KR101381894B1 - Serum miRNA as a marker for the diagnosis of lymph node metastasis of gastric cancer - Google Patents

Abstract

The present invention relates to serum miRNA as a diagnostic marker for lymph node metastasis of gastric cancer, and more particularly, comprising an agent for measuring the expression level of one or more miRNAs selected from the group consisting of miR-21, miR-146a and miR-148a. Composition for diagnosing lymph node metastasis of gastric cancer; A lymph node metastasis diagnostic kit for gastric cancer comprising the composition; And measuring the expression level of one or more miRNAs in the sample of the patient suspected of lymph node metastasis of gastric cancer and comparing the expression level with the expression level of the corresponding miRNA in the normal control sample. It is about a method.

Description

Serum miRNA as a marker for the diagnosis of lymph node metastasis of gastric cancer}

The present invention relates to a method for discriminating whether lymph node metastasis of gastric cancer can be performed without surgical procedure.

Gastric cancer is the fourth most common cancer in the world and the second leading cause of cancer-related deaths. Long-term survival of early gastric cancer is improved with the development of diagnostic methods and treatments, but advanced gastric cancer still does not have high quality of life and survival. Advanced gastric cancer often metastasizes to the lymph nodes and peritoneum, which occur through the lymphatic system and blood circulation.

Gastrointestinal angiography and gastroscopy are relatively accurate and widely used methods of diagnosing gastric cancer, but only provide very limited information in determining whether the gastric cancer has been diagnosed. In addition, since the conventional techniques for determining the metastasis of gastric cancer mainly use DNA, RNA, chromosomal abnormalities, genomic changes, etc. of tissue obtained through ablation of gastric cancer, the procedure for ablation of gastric cancer should be preceded. Specificity is not satisfactory enough to be widely used in clinical treatment.

Recently, endoscopic treatment such as endoscopic mucosal detachment has been shown to be successful in the treatment of gastric cancer, and it has been applied to the treatment of early gastric cancer with laparotomy.However, the diagnosis of gastric cancer has not been determined by imaging or endoscopy. I can't. If metastasized gastric cancer is removed by endoscopic mucosal dissection, the metastasized cancer is not completely cured and thus risks recurrence. If it is possible to determine the metastasis in patients diagnosed with gastric cancer before surgery or endoscopic mucosal removal, it is useful for the selection of tumor removal method and for determining the surgical method and extent before surgery. It will help to reduce complications.

Diagnosis markers that have an excellent effect in diagnosing gastric cancer or determining metastasis through methods that do not require gastrectomy are urgently needed. However, about 60 types of tumor markers through various blood are found and commercialized (CEA, CA50, CA19-9, etc.), but most are limited to cancer marker antigens composed of proteins secreted by cancer cells, No diagnostic marker has been developed that has an excellent effect on the diagnosis or metastasis of gastric cancer.

Recently, microRNAs (miRNAs) are ones that have received much attention as markers of new cancers and diseases. miRNAs are small single-stranded non-coding RNAs consisting of 19 to 25 ribonucleic acids, a genome found in plants and in a variety of animals. miRNAs are known to regulate the expression of more than 30% protein-producing genes by interfering with the transcription process of complementary messenger RNAs (mRNAs) or by degrading mRNAs in the post-transcriptional phase. The presence of miRNAs in the blood as well as in tissues was first described in 2008 in patients with diffuse large B cell lymphoma. Therefore, miRNA research has been actively conducted in various cancers, and there has been a study on expression profiles of blood miRNAs in various cancer patients including gastric cancer.

For example, US Patent Publication No. 2008-0306006 discloses a method for diagnosing solid cancer such as gastric cancer by measuring the level of miRNA such as miR-21; An effective amount of a compound which measures the amount of miRNA, such as miR-21, in comparison with control cells, and suppresses the expression of miRNA, such as miR-21, so that tumor formation of the subject patient is suppressed when the amount exceeds that expressed in the cannon cells. Tumor suppression methods such as administering; Pharmaceutical compositions for treating solid cancers, such as gastric cancer, which contain the compound which suppresses expression of miRNA, such as miR-21, and a pharmaceutically acceptable carrier, etc. are described.

However, the use of miRNA as a diagnostic marker for lymph node metastasis of gastric cancer has not been revealed.

