CN113265405B - SAMM50 mutant gene, primer, kit and method for detecting same, and use thereof - Google Patents

Abstract

The invention relates to a SAMM50 mutant gene related to LIMD, a primer, a kit and a method for detecting the same and application thereof, wherein the mutant SAMM50 gene has one of the following mutations compared with GRCh 37: the base with the physical position of No. 22 chromosome 44369134 is mutated from T to G, and the base with the physical position of No. 22 chromosome 44373821 is mutated from C to T; the cDNA sequence of the mutant SAMM50 gene has one of the following mutations compared to the sequence of SEQ ID NO. 1: c.579T > G, c.919C > T; the sequence of the mutant SAMM50 protein has one of the following mutations compared to the sequence of SEQ ID No. 2: p.tyr193ter, p.gln307ter. The invention provides important basis for early molecular screening and family genetic research of LIMD.

Description

SAMM50 mutant gene, primer, kit and method for detecting same, and use thereof

Technical Field

The invention relates to disease-related mutant genes, in particular to SAMM50 mutant genes, primers, a kit and a method for detecting the same and application thereof.

Background

The incidence of mitochondrial disease is highest among all inherited metabolic diseases. Mitochondria are primarily responsible for oxidative phosphorylation to produce adenosine triphosphate. The pathogenesis of mitochondrial diseases involves two distinct genomes: nuclear genome and maternal inherited 16.6kb mitochondrial genome. Mitochondrial diseases can be caused by mutations in any of these genomes. Defects in nuclear DNA (nDNA) can lead to problems such as respiratory chain complex structure, translation, and mitochondrial DNA (mtDNA) repair defects. Of the mitochondrial diseases diagnosed in childhood, about 25% are due to mitochondrial DNA abnormalities and the remaining 75% are due to nDNA defects. Severe neonatal or infant onset mitochondrial disease usually leads to death within one year of birth, and infant lethal mitochondrial disease (LIMD) accounts for about 8.5% of cases with childhood onset mitochondrial disease, but LIMD has a low molecular genetic diagnosis rate, and most LIMD cases are diagnosed by biochemical and genetic methods after death of the subject. Thus, when parents become pregnant again, such neonatal onset of severe mitochondrial disease may reoccur due to a diagnosis that is not timely. Although nearly thousands of nuclear genomic genes have been found to be involved in mitochondrial function, only a small proportion have been identified as being involved in the development of LIMD, suggesting that there are new LIMD causative genes to be explored.

Disclosure of Invention

The invention aims to provide a SAMM50 mutant gene related to lethal mitochondrial diseases of infants, a primer, a kit and a method for detecting the same and application thereof.

The purpose of the invention is realized by the following technical scheme:

a mutant SAMM50 gene or mutant SAMM50 protein, said mutant SAMM50 gene having at least one of the following mutations compared to a human genome reference sequence GRCh 37:

the base with the physical position of No. 22 chromosome 44369134 is mutated from T to G, and the base with the physical position of No. 22 chromosome 44373821 is mutated from C to T;

the cDNA sequence of the mutant SAMM50 gene has at least one of the following mutations compared to the sequence of SEQ ID No. 1:

c.579T>G、c.919C>T；

the sequence of said mutant SAMM50 protein has at least one of the following mutations compared to the sequence of SEQ ID No. 2:

p.Tyr193Ter (193 tyrosine mutated to stop codon), p.Gln307Ter (307 glutamine mutated to stop codon).

The SAMM50 SORTING AND ASSEMBLY MACHINERY COMPONENT (SAMM 50 Classification Assembly MACHINERY COMPONENT, SAMM 50) gene is located on chromosome 22 at position 22q13.31 AND contains 15 exons AND encodes a SAMM50 protein of 469 amino acids with a molecular weight of about 51kDa. SAMM50 plays a crucial role in maintaining the proper assembly of mitochondrial cristae structure and mitochondrial respiratory chain complex, and is involved in the assembly of TOMM40 into TOM complex. At present, the correlation with diseases is not reported.

The wild-type SAMM50 gene in the Ensemble database (www. Ensembl. Org) encodes ENSG00000100347, which is located on chromosome 22. The inventor utilizes genetic research screening in a large number of normal people and LIMD patient families to find that the gene mutation of SAMM50 gene can cause lethal mitochondrial diseases of infants. The invention provides a new pathogenic mutation site of a pathogenic gene and provides a new molecular biology basis for early molecular screening of the disease.

