CN111663000A

CN111663000A - Soybean locked flower molecular marker and application thereof

Info

Publication number: CN111663000A
Application number: CN202010641851.XA
Authority: CN
Inventors: 邱丽娟; 张勇; 洪慧龙; 孙如建
Original assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Current assignee: Institute of Crop Sciences of Chinese Academy of Agricultural Sciences
Priority date: 2020-07-06
Filing date: 2020-07-06
Publication date: 2020-09-15

Abstract

The invention discloses a soybean locked flower molecular marker, which comprises a DNA molecule SNP2 obtained by using soybean genome DNA as a template and adopting an SNP2 primer pair for amplification, and a DNA molecule SNP3 obtained by using the soybean genome DNA as a template and adopting an SNP3 primer pair for amplification; wherein the SNP2 primer pair and the SNP3 primer pair are shown as SEQ ID NO. 1-SEQ ID NO. 4; the method comprises the steps of positioning a key base sequence of the locked flower character in a locked flower soybean genome by using a map-based cloning method, cloning, determining whether the character of the soybean is the locked flower according to a cloning result, and then planting the locked flower, so that the plants can be kept pure by avoiding the interference of foreign pollen, and the gene flow is controlled.

Description

Soybean locked flower molecular marker and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a soybean locked flower molecular marker and application thereof.

Background

With the increasing population, Jonathan and Tilman et al predict that crop yield must be doubled before 2050 to meet the demand of food consumption brought by the population growth in the world. To meet this demand, crop yield needs to increase at a rate of at least 2.4% per year. The cultivated soybean (Glycine max (L.) Merr.) belongs to leguminous (Leguminosae), Papilionone (Papiliononate), Glycine (Glycine) and Soja (Soja) annual herbaceous plants, is a main source of vegetable protein and oil in people's life, is also an important feed crop, accounts for about 56% of the global edible oil yield, and Ray and the like refer to that the annual yield increase of soybean is about 1.3% at present, and does not meet the expected requirements. Therefore, the search for an efficient breeding strategy to breed high-yield and high-quality soybean varieties is the most urgent problem to be solved by soybean breeders at present, and in the soybean breeding method, various methods such as initial natural variation selective breeding, crossbreeding, development to mutation breeding, introduction, heterosis breeding, high-light-efficiency breeding, pollen tube channel method breeding, marker-assisted selective breeding, transgenic breeding and the like are also adopted, wherein the molecular breeding changes the traditional breeding method based on phenotypic selection into a breeding method directly aiming at genotypic selection, and the selection efficiency is improved. At present, the transgenic technology is a soybean molecular breeding method with the most mature technical means and the highest commercial efficiency. After the development of 23 years, the planting area of 26 countries in the world reaches 1.917 hundred million hectares, the planting area is increased by 113 times since 1996, the cumulative planting area reaches 25 hundred million hectares, wherein the planting area of soybean accounts for 50% of the total planting area of transgenic crops in the world, the planting area of transgenic soybean in 2018 is increased to 9590 million hectares, the application rate of transgenic soybean is as high as 78%, and the transgenic crops show wide application prospect due to the advantages of the transgenic crops in the aspects of yield, resistance and the like.

However, while the transgene is rapidly developed, many concerns are raised about the safety of the transgene because the transgene has an exogenous gene, so the possibility of environmental risk caused by gene drift or gene flow (gene flow) between the transgenic crop and other crops or wild parents is considered as a serious public problem, including potential environmental risk caused by the pollen-mediated gene drift of the exogenous gene in the transgenic crop to its cultivars and wild relatives, and further causing extensive concerns, such as the spread of herbicide-resistant genes to wild relatives, resulting in the production of "super weeds", and the current methods for inhibiting or reducing gene flow can be divided into molecular techniques (seed sterility, male sterility, chloroplast transformation, transgene alleviation, gene division, gene deletion) and conventional techniques (physical isolation, locked flower fertilization, apomixis). Male and seed sterility is not suitable for crops propagated in a sexual reproduction manner; gene division and gene deletion are currently only verified on tobacco; apomixis is a special mode of reproduction that is widely found in the plant kingdom for seed production without normal fertilization, but has not made substantial progress for its use in soybean. Closed flower fertilization is the completion of fertilization when a flower is not opened. The method can prevent the interference of foreign pollen and keep the pure breed of the plant, so the closed flower fertilization is an ideal method for controlling the gene flow.

