includes positive correlation gene and negative correlation gene that described and LINC01094, which expresses relevant gene,.The positive correlation base
Because expression trend and LOC105372881 express consistent gene, the negative correlation gene be expression trend with
LOC105372881 expresses opposite gene.
Further, positively related gene be TESC, JAZF1, NEDD4L, EIF3B, ANP32B, RAD23A, STRADB,
BCKDK, CCNY, ASCC2, UTS2 or/and MMP17.
Further, negatively correlated gene be KIAA1324L, MIS18A, C1QTNF6, MTERF2, MAP6D1, ZNF530,
DNAH1, CRACR2A, TTC22 and/or MIB2.
Preferably, it is JAZF1 relevant gene to be expressed with LINC01094.
Further, cerebral apoplexy is cerebral arterial thrombosis.
Further, diagnosing ischemia cerebral apoplexy biological agent includes based on high-flux sequence method and/or being based on quantitative PCR
Method and/or based in probing procedure detection cerebral arterial thrombosis sample and LINC01094 expresses relevant genetic transcription
Or the expression for expressing relevant gene in cerebral arterial thrombosis sample with LINC01094 is detected based on immunologic detection method.
Preferably, cerebral arterial thrombosis sample is peripheral blood.
Preferably, include primer that specific amplification and LINC01094 express relevant gene based on quantifying PCR method,
Further preferably, the primer sequence of specific amplification JAZF1 genes is SEQ ID NO.3 and SEQ ID NO.4；It is miscellaneous based on probe
Friendship method includes the probe with JAZF1 nucleic acid array hybridizings；Immunologic detection method includes and JAZF1 gene expression protein-specifics
In conjunction with antibody.
The purpose of the present invention is to provide above-mentioned biological agents to prepare the application in diagnosing cerebral apoplexy tool.
The purpose of the present invention is to provide a kind of reagent of prevention cerebral apoplexy, reagent regulation and control express phase with LINC01094
The expression of the gene of pass.
Further, cerebral apoplexy is cerebral arterial thrombosis.
Further, prevention cerebral apoplexy reagent includes lowering the transcription that positively related gene is expressed with LINC01094, or raise
The transcription of negatively correlated gene with LINC01094 expression.
Preferably, it is lowered by the methods of siRNA, shRNA, antisense nucleic acid and expresses positively related gene with LINC01094
Transcription or the transcription by building the methods of over-express vector up-regulation gene negatively correlated with LINC01094 expression.
The purpose of the present invention is to provide application of the reagent of above-mentioned prevention cerebral apoplexy in preparing Treatment of Cerebral Stroke drug.
Definition：
" homologous " as used herein refers between two polymerizable moleculars (for example, two nucleic acid molecules such as two DNA moleculars
Between) subunit sequence similarity.When all (examples occupied by identical monomer subunits of the subunit position in two molecules
Such as, if a position of two DNA moleculars is all occupied by adenine), they are homologous on that position.Two
Homology between sequence is the direct function of the quantity of matching or homologous position.For example, the 10 of two compound sequences
5 in a position are matchings or homologous, then two sequences are 50% homologous, if 9 in 10 positions are phases
Matching or homologous, then two sequences are 90% homologous.
" diagnosis " expression is detected the presence of pathological condition or characteristic.Diagnostic method susceptibility and specificity on be
It is distinguishing." sensitivity " of diagnostic method refers to being detected as the percentage (percentage of " true positives " of positive diseased individuals
Than).The undetected diseased individuals of method are " false negatives ".In the method, non-illness and be detected as it is negative by
Examination person is referred to as " true negative "." specificity " in diagnostic method is 1 difference for subtracting false positive rate, wherein " false positive " rate quilt
It is defined as：It is disease-free but and test positive individual ratio.Although a certain particular diagnostic method can not provide for a kind of symptom
Authoritative diagnosis, but it is enough to provide the positive indicating means as auxiliary diagnosis.
The method of the expression of detection lncRNA includes mainly based on high throughput sequencing technologies, is based on nucleotide at this stage
The lncRNA detection methods of hybridization and based on PCR.LncRNA detection methods based on probe hybridization technique are a kind of directly detections
Method need not expand sample rna in advance.
