CN111995690B

CN111995690B - Artificially synthesized insect-resistant protein mCry1Ia2 and preparation method and application thereof

Info

Publication number: CN111995690B
Application number: CN202010915439.2A
Authority: CN
Inventors: 于壮; 岳莉莉
Original assignee: Heilongjiang Dapeng Agriculture Co ltd
Current assignee: Heilongjiang Dapeng Agriculture Co ltd
Priority date: 2020-01-16
Filing date: 2020-09-03
Publication date: 2022-10-11
Anticipated expiration: 2040-09-03
Also published as: CN111100208A; CN111995690A

Abstract

The invention discloses an artificially synthesized insect-resistant protein mCry1Ia2. The invention also discloses a nucleic acid molecule of the protein, and a recombinant vector, a host cell or a recombinant bacterium of the nucleic acid molecule. Also discloses applications of the protein, the nucleic acid molecule, a recombinant vector, a host cell or a recombinant bacterium of the nucleic acid molecule in regulating and controlling plant insect resistance, killing insects or improving transgenic plant insect resistance and preparing insecticides or insect-proof preparations. In vitro experiments prove that the modified and synthesized Bt gene toxoprotein has higher insecticidal activity to corn borers and has obvious insecticidal effect to Cry1Ab, cry1F and Cry1Ie toxoprotein resistant corn borer populations. The invention constructs a novel plant expression vector by using a constitutive promoter, and the insect-resistant gene mCry1Ia2 can be stably and efficiently expressed in monocotyledons, so that the insect-resistant gene mCry1Ia2 can be further used for producing insect-resistant transgenic plants.

Description

Artificially synthesized insect-resistant protein mCry1Ia2, and preparation method and application thereof

Technical Field

The invention relates to the field of genetic engineering and biological control, in particular to an artificially synthesized insect-resistant protein mCry1Ia2 and a preparation method and application thereof.

Background

The Bt gene codes insecticidal crystal protein, comes from Bacillus thuringiensis (Bacillus thuringiensis), is widely present in water, soil, desert, leaves and insect corpses, and is the biological insecticide with the largest yield and the most widely used nowadays. It can form Insecticidal Crystal Protein (ICP) when forming spores, also called delta-endotoxin, and can generate specific insecticidal activity to agricultural pests such as lepidoptera and coleoptera. The action process comprises the steps of swallowing protoxin by an insect body, performing enzymolysis and activation on the protoxin, enabling the toxin to pass through a peritrophic membrane, combining the toxin with a specific receptor, embedding toxin molecules into an epidermal cell membrane, forming an ion channel, and performing cell lysis after the ion imbalance of midgut cells. Over the past several decades, several tens of Bacillus thuringiensis strains and 130 or more of their encoded insecticidal crystal proteins have been identified.

The nucleotide sequence of the cry gene cloned from Bacillus thuringiensis was published by Whiteley and Schnepf in 1985. With the continued discovery of new Bt strains and the cloning of Bt genes, members of the Bt family are increasing, and 975 insecticidal protein genes, including 789 Cry genes, 38 Cyt genes, and 142 Vip genes, have been identified and named in isolated Bt strains at present, based on the latest updated statistics of the database (www.lifesci.suslex.ac.uk). The cultivation of insect-resistant transgenic crops by introducing Bt genes into plants is the main application direction of Bt genes. According to data statistics of the international agricultural biotechnology application service organization (ISAAA) website, 345 transformation events by safety evaluation of Bt genes exist, wherein 255 maize transformant events pass approval.

Nongsanto and Dicka obtained a fructified normal transgenic Bt maize in 1990. In 1993, maize transformed with cry1Ab gene was developed by Koziel et al, and transgenic maize lines obtained by transforming cry1Ab gene by Michael et al were highly resistant to corn borer. In 1996, transgenic insect-resistant maize was grown commercially in the United states. In 1997, 4 varieties of transgenic Bt maize were officially approved for sale in the United states, including mon810 by Monsanto, bt176 and Bt11 by Syngenta, and DBT418 by Dicard, all of which are corn borers, and the annual planting area of insect-resistant transgenic maize reached 320 kilohm ² . Since cutworms, corn rootworms and other soil insects also affect corn yields, monsanto corporation promoted the control of the soil insect "mon863" (cry 3 Bb) and obtained an insect-resistant corn "mon863 × mon810" that has control effects on corn borers and soil insects at the same time. In 2007 and 2008, mr 604 (cry 3A) and mir162 (Vip 3 Aa) for controlling lepidopteran pests and soil insects were introduced by the first zhengda company. Two-gene "bt11 × GA21 × mir162" and three-gene "bt11 × mir162 × mir604 × GA21" insect-resistant maize were introduced in 2011 and 2012, respectively.

China starts to research the insect-resistant transgenic corn later, but the research has made great progress in recent years, and a plurality of heritages are obtainedStable transformant with better insect-resistant character and transgenic hybrid combination. Queen et al (1995) transferred pB48.415 plasmid into maize callus by a particle gun method to obtain transgenic plant, and identified it had a certain insect resistance. Zhang Li Nu et al (2003) transfer the modified Bt, SCK and Bt bivalent insect-resistant gene into maize inbred line R18 by gene gun method, to obtain a large number of transgenic plants. Zhang Yan Zhen et al (2004) adopt agrobacterium-mediated method to introduce Bt gene into corn inbred line 4112 and Dan 340, and molecular detection method proves that exogenous gene has been stably integrated on corn genome, and average transformation rate reaches 2.35%. plum-Yuehang, etc. (2005) in maize inbred line S ₁ Transferring Bt and GNA genes into the strain to obtain a strain capable of simultaneously amplifying two target genes, and performing indoor insect resistance identification to discover the strain with stronger resistance. Xishu tree chapter and the like (2015) obtain the GmCry1F gene by a codon optimization method, and the gene is transferred into a corn material, so that a new material is provided for breeding insect-resistant varieties. Wangyang et al (2016) exchanged the domain of Cry1Ab with Cry1Ial domain, followed by codon optimization and transformation into maize, obtained genetically stable new germplasm against corn borer. The Chinese agriculture university utilizes the insect-resistant gene mCry1Ac with the independent property right to culture an excellent transformant Bt-799, and the transgenic insect-resistant corn Bt-799 expresses high resistance to Asiatic corn borers under the condition of insect inoculation in the field heart leaf stage. In 12 months of 2019, DBN9936 insect-resistant corn of Cry1Ab gene transferred by Beijing Dabei agricultural biotechnology limited company and double-resistant 12-5 corn of Cry1Ab/Cry2Aj transferred by Hangzhou Ruifeng Biotech limited company and Zhejiang university respectively obtain safety certificate approval.

Cry1Ab is the most widely applied in transgenic crops, is a parasporal crystal which is generated by bacillus thuringiensis and has a poisoning effect on lepidoptera pests, and has important application prospects in the field of biological control. The Bacillus thuringiensis delta-endotoxin gene Cry1Ab is derived from microorganisms, but the transgenic plants thereof have the problems of low expression level, unstable expression products, poor insect resistance effect and the like. The expression quantity of GC content can be improved in transgenic plants by modifying a base sequence to improve GC content, so that the aim of killing insects is fulfilled (Koziel, 1993).