Soybeans are self-pollinated crops, the cross-pollination rate is 0.03-3.62%, although mechanical obstacles caused by special butterfly petal structures cause difficulty in cross-pollination of the soybeans, field-inspired teachers domesticate 302 parts of soybean resource sequencing to discover that some cultivated soybeans have mixed ancestors, which indicates that the soybean lines are likely to undergo introduction or gene flow in the breeding process, China is a soybean country of origin, and conventional soybeans are large in planting area and have wild soybeans distributed in a large area, so that the problem of gene safety such as gene drift of transgenic soybeans to cultivated soybeans and wild soybeans cannot be ignored, and therefore, the study on the flower opening habit of the soybeans is of great importance to the transgenic safety.

Therefore, how to provide a molecular marker capable of specifically identifying the opening habit of soybean flowers is a technical problem to be solved urgently by those skilled in the art.

Disclosure of Invention

In view of the above, the invention uses a map-based cloning method to locate and clone the key base sequence of the locked flower character in the locked flower soybean genome, and determines whether the character of the soybean is the locked flower according to the cloning result, and then plants the locked flower character, so that the plants can be kept pure and the gene flow can be controlled without the interference of foreign pollen.

In order to achieve the purpose, the invention adopts the following technical scheme:

a soybean locked flower molecular marker is characterized by comprising a DNA molecule SNP2 obtained by taking soybean genomic DNA as a template and adopting an SNP2 primer pair for amplification and a DNA molecule SNP3 obtained by taking the soybean genomic DNA as a template and adopting an SNP3 primer pair for amplification;

wherein the SNP2 primer pair comprises:

SNP 2-F: ATGAGTACAATGCGAATTACT, as shown in SEQ ID NO. 1:

SNP2-RTGCTGGTAATCGATTACACATCACT, SEQ ID NO. 2;

the SNP3 primer pair comprises:

SNP 3-F: ACTCTCCTACAGCCACACGT, as shown in SEQ ID NO. 3;

SNP 3-R: GTCTCTCCTAAAGTTTGATTGGGGC, as shown in SEQ ID NO. 4.

The technical effect achieved by the technical scheme is as follows: the molecular marker is a section of base sequence in the soybean genome, the base sequence is used as the molecular marker of the soybean genome, and the SNP2 primer pair and the SNP3 primer pair which can specifically amplify the molecular marker are used for amplifying the soybean genome, if a target fragment can be amplified, the opening habit of the soybean flower to be detected is closed flower, so that a foundation is provided for identifying the character of the soybean flower, and the sensitivity and the specificity of the two groups of primer pairs are excellent, so that the occurrence of false positive is prevented.

In a preferred embodiment of the present invention, the sequence of SNP2 is: ATGAGTACAATGCGAATTACTTCAATAAAATTATAAGAAAATGAGTCTTAATATTGTGAATGTATGAATACATGATTTTGATGATGTCAAAGAATAATCAAACAAGGTTGCGTTCAAGATTACTTCAATAAACATTCAAAGGTTAAGCATTGCTTCAACAAACAAGCATTGCTTCAAGATTAATTAAAGATCATGTCTTTGCCTCAAAACAAGTGTTTCCAAGACACTTAAGGCTCTGGTAATCGATTACCAGGCAGTGTAATCGATTACCAGAAGACAATTTTGAAAAAATCAGCTTTTAGAAGAGTTTTGAAATTTGAATTTAAAAGTTGTAATTGATTACCATTGATGTGTAATCGATTACCAGCA, as shown in SEQ ID NO. 5.

In a preferred embodiment of the present invention, the sequence of SNP3 is: ACTCTCCTACAGCCACACGTACAACCTGAAGAACACAAAAATTACTTGTACTTTATAAATTACAATAACACCCTCCCTTTTCTGATTTCTCTTGCCTATAAATTTGTATTAGATCACTATATTCAAAAGTTTAATTCACCATTTCAATTTTTAGCCCAAATCACATCATGTGAAAAGACCCCAATCAAACTTTAGGAGAGAC, as shown in SEQ ID NO. 6.