Real-Time Fluorescent Quantitative PCR Technique (Real-time PCR, RT-PCR)
Fluoroscopic examination PCR instrument can draw dynamic changing curve to the cumulative speed of extension increasing sequence during entire PCR.Anti-
Answer the initial concentration of target sequence in mixed system bigger, it is desirable that the PCR cycle number for obtaining amplified production specific output is (general to use
Specific threshold recurring number Ct is expressed) it is fewer.QRT-PCR has the advantages that specific high, sensitivity is good, quick and easy etc. a variety of.
High-flux sequence (High-throughput sequencing) is also known as next-generation sequencing technologies (next
Generation sequencing) it is the change for tradition being sequenced revolution, once to hundreds of thousands to millions of DNA
Molecule carries out sequencing, greatly improves sequencing efficiency.This kind of large scale sequencing technology greatly improves multiple species and loses
The solution reading rate of communication breath, to obtain the sequence information of all lncRNA, decryption lncRNA collection of illustrative plates provides guarantee.High pass simultaneously
It measures sequence to carry out the analysis of careful overall picture to the transcript profile and genome of species, so the depth that is otherwise known as
Degree sequencing (deep sequencing).The representative of high-flux sequence platform is 454 sequenator (Roch of Roche Holding Ag (Roche)
GSFLX sequencer), the Solexa genome analysis instrument (Illumina Genome Analyzer) of Illumina companies and
The SOLiD sequenators (ABI SOLiD sequencer) of ABI.
The carrier permitted in the pharmacy of the pharmaceutical composition of the present invention is the load usually utilized in preparation
Body, which includes lactose (lactose), dextrose (dextrose), sucrose (sucrose), sorbierite (sorbitol), sweet
Reveal alcohol (mannitol), starch, acacia gum, calcium phosphate, alginates (alginate), gel (gelatin), calcium silicates,
Microcrystalline cellulose, polyvinylpyrrolidone (polyvinylpyrrolidone), cellulose (cellulose), water, syrup, first
Base cellulose (methyl cellulose), methyl hydroxybenzoate (methyl hydroxybenzoate), propyl hydroxy benzene
Propyl formate (propyl hydroxybenzoate), talcum, magnesium stearate (stearic acid magnesium) and mineral
Oily (mineral oil) etc., but it is not limited to this.
The pharmaceutical composition of the present invention can also include lubricant, wetting agent, sweetener, perfume (or spice) other than mentioned component
Taste agent, emulsifier, suspending agent, preservative etc..The suitable carrier and preparation permitted in pharmacy is recorded in Lei Mingdengshi in detail
Pharmacy pandect.
The pharmaceutical composition of the present invention can by it is oral or it is non-oral be administered, when as non-oral administration, can lead to
Cross intravenous injection, intranasal injection, local injection, intraventricular injection, spinal cavity injection is subcutaneously injected, intraperitoneal injection, percutaneously
The modes such as administration are administered.
The present invention pharmaceutical composition suitable dosage according to preparation ways, administering mode, patient year
The factor of age, weight, gender, morbid state, food, administration time, administration route, drainage rate and draw property etc and can be with
Carry out a variety of prescriptions, in general, skilled practitioner can be easily determined by and prescription to it is desirable treatment or prevention effectively to
Pharmaceutical quantities.
The pharmaceutical composition of the present invention can be easy to implement according to general technical staff of the technical field of the invention
Method, carried out using receptible carrier in pharmacy and/or excipient it is formulation, so as in the form of unit dose
It prepares or interior prepares in the multicapacity container.At this point, dosage form be solution in oiliness or aqueous medium, suspension or
Emulsion form can also be either extract, powder agent, granule, tablet or capsule form, can also include dispersion
Agent or stabilizer.
Description of the drawings
Fig. 1 is LINC01094 in cerebral apoplexy group and healthy control group relative expression's situation map
Fig. 2 is JAZF1 in cerebral apoplexy group and healthy control group relative expression's situation map
Fig. 3 is each group LINC01094 relative expression's situation maps after transfection
Specific implementation mode
Present invention will be further explained below with reference to specific examples, is only used for explaining the present invention, and should not be understood as to this
The limitation of invention.It will be understood by those skilled in the art that：Without departing from the principle and spirit of the present invention may be used
To carry out a variety of change, modification, replacement and modification to these embodiments, the scope of the present invention is limited by claim and its equivalent
It is fixed.In the following examples, the experimental methods for specific conditions are not specified, usually according to normal condition or according to the item proposed by manufacturer
Part examinations.
