KR101644776B1 - Genetic Markers for Detection of Red Sea Bream Iridoviral(RSIV), and Method for Detection of the Causative Virus Using the Same - Google Patents

Abstract

The present invention relates to a genetic marker for detecting a red seabream iridovirus (RSIV), and to a method for detecting a causative virus by using the same. More specifically, to discriminate an RSIV and an infectious spleen and kidney necrosis virus (ISKNV) which are causative viruses, a DNA base sequence for coding a particular gene which is specific to an RSIV among an RSIV and an RSKNV is selected and amplified. Peptide nucleic acid (PNA) for specifically recognizing an amplified byproduct is blended, and a melting curve is obtained by controlling the temperature of a blended byproduct. A virus type is determined from a melting temperature or infection of the virus type of fish is detected by analyzing the obtained melting curve.

Description

Genetic Markers for Detection of Red Sea Bream Iridoviral (RSIV), and Method for Detection of the Causative Virus Using the Same}

The present invention relates to a genetic marker for detecting red sea bream iridovirus, and a method for detecting the causative virus using the same, and in more detail, red sea bream iridovirus (RSIV), which is a causative virus of red sea bream iridovirus, and infectious spleen and kidney In order to distinguish between Infectious Spleen and Kidney Necrosis Virus (ISKNV), a DNA sequence encoding a specific RSIV-specific gene among RSIV and RSKNV is selected and amplified, and then a peptide nucleic acid that specifically recognizes the amplified product. (Peptide Nucleic Acid, PNA) is hybridized, and a melting curve for each temperature is obtained by controlling the temperature of the hybridized product, and the virus type is determined from the melting temperature through the analysis of the obtained melting curve, or whether fish is infected with the virus type. It relates to a method of detecting.

Red sea bream iridoviral disease (RSIVD) is a viral disease that causes serious damage to major marine fish cultivated in Korea, and has been designated as a marine bio-infectious disease.

Various molecular diagnostic methods and kits have been developed for diagnosing fish viral diseases, and after performing a general polymerase chain reaction (PCR) method, the amplification product of the reaction is confirmed by electrophoresis, or TaqMan probe Or, a method of checking by real-time PCR using SYBR Green is mainly used.

Currently, a conventional PCR (conventional PCR) method, which is a general genetic diagnosis method, has been designated as a standard diagnostic method for legal infectious diseases. In the case of RSIV/ISKNV, a real-time PCR-based diagnostic method has not been developed, so a conventional PCR method is performed to confirm the PCR amplified product by electrophoresis, and then the World Organization for Animal Health (OIE) aquatic animal hygiene It is prescribed to perform diagnosis according to the criteria of the Aquatic Animal Health Code. For the diagnosis of RSIVD, due to the nature of these viruses, RSIV, which is a DNA virus, has the disadvantage of separating DNA from infected tissues and performing PCR. Therefore, no diagnostic method for simultaneous analysis of RSIV/ISKNV has been reported to date.

Red snapper iridovirus disease (RSIVD) is known to occur mainly in farmed red snapper, as well as an important cause of mortality in more than 30 species of marine fish. The first case of RSIVD was recorded in 1990 from farmed red snapper on Shikoku Island, Japan, and RSIVD is a major cause of mass death of red snapper fry.

Recently, in addition to RSIV as the causative virus of RSIVD, Infectious Spleen and Kidney Necrosis Virus (ISKNV) of the Iridovirus family has been identified. Therefore, RSIV and ISKNV need to be analyzed simultaneously for accurate diagnosis of RSIVD. There is. For RSIV/ISKNV diagnosis, serological diagnosis methods such as staining using tissue smear samples and IFAT using MAb are used, and for molecular diagnosis, diagnosis by performing conventional PCR using two types of primers according to OIE standards. do.

For the diagnostic PCR of RSIV/ISKNV according to the OIE standard, primer pairs, OIE protocol 1 (OIE 1), and OIE protocol 2 (OIE 4) ( Kurita et al. , 1998) are secured, and when using OIE 1, RSIV/ISKNV While all can be detected, only RSIV can be detected when OIE 4 is used. Therefore, in order to diagnose and discriminate RSIV/ISKNV, two PCR steps must be taken according to the OIE criteria.

