CN115785235B

CN115785235B - Vip3Aa truncated protein variant and vector and application thereof

Info

Publication number: CN115785235B
Application number: CN202211137697.8A
Authority: CN
Inventors: 吕玉平; 邸萌亮; 王建海; 李晓娇; 王强; 杨蒙迪; 李涛; 陈梅桂; 林黎彦
Original assignee: Longping Biotechnology Hainan Co ltd
Current assignee: Longping Biotechnology Hainan Co ltd
Priority date: 2022-09-19
Filing date: 2022-09-19
Publication date: 2023-11-17
Anticipated expiration: 2042-09-19
Also published as: CN115785235A

Abstract

The application discloses a Vip3Aa truncated protein variant, and a vector and application thereof. Wherein the amino acid sequence of the protein is SEQ ID NO. 1 or SEQ ID NO. 2. The insect-resistant protein provided by the application has good resistance to various lepidoptera pests such as Oriental armyworms, cutworm, prodenia litura, cotton bollworms, spodoptera frugiperda, asparagus caterpillar and the like, and especially greatly improves the resistance to cutworm.

Description

Vip3Aa truncated protein variant and vector and application thereof

Technical Field

The application relates to the technical field of molecular biology, in particular to a Vip3Aa truncated protein variant, a carrier and application thereof.

Background

At present, biotic stress (such as diseases, insect pests and the like) and abiotic stress (such as drought damage, cold damage, salt damage and the like) facing agricultural production cause weakening of crop growth vigor, reduce yield and pose a great threat to global grain safety. Among these, insect pests are one of the major biotic stress factors affecting agriculture and forestry productivity. As environmental problems caused by pest control using chemical pesticides become more serious, the use of biopesticides is gradually coming into the field of view of people.

Bacillus thuringiensis (Bacillus thuringiensis, bt for short) is a gram-positive bacterium capable of producing different types of insecticidal proteins, such as insecticidal crystal proteins (Insecticidal crystal proteins, ICPs) and vegetative insecticidal proteins (Vegetative insecticidal proteins, vips). Vip toxins are divided into four subfamilies, vip1, vip2, vip3 and Vip4, respectively. Among them, vip3A is a specific protein produced by bacillus cereus. Vip3A protein is taken up by insects into the midgut and the toxin is solubilized in the alkaline environment of the insect midgut. The N-and C-terminal of the protein are digested by alkaline protease, protoxin is converted into active fragment, the active fragment is combined with receptor on the upper surface of insect midgut epithelial cell membrane, and inserted into intestinal membrane, so that the cell membrane has perforation focus, osmotic pressure change and pH balance inside and outside the cell membrane are destroyed, the digestion process of the insect is disturbed, and the death of the insect is finally caused. Because Vip3A protein shows strong resistance to lepidoptera pests (cutworm, spodoptera frugiperda, corn noctuid, etc.), it has been successfully transferred into crops such as corn, soybean, cotton, tobacco, etc., and these high-efficiency multivalent insect-resistant transgenic crops not only broaden the insect-resistant spectrum, but also delay the generation of insect resistance.

In chinese patent CN201610080690.5, there is provided an improvement of resistance to armyworms and asparagus caterpillar by modification of the Vip3A encoding gene. However, the above prior art solutions do not have resistance to lepidopteran pests such as cutworms. Therefore, rational modification of the gene is required to further improve resistance to lepidopteran pests.

Disclosure of Invention

Aiming at the technical problems, the application provides a Vip3Aa truncated protein variant, a carrier and application thereof. In particular, in one aspect, the application provides a protein for plant insect resistance, which is characterized in that the amino acid sequence of the protein is SEQ ID NO. 1 or SEQ ID NO. 2. The insect-resistant protein provided by the application has good resistance to various lepidoptera pests such as Oriental armyworms, cutworm, prodenia litura, cotton bollworms, spodoptera frugiperda, asparagus caterpillar and the like, and especially greatly improves the resistance to cutworm.

The application also discloses an insect-resistant gene, which is characterized by comprising a gene sequence for encoding the protein. Optionally, the nucleotide sequence of the insect-resistant gene is SEQ ID NO. 4 or SEQ ID NO. 5.

The application further provides an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the insect-resistant gene.

In another aspect, the present application provides an expression vector, which is characterized in that the expression vector comprises the insect-resistant gene.

According to one embodiment of the present application, the expression vector comprises the following gene structures in order: the above insect-resistant gene; terminator (Nos) of nopaline synthase; corn ubiquitin gene promoter (Ubi); a phosphinothricin acetyl transferase gene (PAT); a terminator of cauliflower mosaic virus (CaMV).

