KR101642783B1 - Genetic Markers for Detection of Causative Virus of Red Sea Bream Iridoviral Disease(RSIVD), and Method for Detection of Causative Virus Using the Same - Google Patents

Abstract

The present invention relates to a gene marker for detecting a red sea bream iridoviral disease (RSIVD) causative virus which is a causative virus of fishery organism infectious diseases, and to a method for detecting a causative virus by using the same. More specifically, the present invention relates to a method for determining a virus type from a dissolving temperature or detecting infection of the virus type of fish by analyzing a dissolving curve, wherein the dissolving curve is obtained for each temperature by adjusting a temperature of a product obtained by blending peptide nucleic acid (PNA) which specifically recognizes an amplified product obtained by selecting and amplifying a DNA base sequence for coding a particular gene of an RSIV and an infectious spleen and kidney necrosis virus (ISKNV).

Description

BACKGROUND OF THE INVENTION 1. Field of the Invention The present invention relates to a genetic marker for detecting viruses caused by viruses,

The present invention relates to a genetic marker for detecting a virus caused by a red sea bream virus (RSIV) / infectious spleen, and more particularly, And a DNA nucleotide sequence encoding a specific gene of the kidney necrosis virus (ISKNV) are selected and amplified, followed by hybridization with a peptide nucleic acid (PNA) that specifically recognizes the amplification product The present invention relates to a method for determining a virus type from a fusion temperature or a method for detecting the infection of a fish with the virus type through analysis of the obtained melting curve by obtaining a temperature-dependent melting curve through temperature control of the hybridized product.

Red sea bream iridoviral disease (RSIVD) is a viral disease that causes severe damage to major marine fish farming in Korea and is designated as a marine life-threatening disease.

A variety of molecular diagnostic methods and kits have been developed as diagnostic methods for fish virus diseases. After performing the general polymerase chain reaction (PCR) method, amplification products of the reaction can be confirmed by electrophoresis or TaqMan probe Or real-time PCR method using SYBR Green.

Currently, the conventional PCR (conventional PCR) method, which is a general gene diagnosis method, is designated as a standard diagnostic method for a legal infectious disease. In the case of RSIV / ISKNV, real-time PCR-based diagnosis was not developed and PCR amplification products were confirmed by electrophoresis using conventional PCR method. Then, aquatic animal health (OIE) of World Organization for Animal Health It is stipulated to conduct the diagnosis according to the criteria of the Aquatic Animal Health Code. In order to diagnose RSIVD, RSIV, a DNA virus, has a disadvantage in that DNA must be isolated from an infected tissue and PCR must be performed. Therefore, the diagnostic method for simultaneously analyzing RSIV / ISKNV has not been reported so far.

Red sea bream virus (RSIVD) is a major cause of mortality in over 30 species of marine aquaculture, and it is known to occur mainly in sea anemones and thrips. The first case of RSIVD was recorded in 1990 in Shikoku Island, Japan, and RSIVD is the main cause of mass mortality in the red sea bream.

Since the infectious spleen and kidney necrosis virus (ISKNV) of the Iridovirus family have been identified in addition to RSIV as a causative agent of RSIVD, it is necessary to analyze RSIV and ISKNV simultaneously for accurate diagnosis of RSIVD . For RSIV / ISKNV diagnosis, serologic diagnosis methods such as tissue smear samples and IFAT using MAb are used. For molecular diagnosis, conventional PCR method using two kinds of primers according to OIE standard do.

OIE protocol 1 (OIE 1) and OIE protocol 2 (OIE 4) ( Kurita et al. , 1998) are secured in the case of PCR for the diagnosis of RSIV / ISKNV according to the OIE standard. In the case of OIE 1, RSIV / ISKNV While it can detect only RSIV when OIE 4 is used. Therefore, for the diagnosis and discrimination of RSIV / ISKNV, two PCR steps should be carried out according to the OIE standard.

Under such technical background, the inventors of the present invention have found that a fish disease virus can be identified without sequencing step or sequencing step, whether specific or non-specific amplification of a PCR product for discrimination or detection of RSIV / ISKNV or RSIV which is a causative virus of a marine life infectious disease, As a result of intensive efforts to develop a method for detecting a virus-infected entity (for example, fish), the inventors of the present invention have found that the viruses such as Red Sea Bream Iridovirus (RSIV) / Infectious Spleen and Kidney Necrosis Virus , ISKNV), or a specific gene which discriminates RSIV from RSIV / RSKNV is selected as a genetic marker for virus type discrimination and / or detection, and a specific peptide nucleic acid and a primer pair Different types of viruses exhibit different fluorescence amplification and melting curves By confirming that this is effect that can be determined accurately and rapidly and simply the type of fish diseases causing virus, and have completed the present invention.