Under this technical background, the present inventors determine whether the specific/non-specific amplification of the PCR product for identification or detection of RSIV/ISKNV or RSIV, which is the causative virus of aquatic life infectious disease, is determined without a sequencing step or before the sequencing step, and the cause As a result of earnest efforts to develop a method for detecting virus-infected individuals (e.g., fish), Red Sea Bream Iridovirus (RSIV)/Infectious Spleen and Kidney Necrosis Virus, a virus that causes fish disease. , ISKNV), or a nucleotide sequence of a specific gene that distinguishes RSIV from RSIV/RSKNV as a gene marker for viral type identification and/or detection, and using a peptide nucleic acid and a primer pair specific for the gene marker It was confirmed that there is an effect of simply, quickly and accurately discriminating the type of virus that causes fish disease by showing different fluorescence amplification and melting curves for each virus type, and the present invention was completed.

An object of the present invention is to provide a genetic marker, a primer pair, and a PNA probe for discrimination or detection of Red Sea Bream Iridovirus (RSIV).

Another object of the present invention is to provide a composition and kit for discriminating or detecting red snapper iridovirus comprising the primer pair and the PNA probe.

Another object of the present invention is to provide a method for detecting whether an individual is infected with the virus by obtaining a Tm value according to hybridization of the PNA probe in the amplified red snapper iridovirus-specific gene marker region using the primer pair. have.

In order to achieve the above object, the present invention provides a genetic marker for discrimination or detection of Red Sea Bream Iridovirus (RSIV) represented by the nucleotide sequence of SEQ ID NO: 8.

The present invention also provides a PNA probe for discrimination or detection of Red Sea Bream Iridovirus (RSIV) represented by the nucleotide sequence of SEQ ID NO: 2 complementarily binding to the genetic marker.

The present invention also provides the identification of a red sea bream iridovirus (RSIV) comprising a primer pair represented by the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 2, or It provides a composition and kit for detection.

The present invention also,

(a) extracting a target nucleic acid from the specimen;

(b) Amplify the gene marker nucleotide sequence of red snapper iridovirus contained in the target nucleic acid using a primer pair represented by the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, and SEQ ID NO: 2 to the amplified gene marker sequence fragment. Hybridizing a PNA probe represented by;

(c) obtaining a melting curve for each temperature while increasing the temperature of the product hybridized with the PNA probe in step (b); And

(d) detecting red sea bream iridovirus (RSIV) from the melting temperature through analysis of the melting curve obtained in step (c) or determining whether the virus is infected

It provides a method for discriminating or detecting red sea bream iridovirus (RSIV) comprising a.

The present invention selects a genetic marker for discrimination and/or detection of red sea bream iridovirus, red sea bream iridovirus (RSIV) and infectious spleen and kidney necrosis virus (Infectious Spleen and Kidney). Necrosis Virus, ISKNV) can be distinguished by providing a method and composition to easily, quickly and accurately discriminate and detect whether the virus is infected.

1 is a conceptual diagram showing the technical characteristics of a step of determining a virus type or obtaining an amplification curve for detecting a virus infection of an individual.
Fig. 2 is a schematic diagram showing a step of obtaining a melting curve according to hybridization of peptide nucleic acids in a method for discriminating a virus type and a method for detecting a virus infection in an individual.
3 is a gene position diagram for explaining a nucleotide sequence site included in a primer and a peptide nucleic acid in an amplification product derived by the “PCR protocol 1 (OIE 1)” method for detection according to the OIE standard of RSIV/ISKNV.
4 is a gene location diagram for explaining a nucleotide sequence region containing primers and peptide nucleic acids in an amplification product derived by the “PCR protocol 2 (OIE 4)” method for detection according to the OIE standard of RSIV
5 and 6 show amplification curves and melting curve graphs according to the RSIV/ISKNV detection method using primers and peptide nucleic acids for each virus type described in FIGS. 1 to 4.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by an expert skilled in the art to which the present invention belongs. In general, the nomenclature used in this specification is well known and commonly used in the art.

The present invention is to develop a method for discriminating RSIV/ISKNV, which is a virus that causes red snapper iridovirus disease, and detecting an individual (eg, fish) infected with the causative virus in one aspect, a marker having a specific nucleotide sequence according to the virus type And by using a primer pair for determining the virus type corresponding to the marker and a peptide nucleic acid probe (PNA probe), it was possible to detect the causative virus of aquatic life infectious disease and to determine the type of each causative virus.

