CN113308534A - VDAC1 mutant gene, primer, kit and method for detecting same and application thereof - Google Patents

Abstract

The invention relates to a VDAC1 mutant gene related to LIMD, a primer, a kit and a method for detecting the same and application thereof, wherein the mutant VDAC1 gene has one of the following mutations compared with a human genome reference sequence GRCh 37: the base with the physical position of No. 5 chromosome 133326788 is mutated from C to A, and the base with the physical position of No. 5 chromosome 133316511 is mutated from G to A; the cDNA sequence of the mutant VDAC1 gene has one of the following mutations compared with the sequence of SEQ ID NO. 1: c.175G > T, c.460C > T; the sequence of the mutant VDAC1 protein has one of the following mutations compared to the sequence of SEQ ID No. 2: p.Glu59Ter, p.Gln154Ter. The invention provides important basis for early molecular screening and family genetic research of LIMD.

Description

VDAC1 mutant gene, primer, kit and method for detecting same and application thereof

Technical Field

The invention relates to disease-related mutant genes, in particular to a VDAC1 mutant gene, a primer, a kit and a method for detecting the same and application thereof.

Background

The incidence of mitochondrial disease is highest among all inherited metabolic diseases. Mitochondria are primarily responsible for oxidative phosphorylation to produce adenosine triphosphate. The pathogenesis of mitochondrial diseases involves two distinct genomes: nuclear genome and maternal inherited 16.6kb mitochondrial genome. Mitochondrial diseases can be caused by mutations in any of these genomes. Defects in nuclear dna (ndna) can lead to problems such as respiratory chain complex structure, translation, and mitochondrial dna (mtdna) repair defects. Of the mitochondrial diseases diagnosed in childhood, about 25% are due to mitochondrial DNA abnormalities, while the remaining 75% are due to nDNA defects. Severe neonatal or infant onset mitochondrial disease usually leads to death within one year of birth, and infant lethal mitochondrial disease (LIMD) accounts for about 8.5% of cases with childhood onset mitochondrial disease, but LIMD has a low molecular genetic diagnosis rate, and most LIMD cases are diagnosed by biochemical and genetic methods after death of the subject. Thus, when parents become pregnant again, such neonatal onset of severe mitochondrial disease may reoccur due to a diagnosis that is not timely. Although nearly thousands of nuclear genomic genes have been found to be involved in mitochondrial function, only a small proportion have been implicated in the development of LIMD, suggesting that there are new LIMD virulence genes to be exploited.

Disclosure of Invention

The invention aims to provide a VDAC1 mutant gene related to infantile lethal mitochondrial diseases, a primer, a kit and a method for detecting the same and application thereof.

The purpose of the invention is realized by the following technical scheme:

a mutant VDAC1 gene or a mutant VDAC1 protein, the mutant VDAC1 gene having at least one of the following mutations compared to a human genome reference sequence GRCh 37:

the base with the physical position of No. 5 chromosome 133326788 is mutated from C to A, and the base with the physical position of No. 5 chromosome 133316511 is mutated from G to A;

the cDNA sequence of the mutant VDAC1 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.175G>T、c.460C>T；

the sequence of the mutant VDAC1 protein has at least one of the following mutations compared with the sequence of SEQ ID No. 2:

Glu59Ter (glutamic acid at position 59 is mutated into a stop codon), and Gln154Ter (glutamine at position 154 is mutated into a stop codon).

The VOLTAGE-DEPENDENT ANION CHANNEL 1 (VOLTAGE-dependent anion channel 1, VDAC1) gene is located at chromosome 5q31.1, and contains 9 exons, and encodes VDAC1 protein with 283 amino acids and 31 kDa. VDAC1 is a channel molecule for the outer mitochondrial membrane and cell membrane. The channel allows diffusion of hydrophilic small molecules through the outer mitochondrial membrane; in the cell membrane, it is involved in cell volume regulation and apoptosis. VDAC1 can bind to a variety of signaling molecules including sphingolipid ceramides, phospholipid phosphatidylcholine, and cholesterol. In depolarizing mitochondria, acting downstream of PRKN and PINK1, promote mitochondrial phagocytosis or prevent apoptosis. VDAC1 is involved in the formation of the Permeability Transition Pore Complex (PTPC) which is responsible for the release of mitochondrial products that trigger apoptosis, and VDAC1 mediates the export of ATP from the cell. At present, the correlation between VDAC1 and diseases is not reported.