1 high-flux sequence of embodiment and analysis
LncRNA is the non-coding RNA that a kind of length is more than 200nt, and sequencing experiment uses Illumina TruseqTM RNA
Sample prep Kit methods carry out chain specific library structure, including：
Extract total serum IgE.Total RNA are extracted from tissue sample, using Nanodrop2000 to the concentration of carried RNA and
Purity is detected, and agarose gel electrophoresis detects RNA integralities, and Agilent2100 measures RIN values.Single requirement for construction data base RNA
Total amount 5ug, concentration >=200ng/ μ L, OD260/280 is between 1.8~2.2.
Remove rRNA.A part of into the cell (>24%) long-chain non-coding RNA is all the absence of traditional pol y A tails, because
This builds library by the way of removing rRNA can obtain more comprehensive lncRNA information
Fragmentation mRNA.It, can be by mRNA random fractures at the small fragment of 200bp or so using metal ion.
Reversion synthesis cDNA.Under the action of reverse transcriptase, using random primer, one chain of synthesis is inverted by template of mRNA
When carrying out the synthesis of two chains, dTTP is replaced in dNTPs reagents with dUTP by cDNA, and it includes A/U/C/G to make base in the second chains of cDNA.
Connect adaptor.The cDNA structures of chain are cohesive end, and End Repair Mix are added and are mended into flat end,
Then an A base, the connector for connecting Y-shaped are added in 3 ' ends.
Bis- chains of UNG enzymic digestions cDNA.Before PCR amplification, the second chains of cDNA are digested with UNG enzymes, to make in library only
Including the first chains of cDNA.
Machine is sequenced on Illumina Hiseq4000.
Due to that can include that sequence measuring joints sequence, low quality read, N rates higher sequence and length are too short in raw sequencing data
Sequence, this will seriously affect the quality subsequently assembled.To ensure the accuracy of subsequent analysis of biological information, first to original survey
Ordinal number is according to being filtered, to obtain the sequencing data (clean data) of high quality to ensure being smoothed out for subsequent analysis.
Further, the high quality sequencing sequence obtained after Quality Control and specified reference gene group are compared, reference gene group
Version is GRCh38.First, TopHat using its embedded software Bowtie by high quality clean sequences map to genome, this
The sequence that Shi Suoyou participates in mapping will be divided into two groups：One group is on map to genome, another group is no map to base
Because in group.Later, TopHat assembles the sequence on these map to genome, at this moment can think that these are continuous
Sequence is one group of exon.Meanwhile TopHat can detect the sequence map on no map to genome to shearing site
Both ends.The distance between a pair of of exon that usual TopHat is detected is the distance between 70bp~20kb.If it is less than
If 70bp, tophat will be considered that the two exons may belong to the same exon, since the expression quantity of gene is relatively low,
Intermediate part does not measure, thus forms a GAP.Generally use default parameters runs software, while according to practical feelings
Condition, such as sequencing data amount, genome situation does adjustment appropriate to parameter.
Finally, it is used for carrying out expression quantity assessment and standardization using software cuffquant and cuffnorm.Cuffdiff profits
With Tophat comparisons as a result, calling Cufflinks calculates the expression quantity of each gene/transcript.Generally use default parameters
Runs software, while according to actual conditions, such as sequencing data amount, genome situation does adjustment appropriate to parameter.Significant difference
LncRNA＆mRNA screening conditions：q-value<0.0.The function of lncRNA is related to the protein coding gene of its coexpression, can be with
It is studied by the expression quantity correlation analysis or coexpression analysis method of lncRNA between sample and protein coding gene.Work as sample
Number>When=6, the correlation of lncRNA and protein coding gene between sample are analyzed using Pearson correlation coefficient method；Using
Pearson correlation coefficient method analyzes the correlation of lncRNA and protein coding gene between sample, and threshold value uses 0.9.
As a result：LINC01094 up-regulated expressions in cerebral arterial thrombosis group are notable, TESC, JAZF1, NEDD4L, EIF3B,
ANP32B, RAD23A, STRADB, BCKDK, CCNY, ASCC2, UTS2 and MMP17 gene are also apparent in cerebral arterial thrombosis group
Up-regulated expression, KIAA1324L, MIS18A, C1QTNF6, MTERF2, MAP6D1, ZNF530, DNAH1, CRACR2A, TTC22 and
MIB2 genes in cerebral arterial thrombosis group obviously lower by expression, they and LINC01094 have good correlation.It selects
JAZF1 genes carry out relevance verification.