In more detail, the causative virus can be discriminated/detected by type,

(1) an oligomer mixture comprising a PNA probe for RSIV/ISKNV detection capable of simultaneous detection of RSIV and ISKNV (SEQ ID NO: 1) and a primer pair (SEQ ID NO: 3 and SEQ ID NO: 4); And. or

(2) an oligomer mixture comprising a RSIV-specific detection PNA probe (SEQ ID NO: 2) and a primer pair (SEQ ID NO: 5 and SEQ ID NO: 6);

Using a composition or kit comprising a red snapper iridovirus disease causative virus could be detected and the type of each causative virus could be determined.

Accordingly, in one aspect, the present invention is for discrimination or detection of red sea bream iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), which is a virus that causes aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 7 It relates to a genetic marker.

In another aspect, the present invention relates to a genetic marker for discrimination or detection of red sea bream iridovirus (RSIV), a virus that causes aquatic organisms infectious disease, represented by the nucleotide sequence of SEQ ID NO: 8.

In another aspect, the present invention discriminates red sea bream iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), which is a virus that causes aquatic life infectious diseases represented by the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4 Or it relates to a pair of primers for detection.

In another aspect, the present invention relates to a primer pair for discrimination or detection of red sea bream iridovirus (RSIV), which is a virus that causes aquatic organisms infectious disease, represented by the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6.

In another aspect, the present invention is a PNA for discrimination or detection of red sea bream iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV), which is a virus that causes aquatic organisms infectious disease represented by the nucleotide sequence of SEQ ID NO: 1 It relates to the probe.

In another aspect, the present invention relates to a PNA probe for discrimination or detection of red sea bream iridovirus (RSIV), which is a virus that causes aquatic organisms infectious disease, represented by the nucleotide sequence of SEQ ID NO: 2.

In the PNA probe of the present invention, a reporter and a fluorescent material of a quencher capable of quenching reporter fluorescence may be combined at both ends. The reporter is FAM (6-carboxyfluorescein), Texas red, HEX (2',4',5',7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 and Cy5. It may be one or more selected from the group consisting of, and the quencher may be one or more selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2, and Dabcyl, but is not limited thereto, and preferably Dabcyl (FAM-labeled) can be used.

Peptide nucleic acid (PNA) is a similar DNA in which a nucleic acid base is linked by a peptide bond rather than a phosphate bond, and was first synthesized by Nielsen et al. in 1991. PNA is not found in nature and is artificially synthesized by chemical methods.

Peptide nucleic acid is artificially synthesized as one of gene recognition materials such as LNA (Locked Nucleic Acid) or MNA (Mopholino nucleic acid), and its basic skeleton is composed of polyamide. PNA has excellent affinity and selectivity, and has high stability against nucleases, so it is not degraded by existing restriction enzymes. In addition, thermal/chemical properties and stability are high, so storage is easy and it is not easily decomposed.

PNA forms double strands through a hybridization reaction with a natural nucleic acid having a complementary nucleotide sequence. When the length is the same, the PNA/DNA double strand is more stable than the DNA/DNA double strand, and the PNA/RNA double strand is more stable than the DNA/RNA double strand. In addition, because PNA has a high degree of unstable double-stranded due to single base mismatch, its ability to detect single nucleotide polymorphism (SNP) is superior to that of natural nucleic acids.

In addition, PNA-DNA binding power is very superior to DNA-DNA binding power, so even a nucleotide miss match differs by about 10 to 15°C. Using this difference in avidity, it is possible to detect changes in SNP (Single-nucleotide polymorphism) and In/Del nucleotides.

Although the length of the PNA nucleotide sequence according to the present invention is not particularly limited, it can be produced in a length of 12 to 18 mer to include a specific nucleotide sequence (e.g., base mutation or single nucleotide polymorphism (SNP)) according to the virus type. have. At this time, it is possible to design a PNA probe to have a desired Tm value by adjusting the length of the PNA probe, or it is also possible to adjust the Tm value by changing the base sequence even with a PNA probe of the same length. In addition, since PNA probes have higher binding power than DNA and have a higher basic Tm value, they can be designed to have a shorter length than DNA, so that even a close neighboring base mutation or SNP can be detected. According to the existing HRM (High Resolution Melt) method, the difference in Tm value is very small, about 0.5℃, requiring an additional analysis program or detailed temperature change or correction. For this reason, when two or more base mutations or SNPs appear, analysis Although this was difficult, the PNA probe according to the present invention is not affected by the sequence and SNP of the PNA probe, and thus can be conveniently analyzed.