A method for obtaining a soybean locked flower molecular marker is characterized by comprising the following steps:

(1) constructing an F2 separation population by taking a normal flower open soybean variety g 1050 as a female parent and a flower locked variety N639 as a male parent; the field phenotype identification result shows that g 1050 is a flag petal of a flower, the petal is unfolded after pollination, N639 is the flag petal of the flower, the petal pollination is locked, and genetic analysis is carried out on qualitative statistics (open flowers and locked flowers) of the open habits of the flowers of the F2 population²＝1.20＜χ² _0.053.84, indicating that the locked flower phenotype is controlled by a pair of recessive nuclear genes;

(2) extracting genome DNA of the leaf of a colony of 1050 grams, N639 grams and F2 of the colony;

(3) integrating the genetic map of soybean published in recent years, carrying out amplification on SSR primers published in public and SSR primers autonomously developed according to soybean genomic information by using gram 1050 and N639 genomic DNA, and discriminating and screening polymorphic primers according to the molecular weight of a target band after an amplification product is subjected to denaturing polyacrylamide gel electrophoresis, fixing, dyeing and developing;

(4) carrying out genotype identification on two extreme mixed pools of gram 1050, N639 and F2 populations by using 302 polymorphic SSR markers among parents to obtain 1 related marker SSR 587; screening 140 SSR markers on two sides of the markers, carrying out genotype identification on the parent and the two extreme mixed pools by using modified polyacrylamide gel electrophoresis, and screening out 30 markers which are co-separated from the flowering habit; carrying out genotype identification on the F2 recessive single plant by using a co-segregation marker through modified polyacrylamide gel electrophoresis, and positioning the gene between SSR668 and SSR760, wherein the interval size is 1.704 Mbp;

(5) screening linkage markers for SSR markers in an initial positioning interval by using a BSA mixed pool method, carrying out genotype identification on 665 strains of F2 populations on 12 linkage markers by using denaturing polyacrylamide gel electrophoresis, combining SSR results with F3 phenotypes, narrowing the positioning interval, comparing reference genome sequences by using sequencing results of parent grams 1050 and N639, newly developing 5 polymorphic InDel markers and 2 dCAPS markers, carrying out genotype identification on exchanged single strains and derivative F3 in an F2 population by using denaturing polyacrylamide gel electrophoresis, carrying out genotype identification on dCAPS markers by using non-denaturing polyacrylamide gel electrophoresis, and finally positioning locked flower genes in a range of about 59.3kb between the dCAPS markers SNP2 and SNP3 by using recombination event analysis.

The technical effect achieved by the technical scheme is as follows: map-based cloning, also known as positional cloning, refers to a technical method for gradually determining and isolating a target gene based on the position of molecular markers closely linked to the target gene on a chromosome. The gene is separated by the method according to the position of the target gene on the chromosome, the DNA sequence of the gene is not required to be known in advance, and the information about the expression product is not required to be known in advance, so that the position of the target gene (locked flower character control gene) can be rapidly and accurately obtained according to the method, and the molecular marker can be obtained.

The soybean locked flower molecular marker obtained by the method is applied to identification of soybean locked flower characters.

A primer pair for amplifying soybean atresia locked flower molecular markers is characterized by being shown as SEQ ID No. 1-SEQ ID No. 4.

The technical effect achieved by the technical scheme is as follows: the lowest amplification concentration of the SNP2 primer pair is 20 ng/. mu.L, and the lowest amplification concentration of the SNP3 primer pair is 20 ng/. mu.L, so that the sensitivity of the two primer pairs is high, and the molecular marker can be accurately amplified.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the provided drawings without creative efforts.