2 large sample of embodiment verifies LINC01094 and JAZF1 genes
One, sample collection
46 patients with cerebral apoplexy and 31 healthy population controls are all from hospital's (in January, 2014 in September, -2015), extract
Their peripheral blood, 4000rpm centrifugal separation plasmas add TRIzoI reagents (l:3) and -80 DEG C are maintained at until progress RNA is carried
It takes.All subjects endorsed informed consent form.
Two, experimental method
2.1 design of primers
LINC01094 amplimers：
Sense primer：CATACCTGAGCCAACATACAAT(SEQ ID NO.1)
Downstream primer：TAACTGCCTAACTAACGATGAAG(SEQ ID NO.2)
Amplification length：150bp.
JAZF1 gene magnification primers：
Sense primer：ATTGTATTGCGGTGGTAT(SEQ ID NO.3)
Downstream primer：TGTGAGTTGATGTGTTGA(SEQ ID NO.4)
Amplification length：102bp.
2.2 RNA are extracted and reverse transcription
1) blood plasma of defrosting reagent containing TRIzoI, static 5 minutes after concussion.
2) chlorination imitates (chloroform 0.2m1), acutely concussion 30 seconds, static 15 minutes.
3) 15 minutes (12000g, 15 minutes, 4 DEG C) is centrifuged.
4) supernatant is taken, isopropanol (0.5m1) is added acutely to shake, static 10 minutes.
5) 10 minutes (12000g, 10 minutes, 4 DEG C) is centrifuged, then abandons supernatant.
6) adding 75% decontamination ethyl alcohol 1ml, (absolute ethyl alcohol is matched with the DEPC deionized waters handled, absolute ethyl alcohol：DEPC water=
3:1).It is shaken 0.5 minute with oscillator.
7) supernatant is abandoned in centrifugation 5 minutes (7500g, 4 DEG C), and back-off in just setting 5 minutes in a moment on toilet paper.
8) add 5ul DEPC-H2O palm centrifuge brief centrifugations, 60 DEG C of water-baths 10 minutes.
9) concentration is surveyed, with RNA concentration measuring instruments.
Then using using TaKaRa kits PrimeScriptTM RT reagent Kit with gDNA Eraser
(Perfect Real Time) (article No. RR047A) synthesizes the first chain cDNA to the total serum IgE reverse transcription of extraction.
The preparation of 2.3 standard DNA templates
The cDNA that reverse transcription reaction is obtained carries out Standard PCR, and reaction system and condition are as follows：10×Ex Taq
Buffer 10 μ L, dNTP Mixture (each 2.5mmol/L) 4 μ L, Sequence NO.3 (10pmol) 4 μ L, Sequence
45 μ L, Ex Taq archaeal dna polymerases of μ L, cDNA (0.1-2 μ g) of NO.4 (10pmol), 0.5 μ L, distilled water polishing to 100uL.Reaction
Condition is 94 DEG C of pre-degeneration 5min；94 DEG C of denaturation 50s, 50 DEG C of annealing 50s, 72 DEG C extend 50s, 35cycles；Last 72 DEG C are prolonged
Stretch 10min.
5 μ L are sampled, the product of PCR amplification is detected into row agarose gel electrophoresis, gel extraction is carried out and purifies (recycling
Use kit：EZ-10Spin Column DNA Gel Extraction Kit), purified product is connected to pGM-T clones
Carrier is then transformed into DH5 α competent cells.Drawn by the specificity that sequence is SEQ ID NO.3 and SEQ ID NO.4
Object screening positive clone.Plasmid DNA is extracted after positive colony amplification, Plasmid DNA uses NanoDrop ND-1000 nucleic acid quantifications
Instrument quantifies (NanoDrop Technologies, Wilmington, Delaware) and does 10 times and is serially diluted as standard items use
In the preparation of standard curve, (standard DNA template concentration range is 108-102copies/μl)。
2.4 sensitivity experiments
Recombinant plasmid is taken to be diluted to 10 in proportion8、107、106、105、104、103、102A copy/μ L carries out fluorescent quantitation
PCR, using the minimum concentration of test positive as the detection sensitivity of this method.This research institute establish method detection range be
108-102Copies/ μ L, minimum concentrations are 100copies/ μ L.