As in the present invention, when the PNA probe includes 14 nucleotide sequences, it is preferable to have a sequence corresponding to the nucleotide mutation or SNP site of the virus at one or more positions in the middle nucleotide sequence. In addition, the PNA probe may have structural modifications by including a sequence corresponding to a virus base mutation or SNP site in the middle part of the base sequence, and through this, the melting temperature with the target nucleic acid (perfect match) ( Tm) The difference can be made even larger.

In another aspect, the present invention relates to a composition and a kit for discriminating or detecting a virus causing aquatic life infectious disease, including the primer pair and the PNA probe.

The kit of the present invention may optionally include a buffer, a DNA polymerase cofactor, and reagents necessary for carrying out a target nucleic acid amplification reaction (eg, PCR reaction) such as deoxyribonucleotide-5-triphosphate. Optionally, the kits of the present invention may also include various polynucleotide molecules, reverse transcriptases, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. In addition, in the kit, the optimal amount of the reagent to be used in a specific reaction can be easily determined by a person skilled in the art who has learned the disclosure herein. Typically, the equipment of the present invention may be manufactured in separate packaging or compartments containing the aforementioned components.

The kit may be composed of a PNA-based multiple analysis kit, capable of detecting and/or discriminating a gene sequence for distinguishing RSIV/ISKNV, and one 2x qPCR premix tube and one oligomer mixture tube (oligomer mix). tube), and the oligomer mixture may be characterized in that it comprises two or more primers selected from one TaqMan probe, a PNA probe of SEQ ID NO: 1 or SEQ ID NO: 2, and primers of SEQ ID NO: 3 to SEQ ID NO: 6. Yes (see Table 1).

Using the kit, it is possible to effectively detect a single base mutation of a target nucleic acid and a mutation due to a deletion or insertion of a base through a dissolution curve analysis by a PNA probe, and through this, it is possible to discriminate the virus species.

In another aspect of the present invention, (i) a specific gene of Red Sea Bream Iridovirus (RSIV)/Infectious Spleen and Kidney Necrosis Virus (ISKNV); Or (ii) for discrimination or detection according to a specific gene that distinguishes RSIV from RSIV/RSKNV, PCR for detection according to OIE criteria for RSIV and/or RSKNV is performed, and then the gene sequence corresponding to the PCR product is By comparative analysis, a PNA probe represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2 was prepared, and PNA in the synthesized PCR amplification product using the PNA and primers represented by the nucleotide sequence of SEQ ID NO: 3 to SEQ ID NO: 6 By checking the melting temperature (Tm) from the melting curve obtained by hybridizing the probe, it was possible to discriminate and detect RSIV and/or RSKNV.

Thus, the present invention from another point of view,

(a) extracting a target nucleic acid from the specimen;

(b) amplifying the gene marker nucleotide sequence of the aquatic organisms infectious disease causative virus contained in the target nucleic acid using a primer pair represented by the nucleotide sequence of SEQ ID NO: 3 to SEQ ID NO: 6, and sequenced in the amplified gene marker sequence fragment Hybridizing a PNA probe represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2;

(c) obtaining a melting curve for each temperature while increasing the temperature of the product hybridized with the PNA probe in step (b); And

(d) determining the virus type of the aquatic organism infectious disease causative virus from the melting temperature through the analysis of the melting curve obtained in step (c) or detecting whether the fish is infected with the virus type;

It relates to a method for discriminating or detecting a virus that causes aquatic organisms infectious disease comprising a.

In the present invention, when amplifying the gene marker nucleotide sequence using the primer pair in step (b), a TaqMan probe may be additionally included to obtain an amplification curve.

In the present invention, two or more target nucleic acids are used, and the reporter labeled on the PNA probe is different for each target nucleic acid, and the virus type of one or more aquatic organisms infectious disease-causing viruses is discriminated or detected through detection of two or more target nucleic acids. You can do it.

In the present invention, the amplification may be characterized in that it is performed by a real-time polymerase chain reaction (PCR) method.