The gene of the wild type VDAC1 gene in Ensemble database (www.ensembl.org) is encoded as ENSG00000213585, and the gene is located on chromosome 5. The inventor utilizes genetic research screening in a large number of normal people and LIMD patient families to find that the gene mutation of VDAC1 gene can cause lethal mitochondrial diseases of infants. The invention provides a new pathogenic mutation site of a pathogenic gene and provides a new molecular biology basis for early molecular screening of the disease.

The first mutation and the second mutation are both positioned in a translation region, wherein the physical position of the first mutation is 133326788, and the base C is mutated into A; RNA level: the 175 th base of the cDNA sequence of the VDAC1 gene is mutated from G to T; protein level: the 59 th amino acid of the VDAC1 gene coding protein is mutated from glutamic acid into a stop codon.

The second mutation was at the physical position of 133316511, base was mutated from G to A, RNA level: the 460 th base of the cDNA sequence of the VDAC1 gene is mutated from C to T; protein level: the 154 th amino acid of the VDAC1 gene coding protein is mutated from glutamine into a stop codon.

A method of detecting a mutant VDAC1 gene or a mutant VDAC1 protein for non-diagnostic purposes, the method comprising detecting the presence or absence of a mutation site in a VDAC1 gene or a VDAC1 protein; the mutation site is at least one of the following:

chr5(GRCh37) g.133326788C > A, cDNA sequence generation c.175G > T, p.Glu59Ter (glutamic acid mutation at 59 position is stop codon);

chr5(GRCh37): g.133316511G > A, cDNA sequence generation c.460C > T, p.Gln154Ter (glutamine mutation at position 154 to stop codon).

In some embodiments, the purpose of the non-diagnostic diseases described in the present invention includes, but is not limited to, studying SNP distribution and polypeptidases for family evolution studies. Such applications will be understood by those skilled in the art.

Some individuals carry the mutant VDAC1 gene of the invention but do not suffer from LIMD, e.g., a heterozygous genotype with only one chromosome carrying the mutation. The detection of this portion of the population may not be relevant for any purpose of diagnosing the disease, since these individuals are not themselves diseased. But the results of their detection can be used as useful information, for example as important indicators for pre-natal examinations, to guide fertility, or for mutation carrier screening, or as a tool for SNP distribution and polymorphism studies or to follow gene mutations or family evolution. Such applications are also understood by those skilled in the art. Accordingly, the method for detecting a mutant VDAC1 gene or a mutant VDAC1 protein provided by the present invention relates to detection of heterozygous mutations.

However, the method for detecting the mutant VDAC1 gene or the mutant VDAC1 protein provided by the invention also comprises the detection of homozygous mutation.

In a preferred embodiment of the present invention, the method for detecting the mutant VDAC1 gene or the mutant VDAC1 protein comprises the following steps of performing PCR amplification using at least one set of primers:

VDAC1_ E3F: GAGCCAGGATGGAAGGGAGAT (SEQ ID NO:3) and

VDAC1_E3R:GAAGGTCAGCTTCAGTCCACG(SEQ ID NO:4)；

VDAC1_ E5F: CCTGTGTAGGCTGCTACGTT (SEQ ID NO:5) and

VDAC1_E5R:CAGGCCATGTGGCTCATCTAA(SEQ ID NO:6)。

in a preferred embodiment of the present invention, the PCR reaction procedure using the primers for amplification comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

The method for detecting the mutant VDAC1 gene comprises the following steps:

(1) establishing a family clinical and genetic resource library of LIMD patients, collecting clinical information and blood samples of LIMD families, and extracting genome DNA;

(2) designing amplification and sequencing primers covering the whole exon sequence of the VDAC1 gene for sequencing;

(3) and comparing the sequencing results of the family samples of the normal person and the LIMD patient.

In one embodiment, the sequencing is a Sanger sequencing.