It is an object of the present invention to provide a genetic marker, a primer pair and a PNA probe for discrimination or detection of a virus caused by a red sea bream virus, which is a virus that causes a marine life infectious disease.

It is another object of the present invention to provide a composition and a kit for identifying or detecting a virus caused by red sea bream virus comprising the primer pair and the PNA probe.

It is still another object of the present invention to provide a method for determining the type of a causative virus by determining a Tm value according to the hybridization of the PNA probe in a virus-specific gene marker region that is amplified using the primer pair, And a method for detecting the presence or absence of a virus infection.

In order to achieve the above object, the present invention provides a method for identifying or detecting a red sea bream iridovirus (RSIV) or an infectious spleen and kidney necrosis virus (ISKNV), which is a virus of aquatic lifeblood transmission system represented by the nucleotide sequence of SEQ ID NO: Lt; / RTI > gene marker.

The present invention also provides a gene marker for discrimination or detection of Red Sea Bream Iridovirus (RSIV), which is a virus of aquatic life-threatening disease, represented by the nucleotide sequence of SEQ ID NO: 8.

The present invention also provides a method for identifying or detecting a red sea bream iridovirus (RSIV) or an infectious spleen and kidney necrosis virus (ISKNV), which is a virus of aquatic life communicable disease sequence represented by the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: Provide a pair of primers.

The present invention also provides a pair of primers for discrimination or detection of Red Sea Bream Iridovirus (RSIV), which is a virus that is a pathogen of aquatic lifeblood, represented by the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6.

The present invention also provides a PNA probe for discrimination or detection of infectious spleen and kidney necrosis virus (ISKNV), Red Sea Bream Iridovirus (RSIV), which is a virus of aquatic life-threatening disease represented by the nucleotide sequence of SEQ ID NO: 1 do.

The present invention also provides a PNA probe for discrimination or detection of Red Sea Bream Iridovirus (RSIV), which is a virus of aquatic life pathogenicity disease represented by the nucleotide sequence of SEQ ID NO: 2.

The present invention also provides compositions and kits for the identification or detection of said primer pair and viruses which are aquatic life-threatening disease virus including said PNA probes.

The present invention also relates to

(a) extracting a target nucleic acid from a specimen sample;

(b) amplifying a genomic marker sequence of a virus that is a causative agent of aquatic life-threatening disease contained in the target nucleic acid using the primer pair, and hybridizing the amplified gene marker sequence fragment with the PNA probe;

(c) obtaining a temperature-dependent melting curve by increasing the temperature of the product hybridized with the PNA probe in the step (b); And

(d) analyzing the melting curve obtained in the step (c) to determine the virus type of the virus causing the aquatic organism infectious disease from the melting temperature or detecting the infection of the fish with the virus type;

A method for distinguishing or detecting a virus which is a causal organism of a marine life-threatening infectious disease.

The present invention provides a method for identifying and / or detecting a virus responsible for the red mite mycorrhizal virus disease, comprising the steps of: (i) selecting a red sea bream iridovirus (RSIV) / infectious spleen and kidney necrosis virus , ISKNV); Or (ii) expressing different fluorescence amplification and melting curves for each virus type using a peptide nucleic acid and a primer pair specific to a specific gene marker which distinguishes RSIV from RSIV / RSKNV. Thus, And it is possible to detect the infection of the fish with the virus.

1 is a conceptual diagram showing technical features of a step of obtaining a amplification curve for discrimination of a virus type or virus infection detection of an individual.
2 is a schematic diagram showing a step of obtaining a fusion curve according to hybridization of a peptide nucleic acid in a virus type discriminating method and a virus infection detecting method of an individual.
FIG. 3 is a gene locus for explaining the nucleotide sequence region of the primer and the peptide nucleic acid in the amplification product derived by the "PCR protocol 1 (OIE 1)" method for detection according to the OIE standard of RSIV / ISKNV.
Fig. 4 is a gene position map for explaining the nucleotide sequence region containing the primer and the peptide nucleic acid in the amplification product derived by the "PCR protocol 2 (OIE 4)" method for detection according to the OIE standard of RSIV
FIGS. 5 and 6 show amplification curves and melting curve graphs according to the RSIV / ISKNV detection method using the primers and peptide nucleic acids according to the virus types shown in FIGS. 1 to 4.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In general, the nomenclature used herein is well known and commonly used in the art.