The generation of resistance by target pests seriously hinders the continuous application of Bt preparations and transgenic Bt insect-resistant corns, and a single transgenic insect-resistant plant is planted in a large area, so that the target pests can be caused to generate resistance. Current research has found that many insects have developed varying degrees of resistance to Bt toxic proteins indoors, and that resistance to Bt preparations or Bt crops has also been reported in field or greenhouse conditions. Pesticide cross-resistance refers to the phenomenon that a plant pest or pathogenic microorganism develops resistance to one insecticidal (bacterial) agent and also to another agent that has never been used but has a similar mechanism of action. The current research also finds that many pesticides generate cross resistance when applied, so that overcoming the problem of cross resistance is also an important subject in the research of various crop disease and insect resistance at present.

It is believed that domain i of Bt proteins is involved in pore formation, domain ii determines specific binding of the toxin to the receptor, and domain iii primarily regulates toxin activity. Indoor studies show that the Asian corn borer Cry1F resistant strain has moderate cross resistance to Cry1Ab and Cry1Ac insecticidal proteins, but has no cross resistance to Cry1h or Cry1Ie, and the superposition of Cry1F and Cry1h or Cry1Ie can be used as a strategy for delaying the Asian corn borer resistance to Bt proteins (Wang et al., 2016). Further studies have shown that Cry1Ie is not cross-resistant to Cry1Ab, cry1Ac, cry1F and Cry1h, and can be stacked with these proteins to delay the development of resistance by Bt proteins (Wang et al, 2017).

Corn is an important grain crop and also an important feed and industrial raw material, and the current corn insect pest (mainly corn borer) is serious, so that the yield of the corn is greatly reduced, and therefore, the method has important significance for improving the corn yield and increasing the income of farmers by adopting effective measures to control the harm of the corn. Due to the lack of suitable insect-resistant varieties, the current main method for solving insect damage is to spray chemical insecticides in the growth process; however, chemical pesticides kill both pests and their natural enemies, causing ecological imbalance and environmental pollution. By the transgenic technology, the insect-resistant gene can be introduced into a corn variety, so that the insect resistance of the transgenic corn is improved, the use amount of pesticides is reduced, and manpower, material resources and social resources are saved. The use of a single insect-resistant gene can cause the corn borer to generate resistance to Bt protein. Therefore, the application of new insect-resistant gene combinations, the improvement of the expression level of insecticidal proteins and the cultivation of novel insect-resistant transgenic corn are one of the most effective approaches to solve the problems.

Disclosure of Invention

In order to cultivate novel insect-resistant crops, the invention aims to provide an artificially synthesized insect-resistant protein mCry1Ia2.

Another object of the present invention is to provide a nucleic acid molecule encoding the above protein.

Another object of the present invention is to provide a recombinant vector, host cell or recombinant bacterium containing the above gene.

Another object of the present invention is to provide the use of the above protein in regulating plant resistance to insects, killing insects or improving the resistance of transgenic plants to insects.

It is a further object of the present invention to provide the use of the above-mentioned proteins in the preparation of insecticides or pest control formulations.

It is a further object of the present invention to provide a method for increasing the insect resistance of plants.

It is a further object of the present invention to provide a method for breeding a transgenic plant with improved insect resistance.

It is a further object of the invention to provide a method of slowing the population of Bt resistant corn borers.

In order to achieve the purpose of the invention, the invention provides the following scheme: an insect-resistant gene mCry1Ia2 is characterized in that three cry1Ab, cry1F and cry1Ie genes with high toxicity to lepidoptera pests are artificially optimized, modified and synthesized to form a new DNA sequence, so that the codon sequence preferred by plants is utilized to improve the conversion power of the insect-resistant gene in the transgenic process, the expression quantity and the stable expression characteristic in transgenic plants are improved, the generation resistance of Asian corn borers to Bt proteins is delayed and the insecticidal activity of the genes is improved through the combined application of the three genes and six structural domains

Firstly, the artificially synthesized insect-resistant protein mCry1Ia2 provided by the invention is any one of the following proteins (a) to (d):

(a) The amino acid sequence of the polypeptide comprises an amino acid sequence shown in a sequence 2 in a sequence table;

(b) The amino acid sequence of the polypeptide consists of amino acid residues shown in a sequence 2 in a sequence table;

(c) Protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence of (a) or (b) and has an insect-resistant function and is derived from (a) or (b);

(d) A protein having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the protein defined in (a) or (b) and having an anti-insect function.

The sequence 2 is an amino acid sequence shown in SEQ ID No. 2.

The mCry1Ia2 protein in (b) can be obtained by synthesizing the coding gene (sequence 1) and then performing biological expression. The gene encoding the mCry1Ia2 protein in (b) above can be obtained by deleting one or several codons for amino acid residues from the DNA sequence represented by nucleotides 1 to 4002 in sequence No.1, and/or by performing missense mutation of one or several base pairs.

The invention also provides a nucleic acid molecule for coding the protein, which is named as gene mCry1Ia2.

The nucleic acid molecule is any one of the following nucleic acid molecules 1) to 4):

1) The coding region comprises a nucleic acid molecule shown as a sequence 1 in a sequence table;

2) The coding region consists of nucleic acid molecules shown in a sequence 1 in a sequence table;

3) A nucleic acid molecule which hybridizes with the nucleic acid sequence defined in 1) or 2) and codes for a protein with insect-resistant function;

4) A nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to a nucleic acid sequence defined in 1) or 2) and encoding a protein having an anti-insect function.

The nucleotide sequence of the nucleic acid molecule of the sequence 1 is shown as SEQ ID No. 1.

The nucleic acid molecule of the insect-resistant gene provided by the invention is formed by splicing a first functional domain 1392bp and a second functional domain 1392bp of Cry1Ab which are optimized by codons, a third functional domain 453bp of Cry1F and a fragment of three functional domains which are 2157bp in length of Cry1Ie, and a new nucleotide sequence of six domains is named as mCry1Ia2.

The invention also provides a vector containing the insect-resistant gene mCry1Ia2, preferably a bivalent vector pTF101, wherein the vector contains a screening gene bar gene, so that on one hand, screening of a transformant is facilitated, and the later-stage detection workload is reduced; on the other hand, in the case of a transformant, it can be further clarified that the gene of interest has been transferred into a recipient plant by detecting the bar gene.

Further, the present invention also provides a host cell, preferably LBA4404, containing the above vector.

The invention also provides a transformed plant cell or recombinant bacterium containing the insect-resistant gene mCry1Ia2.

Furthermore, the invention also provides application of the protein, the nucleic acid molecule, the recombinant vector, the host cell or the recombinant bacterium in regulation and control of plant insect resistance;

or, the protein, the nucleic acid molecule, the recombinant vector, the host cell or the recombinant bacterium is applied to disinsection;

or, the protein, the nucleic acid molecule, the recombinant vector, the host cell or the recombinant bacterium is applied to improving the insect resistance of the transgenic plant;

or the protein, the nucleic acid molecule, the recombinant vector, the host cell or the recombinant bacterium are applied to the preparation of pesticides or insect-resistant preparations.

The plant is preferably a crop, fruit tree or vegetable, such as corn, rice, potato, cotton, etc.

Still further, the present invention provides an insecticide or a pest control formulation.