In the present invention, the "sample sample" includes various samples, and preferably, a biosample is analyzed using the method of the present invention. More preferably, it may be a sample mixed with a virus species described in the present invention or a sample of an individual infected with the virus (eg, fish, etc.), and organisms of plant, animal, human, fungus, bacteria and virus origin. The sample can be analyzed. When analyzing a sample of mammalian or human origin, the sample may be derived from a specific tissue or organ. Representative examples of tissue include connective, skin, muscle, or nervous tissue. Representative examples of organs include eyes, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testicle, ovary, uterus, rectum, nervous system, Includes glandular and internal blood vessels. The biological sample to be analyzed includes any cells, tissues, fluids from biological sources, or any other medium that can be well analyzed by the present invention, which is human, animal, human or animal consumption. Samples obtained from foods prepared for use are included. In addition, biological samples to be analyzed include bodily fluid samples, which include blood, serum, plasma, lymph, breast milk, urine, feces, ocular fluid, saliva, semen, brain extract (e.g., brain crush), spinal fluid, appendix, spleen. And tonsil tissue extract, but is not limited thereto.

'Target nucleic acid','synthetic DNA' or'artificial oligo' of the present invention means a nucleic acid sequence (including base mutations or SNPs) to be detected or not, and'coding proteins having physiological and biochemical functions' It contains a specific site of the nucleic acid sequence of the target gene', and is annealed or hybridized with a primer or probe under conditions of hybridization, annealing or amplification.

'Hybridization' of the present invention means that complementary single-stranded nucleic acids form double-stranded nucleic acids. Hybridization can occur when the complementarity between the two nucleic acid strands is perfect match or even in the presence of some mismatched bases. The degree of complementarity required for hybridization may vary according to hybridization conditions, and in particular, may be controlled by temperature.

In the present invention, the melting curve analysis may be characterized by performing a fluorescence melting curve analysis (FMCA) method.

The PNA probe containing the reporter and quencher of the present invention generates a fluorescent signal after hybridization with the target nucleic acid, and as the temperature rises, the fluorescent signal is quenched by rapidly melting with the target nucleic acid at an appropriate melting temperature of the probe. The presence or absence of base denaturation (including base mutation or SNP) of the target nucleic acid can be detected through high-resolution melting curve analysis obtained from the fluorescence signal according to The PNA probe shows an expected melting temperature (Tm) value when it achieves a perfect match with a target nucleic acid sequence, but a melting temperature lower than expected due to incomplete hybridization with a target nucleic acid in which a base mutation exists. It is characterized by showing the (Tm) value.

The'base mutation' of the present invention is characterized in that mutation occurs in the base sequence of the target nucleic acid, and includes not only single nucleotide polymorphism (SNP), but also mutation caused by substitution, deletion or insertion of a base. , The PNA probe of the present invention can be analyzed through melting curve analysis that mutations occur due to substitution, deletion, or insertion of the SNP of the target nucleic acid or the base of the target nucleic acid.

In the PNA probe of the present invention, a reporter and a fluorescent material of a quencher capable of quenching reporter fluorescence may be combined at both ends. The reporter is FAM (6-carboxyfluorescein), Texas red, HEX (2',4',5',7',-tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 and Cy5. It may be one or more selected from the group consisting of, and the quencher may be one or more selected from the group consisting of 6-carboxytetramethyl-rhodamine (TAMRA), BHQ1, BHQ2, and Dabcyl, but is not limited thereto, and preferably Dabcyl (FAM-labeled) can be used.

The Tm value is also changed according to the difference between the nucleotide of the PNA probe and the nucleotide of the DNA complementarily bound thereto, making it easy to develop an application using this. PNA probes are analyzed using a hybridization method different from the hydrolysis method of TaqMan probes, and probes that play a similar role include molecular beacon probes and scorpion probes. There is.

For analysis of a specific base sequence (e.g., base mutation or SNP) using a PNA probe, it is sufficient to first need a probe containing base(s) that recognize a specific base sequence and a forward/reverse primer set for PCR. Do. For the PCR conditions, an existing method can be used, and a melting process is required after PCR is completed, and the Tm value is obtained by measuring the fluorescence intensity every 0.5°C increment. In particular, general real-time PCR (real-time PCR) devices are widely used and have the advantage of not requiring additional program purchases or detailed temperature changes such as HRM (high resolution melting).