The present invention relates to a method for detecting RSIV / ISKNV, which is a virus caused by red sea bream virus, in an embodiment of the present invention, and a method for detecting an infected individual (for example, fish) And a pair of primers for discriminating virus types corresponding to the markers and a peptide nucleic acid probe (PNA probe) were used to detect the causative virus of aquatic life communicable diseases and to identify the type of each causative virus.

More specifically, it is possible to identify / detect the cause virus by type,

(1) an oligomer mixture comprising a PNA probe (SEQ ID NO: 1) and a primer pair (SEQ ID NO: 3 and SEQ ID NO: 4) for RSIV / ISKNV detection capable of simultaneous detection of RSIV and ISKNV; And

(2) an oligomer mixture comprising a detection PNA probe specific for RSIV (SEQ ID NO: 2) and a primer pair (SEQ ID NO: 5 and SEQ ID NO: 6);

Were used to detect the virus causing the red sea bream virus and to identify the type of each causative virus.

Accordingly, in one aspect, the present invention provides a method for identifying or detecting a red sea bream iridovirus (RSIV) or an infectious spleen and kidney necrosis virus (ISKNV), which is a virus of aquatic life-threatening disease represented by the nucleotide sequence of SEQ ID NO: Gene markers.

In another aspect, the present invention relates to a gene marker for discrimination or detection of Red Sea Bream Iridovirus (RSIV), which is a virus that is a pathogen of aquatic life-threatening disease represented by the nucleotide sequence of SEQ ID NO:

In another aspect, the present invention provides a method for identifying a red sea bream iridovirus (RSIV) or an infectious spleen and kidney necrosis virus (ISKNV), which is a virus of aquatic life-threatening disease represented by the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: Or a primer pair for detection.

In another aspect, the present invention relates to a pair of primers for discrimination or detection of Red Sea Bream Iridovirus (RSIV), which is a virus of aquatic life-threatening diseases represented by the nucleotide sequences of SEQ ID NO: 5 and SEQ ID NO:

In another aspect, the present invention provides a method for identifying or detecting a PNA (Red Sea Bream Iridovirus (RSIV) or an infectious spleen and kidney necrosis virus (ISKNV), which is a virus of aquatic life-threatening disease represented by the nucleotide sequence of SEQ ID NO: Probe.

In another aspect, the present invention relates to a PNA probe for discrimination or detection of Red Sea Bream Iridovirus (RSIV), which is a virus of aquatic life communicable disease indicated by the nucleotide sequence of SEQ ID NO: 2.

The PNA probe of the present invention can bind a quencher fluorescent material capable of quenching reporter and reporter fluorescence at both ends. The reporter may be selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 and Cy5 And the quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2, and Dabcyl, but is not limited thereto. Preferably, the quencher is Dabcyl (FAM-labeled) can be used.

Peptide nucleic acid (PNA) was first synthesized by Nielsen et al. In 1991 as a pseudo-DNA in which the nucleic acid base was linked by a peptide bond rather than a phosphate bond. PNAs are synthesized by artificial chemical methods, not found in nature.

The peptide nucleic acid is artificially synthesized as a gene recognition substance such as LNA (Locked nucleic acid) or MNA (Mopholino nucleic acid), and the basic skeleton is composed of polyamide. PNA has very good affinity and selectivity and is highly stable against nucleic acid degrading enzymes and thus is not degraded into existing restriction enzymes. In addition, it has the advantage of being easy to store and not to be easily decomposed because of high thermal / chemical property and stability.

PNAs form double strands through hybridization reactions with natural nucleic acids of complementary base sequences. When the length is the same, the PNA / DNA double strand is more stable than the DNA / DNA double strand, and the PNA / RNA double strand is more stable than the DNA / RNA double strand. In addition, PNA is more resistant to double stranding due to single base mismatch, and therefore has the ability to detect single nucleotide polymorphism (SNP) better than natural nucleic acid

In addition, the PNA-DNA binding power is superior to the DNA-DNA binding force, resulting in a nucleotide miss match of about 10 to 15 ° C. Using this difference in binding force, it is possible to detect SNP (Single-nucleotide polymorphism) and nucleotide change of In / Del.