The active ingredients of the pesticide or the insect-resistant preparation provided by the invention are the protein, the DNA molecule or the recombinant vector, the host cell or the recombinant bacterium.

Further, the present invention provides a method for breeding a transgenic plant having improved insect resistance or a method for improving insect resistance of a plant.

The method provided by the invention comprises the following steps: and (3) improving the expression quantity or activity of the DNA molecules for coding the protein in the plant to obtain a transgenic plant, wherein the insect resistance of the transgenic plant is higher than that of the target plant.

In the above method, the expression level or activity of the DNA molecule encoding the protein is increased by introducing the DNA molecule encoding the protein into a target plant.

Still further, the present invention provides a method for solving Bt protein cross-resistance, comprising the steps of: effectively poisoning Cry1Ab, cry1F and Cry1Ie poison protein resistant corn borer populations to obtain transgenic plants, wherein the transgenic plants effectively delay the output of Bt protein resistant corn borers; the transgenic plant comprises an artificially synthesized insect-resistant protein mCry1Ia2.

The gene mCry1Ia2 is operably connected with a prokaryotic expression vector, so that the toxicity of the synthesized Bt gene expression product on corn borers can be rapidly and preliminarily detected. The gene mCry1Ia2 is operably connected with a plant expression vector, the expression vector is introduced into corresponding agrobacterium, and genetic transformation is carried out through an agrobacterium-mediated method to cultivate insect-resistant transgenic corn. Also can be used for genetic transformation of other crops or fruit trees and the like to ensure that the crops or fruit trees have insect-resistant activity.

The skilled in the art can also transform the gene of the invention into bacteria or fungi, produce Bt protein through large-scale fermentation, and prepare the Bt protein into pesticide for controlling crop pests.

The invention at least has the following advantages and beneficial effects:

compared with the original Cry1Ab, cry1F and Cry1Ie sequences, the artificially synthesized insect-resistant gene mCry1Ia2 sequence greatly enhances the expression of the insect-resistant gene mCry 1Ab, cry1F and Cry1Ie sequences in plants and delays the generation of Bt protein resistance of corn borers. The similarity of the modified mCry1Ia2 gene and a CACL gene (gene sequence number, KY 421715.1) in the priority ratio of 1-1605bp is 89.65% and the similarity of the modified mCry1Ia2 gene and a Cry1Ie gene (gene sequence number, KX 650634.1) in the priority ratio of 1846-4002bp is 82.00% through comparison analysis of an NCBI database (https:// NCBI. Nlm. Nih. Gov). Alignment analysis of the encoded amino acid sequences showed that the similarity of the modified mCry1Ia2 encoded protein to the protein Cry1 accy 1I (AGS 47767.1) in the priority ratio was 81.60%. The insect-resistant gene mCry1Ia2 can be efficiently and stably expressed in plant cells.

After introducing the insect-resistant gene mCry1Ia2 into corn, a stably inherited mCry1Ia2 transformant can be obtained. In addition, the gene can also transform crops such as cotton, rice, vegetables and the like, so that the crops have corresponding insect-resistant activity, the use amount of pesticides is reduced, the environmental pollution is reduced, and the gene has important economic value and wide application prospect.

In vitro experiments prove that the modified and synthesized Bt gene toxoprotein has higher insecticidal activity to corn borers and has obvious insecticidal effect to Cry1Ab, cry1F and Cry1Ie toxoprotein resistant corn borer populations. The invention constructs a new plant expression vector by using a constitutive promoter, and the insect-resistant gene mCry1Ia2 can be stably and efficiently expressed in monocotyledons so as to be further used for producing insect-resistant transgenic plants.

Drawings

FIG. 1 is T ₀ Carrying out immunological detection on a target protein mCry1Ia2 of a generation transformant, wherein CK is a negative control of a non-transgenic seedling; the number of transgenic positive seedlings is 1 to 5. The upper band is the quality control line, and the lower band is the detection line indicating the detected protein. The result shows that the target protein expressed by the insect-resistant gene mCry1Ia2 is efficiently expressed in the transgenic corn.

FIG. 2 is T ₁ Detecting the insecticidal property of the ostrinia nubilalis of the filigree of the generation transformant, wherein CK is negative control of the filigree of the non-transgenic seedling; the number of transgenic positive seedling filaments is 1 to 5. The result shows that the target protein expressed by the insect-resistant gene mCry1Ia2 can effectively kill insects in the transgenic corn.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

Example 1 Synthesis of mCry1Ia2 Gene

Cry1Ab, cry1F and Cry1Ie were synthesized by codon optimization (the synthesis was done by Kinzhi, suzhou) Inc.), and the first and second functional domains of Cry1Ab, the third functional domain of Cry1F and the three domain fragments of Cry1Ie were spliced together by SOE method (1992, chuia 26104) to form a new six-domain mCry1Ia2 DNA sequence with the nucleotide sequence shown in SEQ ID No. 1. It is generally believed that: the Bt protein is composed of three structural domains, wherein a structural domain I comprises 250-300 amino acids at the N terminal of the active insecticidal protein and consists of 7 alpha-helices, one alpha-helix has stronger hydrophobicity and is positioned in the center of the structural domain I, and the other 6 alpha-helices surround the periphery. It has been shown to be associated with the toxicity of insecticidal proteins, the hydrophobic alpha-helix has the ability to insert into and form channels in the midgut cell membranes of sensitive insects; the structure domain II is formed into a triangular structure by three anti-phase parallel beta folds, and each fold is connected through a small ring structure. There are two beta sheets that are highly homologous, each consisting of four anti-parallel peptide chains with beta conformation. The other beta sheet consists of three peptide chains in beta conformation and a small alpha helix. This domain consists of the middle about 200 amino acids. The structural domain II is mainly involved in recognition and combination of target cells of the alimentary canal epidermis of a target insect and is a main factor for determining specificity of insecticidal protein. Domain iii is highly entangled by two anti-parallel peptide chains with beta conformation to form a beta-three-splint structure, whose main function is to maintain the protein structure stable from degradation by insect proteases (Li et al, 1991, grochulski et al, 1995. In addition, the domain may also serve to ensure stable binding of the toxoprotein to the receptor. The similarity of the modified mCry1Ia2 gene and a CACL gene (gene sequence number, KY 421715.1) in the priority ratio of 1-1605bp is 89.65% and the similarity of the modified mCry1Ia2 gene and a Cry1Ie gene (gene sequence number, KX 650634.1) in the priority ratio of 1846-4002bp is 82.00% through comparison analysis of an NCBI database (https:// NCBI. Nlm. Nih. Gov). Alignment analysis of the encoded amino acid sequences showed that the engineered mCry1Ia2 encoded protein was 81.60% similar to the preferential ratio protein Cry1 accy 1I (AGS 47767.1). The amino acid sequence of the code mCry1Ia2 is shown in SEQ ID NO. 2.

