KR20150028063A - Liquid Type Melting Array Using Probe Comprising Reporter and Quenching and Method for Target DNA or Mutant Detection Using Liquid Type Melting Array - Google Patents

Abstract

The present invention relates to a liquid array using a probe comprising a reporter and a quencher, and to a method for detecting a target nucleic acid or a mutant using the same, and more specifically, to a method for detecting a target nucleic acid or a mutant, which analyzes a melting profile of the target nucleic acid or the mutant by using a liquid array comprising a reporter and a quencher. According to the present invention, the method for detecting a target nucleic acid or a mutant can fix the probe on a plate, can reduce false negative and false positive signals as a washing process is omitted after hybridization of the probe and the target nucleic acid or the mutant, and can simply and effectively detect single nucleotide polymorphism of the target nucleic acid and mutation caused by loss or insertion of a base. Also, the method can diagnose infection bacteria and discriminate drug resistance bacteria, and can be widely applied to various fields for discrimination of species of an organism, forensic medicine, etc.

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention [0001] The present invention relates to a liquid type array using a probe coupled with a reporter and a quencher, and a method for detecting a target nucleic acid or a mutation using the probe.

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a liquid oarray using a probe coupled with a reporter and a quencher, and a method for detecting a target nucleic acid or a mutation using the same, and more particularly, to a probe comprising a reporter and a quencher And analyzing the melting curve of the target nucleic acid or the mutant using a liquid-phase array of the target nucleic acid or mutant.

Differences in the portion of the genomic sequence due to single nucleotide polymorphism (SNP), insertion or deletion of the base are used as important markers in interspecific, interspecific, or habitat and origin discrimination. Analysis of changes or differences in genomic sequence is important for studying biological information. In particular, it is possible to diagnose genetic diseases and make customized medicines according to genetic traits, to diagnose infectious bacteria and to identify drug resistant bacteria, and in addition, it can be widely applied in many fields such as species discrimination and forensic examination of living organisms, Since detection is very important, various detection methods for diagnosis have been reported according to the purpose of analysis or the type of gene (Taylor CF, Taylor GR. Methods Mol . Med . , 92: 9, 2004).

Representative methods for detecting such mutations include various methods such as sequencing, PCR (PCR), and microarray. Particularly, in the microarray method, a DNA chip capable of analyzing a large number of genes at the same time by attaching tens of tens to tens of thousands of very small amounts of genetic material to a solid support at a high density is attracting attention as a useful technique. Amplification has the advantage of being able to examine multiple gene mutation sites.

However, in the case of a probe combining a single fluorescence or a microarray using a target nucleic acid, a washing process to remove unbound probe or target nucleic acid must be performed after hybridization. This process requires additional time, and depending on the intensity of the washing, it greatly affects the efficiency of hybridization, and may be influenced by external factors as far as it is exposed. This can lead to false positives (false negatives) of the experimental results and remain a major controversy in diagnosis.

In addition, in the case of a microarray chip using a plurality of probes, it is difficult to make a hybridization condition every time there is a change in the probe addition or the like. In the fabrication of a microarray chip, a probe -tip, inkjet method, and electrode-using method require additional equipment, which makes it difficult for general users to easily access.

Accordingly, the present inventors have made efforts to solve the above problems. As a result, the present inventors have found that when a melting curve analysis of a target nucleic acid or a mutant is performed using a liquid type array including a reporter and a quencher-conjugated probe, And the target nucleic acid or mutant can be detected easily and effectively, and the false negative and false positive signals can be reduced by omitting the washing process after hybridization of the target nucleic acid or the mutant.

In order to achieve the above object,

A method for detecting the presence or absence of a target nucleic acid or a mutation thereof, characterized in that the melting curve of a target nucleic acid or a mutant is analyzed using a liquid array including a probe having a reporter and a quencher attached thereto to provide.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The 'target nucleic acid' of the present invention means a nucleic acid sequence to be detected, and is annealed or hybridized with a primer or a probe under hybridization, annealing or amplification conditions. The 'target nucleic acid' is not different from the term 'target nucleic acid', 'target nucleic acid sequence' or 'target sequence' as used herein, and is used in this specification.

"Hybridization" of the present invention means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur either in perfect match between two nucleic acid strands, or even in the presence of some mismatching bases. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be controlled, in particular, by temperature.