Although the length of the PNA nucleotide sequence according to the present invention is not particularly limited, the length of the PNA nucleotide sequence according to the present invention may be 12 to 18 mers in length so as to include a specific nucleotide sequence (for example, a base mutation or single nucleotide polymorphism (SNP) have. At this time, it is possible to design the PNA probe to have the desired Tm value by adjusting the length of the PNA probe, or to adjust the Tm value by changing the base sequence of the PNA probe of the same length. In addition, since PNA probes have higher binding strength than DNA and have a higher basic Tm value, they can be designed to have a shorter length than DNA, so that neighboring base mutations or SNPs can be detected. According to the existing HRM (High Resolution Melt) method, the difference in Tm value is very low at about 0.5 ° C, requiring additional analysis program or fine temperature change or correction. Therefore, when two or more base mutations or SNPs appear, analysis However, the PNA probe according to the present invention is not affected by the sequence and the SNP of the PNA probe, and thus can be easily analyzed.

As in the present invention, when the PNA probe comprises 14 nucleotide sequences, it is preferable that the nucleotide sequence has a sequence corresponding to the base mutation or SNP site of the virus at one or more positions in the middle nucleotide sequence. In addition, the PNA probe may have a structural modification including a base mutation of the virus or a sequence corresponding to the SNP site in the middle of the base sequence, and thereby the fusion temperature with a perfect match (hybridization) Tm) can be further increased.

In another aspect, the present invention relates to a composition and a kit for identifying or detecting the primer pair, and a virus that is a causative agent of aquatic life-threatening disease comprising the PNA probe.

The kit of the present invention may optionally comprise reagents necessary for carrying out a target nucleic acid amplification reaction (e. G., PCR reaction) such as a buffer, a DNA polymerase joiner and deoxyribonucleotide-5-triphosphate. Alternatively, the kit of the present invention may also include various polynucleotide molecules, reverse transcriptase, various buffers and reagents, and antibodies that inhibit DNA polymerase activity. In addition, the kit may be readily determined by those skilled in the art having the teachings of the present disclosure to determine the optimal amount of reagent used in a particular reaction. Typically, the equipment of the present invention may be fabricated as a separate package or compartment comprising the aforementioned components.

The kit may comprise a PNA-based multiple assay kit capable of detecting and / or discriminating the RSIV / ISKNV discriminative gene sequences and may comprise one 2x qPCR premix tube and one oligomer mix wherein the oligomer mixture comprises one TaqMan probe, a PNA probe of SEQ ID NO: 1 or SEQ ID NO: 2, and a primer selected from two or more primers of SEQ ID NO: 3 to SEQ ID NO: 6 (See Table 1).

Using the kit, a single base mutation of a target nucleic acid and a mutation due to a deletion or insertion of a base can be effectively detected through a dissolution curve analysis by a PNA probe, and the species of virus can be discriminated through this.

In another aspect, the present invention relates to a method for the detection of (i) a specific gene of Red Sea Bream Iridovirus (RSIV) / infectious spleen and kidney necrosis virus (ISKNV); Or (ii) PCR for detection according to the OIE standard with respect to RSIV and / or RSKNV for discrimination or detection according to a specific gene which distinguishes RSIV from RSIV / RSKNV, and then, a gene sequence corresponding to the PCR product The PCR amplification product synthesized using the PNA and the primers represented by the nucleotide sequences of SEQ ID NOS: 3 to 6 was subjected to PNA RSIV and / or RSKNV were identified and detected by confirming the melting temperature (Tm) from the melting curve obtained by hybridizing the probe.

Thus, the present invention, in another aspect,

(a) extracting a target nucleic acid from a specimen sample;

(b) amplifying the genomic marker base sequence of the virus of aquatic life-threatening diseases contained in the target nucleic acid using a primer pair represented by the nucleotide sequence of SEQ ID NO: 3 to SEQ ID NO: 6, Hybridizing a PNA probe represented by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2;

(c) obtaining a temperature-dependent melting curve by increasing the temperature of the product hybridized with the PNA probe in the step (b); And

(d) analyzing the melting curve obtained in the step (c) to determine the virus type of the virus causing the aquatic organism infectious disease from the melting temperature or detecting the infection of the fish with the virus type;

To a method for identifying or detecting a virus that is a causative agent of a marine life-threatening infectious disease.

In the present invention, the amplification curve may be obtained by further including a TaqMan probe when amplifying the gene marker sequence using the primer pair in step (b).