The application also provides application of the protein for plant insect resistance, or the insect resistance gene, or an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic cell line containing the insect resistance gene in plant insect resistance, wherein the application is as follows: a) Preparing a medicament with an insect-resistant effect; and/or b) growing transgenic plants having or having increased pest resistance.

According to one embodiment of the application, the pest controlled in the application is selected from one or more of Oriental armyworm, cutworm, spodoptera litura, heliothis armyworm, spodoptera frugiperda and Spodoptera exigua. Preferably, the pest controlled in the application is a cutworm, and the application is to increase resistance to the cutworm.

The present application also provides a method of growing plants having or having increased pest resistance, the method comprising the steps of: and introducing the insect-resistant gene into a receptor plant to obtain a transgenic plant.

According to one embodiment of the application, the plant is selected from monocotyledonous plants, or dicotyledonous plants; corn is preferred.

The application has the beneficial effects that:

the insecticidal protein has wide insecticidal spectrum and improved insecticidal activity, has good resistance to various lepidoptera pests such as Oriental armyworms, cutworm, spodoptera litura, cotton bollworms, spodoptera frugiperda, beet armyworms and the like, and particularly greatly improves the resistance to the cutworm.

Drawings

The accompanying drawings, which are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification, illustrate embodiments of the application and together with the description serve to explain the application and do not constitute a limitation on the application. In the drawings:

FIG. 1 is a flow chart showing construction of a recombinant cloning vector LP10-T containing the nucleotide sequence of Vip3Aa-d1 for the pest control method of the present application;

FIG. 2 is a flow chart showing construction of a recombinant cloning vector LP11-T containing the nucleotide sequence of Vip3Aa-d2 for the pest control method of the present application;

FIG. 3 is a flow chart showing construction of a recombinant expression vector LP-PT10 containing Vip3Aa-d1 nucleotide sequence for controlling pests according to the present application;

FIG. 4 is a flow chart showing construction of a recombinant expression vector LP-PT11 containing Vip3Aa-d2 nucleotide sequence for controlling pests according to the present application;

FIG. 5 is a diagram of a cutworm transformed by the pest control method of the present application, wherein WT is a wild-type plant, vip3Aa20 is transformed with an unmodified Vip3Aa transformation event, vip3Aa-d1 is transformed with a modified Vip3Aa transformation event, and Vip3Aa-d2 is transformed with a modified Vip3Aa transformation event.

Detailed Description

The following description of the embodiments of the present application will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present application, but not all embodiments. The following description of at least one exemplary embodiment is merely exemplary in nature and is in no way intended to limit the application, its application, or uses. All other embodiments, which can be made by those skilled in the art based on the embodiments of the application without making any inventive effort, are intended to be within the scope of the application.

It should be noted that, as referred to throughout the specification and claims, the terms "include" and "comprising" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description hereinafter sets forth a preferred embodiment for practicing the application, but is not intended to limit the scope of the application, as the description proceeds with reference to the general principles of the description. The scope of the application is defined by the appended claims.

Example 1Vip3Aa-d1AndVip3Aa-d2gene acquisition and Synthesis

1. Obtaining Vip3Aa-d1 and Vip3Aa-d2 nucleotide sequences

Amino acid sequences (778 and 771 amino acids) of the Vip3Aa-d1 and Vip3Aa-d2 insecticidal proteins are shown as SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence table; the nucleotide sequences of Vip3Aa-d1 and Vip3Aa-d2 (2337 and 2316 nucleotides) which encode the amino acid sequences corresponding to the Vip3Aa-d1 and Vip3Aa-d2 insecticidal proteins are shown in SEQ ID NO:4 and ID NO:5 of the sequence Listing.

The amino acid sequence (789 amino acids) of the Vip3Aa20 insecticidal protein is shown as SEQ ID NO. 3 in a sequence table; the nucleotide sequence (2370 nucleotides) of Vip3Aa20, which codes for the amino acid sequence (789 amino acids) of the insecticidal protein Vip3Aa20, is shown as SEQ ID NO:6 in the sequence Listing.