The first mutation and the second mutation are both positioned in a translation region, wherein the physical position of the first mutation is 44369134, and the base T mutation is G; RNA level: the 579 th basic group of the cDNA sequence of the SAMM50 gene is mutated from T to G; protein level: the 193 th amino acid of the protein coded by the SAMM50 gene is mutated into a stop codon from tyrosine.

The second mutation was at the physical position 44373821, base was mutated from C to T, RNA level: the 919 th base of the cDNA sequence of the SAMM50 gene is mutated from C to T; protein level: the 307 th amino acid of the protein coded by the SAMM50 gene is mutated into a stop codon from glutamine.

A method of detecting a mutant SAMM50 gene or a mutant SAMM50 protein for non-diagnostic purposes, said method comprising detecting the presence or absence of a mutation site in a SAMM50 gene or a SAMM50 protein; the mutation site is at least one of the following:

chr22 (GRCh 37) g.44369134T > G, cDNA sequence generation c.579T > G, p.Tyr193Ter (193 tyrosine is mutated into stop codon);

chr22 (GRCh 37): g.44373821C > T, cDNA sequence c.919C > T, p.Gln307Ter (glutamine at position 307 mutated to a stop codon).

In some embodiments, the purpose of the non-diagnostic diseases described in the present invention includes, but is not limited to, studying SNP distribution and polypeptidases for family evolution studies. Such applications will be understood by those skilled in the art.

Some individuals carry the mutant SAMM50 genes of the invention but do not suffer from LIMD, e.g. heterozygous genotypes carrying the mutation in only one chromosome. The detection of this portion of the population may not be relevant for any purpose of diagnosing the disease, since these individuals are not themselves diseased. But the results of their detection can be used as useful information, for example as an important indicator of prenatal examination, to guide fertility, or for mutation carrier screening, or as a tool for SNP distribution and polymorphism studies or to follow gene mutations or family evolution. Such applications are also understood by those skilled in the art. Thus, the methods provided by the present invention for detecting mutant SAMM50 genes or mutant SAMM50 proteins involve detecting heterozygous mutations.

However, the methods of detecting mutant SAMM50 genes or mutant SAMM50 proteins provided herein also include detecting homozygous mutations.

In a preferred embodiment of the present invention, the method for detecting mutant SAMM50 gene or mutant SAMM50 protein comprises a step of performing PCR amplification using at least one set of primers:

SAMM50_ E7F GTCTTGGTCGTGCAGAAAGG (SEQ ID NO: 3) and

SAMM50_E7R:TAAGGAGCTGCTAACATGGGC(SEQ ID NO:4)；

SAMM50_ E10F GAACTGGCAGGCTACACTGG (SEQ ID NO: 5) and

SAMM50_E10R:AAGGTTAAGCATTACCGCCCAG(SEQ ID NO:6)。

in a preferred embodiment of the present invention, the PCR reaction procedure using the primers for amplification comprises: 94-100 deg.C, 1-10min;94-95 ℃,3-5min,95-96 ℃,25-30s,58-60 ℃,25-30s, 30-40 times of circulation, 70-72 ℃ and 1-10min.

The method for detecting the mutant SAMM50 gene comprises the following steps:

(1) Establishing a family clinical and genetic resource library of LIMD patients, collecting clinical information and blood samples of LIMD families, and extracting genome DNA;

(2) Designing amplification and sequencing primers covering SAMM50 gene full exon sequences for sequencing;

(3) And comparing the sequencing results of the family samples of the normal person and the LIMD patient.

In one embodiment, the sequencing is a Sanger sequencing.

In another embodiment, the method for detecting a mutant SAMM50 gene may be performed by a technique selected from the group consisting of:

electrophoresis, nucleic acid hybridization, in situ hybridization, PCR, reverse transcriptase chain reaction, and denaturing high performance liquid chromatography.

In other embodiments, it also relates to a method for detecting exon and exon/intron boundary mutations in a SAMM50 gene, comprising the steps of:

(1) Extracting a DNA sample from a subject;

(2) Sequencing the exome and all exon/intron boundary sequences of the DNA sample to obtain sequencing fragments;

(3) And comparing the sequencing fragment with a reference sequence to obtain the exon and exon/intron boundary mutation of the gene.

A reagent for detecting a mutant SAMM50 gene, wherein the reagent is a nucleic acid detection probe or primer;

the nucleic acid detection probe is complementary to a mutant SAMM50 gene; the mutant SAMM50 gene has at least one of the following mutations compared to the human genome reference sequence GRCh 37:

the base with the physical position of No. 22 chromosome 44369134 is mutated from T to G, and the base with the physical position of No. 22 chromosome 44373821 is mutated from C to T;

the cDNA sequence of the mutant SAMM50 gene has at least one of the following mutations compared to the sequence of SEQ ID No. 1:

c.579T>G、c.919C>T；

the region of the nucleic acid detection probe complementary to the mutant SAMM50 gene includes a physical location or a cDNA sequence location selected from at least one of:

physical positions 44369134, 44373821; the 579 th and 919 th cDNA sequences;

the primer is at least one group of primers with the following sequences:

SAMM50_ E7F GTCTTGGTCGTGCAGAAAGG (SEQ ID NO: 3) and

SAMM50_E7R:TAAGGAGCTGCTAACATGGGC(SEQ ID NO:4)；

SAMM50_ E10F GAACTGGCAGGCTACACTGG (SEQ ID NO: 5) and

SAMM50_E10R:AAGGTTAAGCATTACCGCCCAG(SEQ ID NO:6)。

the nucleic acid detection probe realizes detection of the mutant SAMM50 gene by nucleic acid pairing with a complementary region of the mutant SAMM50 gene.

In other embodiments, the reagent for detecting a mutant SAMM50 gene further comprises a buffer, an enzyme, an inorganic salt.

And (3) amplifying the template DNA by adopting a primer for detecting the mutant SAMM50 gene, and carrying out mutation identification on an amplification product by sequencing or gel electrophoresis.

A kit for detecting a mutant SAMM50 gene comprising said reagents.

In other embodiments, the kit for detecting mutant SAMM50 gene further comprises a buffer and instructions for use.

Application of a reagent for detecting mutant SAMM50 gene or mutant SAMM50 protein in preparing a reagent for detecting lethal mitochondrial diseases of infants;

the detection reagent for the fatal mitochondrial diseases of the infants is a reagent for a gene chip, a reagent for DNA amplification, a reagent for reverse transcription amplification, a reagent for a restriction enzyme digestion method or a reagent for sequencing.

The reagent for gene chip may be a probe for cDNA chip.

The DNA amplification reagent may be a primer or a probe.

The reagent for reverse transcription amplification can be a reverse transcription amplification primer and a reverse transcription amplification buffer solution.

The reagent for the restriction enzyme cutting method can be a primer containing a restriction enzyme site and a seamless cloning buffer solution.

The sequencing reagent may be a primer or a detection buffer.

The application of a reagent for detecting mutant SAMM50 gene in early molecular screening of lethal mitochondrial diseases of infants is a non-disease diagnosis purpose.

An application of a kit for detecting mutant SAMM50 genes in early molecular screening of lethal mitochondrial diseases of infants is disclosed, and the application is a non-disease diagnosis purpose.

Compared with the prior art, the invention has the advantages that:

the invention provides an SAMM50 mutant gene, a reagent, a primer, a kit and a method for detecting the SAMM50 mutant gene and application thereof, creatively excavates an LIMD pathogenic gene SAMM50, and provides an SAMM50 mutant gene locus, which provides important basis for early molecular screening, family genetic research and genetic consultation of lethal mitochondrial diseases of infants.

Drawings

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 is a family diagram;

FIG. 2 is a high throughput sequencing map of SAMM50 mutant sequences.

FIG. 3 is a Sanger sequencing chart of the SAMM50 mutant sequence.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.

The features and properties of the present invention are described in further detail below with reference to examples.

Example 1

This example performed whole exome high throughput sequencing assays for multiple families of patients with infantile fatal mitochondrial disease (LIMD), which included the following sequential steps:

(1) Sample collection and extraction of genomic DNA.

Clinical data of family members and blood samples (EDTA anticoagulation) were collected, which were blood samples sent to forry medical laboratory ltd.

Blood genomic DNA of each member of the family was extracted according to the instruction procedures of a Blood DNA extraction Kit (magenta, hiPure Blood & Tissue DNA Kit). The purity of the DNA was measured using Nanodrop one, and the OD260nm/OD280nm of the genomic DNA obtained was between 1.7 and 2.0, and the concentration of the DNA was measured using Nanodrop one, and the concentration of the genomic DNA obtained was 50 to 100 ng/. Mu.L, and the total amount was 5 to 10. Mu.g. Storing at-20 deg.C.

(2) Exome sequencing and bioinformatic analysis.

In order to find other pathogenic genes of LIMD, exon sequencing was used to screen 1 LIMD family for potential genetic variation (family map is shown in FIG. 1), and no pathological variation was found in the existing LIMD pathogenic gene test.

Exome sequencing was performed on the proband. Briefly, genomic DNA was fragmented, and subjected to enzymatic fragmentation, end repair, 3' end addition of a, linker and PCR amplification by using a Kit of KAPA corporation (KAPA hyper plus Library prediction Kit); the exon regions were captured using a library construction kit (XGen outer Research Panel v 2) from IGT. The library was sequenced on a Novaseq sequencer (Illumina, san diego, CA, usa) (sequencing depth 150X). NGS sequencing results were aligned to the human reference genome UCSC NCBI37/hg19 using Novocraft Novoalign to obtain a unique aligned sequence aligned to the genome. The variation of the target region was determined using VarScan mpileup2snp and VarScan mpileup2indel detection. Remove Run Common Variants and Remove Global Common Variants software were used to Remove Common variations in dbSNP and ExAC databases. The variants were then annotated using Interactive Biosoftware Alamut Batch. The database used for annotation includes: dbSNP, exAC, 1000g, clinVar, OMIM, etc. Py was used to rank the annotated variants by High, medium, low. In High and Medium packets, a precedence value and a classification reason are given to the variation. All mutations are initially in the Low group and when a mutation meets certain criteria, it can be classified as a higher level mutation. And performing SNP function prediction by using FATHMM, FATHMMMKL, METALR, METASVM, MUTATIONASSESSOR, MUTATIONTASTERAGGGD, AGVGD, LRT, PROVEAN and SIFT software.

After sequencing all exons and bioinformatics analysis of 1 LIMD pedigree SAMM50 gene in fig. 1, we found that proband carried 2 compound heterozygous mutations, BAM file of mutation sequencing results is shown in fig. 2, and gene coding of SAMM50 gene in the Ensemble database (www.ensembler.org) is ENSG00000100347, wherein SAMM50 p.tyr193ter is mutated from T to G at physical position 44369134; RNA level: the 579 th basic group of the SAMM50 gene coding RNA is mutated from T to G; protein level: amino acid 193 of SAMM50 gene coding protein is mutated from tyrosine to stop codon; SAMM50 p.Gln307Ter was mutated from C to T at the base 44373821; RNA level: the 919 th base of SAMM50 gene coding RNA is mutated from C to T; protein level: the 307 th amino acid of the SAMM50 gene coding protein is mutated into a stop codon from glutamine; no other suspected site of mutation of the causative gene was found.

The above SAMM50 gene mutations p.Tyr193Ter and p.Gln307Ter, which were not recorded in a normal population database such as gnomaD, resulted in complete loss of the function of the SAMM50 protein of the predecessor, and severely affected the physiological function of the SAMM50 protein. According to the known biological function results, the clinical symptoms of proband LIMD are highly consistent.

According to the screening process designed by us, by means of high-throughput deep sequencing and bioinformatics analysis, we successfully find that SAMM50 gene is a new pathogenic gene of LIMD, and mutations p.Tyr193Ter and p.Gln307Ter are new pathogenic sites of the disease.

(3) And (5) carrying out Sanger sequencing verification to identify the mutant gene.

Sanger sequencing was used to verify the 2 mutations of SAMM50 gene detected by exon sequencing: c.579T > G, c.919C > T (see FIG. 3). Primer sequences SEQ ID NO. 3-SEQ ID NO.6 are designed by using Primer 3 Primer design software, and the Primer sequences amplify genome DNA fragments containing SAMM50 gene mutation sites.

The PCR amplification system (20. Mu.l) included: PCR 5 × buffer mix 10 μ l, forward primer (10 μmol) 1 μ l, reverse primer (10 μmol) corresponding to the forward primer 1 μ l, ddH ₂ O6. Mu.l, DNA 2. Mu.l. Procedure for PCR reactionThe method comprises the following steps: at 95 ℃ for 5min,35 cycles (95 ℃ for 5min,95 ℃ for 30s,60 ℃ for 30 s), 72 ℃ for 10min, and 4 ℃ for storage. After PCR amplification is finished, 1% agarose gel electrophoresis is adopted for detection, PCR product gel is recovered by cutting gel, and products are recovered by Taq enzyme purification. All PCR products were sequenced with forward and reverse primers, respectively. The sequencing results are shown in FIG. 3.

In summary, the mutant SAMM50 genes identified in the present invention are useful for early clinical screening of LIMD patients, and the above description is only a preferred embodiment of the present invention, and is not intended to limit the present invention, and various modifications and variations of the present invention are possible to those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> Fuzhou Furui medical laboratory Co., ltd

<120> SAMM50 mutant gene, primer, kit and method for detecting same, and use thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1410

<212> DNA

<213> human (human)

<400> 1

atggggactg tgcacgcccg gagtttggag cctcttccat caagtggacc tgattttgga 60

ggattaggag aagaagctga atttgttgaa gttgagcctg aagctaaaca ggaaattctt 120

gaaaacaaag atgtggttgt tcaacatgtt cattttgatg gacttggaag gactaaagat 180

gatatcatca tttgtgaaat tggagatgtt ttcaaggcca aaaacctaat tgaggtaatg 240

cggaaatctc atgaagcccg tgaaaaattg ctccgtcttg gaatttttag acaagtggat 300

gttttgattg acacatgtca aggtgatgac gcacttccaa atgggttaga cgttaccttt 360

gaagtaactg aattgaggag attaacgggc agttataaca ccatggttgg aaacaatgaa 420

ggcagtatgg tacttggcct caagcttcct aatcttcttg gtcgtgcaga aaaggtgacc 480

tttcagtttt cctatggaac aaaagaaact tcgtatggcc tgtccttctt caaaccacgg 540

cccggaaact tcgaaagaaa tttctctgta aacttatata aagttactgg acagttccct 600

tggagctcac tgcgggagac ggacagagga atgtcagctg agtacagttt tcccatatgg 660

aagaccagcc acactgtcaa gtgggaaggc gtatggcgag aactgggctg cctctcaagg 720

acggcgtcat ttgctgttcg aaaagaaagc ggacattcac tgaaatcatc tctttcgcac 780

gccatggtca tcgattctcg gaattcttcc atcttaccaa ggagaggtgc tttgctgaaa 840

gttaaccagg aactggcagg ctacactggc ggggatgtga gcttcatcaa agaagatttt 900

gaacttcagt tgaacaagca actcatattt gattcagttt tttcagcgtc tttctggggc 960

ggaatgttgg tacccattgg tgataagccg tcaagcattg ctgataggtt ttaccttggg 1020

ggacccacaa gcatccgcgg attcagcatg cacagcatcg ggccacagag cgaaggagac 1080

tacctaggtg gagaagcgta ctgggccggc ggcctgcacc tctacacccc attacctttc 1140

cggccaggcc agggtggctt tggagaactt ttccgaacac acttctttct caacgcagga 1200

aacctctgca acctcaacta tggggagggc cccaaagctc atattcgtaa gctggctgag 1260

tgcatccgct ggtcgtacgg ggccgggatt gtcctcaggc ttggcaacat cgctcggttg 1320

gaacttaatt actgcgtccc catgggagta cagacaggcg acaggatatg tgatggcgtc 1380

cagtttggag ctgggataag gttcctgtag 1410

<210> 2

<211> 469

<212> PRT

<213> person (human)

<400> 2

Met Gly Thr Val His Ala Arg Ser Leu Glu Pro Leu Pro Ser Ser Gly

1 5 10 15

Pro Asp Phe Gly Gly Leu Gly Glu Glu Ala Glu Phe Val Glu Val Glu

20 25 30

Pro Glu Ala Lys Gln Glu Ile Leu Glu Asn Lys Asp Val Val Val Gln

35 40 45

His Val His Phe Asp Gly Leu Gly Arg Thr Lys Asp Asp Ile Ile Ile

50 55 60

Cys Glu Ile Gly Asp Val Phe Lys Ala Lys Asn Leu Ile Glu Val Met

65 70 75 80

Arg Lys Ser His Glu Ala Arg Glu Lys Leu Leu Arg Leu Gly Ile Phe

85 90 95

Arg Gln Val Asp Val Leu Ile Asp Thr Cys Gln Gly Asp Asp Ala Leu

100 105 110

Pro Asn Gly Leu Asp Val Thr Phe Glu Val Thr Glu Leu Arg Arg Leu

115 120 125

Thr Gly Ser Tyr Asn Thr Met Val Gly Asn Asn Glu Gly Ser Met Val

130 135 140

Leu Gly Leu Lys Leu Pro Asn Leu Leu Gly Arg Ala Glu Lys Val Thr

145 150 155 160

Phe Gln Phe Ser Tyr Gly Thr Lys Glu Thr Ser Tyr Gly Leu Ser Phe

165 170 175

Phe Lys Pro Arg Pro Gly Asn Phe Glu Arg Asn Phe Ser Val Asn Leu

180 185 190

Tyr Lys Val Thr Gly Gln Phe Pro Trp Ser Ser Leu Arg Glu Thr Asp

195 200 205

Arg Gly Met Ser Ala Glu Tyr Ser Phe Pro Ile Trp Lys Thr Ser His

210 215 220

Thr Val Lys Trp Glu Gly Val Trp Arg Glu Leu Gly Cys Leu Ser Arg

225 230 235 240

Thr Ala Ser Phe Ala Val Arg Lys Glu Ser Gly His Ser Leu Lys Ser

245 250 255

Ser Leu Ser His Ala Met Val Ile Asp Ser Arg Asn Ser Ser Ile Leu

260 265 270

Pro Arg Arg Gly Ala Leu Leu Lys Val Asn Gln Glu Leu Ala Gly Tyr

275 280 285

Thr Gly Gly Asp Val Ser Phe Ile Lys Glu Asp Phe Glu Leu Gln Leu

290 295 300

Asn Lys Gln Leu Ile Phe Asp Ser Val Phe Ser Ala Ser Phe Trp Gly

305 310 315 320

Gly Met Leu Val Pro Ile Gly Asp Lys Pro Ser Ser Ile Ala Asp Arg

325 330 335

Phe Tyr Leu Gly Gly Pro Thr Ser Ile Arg Gly Phe Ser Met His Ser

340 345 350

Ile Gly Pro Gln Ser Glu Gly Asp Tyr Leu Gly Gly Glu Ala Tyr Trp

355 360 365

Ala Gly Gly Leu His Leu Tyr Thr Pro Leu Pro Phe Arg Pro Gly Gln

370 375 380

Gly Gly Phe Gly Glu Leu Phe Arg Thr His Phe Phe Leu Asn Ala Gly

385 390 395 400

Asn Leu Cys Asn Leu Asn Tyr Gly Glu Gly Pro Lys Ala His Ile Arg

405 410 415

Lys Leu Ala Glu Cys Ile Arg Trp Ser Tyr Gly Ala Gly Ile Val Leu

420 425 430

Arg Leu Gly Asn Ile Ala Arg Leu Glu Leu Asn Tyr Cys Val Pro Met

435 440 445

Gly Val Gln Thr Gly Asp Arg Ile Cys Asp Gly Val Gln Phe Gly Ala

450 455 460

Gly Ile Arg Phe Leu

465

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtcttggtcg tgcagaaaag g 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

taaggagctg ctaacatggg c 21

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gaactggcag gctacactgg 20

<210> 6

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

aaggttaagc attaccgccc ag 22

Claims (1)

1. Application of a reagent for detecting mutant SAMM50 gene or mutant SAMM50 protein in preparation of a reagent for detecting lethal mitochondrial diseases of infants;

the mutations of the mutant SAMM50 gene compared to the human genome reference sequence GRCh37 are as follows:

the base with the physical position of No. 22 chromosome 44369134 is mutated from T to G, and the base with the physical position of No. 22 chromosome 44373821 is mutated from C to T;

the mutations of the cDNA sequence of the mutant SAMM50 gene compared to the sequence of SEQ ID No.1 are as follows:

c.579T > G and c.919C > T;

the mutations of the sequence of the mutant SAMM50 protein compared to the sequence of SEQ ID No.2 are as follows:

p.tyr193ter and p.gln307ter.

Images