In another embodiment, the method for detecting the mutant VDAC1 gene may be performed by a technique selected from the group consisting of:

electrophoresis, nucleic acid hybridization, in situ hybridization, PCR, reverse transcriptase chain reaction, and denaturing high performance liquid chromatography.

In other embodiments, it also relates to a method for detecting mutations at exon and exon/intron boundaries of VDAC1 gene, comprising the steps of:

(1) extracting a DNA sample from a subject;

(2) sequencing the exome and all exon/intron boundary sequences of the DNA sample to obtain sequencing fragments;

(3) and comparing the sequencing fragment with a reference sequence to obtain the exon and exon/intron boundary mutation of the gene.

A reagent for detecting a mutant VDAC1 gene, wherein the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant VDAC1 gene; the mutant VDAC1 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 5 chromosome 133326788 is mutated from C to A, and the base with the physical position of No. 5 chromosome 133316511 is mutated from G to A;

the cDNA sequence of the mutant VDAC1 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.175G>T、c.460C>T；

the region of the nucleic acid detection probe complementary to the mutant VDAC1 gene comprises a physical position or a cDNA sequence position selected from at least one of:

physical positions 133326788 th, 133316511 th; the 175 th and 460 th cDNA sequence;

the primer is at least one group of primers with the following sequences:

VDAC1_ E3F: GAGCCAGGATGGAAGGGAGAT (SEQ ID NO:3) and

VDAC1_E3R:GAAGGTCAGCTTCAGTCCACG(SEQ ID NO:4)；

VDAC1_ E5F: CCTGTGTAGGCTGCTACGTT (SEQ ID NO:5) and

VDAC1_E5R:CAGGCCATGTGGCTCATCTAA(SEQ ID NO:6)。

the nucleic acid detection probe realizes the detection of the mutant VDAC1 gene by nucleic acid pairing with a complementary region of the mutant VDAC1 gene.

In other embodiments, the reagents for detecting a mutant VDAC1 gene further comprise buffers, enzymes, and inorganic salts.

And (3) amplifying the template DNA by using a primer for detecting the mutant VDAC1 gene, and carrying out mutation identification on an amplification product by sequencing or gel electrophoresis.

A kit for detecting a mutant VDAC1 gene comprises the reagent.

In other embodiments, the kit for detecting a mutant VDAC1 gene further comprises a buffer and instructions for use.

Application of a reagent for detecting a mutant VDAC1 gene or a mutant VDAC1 protein in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the detection reagent for the fatal mitochondrial diseases of the infants is a reagent for a gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for a restriction enzyme digestion method or a reagent for sequencing.

The reagent for gene chip may be a probe for cDNA chip.

The DNA amplification reagent may be a primer or a probe.

The reagent for reverse transcription amplification can be a reverse transcription amplification primer and a reverse transcription amplification buffer solution.

The reagent for the restriction enzyme cutting method can be a primer containing a restriction enzyme site and a seamless cloning buffer solution.

The sequencing reagent may be a primer or a detection buffer.

The application of a reagent for detecting a mutant VDAC1 gene in early molecular screening of lethal mitochondrial diseases of infants is a non-disease diagnosis purpose.

An application of a kit for detecting a mutant VDAC1 gene in early molecular screening of lethal mitochondrial diseases of infants is disclosed, and the application is a non-disease diagnosis purpose.

Compared with the prior art, the invention has the advantages that:

the invention provides a VDAC1 mutant gene, a reagent, a primer, a kit and a method for detecting the VDAC1 mutant gene and application of the VDAC1 mutant gene, creatively digs a LIMD pathogenic gene VDAC1, and provides a VDAC1 mutant gene site, which provides important basis for early molecular screening, family genetic research and genetic consultation of lethal mitochondrial diseases of infants.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a family diagram;

FIG. 2 is a high throughput sequencing graph of the VDAC1 mutant sequence.

FIG. 3 is a Sanger sequencing chart of the VDAC1 mutant sequence.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

This example performed whole exome high throughput sequencing assays for multiple families of patients with infantile fatal mitochondrial disease (LIMD), which included the following sequential steps:

(1) sample collection and extraction of genomic DNA.

Clinical data of family members and blood samples (EDTA anticoagulation) were collected, which were blood samples sent to forry medical laboratory ltd.

The Blood genomic DNA of each member of the family was extracted according to the instruction procedures of the Blood DNA extraction Kit (magenta, HiPure Blood & Tissue DNA Kit). The purity of the DNA was measured using Nanodrop one, OD260nm/OD280nm of the obtained genomic DNA were each between 1.7 and 2.0, and the concentration of the DNA was measured using Nanodrop one, the concentration of the obtained genomic DNA was 50 to 100 ng/. mu.L, and the total amount was 5 to 10. mu.g. Storing at-20 deg.C.

(2) Exome sequencing and bioinformatic analysis.

In order to find other pathogenic genes of LIMD, exome sequencing was used to screen 1 LIMD family for potential genetic variation (family map is shown in FIG. 1), and no pathological variation was found in the existing LIMD pathogenic gene test.

Exome sequencing was performed on the proband. Briefly, genomic DNA was fragmented, and subjected to enzymatic fragmentation, end repair, 3' -end addition of A, linker ligation, and PCR amplification by using a Kit of KAPA company (KAPA Hyperplus Library Preparation Kit); the exon regions were captured using a library construction kit (XGen outer Research Panel v2) from IGT. The library was sequenced on a Novaseq sequencer (Illumina, san diego, CA, usa) (sequencing depth 150X). NGS sequencing results were aligned to the human reference genome UCSC NCBI37/hg19 using Novocraft Novoalign to obtain a unique aligned sequence aligned to the genome. The variation of the target region was determined using VarScan mpileup2snp and VarScan mpileup2indel detection. Remove Run Common Variants and Remove Global Common Variants software were used to Remove Common variations in dbSNP and ExAC databases. The variants were then annotated using Interactive Biosoftware Alamut Batch. The database used for annotation includes: dbSNP, ExAC, 1000g, ClinVar, OMIM, etc. Py was used to rank the annotated variants by High, Medium, Low. In High and Medium packets, a precedence value and a classification reason are given to the variation. All mutations are initially in the Low group and when a mutation meets certain criteria, it can be classified as a higher level mutation. And performing SNP function prediction by using FATHMM, FATHMMMKL, METALR, METASVM, MUTATIONASSESSOR, MUTATIONTASTERAGGGD, AGVGD, LRT, PROVEAN and SIFT software.

After sequencing the whole exon of 1 LIMD pedigree VDAC1 gene in figure 1 and bioinformatics analysis, we find that proband carries 2 compound heterozygous mutations, and a BAM file of mutation sequencing result is shown in figure 2, wherein the gene code of the VDAC1 gene in an Ensemble database (www.ensembl.org) is ENSG00000213585, wherein the mutant VDAC1 p.Glu59Ter, and the base with the physical position of 133326788 is mutated from C to A; RNA level: the 175 th base of VDAC1 gene coding RNA is mutated from G to T; protein level: the 59 th amino acid of the VDAC1 gene coding protein is mutated into a stop codon from glutamic acid; mutation VDAC1 p.Gln154Ter, wherein the base with the physical position of 133316511 is mutated from G to A; RNA level: the 460 th base of VDAC1 gene coding RNA is mutated from C to T; protein level: the 154 th amino acid of the VDAC1 gene coding protein is mutated into a stop codon from glutamine; no other suspected site of mutation of the pathogenic gene was found.

The mutations p.Glu59Ter and p.Gln154Ter of the VDAC1 gene are not recorded in a normal population database such as gnomAD, which leads to complete loss of the function of the proband VDAC1 protein and seriously affects the physiological function of the VDAC1 protein. According to the known biological function results, the clinical symptoms of proband LIMD are highly consistent.

According to the screening process designed by us, by means of high-throughput deep sequencing and bioinformatics analysis, we successfully find that the VDAC1 gene is a new LIMD pathogenic gene, and the mutations p.Glu59Ter and p.Gln154Ter are new pathogenic sites of the disease.

(3) And (5) carrying out Sanger sequencing verification to identify the mutant gene.