2.2 RT-PCR are tested
Using TAKARA SYBR Premix Ex TaqTM II (TIi RNaseH Plus) fluorescence quantitative kit (article No.
RR820A).50 μ L qRT-PCR reaction systems include：Sense primer (10 μm of ol/L) 2 μ L；Downstream primer (10 μm of ol/L) 2 μ L；
4 μ L of sample cDNA；50×ROX Reference Dye 1μL；2×SYBR Premex Ex TaqⅡ(TIi RNaseH
Plus) 25 μ L add ionized water to 50 μ L.Instrument uses Applied Biosystems 7300.Quantitative fluorescent PCR program：95℃
30s pre-degenerations connect 40 cycles：95 DEG C of 5s, 60 DEG C of 35s.
11.5 softwares of SPSS For Windows are used to qRT-PCR reaction results, related data using chi-square criterion and
Fisher exact propability is handled, and P ＜ 0.05 are statistically significant；QRT-PCR reactions are soft using MedCalc statistical analyses
Part calculates.
According to the relative quantification formula of qRT-PCR：2- Δ Ct × 100% compares LINC01094 and JAZF1 in ischemic
Expression in patients with cerebral apoplexy and healthy population.As a result show that qRT-PCR stable amplification results, wherein LINC01094 exist
High expression whole compared with healthy population in ischemic cerebral stroke patients group, expression quantity is about 4 times (see Fig. 1) of healthy population, JAZF1
The high expression whole compared with healthy population in ischemic cerebral stroke patients group, expression quantity is about 1.8 times (see Fig. 2) of healthy population.
Further analysis finds that the correlation coefficient r of the two is up to 0.98.
4 RNAi of embodiment inhibits LINC01094 expression
One, material
SiRNA is built and synthesis
According to LINC01094 in GenBank (NCBI Reference Sequence:NR_038303.1 sequence design in)
Corresponding siRNA.Synesis Company's synthesis is sent to after design.
The design and synthesis of siRNA：
3 RNA interference target sequences (table 1) of design, negative control is provided by company.
1 LINC01094-siRNA transcription templates sequences of table
Two, experimental method
(1) RNA perturbation techniques inhibit the expression of LINC01094 in HEK293 cells
1, cell grouping and transient transfection
(1) cell is grouped
C groups：Blank control group；C1 groups：Transfect nonspecific siRNA groups；S1, S2, S3 group：Transfection specificity
SiRNA groups.
(2) it transfects
According to LipofectamineTMThe step of 2000 Transfection Reagent are provided carries out.
1. before transfection for 24 hours, the cell pancreatin of logarithmic growth phase is digested and is counted, dense with DMEM culture mediums adjustment cell
Degree is 1 × 105/ ml takes 2m1 to be inoculated in six orifice plates, is positioned over 37 DEG C, 5%CO2It cultivates in incubator, is merged up to 80% in cell
When for transfecting.With the DMEM medium cultures 3-4h without serum before transfection.
2. preparing transfection liquid：
A liquid：250u1 serum free mediums dilute 4.0ugDNA, mild mixing；
B liquid：250u1 serum free mediums dilute 10u1Lipofectamine, and mild mixing is placed at room temperature for 5min；
3. transfecting：A liquid is mixed with B liquid, and compound is directly added in every hole by incubation at room temperature 20min, is shaken
Culture plate, gently mixing.In CO2Liquid is changed after 37 DEG C of heat preservations 24-48h, 6h in incubator, the culture medium containing serum is added.
2, using the variation of the front and back LINC01094 expression of Real-time PCR methods detection transfection
1. the structure of standard curve：1 bottle of the HEK293 cells normally cultivated in 50mI culture bottles are chosen at, RNA is extracted, are surveyed
Determine RNA concentration and purity, carry out reverse transcription reaction, ten times of dilutions of DNA profiling that reaction is generated obtain being equivalent to 104-
100The DNA profiling of copies/ul is separately added into LINC01094 primers and internal control primer, prepares 25u1 reaction systems, uses
Real-time PCR amplification instruments carry out pcr amplification reaction.Obtain the standard curve of LINC01094 and internal reference.