FIG. 1 is a graph showing a growth comparison between N639 and g 1050 at different stages; wherein A is a comparison graph of N639 and g 1050 in the vegetative growth phase; b is a comparison of the pod stage of N639 and g 1050; c is a comparison graph of N639 and g 1050 maturity;

FIG. 2 is a graph showing a comparison of the traits of flowers N639 and g 1050;

FIG. 3 is an electrophoretogram identifying the SNP2 marker; wherein 1 is N639, 2 is g 1050, 3 is the Loranthus roseus offspring, 4 is the heterozygous offspring, and 5 is the Ophiopogon roseus offspring;

FIG. 4 is an electrophoretogram showing the identification of SNP3 marker; wherein 1 is N639, 2 is g 1050, 3 is the Loranthus roseus offspring, 4 is the heterozygous offspring, and 5 is the Ophiopogon roseus offspring;

FIG. 5 is a graph showing the effect of SNP2 primer pairs on amplification of genomic DNA at different concentrations of N639 and g 1050;

FIG. 6 is a graph showing the effect of SNP3 primer pairs on amplification of genomic DNA at different concentrations of N639 and g 1050.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1

A method for obtaining a soybean locked flower molecular marker comprises the following steps:

(1) f is constructed by taking normal flower open soybean variety g 1050 as female parent and flower locked variety N639 as male parent₂Isolating the population; the field phenotype identification result shows that g 1050 is a flag petal of a flower, the petal is unfolded after pollination, N639 is the flag petal of the flower, the petal pollination is locked, and genetic analysis is carried out on qualitative statistics (open flowers and locked flowers) of the open habits of the flowers of the F2 population²＝1.20＜χ² _0.053.84, indicating that the locked flower phenotype is controlled by a pair of recessive nuclear genes;

(2) extraction of parent and F thereof₂Genome DNA of a population leaf; extraction of parent and F by CTAB method₂Genomic DNA from the leaves of the population was isolated. Taking an equal amount of mixing blade in a 2mL centrifuge tube, and putting steelThe beads and liquid nitrogen are rapidly frozen and sampled, each sample is added with 600 mu LCTAB (added with 2 percent of β -mercaptoethanol), vigorously shaken and mixed evenly, water bath at 65 ℃ is carried out for 60min, 5 mu L (10 mg/mu L) RNaseA is added and mixed evenly, water bath at 37 ℃ is carried out for 30min, 600 mu L phenol is added and chloroform is extracted (phenol: chloroform is 25:24), fully shaken and mixed evenly, centrifuged at 12000rpm for 10min, 400 mu L supernatant is carefully absorbed into a new centrifugal tube, 600 mu L isopropanol is added, gently inverted and mixed evenly, centrifuged at 12000rpm for 10min, supernatant is discarded, 500 mu L70 percent ethanol is added, DNA precipitate is suspended by shaking, supernatant is removed, two times of washing are carried out, residual liquid is sucked, DNA precipitate is dried in the air, 100 mu L ultrapure water is added for fully dissolving, and the mixture is placed at 20 ℃ below zero for storage.

(3) Preparation of PAGE Panel

Washing the plate: and (4) shoveling the residual glue on the glass plate by using a steel ruler, carefully scrubbing the glass plate by using a steel wire ball, and washing the glass plate by using tap water for later use.

Treatment for preparing a plate: clean the glass plate with 95% ethanol (note no foreign matter exists after wiping, otherwise, bubbles will be generated during glue pouring). Taking about 1.5ml of absolute ethyl alcohol, adding 10ul of affinity silane and 10ul of glacial acetic acid, uniformly mixing, and uniformly coating on a glass plate (wiping in one direction as much as possible);

processing the concave plate: wiping the glass plate clean with 95% ethanol in a fume hood; taking a small amount of 2% stripping silane (prepared by trichloromethane), and lightly wiping the concave plate (wiping in one direction as much as possible);

combining glass plates: placing proper edge strips on two sides of the glass plate, placing the processed concave plate on the glass plate (the processing surfaces are opposite), and then symmetrically clamping the two sides by 2-3 clamps respectively;

glue pouring: taking about 70ml 6% PAGE in a glue filling barrel (about 1/3 of the whole glue filling barrel), adding 40ul TEMED and 200ul 10% APS, mixing uniformly, filling glue between the two plates (in the glue filling process, the glass plate at the glue filling end can be properly lifted, the advancing speed of the glue is kept consistent as much as possible, for the bubbles to be formed, the glass plate is lightly knocked to prevent the bubbles from forming, for the bubbles near the glue filling opening, the bubbles are hooked out by a plastic plate)

Inserting a comb: the comb teeth are outward and gradually inserted from one side to manufacture a horizontal and neat glue surface (more glue is put to avoid the generation of bubbles);