2. Synthesis of the above-mentioned Vip3Aa-d1 and Vip3Aa-d2 nucleotide sequences

The nucleotide sequences of Vip3Aa-d1 and Vip3Aa-d2 (shown as SEQ ID NO:4 and SEQ ID NO:5 in the sequence table) and the nucleotide sequence of Vip3Aa20 (shown as SEQ ID NO:6 in the sequence table) are synthesized by Nanjin Jinsi Biotech company; the 5 'end of the synthesized Vip3Aa-d1 and Vip3Aa-d2 nucleotide sequences (SEQ ID NO:4 and SEQ ID NO: 5) is connected with an NcoI cleavage site, and the 3' end is connected with an EcoRI cleavage site; the 5 'end of the synthesized Vip3Aa20 nucleotide sequence (SEQ ID NO: 6) is connected with an NcoI restriction enzyme site, and the 3' end is also connected with an EcoRI restriction enzyme site.

EXAMPLE 2 vector construction

1. Construction of cloning vectors

The synthesized nucleotide sequences of Vip3Aa-d1 and Vip3Aa-d2 were respectively ligated into cloning vector pEASY-T5 (Transgen, beijin, china, CAT: CT 501-01), and the procedures were carried out according to the specification of the vector pEASY-T5 from the company of Transgen, to obtain recombinant cloning vectors LP10-T and LP11-T, the construction procedures of which are shown in FIG. 1 and FIG. 2 (wherein Kan represents kanamycin resistance gene; amp represents ampicillin resistance gene; pUC origin represents the replication region sequence of plasmid pUC, which can induce the double-stranded DNA replication process; lacZ is LacZ initiation codon; vip3Aa-d1 and Vip3Aa-d2 nucleotide sequences of Vip3Aa-d1 and Vip3Aa-d2 (SEQ ID NO:4 and SEQ ID NO: 5)).

The recombinant cloning vectors LP10-T and LP11-T were then transformed into competent E.coli T1 cells by heat shock (Transgen, beijin, china; cat. No. CD 501), respectively. The conversion process is as follows: 50. mu.l of transformed E.coli T1 competent cells and 10. Mu.l of cell plasmid DNA (recombinant cloning vectors LP10-T and LP 11-T) were mixed, then water-bath was carried out at 42℃for 30 s,37℃for 45 min, shaking 1 h on a 200 rpm shaker after transformation, and then plated on LB plates (tryptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, agar 15 g/L, pH adjusted to 7.5) containing ampicillin (100 mg/L) and grown overnight with NaOH. White colonies were picked and cultured overnight on a shaker in LB liquid medium (tryptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, ampicillin 100 mg/L, pH adjusted to 7.5 with NaOH) at 37 ℃. The plasmid is extracted by an alkaline method, and the specific steps are as follows: the bacterial solution was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the precipitated bacterial cells were suspended with 100. Mu.l of solution I (25 mM Tris-HCl,10 mM EDTA (ethylenediamine tetraacetic acid), 50 mM glucose, pH adjusted to 8.0) pre-chilled with ice; 150 μl of freshly prepared solution II (0.2M NaOH,1% SDS (sodium dodecyl sulfate)) was added, the centrifuge tube was inverted 4 times up and down, mixed, and placed on ice for 3-5 min; adding 150 μl ice-cold solution III (4M potassium acetate, 2M acetic acid), immediately mixing, and standing on ice for 5-10 min; centrifuging at 12000 rpm at 4deg.C for 5 min, adding 2 times volume of absolute ethanol into the supernatant, mixing, and standing at room temperature for 5 min; centrifuging at 12000 rpm for 5 min at 4deg.C, removing supernatant, washing the precipitate with 70% ethanol, and air drying; the precipitate was dissolved by adding 30. Mu.l of TE (10 mM Tris-HCl,1 mM EDTA,PH adjusted to 8.0) containing RNase (20. Mu.g/ml) for washing; 37. digesting RNA in water bath at the temperature of 30 min; finally, the mixture is stored in a refrigerator at the temperature of minus 20 ℃ for standby.

After the extracted plasmid is subjected to NcoI and EcoRI digestion identification, positive clones are subjected to sequencing verification, and the result shows that the nucleotide sequences of the Vip3Aa-d1 and Vip3Aa-d2 inserted in the recombinant cloning vectors LP10-T and LP11-T are the nucleotide sequences shown as SEQ ID NO. 4 and SEQ ID NO. 5 in a sequence table, namely, the nucleotide sequences of the Vip3Aa-d1 and Vip3Aa-d2 are correctly inserted.