In the present invention, it is characterized in that two or more target nucleic acids are used and the reporter labeled with the PNA probe is different for each target nucleic acid, thereby detecting or detecting the virus type of the virus, which is one or more than one kind of aquatic life- .

In the present invention, the amplification may be performed using a Real-Time Polymerase Chain Reaction (PCR) method.

In the present invention, a "specimen sample" includes various specimens, and preferably a biosample is analyzed using the method of the present invention. More preferably, it may be a sample mixed with the virus species described in the present invention or a sample of an individual (for example, fish, etc.) infected with the virus, and may be a sample of plants, animals, humans, fungi, bacteria, Samples can be analyzed. When analyzing a sample of mammalian or human origin, the sample may be from a particular tissue or organ. Representative examples of tissues include binding, skin, muscle or nervous tissue. Representative examples of organs include, but are not limited to, eyes, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gallbladder, stomach, small intestine, testes, Line and inner blood vessels. The biological sample to be analyzed includes any cells, tissues, fluids from the biological source, or any other medium that can be well analyzed by the present invention, including human, animal, human or animal Lt; RTI ID = 0.0 > a < / RTI > In addition, the biological sample to be analyzed includes a body fluid sample, which may be a blood sample, serum, plasma, lymph, milk, urine, feces, eye milk, saliva, semen, brain extract And tonsil tissue extracts.

The term "target nucleic acid", "synthetic DNA" or "synthetic synthetic oligo" of the present invention refers to a nucleic acid sequence (including a base mutation or a SNP) to be detected, and includes a nucleotide sequence encoding a protein having a physiological / biochemical function, Specific region of the nucleic acid sequence of the target gene, and is annealed or hybridized with the primer or probe under hybridization, annealing or amplification conditions.

"Hybridization" of the present invention means that complementary single-stranded nucleic acids form a double-stranded nucleic acid. Hybridization can occur either in perfect match between two nucleic acid strands, or even in the presence of some mismatching bases. The degree of complementarity required for hybridization can vary depending on the hybridization conditions, and can be controlled, in particular, by temperature.

In the present invention, the melting curve analysis may be performed by the FMCA (Fluorescence Melting Curve Analysis) method.

The PNA probe comprising the reporter and the quencher of the present invention hybridizes with the target nucleic acid and generates a fluorescence signal. As the temperature rises, the fluorescence signal is rapidly extinguished with the target nucleic acid at the optimal melting temperature of the probe, (Base mutation or SNP) of the target nucleic acid can be detected through analysis of the high-resolution fusion curve obtained from the fluorescence signal according to the fluorescence signal. The PNA probe exhibits a predicted melting temperature (Tm) value in the case of a perfect match with the target nucleic acid sequence, but incompletely hybridizes with the target nucleic acid in which the base mutation is present, (Tm) value.

The 'base mutation' of the present invention is characterized by a mutation in the base sequence of the target nucleic acid, which includes not only single nucleotide polymorphism (SNP) but also mutation of base, substitution, deletion or insertion , The PNA probe of the present invention can be analyzed by melting curve analysis that the SNP of the target nucleic acid or the base of the target nucleic acid has been substituted, deleted or inserted so that the mutation occurs.

The PNA probe of the present invention can bind a quencher fluorescent material capable of quenching reporter and reporter fluorescence at both ends. The reporter may be selected from the group consisting of 6-carboxyfluorescein, Texas red, HEX (2 ', 4', 5 ', 7', - tetrachloro-6-carboxy-4,7-dichlorofluorescein), JOE, Cy3 and Cy5 And the quencher may be one or more selected from the group consisting of TAMRA (6-carboxytetramethyl-rhodamine), BHQ1, BHQ2, and Dabcyl, but is not limited thereto. Preferably, the quencher is Dabcyl (FAM-labeled) can be used.

The Tm value changes depending on the nucleotide of the DNA complementary to the nucleotide of the PNA probe, and it is easy to develop an application using the same. PNA probes are analyzed using a hybridization method different from the hydrolysis method of TaqMan probes. Molecular beacon probes, scorpion probes, .

In order to analyze a specific base sequence (for example, base mutation or SNP) using a PNA probe, it is sufficient that a probe including a base (s) recognizing a specific base sequence and a forward / reverse primer set for PCR are sufficient Do. The PCR can be performed using conventional methods. After the PCR is completed, a melting process is required. The intensity of fluorescence is measured every 0.5 ° C to obtain a Tm value. Particularly, general real-time PCR (real-time PCR) apparatuses are widely used and advantageous in that they do not require additional program purchase such as HRM (High Resolution Melting) or detailed temperature change.