2. the variation of the front and back LINC01094 expression of Real-time PCR methods detection transfection：The RNA of each group cell is extracted,
RNA concentration and purity are measured, reverse transcription reaction is carried out, every group of DNA profiling is carried out at the same time the Real- of LINC01094 and internal reference
Time PCR reactions, experiment is in triplicate.
3. to PCR product into row agarose gel electrophoresis.
Three, experimental result
The standard curve of LINC01094 and internal reference are built using Real-time PCR methods, related coefficient is respectively
0.9937,0.9952, linear relationship is good, meets the requirements.Compare the table of each group LINC01094 with the method for double standard curves
It reaches.Blank control group, the expression of nonspecific transfection group gene are substantially similar, no significant difference.LINC01094-
There is the work for inhibiting LINC01094 expression after tri- groups of transfections of siRNA1, LINC01094-siRNA2, LINC01094-siRNA3
With, the effect of LINC01094-siRNA1 and LINC01094-siRNA2 become apparent from, and inhibit efficiency up to 65% and 67%, and
The inhibiting effect of LINC01094-siRNA1 is 23%, and compared with blank control group, nonspecific transfection group, difference has statistics
Meaning, P<0.05 (Fig. 3).
Invention filters out cerebral apoplexy related gene LINC01094 using high-flux sequence, and binding molecule cell biology is real
Verification, it was confirmed that LINC01094 has good correlation with cerebral apoplexy.The present invention provides newly for stroke clinical diagnosis and treatment
Target, have good potential applicability in clinical practice.
SEQUENCE LISTING
<110>The First Hospital of Medical College of Shantou University
<120>Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis
<160> 13
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213>Artificial sequence
<400> 1
catacctgag ccaacataca at 22
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence
<400> 2
taactgccta actaacgatg aag 23
<210> 3
<211> 18
<212> DNA
<213>Artificial sequence
<400> 3
attgtattgc ggtggtat 18
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence
<400> 4
tgtgagttga tgtgttga 18
<210> 5
<211> 23
<212> DNA
<213>Artificial sequence
<400> 5
ctcatcaata aaagattaaa tta 23
<210> 6
<211> 21
<212> RNA
<213>Artificial sequence
<400> 6
auuuaaucuu uuauugauga g 21
<210> 7
<211> 21
<212> RNA
<213>Artificial sequence
<400> 7
caucaauaaa agauuaaauu a 21
<210> 8
<211> 23
<212> DNA
<213>Artificial sequence
<400> 8
agcttttaaa attataaata tat 23
<210> 9
<211> 21
<212> RNA
<213>Artificial sequence
<400> 9
auauuuauaa uuuuaaaagc u 21
<210> 10
<211> 21
<212> RNA
<213>Artificial sequence
<400> 10
cuuuuaaaau uauaaauaua u 21
<210> 11
<211> 23
<212> DNA
<213>Artificial sequence
<400> 11
tggcaatagc ttttaaaatt ata 23
<210> 12
<211> 21
<212> RNA
<213>Artificial sequence
<400> 12
uaauuuuaaa agcuauugcc a 21
<210> 13
<211> 21
<212> RNA
<213>Artificial sequence
<400> 13
gcaauagcuu uuaaaauuau a 21
Claims (7)
1. a kind of application of preparation of detection LINC01094 expression in preparing diagnosing ischemia cerebral apoplexy reagent.
2. application according to claim 1, which is characterized in that diagnosing ischemia cerebral apoplexy reagent uses high-flux sequence side
LINC01094 is transcribed in method and/or quantifying PCR method and/or probing procedure detection sample.
3. application according to claim 1, which is characterized in that cerebral arterial thrombosis sample is peripheral blood.
4. application according to claim 2, which is characterized in that specific amplification LINC01094's draws in quantifying PCR method
Object sequence is SEQ ID NO.1 and SEQ ID NO.2.
5. a kind of application of preparation of detection JAZF1 expression in preparing diagnosing ischemia cerebral apoplexy reagent.
6. application according to claim 5, which is characterized in that diagnosing ischemia cerebral apoplexy reagent uses high-flux sequence side
JAZF1 is transcribed in method and/or quantifying PCR method and/or probing procedure detection sample.