The melting curve analysis of the present invention is a method of analyzing the melting temperature of a double-stranded nucleic acid formed of a target nucleic acid, DNA or RNA, and a probe. Since such a method is performed by, for example, Tm analysis or analysis of the melting curve of the double chain, it is called a melting curve analysis. A hybrid (double-stranded DNA) between the target single-stranded DNA of the detection sample and the probe is formed by using a probe that is complementary to a specific nucleotide sequence (including a base mutation or SNP) of the detection target (target). Subsequently, the hybrid formed body is subjected to a heat treatment, and dissociation (melting) of the hybrid according to the temperature increase is detected by fluctuations in signals such as absorbance. And, it is a method of determining the presence or absence of a specific nucleotide sequence by determining the Tm value based on the detection result. The Tm value is higher as the homology of the hybrid-formed body is higher, and lower as the homology is lower. For this reason, a Tm value (evaluation reference value) is obtained in advance for a hybrid formed body of a specific base sequence to be detected and a probe complementary thereto, and the Tm value (measured value) between the target single-stranded DNA of the detection sample and the probe (measured value) If the measured value is the same as the evaluation reference value, it can be determined that a specific nucleotide sequence is present in the target DNA, and if the measured value is lower than the evaluation reference value, a mismatch, that is, a mutation exists in the target DNA. You can judge that you don't.

The fluorescence melting curve analysis of the present invention is a method of analyzing a melting curve using a fluorescent material, and more specifically, the melting curve may be analyzed using a probe containing a fluorescent material. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

In the real-time PCR (Real-Time Polymerase Chain Reaction) method of the present invention, a fluorescent substance is interchelated to a double-stranded DNA chain in the PCR process, and the temperature is raised along with the amplification of the PCR product. The pattern of the melting curve, in which the amount of fluorescent substance present between the double strands of DNA is reduced by unwinding the double strands, in particular, by analyzing the temperature (Tm) at which the DNA is melting (denaturing), The presence or absence of the virus type can be detected and/or discriminated.

1 or 2 is a conceptual diagram for explaining the technical characteristics of a peptide nucleic acid for viral discrimination or detection according to an embodiment, and as shown here, a PNA probe may generate a fluorescent signal after hybridization with a target nucleic acid. As the temperature rises, the probe is rapidly melted from the target nucleic acid at an appropriate melting temperature, thereby quenching the fluorescent signal. In the present invention, it is possible to detect the presence or absence of a base mutation of a target nucleic acid through a high-resolution fluorescence melting curve analysis (FMCA) obtained from the fluorescence signal according to the temperature change. The PNA probe according to the present invention exhibits an expected melting temperature (Tm) value when it completes a perfect match with the target nucleic acid sequence, but it makes incomplete hybridization (mismatch) with the target nucleic acid in which the base mutation exists. It may be characterized by showing a low melting temperature (Tm) value.

Hereinafter, the present invention will be described in more detail through examples. These examples are for illustrative purposes only, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not construed as being limited by these examples.

Example 1: red snapper Iridovirus disease Cause of the virus Genetic markers for discrimination or detection, and specific for the virus primer And PNA Probe making

1-1: Red snapper iridovirus disease Cause virus : RSIV(Red Sea Bream Iridovirus)/ISKNV(Infectious Spleen and Kidney Necrosis Virus)

The sequence of the gene fragment synthesized by the “PCR protocol 1 (OIE 1)” method for detection of RSIV/ISKNV's OIE standard is in the nucleotide database of the National Center for Biotechnology Information (NCBI). By comparing and analyzing the registered nucleotide sequence, we tried to obtain the nucleotide sequence of each virus type.

As a result, a common nucleotide sequence of RSIV/ISKNV represented by 5'-CCATGTACAACATGCTC-3' (SEQ ID NO: 7) was obtained, and the nucleotide sequence was selected as a genetic marker for discrimination or detection of RSIV/ISKNV.

In addition, as a primer for DNA amplification of the gene marker, a pair of primers represented by SEQ ID NO: 3 and SEQ ID NO: 4 (Forward primer 1, Reverse primer 1) and PNA 1 represented by SEQ ID NO: 1 as a probe for hybridization of the gene marker Was produced.

3 is a nucleotide sequence diagram showing a part of the gene of RSIV/ISKNV, a nucleotide sequence for discrimination/detection, and an example nucleotide sequence of a PNA derived therefrom, and the corresponding nucleotide sequence of a PNA probe is indicated in blue.

1-2: Red snapper iridovirus disease Cause virus : RSIV

The sequence of the gene fragment synthesized by the “PCR protocol 2 (OIE 4)” method for the detection of RSIV/ISKNV's OIE standard is in the nucleotide database of the National Center for Biotechnology Information (NCBI). By comparing and analyzing the registered nucleotide sequence, we tried to secure the nucleotide sequence of the gene for each virus type.