The 'mutation' of the present invention is characterized by a mutation in the nucleotide sequence of the target nucleic acid and includes not only a single nucleotide polymorphism (SNP) but also a nucleotide substitution, deletion or insertion, The probes of the present invention can be analyzed by melting curve analysis in which one to four bases of the target nucleic acid are substituted, deleted or inserted to cause mutation.

The 'probe' may be synthesized to be complementary to a target nucleic acid by selecting at least one selected from the group consisting of synthesized DNA (deoxyribonucleic acid), PNA (peptide nucleic acids) and LNA (locked nucleic acid) And a quencher fluorescent material capable of reporter and quenching the reporter fluorescence can be combined at both ends. The reporter may be selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', -tetrachloro-6-carboxy-4,7-dichlorofluorescein) And the quencher may be at least one selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2 and Dabcyl, but is not limited thereto. Preferably, Dabcyl is used .

The 'liquid-phase array' of the present invention is characterized not by immobilizing a DNA or a probe as in a conventional microarray but by dividing a reaction solution containing a probe into an array plate and then adding and analyzing each sample In the present invention, an array plate in which a reporter and a quencher-attached probe are partitioned is used.

In the present invention, the liquid-type array may be characterized in that not only a reporter and a probe with a quencher are bonded but also an exonuclease and a buffer necessary for the reaction are further added. In the present invention, The reaction solution containing the probes, exonuclease, reaction buffer, etc. was partitioned into array plates and used for target nucleic acid or mutation detection.

The 'liquid-phase array' of the present invention is characterized not by immobilizing a DNA or a probe as in a conventional microarray but by dividing a reaction solution containing a probe into an array plate and then adding and analyzing each sample In the present invention, an array plate in which a reporter and a quencher-attached probe are partitioned is used.

Specifically, the method of detecting a target nucleic acid or a mutation of the present invention comprises: (a) mixing a target nucleic acid or a mutation with a primer having a phosphate group at the 5 'end and then amplifying the target nucleic acid or mutation using asymmetric PCR; (b) adding the amplification product to a liquid-phase array containing a reporter and a quencher-coupled probe and an exonuclease to hybridize; (c) melting the hybridized product while changing the temperature to obtain a melting curve; And (d) analyzing the obtained melting curve to detect the presence or absence of a target nucleic acid or a mutation thereof. According to the number of the target nucleic acid or the mutation to be detected, the reporter labeled with the probe is detected by the target nucleic acid Alternatively, two or more target nucleic acids or mutations can be detected.

As shown in Fig. 1, a target nucleic acid or a mutant in a sample amplified by using a primer having a phosphate group at the 5'-terminal thereof is divided into an array in which a lambda exonuclease and a probe in which a reporter and a quencher are combined are distributed in each well Lt; / RTI > plate to perform a melting curve analysis. The degree of hybridization is indicated by a melting curve analysis in a real-time PCR chain, and a probe containing a reporter and a quencher is hybridized with a target nucleic acid and then a fluorescence signal is generated. As the temperature rises, the fluorescence signal is rapidly fused with the target nucleic acid at the optimal melting temperature of the probe, and the fluorescence signal is extinguished. The high-resolution fluorescence melting curve analysis (FMCA) The presence or absence of nucleic acid or mutation can be detected.

In the present invention, in step (b), a target nucleic acid or a mutation is made into a single strand using a lambda exonuclease to hybridize the amplified target nucleic acid or the mutant with the reporter-and-exonuclease-conjugated probe.

The single strand production of the target nucleic acid or mutant utilizes the 5 'phosphate-specific DNA degradation reaction of lambda exonuclease, and the amplification of the target nucleic acid or mutation in step (a) . In the present invention, a primer was prepared by binding a phosphate group to the 5 'end of a primer complementary to a target strand to which a probe was hybridized.

In the asymmetric PCR amplification method of the above step (a), PCR is performed under the condition that a primer corresponding to one side of double-stranded DNA is excessively added to amplify a single DNA chain in a large amount, If only the primer is excessively (several tens of times), one primer is consumed first, and the remaining reaction proceeds only to the excess primer, and a large amount of one DNA chain is produced. In the present invention, a primer complementary to a target strand in which a probe is hybridized is added at a ratio of 1/5 to 1/100 lower than that of a primer not complementary thereto.