According to the method for constructing the recombinant cloning vectors LP10-T and LP11-T, the synthesized nucleotide sequence of Vip3Aa20 is connected to a cloning vector pEASY-T5 to obtain recombinant cloning vectors LP10CK-T and LP11CK-T, wherein the nucleotide sequence of Vip3Aa20 is the nucleotide sequence of Vip3Aa (SEQ ID NO: 6). Cleavage and sequencing confirmed that the Vip3Aa nucleotide sequences in recombinant cloning vectors LP10CK-T and LP11CK-T were inserted correctly.

2. Construction of the inclusionVip3Aa-d1AndVip3Aa-d2recombinant expression vector for gene

Recombinant cloning vectors LP10-T and LP11-T and expression vector LP-BB1 (vector backbone: pCAMBIA3301 (supplied by CAMBIA mechanism)) were digested with restriction endonucleases NcoI and EcoRI, respectively, and the cut-out nucleotide sequence fragments of Vip3Aa-d1 and Vip3Aa-d2 were inserted between the NcoI and EcoRI sites of expression vector LP-BB1 to construct recombinant expression vectors LP-PT10 and LP-PT11, the construction procedures of which are shown in FIGS. 3 and 4 (Kan: kanamycin gene; RB: right border; vip3Aa-d1 and Vip3Aa-d2: vip3Aa-d1 and Vip3Aa-d2 nucleotide sequences (SEQ ID NO:4 and SEQ ID NO: 5)), the terminator of the NOs: nopaline synthase (SEQ ID NO: 7), the promoter of the maize ubitin gene (SEQ ID NO: 8), the PAT silk fibroin acetyl transferase gene (SEQ ID NO: 9), and the left-side mosaic virus (SEQ ID NO: 35) from the left-side of the cauliflower mosaic virus (SEQ ID NO: 35).

The recombinant expression vectors LP-PT10 and LP-PT11 are transformed into competent cells of the escherichia coli T1 by a heat shock method. The conversion process is as follows: 50. mu.l of cell E.coli T1 competent cells and 10. Mu.l of cell plasmid DNA (recombinant cloning vectors LP10-T and LP 11-T) were mixed, then subjected to a water bath at 42℃for 30 s and 37℃for 45 min, after transformation, were shaken on a 200 rpm shaker for 1 h, and then coated on LB plates (tryptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, agar 15 g/L, pH adjusted to 7.5) containing ampicillin (100 mg/L) and grown overnight with NaOH. White colonies were picked and grown overnight on a shaker at 37℃in LB liquid medium (tryptone 10 g/L, yeast extract 5 g/L, naCl 10 g/L, kanamycin 50mg/L, pH 7.5 with NaOH). Extracting the plasmid by alkali method, and extracting method is the same as above. The extracted plasmid is identified after restriction enzyme NcoI and EcoRI are used for enzyme digestion, and positive clones are sequenced, so that the result shows that the nucleotide sequences of the recombinant expression vectors LP-PT10 and LP-PT11 between the NcoI and EcoRI sites are the nucleotide sequences shown in SEQ ID NO. 4 and SEQ ID NO. 5 in a sequence table, namely the nucleotide sequences of Vip3Aa-d1 and Vip3Aa-d2.

Recombinant expression vectors LP-PT10CK and LP-PT11CK were constructed according to the methods described above for constructing recombinant expression vectors LP-PT10 and LP-PT 11.

Example 3 recombinant expression vector transformation of Agrobacterium and detection

Recombinant expression vector for transforming agrobacterium

The recombinant expression vectors LP-PT10, LP-PT11, LP-PT10CK and LP-PT11CK which are constructed correctly are transformed into agrobacterium LBA4404 (Invitrogen, chicago, USA; cat. No. 18313-015) by a liquid nitrogen method, and the transformation conditions are as follows: 100. mu.l of Agrobacterium LBA4404 and 3. Mu.l of plasmid DNA (recombinant expression vector) were frozen in liquid nitrogen for 10 min, and water-bath at 37℃for 10 min; the transformed agrobacterium LBA4404 is inoculated in a centrifuge tube filled with LB liquid culture medium, cultured on a shaking table at 28 ℃ and 200 rpm for 2 h, coated on LB solid culture medium containing 50mg/L Rifampicin (Rifampicin) and 50mg/L Kanamycin (Kanamycin) until positive monoclonal is grown, the monoclonal culture is selected and plasmids thereof are extracted, restriction enzymes NotI and SalI are used for carrying out enzyme digestion verification on recombinant expression vectors LP-PT10, LP-PT11, LP-PT10CK and LP-PT11CK, and the result shows that the structures of the recombinant expression vectors LP-PT10, LP-PT11, LP-PT10CK and LP-PT11CK are completely correct.