US Patent Publication No. 2008-0306006

It is an object of the present invention to provide a method for diagnosing lymph node metastasis of gastric cancer without surgical procedure.

The present invention is a composition for diagnosing lymph node metastasis of gastric cancer, kit for diagnosing lymph node metastasis of gastric cancer, based on a novel use of one or more miRNAs selected from the group consisting of miR-21, miR-146a and miR-148a as a diagnostic marker for lymph node metastasis of gastric cancer. An object of the present invention is to provide a method for providing information for diagnosing lymph node metastasis and a method for screening a gastric cancer lymph node metastasis blocker.

The present invention provides a composition for diagnosing lymph node metastasis of gastric cancer comprising an agent for measuring the expression level of at least one miRNA selected from the group consisting of miR-21, miR-146a and miR-148a.

The present invention provides a kit for diagnosing lymph node metastasis of gastric cancer comprising the stomach composition.

The present invention comprises the steps of measuring the expression level of one or more miRNA selected from the group consisting of miR-21, miR-146a and miR-148a of a sample of a patient suspected of lymph node metastasis of gastric cancer; And it provides a method for providing information for diagnosing lymph node metastasis of gastric cancer comprising comparing the expression level of the at least one miRNA with the expression level of the miRNA in the normal control sample.

According to the present invention it is possible to easily determine whether the lymph node metastasis of gastric cancer through a blood test without surgical procedures. To date, imaging methods cannot accurately determine lymph node metastasis, and markers included in the blood so far cannot confirm the lymph node metastasis of gastric cancer.

According to the present invention, when it is possible to provide a patient who is confirmed to have gastric cancer by an endoscope or the like to provide information on the lymph node metastasis of gastric cancer by a blood test before gastric cancer resection, the scope or method of surgery can be set more clearly. .

In addition, even in patients who have not yet been confirmed to have gastric cancer, the miRNA of the present invention may be applied before applying a therapeutic method to the patient that can be treated only for gastric cancer without metastasis, such as endoscopic mucosal resection. If the expression level is confirmed, it is expected to improve the early treatment result of gastric cancer.

Because the present invention uses blood as a sample, the sample is easier to collect than other tests performed by collecting gastric cancer tissue through invasive methods such as surgery, there is no harm to the patient, and the diagnosis result can be quickly known before the procedure. There is an advantage.

The invention may also be utilized in the method of screening lymph node metastasis blockers.

1 shows the difference in expression levels in the blood of gastric cancer group (GCPM) with lymph node metastasis (GCPM), gastric cancer group without lymph node metastasis (GCNM) and healthy (Control) miR-21, miR-146a and miR-148a.
2 is a ROC curve and AUC showing that the expression level in the blood of miR-21, miR-146a and miR-148a indicates the sensitivity and specificity of lymph node metastasis of gastric cancer.

The present invention is a composition for diagnosing lymph node metastasis of gastric cancer comprising an agent for measuring the expression level of one or more miRNA selected from the group consisting of miR-21, miR-146a and miR-148a; A lymph node metastasis diagnostic kit for gastric cancer comprising the composition; And measuring the expression level of one or more miRNAs in the sample of the patient suspected of lymph node metastasis of gastric cancer and comparing the expression level with the expression level of the corresponding miRNA in the normal control sample. It is about a method.

Hereinafter, the present invention will be described in more detail.

miR-21 is a protein that affects expression through complementary binding of genes has been found to be cancer suppressor. To date, the microRNA has been confirmed to correlate with various cancers, including breast cancer, ovarian cancer, cervical cancer, colon cancer and lung cancer.

miR-146a has been found to be mainly involved in the activity of T-type lymphocytes, and is a microRNA that is being studied because it is thought to be involved in the regulation of various autoimmune diseases and metastasis of cancer (Molecular Biology International Volume 2011 (2011), Article ID 437301, 7 pagesdoi: 10.4061 / 2011/437301).

miR-148a is known experimentally to act as an inhibitory factor in natural immunity, mainly by suppressing factors involved in natural immunity (J. Biol. Chem. 285: 19076-19084, 2010., J. Immun. 185: 7244-7251, 2010), microRNAs that have recently been shown to play an important role in suicide (see Cell Death & Differentiation 18, 1702-1710, Nov. 2011).

miR-21, miR-146a and miR-148a consist of the sequences set forth in Table 1 below.

microRNA order miR-21 UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA miR-146a CCGAUGUGUAUCCUCAGCUUUGAGAACUGAAUUCCAUGGGUUGUGUCAGUGUCAGACCUCUGAAAUUCAGUUCUUCAGCUGGGAUAUCUCUGUCAUCGU miR-148a GAGGCAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAACUUUGUCUC

The present invention is based on the finding that the expression level of miR-21, miR-146a and miR-148a in the blood is significantly reduced compared to the case where the gastric cancer has metastasized to the lymph nodes. That is, in the present invention, miR-21, miR-146a and miR-148a are used as diagnostic markers for lymph node metastasis of gastric cancer.

