CN110129479A - Detect the Bi-PASA labeled primer and method of tobacco eIF4E-1 gene single base insertion mutation - Google Patents

Abstract

The invention discloses a kind of Bi-PASA labeled primers and method for detecting tobacco eIF4E-1 gene single base insertion mutation, the primer sequence is as follows: the nucleotide sequence of outer primer P is as shown in SEQ ID No.1, the nucleotide sequence of outer primer Q is as shown in SEQ ID No.2, the nucleotide sequence of inner primer A is as shown in SEQ ID No.3, the nucleotide sequence of inner primer B is as shown in SEQ ID No.4, base in above-mentioned primer sequence with underscore is the base mismatch introduced, and lowercase base is that incomplementarity is rich in G+C sequence.Using four primers of the invention, in conjunction with a PCR and electrophoresis, it can accurately detect that eIF4E-1 single base insertion mutation allele backcross transformation is returned in the process and the genotype of self progeny, raising molecular labeling assist circulation efficiency of selection, quickening breeding process.

Description

Detect tobacco eIF4E-1 gene single base insertion mutation Bi-PASA labeled primer and Method

Technical field

The invention belongs to plant biotechnology fields, and in particular to a kind of detection tobacco eIF4E-1 gene single base insertion The Bi-PASA labeled primer of mutation, the invention further relates to a kind of sides for detecting tobacco eIF4E-1 gene single base insertion mutation Method.

Background technique

Tobacco is important one of industrial crops, and tobacco potato Y virus disease, also known as arteries and veins pinta are by potato Y disease A kind of Tobacco System caused by malicious (Potato virus Y, PVY) infects disease, and yield of tobacco and quality is caused to damage throughout the year It loses.Breeding and plantation disease-resistant variety are the prevention and treatment most economical effective methods of the disease.The anti-source of studies have shown that tobacco PVY is divided into two Major class, one kind are resisted using VAM (TI1406) and its derivative germplasm TN86 as what the recessive gene site (VAM and va) of representative controlled Property, another kind of is the resistance that PVY is immunized with African tobacco (Nicotiana africana) for representative.Currently, by va The anti-source of point control is widely used in tobacco disease resistance breeding.In order to improve the breeding utilization efficiency in the site va, study both at home and abroad Person develops molecular labeling relevant to the site va in succession, such as Randomly Amplified Polymorphic DNA (RAPD) It is marked with Sequence Characterized Amplified Region (SCAR).Heredity between these labels and the site va Distance farther out, causes to judge that resistant phenotype error is larger using flag data, and then limit this kind of molecular labeling in breeding Practical application.

In the research that resistance obtains, Noguchis etc. thinks that the resistance of va genotype tobacco plant is due to feeling to PVY Caused by the missing of the genetic fragment of disease.2014, Julio etc. was close etc. using the anti-sense PVY of new-generation sequencing Technical comparing tobacco Gene line transcript profile specifies that tobacco eIF4E-1 gene is tobacco PVY recessiveness disease-resistant gene, i.e. sense PVY gene, the gene category In a seed type of Eukaryotic initiation factor (eukaryotic initiation factor, referred to as eIF).2015 Year, Liu Yong etc. develops one and eIF4E-1 wild type according to tobacco eIF4E-1 gene and its sequence information of family gene The dominant marker of allele close linkage, since the label cannot function as the codominant marker of eIF4E-1 deletion allele, It is limited in the application of practical breeding.2018, Dluge etc. compared TI 1406, K326-va using the method that RNA is sequenced With the gene expression difference in tri- kinds of tobaccos of K326, the eukaryotic translation in TI 1406 and K326-va with PVY resistance is found Missing on a large scale occurs for the chromosome segment where initiation factor eIF4E-1 gene, lacks due to establishing eIF4E-1 allele The codominant marker of mistake it should be understood that the gene delection junction fragment sequence characteristic, and eIF4E-1 gene and its flanking sequence A wide range of missing, cause researcher to fail effectively to be cloned into the missing junction fragment of the gene, obtain sequence information, thus Fail to develop the codominant marker of deletion allele.

Before this, our unit is by carrying out sequencing and sequence to the eIF4E-1 allele in the small black smoke in tobacco bred Kaiyang Comparison identifies 1 gene internal specific single base insertion point, then develops co-dominant molecular mark for the mutational site Remember and proposes entitled " mutational site tobacco eIF4E-1 specificity codominant marker and its application " to State Patent Office Application for a patent for invention, application No. is " 201810989309.6 ", a kind of tobacco eIF4E-1 single base insertion of the disclosure of the invention is prominent Become locus specificity codominant marker, label detection is made of 2 single pcr amplification reactions.It is detected with wild type site Relevant label is named as ASM-W, and amplimer is to for FW/RWm, amplified fragments size 543bp；With saltant type site primer phase The label of pass is named as ASM-m, and amplimer is to for Fm/RWm, amplified fragments clip size 543bp.

Using the label and primer can backcross transformation offspring's single plant to PVY resistant donor parent genotype carry out it is quasi- Really selection, but the detection of each single plant genotype requires to carry out 2 single PCR amplifications, and operating procedure is complex.

Two-way allele specific pcr (bi-directional PCR amplification of specific Alleles, Bi-PASA) can in a PCR reaction system simultaneously detect two different lengths allele segment, be A kind of more simple and direct allelic gene typing method can be detected the type in known mutations site by 1 PCR reaction.Most In recent years, it had been received increasingly in the biological detections such as human diseases, peanut and barley using two-way allele specific pcr More researchers payes attention to.But two-way allele specific pcr requires in same reaction system simultaneously to different gene types Specific amplification is carried out, thus the factor for influencing its expanding effect is more, and dimer, annealing temperature whether are formed between different primers It spends the different parameters such as poor, primer proportion, reaction temperature and all has higher requirement, therefore, will test different genes type Specific primer mixing, is detected in same reaction system using two-way allele specific pcr, may not can be managed Think effect, can only have to take the second best, individually detects corresponding gene type using the specific primer of different genes type.

On the basis of this test detects saltant type eIF4E-1 allele in the small black smoke in Kaiyang, explore by two-way Allele specific pcr completes the amplification of two eIF4E-1 allele molecular labelings in same reaction, educates for tobacco resistance Kind molecular labeling correlative study provides a kind of more time saving, laborsaving, cost-effective method.

Summary of the invention

The object of the present invention is to provide a kind of Bi-PASA labels for detecting tobacco eIF4E-1 gene single base insertion mutation Primer.

It is a further object of the present invention to provide a kind of detection reagents for detecting tobacco eIF4E-1 gene single base insertion mutation Box.

Another object of the present invention is to provide a kind of method for detecting tobacco eIF4E-1 gene single base insertion mutation, should The nucleotide sequence and the primer of four primers of the method based on Bi-PASA carry saltant type eIF4E-1 equipotential base in detection The anti-PVY tobacco (rr type) of cause, the sense PVY tobacco (RR type) for carrying wild type eIF4E-1 allele and simultaneously containing mutation The usage of the heterozygous tobacco (Rr type) of type and wild type eIF4E-1 allele

The technical scheme is that

In a first aspect, the present invention provides a kind of Bi-PASA label for detecting tobacco eIF4E-1 gene single base insertion mutation Primer, which is characterized in that the primer sequence is as follows:

The nucleotide sequence of outer primer P as shown in SEQ ID No.1, specifically: 5 '-CAAGTACCCTTTTCCTACTAA AATCTATAACTAAG-3'；

The nucleotide sequence of outer primer Q as shown in SEQ ID No.2, specifically: 5 '-gccggACAGAATTAGTGTCAC ATAAAATTGAAGATTTTAC-3'；

The nucleotide sequence of inner primer A as shown in SEQ ID No.3, specifically: 5 '- cggCACTTTTTCCACTGTCGAAGATTTTAG-3'；

The nucleotide sequence of inner primer B as shown in SEQ ID No.4, specifically: 5 '- GAATATGAAATAACTTACCCCCAAAAACT-3'；

Base in above-mentioned primer sequence with underscore is the base mismatch introduced, and lowercase base is rich in for incomplementarity G+C sequence.

Second aspect, the present invention provide a kind of detection kit containing the labeled primer.

The following steps are included:

Step 1 extracts tobacco bred genomic DNA；

Step 2 expands tobacco bred genomic DNA using the primer or detection kit, obtains PCR amplification and produces Object；

Pcr amplification product is carried out electrophoresis by step 3, is determined genotype.

Optionally, pcr amplification product is subjected to electrophoresis in step 3, genotype determine specifically according to the following steps Implement: amplified production is separated in agarose gel electrophoresis, the constant electrophoresis 50min detection of 100V,

If amplified production is two kinds of segments of 713bp and 440bp, display tagging genotype is RR type, is homozygous wild Raw type individual, electrophoretic band are two bands；

If amplified production is two kinds of segments of 714bp and 325bp, display tagging genotype is rr type, is homozygous prominent Modification individual, electrophoretic band are two bands；

If amplified production is tri- band of 713/714bp, 440bp and 325bp, display tagging genotype is Rr type, For heterozygous mutant individual, electrophoretic band is three bands.

Optionally, tobacco bred genomic DNA is to be mentioned using AxyPrep genomic DNA Miniprep Kit in step 1 Tobacco bred genomic DNA is taken to obtain.

Optionally, the PCR response procedures are as follows:

(1) 94 DEG C of initial denaturation 3min

(2) 94 DEG C of denaturation 30sec；

(3) 58 DEG C of annealing 30sec；

(4) 72 DEG C of extension 30sec；

Repeat the circulation of (2) → (4) 30；

(5) extend 10min eventually；

(6) 4 DEG C of preservations.

The beneficial effects of the present invention are: the present invention is that two outer primers and two inner primers are designed near mutational site, 3 ' terminal ends of inner primer are mutational site, while introducing base mismatch in 3 ' end of inner primer, when primer mispairing, extend effect Whether rate reduces, finally occurred according to the quantity of amplified fragments and size detection mutation.

The mono- alkali of eIF4E-1 can be accurately detected in conjunction with a PCR and electrophoresis using four primers of the invention It is returned during base insertion mutation allele backcross transformation and the genotype of self progeny, raising molecular labeling assists circulation choosing Efficiency is selected, breeding process is accelerated.The present invention expands 2 single PCR of anti-sense allele by being in charge of originally using 2 pairs of primers Amplified reaction is reduced to four primer one tube PCR amplifications, easy to operate, time saving and energy saving.

Detailed description of the invention

The gDNA of Fig. 1: two parts of tobacco-containing material eIF4E-1 genes expands (agarose gel electrophoresis), wherein 1,2 respectively represent K326 and Kaiyang two parts of tobacco-containing materials of small black smoke, M are DNA molecular amount standard DL15000；

The cDNA of Fig. 2: two parts of tobacco-containing material eIF4E-1 genes expands (agarose gel electrophoresis), wherein 1,2 respectively represent K326 and Kaiyang two parts of tobacco-containing materials of small black smoke, M are DNA molecular amount standard 100bpLadder；

Fig. 3: it is compared from the small black smoke in Kaiyang, K326 and red big eIF4E-1 genomic dna sequence and cDNA sequence.(a) The DNA sequence dna of tobacco eIF4E-1 gene includes 5 exons and 4 intrones.Black box represents exon, horizontal line generation Table introne.The genome sequence of K326, the small black smoke in Kaiyang (Kai) and Hongda tobacco (Hongda) compare, capitalization generation Table exon sequence, lowercase represent intron sequences, the list in the small black smoke eIF4E-1 gene First Exon in Kaiyang One insertion base (T) is shown with gray background.(b) two kinds of splice modes of the small black smoke eIF4E-1 gene in Kaiyang.Kai-1: continuous Splice mode；Kai-2: alternative splicing mode.White box represents exon.In Kai-1 and Kai-2 First Exon Single insertion base (T) and the Premature stop codon positioned at the position Kai-1 Second Exon 10-12nt are marked with arrow.

Fig. 4: Bi-PASA genetic marker inner primer (A and B) binding site and sequence (inner primer A and eIF4E1.S equipotential base The antisense strand specific bond of cause, the positive-sense strand specific bond of inner primer B and eIF4E1.Kai allele)；

Fig. 5: Bi-PASA genetic marker primer confrontation sense material genomic DNA amplification situation.M:DL2000marker；1: The small black smoke in Kaiyang；The small black smoke in 2:K326 × Kaiyang；3: the small black smoke in Hongda tobacco × Kaiyang；4: the small black smoke in 87 × Kaiyang of cloud and mist； 5:K326；6: Hongda tobacco；7: cloud and mist 87；(a) A/Q primer amplification result；(b) B/P primer amplification result；(c)A/Q/B/P Primer amplification result；

Amplification of Fig. 6: the Bi-PASA genetic marker in F2 group and parent.P1: the small black smoke in Kaiyang；P2:K326；1-21: F2 is for single plant.2,6,9,13,20 and 21 single plants are homozygous mutant (rr), and amplified production electrophoresis banding pattern and 1 Kaiyang of parent are small black Cigarette is identical, is two electrophoretic bands；7,8,11,17,18 and 22 single plants be homozygous wildtype (RR), amplified production electrophoresis banding pattern with Parent 2K326 is identical, is two electrophoretic bands；Remaining single plant is heterozygous mutant (Rr), and amplified production electrophoretic band is three Band.

Specific embodiment

1, the variance analysis of tobacco eIF4E gene loci and verifying

Research based on forefathers to PVY disease-resistant related gene, applicant is by genome weight sequencing technologies, to highly resistance, height Sense PVY tobacco bred full-length genome be sequenced and carries out deep sequence to eIF4E and eIF (iso) 4E gene family member Compare.As a result, it has been found that: compared with the conservative of high sense kind, highly resistance kind exists in various degree in eIF4E-1 gene region Base insertion or deletion mutation.

Sequence is resurveyed further to verify full-length genome and is obtained Candidate Mutant site, according to the genome sequence of eIF4E-1 With the upstream and downstream primer of the sequence design tobacco eIF4E-1 of eIF4E family member,

Upstream primer 4-S:CTAAAATCTATAACTAAGTACATAGAAAACACACG；

Downstream primer 4-A:GGTACTTAAACTGTCAAGTGGCAGC, as shown in SEQ ID NO.5,6；

To feel the PVY flue-cured tobacco cultivars K326 and anti-PVY suncured tabacco small black smoke in kind Kaiyang as material, pass through PCR and RT- respectively GDNA the and cDNA complete sequence (Fig. 1, Fig. 2) of round pcr amplification tobacco eIF4E-1.

The genome sequence that amplification obtains is sequenced, with the Hongda tobacco in Chinese tobacco genome database Discovery, the DNA sequence dna of tobacco eIF4E-1 gene is compared in (the susceptible material of PVY containing wild type eIF4E-1 gene) data Comprising 5 exons and 4 intrones, in Kaiyang, the First Exon region of small black smoke eIF4E-1 gene is conservative there are one Single base insertion mutation (Fig. 3 a).In addition, the sequencing result of cDNA amplified production is shown, amplified in the small black smoke in Kaiyang Two segments are two kinds of splice modes of eIF4E-1 gene, including a continuous montage (Kai-1) and an alternative splicing (Kai-2), wherein the single insertion base (T) being located in First Exon still remains in the transcript of two kinds of splice modes (Fig. 3 b).In the continuous splice mode of the small black smoke eIF4E-1 gene in Kaiyang, due to the insertion of single base in First Exon, The frameshift mutation of sequence generation thereafter is caused, the terminator codon of a hypothesis occurs in the position Second Exon 10-12nt, thus it is speculated that There may be a truncated proteins.It compares, in alternative splicing mode, due to the change of acceptor splicing site point, Kai-2 is caused to transcribe The length of object shortens, and wherein exon 2 completely disappears.

2, the Bi-PASA labeled primer of tobacco eIF4E-1 gene single base insertion mutation is detected

The design of 2.1 molecular labeling primers

Before this, in order to distinguish amorph eIF4E-1.Kai and its wild type gene, applicant's needle One codominant marker is established to the amorph, label detection is made of 2 single pcr amplification reactions (please join Read applicant's submission it is published application No. is 201810989309.6, the entitled " mutational site tobacco eIF4E-1 specificity The application for a patent for invention of codominant marker and its application ", the relevant label of Wen Zhongyu wild type site detection are named as ASM-W, label relevant to saltant type site primer are named as ASM-m).In order to be further simplified above-mentioned label detection operation step Suddenly, a kind of more time saving, laborsaving, cost-effective mark detection method is established, the application is according to two-way allele-specific PCR amplification principle designs 1 set of special primer to the single base insertion mutation site of eIF4E-1.Kai gene, including draws in 2 Object (A and B) and 2 outer primers (P and Q) (please referring to Fig. 4).During design of primers, for improve extension specificity, At the end 3' of inner primer, 2nd reciprocal is artificially introduced 1 base mismatch；To eliminate the asymmetric amplification of two segments of PB and AQ now As at the end primer 5' A/Q, addition incomplementarity is rich in G+C sequence.

1 Bi-PASA genetic marker primer sequence of table

A capitalization base is complementary series, and lowercase base is that incomplementarity is rich in G+C sequence.Leukorrhagia is drawn in sequence The base of line is the base mismatch introduced.

2.2 tobacco bred extracting genome DNAs

Tobacco bred genomic DNA is extracted using AxyPrep genomic DNA Miniprep Kit, the specific method is as follows:

1) it, takes the young leaflet tablet of 100mg tobacco to be placed in 2ml centrifuge tube, drying is uncapped in 55 DEG C for 24 hours, utilizes Geno/ Grinder2010SPEX high throughput animal vegetable tissue grinder oscillation be ground into fine-powdered after, be added at one time 350 μ l PBS, 0.9 μ l RNase A, 150 μ l Buffer C-L, 20 μ l Proteinase K, vortex oscillation 1min is uniformly mixed at once, and 56 DEG C water-bath 30min；

2) it is uniformly mixed that 350 μ l Buffer P-D, vortex oscillation 30s, are added, 12000rpm centrifugation 10min；

3) DNA, is prepared pipe to be placed in 2ml centrifuge tube, the centrifuged supernatant of step 1.2 is moved to and is prepared in pipe, 12000rpm is centrifuged 1min；

4) filtrate, is abandoned, pipe will be prepared and put back into original 2ml centrifuge tube, 500 μ l Buffer W1 are added, 12000rpm is centrifuged 1min；

5) filtrate, is abandoned, pipe will be prepared and put back into original 2ml centrifuge tube, 700 μ l Buffer W2 are added, 12000rpm centrifugation 1min washed once with 700 μ l Buffer W2 again in the same way.

6) filtrate, is abandoned, pipe will be prepared and put back into original 2ml centrifuge tube, 12000rpm is centrifuged 1min；

7) DNA, is prepared pipe to be placed in the 1.5ml centrifuge tube of another cleaning, adds 100 μ l preparing periosteum center Eluent or deionized water, are stored at room temperature 10min, and 12000rpm is centrifuged 1min eluted dna.

2.3 expand tobacco bred genomic DNA using primer or the detection kit comprising primer, obtain PCR amplification and produce Object

PCR amplification

1) PCR reaction system (20 μ l):

Premix TaqTM Hot Start Version	10μl
		Outer primer Q	0.4μM
Inner primer A	0.4μM
		Outer primer P	0.15μM
Inner primer B	0.15μM
		Template DNA	100-200ng
ddH2O	Add to 20 μ l of final volume

2) PCR reaction cycle program:

3) 5ul amplified production is taken to carry out electrophoresis detection on 2% agaropectin.

PCR is reacted in C1000Touch^TMIt is carried out in PCR instrument.Amplified production is separated in 2.5% agarose gel electrophoresis, The constant electrophoresis 50min detection of 100V, referring to FIG. 5, if amplified production is two kinds of segments of 713bp and 440bp, display label Body genotype is RR type, is homozygous wildtype individual, and electrophoretic band is two bands；If amplified production is 714bp and 325bp two Kind segment, display tagging genotype are rr type, are homozygous mutant individual, and electrophoretic band is two bands；If amplification produces Object is tri- band of 713/714bp, 440bp and 325bp, and display tagging genotype is Rr type, is heterozygous mutant individual, electricity Swimming band is three bands.

2.4 F2 are for group's PVY Resistance Identification

Seedling stage using viral juice frictional inoculation method to the F2 groups of the small black smoke in Kaiyang and K326 500 single plants constructed into Row PVY Resistance Identification investigates the disease-resistant situation of single plant after inoculation 20 days, susceptible single plant is 371 plants in identified group, disease-resistant single plant It is 129 plants, meets the segregation ratio of 3:1, it was demonstrated that the PVY resistance of the small black smoke in Kaiyang is controlled by Recessive genes (with r gene table Up to).

2.5 identify F2 for group's single plant genotype using Bi-PASA genetic marker

F2 is extracted for single plant genomic DNA (method is same as above) using AxyPrep genomic DNA Miniprep Kit, is made PCR amplification (method is same as above) is carried out for the DNA of single plants different in group with Bi-PASA genetic marker primer pair F2, as a result such as Fig. 6 Shown, P1 is the small black smoke in 1 Kaiyang of parent, and P2 is parent 2K326, and 1-21 is F2 for single plant.2, the base of 6,9,13,20 and 21 single plants Because type is identical as parent's small black smoke in 1 Kaiyang, i.e. homozygous mutant (rr), these single plants are anti-with PVY as the result is shown for Resistance Identification Characteristic of disease.7, the genotype of 8,11,17,18 and 22 single plants is identical as parent 2K326, i.e. homozygous wildtype (RR), Resistance Identification knot Fruit shows that these single plants have PVY susceptibility.Remaining single plant is heterozygous mutant (Rr), Resistance Identification these single plants as the result is shown Equally there is PVY susceptibility.It can be seen that it is prominent to distinguish eIF4E1 gene pure wild type, homozygosis using Bi-PASA genetic marker The accuracy rate of modification and heterozygous mutant is 100%.

SEQUENCE LISTING

Sequence table

<110>Guizhou Province Tabacco Science and Technology Institute

<120>the Bi-PASA labeled primer and method of tobacco eIF4E-1 gene single base insertion mutation are detected

<160> 6

<210>1

<211>35

<212> DNA

<213>artificial sequence

<400>1

CAAGTACCCT TTTCCTACTA AAATCTATAA CTAAG 35

<210>2

<211>40

<212> DNA

<213>artificial sequence

<400>2

gccggACAGA ATTAGTGTCA CATAAAATTG AAGATTTTAC 40

<210>3

<211>30

<212> DNA

<213>artificial sequence

<400>3

cggCACTTTT TCCACTGTCG AAGATTTTAG 30

<210>4

<211>29

<212> DNA

<213>artificial sequence

<400>4

GAATATGAAA TAACTTACCC CCAAAAACT 29

<210>5

<211>35

<212> DNA

<213>artificial sequence

<400>5

CTAAAATCTA TAACTAAGTA CATAGAAAAC ACACG 35

<210>6

<211>35

<212> DNA

<213>artificial sequence

<400>6

GGTACTTAAA CTGTCAAGTG GCAGC 25

Claims (6)

1. a kind of Bi-PASA labeled primer for detecting tobacco eIF4E-1 gene single base insertion mutation, which is characterized in that described Primer sequence is as follows:

The nucleotide sequence of outer primer P as shown in SEQ ID No.1, specifically: 5 '-CAAGTACCCTTTTCCTACTAAAATC TATAACTAAG-3'；

The nucleotide sequence of outer primer Q as shown in SEQ ID No.2, specifically: 5 '-gccggACAGAATTAGTGTCACATAA AATTGAAGATTTTAC-3'；

The nucleotide sequence of inner primer A as shown in SEQ ID No.3, specifically: 5 '- cggCACTTTTTCCACTGTCGAAGATTTTAG-3'；

The nucleotide sequence of inner primer B as shown in SEQ ID No.4, specifically: 5 '- GAATATGAAATAACTTACCCCCAAAAACT-3'；

Base in above-mentioned primer sequence with underscore is the base mismatch introduced, and lowercase base is that incomplementarity is rich in G+C Sequence.

2. the detection kit containing labeled primer described in claim 1.

3. a kind of method for detecting tobacco eIF4E-1 gene single base insertion mutation, which comprises the following steps:

Step 1 extracts tobacco bred genomic DNA；

Step 2 expands tobacco bred gene using primer described in claim 1 or detection kit as claimed in claim 2 Group DNA, obtains pcr amplification product；

Pcr amplification product is carried out electrophoresis by step 3, is determined genotype.

4. detecting the method for tobacco eIF4E-1 gene single base insertion mutation according to claim 3, which is characterized in that step Pcr amplification product is subjected to electrophoresis in rapid 3, to genotype carry out determine be specifically implemented according to the following steps: by amplified production in Agarose gel electrophoresis separation, the constant electrophoresis 50min detection of 100V,

If amplified production is two kinds of segments of 713bp and 440bp, it is homozygous wildtype that display tagging genotype, which is RR type, Individual, electrophoretic band are two bands；

If amplified production is two kinds of segments of 714bp and 325bp, it is homozygous mutant that display tagging genotype, which is rr type, Individual, electrophoretic band are two bands；

If amplified production is tri- band of 713/714bp, 440bp and 325bp, it is miscellaneous that display tagging genotype, which is Rr type, Saltant type individual is closed, electrophoretic band is three bands.

5. according to the method for the detection tobacco eIF4E-1 gene single base insertion mutation of claim 3 or 4, which is characterized in that Tobacco bred genomic DNA is to extract tobacco bred gene using AxyPrep genomic DNA Miniprep Kit in step 1 Group DNA is obtained.

6. according to the method for the detection tobacco eIF4E-1 gene single base insertion mutation of claim 3 or 4, which is characterized in that The PCR response procedures are as follows:

(1) 94 DEG C of initial denaturation 3min

(2) 94 DEG C of denaturation 30sec；

(3) 58 DEG C of annealing 30sec；

(4) 72 DEG C of extension 30sec；

Repeat the circulation of (2) → (4) 30；

(5) extend 10min eventually；

(6) 4 DEG C of preservations.