The specific steps of the transformation are as follows:

1. preparation of maize young embryo

The maize inbred line AX808 inside the company is planted in a field or a greenhouse, and the maize 8-10 days (summer)/10-13 days (autumn) after artificial pollination is taken as a young embryo source.

2. Preparation of Agrobacterium

(1) Streaking transformed and identified agrobacterium glycerinogenes on a YEP solid medium containing 100 mg/L kan and 12 mg/L tet, and performing dark culture at 28 ℃ for 2-3 days;

(2) Adding 1 ml of infection culture medium into a sterilized 2 ml centrifuge tube, putting the agrobacterium of the step 1 into the infection culture medium, and fully blowing and uniformly mixing by using a pipetting gun;

(3) Another sterilized 2 ml centrifuge tube is used to adjust the concentration of bacteria liquid by using an infection culture medium to make OD ₆₆₀ Reaching 0.5 to 0.7.

3. Co-culture of maize young embryo and agrobacterium

(1) Removing the infection culture medium in the centrifuge tube for filling the young embryo, and adding 1.5. 1.5 ml fresh infection culture medium to clean the embryo once;

(2) Removing the infection culture medium, and adding the prepared agrobacterium tumefaciens bacteria solution;

(3) Placing in a shaking table at maximum rotation speed for shaking 30 s, and placing at room temperature for 5 min;

(4) Pouring the embryo onto a co-culture medium, and sucking the liquid;

(5) Placing the embryo with the plane upward and the shield downward;

(6) The embryos are dark cultured for 2-3 days at 22 ℃.

4. Callus induction and screening

(1) Transferring the co-cultured embryo onto an induction callus culture medium, and performing dark culture in a 28 ℃ incubator for 7-10 days;

(2) Transferring the induced callus to a screening culture medium for screening culture, wherein the screening pressure is 5.0 mM glyphosate, and the callus is subjected to dark culture at 28 ℃ for 2-3 weeks;

(3) The surviving calli from the first screening were taken for the second screening, with a screening pressure of 2.0 mM glyphosate.

5. Regeneration and cultivation of transformant lines

(1) Placing the embryogenic callus which grows after screening on a pre-differentiation culture medium, and culturing in dark at 28 ℃ for 10-14 days;

(2) Taking embryogenic callus onto a differentiation medium, and culturing at 28 ℃ for 10-14 days until seedlings are differentiated;

(3) Transferring the differentiated seedlings to a rooting culture medium, and performing light culture at 28 ℃ until the roots are completely developed;

(4) Transplanting the seedlings with good growth vigor into a greenhouse matrix for growth.

And (5) seed collection is carried out after the transgenic plants bloom and fruit. Sowing the harvested seeds in a greenhouse, and carrying out expression analysis and detection by adopting a PCR technology when the plants grow to 4-6 leaf periods.

Detection of transgenic maize

1. Transfer was verified by conventional PCR using the full gold company 2 formula EasyTaq PCR SuperMix (China, beijin, cat: AS 111-11)Vip3Aa20、Vip3Aa-d1AndVip3Aa-d2maize plants of the genes.

The primers used for PCR detection are:

F：gatccagtacaccgtgaagg (SEQ ID NO:11)

R：tgccctggctcagctcgat (SEQ ID NO:12)

fragment size: 530bp

Conditions of PCR reaction: 95. 30 times at 30 deg.C s, 58 deg.C 30 s, 72 deg.C 40 s.

2. Transfer was verified by qRT-PCRVip3Aa20、Vip3Aa-d1AndVip3Aa-d2maize plants of the genes

Detection ofVip3Aa20、Vip3Aa-d1AndVip3Aa-d2the specific method for gene copy number is as follows:

(1) Leaves of maize plants and wild-type maize plants, each 100 mg, transformed with the nucleotide sequences Vip3Aa20, vip3Aa-d1 and Vip3Aa-d2, were homogenized in a mortar with liquid nitrogen, 3 replicates were taken per sample;

(2) Genomic DNA of the above samples was extracted using EasyPure Plant Genomic DNA Kit (RNase A-containing) (Transgen, beijing, china, cat: EE 111-01) and the specific method was referred to the product specifications;

(3) The genomic DNA concentration of the above samples was determined using a NanoDrop 2000 (Thermo Scientific, USA);

(4) Adjusting the concentration of the genomic DNA of the sample to the same concentration value, wherein the concentration value ranges from 80 to 100 ng/. Mu.l;

(5) The copy number of the sample is identified by using a TransStart Green fluorescence quantitative PCR method, and the sample with the identified known copy number is used as a standard substance. Samples of wild-type maize plants were also used as controls, 3 replicates per sample, and their average was taken.