A method for detecting a target nucleic acid or a mutation, which comprises analyzing a fusion curve using the liquid-phase array of the present invention, comprises the steps of immobilizing the probe in a plate form, omitting the washing step after hybridization of the probe and the target nucleic acid or mutant, The signal can be reduced, and a single base mutation of a target nucleic acid and a mutation due to deletion or insertion of a base can be detected simply and effectively (Fig. 2).

In the present invention, the probe exhibits a perfect match with the target nucleic acid sequence and exhibits the expected melting temperature (Tm) value, and mismatches with the target nucleic acid in which the base mutation is present, And has a melting temperature (Tm) value.

In an embodiment of the present invention, in order to confirm the feasibility and feasibility of the target nucleic acid or mutation detection method using the liquid-phase array method using the reporter and the quencher-conjugated probe, . As shown in Table 1, three kinds of G-protein gene sequences of Rhabdovirus Species were aligned, and a portion having a difference between the three species was made as a probe. HRV was a sequence complementary to PNA probe and IHNV was 1 , And VHSV was used as a PNA probe binding site by searching for a region having two mismatches. The primers were primers that did not bind to the 5 'end of the phosphate group and primers that did not bind to the 5' end of the probe. The probes were Texas red as the reporter and Dabcyl coupled PNA probes as the quencher.

The target nucleic acid or mutant amplified by the asymmetric PCR method is prepared by mixing a reporter and a quencher-conjugated probe and a lambda exonuclease into a liquid type array plate divided into respective compartments, The reaction is carried out for 15 minutes so that the laminar exonuclease decomposes the strand of the target nucleic acid to which the phosphate group is bonded at the 5 'end, and the hybridization of the PNA probe proceeds. Melting curve analysis was performed by increasing the melting temperature from 25 캜 to 85 캜 by 1 캜 and measuring the fluorescence. The temperature and reaction time required for the reaction were varied depending on the length of the target nucleic acid and the hybridization conditions.

As described above, the target nucleic acid as a viral gene was amplified by a general PCR method, and 5 μl of the product was added to a liquid phase array of a PNA probe and a lambda exo nuclease coupled with a reporter and a quencher to analyze the melting curve As a result, when the PNA probe and the target nucleic acid were completely matched (SEQ ID NO: 3), one base was not complementary (SEQ ID NO: 2), and two bases were not complementary (SEQ ID NO: 1) It was confirmed that the curves and the transition temperatures appear differently (Fig. 3).

That is, it was confirmed that not only the target nucleic acid detection but also the diagnosis of the infectious virus and the species discrimination were possible using the liquid type array using the reporter and the photocoagulated probe of the present invention. In addition, it was confirmed through the analysis of the melting temperature of the target nucleic acid and the PNA probe that single base mutation in the target nucleic acid and mutation due to deletion or insertion of the base can be effectively detected.

In another aspect, the invention features a method for detecting a target nucleic acid or mutation comprising a liquid array containing a probe coupled with a reporter and a quencher using the target nucleic acid or mutation detection method of the present invention, To a detection kit.

In the present invention, the kit can detect two or more target nucleic acids or mutations contained in a sample, and can be used for analyzing genotypes of mutations of resistant viruses, resistant bacteria, and the like.

The kit of the present invention can optionally include reagents necessary for conducting a target amplification PCR reaction (e. G., PCR reaction) such as a buffer, a DNA polymerase joiner and deoxyribonucleotide-5-triphosphate. Alternatively, the kit of the present invention may also comprise various polynucleotide molecules, reverse transcriptase, various buffers and reagents for inhibiting asymmetric PCR, and antibodies that inhibit DNA polymerase activity and may be analyzed by melting curve analysis using a liquid- For example, lambda exonuclease, various buffers and reagents, and microwell plates.

Also, the optimal amount of reagent used in a particular reaction in a kit can be readily determined by those skilled in the art having the teachings herein. Typically, the kit of the present invention is fabricated as a separate package or compartment comprising the aforementioned components.