Sanger sequencing was used to verify 2 mutations of VDAC1 gene detected by exon sequencing: c.175G > T, c.460C > T (see FIG. 3). Primer 3 Primer design software is adopted to design Primer sequences SEQ ID NO. 3-SEQ ID NO.6, and the Primer sequences amplify genome DNA fragments containing VDAC1 gene mutation sites.

The PCR amplification system (20. mu.l) included: PCR 5 Xbuffer mix 10. mu.l, forward primer (10. mu. mol) 1. mu.l, reverse primer (10. mu. mol) corresponding to the forward primer 1. mu.l, ddH₂O6. mu.l, DNA 2. mu.l. PCR reaction procedure: at 95 deg.C for 5min, for 35 cycles (95 deg.C for 5min, 95 deg.C for 30s, 60 deg.C for 30s), at 72 deg.C for 10min, and at 4 deg.C. After PCR amplification is finished, 1% agarose gel electrophoresis is adopted for detection, PCR product gel is recovered by cutting gel, and products are recovered by Taq enzyme purification. All PCR products were sequenced with forward and reverse primers, respectively. The sequencing results are shown in FIG. 3.

In summary, the identified mutant VDAC1 gene of the present invention can be used for early clinical screening of LIMD patients, and the above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and various modifications and variations can be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Fuzhou Furui medical laboratory Co., Ltd

<120> VDAC1 mutant gene, primer, kit and method for detecting same, and use thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 852

<212> DNA

<213> human (human)

<400> 1

atggctgtgc cacccacgta tgccgatctt ggcaaatctg ccagggatgt cttcaccaag 60

ggctatggat ttggcttaat aaagcttgat ttgaaaacaa aatctgagaa tggattggaa 120

tttacaagct caggctcagc caacactgag accaccaaag tgacgggcag tctggaaacc 180

aagtacagat ggactgagta cggcctgacg tttacagaga aatggaatac cgacaataca 240

ctaggcaccg agattactgt ggaagatcag cttgcacgtg gactgaagct gaccttcgat 300

tcatccttct cacctaacac tgggaaaaaa aatgctaaaa tcaagacagg gtacaagcgg 360

gagcacatta acctgggctg cgacatggat ttcgacattg ctgggccttc catccggggt 420

gctctggtgc taggttacga gggctggctg gccggctacc agatgaattt tgagactgca 480

aaatcccgag tgacccagag caactttgca gttggctaca agactgatga attccagctt 540

cacactaatg tgaatgacgg gacagagttt ggcggctcca tttaccagaa agtgaacaag 600

aagttggaga ccgctgtcaa tcttgcctgg acagcaggaa acagtaacac gcgcttcgga 660

atagcagcca agtatcagat tgaccctgac gcctgcttct cggctaaagt gaacaactcc 720

agcctgatag gtttaggata cactcagact ctaaagccag gtattaaact gacactgtca 780

gctcttctgg atggcaagaa cgtcaatgct ggtggccaca agcttggtct aggactggaa 840

tttcaagcat aa 852

<210> 2

<211> 283

<212> PRT

<213> human (human)