7. application according to claim 6, which is characterized in that the primer sequence of specific amplification JAZF1 in quantifying PCR method
It is classified as SEQ ID NO.3 and SEQ ID NO.4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611053234.8A CN107029238B (en) | 2016-11-24 | 2016-11-24 | Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611053234.8A CN107029238B (en) | 2016-11-24 | 2016-11-24 | Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107029238A CN107029238A (en) | 2017-08-11 |
| CN107029238B true CN107029238B (en) | 2018-08-14 |
Family
ID=59530773
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611053234.8A Active CN107029238B (en) | 2016-11-24 | 2016-11-24 | Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107029238B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114886910B (en) * | 2022-06-21 | 2023-09-22 | 上海市同仁医院 | Application of LINC00938 in nerve cell apoptosis |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103874768A (en) * | 2011-05-05 | 2014-06-18 | 临床基因组学股份有限公司 | A method of diagnosing neoplasms |
| WO2016094420A1 (en) * | 2014-12-08 | 2016-06-16 | The Regents Of The University Of Michigan | Non-coding rnas and uses thereof |
-
2016
- 2016-11-24 CN CN201611053234.8A patent/CN107029238B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103874768A (en) * | 2011-05-05 | 2014-06-18 | 临床基因组学股份有限公司 | A method of diagnosing neoplasms |
| WO2016094420A1 (en) * | 2014-12-08 | 2016-06-16 | The Regents Of The University Of Michigan | Non-coding rnas and uses thereof |
Non-Patent Citations (2)
| Title |
|---|
| JAZF1 can regulate the expression of lipid metabolic genes and inhibit lipid accumulation in adipocytes;Guang-feng Ming等;《Biochemical and Biophysical Research Communications》;20140226;第445卷;第673-680页 * |
| 长链非编码RNA在神经系统疾病中的研究进展;陈瑞等;《中国临床药理学杂志》;20160131;第32卷(第1期);第91-94页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107029238A (en) | 2017-08-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6755391B2 (en) | Group classification and prognosis prediction system based on the biological characteristics of gastric cancer | |
| CN106520931B (en) | EGFR genetic mutation detection primer probe and its kit | |
| CN106434982B (en) | The relevant molecular marked compound of cerebral arterial thrombosis and its application | |
| CN104762408B (en) | Detect the kit and its detection method of EGFR genetic mutation | |
| CN103710460B (en) | Test kit of detection by quantitative EGFR genetic mutation and uses thereof | |
| CN106978497A (en) | Detection primer, probe and the detection kit of EML4 ALK fusion gene mutations | |
| CN101679971A (en) | The decision method of progression risk of glaucoma | |
| CA3023156A1 (en) | Detection of chromosome interaction relevant to breast cancer | |
| CN105567854A (en) | Primer combination for detecting human EGFR, KRAS and BRAF gene mutation and kit thereof | |
| CN109468382B (en) | Application of lncRNA in diagnosis and treatment of lung adenocarcinoma | |
| WO2014114802A1 (en) | Non-invasive prenatal genetic diagnostic methods | |
| Curti et al. | Maternal plasma mRNA species in fetal heart defects: a potential for molecular screening | |
| CN107513577A (en) | A kind of method of efficient detection EGFRT790M mutant and probe and kit for detection | |
| CN107029238B (en) | Applications of the LINC01094 in diagnosis and treatment cerebral arterial thrombosis | |
| CN104087672A (en) | Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique | |
| CN106755551A (en) | A kind of EGFR/L858R is mutated liquid biopsy kit and its application | |
| CN107988370B (en) | Application of circRNA gene in preparation of reagent for diagnosing chronic myelogenous leukemia | |
| CN110172512A (en) | A kind of application of carcinoma of endometrium biomarker in cancer diagnosis and the prediction of prognosis situation | |
| CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
| CN109652529A (en) | Osteoporosis specificity miRNA, composition and its diagnostic use | |
| CN108660211A (en) | A kind of and the relevant biomarker LINC01549 of hepatocellular carcinoma and its application | |
| CN114350812A (en) | NSCLC-free RNA-3 related to oxicetitinib drug resistance and application thereof | |
| CN107326076A (en) | A kind of scoliosis early stage auxiliary detection kit and its application | |
| CN106701761A (en) | Long-chain non-coding RNA (Ribonucleic Acid) NR-027469.1 and preparation or diagnostic reagent or medicine or kit and application | |
| CN110938680A (en) | Gene variation site detection method for simultaneously detecting DNA and RNA |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |