CN109055390A

CN109055390A - Application of the rice Os ERF101 gene in the case where improving dry weather on Seed-Setting Percentage in Rice

Info

Publication number: CN109055390A
Application number: CN201810761608.4A
Authority: CN
Inventors: 葛晓春; 马红; 金越; 程轩; 潘维扬
Original assignee: Fudan University
Current assignee: Fudan University
Priority date: 2018-07-12
Filing date: 2018-07-12
Publication date: 2018-12-21

Abstract

The invention belongs to molecular biology, gene engineering technology field, a kind of transcription factor by drought-induced expression specially in riceOsERF101Function.Paddy drought resistance can be enhanced by being overexpressed the gene, improve the fertility of rice pollen grain under drought condition, to improve setting percentage, stablize the yield of rice under dry weather.The present invention also includes the genetically modified plants that the resistance according to obtained from the conversion of this gene function enhances.The experiment condition and test result provided according to the present invention,OsERF101Gene has application value in Studies of Gene Engineering on Plant Drought-resistance breeding, can significantly reduce production loss of the crops under water deficit conditions.

Description

RiceOsERF101Application of the gene in the case where improving dry weather on Seed-Setting Percentage in Rice

Technical field

The invention belongs to molecular biology, gene engineering technology field, and in particular to a kind of riceOsERF101Gene exists Improve the application under dry weather on Seed-Setting Percentage in Rice, the table for the transcription factor OsERF101 gene that the present invention expresses in rice Up to characterization, transcriptional activity is determining, transgene carrier building, conversion and transgenic plant drought tolerance and Fertility observation, The experimental results showed that the gene has application value in crop drought resistance transformation and stable yields.

Background technique

Rice is widely planted in China, is the staple food grain crop of Chinese population, is needed largely to irrigate during Rice Cropping With water, but China is one of 13 poor-water states that the United Nations is assert, water shortage seriously limits the growth of rice and the stabilization of yield； In addition, In Middle And Lower Reaches of Changjiang River is the area Zhu Zai of China's rice, the weather of high temperature and arid intertexture is often faced in summer, by In rice blooming stage also in summer, hot dry weather often leads to the serious cereal underproduction.For these reasons, drought tolerance is cultivated The rice of enhancing reduces irrigation water, to the Water resources security in China, grain security and guarantees that the income of peasant has Very important realistic meaning.In crop breeding field, molecular breeding is shorter than the conventional breeding time, quick, can be purposeful Ground optimizes the character of crop.One of the means for carrying out Crop Drought Resistance transformation are exactly that excavation is relevant to drought resistance in plants Gene carries out molecular breeding using technique for gene engineering, so that gene related to drought tolerance can be high in rice when facing arid Degree expression cultivates the new crop varieties of drought resisting and stable yield and high quality so as to improve the drought resistance of rice.

Involved in the applicationERF101Gene belongs to AP2/EREBP (APETALA2/Ethylene Responsive Element Binding Protein) transcription factor superfamily a member, this family contains AP2/ERF functional domain according to it Quantity and evolutionary relationship, and 4 subfamilies can be divided into, including AP2, RAV (Related to ABI3/VP1), DREB (dehydration-responsive element-binding protein) and ERF (Ethylene-responsive Factor) subfamily (Sakuma et al. 2002;Sharoni et al. 2011), wherein DREB and ERF subfamily Including the single domain AP2/ERF, (Nakano et al. 2006) can be bonded directly on DNA cis elements.From the two The member of subfamily is related with biology and abiotic stress response respectively.ERF subfamily mainly passes through in conjunction with promoter region GCC box (Chakravarthy et al. 2003; Ohme-Takagi and Shinshi 1995; Wang et al. 2004) expression that biotic response has correlation gene, is adjusted；And DREB subfamily then by with C- repeat (c-repeat) or DRE element combines expression (the Chen et al. 2008 for adjusting abiotic pathway gene; Gilmour et al. 1998; Stockinger et al. 1997).But in past several years, also there is laboratory discovery, the member of ERF subfamily also joins With the regulation of some abiotic stress processes.Such as the Tsi1 (Tobacco Stress-Induced Gene 1) in tobacco With TSRF1 (Tomato Stress-Responsive Factor 1) transcription factor, can in combination with to GCC box and DRE sequentially adjusts the salt and drought tolerance (Park et al. 2001 of plant; Quan et al. 2010; Zhang et al. 2004)；An important member SUB1A (Submergence 1A) for rice ERF subfamily, is resistance to the flooding property of rice The master regulation factor (Fukao et al. 2011) determined；Another two ERF subfamily member OsERF922 and OsDERF1 also has adjusted the salt tolerant and drought tolerance (Liu et al. 2012a of vegetative growth of rice plants phase respectively; Wan et al. 2011).

163 members are shared in rice AP2/EREBP family, there are 77 to belong to ERF subfamily (Sharoni et al. 2011), in the previous work in laboratory, it has been found thatOsERF101By induction (the Jin et al. of drought stress 2013), but whether it has the activity of transcriptional activation and is unknown which kind of effect played in drought stress responds.For Illustrate the function of the gene, we using molecule and biochemical apparatus have studied the gene expression characteristic and protein product it is living Property, and observe crop phenotype caused by the changes in gene expression using overexpression, interference and mutant strain and change.We send out It is existingOsERF101It encodes a transcription factor, under normal circumstances mainly in the floral organ of expression rice, but in blade and spends All by the induction of drought stress, by transgenosis the experiment proves that it can improve drought resistance in plants, enhance under dry weather The fertility of pollen grain improves the setting percentage of rice under dry weather.Therefore, the yield of gene crop in the case where stablizing dry weather It is upper that there is significant application value.

Summary of the invention

The purpose of the present invention is to provide a kind of riceOsERF101Gene is in the case where improving dry weather on Seed-Setting Percentage in Rice Application.

Specifically, rice is providedOsERF101Gene is improving crop drought resistance, to stablize crop under dry weather Function on setting percentage and yield.

Correspondingly, rice is utilizedOsERF101The formation function genetically modified plants of gene obtain the plant of drought resistance enhancing, Such as the better crops of drought resistance.

Rice proposed by the present inventionOsERF101Application of the gene in the case where improving dry weather on Seed-Setting Percentage in Rice, in rice It is overexpressedOsERF101The drought resistance of rice can be enhanced, improve the setting percentage of rice under drought stress, to stablize arid day The yield of rice under gas.

Rice proposed by the present inventionOsERF101Application of the gene in the case where improving dry weather on Seed-Setting Percentage in Rice, it is specific to walk It is rapid as follows:

It (1) will codingOsERF101The open reading frame nucleotide sequence of albumen is operable to be connected into plant transgene carrier；

(2) the plant transgene carrier that step (1) obtains is transferred in Agrobacterium, the Agrobacterium containing expression vector is infected Rice callus is obtained by co-cultivation, degerming, antibiotic-screening and differentiationOsERF101The transgenosis of the overexpression of gene is planted Strain.

In the present invention, step will encode rice transcription factor in (1)OsERF101Nucleotide sequence be transformed into rice, Applied to change paddy drought resistance.

In the present invention, Agrobacterium described in step (2) is EHA105.

In the present invention, the Agrobacterium containing expression vector is infected into rice callus, culture, degerming, antibiotic at 28 DEG C Screening and differentiation, amount to 4 months time.

In the present invention, rice transcription factorOsERF101Nucleotide sequence, gene locus: LOC_Os04g32620, 2360 bp of full length gene, black matrix underscore part are exon, remaining is introne and UTR region, and nucleotide sequence is shown in SEQ Shown in ID NO.1；CDNA coding region sequence grows 807 bp, and sequence is as shown in SEQ ID NO.2；The gene encodes 268 amino Acid, amino acid sequence is as shown in SEQ ID NO.3.

In the present invention, cloned from rice mRNA by reverse transcription PCROsERF01Primer sequence, the amplifying riceOsERF01The primer of gene is SEQ ID NO.4 and SEQ ID NO.5.SEQ ID NO.4 is specially OsERF101-F:5 '- GGATCCATGGTCACCGCGCTAGCCCA-3'；SEQ ID NO.5 is specially OsERF101-R:5 '- GGTACCTCACGACGACGAATCCTTCTT-3’ 。

In the present invention, the riceOsERF01The carrier of gene, such as pCAMBIA1301U carrier.

In the present invention, the riceERF01The host of genophore.Preferably, the host is plant；It is highly preferred that The host is rice.

The present invention is provided to detect the method for expression quantity in transgenic paddy rice, the main method for utilizing quantitative fluorescent PCR； Specific steps are as follows: the blade for taking transgenic paddy rice extracts rice RNA with TRIzol method, and digests DNA with DNaseI, then instead Transcription forms cDNA, carries out quantitative fluorescent PCR as template using it and is analyzed.Fluorescence quantification PCR primer nucleotides sequence is classified as SEQ ID NO.6 and SEQ ID NO.7.SEQ ID NO.6 is specially OsERF101qpcr-F:5 '- CAGCAGGCTTCTTCCTTCTACC -3 ', SEQ ID NO.7 are specially OsERF101qpcr-R:5 ' - CTTCTTCGGGTCCCTTATCTCC -3’ 。

It is reported according to the applicationOsERF101The function of gene, will using transgenic approachOsERF101It is transferred to plant Obtained in drought resistance enhancing genetically modified plants, such as drought resistance enhancing rice, corn, wheat or Soybean and Other Crops strain System.

The present invention at least have following advantages and the utility model has the advantages that

(1) rice provided by the inventionOsERF101Gene and its coding albumen have obvious in terms of improveing plant drought resistance Effect, can reduce the death rate for the crops planted on arid lands, have very big application value.

(2) contain the present invention using what transgenic technology obtainedOsERF101The conversion plant of gene is under water deficit conditions Pollen grain fertility is better than wild type, showsOsERF101Gene can be tied by improving the reproductive growth state of crop and improving Real rate stablizes the cereal crops yield under dry weather.

Detailed description of the invention

The building of Fig. 1 transgene carrier and genetically modified plants identification.

A. it is overexpressed and rna interference vector simplified diagram, upper figure is over-express vector, the following figure is RNAi carrier；

B. T-DNA exists in T-DNA insertion mutation bodyOsERF101Insertion point schematic diagram in gene, right side are to utilize sxemiquantitative PCR detectionOsERF101 Gene in wild type and mutant expression as a result, showingoserf101Mutant is one Loss-of-function mutant；

C. it is expanded using PCR meansHPTGene (hygromycin gene) identifies transgenic positive strain；

D. it is identified using Semiquatitative RT-PCR assayOsERF101It is being overexpressed and the expression in RNA interference strain.It is marked in figure For carrying out the strain of arid experiment；

E. it is identified using quantifying PCR methodOsERF101It is being overexpressed and the expression in RNA interference strain.

Identificationoserf101Using flower as the material of extract RNA when mutant and RNAi strain, becauseOsERF101 It is high During degree is expressed in and spends；Identification is overexpressed strain and then uses leaf as material, becauseOsERF101Expression is low in leaf.

Fig. 2 OsERF101 has transcriptional activity.Turn the yeast of sky BD carrier as control, turns BD-OsERF101 carrier Yeast occur blue, illustrate OsERF101 have the function of activation reporter gene expression.

Under Fig. 3 infiltration and drought stressOsERF101 It is overexpressed the phenotype of strain.

A-D. under seedling stage osmotic stressOsERF101It is overexpressed the phenotype of strain.4 leaf phase plants (growth about 3 weeks) are placed in 20% PEG6000 is handled 3 days, is then taken pictures.A, C, plant before coercing;B, D, plant after stress.VC is transgene carrier Control.OX2,8,9, to be overexpressed strain, show apparent osmotic stress tolerance phenotype.Scale bar, 2 cm.

E-H. under boot stage drought stressOsERF101It is overexpressed the phenotype of strain.E, G, before drought stress;F, H, After drought stress.Scale bar: 10 cm.

I. after boot stage drought stress plant survival Analysis；J. arid front and back leaf r elative water content analysis； K. Arid front and back blade Determination of Chlorophyll content analysis；L. proline content analysis in the blade of arid front and back；M. arid front and back blade The analysis of POD enzyme activity；N. arid front and back foliar SOD enzyme activity analysis.Mean+SD (n >=40) are shown as in figure.Experiment weight It is 3 times multiple；Difference between wild type and transgenic line carries out T- inspection, P≤0.01 * P≤0.05, * *.

Fig. 4OsERF101Expression deletion reduces rice drought tolerance.

A. under normal and drought stressOsERF101 Interfere the phenotype of strain and deletion mutant.Ri1, Ri2 are interference Strain；KO isoserf101Mutant.Scale bar: 10 cm.

B. the survival rate of each strain compares under drought stress；

C. each strain blade compares with respect to water content under normal and drought stress；

D. each strain chlorophyll content in leaf blades compares under normal and drought stress；

E. each strain proline content analysis under normal and drought stress；

F. each strain blade POD activity analysis under normal and drought stress；

G. each strain sod activity analysis under normal and drought stress.

Figure intermediate value is average value ± SD (n >=40), is tested as 3 repetitions.Difference between wild type and mutant carries out T is examined, P≤0.01 * P≤0.05, * *.

Fig. 5OsERF101Overexpression enhances rice pollen grain fertility under drought stress, and improves setting percentage.

A. the bright red result for carrying out pollen grain dyeing in Lishan Mountain is utilized.Fertile flower powder dyes darkviolet and sterile pollen grain is Blue；

B. different plant flowers powder fertility ratio are compared with being overexpressed and improve pollen grain under drought stress and educate under normal and drought stress Property；

C. the setting percentage of different plants compares under normal and drought stress conditions, and overexpression improves setting percentage under drought stress；

D. the mass of 1000 kernel of different plants is compared under normal and drought stress, and there was no significant difference for each strain mass of 1000 kernel.

Figure intermediate value is average value ± SD (n >=20), is tested as 3 repetitions.Difference between wild type and mutant carries out T is examined, P≤0.01 * P≤0.05, * *.

Fig. 6OsERF101The expression pattern analysis of gene in rice.

A. under normal growing conditionspOsERF101:GUS The tissue specificity table of gus reporter gene in transgenic line Up to situation.Blue is GUS activation signal.Wherein spire is 4 leaf phase blades;Old leaf is tillering stage blade；

B. the anther under normal growing conditions utilizesOsERF101The result of probe progress in situ hybridization.OsERF101It is expressed in In tapetum and microspore.Brown indicates positive signal.Positive-sense strand hybridizes the control hybridized as antisense strand.T, tapetum； Msp, microspore；

C. OsERF101Expression pattern analysis under the conditions of Different stress.PEG6000, 20%；ABA, 50μM；NaCl, 200mM.Seedling PEG6000, ABA or the NaCl processing of two weeks sizes, take blade to carry out qRT-PCR.The value shown in figure is Mean+SD, T- examine P < 0.05 *; ** P<0.01.Scale bar: root, callus, spire, old leaf, arid spire It is 1cm with old leaf；Panicle initiation, 0.5cm；Young flower and gynoecium, 0.5mm；Seed in stamen and development, 1mm；B medium scale: 50 μ m。

Fig. 7 OsERF101 has regulated and controled the expression of environment stress tolerance related gene.

A.OsERF101The expression for being overexpressed stress response gene in strain and mutant changes.The arid side of body The flower for compeling to collect the 5-8 phase after a week carries out qRT-PCR, using wild-type plant flower as control.D-OX8, D-OX9 are arid Overexpression strain under stress；D-WT is the wild type under drought stress；KO is mutant；

B. expression of the ABA responsive genes in blade changes after two weeks big seedlings handle different time with 20% PEG6000,OsERF101Overexpression change the expressions of these genes.The value shown in figure is mean+SD.

Specific embodiment

The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention..

Test method without specific conditions in following embodiment, according to normal conditions, such as Sambrook equal part Son clone: described in laboratory manual (New York: Cold Spring Harbor Laboratory Press, l989) Condition, or according to manufacturer suggest condition.

1 rice of embodimentOsERF101The clone of gene cDNA, transgene carrier construct and the acquisition of mutating strain series

(1) extraction of RNA: take the rice flower of Osmotic treatment that 1 ml is added with powdery is ground into after liquid nitrogen frozen in mortar In TRIzol reagent (TaKaRa), sufficiently after oscillation, 5 minutes are placed at room temperature for, in 4 DEG C, after 12000 rpm are centrifuged 10min, supernatant It moves in new EP pipe, in addition 200 μ l chloroforms blend together emulsus, is stored at room temperature 5 minutes, after 12000 rpm are centrifuged 10min, supernatant Liquid moves in new EP pipe, and two volumes isopropanol precipitating RNA is added, and is digested with DNaseI(Fermentas) for 37 DEG C after dissolution Degradation residual DNA 1 hour.Then rna content is measured on spectrophotometer.

(2) reverse transcription: according to the PrimeScript of TaKaRa company^TMReverse Transcriptase specification into Row operation: 5 μ l of rice total RNA (5 μ g) is added in centrifuge tube, Oligo (dT)₁₇Primer(50 μm of ol/L) 1 μ l, DNTP(10 mmol/L) 1 μ l, and 10 μ l are added to distilled water；Brief centrifugation makes liquid concentrate on tube bottom, 65 DEG C of heat preservations 5 Min cools down rapidly 2 min or more on ice.5 × PrimeScript is added in said mixture^TM4 μ l of Buffer, RNase inhibitor (40 U/ μ l) 0.5 μ l, PrimeScript^TMReverse Transcriptase(200 U/ μ l) 0.5 μ L, distilled water add to 20 μ l, and centrifugation makes liquid concentrate on tube bottom, and 42 DEG C of heat preservation 1 h, 70 DEG C of 15 min of inactivation, cooled on ice obtain To rice cDNA.

(3) clone of cDNA

According to the sequence information provided in Rice database information in GenBank, design primer (SEQ ID NO.4), using RT- PCR method carries out cDNA full-length clone.

By RT-PCR obtain one include complete open reading frame code area, length is 810 bp or so；Recycling, even It is connected on pMD19-T carrier, and is sequenced.Sequencing result carries out BLAST analysis on the website NCBI, as the result is shown itself and water Rice annotates gene LOC_Os04g32620 matching, annotates as AP2/ERF superfamily member OsERF101.

(4) it is overexpressed transgene carrier building

It will haveOsERF101The cDNA segment of complete reading frame scales off laggard from the correct intermediate vector pMD19-T of sequencing One-step cloning is surveyed to using corn ubiquitin gene as (Figure 1A) on the over-express vector (such as pCAMBIA1301U) of promoter The over-express vector is transferred in Agrobacterium by sequence again under the premise of guaranteeing that reading frame is correct, is contained by bacterium colony PCR screeningOsERF101The positive Agrobacterium bacterium colony of cDNA, the rice transgenic method (Ozawa 2009) then introduced using Agrobacterium Over-express vector is transferred in rice OryzasativaLcv.Nipponbare.

(5)OsERF101The building of rna interference vector

In order to further proveOsERF101Function, we using RNA interference means construct the knock of the gene again Down (strikes low) strain.It willOsERF101The stronger length of sequence specificity is the segment of 371 bp with just in gene coding region Anti- both direction is inserted into pGEM-RNAi carrier, forms a hair clip palindrome (Figure 1B), then by this section of hair clip knot Structure is scaled off in insertion pCAMBIA1301U carrier using the restriction endonuclease sites at both ends, is sequenced after determining that clone is correct, It is transferred in EHA105 Agrobacterium, by the transgenic technology of mediated by agriculture bacillus, interference gene is transferred in rice OryzasativaLcv.Nipponbare, is screened To after hygromycin positive seedling, plants in crop field, obtain follow-on seed.

(6) clone of promoter and the building of GUS report carrier

Oryza sativa genomic dna is extracted with CTAB method, is expanded by round pcrOsERF1013 kb size segment of the upstream Gene A TG Promoter, upstream primer introduce Hind III digestion site and protection base, downstream primer introduce BamH I restriction enzyme site and Protect base.Amplified production after digestion is connected into whole carrier pCAMBIA1301 under T4 connection enzyme effect, so thatOsERF101 Promoter merged with gus reporter gene.It obtains and is transferred in Agrobacterium EHA105 after connecting correct plasmid, then utilize agriculture bar Reporter gene is transferred in rice OryzasativaLcv.Nipponbare by bacterium.

(7)oserf101The acquisition and identification of mutating strain series

In order to further confirm thatOsERF101Function, we are from RISD-DB(http: //cbi.khu.ac.kr/ RISD_ DB.html) database orders the T-DNA insertion mutation body (Figure 1B) of the gene, identifies and finds through DNA and RNA level T-DNA is inserted in second exon, it is a gene expression depletion mutant (Figure 1B)；

The identification of 2 transgenic plant of embodiment

Clip transgenic paddy rice blade extracts DNA with CTAB method, and the method identification that whether there is by detecting hygromycin gene turns Genetic profile (Fig. 1 C).Blade is extracted with TRIzol method or spends middle RNA, and reverse transcription uses TaKaRa company at cDNA, reverse transcription PrimeScript RT reagent Kit with gDNA Eraser.Due toOsERF101In spending expression compared with Height, and expression is low in spire, therefore detects in RNAi and mutantOsERF101When expression, material is used as using flower Material is to carry out quantitative and semi-quantitative PCR, with displayOsERF101The difference of expression；And it detects overexpression strain and then uses leaf Piece is material, and reason is identical.The primary dcreening operation (Fig. 1 D) that transgenic line is carried out using semiquantitive PCR means, using quantitative PCR into one Step confirms the difference (Fig. 1 E) of its expression.Fluorescent quantitation reagent uses the PrimeScript RT of TaKaRa company Master Mix.Fluorescence quantitative PCR instrument is ABI Steponeplus^TM, primer sequence is shown in SEQ ID NO.5.

To in transgenic lineOsERF101Expression carry out sxemiquantitative and quantitative PCR identification after, select OX2, The transgenic line of OX6, OX8 and OX9 variable expression continues Phenotypic Observation, wherein in OX6OsERF101Expression It is close with wild type, it can be used as non-transgenic control or empty vector control (VC)；R1 is then selected in RNAi transgenic line Relatively low strain carries out Phenotypic Observation (Fig. 1 D, 1E) together with mutant with two expression quantity of R2.

3 yeast one-hybrid of embodiment determines the transcriptional activation activity of OsERF101

It willOsERF101The open reading frame of gene is cloned in yeast vector pDEST-GBKT7, is then transformed into the place AH109 In main bacterium (Gietz and Woods 2002).Yeast is coated on the mono- scarce culture medium of SD/-Trp, positive transformants are screened Son, after then positive bacterium colony is incubated overnight and is diluted, dibbling on the mono- scarce culture medium of the SD/-Trp supplemented with X- α-Gal, The enzymatic activity of MEL1 is observed, if bacterium colony becomes blue, shows that OsERF101 has transcriptional activation activity, has activated GAL4 report Accuse the expression of gene.

The result shows that (Fig. 2), OsERF101 has the transcriptional activity of activation reporter gene expression really, shows that it is one Transcription factor.

Embodiment 4OsERF101It is overexpressed the Identification of Drought of transgenic rice plant

Laboratory carries out chip analysis and the result of gene expression analysis showsOsERF101The expression under drought condition It significantly improves, shows that it participates in Rice Drought Resistence stress response process, therefore rightOsERF101The overexpression transgenic paddy rice of gene (OryzasativaLcv.Nipponbare) carries out water stress experiment with Adult plant in seedling stage, with analyzing rice geneOsMYBDrought resisting and Osmotic Stress Tolerance Phenotype.

(1) nutrition organs (leaf) Identification of Drought

Grow rice seedlings in rice fluid nutrient medium, it is to be grown to four leaf stage when (after about 3 weeks), PEG6000 is added and is cultivated The wilting situation of each strain is observed after extremely final concentration of 20%, 3 days in base.The result shows thatOsERF101Overexpression strain OX2, OX8, OX9 strain have certain resistance to PEG, and the survival condition for being overexpressed strain is substantially better than WT(Fig. 3 A- D)；Transgenic paddy rice and control strain are placed in the square plate of the soil containing Rice Cropping and are grown, is inclined when rice grows to boot stage Extra water and stop watering in basin, allows moisture natural evaporation, when soil moisture content is reduced to 20% or so, maintain this aqueous Amount about 10 days, then rehydration one week, observes rice phenotype, the Survival of transgenic paddy rice blade is significantly better than wild type (figure 3E-H).It is found after survival rate after measurement rice rehydration, the survival rate for being overexpressed strain is significantly higher (can increase by 20% or more) The physiological status that overexpression strain has also been confirmed in the measurement of (Fig. 3 I), leaf water content and chlorophyll content is better than wild type (figure 3J, K), explanationOsERF101The drought-enduring performance of plant is enhanced after overexpression； OsERF101 Gene pairs drought tolerance rises just Regulating and controlling effect.We further have detected in plant body and can help to improve the enzymatic activity of drought-enduring performance and the level of metabolin, example Such as the variation of peroxidase (POD) activity, superoxide dismutase (SOD) activity and proline content.The result shows that figure Show that POD enzymatic activity and proline content in overexpressing plants are all increased significantly (Fig. 3 L, M) in 4a, but SOD is living Property is without significant change (Fig. 3 N).

Short-term osmotic stress equally is carried out to seedling stage RNAi strain R1, R2 and mutant, is found not bright with wild type Aobvious difference (figure omits)；But when planting to be carried out to Gradual drought processing in basin,Oserf101(mutant is corresponding for mutant Wild type background be DJ), then find RNA interference strain and KO strain all than wild type to arid more sensitive (Fig. 4 A, B), leaf Piece moisture content, chlorophyll content, proline content and POD, SOD enzyme activity have different degrees of reduction (Fig. 4 C- compared with wild type G).

(2) floral organ Identification of Drought

Rice Cropping, when growing to reproduction period starting, removes excessive moisture in the rectangular basin containing rice soil, natural drought, When moisture evaporation to soil moisture content is 20% or so, a small amount of moisture content is suitably supplemented daily, keeps this low-water-content one week, so Rehydration afterwards takes spike of rice when will ear, and utilizes the activity of Alexandria red colouring method observation paddy pollen grain, the method is as follows: The flower acquisition mature flower powder for taking the non-instant of complete cracking of anther, by anther on glass slide, adding 1 drop distilled water, with tweezers by anther It smashs to pieces, discharges pollen grain.It dries, about 10min；Add 1~2 drop staining solution, covered, 5min；Under the microscope 2~3 pieces are observed in observation, and every takes the 3-5 visual field, count the rate of dyeing of pollen, wherein claret-colored pollen is fertile Pollen, blue for pollen sterile (Fig. 5 A), pollen fertility is equal to fertile pollen number/(fertile+pollen sterile sum).As a result it shows Show, is overexpressedOsREF101The transgenic paddy rice of gene pollen grain fertility under drought condition is apparently higher than control group (Fig. 5 B), Fertility improves 10%-20%, and RNAi strain is then opposite.Rehydration measures setting percentage and thousand after paddy growth to maturation after arid Grain weight, discovery are overexpressed setting percentage in strain and improve 9%-15% also above control strain (Fig. 5 C), setting percentage, mention with pollen grain fertility High trend is consistent, but mass of 1000 kernel is not then influenced (Fig. 5 D) by the gene expression dose.ExplanationOsERF101After expression improves Influence to yield under drought stress, which mainly passes through, improves setting percentage rather than mass of 1000 kernel.

Attached drought resistance physical signs method:

I. the measurement of proline content

The measurement of proline content uses ninhydrin method.

(1) standard curve making: take 7 brace plug scale, 15 ml centrifuge tube according to the form below that each reagent is added.Add glass after mixing Bulb stopper heats 30 min in boiling water.Proline titer is 10 μ g/ml.4 ml toluene of people is added to fill to each pipe after taking-up is cooling Point oscillation, stands, draws toluene layer, with No. 0 pipe for impinging upon colorimetric under 520 nm of wavelength.Using extinction value as ordinate, with dried meat Histidine content is abscissa, draws standard curve, seeks equation of linear regression.

Test tube number	0	1	2	3	4	5	6
								Water ml	2	1.6	1.2	0.8	0.4	0.2	0
Proline titer ml	0	0.4	0.8	1.2	1.6	1.8	2
								Glacial acetic acid ml	2	2	2	2	2	2	2
Ninhydrin ml	2	2	2	2	2	2	2

(2) sample measures；It takes 0.2 g of Rice Leaf agreement that contracts a film or TV play to an actor or actress of different disposal to shred mixing, is respectively placed in centrifuge tube, 5 ml are added 3 % sulfosalisylic acid solutions extract 30 min in boiling water bath.Test tube is taken out, after being cooled to room temperature, 2 ml of Aspirate supernatant, Add 2 ml glacial acetic acids and 2 ml ninhydrin developing solutions, 30 min are heated in boiling water bath.Next-step operation presses standard curve making side Method carries out toluene extraction and colorimetric.The calculating of proline content in sample: proline content (μ g/g)=(C*V/A)/W*10⁶ C in formula: proline content (μ g) in extracting solution is acquired by standard curve；V: extracting solution total volume (mL)；A: it surveys

The volume (mL) that timing is drawn；W: sample weight (g).

Determination of activity

SOD determination of activity nitroblue tetrazolium (NBT) method.

(1) enzyme solution extracts: taking 0.5 g of Rice Leaf agreement that contracts a film or TV play to an actor or actress of different disposal, after liquid nitrogen grinding, 10 ml extracting solutions are added；It takes 5 ml, 8000 rpm at 4 DEG C are centrifuged 15 min.Supernatant is SOD crude extract.

(2) chromogenic reaction: taking 4, the identical test tube of quality, and 2 are measurement, and 2 are control, and reagent is added according to the form below.It is mixed After even, 1 control tube shading is placed in lower 28 DEG C of 4000 lx fluorescent lamps with other pipes simultaneously and reacts 30 min.

Reagent	Phosphate buffer	Met	NBT	EDTA	Riboflavin	Enzyme solution	Water
								Dosage ml	1.5	0.3	0.3	0.3	0.3	0.1	0.5

(3) SOD determination of activity and calculating: after reaction, with black cloth cover test tube, reaction is terminated.With the control tube of shading As blank, the absorbance of each pipe is measured under 560 nm wavelength respectively, calculates SOD activity.

SOD activity=(A₀- As) × Vt/(0.5 × A₀× FW × V1)

Wherein SOD gross activity (U/g)；A₀: the absorbance value of irradiation control tube；As: the absorbance value of sample cell；Vt: sample is total Volume, ml；V1: amount of samples when measurement；FW: sample fresh weight, g.

Determination of activity

POD determination of activity uses guaiacol method.

(1) preparation of enzyme solution: the rice leaf of 0.1 g different disposal is taken, is transferred in centrifuge tube after liquid nitrogen grinding, constant volume 10 min are centrifuged to 5 ml, and in 3000 g.

(2) Peroxidase Activity Determination: the reaction system of enzyme assay is 2.9 ml, 0.05 M phosphate buffer, 1.0 ml 2% H₂O₂, 1.0 ml, 0.5 M guaiacol and 0.1 ml enzyme solution.It is control, reactant with the enzyme solution for boiling 5 min After enzyme solution is added in system, 15 min are kept the temperature in 37 DEG C of water-baths immediately, are transferred in ice bath rapidly afterwards, and 2 ml, 20% 3 chloroethene is added Acid terminates reaction, is transferred to 6000 g in centrifuge tube and is centrifuged 5 min.Absorbance is measured under 470 nm wavelength.

(3) result calculates: with interior A per minute₄₇₀Variation 0.01 is 1 peroxidase activity unit U.

Peroxidase activity [U/(g × min)]=△ A470 × Vt/(W × Vs × 0.01 × t)

In formula: △ A470 is the variation of reaction time internal absorbance；W is sample fresh weight, g；T is reaction time, min；Vt is to mention Take enzyme solution total volume, ml；Vs takes enzyme solution volume, ml when being measurement.

Embodiment 5OsERF101The expression characteristic of gene is analyzed and tissue specific expression observation

Analysis showsOsERF101It plays an important role during drought stress and anther development, for a further understanding ofOsERF101The function of gene, we willOsERF101Gene promoter and reporter GUS construct report carrier and turn base Cause, and studied using the means of in situ hybridization and qRT-PCROsERF101The spatial and temporal expression profile of gene.

It obtainsOsERF101Promoter drivingGUS(see embodiment 1) after reporter gene transgenic line, contaminated using GUS Color detectionOsERF101Activity (Fig. 6 A) of the promoter in different tissues.The result shows that in nutrition organs, only in arid Old leaf in can detect GUS signal, in the plant root, stem, spire, old leaf under normal growing conditions without apparent GUS contaminate Chrominance signal, explanationOsERF101Expression under normal circumstances in these tissues is lower, the spire after drought stress Injury can detecte GUS signal；In reproductive organs, in addition to the flower glume in advanced stage, the whole flower of early stage (1-5 phase) It can detect stronger GUS activity, 11 phases only detected GUS blue signal later in anther and gynoecium, in the kind of development Signal only can be detected in wound in son.In order to deeper into understandingOsERF101Expression pattern, we are miscellaneous in situ with RNA Friendship method detectsOsERF101In the expression (Fig. 6 B) of Rice Anther (stamen).The result shows that in the 4th phase of Spikelet development, It can be detected in four coyote holes weakOsERF101Signal；In stage5,6,7 and 8, in the tapetum of anther, microspore It can detect relatively strongOsERF101Signal；It is detected in stage11 in the tapetum of antherOsERF101Expression, in suede Carpet veneer residual position can also detect weakOsERF101Signal, RNA in situ hybridization result are substantially consistent with GUS coloration result.

In order to further analyzeOsERF101Gene by stress-inducing expression, we acquire respectively by PEG6000, ABA and NaCl handle the total serum IgE of the rice seedlings of different time points, are analyzed by qRT-PCR methodOsERF101Base Because of the expression pattern (Fig. 6 C) under different disposal.The result shows thatOsERF101By the inducing expression of PEG, ABA, in PEG processing 1h obviously rises afterwards, but has dropped again after handling for 24 hours；And ABA handle 3 hours just rising, until for 24 hours when reach peak；OsERF101Not by the inducing expression of NaCl.Based on the above results as can be seen thatOsERF101Mainly inside and outside reproductive organs It is expressed in bran, anther and gynoecium.OsERF101By the induction of PEG and ABA, but not by the stress-inducing of NaCl.

Used method in attached embodiment:

I. the histochemical stain of GUS reporter gene expression

It takes plant sample to be put into 90% acetone and pre-processes 10 min；It washed once with suitable dyeing liquor without X-GLUC；So After be put into GUS dyeing liquor, vacuumize 10 minutes 3 times；It is then placed in Incubation in dark in 37 DEG C of insulating boxs, is observed every half an hour Color developing effect can be stayed overnight；After a certain period of time, GUS dyeing liquor is sucked out, adds 100% ethanol dehydration, is then taken pictures with optical microscopy. After change 70% ethyl alcohol into and be placed on 4 DEG C and can save for a long time.

In situ hybridization

The process of plant paraffin section: vegetable material is fixed with the FAA fixer of no RNase, through graded ethanol (50%, 60%, 70%, 85% and 95% each 1 h) be dehydrated after, changed several times among 100% ethanol dehydration, 4 h(more)；With 25% dimethylbenzene, 75% second Alcohol；50% dimethylbenzene, 50% ethyl alcohol；75% dimethylbenzene, 25% ethyl alcohol；100% dimethylbenzene is further dehydrated each 1h, then 100% diformazan The wax disk(-sc) of+1/4 volume of benzene is stayed overnight；Dimethylbenzene gradually is substituted with paraffin afterwards, then changes wax daily twice, continuous three days, at this point, group Tissue samples have been embedded in paraffin；Then be sliced with paraffin slicing machine, slice with a thickness of 6-8 μm.

Probe prepares: after the carrier linearization for enzyme restriction of situ probes building, utilizing DIG RNA labeling kit (Roche) it is transcribed in vitro, respectively transcribed plus probe and antisense probe.

Transcription system:

2 μ g of template DNA

2 μ l of transcription buffer

Nucleotide (UTP and dig-UTPmix) 2 μ l

RNAsin(RNAse inhibitor) 1 μ l

2 μ l of RNA polymerase

The processed sterile water polishing total volume of DEPC is 20 μ l

37 DEG C keep the temperature 2 hours.Then plus 80 μ l DEPC water, 1 μ l 100 1 μ l is taken to run the quality of glue detection RNA after having transcribed, Mg/ml tRNA and 5 Units DNase, 37 DEG C of 10 min of heat preservation digest DNA.

Prepare before hybridization: testing vessel used and toasted 3~4 hours through 180 DEG C；Crossover operation used solution before completing It is both needed to be prepared with DEPC water；The slide that glass slide is handled with special poly-D-lysine.

The process of in situ hybridization:

(1) paraffin section dewaxes through conventional xylene to water, and then 2 × SSC pre-processes 15-20 min；

(2) exposure mRNA nucleic acid fragment: the protein on enzymatic hydrolysis RNA, the purpose RNA that exposure need to hybridize.Preheat albumen enzyme buffer Liquid is rapidly added Proteinase K to 1 mg/ml of final concentration, 37 DEG C of 30 min of heat preservation；

(3) tissue is fixed again: fixer is 1% paraformaldehyde (being prepared with the 0.1 M PBS of pH7.2-7.6), and room temperature fixes 10 Minute.DEPC- is washed 3 minutes × 3 times；

(4) acetic anhydride process: in the triethanolamine that 2 ml acetic anhydrides addition, 400 ml, 0.1 M is newly matched, post-processing is stirred and evenly mixed 10 min of slide, main function are to make electrically charged acetylated, prevent non-specific adsorption probe；

(5) it washs and is dehydrated, successively after the ethanol dehydration of 1 × PBS, 30%, 60%, 80%, 90%, 95%, 100%, vacuum drying；

(6) preparation of prehybridization -- wet box: dry hybridizing box bottom adds the blotting paper being saturated with 0.3 M NaCl-50% formamide To keep humidity.It is incubated for 1-2 hours by after every slice plus 100 μ l prehybridization solutions to 45 DEG C of insulating boxs；

(7) hybridize: adding 100 μ l hybridization solutions by every slide；

(8) it washing: removing coverslip, 37 DEG C or so of 2 × SSC is washed 5 minutes × 2 times, and 0.5 × SSC washes 15 minutes × 1 time, and 37 DEG C 0.2 × SSC is washed 15 minutes × 1 time；

(9) RNase processing and washing: after solution processing slide 30 min of 37 DEG C of preheatings containing RNase, with RNase buffer Washing 3 times, every time 15 min；Then with 2 × SCC room temperature washing, 30 min × 2 time；

(10) it develops the color: 1 × PBT room temperature washing, 5 min；0.5% confining liquid closes 30-60 min；1 × PBT washs 1 min；Every Slide adds 100 μ l anti-dig-AP antibody at room temperature to be incubated for 30-120 min(in the wet box containing 1 × PBT)；1 × PBT washing 20 min×2 min；1 × TNM50 washs 5 min；Every slide adds the developing solution color development at room temperature of 100 μ l, 2% NBT/BCIP (longest can develop the color 7 days).

The application fluorescence quantifying PCR method detection of embodiment 6 turnsOsERF101The variation that adversity gene is expressed in trans-genetic hybrid rice

It extractsOsERF101Then the overexpression strain of gene and the RNA of mutant, reverse transcription utilize TaKaRa company at cDNA Fluorescent quantitation reagent carry out the quantitative analysis specifications of associated companies (concrete operations referring to) of rna expression, then basis-Δ Δ CT method analyzes the expression of gene, in all cases using corresponding wild type as control.The base of concrete analysis Because of reported gene relevant to drought resisting, respectivelyPOD、DREB、SDR、RD22、P5CS1、OAT、P5CDH、ABA-OX3, LEADeng.(Fig. 7 A) as the result is shownOsERF101The overexpression of gene can significantly increasePOD、P5CS1、ABA-OX3、LEA、 DREBIsogenic expression shows that this gene may be by the expression of transcriptional control gene related to drought tolerance to reach the mesh of drought resisting , the especially relevant gene of proline synthesis and ABA signal pathway related gene.Further using qRT-PCR detection ABA letter The time changing curve that the significant gene expression dose in downstream of number approach is overexpressed in strains at two, is compared with wild type Compared with, the results showed thatOsERF101Overexpression result in ABA signal pathway reallyLEA、POD2、RD22The expression liter of gene High (Fig. 7 B), showsOsERF101Overexpression result in anti contravariance related gene in ABA signal pathway transcriptional level up-regulation, from And the resistance of crop is caused to enhance.

In conclusionOsERF101Gene encodes a transcription factor, by the induction of drought stress, under normal circumstances mainly It is expressed in floral organ.It is overexpressedOsERF101The fertility of pollen grain under drought stress can be enhanced in gene, to improve solid Rate achievees the purpose that stable grain-production.The gene has important application value in the drought stress tolerance engineering breeding of crop.

Sequence table

<110>Fudan University

<120>application of the rice Os ERF101 gene in the case where improving dry weather on Seed-Setting Percentage in Rice

<130> 111111

<160> 7

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2359

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 1

ggcaactggt tagacttttt tttccctttg cccataataa agccatctct cataaagcca 60

tcgacctcat ctcctcctcc tcctctctct gtctctctct ggctgttctt atcagtttac 120

gttgtcctca tcgtcgccgg cgccgccctc caaagcttca tagatagctc gatcgatcga 180

tcccgtcgtc gtcgatcgtc gtcgacgcag cagcctcgcc ggcggccgga gactggggag 240

atcgatcgag agggagggag gttgagtaag gtggatccac gggtcaggca tggcaagagg 300

cccctaccgg ccggcgagga ggaggaagaa gaccagccac cgcctccgac accaccagca 360

aagcaggagc agcaggacga ggaggagctc gccgcggtcg tcatcagcgg cggcggagca 420

ggagcagctc cggcgccgga gacgtacgcg cagtactact acgcggcgcg cgccgaccac 480

gacgcctccg ccatggtcac cgcgctagcc cacgtcatcc gcgccgcccc cgacctgcac 540

ctcccccacc acccatcctc ctccgcctcc gccgccgccc acccgcagca ggcttcttcc 600

ttctacccga ccgccgccgc cgccgcctcc tcgccgtccg accagctcgc cgccgccgcc 660

gctgccgaag agcaaggtac cagctgatcc attcaccgca caagtaaatt cctctctctc 720

accgcgccgc gtgccacgcc ccgattgcga aagcatggca cgcgcgagcg cgccataatt 780

tggaagcttc gcatccgcca acgccaacgc ccacgccgcc gtcttcctcg tcctacgtta 840

atccccatgg ctctagctag ctaattaccg ggttaagtag cttcgaagct tgcaatgcat 900

gcttaattag cggtaattga tccataatta attaattagt tgaaccaaac gagggttaat 960

aagttaatta actcccaaat cgttgcctat ttcgtgccgg aagatacgct aaattaatag 1020

cgccatgtga gtattttatg cacacaccgt attacgttat ccctgacgat cgaaggggga 1080

gtccgaatta gtcacggatt aattagcaag ttgcagtatt attattatta ttatgggatt 1140

aattagtggg aattaattag cttagtgtgt tttggtgggt gcaggaggag gcggcactac 1200

agaggtgttc gacagcggcc atgggggaag tgggcggcgg agataaggga cccgaagaag 1260

gcggcgaggg tgtggctggg gacgttcgac acggcggagg acgccgccat cgcctacgac 1320

gaggcggcgc tccggttcaa ggggaccaag gccaagctca acttccccga gcgcgtccag 1380

ggccgcaccg acctcggctt cctcgtcacc cgtggcatcc cccccgccgc cacccacggt 1440

ggcggctact acccctcgtc gtcgccggcg gcgggggcat gccccccgcc gcggcagcag 1500

cagacggtcg tgccgtaccc ggacctcatg cggtacgcgc agctgctgca gggcggcgtc 1560

ggcggcagtt acatgccgtt cggcggcgcc gcgacgatgt cgtcgtcgac ggtgtcgtcc 1620

tcgtcggcgc cgcagatact cgacttctcg acgcagcagc tcatccgggc cggcccgccg 1680

tcaccaatgc catcgtcggg ctccggctcg gcgaccgcgg cggcgtcgtc cacgacgtcg 1740

gcgtcgtcgc ccggtgcatg gccgtacggc ggctcggagc gcaagaagaa ggattcgtcg 1800

tcgtgacgtc actggatgga tcgatcgatg catgaatatg ccatgcattt gagaggaaga 1860

ggtcaagttt ttttttaagc aatggaaatg gattacatct tcggcctcgg cacgtggaca 1920

gaaagagatc aagtgatatg gatcgagaag aatgtttagc tgatctgctc tttactctgc 1980

acgatcgagg agatgaaaat gcatgcaata tgcatggagg ggtaagtgtt aagtggttaa 2040

ttggtgattt ttgcgggtta attaattaca tggacattaa tttttctttt gatcaccttt 2100

tgtttatttt ttctctgaaa actatcttct tttgttcatt tttattttct tggaggtact 2160

taattaatta gctaggttaa ttagctggtg atttttagtt tgttgtttcc ctccttttgt 2220

tcaagtgtga actaattgtg caaaattagt ccaagtaaag caaagagaga ggattcttat 2280

ttaattattg gttaaacatt accctttttt aagatgaaac atgatgtctt tttttaaaaa 2340

aaaaatctga atgattacc 2359

<210> 2

<211> 807

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 2

atggtcaccg cgctagccca cgtcatccgc gccgcccccg acctgcacct cccccaccac 60

ccatcctcct ccgcctccgc cgccgcccac ccgcagcagg cttcttcctt ctacccgacc 120

gccgccgccg ccgcctcctc gccgtccgac cagctcgccg ccgccgccgc tgccgaagag 180

caagggagga ggcggcacta cagaggtgtt cgacagcggc catgggggaa gtgggcggcg 240

gagataaggg acccgaagaa ggcggcgagg gtgtggctgg ggacgttcga cacggcggag 300

gacgccgcca tcgcctacga cgaggcggcg ctccggttca aggggaccaa ggccaagctc 360

aacttccccg agcgcgtcca gggccgcacc gacctcggct tcctcgtcac ccgtggcatc 420

ccccccgccg ccacccacgg tggcggctac tacccctcgt cgtcgccggc ggcgggggca 480

tgccccccgc cgcggcagca gcagacggtc gtgccgtacc cggacctcat gcggtacgcg 540

cagctgctgc agggcggcgt cggcggcagt tacatgccgt tcggcggcgc cgcgacgatg 600

tcgtcgtcga cggtgtcgtc ctcgtcggcg ccgcagatac tcgacttctc gacgcagcag 660

ctcatccggg ccggcccgcc gtcaccaatg ccatcgtcgg gctccggctc ggcgaccgcg 720

gcggcgtcgt ccacgacgtc ggcgtcgtcg cccggtgcat ggccgtacgg cggctcggag 780

cgcaagaaga aggattcgtc gtcgtga 807

<210> 3

<211> 268

<212> PRT

<213>artificial sequence (Artificial Sequence)

<400> 3

Met Val Thr Ala Leu Ala His Val Ile Arg Ala Ala Pro Asp Leu His

1 5 10 15

Leu Pro His His Pro Ser Ser Ser Ala Ser Ala Ala Ala His Pro Gln

20 25 30

Gln Ala Ser Ser Phe Tyr Pro Thr Ala Ala Ala Ala Ala Ser Ser Pro

35 40 45

Ser Asp Gln Leu Ala Ala Ala Ala Ala Ala Glu Glu Gln Gly Arg Arg

50 55 60

Arg His Tyr Arg Gly Val Arg Gln Arg Pro Trp Gly Lys Trp Ala Ala

65 70 75 80

Glu Ile Arg Asp Pro Lys Lys Ala Ala Arg Val Trp Leu Gly Thr Phe

85 90 95

Asp Thr Ala Glu Asp Ala Ala Ile Ala Tyr Asp Glu Ala Ala Leu Arg

100 105 110

Phe Lys Gly Thr Lys Ala Lys Leu Asn Phe Pro Glu Arg Val Gln Gly

115 120 125

Arg Thr Asp Leu Gly Phe Leu Val Thr Arg Gly Ile Pro Pro Ala Ala

130 135 140

Thr His Gly Gly Gly Tyr Tyr Pro Ser Ser Ser Pro Ala Ala Gly Ala

145 150 155 160

Cys Pro Pro Pro Arg Gln Gln Gln Thr Val Val Pro Tyr Pro Asp Leu

165 170 175

Met Arg Tyr Ala Gln Leu Leu Gln Gly Gly Val Gly Gly Ser Tyr Met

180 185 190

Pro Phe Gly Gly Ala Ala Thr Met Ser Ser Ser Thr Val Ser Ser Ser

195 200 205

Ser Ala Pro Gln Ile Leu Asp Phe Ser Thr Gln Gln Leu Ile Arg Ala

210 215 220

Gly Pro Pro Ser Pro Met Pro Ser Ser Gly Ser Gly Ser Ala Thr Ala

225 230 235 240

Ala Ala Ser Ser Thr Thr Ser Ala Ser Ser Pro Gly Ala Trp Pro Tyr

245 250 255

Gly Gly Ser Glu Arg Lys Lys Lys Asp Ser Ser Ser

260 265

<210> 4

<211> 26

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 4

ggatccatgg tcaccgcgct agccca 26

<210> 5

<211> 27

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 5

ggtacctcac gacgacgaat ccttctt 27

<210> 6

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 6

cagcaggctt cttccttcta cc 22

<210> 7

<211> 22

<212> DNA

<213>artificial sequence (Artificial Sequence)

<400> 7

cttcttcggg tcccttatct cc 22

Claims

1. a kind of riceOsERF101Application of the gene in the case where improving dry weather on Seed-Setting Percentage in Rice, it is characterised in that: rice Middle overexpressionOsERF101The drought resistance of rice can be enhanced, improve the setting percentage of rice under drought stress, to stablize arid The yield of rice under weather.

2. rice according to claim 1OsERF101Application of the gene in the case where improving dry weather on Seed-Setting Percentage in Rice, It is characterized in that following steps:

3. rice according to claim 1OsERF101Application of the gene in the case where improving dry weather on Seed-Setting Percentage in Rice, It is characterized by: rice transcription factor will be encoded in step (1)OsERF101Nucleotide sequence be transformed into rice, be applied to Change paddy drought resistance.

4. rice according to claim 1OsERF101Application of the gene in the case where improving dry weather on Seed-Setting Percentage in Rice, It is characterized by: Agrobacterium described in step (2) is EHA105, the Agrobacterium containing expression vector is infected into rice callus, Culture, degerming, antibiotic-screening and differentiation at 28 DEG C amount to 4 months time.

5. rice according to claim 2OsERF101Application of the gene in the case where improving dry weather on Seed-Setting Percentage in Rice, It is characterized by: rice transcription factorOsERF101Nucleotide sequence, gene locus: LOC_Os04g32620, gene are complete Long 2360 bp, black matrix underscore part are exon, remaining is introne and UTR region, nucleotide sequence such as SEQ ID Shown in NO.1；CDNA coding region sequence grows 807 bp, and sequence is as shown in SEQ ID NO.2；The gene encodes 268 amino acid, Amino acid sequence is as shown in SEQ ID NO.3.

6. rice according to claim 1OsERF101Application of the gene in the case where improving dry weather on Seed-Setting Percentage in Rice, It is characterized by: being cloned from rice mRNA by reverse transcription PCROsERF01Primer sequence, the amplifying riceOsERF01Base The primer of cause is respectively SEQ ID NO.4 and SEQ ID NO.5.

7. a kind of rice as described in claim 1OsERF01The carrier of gene.

8. carrier according to claim 8, it is characterised in that: the riceERF01The host of genophore.

9. the present invention is provided to detect the method for expression quantity in transgenic paddy rice, the main method for utilizing quantitative fluorescent PCR；Tool Body step are as follows: the blade for taking transgenic paddy rice extracts rice RNA with TRIzol method, and digests DNA with DNaseI, then inverts Record forms cDNA, carries out quantitative fluorescent PCR as template using it and is analyzed, fluorescence quantification PCR primer nucleotide sequence is respectively SEQ ID NO.6 and SEQ ID NO.7.

10. being reported according to the applicationOsERF101The function of gene, will using transgenic approachOsERF101It is transferred to plant Obtained in drought resistance enhancing genetically modified plants, the crop be rice, corn, wheat or soybean in it is any.