Example 2 expression of mCry1Ia2 Gene in prokaryotic System and detection of product toxicity

In order to detect the in-vitro expression of the modified mCry1Ia2 gene and the toxicity to ostrinia nubilalis, a Bt prokaryotic expression vector is constructed. According to the requirement, an NdeI endonuclease recognition site sequence AAGGAGATATACATA is added at the 5' end of the primer sequence, and is shown as SEQ ID NO. 3; the 3' end is added with XhoI endonuclease recognition site sequence GGTGGTGGTGCTCGAG which is shown as SEQ ID NO. 4. Designing a primer sequence as follows: f:AAGGAGATATACATATGGACAACAACCCAAC as shown in SEQ ID NO. 5; r:GGTGGTGGTGCTCGAGCATGTCCCGCTGCTGCTCGAT is shown as SEQ ID NO. 6. And amplifying the mCry1Ia2 gene by using the spliced DNA as a template and a primer added with a joint, and recovering and purifying the mCry1Ia2 gene fragment by using a gel recovery kit. pET30a was digested with restriction enzymes NdeI and XhoI, and recovered and purified. The two fragments are subjected to ligation reaction, and the constructed prokaryotic expression plasmid is named as pET30a-mCry1Ia2. PCR detection and sequencing show that the vector is constructed correctly. BL21 (DE 3) competent cells were transformed with pET30a-mCry1Ia2.

After IPTG induction is carried out on Escherichia coli BL21 bacterial liquid containing pET30a-mCry1Ia2, bt protein is extracted, and insect test is carried out on corn borers by using clear water and Escherichia coli BL21 bacterial liquid containing empty vector pET30a as a control. The method comprises the following specific steps:

(1) escherichia coli BL21 single colonies were inoculated in 5ml of LB (kanamycin-containing) liquid medium and cultured overnight at 37 ℃.

(2) The bacterial liquid was inoculated into 500ml of LB (kanamycin-containing) liquid medium and cultured until OD ≈ 0.5.

(3) The induction with shaking was continued for 4 hours by adding IPTG to a final concentration of 0.5 mM.

(4) Centrifuging at 4000rpm for 10min, and collecting thallus.

(5) 20ml lysis buffer (2 mM Tris-HCl;0.2mM CaCl) was added ₂ (ii) a PH = 8.0), the cells were resuspended, lysozyme was added to a final concentration of 1mg/ml, and placed on ice for 30min.

(6) The cells were disrupted by sonication (disruption parameters: 3s at intervals, 3s,80 times, disruption in ice bath), centrifuged at 4000rpm for 10min, and the supernatant was collected.

(7) The collected supernatant is added to a feed for raising corn borers. Coli BL21 containing empty vector pET30a was used as negative control.

(8) Putting a feed on a 24-hole plate, connecting each hole with 1 st 2-3 th corn borer, connecting each hole with 100 holes, and repeating for three times. Culturing in an environment with the temperature of 26-28 ℃ and the relative humidity of about 70%, and identifying the toxicity after 7 days: the result shows that the Bt protein encoded by the secreted and expressed mCry1Ia2 gene has a good insecticidal effect, the death rate of the ostrinia nubilalis reaches 100%, and the growth of the ostrinia nubilalis is obviously inhibited (Table 1).

TABLE 1 toxicity test results of mCry1Ia2 gene prokaryotic expression products

Treatment (three replicates)	Number of tested insects	Average mortality (%)
			H ₂ O (negative control)	500	0
pET30a (negative control)	500	0
			Positive control	500	100
mCry1Ia2	500	100

Example 3 expression of mCry1Ia2 Gene in transgenic plants and toxicity testing of the expression product

Adding SmaI endonuclease recognition site sequences CTCTAGAGGATCCCC at the 5 'end and the 3' end of the primer sequence respectively, wherein the SmaI endonuclease recognition site sequences are shown as SEQ ID NO. 7; and TCGAGCTCGGTACCC as shown in SEQ ID NO. 8. The design primer is: f:5'CTCTAGAGG ATCCCCATGGACAACCCAAC 3' as shown in SEQ ID NO. 9; r is 5'TCGAGCTCGGTACCCCTACTACTACTCGAGTGTGGCAGT 3' is shown in SEQ ID NO.10, a synthesized mCry1Ia2 nucleotide sequence is taken as a template, a primer with a connector is used for amplification, and a gel recovery purification kit is used for recovering a target fragment. At the same time, sma I is used for enzyme digestion of the plant expression vector pTF101, and the pTF101 fragment after enzyme digestion is recovered and purified. The two fragments were ligated (In-Fusion HD cloning kit, clontech) to construct eukaryotic expression plasmid pTF101-mCry1Ia2 (the promoter was CaMV35S, and the marker gene was the herbicide-resistant gene Bar of Streptomyces hygroscopicus). PCR detection and sequencing show that the vector is constructed correctly.

Wherein, the pTF101 (pTF 101-35S-MCS-Bar) plasmid is a plasmid constructed on the basis of pCAMBIA1300 plasmid and contains a target gene insertion box and a herbicide-resistant gene Bar from streptomyces hygroscopicus. The vector can be used for genetic transformation of corn receptor material.

The insertion sequence is introduced into the stem tip tissue of a receptor plant by adopting an agrobacterium-mediated transformation method (strain LBA 4404), and a transgenic plant is obtained after screening of herbicide bialaphos. When the transplanted survived transformed plant grows 7-8 leaves, taking the leaves to extract DNA, and detecting the exogenous gene by adopting a PCR technology.

Detection of target protein mCry1Ia2 (Cry 1Ab immunological detection):

1. taking about 1cm ² Left and right fresh young leaves were placed in a 1.5ml Eppendorf tube. The tube with the leaves is then inserted in an ice bin to maintain freshness.

2. Liquid nitrogen was taken, the material was snap frozen, ground to powder with drill bit, and 500 μ L-lml SEB4 sample extraction buffer was quickly added to the tube.

3. The test strip (Shanghai Youlong Biotechnology Co., ltd.) is taken out, the top end of the test strip is held by hand, and a detection mark is made. The protective film is not removed. The test strip is held upright and the labeled end is inserted into a centrifuge tube or extraction bag. The insertion portion does not exceed 0.5cm. The inserted state is maintained throughout the detection process.

4. The control line appeared within 3-5 minutes, the maximum reaction time was 30 minutes, at which time the test strip was removed. The quality control line is used to ensure the accuracy of the test result. If the quality control line does not appear, the detection is invalid. The time at which the signal is generated varies due to the difference in mobility of the samples. If the sample is positive, a test line will appear. If the sample is negative, the test line will not appear. If the test results are to be stored for a long period of time, the sample pad can be cut off and blotted dry with a paper towel, which will prevent the remaining liquid from interfering with the results. The depth of the detection line reflects the content of the protein to be detected (FIG. 1). Wherein CK is a negative control of a non-transgenic seedling; the number of transgenic positive seedlings is 1 to 5. The upper band is a quality control line, and the lower band is a detection line indicating the detected protein. The result shows that the target protein expressed by the insect-resistant gene mCry1Ia2 is efficiently expressed in the transgenic corn.

Indoor insect killing detection of insect-resistant corn filaments by transferring mCry1Ia2 gene:

the dishes were filled with corn silk and 30 larvae of corn borer, as one replicate per dish, with 5 replicates per treatment set. Placing the strain in an artificial climate box for feeding, wherein the culture conditions are as follows: temperature 28 ℃, RH 80%, illumination period 16L: and 8D, timely supplementing the same tissue sample according to the situation that the corn silk is eaten by the corn borers. The survival number of the larvae of the ostrinia nubilalis is counted for 1 time every 48 hours from the inoculation, and the investigation is carried out for 7 days. The survival rate of the larvae of corn borer fed by different corn filaments was calculated according to the number of the larvae survived in each treatment (fig. 2). The indoor bioassay results of the silks show that the survival rate of the corn borers is remarkably reduced by less than 20% on day 3; after 7 days, the survival rate of the transgenic corn silks for feeding the Asiatic corn borers is 0 percent, and the survival rate of negative control for feeding the Asiatic corn borers is close to 100 percent, which shows that the transgenic mCry1Ia2 gene insect-resistant corn silks have good resistance to the Asiatic corn borers.

TABLE 2 toxicity test results of positive plantlet filaments transformed with mCry1Ia2 gene

Treatment (three replicates)	Number of tested insects	7 balance average mortality (%)
			Negative control	30	0
Transgenic positive seedlings 1	30	100
			Transgenic positive seedlings 2	30	100
Transgenic positive seedling 3	30	100
			Transgenic positive seedling 4	30	100
Transgenic positive seedling 5	30	100

Example 4 mCry1Ia2 protein insecticidal Activity and Cross-resistance assays

Asiatic corn borer sensitive line (ACB-BTs) is collected from the population of Henan Zheng state corn field and is fed with semi-artificial agar-free feed under the conditions of 28 +/-1 ℃, photoperiod 16L. The method adopts a feed mixing method to carry out indoor artificial elimination, namely Cry1Ab, cry1F and Cry1Ie proteins are added into semi-artificial feed of the Asiatic corn borer to prepare elimination feed, and the elimination feed is used for starting artificial feeding in a larval stage. Cry1Ab, cry1F and Cry1Ie corn borer resistant populations (ACB-AbR, ACB-FR and ACB-IeR) of the selection generations 20, 14 and 16 are obtained respectively under indoor conditions, and the resistance indexes are improved by 405.4, 248.6 and 320.2 times respectively. The biological assay of the toxicity of the mCry1Ia2 protein to the resistant species group of the three corn borers adopts a feed mixing method, namely, 9 concentration gradients of the Bt protein are prepared to prepare a raw assay feed, and distilled water is used as a control. And (3) inoculating 1 part of the larvae of the corn borer to be tested in a non-hole culture plate with 48 holes, feeding the larvae with each concentration of 1 plate under the conditions of 28 +/-1 ℃, a photoperiod of 16L and 70-80%, recording survival number of the larvae after 7 days, weighing and repeating for 3 times, wherein the larvae are cultured under the conditions that. The LC50 and 95% confidence intervals of the mCry1Ia2 protein on the corn borers of each resistant strain are analyzed by PoloPlus statistical software, and the analysis of the difference significance adopts chi-square test. As shown in table 3, the results indicate that the corn borer resistant populations rejected with Cry1Ab, cry1F and Cry1Ie proteins did not have reduced sensitivity to mCry1Ia2 protein, i.e. did not cause cross-resistance of 3 single Bt proteins.

Indoor bioassay for testing the toxicity of 4 corn borer populations by utilizing mCry1Ia2, cry1Ab, cry1F and Cry1Ie is carried out respectively, and an equal amount of Bt protein is added into artificial feed, so that the results show that the mCry1Ia2 can completely poison 4 corn borer populations in 7 days, the Cry1Ab and Cry1F can only completely poison 2 corn borer populations, and the Cry1Ie can poison 3 corn borer populations (Table 4). The toxicity of an Asian corn borer sensitive line (ACB-Bts) is respectively tested by utilizing mCry1Ia2, cry1Ab, cry1F and Cry1Ie, equivalent Bt protein is added into artificial feed, the mCry1Ia2 can completely poison the corn borers in 5 days, the Cry1Ab, cry1F and Cry1Ie can completely poison the corn borers in 7 days (Table 5), and the result shows that the mCry1Ia2 protein has stronger insecticidal activity of the corn borers.

TABLE 3 sensitivity analysis results of mCry1Ia2 on different Asiatic corn borer populations

Corn borer population	LC50(95％FL)(ug/g)	χ ²
			ACB-BtS	0.48(0.33-0.68)
ACB-AbR	0.45(0.28-0.64)	13.83
			ACB-FR	0.52(0.38-0.72)	28.18
ACB-IeR	0.50(0.35-0.70)	26.49

Table 4 survival rate (%)

	mCry1Ia2	Cry1Ab	Cry1F	Cry1Ie
					ACB-BtS	0	0	0	0
ACB-AbR	0	100	30.00±7.07	0
					ACB-FR	0	28.00±4.47	100	0
ACB-IeR	0	0	0	100

TABLE 5 survival rate (%)

	1 day	3 days	5 days	7 days
					mCry1Ia2	72.00±10.95a	18.00±8.37a	0.00±0.00a	0.00±0.00a
Cry1Ab	78.00±10.95a	25.00±7.07b	4.00±5.48b	0.00±0.00a
					Cry1F	82.00±8.37a	30.00±10b	8.00±4.47b	0.00±0.00a
Cry1Ie	84.00±8.94a	34.00±8.37b	4.00±5.48b	0.00±0.00a

Note that the difference in letters in the same column indicates significant difference (P < 0.05)

Indoor bioassay of different resistant populations of ostrinia nubilalis was carried out using mCry1Ia2 transgenic maize obtained in example 3, the method being the same as above. The indoor bioassay results of the silks show that the survival rates of the corn borers of different resistant populations are remarkably reduced to be below 20% on day 3; after 7 days, the survival rate of the transgenic corn filaments fed with the Asiatic corn borers of different resistant populations is 0%, while the survival rate of the transgenic corn filaments fed with the Asiatic corn borer larvae in a negative control way is close to 100%, which shows that the transgenic mCry1Ia2 gene insect-resistant corn filaments have the effects of efficiently poisoning Cry1Ab, cry1F and Cry1Ie insect-resistant corn borer populations, and the generation of cross resistance is avoided (Table 6).

TABLE 6 toxicity test results of mCry1Ia2 transgenic positive seedling filaments on different resistant populations of Asiatic corn borer

Treatment (three replicates)	Number of tested insects	7 balance average survival (%)
			ACB-BtS	100	0
ACB-AbR	100	0
			ACB-FR	100	0
ACB-IeR	100	0

Although the invention has been described in detail with respect to the general description and the specific embodiments thereof, it will be apparent to those skilled in the art that modifications and improvements can be made based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Heilongjiang Dapeng agricultural Limited firm Zhuang

<120> artificially synthesized insect-resistant protein mCry1Ia2, and preparation method and application thereof

<130> P200256

<141> 2020-09-03

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 4002

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 1

atggacaaca accccaacat caacgagtgc atcccgtaca actgcctgag caacccggag 60

gtggaggtgc tgggcgggga gcggatcgag accggctaca ccccgatcga catcagcctc 120

agcctgaccc agttcctcct gtccgagttc gtcccgggcg ccggcttcgt gctgggcctg 180

gtcgacatca tctggggcat cttcggcccc agccagtggg acgcgttcct cgtccagatc 240

gagcagctga tcaaccagcg catcgaggag ttcgcccgca accaggcgat cagccgcctg 300

gagggcctgt ccaacctgta ccagatctac gcggagtcct tccgcgagtg ggaggcggac 360

cccaccaacc ccgccctgag ggaggagatg cgcatccagt tcaacgacat gaactccgcg 420

ctgacgaccg ccatccccct gttcgccgtg cagaactacc aggtgcccct gctgagcgtc 480

tacgtgcagg ccgccaacct gcacctgtcg gtcctccgcg acgtcagcgt cttcggccag 540

cgctggggct tcgacgccgc cacgatcaac tcccgctaca acgacctgac ccgcctgatc 600

ggcaactaca ccgaccacgc cgtgcgctgg tacaacaccg ggctggagcg cgtgtggggg 660

cccgacagcc gcgactggat caggtacaac cagttccgcc gcgagctgac gctgaccgtg 720

ctcgacatcg tcagcctgtt ccccaactac gacagccgca cgtaccccat ccgcaccgtg 780

agccagctga cgcgcgagat ctacaccaac cccgtgctgg agaacttcga cggctccttc 840

cgcggcagcg cgcagggcat cgaggggagc atccgctccc cccacctgat ggacatcctc 900

aactcgatca ccatctacac ggacgcccac cgcggcgagt actactggag cggccaccag 960

atcatggcca gccccgtcgg cttctcgggc ccggagttca cgttccccct gtacggcacc 1020

atgggcaacg ccgcgccgca gcagcgcatc gtggcgcagc tgggccaggg cgtgtaccgc 1080

acgctcagca gcacgctgta ccggcggccg ttcaacatcg gcatcaacaa ccagcagctg 1140

agcgtgctgg acggcaccga gttcgcgtac ggcacgagca gcaacctgcc cagcgccgtg 1200

taccgcaagt cgggcacggt ggacagcctg gacgagatcc ccccgcagaa caacaacgtc 1260

ccgccgcgac agggcttcag ccaccggctg tcgcacgtca gcatgttccg cagcggcttc 1320

agcaactcca gcgtctcgat catccgggcg ccgatgttca gctggatcca ccgctcggcc 1380

gagttcaaca acaccatcga ccccgagagg atcacccaga tccccttggt gaaggcgcac 1440

acgctccagt cgggcaccac ggtcgtcagg gggccggggt tcacgggcgg cgacatcctc 1500

cgacgcacca gcggcggccc cttcgcgtac accatcgtca acatcaacgg gcagctcccc 1560

cagaggtacc gggccaggat ccgctacgcc tccaccacca acctgaggat ctacgtcacg 1620

gtcgcggggg agcggatctt cgccgggcag ttcaacaaga cgatggacac cggggacccc 1680

ctcacgttcc agtccttctc ctacgccacc atcaacaccg cgttcacctt ccccatgagc 1740

cagagcagct tcacggtcgg ggccgacacc ttcagctcgg gcaacgaggt gtacatcgac 1800

aggttcgagt tgatccccgt caccgccacg ctcgaggccg agtacaagct gaagaaccag 1860

gacaagcacc agagcttctc cagcaacgcg aaggtcgaca agatctccac ggactcgctg 1920

aagaacgaga cggacatcga gttgcagaac atcaaccacg aggactgctt gaagatgtcc 1980

gagtacgaga acgtcgagcc gttcgtcagc gcctcgacca tccagacggg catcgggatc 2040

gccggcaaga tcctcgggac cctgggggtc ccgttcgccg ggcagatcgc cagcctctac 2100

agcttcatct tgggcgagct ctggccgaag gggaagagcc agtgggagat cttcatggag 2160

cacgtcgagg agctcatcgc gcagaagatc tcgacctacg cgaggaacaa ggcgctcacg 2220

gacttgaagg gcttggggga cgccttggcg gtctaccacg agtcgctcga gagctggatc 2280

gagaaccgca acaacacgag ggccaggagc gtcgtcaaga gccagtacat ctcgctggag 2340

ctcatgttcg tccagaagtt gccgtccttc gcggtgtccg gggaggaggt cccgctgttg 2400

cccatctacg cccaggccgc gaacctgcac ttgttgctgt tgagggacgc gtccgtcttc 2460

ggcaaggagt ggggcttgtc gtcctcggag atctcgacgt tctacaaccg gcaggtcgag 2520

cgagcgggcg actactccga ccactgcgtg aagtggtaca gcacggggct gaacaacttg 2580

agggggacga acgccgagag ctgggtccgg tacaaccagt tccggaagga catgacgttg 2640

atggtcctgg acttgatcgc gttgttcccc agctacgaca cgctcgtcta ccccatcaag 2700

accacctccc agctcacgag ggaggtctac acggacgcga tcgggacggt ccaccccaac 2760

gcgagcttcg cgagcacgac ctggtacaac aacaacgcgc cgtcgttctc cgccatcgag 2820

tccgccgtcg tccgaaaccc gcacctgctc gacttcttgg agcaggtcac gatctacagc 2880

ttgttgagca ggtggagcaa cacccagtac atgaacatgt ggggcggcca caggctcgag 2940

ttccgaacga tcggcggcgt gttgaacacc tcgacgcagg ggtccacgaa cacctccatc 3000

aacccggtca cgttgccgtt cacgtcccga gacgtctaca ggaccgagtc gttggcgggg 3060

ctgaacctgt tcttgaccca gccggtcaac ggcgtcccga gggtcgactt ccactggaag 3120

ttcgccacgc tcccgatcgc gtccgacaac ttctactacc ccgggtacgc cggcatcggg 3180

acgcagttgc aggactcgga gaacgagttg ccgccggaga cgacggtcca gcccaactac 3240

gagtcgtaca gccacaggtt gtcccacatc ggcctcatct cggcgtcgca cgtgaaggcg 3300

ttggtctact cctggacgca ccggagcgcg gaccggacga acacgatcga gcccaacagc 3360

atcacgcaga tccccttggt caaggcgttc aacctgtcct cgggggccgc cgtcgtcagg 3420

ggcccgggct tcacgggggg cgacatcctc cgaaggacga acaccgggac gttcggggac 3480

atccgagtca acatcaaccc ccccttcgcg cagaggtacc gcgtcaggat ccggtacgcg 3540

tccaccacgg acttgcagtt ccacacgtcg atcaacggca gggccatcaa ccaggggaac 3600

ttctcggcga ccatgaacag gggcgaggac ttggagtaca ggaccttcag gaccgtcggc 3660

ttcaccaccc ccttcagctt ctcggacgtc cagagcacgt tcacgatcgg ggcctggaac 3720

ttctcctcgg ggaacgacgt ctacatcgac cgaatcgagt tcgtcccggt cgaggtcccc 3780

tacgaggagg agtacgactt cgagaaggtg caggaggcgg tcaccgcgct gttcacgtcc 3840

acgaacccca gggagttgaa gacggacgtc acggactacc acatcgacca ggtctcgaac 3900

ttggtcgagt ccctgtcgga cgagttctac ctcgacgaga agagggagtt gttcgagatc 3960

gtcaagtacg tcaagcagct caacatcgag cgggacatgt ag 4002

<210> 2

<211> 1333

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 2

Met Asp Asn Asn Pro Asn Ile Asn Glu Cys Ile Pro Tyr Asn Cys Leu

1 5 10 15

Ser Asn Pro Glu Val Glu Val Leu Gly Gly Glu Arg Ile Glu Thr Gly

20 25 30

Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gln Phe Leu Leu Ser

35 40 45

Glu Phe Val Pro Gly Ala Gly Phe Val Leu Gly Leu Val Asp Ile Ile

50 55 60

Trp Gly Ile Phe Gly Pro Ser Gln Trp Asp Ala Phe Leu Val Gln Ile

65 70 75 80

Glu Gln Leu Ile Asn Gln Arg Ile Glu Glu Phe Ala Arg Asn Gln Ala

85 90 95

Ile Ser Arg Leu Glu Gly Leu Ser Asn Leu Tyr Gln Ile Tyr Ala Glu

100 105 110

Ser Phe Arg Glu Trp Glu Ala Asp Pro Thr Asn Pro Ala Leu Arg Glu

115 120 125

Glu Met Arg Ile Gln Phe Asn Asp Met Asn Ser Ala Leu Thr Thr Ala

130 135 140

Ile Pro Leu Phe Ala Val Gln Asn Tyr Gln Val Pro Leu Leu Ser Val

145 150 155 160

Tyr Val Gln Ala Ala Asn Leu His Leu Ser Val Leu Arg Asp Val Ser

165 170 175

Val Phe Gly Gln Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn Ser Arg

180 185 190

Tyr Asn Asp Leu Thr Arg Leu Ile Gly Asn Tyr Thr Asp His Ala Val

195 200 205

Arg Trp Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly Pro Asp Ser Arg

210 215 220

Asp Trp Ile Arg Tyr Asn Gln Phe Arg Arg Glu Leu Thr Leu Thr Val

225 230 235 240

Leu Asp Ile Val Ser Leu Phe Pro Asn Tyr Asp Ser Arg Thr Tyr Pro

245 250 255

Ile Arg Thr Val Ser Gln Leu Thr Arg Glu Ile Tyr Thr Asn Pro Val

260 265 270

Leu Glu Asn Phe Asp Gly Ser Phe Arg Gly Ser Ala Gln Gly Ile Glu

275 280 285

Gly Ser Ile Arg Ser Pro His Leu Met Asp Ile Leu Asn Ser Ile Thr

290 295 300

Ile Tyr Thr Asp Ala His Arg Gly Glu Tyr Tyr Trp Ser Gly His Gln

305 310 315 320

Ile Met Ala Ser Pro Val Gly Phe Ser Gly Pro Glu Phe Thr Phe Pro

325 330 335

Leu Tyr Gly Thr Met Gly Asn Ala Ala Pro Gln Gln Arg Ile Val Ala

340 345 350

Gln Leu Gly Gln Gly Val Tyr Arg Thr Leu Ser Ser Thr Leu Tyr Arg

355 360 365

Arg Pro Phe Asn Ile Gly Ile Asn Asn Gln Gln Leu Ser Val Leu Asp

370 375 380

Gly Thr Glu Phe Ala Tyr Gly Thr Ser Ser Asn Leu Pro Ser Ala Val

385 390 395 400

Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu Asp Glu Ile Pro Pro Gln

405 410 415

Asn Asn Asn Val Pro Pro Arg Gln Gly Phe Ser His Arg Leu Ser His

420 425 430

Val Ser Met Phe Arg Ser Gly Phe Ser Asn Ser Ser Val Ser Ile Ile

435 440 445

Arg Ala Pro Met Phe Ser Trp Ile His Arg Ser Ala Glu Phe Asn Asn

450 455 460

Thr Ile Asp Pro Glu Arg Ile Thr Gln Ile Pro Leu Val Lys Ala His

465 470 475 480

Thr Leu Gln Ser Gly Thr Thr Val Val Arg Gly Pro Gly Phe Thr Gly

485 490 495

Gly Asp Ile Leu Arg Arg Thr Ser Gly Gly Pro Phe Ala Tyr Thr Ile

500 505 510

Val Asn Ile Asn Gly Gln Leu Pro Gln Arg Tyr Arg Ala Arg Ile Arg

515 520 525

Tyr Ala Ser Thr Thr Asn Leu Arg Ile Tyr Val Thr Val Ala Gly Glu

530 535 540

Arg Ile Phe Ala Gly Gln Phe Asn Lys Thr Met Asp Thr Gly Asp Pro

545 550 555 560

Leu Thr Phe Gln Ser Phe Ser Tyr Ala Thr Ile Asn Thr Ala Phe Thr

565 570 575

Phe Pro Met Ser Gln Ser Ser Phe Thr Val Gly Ala Asp Thr Phe Ser

580 585 590

Ser Gly Asn Glu Val Tyr Ile Asp Arg Phe Glu Leu Ile Pro Val Thr

595 600 605

Ala Thr Leu Glu Ala Glu Tyr Lys Leu Lys Asn Gln Asp Lys His Gln

610 615 620

Ser Phe Ser Ser Asn Ala Lys Val Asp Lys Ile Ser Thr Asp Ser Leu

625 630 635 640

Lys Asn Glu Thr Asp Ile Glu Leu Gln Asn Ile Asn His Glu Asp Cys

645 650 655

Leu Lys Met Ser Glu Tyr Glu Asn Val Glu Pro Phe Val Ser Ala Ser

660 665 670

Thr Ile Gln Thr Gly Ile Gly Ile Ala Gly Lys Ile Leu Gly Thr Leu

675 680 685

Gly Val Pro Phe Ala Gly Gln Ile Ala Ser Leu Tyr Ser Phe Ile Leu

690 695 700

Gly Glu Leu Trp Pro Lys Gly Lys Ser Gln Trp Glu Ile Phe Met Glu

705 710 715 720

His Val Glu Glu Leu Ile Ala Gln Lys Ile Ser Thr Tyr Ala Arg Asn

725 730 735

Lys Ala Leu Thr Asp Leu Lys Gly Leu Gly Asp Ala Leu Ala Val Tyr

740 745 750

His Glu Ser Leu Glu Ser Trp Ile Glu Asn Arg Asn Asn Thr Arg Ala

755 760 765

Arg Ser Val Val Lys Ser Gln Tyr Ile Ser Leu Glu Leu Met Phe Val

770 775 780

Gln Lys Leu Pro Ser Phe Ala Val Ser Gly Glu Glu Val Pro Leu Leu

785 790 795 800

Pro Ile Tyr Ala Gln Ala Ala Asn Leu His Leu Leu Leu Leu Arg Asp

805 810 815

Ala Ser Val Phe Gly Lys Glu Trp Gly Leu Ser Ser Ser Glu Ile Ser

820 825 830

Thr Phe Tyr Asn Arg Gln Val Glu Arg Ala Gly Asp Tyr Ser Asp His

835 840 845

Cys Val Lys Trp Tyr Ser Thr Gly Leu Asn Asn Leu Arg Gly Thr Asn

850 855 860

Ala Glu Ser Trp Val Arg Tyr Asn Gln Phe Arg Lys Asp Met Thr Leu

865 870 875 880

Met Val Leu Asp Leu Ile Ala Leu Phe Pro Ser Tyr Asp Thr Leu Val

885 890 895

Tyr Pro Ile Lys Thr Thr Ser Gln Leu Thr Arg Glu Val Tyr Thr Asp

900 905 910

Ala Ile Gly Thr Val His Pro Asn Ala Ser Phe Ala Ser Thr Thr Trp

915 920 925

Tyr Asn Asn Asn Ala Pro Ser Phe Ser Ala Ile Glu Ser Ala Val Val

930 935 940

Arg Asn Pro His Leu Leu Asp Phe Leu Glu Gln Val Thr Ile Tyr Ser

945 950 955 960

Leu Leu Ser Arg Trp Ser Asn Thr Gln Tyr Met Asn Met Trp Gly Gly

965 970 975

His Arg Leu Glu Phe Arg Thr Ile Gly Gly Val Leu Asn Thr Ser Thr

980 985 990

Gln Gly Ser Thr Asn Thr Ser Ile Asn Pro Val Thr Leu Pro Phe Thr

995 1000 1005

Ser Arg Asp Val Tyr Arg Thr Glu Ser Leu Ala Gly Leu Asn Leu Phe

1010 1015 1020

Leu Thr Gln Pro Val Asn Gly Val Pro Arg Val Asp Phe His Trp Lys

1025 1030 1035 1040

Phe Ala Thr Leu Pro Ile Ala Ser Asp Asn Phe Tyr Tyr Pro Gly Tyr

1045 1050 1055

Ala Gly Ile Gly Thr Gln Leu Gln Asp Ser Glu Asn Glu Leu Pro Pro

1060 1065 1070

Glu Thr Thr Val Gln Pro Asn Tyr Glu Ser Tyr Ser His Arg Leu Ser

1075 1080 1085

His Ile Gly Leu Ile Ser Ala Ser His Val Lys Ala Leu Val Tyr Ser

1090 1095 1100

Trp Thr His Arg Ser Ala Asp Arg Thr Asn Thr Ile Glu Pro Asn Ser

1105 1110 1115 1120

Ile Thr Gln Ile Pro Leu Val Lys Ala Phe Asn Leu Ser Ser Gly Ala

1125 1130 1135

Ala Val Val Arg Gly Pro Gly Phe Thr Gly Gly Asp Ile Leu Arg Arg

1140 1145 1150

Thr Asn Thr Gly Thr Phe Gly Asp Ile Arg Val Asn Ile Asn Pro Pro

1155 1160 1165

Phe Ala Gln Arg Tyr Arg Val Arg Ile Arg Tyr Ala Ser Thr Thr Asp

1170 1175 1180

Leu Gln Phe His Thr Ser Ile Asn Gly Arg Ala Ile Asn Gln Gly Asn

1185 1190 1195 1200

Phe Ser Ala Thr Met Asn Arg Gly Glu Asp Leu Glu Tyr Arg Thr Phe

1205 1210 1215

Arg Thr Val Gly Phe Thr Thr Pro Phe Ser Phe Ser Asp Val Gln Ser

1220 1225 1230

Thr Phe Thr Ile Gly Ala Trp Asn Phe Ser Ser Gly Asn Asp Val Tyr

1235 1240 1245

Ile Asp Arg Ile Glu Phe Val Pro Val Glu Val Pro Tyr Glu Glu Glu

1250 1255 1260

Tyr Asp Phe Glu Lys Val Gln Glu Ala Val Thr Ala Leu Phe Thr Ser

1265 1270 1275 1280

Thr Asn Pro Arg Glu Leu Lys Thr Asp Val Thr Asp Tyr His Ile Asp

1285 1290 1295

Gln Val Ser Asn Leu Val Glu Ser Leu Ser Asp Glu Phe Tyr Leu Asp

1300 1305 1310

Glu Lys Arg Glu Leu Phe Glu Ile Val Lys Tyr Val Lys Gln Leu Asn

1315 1320 1325

Ile Glu Arg Asp Met

1330

<210> 3

<211> 15

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 3

aaggagatat acata 15

<210> 4

<211> 16

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 4

ggtggtggtg ctcgag 16

<210> 5

<211> 32

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 5

aaggagatat acatatggac aacaacccca ac 32

<210> 6

<211> 34

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

ggtggtggtg ctcgagcatg tcccgctgct cgat 34

<210> 7

<211> 15

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

ctctagagga tcccc 15

<210> 8

<211> 15

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

tcgagctcgg taccc 15

<210> 9

<211> 33

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

ctctagagga tccccatgga caacaacccc aac 33

<210> 10

<211> 36

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 10

tcgagctcgg tacccctact actcgagtgt ggcagt 36

Claims

1. An artificially synthesized insect-resistant protein mCry1Ia2, the amino acid sequence of which consists of amino acid residues shown in a sequence 2 in a sequence table.

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, wherein the nucleic acid molecule is any one of the following 1) to 3):

1) The coding region consists of nucleic acid molecules shown in a sequence 1 in a sequence table;

2) A nucleic acid molecule which hybridizes to the nucleic acid sequence defined in 1) and encodes the insect-resistant protein of claim 1;

3) A nucleic acid molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology to the nucleic acid sequence defined in 1) and encoding the insect-resistant protein of claim 1.

4. The nucleic acid molecule according to claim 2, characterized in that it is a six-domain new nucleotide sequence formed by splicing together the first and second functional domains 1392bp of Cry1Ab and the third functional domains 453bp of Cry1F and a fragment of Cry1Ie with a length of 2157bp, after codon optimization, and namedmCry1Ia2。

5. A recombinant vector, host cell or recombinant bacterium comprising the nucleic acid molecule of any one of claims 2 to 4.

6. Use of the protein of claim 1, the nucleic acid molecule of any one of claims 2 to 4, or the recombinant vector, host cell, or recombinant bacterium of claim 5 for modulating resistance in a plant to ostrinia nubilalis;

or, the use of the protein of claim 1, the nucleic acid molecule of any one of claims 2 to 4 or the recombinant vector, host cell or recombinant bacterium of claim 5 for killing ostrinia nubilalis;

or, the use of the protein of claim 1, the nucleic acid molecule of any one of claims 2 to 4 or the recombinant vector, host cell or recombinant bacterium of claim 5 for increasing resistance of transgenic plants to corn borer;

or the protein of claim 1, the nucleic acid molecule of any one of claims 2 to 4 or the recombinant vector, host cell or recombinant bacterium of claim 5, in the preparation of a pesticide or a preparation for preventing corn borer pests.

7. The use according to claim 6, wherein the plant is a crop, a fruit tree or a vegetable.

8. A pesticide or pest control formulation comprising as an active ingredient a protein according to claim 1, a nucleic acid molecule according to any one of claims 2 to 4 or a recombinant vector, host cell or recombinant bacterium according to claim 5.

9. A method for improving insect resistance of a plant, comprising the steps of: increasing the expression level or activity of a DNA molecule encoding the protein of claim 1 in a plant, to obtain a transgenic plant having increased insect resistance over a plant of interest.

10. A method of addressing Bt protein cross-resistance, comprising the steps of: effectively poisoning Cry1Ab, cry1F and Cry1Ie poison protein resistant corn borer populations to obtain transgenic plants, wherein the transgenic plants effectively delay the generation of Bt protein resistant corn borers; the transgenic plant comprises an artificially synthesized insect-resistant protein mCry1Ia2.