By using the method for detecting a target nucleic acid or a mutation according to the present invention, it is possible to fix the probe to a plate form, or to eliminate the washing process after the hybridization process of the probe and the target nucleic acid or the mutation, thereby reducing the false negative and false positive signals, It is possible to simply and effectively detect base mutation and base mutation or mutation due to insertion. In addition, it is possible to diagnose infectious bacteria and to identify drug-resistant bacteria, and in addition, it can be widely applied in many fields such as species discrimination and forensic examination of living organisms.

Figure 1 is a schematic diagram of a liquid-phase array method using a PNA probe coupled with a reporter and a quencher.
2 is a diagram comparing a liquid type array of the present invention with a conventional microarray method.
Fig. 3 is a data showing the result of analyzing a target nucleic acid amplified in a liquid-phase array in which one PNA probe is mixed.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Liquid-based array analysis for virus species identification

1-1: Target nucleic acid Oligo surface, primer  And PNA Probe  making

In order to confirm the implementation and operability of the target nucleic acid or mutation detection method using the liquid-phase array method using the reporter and the quencher-coupled probe of the present invention, Hirame rhabdovirus (HRV) of Rhabdovirus Species ), Infectious Hematopoietic Necrosis Virus (IHNV), and Viral haemorrhagic septicaemia virus (VHSV).

In order to distinguish species from the lapdog viruses, which are infectious viruses of marine fishes, three kinds of L-dopa virus G-protein gene sequences were aligned, IHNV searches for one mismatch, and VHSV searches for two mismatches to identify PNA probe binding sites.

Genes were artificially synthesized using standard G-protein nucleotide sequences of HRV (SEQ ID NO: 3), IHNV (SEQ ID NO: 2) and VHSV (SEQ ID NO: 1) , And used as a target of the liquid type array test.

In addition, primers and probes were prepared so as to complementarily bind to target nucleic acids. PNA probes conjugated with Texas red as a reporter and Dabcyl as a quencher were used as probes. To increase the difference in the binding temperature between the PNA probe and the target nucleic acid, a portion binding to the mutated portion of the target nucleic acid was positioned in the middle of the PNA probe binding site.

The primers were synthesized by adding a phosphate group to the 5 'end of a primer complementary to a target strand to which a PNA probe was hybridized. . It was used for the specific degradation of lambda exonuclease to single strand the target nucleic acid for hybridization.

All PNA probes, primers and target nucleic acids used in the present invention were synthesized by HPLC purification method in PANAGENE, Korea. The purity of the synthesized PNA probes was confirmed by mass spectrometry, and more effective binding with the target nucleic acid The unnecessary secondary structure of the probe was avoided.

Synthetic double stranded DNA sequences and primers and PNA probe oligomer sequences Sequence (5'-3 ') SEQ ID NO: Target 1
AGTGGAATGCTTGTTCAAAGGAACCTGGTGGAAATTCCCCATCTGAGTATTGT GTTCGTCTCCAACACATCTGATC TCTCCACTAACCACATCCACACCAATCTAATTCCTTCGGATTGG TCA T TCAA T TGGAG TCTTTGGCCGTCACTATCAGGAATGGGGGTGATGGGAGGGGCCCTCCTTCTACTAGTGCTCTGCTGTTGCTGCAAGGCATCTCCTCCTATTCCGAGTTACGGGAT T CCGATGCAGCAGTTCTCCA GAAACCCGATGGTCTGA
SEQ ID NO: 1 Target 2
TGAGCATG ATGGAACCGATGAGCATCAAATC CGTACCCCATCCGAGCATCCTGGACTTCTACAATGAGACAGACGTATCTGGGATCTCCATCAGGAAATTGGACTCGTTCGACCTTCAA TCACTC C ACTGGAG TTTCTGGCCCACAATCTCCACCCTGGGTGGGGTTCCCCTGGTTCTCCTCCTTGCTGTTGCCGCGTGCTGCTGCTGGTCAGGGAGACCTCCCACTCCTTCTGCGCCGCAGAGCAT CCCCATGTATCACCTGGCAAAC CGGTCCT
SEQ ID NO: 2 Target 3
AAGGTGAGCATG ATGGACAAGATGGACATTCGCC CCGTTCCGCATCCTAGTGTCCAGATACTCTACAACGACACAGACACCGCAGACATCACAATCAGGAAGATAGACTCGTTTGATCTGCAA TCACTCAACTGGAG CTTCTGGCCATCATTGTCAGCACTGGGAGGGGTTCCAATACTCCTCGCCCTCGTATTCTTTCTGTACTGCTGCATGAACAGAAGACCCTCCATGCCTGCAGCACCCC AAGAGATCCCCATGTACCACCT CGCCAGTCGA
SEQ ID NO: 3 Primer F1 P-GTTCGTCTCCAACACATCTGATC SEQ ID NO: 3 Primer F2 P-ATGGAACCGATGAGCATCAAATC SEQ ID NO: 5 Primer F3 P-ATGGACAAGATGGACATTCGCC SEQ ID NO: 6 Primer R1 TGGAGAACTGCTGCATCGGA SEQ ID NO: 7 Primer R2 GTTTGCCAGGTGATACATGGGG SEQ ID NO: 8 Primer R3 AGGTGGTACATGGGGATCTCTT SEQ ID NO: 9 PNA probe (SSRVP02) Dabcyl-TCACTCAACTGGAG-O-K (Texas Red) SEQ ID NO: 10