The fusion curve analysis of the present invention is a method of analyzing the melting temperature of a double-stranded nucleic acid formed from DNA or RNA as a target nucleic acid and a probe. Such a method is called a fusion curve analysis because it is performed, for example, by Tm analysis or analysis of the melting curve of the double chain. Hybrid (double-stranded DNA) of the target single-stranded DNA of the detection sample and the probe is formed using a probe complementary to a specific base sequence (including base mutation or SNP) of the detection target (target). Subsequently, the hybrid formed body is subjected to a heat treatment, and dissociation (melting) of the hybrid due to temperature rise is detected by fluctuation of signals such as absorbance. Then, the Tm value is determined based on the detection result to determine the presence or absence of the specific base sequence. The Tm value is higher as the homology of the hybrid construct is higher, and lower as the homology is lower. For this reason, a Tm value (evaluation reference value) is previously obtained for a hybrid formed product of a specific base sequence to be detected and a probe complementary thereto, and the Tm value (measured value) between the target single- If the measured value is equal to the evaluation reference value, it can be determined that a specific base sequence exists in the match, that is, the target DNA. If the measured value is lower than the evaluation reference value, mismatch, that is, It can be judged that it does not.

The fluorescence melting curve analysis of the present invention is a method of analyzing a melting curve using a fluorescent substance, and more specifically, a melting curve can be analyzed using a probe containing a fluorescent substance. The fluorescent material may be a reporter and a quencher, and may be an intercalating fluorescent material.

The real-time polymerase chain reaction (PCR) method of the present invention allows a fluorescent substance to be interchelated in a double strand DNA chain in a PCR process, amplifies the PCR product, By analyzing the pattern of the melting curve, especially the temperature (Tm) at which the DNA is melted (denatured), the specific nucleotide sequence (including base mutations, SNPs) The virus type can be detected and / or discriminated.

FIG. 1 or FIG. 2 is a conceptual diagram for explaining technical characteristics of a peptide nucleic acid for virus identification or detection according to an embodiment. As shown therein, a PNA probe can generate a fluorescent signal after hybridization with a target nucleic acid As the temperature rises, it rapidly fuses from the target nucleic acid at the optimal melting temperature of the probe to quench the fluorescence signal. The present invention is capable of detecting the presence or absence of base mutation of a target nucleic acid through a fluorescence melting curve analysis (FMCA) obtained from the fluorescence signal according to the temperature change at a high resolution. The PNA probe according to the present invention exhibits a predicted melting temperature (Tm) value in the case of perfect match with the target nucleic acid sequence, but incompletely hybridizes with the target nucleic acid in which the base mutation is present, And has a low melting temperature (Tm) value.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these examples are for illustrative purposes only and that the scope of the present invention is not construed as being limited by these examples.

Example  1: red sea bream Here too viral disease Cause of the virus  A gene marker for discrimination or detection, and a gene marker specific for the virus primer  And PNA Probe  making

1-1: red sea bream virus disease Causative virus : RSIV (Red Sea Bream Iridovirus) / ISKNV (Infectious Spleen and Kidney Necrosis Virus)

The sequence of the gene fragment synthesized by the "PCR protocol 1 (OIE 1)" method for the detection of the OIE standard of RSIV / ISKNV was determined at the nucleotide database (DB) of the National Center for Biotechnology Information (NCBI) The nucleotide sequences of the viruses were compared with the registered nucleotide sequences.

As a result, a common nucleotide sequence of RSIV / ISKNV represented by 5'-CCATGTACAACATGCTC-3 '(SEQ ID NO: 7) was obtained and the nucleotide sequence was selected as a genetic marker for discrimination or detection of RSIV / ISKNV.

The primer pairs (Forward primer 1, Reverse primer 1) shown in SEQ ID NO: 3 and SEQ ID NO: 4 and the PNA 1 shown in SEQ ID NO: 1 were used as probes for hybridization of the gene markers, Respectively.

FIG. 3 is a nucleotide sequence diagram showing a part of the gene of RSIV / ISKNV, a nucleotide sequence for discrimination / detection and a nucleotide sequence of PNA derived therefrom, and the nucleotide sequence corresponding to the PNA probe is shown in blue.

1-2: Snapper yirido virus disease Cause virus : RSIV

The sequence of the gene fragment synthesized by the "PCR protocol 2 (OIE 4)" method for the detection of the OIE standard of RSIV / ISKNV was determined in the nucleotide database (DB) of the National Center for Biotechnology Information (NCBI) The nucleotide sequences of the viruses were compared with the registered nucleotide sequences.

As a result, a nucleotide sequence having single nucleotide polymorphism (SNP) of RSIV capable of discriminating between RSIV and ISKNV represented by 5'-ACCAAGTTCATCATCT-3 '(SEQ ID NO: 8) was obtained, As a genetic marker for discrimination or detection.

In addition, a primer pair (Forward primer 2, Reverse primer 2) shown in SEQ ID NO: 5 and SEQ ID NO: 6 as a primer for DNA amplification of the gene marker and PNA 2 shown in SEQ ID NO: 2 as a probe for hybridization of the gene marker Respectively.

FIG. 4 is a nucleotide sequence diagram showing a part of the gene of RSIV / ISKNV, a nucleotide sequence for discrimination / detection and an example of a base sequence of PNA derived therefrom, and the corresponding base sequence of the PNA probe is shown in blue.

Thus, the PNA probes and primer base sequences according to the present invention were determined and shown in Table 1.

division name SEQ ID NO: Sequences (5 '-> 3') Deformation (Fluorescent Reporter) target PNA
Probe PNA 1 SEQ ID NO: 1 CCATGTACAACATGCTC TexasRed, Dabsyl RSIV, ISKNV PNA 2 SEQ ID NO: 2 AGATGATGAACTTGGT Cy5, Dabsyl RSIV primer Forward primer 1 SEQ ID NO: 3 CTCAAACACTCTGGCTCATC - RSIV, ISKNV Reverse primer 1 SEQ ID NO: 4 GCACCAACACATCTCCTATC - RSIV, ISKNV Forward primer 2 SEQ ID NO: 5 CGGGGGCAATGACGACTACA - RSIV Reverse primer 2 SEQ ID NO: 6 CCGCCTGTGCCTTTTCTGGA - RSIV Virus marker VM 1 SEQ ID NO: 7 CCATGTACAACATGCTC - RSIV / ISKNV VM 2 SEQ ID NO: 8 ACCAAGTTCATCATCT - RSIV

TaqMan and PNA probes were prepared by combining FAM, TexasRed, and Cy5, respectively, so as not to include the same fluorescence. Then, PNA probes were prepared with the nucleotide sequences shown in Table 1, reporter and quencher. The PNA probe used in the present invention was designed using a PNA probe designer (Applied biosystems, USA), and the PNA probe was synthesized by HPLC purification method from Panagene (South Korea). The purity of all synthesized probes was determined by mass spectrometry (To avoid unnecessary secondary structure of the probe for more effective binding with the target nucleic acid).

Example  2: Real-Time for virus detection or detection PCR Establishment of

Using the PNA probes and primers prepared in Example 1, amplification curves and dissolution curves were obtained for DNA samples of viruses responsible for red spot iridovirus, and the viruses were identified or detected by analysis. At this time, a TaqMan probe (and its corresponding primer set) for discrimination or detection of the causative virus according to the Office of International Epizootics (OIE) standard can be used.

PCR was performed using a CFX96 ™ Real-Time system (BIO-RAD, USA). All PCR conditions used asymmetric PCR to generate a single-stranded target nucleic acid.

The composition of the reactants for asymmetric PCR is shown in Table 2. PCR master mix was performed and 1 μl of viral DNA was added to perform real-time PCR. When different virus types were to be discriminated or detected at the same time, 1 μl of template DNA of each virus was participated and PCR was performed.

Furtherance Volume 2X qRT PCR Premix (for TaqMan) 10 μL RSIV / ISKNV Oligomer Mix 8.5 μL RSIV, ISKNV PNA probe (5 pmoles) Forward primer (1 pmole) Reverse primer (10 pmoles) RSIV PNA probe (5 pmoles) Forward primer (20 pmoles) Reverse primer (2 pmoles) Template DNA - Distilled water up to 20μL

Table 3 shows the amplification conditions and the hybridization reaction conditions of the reactants, and shows a process of amplifying and hybridizing the viral DNA sample and then raising the temperature of the hybridized product. The above procedure was performed by real-time PCR.

step Temperature (℃) Reaction time and cycle UDG incubation 50 5 min (optional) Initial denaturation 95 10 min 35-40 cycles 95 30 sec 56 60 sec (FAM, TexasRed) 74 60 sec Re-denaturation 95 5 min Probe binding 75 30 sec 55 30 sec Melting 35 to 80 Increment 1.0 ℃, 5 sec
(HEX, TexasRed, Cy5)

Example  3: Real-time PCR Of the virus according to the amplification curve and the melting curve of the virus

When real-time PCR is performed as a discrimination or detection method according to the present invention to detect multiple samples containing one or more viruses, various fluorescent reporters as shown in Table 1 can be used in combination with PNA probes.