(4) integrating genetic maps of soybeans published in recent years, carrying out amplification on SSR primers published in public, as well as an SSR primer SNP2 primer pair and an SNP3 primer pair independently developed according to soybean genomic information by using two parental genome DNAs, judging amplified products according to the molecular weight of target bands after modified polyacrylamide gel electrophoresis, fixation, dyeing and color development, and screening polymorphic primers by parents; SNP2-F is shown as SEQ ID NO.1, SNP2-R is shown as SEQ ID NO.2, SNP3-F is shown as SEQ ID NO.3, and SNP3-R is shown as SEQ ID NO. 4;

(5) carrying out genotype identification on parents and two extreme mixed pools (closed flower and open flower mixed pools) of the parents and an F2 population thereof by using 302 polymorphic SSR markers among the parents by using modified polyacrylamide gel electrophoresis to obtain 1 related marker SSR 587; screening 140 SSR markers on two sides of the markers, carrying out genotype identification on the parent and the two extreme mixed pools by using modified polyacrylamide gel electrophoresis, and screening out 30 markers which are co-separated from the flowering habit; with coseparation tag pair F₂Recessive individual plants utilize modified polyacrylamide gel electrophoresis to carry out genotype identification, and genes are positioned between SSR668 and SSR760, and the interval size is 1.704 Mbp;

(6) screening the linkage markers of the SSR markers in the initial localization interval by using a BSA pool mixing method, and performing F on 12 linkage markers₂The 665 strain of the population is subjected to genotype identification by utilizing modified polyacrylamide gel electrophoresis, and the SSR result is combined with F₃Phenotype, narrowing the location interval, comparing the reference genome sequence by using the parental re-sequencing result, newly developing 5 polymorphic InDel markers and 2 dCAPS markers, and comparing F₂Cross-over individuals and derivatives in the population F₃The InDel marker is subjected to genotype identification by utilizing denaturing polyacrylamide gel electrophoresis, the dCAPS marker is subjected to genotype identification by utilizing non-denaturing polyacrylamide gel electrophoresis, and a locked flower gene is finally positioned in a range of about 59.3kb between the dCAPS markers SNP2 and SNP3 through recombination event analysis; wherein SNP2 is shown as SEQ ID NO.5, and SNP3 is shown as SEQ ID NO. 6.

The amplification procedure in steps (4) to (6) is as follows: firstly, the temperature is 95 ℃ for 5 min; then amplifying for 34 cycles at 95 ℃ for 20S, 58 ℃ for 30S and 72 ℃ for 30S; finally, extension is carried out at 72 ℃ for 10min and at 12 ℃ for forever.

The reaction system in the steps (4) to (6) is as follows: DNA 2.0. mu.L (50 ng/. mu.L); EasyTaq enzyme 0.2. mu.L; 2.0. mu.L of 10 XEasyTaq Buffer; dNTPmix 1.5. mu.L; 1.5. mu.L (2. mu.M) of the primer(s); 12.8 mu L of ddH 2O; the total volume was 20. mu.L.

After the dCAPS labeled PCR reaction amplification in the step (6) is finished, 1 mu of LPCR product, 1 mu of Cutsmart Buffer and 0.2 mu of restriction enzyme (20,000U/mL) are taken, 7.8 mu of water is added, the mixture is centrifuged and mixed in the total volume of 10 mu of water, and the enzyme digestion is carried out for 0.5 to 8 hours at the temperature of 37 ℃.

Denaturing the amplification product after the PCR reaction in steps (4) to (6):

6ul loading buffer is added into each reaction of the PCR product for denaturation, the PCR product is denatured at 95 ℃ for 5min, the PCR product is taken out and then quickly placed into an ice-water mixture for cooling, and then sample loading electrophoresis is prepared or the PCR product is placed into a refrigerator at 4 ℃ for storage.

Note: an ice-water mixture must be used to ensure that each well on the PCR plate can be rapidly cooled; the amplification product is denatured before each spotting.