In Table 1, O means linker, K means lysine, P means phosphate, and underlined letters and bold characters indicate the hybridization of the PNA probe and the primer and the mutated portion of the base it means.

1-2: Amplification of the target nucleic acid by polymerase chain reaction

Using the primers synthesized above, the target nucleic acid was amplified using a general polymerase chain reaction. The PCR conditions were as follows; 25 μl of 2x Enzynomics Hot start Taq Premix, 1 μl of a primer (10 pmole / μl) and 1 μl of a synthetic nucleic acid sample were added so that the total volume was 50 μl, and PCR was performed under the conditions shown in Table 2.

PCR reaction conditions Temperature Reaction time 94 ° C 5 minutes 1 cycle 94 ° C 20 seconds 40 cycles 58 ℃ 30 seconds 72 ℃ 30 seconds 72 ℃ 7 minutes 1 cycle

1-3: Single-stranded , PNA With probe Hybridization  And melting curve analysis

5 μl of the product amplified in 1-2 above was mixed with 1 unit of lambda exonuclease, 5 pmole of PNA probe, and Melting Array ™ Buffer (Seen Biomaterials, Korea) to prepare a well plate After dispensing, the single-stranded lambda exonuclease reaction and the hybridization of the PNA probe were performed in a real-time PCR reactor CFX96 ™ real-time system (BIO-RAD, USA) at 37 ° C. for 15 minutes The melting curves were analyzed continuously. Melting curve analysis was performed by increasing the melting temperature from 25 캜 to 85 캜 by 1 캜 and measuring the fluorescence. The stationary state was maintained for 5 seconds between each step.

As described above, the target nucleic acid as a viral gene was amplified by a general PCR method, and 5 μl of the product was added to a liquid phase array of a PNA probe and a lambda exo nuclease coupled with a reporter and a quencher to analyze the melting curve As a result, when the PNA probe and the target nucleic acid were completely matched (SEQ ID NO: 3), one base was not complementary (SEQ ID NO: 2), and two bases were not complementary (SEQ ID NO: 1) It was confirmed that the curves and the transition temperatures appear differently (Fig. 3).