<400> 2

Met Ala Val Pro Pro Thr Tyr Ala Asp Leu Gly Lys Ser Ala Arg Asp

1 5 10 15

Val Phe Thr Lys Gly Tyr Gly Phe Gly Leu Ile Lys Leu Asp Leu Lys

20 25 30

Thr Lys Ser Glu Asn Gly Leu Glu Phe Thr Ser Ser Gly Ser Ala Asn

35 40 45

Thr Glu Thr Thr Lys Val Thr Gly Ser Leu Glu Thr Lys Tyr Arg Trp

50 55 60

Thr Glu Tyr Gly Leu Thr Phe Thr Glu Lys Trp Asn Thr Asp Asn Thr

65 70 75 80

Leu Gly Thr Glu Ile Thr Val Glu Asp Gln Leu Ala Arg Gly Leu Lys

85 90 95

Leu Thr Phe Asp Ser Ser Phe Ser Pro Asn Thr Gly Lys Lys Asn Ala

100 105 110

Lys Ile Lys Thr Gly Tyr Lys Arg Glu His Ile Asn Leu Gly Cys Asp

115 120 125

Met Asp Phe Asp Ile Ala Gly Pro Ser Ile Arg Gly Ala Leu Val Leu

130 135 140

Gly Tyr Glu Gly Trp Leu Ala Gly Tyr Gln Met Asn Phe Glu Thr Ala

145 150 155 160

Lys Ser Arg Val Thr Gln Ser Asn Phe Ala Val Gly Tyr Lys Thr Asp

165 170 175

Glu Phe Gln Leu His Thr Asn Val Asn Asp Gly Thr Glu Phe Gly Gly

180 185 190

Ser Ile Tyr Gln Lys Val Asn Lys Lys Leu Glu Thr Ala Val Asn Leu

195 200 205

Ala Trp Thr Ala Gly Asn Ser Asn Thr Arg Phe Gly Ile Ala Ala Lys

210 215 220

Tyr Gln Ile Asp Pro Asp Ala Cys Phe Ser Ala Lys Val Asn Asn Ser

225 230 235 240

Ser Leu Ile Gly Leu Gly Tyr Thr Gln Thr Leu Lys Pro Gly Ile Lys

245 250 255

Leu Thr Leu Ser Ala Leu Leu Asp Gly Lys Asn Val Asn Ala Gly Gly

260 265 270

His Lys Leu Gly Leu Gly Leu Glu Phe Gln Ala

275 280

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gagccaggat ggaagggaga t 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaaggtcagc ttcagtccac g 21

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cctgtgtagg ctgctacgtt 20

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caggccatgt ggctcatcta a 21

Claims (8)

1. A mutant VDAC1 gene or a mutant VDAC1 protein, wherein: the mutant VDAC1 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 5 chromosome 133326788 is mutated from C to A, and the base with the physical position of No. 5 chromosome 133316511 is mutated from G to A;

the cDNA sequence of the mutant VDAC1 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.175G>T、c.460C>T；

the sequence of the mutant VDAC1 protein has at least one of the following mutations compared with the sequence of SEQ ID No. 2:

p.Glu59Ter、p.Gln154Ter。

2. a method of detecting the mutant VDAC1 gene or mutant VDAC1 protein of claim 1 for non-diagnostic purposes, characterized in that: the method comprises the step of detecting whether a mutation site exists in a VDAC1 gene or a VDAC1 protein, wherein the mutation site is at least one of the following:

chr5(GRCh37) g.133326788C > A, cDNA sequence generation c.175G > T, p.Glu59Ter;

chr5(GRCh37) g.133316511G > A, cDNA sequence occurrence c.460C > T, p.Gln154Ter.

3. The method of claim 2, wherein: the method comprises the step of performing PCR amplification by using at least one set of primers as follows:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

4. The method of claim 3, wherein: the PCR amplification reaction program comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

5. A reagent for detecting a mutant VDAC1 gene, comprising: the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant VDAC1 gene; the mutant VDAC1 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 5 chromosome 133326788 is mutated from C to A, and the base with the physical position of No. 5 chromosome 133316511 is mutated from G to A;

the cDNA sequence of the mutant VDAC1 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.175G>T、c.460C>T；

the region of the nucleic acid detection probe complementary to the mutant VDAC1 gene comprises a physical position or a cDNA sequence position selected from at least one of:

physical positions 133326788 th, 133316511 th; the 175 th and 460 th cDNA sequence;

the primer is at least one group of primers with the following sequences:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

6. A kit for detecting a mutant VDAC1 gene, comprising: comprising the reagent according to claim 5.

7. Application of a reagent for detecting a mutant VDAC1 gene or a mutant VDAC1 protein in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the mutant VDAC1 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 5 chromosome 133326788 is mutated from C to A, and the base with the physical position of No. 5 chromosome 133316511 is mutated from G to A;

the cDNA sequence of the mutant VDAC1 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.175G>T、c.460C>T；

the sequence of the mutant VDAC1 protein has at least one of the following mutations compared with the sequence of SEQ ID No. 2:

p.Glu59Ter、p.Gln154Ter。

8. the use of claim 7, wherein the reagent for detecting lethal mitochondrial disease in infants is a reagent for gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for restriction enzyme digestion or a reagent for sequencing.

Images