The electrophoresis process comprises the following steps:

1. and (3) checking the bath solution: the upper bath solution is 0.3 times TBE, and the lower bath solution is 1 times TBE

2. And (3) upper plate: after gelation, the clamp and the comb are taken down, the steel wire ball is firstly used for scrubbing the glue filling opening, then the brush is washed clean by water, after fixation, the comb is scrubbed clean, the concave plate is arranged inside when the comb is used for feeding the plate, the glue filling opening is upward, after fixation, the upper tank liquid is filled, whether liquid leakage exists or not is checked, whether the electrode is used correctly or not is checked, and oily substances on the glue surface are blown out, so that the glue surface is clean without covering substances, and sample application is facilitated.

3. Pre-electrophoresis: inserting a comb, dropping 3ul loading buffer, switching on the power supply, pre-electrophoresis, about 90w, half an hour, observing whether the strip is neat (determining whether to use the adhesive according to specific conditions)

4. Loading: and suspending the pre-electrophoresis, blowing out the glue surface and impurities by using a rubber head dropper, and carrying out sample application. Avoiding sample bunching.

5. A lower plate: and (4) electrophoresis is stopped until the last xylene green band enters the lower bath solution (about 2-3 h).

6. Disassembling the plate: turning off the power supply, pouring the bath solution (which can be repeatedly used), loosening the fixing clamp, taking down the plate, taking down the comb and the edge strip, and prying open the plate (prying the plate from the end far away from the two lugs).

The silver staining and developing process comprises the following steps:

fixing the fixing solution for more than 15min, silver-staining the silver staining solution for 10min, rinsing with deionized water, and developing with developing solution until the strips are clear.

Air-drying, reading the plate, taking a picture for recording, and after the experiment is confirmed to be completed, putting the glass plate into a sodium hydroxide solution (0.1% -0.2%) for washing the plate.

Wherein, 6 percent PAGE modified polyacrylamide gel formula

10 TBE solution formula

Medicine and food additive	Amount of TBE (1L)
		Tris	108.00g
Boric acid	55.00g
		EDTA	7.43g

10 × Loading buffer formula

Fixing liquid

Medicine and food additive	Required amount (3L)
		Deionized water	2.7L
Ethanol	0.3L
		Acetic acid	18ml

Silver dye liquor

Medicine and food additive	Required amount of
		Deionized water	1.5L
Silver nitrate	3g

Developing solution

Performing 6% non-denaturing polyacrylamide gel electrophoresis on the amplified enzyme digestion product in the step (6), adding 5 mu L of 10 × Loading Buffer into the PCR product, uniformly mixing, taking 0.8 mu L of mixed sample, and detecting by using non-denaturing polyacrylamide gel electrophoresis;

non-denaturing polyacrylamide gel electrophoresis step: soaking the glass plate in water for 5min, and scrubbing the glass plate by using steel wire balls until no impurities exist on the glass plate; scrubbing the glass plate again with 70% ethanol; after the glass plate is dried, the concave plate and the flat plate are oppositely placed, two sides of the concave plate and the flat plate are symmetrically clamped by 1 clamp respectively, and the leveling instrument is leveled; taking 40mL of 6% PAGE gel, adding 400 mu L of 10% ammonium persulfate and 40 mu L of LEMEED, uniformly mixing, and pouring the gel into the two plates, wherein bubbles need to be discharged completely if the gel exists; slowly insert into comb and gel at room temperature for use.

Electrophoresis is carried out by adopting a 250V constant voltage and 0.5 times TBE buffer solution, the electrophoresis time is adjusted according to the size of a PCR product, and the electrophoresis is generally carried out for about 50 min. And dyeing by a silver nitrate dyeing method after electrophoresis. The dyeing solution and the developing solution have the following formulas:

6% PAGE non-denaturing polyacrylamide gel formulation

Medicine and food additive	Glue amount (1L)
		Acrylamide	57.00g
Methylene fork	3.00g
		10*TBE	50ml

10 TBE solution formula

10 × Loading buffer formula

Silver dye liquor

Medicine and food additive	Required amount of
		Deionized water	1L
Silver nitrate	1g

Developing solution

Medicine and food additive	Required amount of
		Deionized water	1L
Sodium hydroxide	15g
		Formaldehyde (I)	5ml

Stripping the film from the glass plate, and immersing the film in silver dye solution for shaking and dyeing for 5 min; taking out and washing with deionized water for 2 times; placing into developing solution for developing for 5 min; washing with deionized water for 2 times; and (5) sealing the preservative film.