As a result, a nucleotide sequence having a single nucleotide polymorphism (SNP) of RSIV capable of discriminating between RSIV and ISKNV represented by 5'-ACCAAGTTCATCATCT-3' (SEQ ID NO: 8) was obtained, and the nucleotide sequence was RSIV Was selected as a genetic marker for discrimination or detection of.

In addition, as a primer for DNA amplification of the gene marker, a pair of primers represented by SEQ ID NO: 5 and SEQ ID NO: 6 (Forward primer 2, Reverse primer 2) and PNA 2 represented by SEQ ID NO: 2 as a probe for hybridization of the gene marker Was produced.

4 is a nucleotide sequence diagram showing a part of the gene of RSIV/ISKNV, a nucleotide sequence for discrimination/detection, and an example nucleotide sequence of a PNA derived therefrom, and the corresponding nucleotide sequence of the PNA probe is indicated in blue.

In this way, the base sequence of the PNA probe and primer according to the present invention was determined, and is shown in Table 1.

division name Sequence number Sequence (5'-> 3') Transformation (fluorescence reporter) target PNA
Probe PNA 1 SEQ ID NO: 1 CCATGTACAACATGCTC TexasRed, Dabsyl RSIV, ISKNV PNA 2 SEQ ID NO:2 AGATGATGAACTTGGT Cy5, Dabsyl RSIV primer Forward primer 1 SEQ ID NO:3 CTCAAACACTCTGGCTCATC - RSIV, ISKNV Reverse primer 1 SEQ ID NO:4 GCACCAACACATCTCCTATC - RSIV, ISKNV Forward primer 2 SEQ ID NO: 5 CGGGGGCAATGACGACTACA - RSIV Reverse primer 2 SEQ ID NO: 6 CCGCCTGTGCCTTTTCTGGA - RSIV Virus marker VM 1 SEQ ID NO: 7 CCATGTACAACATGCTC - RSIV/ISKNV VM 2 SEQ ID NO: 8 ACCAAGTTCATCATCT - RSIV

TaqMan and PNA probes were prepared by combining FAM, TexasRed, and Cy5, respectively, so as not to contain the same fluorescence. Then, a PNA probe was prepared with a nucleotide sequence as shown in Table 1, a reporter, and a quencher. The PNA probe used in the present invention was designed using a PNA probe designer (Applied biosystems, USA), and the PNA probe was synthesized by HPLC purification method in Panagene (Panagene, Korea), and the purity of all synthesized probes was determined using mass spectrometry. (For more effective binding to the target nucleic acid, unnecessary secondary structures of the probe are avoided).

Example 2: Real-time for detection or detection of viruses PCR Establishment of

Using the PNA probe and primer prepared in Example 1, an amplification curve and a dissolution curve were derived for a DNA sample of a virus causing red snapper iridovirus disease, and analyzed to determine or detect the causative virus. At this time, a TaqMan probe (and a corresponding primer set) for discrimination or detection of the causative virus according to the Office of International Epizootics (OIE) standard may be used.

PCR was performed using the CFX96™ Real-Time system (BIO-RAD, USA), and all PCR conditions used asymmetric PCR to generate single-stranded target nucleic acids.

The composition of the reactants for asymmetric PCR is shown in Table 2. After making the PCR master mix, 1 μl viral DNA was added to perform real-time PCR. When trying to discriminate or detect different virus types at the same time, 1 μl of template DNA of each virus was added and then PCR was performed.

Furtherance Volume 2X qRT PCR Premix (for TaqMan) 10 μL RSIV/ISKNV Oligomer Mix 8.5 μL RSIV, ISKNV PNA probe (5 pmole) Forward primer (1 pmole) Reverse primer (10 pmole) RSIV PNA probe (5 pmole) Forward primer (20 pmole) Reverse primer (2 pmole) Template DNA - Distilled water up to 20μL

Table 3 shows the amplification conditions and hybridization reaction conditions of the reactants, and shows a process of amplifying and hybridizing a viral DNA sample, and then raising the temperature of the hybridized product. The above process was performed by Real-time PCR.

step Temperature(℃) Response time and cycle UDG incubation 50 5 min (optional) Initial denaturation 95 10 min 35-40 cycles 95 30 sec 56 60 sec (FAM, TexasRed) 74 60 sec Re-denaturation 95 5 min Probe binding 75 30 sec 55 30 sec Melting 35 to 80 Increment 1.0℃, 5 sec
(HEX, TexasRed, Cy5)

Example 3: Real-time PCR Virus identification or detection method according to the amplification curve and melting curve of

When performing real-time PCR with the discrimination or detection method according to the present invention to multiplely detect samples containing one or more viruses, as shown in Table 1, various fluorescent reporters may be combined with PNA probes and used.

