CN113265409B

CN113265409B - TIMM21 mutant gene, primer, kit and method for detecting same and application thereof

Info

Publication number: CN113265409B
Application number: CN202110556490.3A
Authority: CN
Inventors: 王开宇; 马鑫瑞
Original assignee: Beijing Fujun Gene Biotechnology Co ltd
Current assignee: Beijing Fujun Gene Biotechnology Co ltd
Priority date: 2021-05-21
Filing date: 2021-05-21
Publication date: 2022-05-20
Anticipated expiration: 2041-05-21
Also published as: CN113265409A

Abstract

The invention relates to a TIMM21 mutant gene related to LIMD, a primer, a kit and a method for detecting the same and application thereof, wherein the mutant TIMM21 gene has one of the following mutations compared with a human genome reference sequence GRCh 37: the base with the physical position of No. 18 chromosome 71816137 is mutated from A to T, and the base with the physical position of No. 18 chromosome 71822624 is mutated from A to T; the cDNA sequence of the mutant TIMM21 gene has one of the following mutations compared with the sequence of SEQ ID NO. 1: c.94A > T, c.448A > T; the sequence of the mutant TIMM21 protein has one of the following mutations compared to the sequence of SEQ ID No. 2: p.lys32ter, p.arg150ter. The invention provides important basis for early molecular screening and family genetic research of LIMD.

Description

TIMM21 mutant gene, primer, kit and method for detecting same and application thereof

Technical Field

The invention relates to disease-related mutant genes, in particular to a TIMM21 mutant gene, a primer, a kit and a method for detecting the same and application thereof.

Background

The incidence of mitochondrial disease is highest among all inherited metabolic diseases. Mitochondria are primarily responsible for oxidative phosphorylation to produce adenosine triphosphate. The pathogenesis of mitochondrial diseases involves two distinct genomes: nuclear genome and maternal inherited 16.6kb mitochondrial genome. Mitochondrial diseases can be caused by mutations in any of these genomes. Defects in nuclear dna (ndna) can lead to problems such as respiratory chain complex structure, translation, and mitochondrial dna (mtdna) repair defects. Of the mitochondrial diseases diagnosed in childhood, about 25% are due to mitochondrial DNA abnormalities, while the remaining 75% are due to nDNA defects. Severe neonatal or infant onset mitochondrial disease usually leads to death within one year of birth, and infant lethal mitochondrial disease (LIMD) accounts for about 8.5% of cases with childhood onset mitochondrial disease, but LIMD has a low molecular genetic diagnosis rate, and most LIMD cases are diagnosed by biochemical and genetic methods after death of the subject. Thus, when parents become pregnant again, such neonatal onset of severe mitochondrial disease may reoccur due to a diagnosis that is not timely. Although nearly thousands of nuclear genomic genes have been found to be involved in mitochondrial function, only a small proportion have been implicated in the development of LIMD, suggesting that there are new LIMD virulence genes to be exploited.

Disclosure of Invention

The invention aims to provide a TIMM21 mutant gene related to infantile lethal mitochondrial diseases, a primer, a kit and a method for detecting the same and application thereof.

The purpose of the invention is realized by the following technical scheme:

a mutant TIMM21 gene or a mutant TIMM21 protein, the mutant TIMM21 gene having at least one of the following mutations compared to a human genome reference sequence GRCh 37:

the base with the physical position of No. 18 chromosome 71816137 is mutated from A to T, and the base with the physical position of No. 18 chromosome 71822624 is mutated from A to T;

the cDNA sequence of the mutant TIMM21 gene has at least one of the following mutations compared with the sequence of SEQ ID NO. 1:

c.94A>T、c.448A>T；

the sequence of the mutant TIMM21 protein has at least one of the following mutations compared to the sequence of SEQ ID No. 2:

p.lys32ter (lysine at position 32 mutated to a stop codon), p.arg150ter (arginine at position 150 mutated to a stop codon).

The TRANSLOCASE OF INNER MITOCHONDRAL MEMBRANE 21 (MITOCHONDRIAL INNER MEMBRANE TRANSLOCASE 21, TIMM21) gene is located on chromosome 18q22.3, and contains 6 exons, and encodes TIMM21 protein with 248 amino acids and a molecular weight OF about 28 kDa. TIMM21 is involved in the transport of transit peptide proteins on the inner mitochondrial membrane. Is involved in the formation of mitochondrial respiratory chain complex I and complex IV as part of the MITRAC (intermediate in mitochondrial translation regulatory assembly of the cytochrome c oxidase complex), possibly shuttling processes between prosequence translocase and respiratory chain assembly intermediates. At present, the correlation between the TIMM21 gene and diseases is not reported.

The gene of the wild-type TIMM21 gene in the Ensemble database (www.ensembl.org) is encoded as ENST00000169551, and is located on chromosome 18. The inventor utilizes genetic research screening in a large number of normal people and LIMD patient families to find that the gene mutation of TIMM21 gene can cause lethal mitochondrial diseases of infants. The invention provides a new pathogenic mutation site of a pathogenic gene and provides a new molecular biology basis for early molecular screening of the disease.

The first mutation and the second mutation are both positioned in a translation region, wherein the physical position of the first mutation is 71816137, and the base A is mutated into T; RNA level: the 94 th base of the cDNA sequence of the TIMM21 gene is mutated from A to T; protein level: the 32 th amino acid of protein coded by the TIMM21 gene is mutated into a stop codon from lysine.

The second mutation was at the physical position of 71822624, base from a to T, RNA level: the 448 th base of the cDNA sequence of the TIMM21 gene is mutated from A to T; protein level: the 150 th amino acid of protein coded by the TIMM21 gene is mutated from arginine to stop codon.

A method of detecting a mutant TIMM21 gene or a mutant TIMM21 protein for non-diagnostic purposes, the method comprising detecting the presence or absence of a mutation site in a TIMM21 gene or a TIMM21 protein; the mutation site is at least one of the following:

chr18(GRCh37) g.71816137A > T, cDNA sequence generation c.94A > T, p.Lys32Ter (32-position lysine is mutated into a stop codon);

chr18(GRCh37) g.71822624A > T, cDNA sequence generation c.448A > T, p.Arg150Ter (150-arginine mutation to stop codon).

In some embodiments, the purpose of the non-diagnostic diseases described in the present invention includes, but is not limited to, studying SNP distribution and polypeptidases for family evolution studies. Such applications will be understood by those skilled in the art.

Some individuals carry the mutant TIMM21 gene of the invention but do not suffer from LIMD, e.g., a heterozygous genotype with only one chromosome carrying the mutation. The detection of this portion of the population may not be relevant for any purpose of diagnosing the disease, since these individuals are not themselves diseased. But the results of their detection can be used as useful information, for example as important indicators for pre-natal examinations, to guide fertility, or for mutation carrier screening, or as a tool for SNP distribution and polymorphism studies or to follow gene mutations or family evolution. Such applications are also understood by those skilled in the art. Thus, the methods of detecting a mutant TIMM21 gene or a mutant TIMM21 protein provided by the present invention involve detecting heterozygous mutations.

However, the methods of the present invention for detecting a mutant TIMM21 gene or a mutant TIMM21 protein also include detecting a homozygous mutation.

In a preferred embodiment of the present invention, the method for detecting mutant TIMM21 gene or mutant TIMM21 protein comprises the following steps of PCR amplification using at least one set of primers:

TIMM21_ E1F: ATACGGAGAAGCTGCACAGGTC (SEQ ID NO:3) and

TIMM21_E1R:TGATGTTGGGACGGCGGTTC(SEQ ID NO:4)；

TIMM21_ E3F: TGTTGCCCTTGCTTCGCTTCAT (SEQ ID NO:5) and

TIMM21_E3R:CAGAGTGCTTGCACGGACACAT(SEQ ID NO:6)。

in a preferred embodiment of the present invention, the PCR reaction procedure using the primers for amplification comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

The method for detecting the mutant TIMM21 gene comprises the following steps:

(1) establishing a family clinical and genetic resource library of LIMD patients, collecting clinical information and blood samples of LIMD families, and extracting genome DNA;

(2) designing amplification and sequencing primers covering the whole exon sequence of the TIMM21 gene for sequencing;

(3) and comparing the sequencing results of the family samples of the normal person and the LIMD patient.

In one embodiment, the sequencing is a Sanger sequencing.

In other embodiments, the method for detecting a mutant TIMM21 gene described above may be performed by a technique selected from the group consisting of:

electrophoresis, nucleic acid hybridization, in situ hybridization, PCR, reverse transcriptase chain reaction, and denaturing high performance liquid chromatography.

In other embodiments, methods of detecting mutations at exon and exon/intron boundaries of the TIMM21 gene are also contemplated, comprising the steps of:

(1) extracting a DNA sample from a subject;

(2) sequencing the exome and all exon/intron boundary sequences of the DNA sample to obtain sequencing fragments;

(3) and comparing the sequencing fragment with a reference sequence to obtain the exon and exon/intron boundary mutation of the gene.

A reagent for detecting a mutant TIMM21 gene, wherein the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant TIMM21 gene; the mutant TIMM21 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

c.94A>T、c.448A>T；

the region of the nucleic acid detection probe complementary to the mutant TIMM21 gene comprises a physical position or a cDNA sequence position selected from at least one of:

physical positions 71816137 th, 71822624 th; 94 th and 448 th in the cDNA sequence;

the primer is at least one group of primers with the following sequences:

TIMM21_ E1F: ATACGGAGAAGCTGCACAGGTC (SEQ ID NO:3) and

TIMM21_E1R:TGATGTTGGGACGGCGGTTC(SEQ ID NO:4)；

TIMM21_ E3F: TGTTGCCCTTGCTTCGCTTCAT (SEQ ID NO:5) and

TIMM21_E3R:CAGAGTGCTTGCACGGACACAT(SEQ ID NO:6)。

the nucleic acid detection probes enabled detection of the mutant TIMM21 gene by nucleic acid pairing with the complementary region of the mutant TIMM21 gene.

In other embodiments, the reagents for detecting the mutant TIMM21 gene further comprise buffers, enzymes, and inorganic salts.

And (3) amplifying the template DNA by using a primer for detecting the mutant TIMM21 gene, and carrying out mutation identification on an amplification product by sequencing or gel electrophoresis.

A kit for detecting a mutant TIMM21 gene, comprising the reagents.

In other embodiments, the kit for detecting a mutant TIMM21 gene further comprises a buffer and instructions for use.

The application of a reagent for detecting mutant TIMM21 gene or mutant TIMM21 protein in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the detection reagent for the fatal mitochondrial diseases of the infants is a reagent for a gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for a restriction enzyme digestion method or a reagent for sequencing.

The reagent for gene chip may be a probe for cDNA chip.

The DNA amplification reagent may be a primer or a probe.

The reagent for reverse transcription amplification can be a reverse transcription amplification primer and a reverse transcription amplification buffer solution.

The reagent for the restriction enzyme cutting method can be a primer containing a restriction enzyme site and a seamless cloning buffer solution.

The sequencing reagent may be a primer or a detection buffer.

The application of a reagent for detecting mutant TIMM21 gene in early molecular screening of lethal mitochondrial diseases of infants, which is used for the purpose of non-disease diagnosis.

The application of a kit for detecting a mutant TIMM21 gene in early molecular screening of lethal mitochondrial diseases of infants is a non-disease diagnosis purpose.

Compared with the prior art, the invention has the advantages that:

the invention provides a TIMM21 mutant gene, a reagent, a primer, a kit and a method for detecting the TIMM21 mutant gene and application thereof, creatively digs a LIMD pathogenic gene TIMM21, and provides a TIMM21 mutant gene site, which provides important basis for early molecular screening, family genetic research and genetic consultation of lethal mitochondrial diseases of infants.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a family diagram;

FIG. 2 is a high throughput sequencing of the TIMM21 mutant sequence.

FIG. 3 is a Sanger sequencing of the mutant sequence of TIMM 21.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

This example performed whole exome high throughput sequencing assays for multiple families of patients with infantile fatal mitochondrial disease (LIMD), which included the following sequential steps:

(1) sample collection and extraction of genomic DNA.

Clinical data of family members and blood samples (EDTA anticoagulation) were collected, which were blood samples sent to forry medical laboratory ltd.

The Blood genomic DNA of each member of the family was extracted according to the instruction procedures of the Blood DNA extraction Kit (magenta, HiPure Blood & Tissue DNA Kit). The purity of the DNA was measured using Nanodrop one, OD260nm/OD280nm of the obtained genomic DNA were each between 1.7 and 2.0, and the concentration of the DNA was measured using Nanodrop one, the concentration of the obtained genomic DNA was 50 to 100 ng/. mu.L, and the total amount was 5 to 10. mu.g. Storing at-20 deg.C.

(2) Exome sequencing and bioinformatic analysis.

In order to find other pathogenic genes of LIMD, exon sequencing was used to screen 1 LIMD families for potential genetic variation (family map is shown in FIG. 1), and no pathological variation was found in the existing LIMD pathogenic gene test.

Exome sequencing was performed on the proband. Briefly, genomic DNA was fragmented, and subjected to enzymatic fragmentation, end repair, 3' end addition of a, linker and PCR amplification by using a Kit of KAPA corporation (KAPA hyper plus Library prediction Kit); the exon regions were captured using a library construction kit (XGen outer Research Panel v2) from IGT. The library was sequenced on a Novaseq sequencer (Illumina, san diego, CA, usa) (sequencing depth 150X). NGS sequencing results were aligned to the human reference genome UCSC NCBI37/hg19 using Novocraft Novoalign to obtain a unique aligned sequence aligned to the genome. The variation of the target region was determined using VarScan mpileup2snp and VarScan mpileup2indel detection. Remove Run Common Variants and Remove Global Common Variants software were used to Remove Common variations in dbSNP and ExAC databases. The variants were then annotated using Interactive Biosoftware Alamut Batch. The database used for annotation includes: dbSNP, ExAC, 1000g, ClinVar, OMIM, etc. Py was used to rank the annotated variants by High, Medium, Low. In High and Medium packets, a precedence value and a classification reason are given to the variation. All mutations are initially in the Low group and when a mutation meets certain criteria, it can be classified as a higher level mutation. And performing SNP function prediction by using FATHMM, FATHMMMKL, METALR, METASVM, MUTATIONASSESSOR, MUTATIONTASTERAGGGD, AGVGD, LRT, PROVEAN and SIFT software.

After sequencing the whole exons of 1 LIMD family TIMM21 gene in figure 1 and bioinformatics analysis, we found that the proband carries 2 complex heterozygous mutations, and the BAM file of mutation sequencing result is shown in figure 2, wherein the gene code of the TIMM21 gene in an Ensemble database (www.ensembl.org) is ENST00000169551, the mutation TIMM21 p.Lys32Ter, and the base with the physical position 71816137 is mutated from A to T; RNA level: the 94 th base of the coding RNA of the TIMM21 gene is mutated from A to T; protein level: the 32 th amino acid of protein coded by the TIMM21 gene is mutated into a stop codon from lysine; mutation of TIMM21 p. Arg150Ter, mutation of a base with a physical position of 71822624 from A to T; RNA level: the 448 th base of the coding RNA of the TIMM21 gene is mutated from A to T; protein level: the 150 th amino acid of protein coded by the TIMM21 gene is mutated into a stop codon from arginine; no other suspected site of mutation of the pathogenic gene was found.

The mutation p.Lys32Ter and p.Arg150Ter of the TIMM21 gene is not recorded in a normal population database such as gnomaD, which leads to complete loss of the function of the protein of proband TIMM21 and seriously affects the physiological function of TIMM21 protein. According to the known biological function results, the clinical symptoms of proband LIMD are highly consistent.

According to the screening process designed by us, by means of high-throughput deep sequencing and bioinformatics analysis, we successfully found that the TIMM21 gene is a LIMD new pathogenic gene, and the mutations p.Lys32Ter and p.Arg150Ter are new pathogenic sites of the disease.

(3) And (5) carrying out Sanger sequencing verification to identify the mutant gene.

Sanger sequencing was used to verify 2 mutations of the TIMM21 gene detected by exon sequencing: c.94A > T and c.448A > T (see FIG. 3). Primer 3 Primer design software is adopted to design Primer sequences SEQ ID NO. 3-SEQ ID NO.6, and the Primer sequences amplify genome DNA fragments containing TIMM21 gene mutation sites.

The PCR amplification system (20. mu.l) included: PCR 5 Xbuffer mix 10. mu.l, forward primer (10. mu. mol) 1. mu.l, reverse primer (10. mu. mol) corresponding to the forward primer 1. mu.l, ddH₂O6. mu.l, DNA 2. mu.l. PCR reaction procedure: at 95 deg.C for 5min, for 35 cycles (95 deg.C for 5min, 95 deg.C for 30s, 60 deg.C for 30s), at 72 deg.C for 10min, and at 4 deg.C. After PCR amplification is finished, 1% agarose gel electrophoresis is adopted for detection, PCR product gel is recovered by cutting gel, and products are recovered by Taq enzyme purification. All PCR products were sequenced with forward and reverse primers, respectively. The sequencing results are shown in FIG. 3.

In summary, the identified mutant TIMM21 gene of the present invention can be used for early clinical screening of LIMD patients, and the above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and various modifications and variations can be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Fuzhou Furui medical laboratory Co., Ltd

<120> TIMM21 mutant gene, primer, kit and method for detecting same, and use thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 747

<212> DNA

<213> human (human)

<400> 1

atgatttgta cttttctacg agccgtacag tatacggaga agctgcacag gtcctcggca 60

aagcgattgc ttttgccata catcgtgctt aacaaagcgt gcttgaagac tgagcccagt 120

ttgagatgtg ggcttcaata tcaaaagaaa acgctgcgac ctagatgtat tcttggagtc 180

acccagaaaa ccatctggac gcagggaccg agcccccgaa aagcaaagga ggatggcagc 240

aaacaagtgt ctgtgcacag gagtcagaga gggggaaccg ccgtcccaac atcacaaaaa 300

gtgaaagaag ccggaagaga ttttacctat ttaatagtgg tgctttttgg aatcagcatt 360

acaggtggct tgttttacac gattttcaaa gaactttttt cttcatccag tcctagcaag 420

atatatggga gagccttaga aaaatgcaga tcacatcctg aggtgatcgg tgtctttggt 480

gagtctgtta aaggctatgg ggaggtgaca aggcggggtc gccggcagca tgtcaggttc 540

actgaatatg taaaagatgg gctgaaacac acgtgtgtga aattctacat tgagggctct 600

gagccaggga agcaaggaac ggtgtatgcg caagtgaaag agaacccagg aagtggtgaa 660

tatgattttc gatatatatt tgtagaaatt gaatcttatc ctagaagaac tattatcatt 720

gaagataatc gatcccaaga tgattaa 747

<210> 2

<211> 248

<212> PRT

<213> human (human)

<400> 2

Met Ile Cys Thr Phe Leu Arg Ala Val Gln Tyr Thr Glu Lys Leu His

1 5 10 15

Arg Ser Ser Ala Lys Arg Leu Leu Leu Pro Tyr Ile Val Leu Asn Lys

20 25 30

Ala Cys Leu Lys Thr Glu Pro Ser Leu Arg Cys Gly Leu Gln Tyr Gln

35 40 45

Lys Lys Thr Leu Arg Pro Arg Cys Ile Leu Gly Val Thr Gln Lys Thr

50 55 60

Ile Trp Thr Gln Gly Pro Ser Pro Arg Lys Ala Lys Glu Asp Gly Ser

65 70 75 80

Lys Gln Val Ser Val His Arg Ser Gln Arg Gly Gly Thr Ala Val Pro

85 90 95

Thr Ser Gln Lys Val Lys Glu Ala Gly Arg Asp Phe Thr Tyr Leu Ile

100 105 110

Val Val Leu Phe Gly Ile Ser Ile Thr Gly Gly Leu Phe Tyr Thr Ile

115 120 125

Phe Lys Glu Leu Phe Ser Ser Ser Ser Pro Ser Lys Ile Tyr Gly Arg

130 135 140

Ala Leu Glu Lys Cys Arg Ser His Pro Glu Val Ile Gly Val Phe Gly

145 150 155 160

Glu Ser Val Lys Gly Tyr Gly Glu Val Thr Arg Arg Gly Arg Arg Gln

165 170 175

His Val Arg Phe Thr Glu Tyr Val Lys Asp Gly Leu Lys His Thr Cys

180 185 190

Val Lys Phe Tyr Ile Glu Gly Ser Glu Pro Gly Lys Gln Gly Thr Val

195 200 205

Tyr Ala Gln Val Lys Glu Asn Pro Gly Ser Gly Glu Tyr Asp Phe Arg

210 215 220

Tyr Ile Phe Val Glu Ile Glu Ser Tyr Pro Arg Arg Thr Ile Ile Ile

225 230 235 240

Glu Asp Asn Arg Ser Gln Asp Asp

245

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atacggagaa gctgcacagg tc 22

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgatgttggg acggcggttc 20

<210> 5

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgttgccctt gcttcgcttc at 22

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cagagtgctt gcacggacac at 22

Claims

1. A mutant TIMM21 gene or a mutant TIMM21 protein, wherein: the mutant TIMM21 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

c.94A>T、c.448A>T；

p.Lys32Ter、p.Arg150Ter。

2. a method of detecting the mutant TIMM21 gene or mutant TIMM21 protein of claim 1 for a non-diagnostic purpose, wherein the method comprises: the method comprises detecting the presence or absence of a mutation site in the TIMM21 gene or the TIMM21 protein, said mutation site being at least one of:

chr18(GRCh37) g.71816137A > T, cDNA sequence occurrence c.94A > T, p.Lys32Ter;

chr18(GRCh37) g.71822624A > T, cDNA sequence generation c.448A > T, p.Arg150Ter.

3. The method of claim 2, wherein: the method comprises the step of performing PCR amplification by using at least one set of primers as follows:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

4. The method of claim 3, wherein: the PCR amplification reaction program comprises: 94-100 deg.C, 1-10 min; 94-95 deg.C, 3-5min, 95-96 deg.C, 25-30s, 58-60 deg.C, 25-30s, 30-40 times of circulation, 70-72 deg.C, 1-10 min.

5. A reagent for detecting a mutant TIMM21 gene, comprising: the reagent is a nucleic acid detection probe or primer;

the base with the physical position of 71816137 of chromosome 18 is mutated from A to T, and the base with the physical position of 71822624 of chromosome 18 is mutated from A to T;

c.94A>T、c.448A>T；

physical positions 71816137 th, 71822624 th; 94 th and 448 th positions of the cDNA sequence;

the primer is at least one group of primers with the following sequences:

3 and 4;

SEQ ID NO 5 and SEQ ID NO 6.

6. A kit for detecting a mutant TIMM21 gene, comprising: comprising the reagent according to claim 5.

7. The application of a reagent for detecting mutant TIMM21 gene or mutant TIMM21 protein in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the mutant TIMM21 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

c.94A>T、c.448A>T；

p.Lys32Ter、p.Arg150Ter。

8. the use of claim 7, wherein the reagent for detecting lethal mitochondrial disease in infants is a reagent for gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for restriction enzyme digestion or a reagent for sequencing.