That is, it was confirmed that not only the target nucleic acid detection but also the diagnosis of the infectious virus and the species discrimination were possible using the liquid type array using the reporter and the photocoagulated probe of the present invention. In addition, it was confirmed through the analysis of the melting temperature of the target nucleic acid and the PNA probe that single base mutation in the target nucleic acid and mutation due to deletion or insertion of the base can be effectively detected.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Seasunbiomaterials <120> Liquid Type Melting Array Using Probe Comprising Reporter and          Quenching and Method for Target DNA or Mutant Detection Using          Liquid Type Melting Array <130> P13-B236 <160> 10 <170> Kopatentin 2.0 <210> 1 <211> 276 <212> DNA <213> Artificial Sequence <220> <223> Hirame rhabdovirus G-protein <400> 1 agtggaatgc ttgttcaaag gaacctggtg gaaattcccc atctgagtat tgtgttcgtc 60 tccaacacat ctgatctctc cactaaccac atccacacca atctaattcc ttcggattgg 120 tcattcaatt ggagtctttg gccgtcacta tcaggaatgg gggtgatggg aggggccctc 180 cttctactag tgctctgctg ttgctgcaag gcatctcctc ctattccgag ttacgggatt 240 ccgatgcagc agttctccag aaacccgatg gtctga 276 <210> 2 <211> 276 <212> DNA <213> Artificial Sequence <220> <223> Infectious Hematopoietic Necrosis Virus G-protein <400> 2 tgagcatgat ggaaccgatg agcatcaaat ccgtacccca tccgagcatc ctggacttct 60 acaatgagac agacgtatct gggatctcca tcaggaaatt ggactcgttc gaccttcaat 120 cactccactg gagtttctgg cccacaatct ccaccctggg tggggttccc ctggttctcc 180 tccttgctgt tgccgcgtgc tgctgctggt cagggagacc tcccactcct tctgcgccgc 240 agagcatccc catgtatcac ctggcaaacc ggtcct 276 <210> 3 <211> 276 <212> DNA <213> Artificial Sequence <220> <223> Viral haemorrhagic septicaemia virus G-protein <400> 3 aaggtgagca tgatggacaa gatggacatt cgccccgttc cgcatcctag tgtccagata 60 ctctacaacg acacagacac cgcagacatc acaatcagga agatagactc gtttgatctg 120 caatcactca actggagctt ctggccatca ttgtcagcac tgggaggggt tccaatactc 180 ctcgccctcg tattctttct gtactgctgc atgaacagaa gaccctccat gcctgcagca 240 ccccaagaga tccccatgta ccacctcgcc agtcga 276 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer F1 <400> 4 gttcgtctcc aacacatctg atc 23 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer F2 <400> 5 atggaaccga tgagcatcaa atc 23 <210> 6 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer F3 <400> 6 atggacaaga tggacattcg cc 22 <210> 7 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer R1 <400> 7 tggagaactg ctgcatcgga 20 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer R2 <400> 8 gtttgccagg tgatacatgg gg 22 <210> 9 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Primer R3 <400> 9 aggtggtaca tggggatctc tt 22 <210> 10 <211> 14 <212> DNA <213> Artificial Sequence <220> <223> PNA probe <400> 10 tcactcaact ggag 14

Claims (10)

Characterized in that the melting curve of the target nucleic acid or mutant is analyzed using a liquid oarray comprising a probe coupled with a reporter and a quencher.
4. The method of claim 1 wherein the reporter is selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein) Gt; CY5 &lt; / RTI &gt; in the target nucleic acid or mutant.
The method according to claim 1, wherein the quenching is one or more selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2, and Dabcyl.
The probe according to claim 1, wherein the probe is one or more selected from the group consisting of synthesized artificial DNA (deoxyribonucleic acid), PNA (peptide nucleic acids) and LNA (locked nucleic acid). Detection method.
The method of claim 1, wherein the liquid-phase array is further supplemented with an exonuclease.
The method of claim 1, wherein the liquid-phase array is a liquid phase comprising a target nucleic acid or a mutant using an array plate selected from the group consisting of 6, 8, 12, 96 and 384 well plates A method for detecting a target nucleic acid or a mutation, characterized in that the sample is segmented.
The method according to claim 1, comprising the step of detecting a target nucleic acid or a mutation.
(a) mixing a target nucleic acid or a mutation with a phosphate-bound primer at the 5 'end and then amplifying using asymmetric PCR;
(b) adding the amplification product to a liquid-phase array containing a reporter and a quencher-coupled probe and an exonuclease to hybridize;
(c) melting the hybridized product while changing the temperature to obtain a melting curve; And
(d) analyzing the obtained melting curve to detect a target nucleic acid or a mutation thereof.
The probe according to claim 1, wherein the probe exhibits a perfect match with the target nucleic acid sequence and exhibits a predicted melting temperature (Tm) value, and mismatches with the target nucleic acid having a base mutation, (Tm) of the target nucleic acid or mutant.
The method according to claim 1, wherein two or more target nucleic acids or mutations are used and the reporter labeled on the probe is different for each target nucleic acid, thereby detecting two or more target nucleic acids or mutations.
A kit for detecting a target nucleic acid or a mutant, comprising a liquid array containing a probe combined with a reporter and a quencher using the method of any one of claims 1 to 9, .

Images