For example, as shown in Table 4, the virus-specific fluorescence amplification curve is checked so that the type of virus can be determined by a fluorescent reporter (RSIV/ISKNV detection by TexasRed fluorescence).

Fluorescent reporter Virus type TexasRed RSIV/ISKNV

In addition, in the case of performing real-time PCR with the discrimination or detection method according to the present invention to discriminate RSIV and ISKNV, it is possible to create a melting temperature and fluorescence-specific score table as shown in Table 5 in advance, and use it. .

After performing the melting curve analysis as in Example 2, the derived fluorescence signal and Tm value were digitized according to the temperature when complementarity was perfect (perfect match). That is, a range of ±2°C of the perfect match temperature is made, and if the Tm value for an unknown viral DNA sample falls within the above range, the virus type can be specified and discriminated.

5 and 6 show an amplification curve obtained by applying the peptide nucleic acid of SEQ ID NO: 1 or SEQ ID NO: 2 according to the present invention to a viral DNA sample and a melting curve graph for each fluorescence. Or it has been shown to be detectable.

Fluorescent reporter Tm(℃) virus TexasRed, Cy5 64, 67 RSIV TexasRed 64 ISKNV

As described above, a specific part of the present invention has been described in detail, and for those of ordinary skill in the art, it is obvious that this specific description is only a preferred embodiment, and the scope of the present invention is not limited thereby. something to do. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> Republic of Korea (National Fisheries Research and Development Institute) <120> Genetic Markers for Detection of Red Sea Bream Iridoviral(RSIV), and Method for Detection of the Causative Virus Using the Same <130> P16-B125 <160> 8 <170> KopatentIn 2.0 <210> 1 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PNA 1 <400> 1 ccatgtacaa catgctc 17 <210> 2 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PNA 2 <400> 2 agatgatgaa cttggt 16 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer 1 <400> 3 ctcaaacact ctggctcatc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer 1 <400> 4 gcaccaacac atctcctatc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer 2 <400> 5 cgggggcaat gacgactaca 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer 2 <400> 6 ccgcctgtgc cttttctgga 20 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> VM 1 <400> 7 ccatgtacaa catgctc 17 <210> 8 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> VM 2 <400> 8 accaagttca tcatct 16

Claims (7)

A gene marker for discrimination or detection of Red Sea Bream Iridovirus (RSIV) represented by the nucleotide sequence of SEQ ID NO: 8.
A PNA probe for discrimination or detection of Red Sea Bream Iridovirus (RSIV) represented by the nucleotide sequence of SEQ ID NO: 2, which is complementary to the gene marker of claim 1.
The PNA probe according to claim 2, wherein at least one of a reporter and a small photon is bound.
A pair of primers represented by the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 2, for the identification or detection of Red Sea Bream Iridovirus (RSIV).
A pair of primers represented by the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO: 6, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 2, for identification or detection of Red Sea Bream Iridovirus (RSIV).
Identification or detection of Red Sea Bream Iridovirus (RSIV), including the following steps:
(a) extracting a target nucleic acid from a specimen sample;
(b) amplifying the genomic marker base sequence of Bacillus thuringiensis virus contained in the target nucleic acid using a primer pair represented by the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, introducing into the amplified gene marker sequence fragment SEQ ID NO: 2 &Lt; RTI ID = 0.0 &gt; a &lt; / RTI &gt; PNA probe;
(c) obtaining a temperature-dependent melting curve by increasing the temperature of the product hybridized with the PNA probe in the step (b); And
(d) detecting Red Sea Bream Iridovirus (RSIV) from the melting temperature through analysis of the melting curve obtained in the step (c), or determining whether the virus is infected or not.
[7] The method according to claim 6, wherein the amplification curve is obtained by further including a TaqMan probe when amplifying the gene marker sequence using the primer pair in step (b).

Images