Accordingly, the present invention provides a composition for diagnosing lymph node metastasis of gastric cancer comprising an agent for measuring the expression level of one or more miRNAs selected from the group consisting of miR-21, miR-146a and miR-148a.

One or more miRNAs may be included in the blood of a patient suspected of having lymph node metastasis of gastric cancer.

The agent for measuring the expression level of miRNA is the expression of one or more miRNAs selected from the group consisting of miR-21, miR-146a and miR-148a, markers that decrease the expression level in samples such as blood when gastric cancer has metastasized to lymph nodes By a level is meant a molecule that can be used for detection of a marker.

The agent may be widely used in the field of bio kits, but primers or probes that specifically bind to one or more miRNAs are preferable.

The primer is a nucleic acid sequence having a short free 3 'hydroxyl group, a short nucleic acid sequence capable of forming a base pair with a complementary template and serving as a starting point for template strand copying . Primers can be used to initiate DNA synthesis in the presence of reagents and four different nucleoside triphosphates for polymerization reactions (i. E., DNA polymerase or reverse transcriptase) at appropriate buffer solutions and temperatures. In the present invention, PCR amplification using sense and antisense primers specifically binding to one or more miRNAs above can be used to diagnose the level of gastric cancer metastasis to lymph nodes. The PCR conditions, the lengths of the sense and antisense primers can be modified based on what is known in the art.

A probe is labeled with a nucleic acid fragment such as RNA or DNA corresponding to a short period of a few nucleotides or a long few tens of nucleotides. The probe may be prepared in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, or an RNA probe. In the present invention, hybridization is performed using a probe complementary to one or more of the above miRNAs to confirm the expression level, thereby diagnosing whether or not the stomach cancer is metastasized to the lymph node. Selection of suitable probes and hybridization conditions can be modified based on what is known in the art.

Such primers or probes can be appropriately designed by those skilled in the art based on the sequences of known miR-21, miR-146a and miR-148a.

For example, primers or probes can be chemically synthesized using the phosphoramidite solid support method, or other well-known methods. Such nucleic acid sequences may also be modified using many means known in the art. Non-limiting examples of such modifications include, but are not limited to, methylation, "capping ", replacement of natural nucleotides with one or more homologues, and modifications between nucleotides, such as uncharged linkers, such as methylphosphonate, Phosphoamidates, carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

Expression levels of miRNA can be measured according to methods commonly used in the field of bio kits, such as reverse transcriptase polymerase reaction (RT-PCR), competitive reverse transcriptase polymerase reaction (Competitive RT-PCR), real time reverse transcriptase polymerase. Real-time RT-PCR, RNase protection assay (RPA), Northern blotting, or gene chips, and the like.

The composition for diagnosing lymph node metastasis of gastric cancer of the present invention may include other components for making it suitable for use as a diagnostic kit for lymph node metastasis of gastric cancer in addition to the agent for measuring the expression level of one or more miRNAs.

In addition, the lymph node metastasis diagnostic kit of gastric cancer of the present invention may further comprise a configuration commonly used in the diagnostic kit in addition to the stomach composition.

For example, the diagnostic kit of the present invention may be a kit containing essential elements necessary for performing RT-PCR. In addition to each primer pair specific for the marker miRNA, the RT-PCR kit includes test tubes or other suitable containers, reaction buffers (pH and magnesium concentrations vary), deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases. Such enzymes, DNase, RNAse inhibitors, DEPC-water (DEPC-water), sterile water and the like can be included.

The diagnostic kit of the present invention may be a gene chip kit. The gene chip kit may include a substrate on which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and reagents, preparations, enzymes, and the like for producing a fluorescent-labeled probe. In addition, the substrate may contain a cDNA corresponding to a quantitative control gene or a fragment thereof.