Example 2

The process for identifying the locked soybean character by using the molecular marker comprises the following steps:

extracting genome DNA of soybean to be detected, using the genome DNA as a template, and performing PCR amplification on SNP2 and SNP3 by using primers (the PCR reaction program is: 95 ℃ for 5min, 95 ℃ for 20S, 58 ℃ for 30S, 72 ℃ for 30S, 34 cycles, 72 ℃ for 5 min.), taking 1 mu of LPCR product, 1 mu of Cutsmart Buffer, 0.2 mu of restriction endonuclease (20,000U/mL), adding 7.8 mu of water, wherein the total volume is 10 mu of L, centrifugally mixing, performing enzyme digestion for 2h at 65 ℃ by SNP2, and performing enzyme digestion for 2h at 37 ℃ by SNP 3. Then 6% native polyacrylamide gel electrophoresis and silver nitrate staining were performed sequentially. Then, the following determination is made:

taking genome DNA of soybean N639 and gram 1050 to be detected as a template, carrying out enzyme digestion on the PCR amplification by using the specific primer SNP2, and if a 342bp fragment is obtained, the flower open habit of the soybean to be detected is or is a candidate for locked flower, and if a 369bp fragment is obtained, the flower open habit of the soybean to be detected is or is a candidate for open flower;

taking genome DNA of soybean N639 and gram 1050 to be detected as a template, carrying out enzyme digestion on the PCR amplification by using the specific primer SNP3, and if a 176bp fragment is obtained, the flower open habit of the soybean to be detected is or is a candidate for locked flower, if a 202bp fragment is obtained, the flower open habit of the soybean to be detected is or is a candidate for open flower;

wherein, the characters of N639 and g 1050 are shown in figure 1, and the flower organ is shown in figure 2;

carrying out PCR amplification and enzyme digestion electrophoresis on SNP2 and SNP3 by using primers, as shown in figures 3 and 4;

sequencing results show that the marker SNP2 shows that the marker SNP2 is an amphiphilic amplification sequencing result, the site 33222627 locked flower tender Australian 639SNP is C, the open flower gram 1050SNP is T, the endonuclease BsrI recognizes the locked flower site, the fragment 369bp is cut into 342bp and 27bp, and the open flower type is not cut into 369 bp.

The result of the sequencing by the parental amplification of the marker SNP3 shows that the site 33281924 locked flower tender Australian 639SNP is G, the open flower gram 1050SNP is T, the endonuclease HaeIII recognizes the locked flower site, the fragment 202bp is cut into 176bp and 26bp, and the open flower type is not cut into 202 bp.

The results show that the flower open habit variation molecular markers SNP2 and SNP3 have close linkage relation with the soybean flower open habit.

Example 3 primer sensitivity detection

The method comprises the following steps: parental DNA was amplified at different concentrations using primer pair SNP2 and primer pair SNP3, and DNA concentrations of N639 and g 1050 were set at 100 ng/. mu.L, 80 ng/. mu.L, 60 ng/. mu.L, 40 ng/. mu.L, 20 ng/. mu.L, 10 ng/. mu.L, 5 ng/. mu.L, 2 ng/. mu.L, 1 ng/. mu.L, 0.5 ng/. mu.L, 0.2 ng/. mu.L, and 0.1 ng/. mu.L, respectively.

PCR amplification System: DNA concentration above, 1.5. mu.L of primer (F + R), 2. mu.L of Buffer, 1.5. mu.L of dNTP, 0.2. mu.L of EasyTaq enzyme, and 20. mu.L of sterile water.

Reaction procedure: 5min at 95 ℃, 20s at 95 ℃, 30s at 58 ℃, 30s at 72 ℃, 5min at 72 ℃ and 34 cycles.

The results are shown in FIGS. 5 and 6.

As can be seen, the minimum amplification concentration of the primer pair SNP2 and SNP3 was 20 ng/. mu.L.

The embodiments in the present description are described in a progressive manner, each embodiment focuses on differences from other embodiments, and the same and similar parts among the embodiments are referred to each other. The device disclosed by the embodiment corresponds to the method disclosed by the embodiment, so that the description is simple, and the relevant points can be referred to the method part for description.