The following primers were used to detect the nucleotide sequences of Vip3Aa20, vip3Aa-d1 and Vip3Aa-d2:

primer 3 (CF 2): acaccgagctgagcaagga (SEQ ID NO: 13);

primer 4 (CR 2): gcttgttgttcacgtcgttca (SEQ ID NO: 14);

probe 1 (CP 1): ccttaagatcgccaacgagcagaacca (SEQ ID NO: 15).

The following primers were used to detect the 18S nucleotide sequence for internal control leveling.

Primer 5 (CF 3): ggatcagcgggtgttactaatagg (SEQ ID NO: 16);

primer 6 (CR 3): ccccggaacccaaagact (SEQ ID NO: 17);

probe 2 (CP 2): ccccgctggcaccttatgagaaatc (SEQ ID NO: 18).

The PCR reaction system is as follows:

2*TransStart Green qPCR SuperMix（Transgen） 10μl

10. Mu.M Forward primer 1. Mu.l

10. Mu.M Reverse primer 1. Mu.l

Passive Reference Dye I (50X) 0.4μl

2 μl of genomic DNA

Water (ddH) ₂ O） 5.6μl

The PCR reaction conditions were:

step temperature time

1 95℃ 5 min

2 95℃ 30 s

360℃ 1 min

Repeating the steps 2-3 and 40 times.

The data were analyzed using SDS 2.3 software (Applied Biosystems).

Experimental results show that the nucleotide sequences of Vip3Aa20, vip3Aa-d1 and Vip3Aa-d2 are integrated into the detected corn plant chromosome group, and corn plants transformed with the nucleotide sequences of Vip3Aa20, vip3Aa-d1 and Vip3Aa-d2 all obtain corn plants containing single copiesVip3Aa20、Vip3Aa-d1AndVip3Aa-d2transgenic maize plants of the gene.

Example 4 insecticidal protein detection of transgenic maize plants

1. Insecticidal protein content detection of transgenic corn plants

The solutions involved in this experiment were as follows:

extraction buffer: 8 g/L NaCl,0.2 g/L KH ₂ PO ₄ ，2.9 g/L Na ₂ HPO ₄ •12H ₂ O, 0.2. 0.2 g/L KCl, 5.5. 5.5 ml/L Tween 20 (Tween-20), pH 7.4;

wash buffer PBST:8 g/L NaCl，0.2 g/L KH ₂ PO ₄ ，2.9 g/L Na ₂ HPO ₄ •12H ₂ O, 0.2. 0.2 g/L KCl, 0.5. 0.5 ml/L Tween 20 (Tween-20), pH 7.4;

stop solution: 1M HCl.

Taking 3 mg corn plants transferred into Vip3Aa-d1 and Vip3Aa-d2 nucleotide sequences and fresh leaves of corn plants transferred into Vip3Aa20 nucleotide sequences as samples, respectively, adding 800 μl of the extraction buffer after grinding with liquid nitrogen, centrifuging at 4000 rpm for 10 min, taking supernatant, diluting 40 times with the extraction buffer, and taking 80 μl of diluted supernatant for ELISA detection. The amount of insecticidal proteins (Vip 3Aa20, vip3Aa-d1 and Vip3Aa-d2 proteins) in the samples was measured and analyzed in terms of the proportion of fresh weight of leaves using ELISA (enzyme-linked immunosorbent assay) kit (ENVIRLOGIX Co.), and the specific method was referred to the product specifications.

And simultaneously, taking a wild corn plant and a corn plant which is identified as non-transgenic by fluorescent quantitative PCR as a control, and carrying out detection analysis according to the method. 6 total strains (S1, S2, S3, S4, S5 and S6) transferred into the nucleotide sequences of Vip3Aa-d1 and Vip3Aa-d2, 3 total strains (S7, S8 and S9) transferred into the nucleotide sequence of Vip3Aa20, 1 total strain of non-transgenic (NGM) and 1 total strain of wild type (CK) identified by fluorescent quantitative PCR; 3 strains were selected from each strain for testing, each strain being repeated 6 times.