For example, as shown in Table 4, a virus-specific fluorescence amplification curve is identified (RSIV / ISKNV detection with TexasRed fluorescence) to identify the virus species with a fluorescent reporter.

Fluorescent reporter Virus Type TexasRed RSIV / ISKNV

When real-time PCR is performed by the discrimination or detection method according to the present invention to discriminate between RSIV and ISKNV, it is possible to prepare a score table for each of the fusion temperature and fluorescence as shown in Table 5 and utilize it .

Melting curve analysis was performed as in Example 2 and the derived fluorescence signal and Tm values were digitized to match the perfect match temperature. That is, the range of ± 2 ° C of the perfect match temperature is made, and if the Tm value of the unknown viral DNA sample falls within the above range, the virus type can be identified and identified.

5 and 6 are graphs showing the amplification curve and the fluorescence curve of each fluorescence obtained by applying the peptide nucleic acid of SEQ ID NO: 1 or SEQ ID NO: 2 according to the present invention to a virus DNA sample. Or detection was possible.

Fluorescent reporter Tm (占 폚) virus TexasRed, Cy5 64, 67 RSIV TexasRed 64 ISKNV

 While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

<110> Republic of Korea (National Fisheries Research and Development Institute) <120> Genetic Markers for Discrimination and Detection of Causative          Virus of Red Sea Bream Iridoviral Disease (RSIVD), and Method of          Discrimination and Detection of Causative Virus Using the Same <130> P15-B342 <160> 8 <170> Kopatentin 2.0 <210> 1 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> PNA 1 <400> 1 ccatgtacaa catgctc 17 <210> 2 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> PNA 2 <400> 2 agatgatgaa cttggt 16 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer 1 <400> 3 ctcaaacact ctggctcatc 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer 1 <400> 4 gcaccaacac atctcctatc 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer 2 <400> 5 cgggggcaat gacgactaca 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer 2 <400> 6 ccgcctgtgc cttttctgga 20 <210> 7 <211> 17 <212> DNA <213> Artificial Sequence <220> <223> VM 1 <400> 7 ccatgtacaa catgctc 17 <210> 8 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> VM 2 <400> 8 accaagttca tcatct 16

Claims (13)

A gene marker for the detection of viruses caused by the red sea bream virus virus, which is represented by the nucleotide sequence of SEQ ID NO: 7.
The method according to claim 1, wherein the virus caused by red sea bream virus is Red Sea Bream Iridovirus (RSIV); Or an infectious spleen and kidney necrosis virus (ISKNV).
delete delete A PNA probe for detecting a virus caused by a red sea bream virus, which is represented by the nucleotide sequence of SEQ ID NO: 1.
6. The PNA probe according to claim 5, wherein at least one of a reporter and a small photon is bound.
The PNA probe according to claim 5 or 6, wherein the virus caused by red sea bream virus is Red Sea Bream Iridovirus (RSIV) or infectious spleen and kidney necrosis virus (ISKNV).
delete A pair of primers represented by the nucleotide sequences of SEQ ID NOS: 3 and 4, and a PNA probe represented by the nucleotide sequence of SEQ ID NO: 1.
A kit for detecting viruses caused by red sea bream virus comprising a pair of primers represented by the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4, and a PNA probe represented by the nucleotide sequence of SEQ ID NO:
Detection of viruses that cause viral pathogens, including the following steps:
(a) extracting a target nucleic acid from a specimen sample;
(b) amplifying the genomic marker nucleotide sequence of the virus caused by red sea bream virus virus contained in the target nucleic acid by using a primer pair represented by the nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, Hybridizing the PNA probe represented by SEQ ID NO: 1;
(c) obtaining a temperature-dependent melting curve by increasing the temperature of the product hybridized with the PNA probe in the step (b); And
(d) analyzing the melting curve obtained in the step (c) to detect the infection of the virus caused by the red mite iridotomy virus from the melting temperature.
The method according to claim 11, wherein the amplification curve is obtained by further including a TaqMan probe when amplifying the gene marker sequence using the primer pair in step (b).
delete

Images