The previous description of the disclosed embodiments is provided to enable any person skilled in the art to make or use the present invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the generic principles defined herein may be applied to other embodiments without departing from the spirit or scope of the invention. Thus, the present invention is not intended to be limited to the embodiments shown herein but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Sequence listing

<110> institute of crop science of Chinese academy of agricultural sciences

<120> locked soybean molecular marker and application thereof

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

atgagtacaa tgcgaattac t 21

<210>2

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tgctggtaat cgattacaca tcact 25

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

actctcctac agccacacgt 20

<210>4

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gtctctccta aagtttgatt ggggc 25

<210>5

<211>369

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

atgagtacaa tgcgaattac ttcaataaaa ttataagaaa atgagtctta atattgtgaa 60

tgtatgaata catgattttg atgatgtcaa agaataatca aacaaggttg cgttcaagat 120

tacttcaata aacattcaaa ggttaagcat tgcttcaaca aacaagcatt gcttcaagat 180

taattaaaga tcatgtcttt gcctcaaaac aagtgtttcc aagacactta aggctctggt 240

aatcgattac caggcagtgt aatcgattac cagaagacaa ttttgaaaaa atcagctttt 300

agaagagttt tgaaatttga atttaaaagt tgtaattgat taccattgat gtgtaatcga 360

ttaccagca 369

<210>6

<211>202

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

actctcctac agccacacgt acaacctgaa gaacacaaaa attacttgta ctttataaat 60

tacaataaca ccctcccttt tctgatttct cttgcctata aatttgtatt agatcactat 120

attcaaaagt ttaattcacc atttcaattt ttagcccaaa tcacatcatg tgaaaagacc 180

ccaatcaaac tttaggagag ac 202

Claims

1. A soybean locked flower molecular marker is characterized by comprising a DNA molecule SNP2 obtained by taking soybean genomic DNA as a template and adopting an SNP2 primer pair for amplification and a DNA molecule SNP3 obtained by taking the soybean genomic DNA as a template and adopting an SNP3 primer pair for amplification;

wherein the SNP2 primer pair comprises:

SNP 2-F: ATGAGTACAATGCGAATTACT, as shown in SEQ ID NO. 1:

SNP 2-R: TGCTGGTAATCGATTACACATCACT, SEQ ID NO. 2;

the SNP3 primer pair comprises:

SNP 3-F: ACTCTCCTACAGCCACACGT, as shown in SEQ ID NO. 3;

SNP 3-R: GTCTCTCCTAAAGTTTGATTGGGGC, as shown in SEQ ID NO. 4.

2. The soybean locked flower molecular marker as claimed in claim 1, wherein the sequence of SNP2 is as follows:

ATGAGTACAATGCGAATTACTTCAATAAAATTATAAGAAAATGAGTCTTAATATTGTGAATGTATGAATACATGATTTTGATGATGTCAAAGAATAATCAAACAAGGTTGCGTTCAAGATTACTTCAATAAACATTCAAAGGTTAAGCATTGCTTCAACAAACAAGCATTGCTTCAAGATTAATTAAAGATCATGTCTTTGCCTCAAAACAAGTGTTTCCAAGACACTTAAGGCTCTGGTAATCGATTACCAGGCAGTGTAATCGATTACCAGAAGACAATTTTGAAAAAATCAGCTTTTAGAAGAGTTTTGAAATTTGAATTTAAAAGTTGTAATTGATTACCATTGATGTGTAATCGATTACCAGCA, as shown in SEQ ID NO. 5.

3. The soybean locked flower molecular marker as claimed in claim 1, wherein the sequence of SNP3 is as follows:

ACTCTCCTACAGCCACACGTACAACCTGAAGAACACAAAAATTACTTGTACTTTATAAATTACAATAACACCCTCCCTTTTCTGATTTCTCTTGCCTATAAATTTGTATTAGATCACTATATTCAAAAGTTTAATTCACCATTTCAATTTTTAGCCCAAATCACATCATGTGAAAAGACCCCAATCAAACTTTAGGAGAGAC, as shown in SEQ ID NO. 6.

4. Use of the soybean locked flower molecular marker of claim 1 for identifying soybean locked flower traits.

5. A primer pair for amplifying soybean atresia locked flower molecular markers is characterized by being shown as SEQ ID No. 1-SEQ ID No. 4.