The results of the insecticidal protein (Vip 3Aa20, vip3Aa-d1 and Vip3Aa-d2 proteins) content measurements of transgenic maize plants are shown in table 1. The average expression amounts of insecticidal proteins (Vip 3Aa20, vip3Aa-d1 and Vip3Aa-d2 proteins) in fresh leaves of corn plants transferred with Vip3Aa-d1 and Vip3Aa-d2 nucleotide sequences and corn plants transferred with Vip3Aa20 nucleotide sequences are respectively measured to be 3228.7, 3237.1 and 3117.1 (ng/g) which are the proportion of fresh weight of the leaves, and the result shows that the Vip3Aa-d1 and Vip3Aa-d2 proteins obtain higher expression amounts and stability in corn.

TABLE 1 Vip3Aa protein expression level determination results of transgenic maize plants

The in vitro expression and purification steps of the Vip3Aa-d1 and Vip3Aa-d2 proteins are specifically as follows:

(1) And artificially synthesizing double-stranded DNA molecules shown in a sequence 1 in a sequence table.

(2) And (3) connecting the double-stranded DNA molecule synthesized in the step (1) with a prokaryotic expression vector pEASY-E1 to obtain recombinant plasmids pEASY-Vip3Aa-d1 and pEASY-Vip3Aa-d2. The recombinant plasmids pEASY-Vip3Aa-d1 and pEASY-Vip3Aa-d2 were sequenced. Sequencing results show that the recombinant plasmids pEASY-Vip3Aa-d1 and pEASY-Vip3Aa-d2 contain DNA molecules shown as SEQ ID NO. 4 and SEQ ID NO. 5, and the proteins Vip3Aa-d1 and Vip3Aa-d2 shown as SEQ ID NO. 1 and SEQ ID NO. 2 in the sequence table are expressed.

(3) The recombinant plasmids pEASY-Vip3Aa-d1 and pEASY-Vip3Aa-d2 were introduced into E.coli transetta to obtain recombinant bacteria, and the recombinant bacteria were designated as transetta-Vip3Aa-d1 and transetta-Vip3Aa-d2.

(4) The single clones of the trans-beta-Vip 3Aa-d1 and the trans-beta-Vip 3Aa-d2 were inoculated into 100 mL of LB liquid medium (containing 50. Mu.g/mL ampicillin) and cultured at 37℃with shaking at 200 rpm for 12 h to obtain a culture broth.

(5) Inoculating the culture bacterial liquid into 50 mL of LB liquid medium (containing 50 mug/mL ampicillin) according to the volume ratio of 1:100, and shaking and culturing at 37 ℃ and 200 rpm until reaching OD ₆₀₀ IPTG was then added to a concentration of 1 mM, and the mixture was subjected to shaking culture at 220 rpm at 28℃for 4 hours, and centrifuged at 10000 rpm for 10 minutes at 4℃to collect a bacterial precipitate.

(6) The bacterial pellet is taken, 100 mL of Tris-HCl buffer with pH of 8.0 and 100 mM is added, ultrasonic disruption is carried out after resuspension (ultrasonic power 600W, the circulation procedure is that disruption is carried out for 4 s, stop is carried out for 6 s, total 20 min), centrifugation is carried out for 10 min at 10000 rpm at 4 ℃, and supernatant A is collected.

(7) Taking supernatant A, centrifuging at 12000 rpm for 10 min at 4 ℃, and collecting supernatant B.

(8) The supernatant B was purified using a nickel column from GE company (specific steps of purification are referred to the specification of the nickel column), and then the Vip3Aa-d1 and Vip3Aa-d2 and Vip3Aa20 proteins were quantified using a protein quantification kit from Semer femto's company.

According to the method, the double-stranded DNA molecule shown as the sequence 1 in the artificial synthesis sequence table in the step (1) is replaced by the DNA molecule shown as the sequence 6 in the artificial synthesis sequence table, and other steps are unchanged, so that the Vip3Aa20 protein is obtained.

Example 5 resistance detection of transgenic maize plants against common lepidopteran pests in the field