The present invention comprises the steps of measuring the expression level of one or more miRNA selected from the group consisting of miR-21, miR-146a and miR-148a of a sample of a patient suspected of lymph node metastasis of gastric cancer; And comparing the expression level of the one or more miRNAs with the expression level of the corresponding miRNA in a normal control sample.

In this method, a sample of a patient suspected of lymph node metastasis of gastric cancer should be treated with tissue, cells, whole blood, serum, plasma, saliva, sputum, cerebrospinal fluid, or urine, in which the level of expression of one or more miRNAs differs depending on the lymph node metastasis of gastric cancer. And the like, and the like. However, it may be preferable to be blood for rapid diagnosis.

In the present invention, the step of measuring the expression level of one or more miRNA is as described above in reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real time reverse transcriptase polymerase reaction, RNase protection assay, Northern blotting or gene chip. Can be performed by

In this method, the expression level of one or more miRNAs selected from the group consisting of miR-21, miR-146a, and miR-148a in the sample of patients suspected of lymph node metastasis of gastric cancer compared to the expression level of the corresponding miRNA in the normal control sample was significant. Low measurements can provide information that gastric cancer has spread to lymph nodes.

Hereinafter, the present invention will be described in more detail with reference to examples. This embodiment is only for illustrating the present invention in more detail, it does not limit or limit the claims of the present invention.

Example

Thirty-one preoperative serum samples of gastric cancer patients stored between January and June 2011 were distributed at the National Biobank of Korea (PNUH), and serum samples were collected from 15 health volunteers.

Of the 31 gastric cancer patients, 16 selected gastric cancer with (Positive) lymph node metastasis (GCPM) and 15 selected gastric cancer without (Negative) lymph node metastasis (GCNM). Selected.

All sera were quantified for miRNA-21, 27a, 106b, 146a, 148a, 223 and 433 after centrifugation at 795G for 20 minutes at 4 ° C and additional high speed centrifugation at 15,000 G for 20 minutes. Polymerase chain reaction was performed.

All samples were extracted with total RNA using mirVana PARIS Kit, and synthetic cel-miR-39 was added before all extraction procedures for relative quantification.

To identify gastric cancer markers, relative quantitative values of miRNAs were compared between GCPM group with lymph node metastasis and GCNM group without lymph node metastasis in normal group (health volunteer group), gastric cancer group and gastric cancer group using Mann-Whitney test. For statistically significant results, Receiver-Operating Characteristic (ROC) curve was drawn and Area under a ROC Curve (AUC) was calculated.

For statistical analysis, SPSS 12.0 (SPSS Inc., Chicago, IL) and MicroSoft Excel 2010 were used. It was defined as statistically significant when the P value was <0.05.

As a result, the difference in concentrations of miR-21, miR-146a and miR148a in the blood between the group with lymph node metastasis of gastric cancer and the group without lymph node metastasis showed statistically significant difference with P value of 0.001 or less ( 1), the area under the receiver-operating characteristic curve (AUC) was 0.954 for miR-21, 0.900 for miR-146a, and 0.888 for miR-148a, indicating a very high value. 2).

Claims (8)

Composition for diagnosing lymph node metastasis of gastric cancer comprising an agent for measuring the expression level of at least one miRNA of miR-146a and miR-148a contained in the blood.
The composition of claim 1, further comprising an agent for measuring the expression level of miR-21 included in blood.
The composition of claim 1, wherein the agent comprises a primer or probe that specifically binds the one or more miRNAs.
A kit for the diagnosis of lymph node metastasis of gastric cancer comprising the composition of any one of claims 1 to 3.
The kit of claim 4, wherein the kit is an RT-PCR kit or a gene chip kit.
Measuring the expression level of at least one of miR-146a and miR-148a in a blood sample of a patient suspected of having lymph node metastasis of gastric cancer; And
Comparing the expression level of the one or more miRNAs with the expression level of the corresponding miRNA in a normal control sample
Information providing method for diagnosing lymph node metastasis of gastric cancer.
The method of claim 6, further comprising measuring the expression level of miR-21 in the measuring step.
The method of claim 6, wherein measuring the expression level of one or more miRNAs is by reverse transcriptase polymerase reaction, competitive reverse transcriptase polymerase reaction, real time reverse transcriptase polymerase reaction, RNase protection assay, Northern blotting or gene chip. How to be.

Images