Corn plants, wild corn plants and corn plants identified as non-transgenic by PCR which are transformed with nucleotide sequences of Vip3Aa-d1, vip3Aa-d2 and Vip3Aa20 are subjected to insect resistance effect detection on the cutworm, and the specific steps are as follows:

fresh leaves of maize plants, wild-type maize plants and maize plants identified as non-transgenic by PCR (stages V3-V4) which were respectively transferred to Vip3Aa-d1, vip3Aa-d2 and Vip3Aa20 nucleotide sequences were rinsed clean with sterile water and the leaves were blotted dry with filter paper, then the veins were removed, cut into strips of about 3 cm X1 cm, 2 cut strips were placed on filter paper at the bottom of a circular plastic petri dish, the filter paper was moistened with distilled water, 10 artificial-fed Oriental armyworms, black cutworms, corn borers, spodoptera litura, cotton bollworms, spodoptera frugiperda, spodoptera exigua and Conyza, and Conyza punctiferalis were all hatched larvae, after the petri dish was covered, and after 3 days of standing under conditions of a temperature of 22-26 ℃, a relative humidity of 70% -80%, and a light cycle 16 h/8 h, the mortality was counted. The results are shown in Table 2, wherein the Vip3Aa-d1 and Vip3Aa-d2 proteins maintain the resistance of the Vip3Aa protein to lepidopteran pests after modification, and the resistance to the cutworm is obviously improved compared with the Vip3Aa20 protein.

TABLE 2 resistance of the Vip3Aa protein to Lepidoptera pests

Note that: ++ represents the high resistance is realized, the high-strength steel wire rope is high in resistance, ++ represents medium reactance, -represents sensitivity.

Example 6 detection of the insect-repellent Effect of transgenic maize plants on Gekko Swinhonis

As a result of the study in example 5, it was found that the pest-resistant effect of the agrocybe aegeriata was further examined on maize plants, wild-type maize plants and maize plants identified as non-transgenic by PCR into Vip3Aa-d1, vip3Aa-d2 and Vip3Aa20 nucleotide sequences, and the specific procedure was the same as in the fifth example. As shown in Table 3, table 4 and FIG. 5, the resistance of maize transgenic lines transformed with the nucleotide sequences of Vip3Aa-d1 and Vip3Aa-d2 to Gekko Swinhonis was superior to that of the Vip3Aa transgenic maize lines.

TABLE 3 toxicity determination of insecticidal proteins on Gekko Swinhonis

TABLE 4 in vitro leaf insect resistance assay results of cutworm

Technical effects

The results of the insect resistance assay are shown in Table 3, table 4 and FIG. 5 (WT is wild-type plant, vip3Aa20 is transformed with unmodified Vip3Aa20 transformation event, vip3Aa-d1 and Vip3Aa-d2 are transformed with modified Vip3Aa transformation event), and after transformation of the transformed Vip3Aa genes Vip3Aa-d1 and Vip3Aa-d2 into maize, the obtained transgenic maize with high expression of Vip3Aa-d1 and Vip3Aa-d2 proteins has a resistance to cutworm better than the resistance of Vip3Aa20 protein.

The above is only a preferred embodiment of the present application, and is not intended to limit the present application, but various modifications and variations can be made to the present application by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. A protein for plant insect resistance is characterized in that the amino acid sequence of the protein is SEQ ID NO. 1 or SEQ ID NO. 2.

2. An insect-resistant gene encoding the protein of claim 1.

3. The insect-resistant gene according to claim 2, wherein the nucleotide sequence of the insect-resistant gene is SEQ ID NO. 4 or SEQ ID NO. 5.

4. An expression cassette, recombinant vector, recombinant microorganism or transgenic cell line comprising the insect-resistant gene of claim 2 or 3.

5. An expression vector comprising the insect-resistant gene of claim 2.

6. The expression vector of claim 5, comprising the following genetic constructs in sequence: an insect-resistant gene as claimed in claim 2 or 3; a terminator of nopaline synthase; a maize ubiquitin gene promoter; a phosphinothricin acetyl transferase gene; a terminator of cauliflower mosaic virus.

7. Use of a protein for plant pest resistance according to claim 1, or of a pest resistance gene according to claim 2 or 3, or of an expression cassette, recombinant vector, recombinant microorganism or transgenic cell line comprising the pest resistance genes Vip3Aa-d1 and Vip3Aa-d2 according to claim 2 or 3, in plant pest resistance, characterized in that the use is: a) Preparing a medicament with an insect-resistant effect; and/or b) cultivating a transgenic plant having or having increased pest resistance, said pest controlled in use being selected from one or more of Oriental armyworm, gekko Swinhonis, spodoptera litura, cotton bollworm, spodoptera frugiperda and Spodoptera exigua, said transgenic plant being transgenic corn.

8. The use according to claim 7, wherein: the pests controlled in the application are cutworms.

9. A method of growing a plant having or having increased pest resistance, the method comprising the steps of: introducing the insect-resistant gene of claim 2 or 3 into a recipient plant to obtain a transgenic plant, wherein the transgenic plant is transgenic corn.