CN109971880A

CN109971880A - For detecting the nucleic acid sequence and its detection method of corn plant DBN9508

Info

Publication number: CN109971880A
Application number: CN201910279792.3A
Authority: CN
Inventors: 刘海利; 康越景; 王诚; 王利君; 李风; 张良君; 丁德荣; 鲍晓明
Original assignee: Beijing Dabeinong Biotechnology Co Ltd
Current assignee: Beijing Dabeinong Biotechnology Co Ltd
Priority date: 2019-04-09
Filing date: 2019-04-09
Publication date: 2019-07-05
Anticipated expiration: 2039-04-09
Also published as: CN109971880B

Abstract

The present invention relates to a kind of for detecting the nucleic acid sequence and its detection method of corn plant DBN9508, and the nucleic acid sequence includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series.Corn plant DBN9508 of the present invention with preferable resistance and has preferable tolerance to glufosinate-ammonium herbicide to lepidopterous insects, on yield without influence, and detection method can quickly and accurately identify in biological sample whether include transgenic corn events DBN9508 DNA molecular.

Description

For detecting the nucleic acid sequence and its detection method of corn plant DBN9508

Technical field

The present invention relates to the transgenic crops in field of plant molecular biology, especially agricultural biotechnologies research Breeding field.In particular it relates to the transgenic corn events of insect-resistant and glufosinate-ammonium herbicide tolerant DBN9508 and for detect in biological sample whether include specific transgenic corn events DBN9508 nucleic acid sequence and its inspection Survey method.

Background technique

Many areas are all main cereal crops to corn (Zea mays L.) in the world.Biotechnology has been applied In corn to improve its economical character and quality.Insect-resistant is an important economical character in maize production, especially To resistance of lepidopterous insects, such as corn borer, bollworm, black cutworm etc..Corn can lead to the resistance of lepidopterous insects Crossing transgene method makes the resistant gene of lepidopterous insects express and obtain in corn plant.Another important agronomy Character is herbicide tolerant, such as has successful corn transformation event NK603, GA21, the main growing area of the corns such as U.S. It plants extensively in domain.It is noted that glufosinate-ammonium herbicide is different from the mechanism of action of glyphosate herbicidal, for life of going out Property contact killing type herbicide, and can be used as a kind of means of effectively management glyphosate-resistant weeds.Corn is to glufosinate-ammonium weeding The tolerance of agent can make glufosinate-ammonium herbicide-tolerant gene (such as pat) table in corn plant by transgene method It reaches and obtains.

Known foreign gene is influenced in the intracorporal expression of plant by their chromosome location, it may be possible to due to dye Chromatin structure (such as heterochromatin) or transcription regulatory element (such as enhancer) are close to integration site.Thus, it usually needs screening is big The event of amount is possible to identify can be with commercialized event (event that the target gene imported obtains optimal expression). For example, having been observed that the expression quantity of quiding gene may have very big difference between event in plant and other organisms；? On the space of expression or time mode may there is also differences, such as the relative expression of transgenosis deposits between different plant tissues In difference, this species diversity shows that actual expression pattern may be with the transcriptional regulatory member in the gene construct according to importing Expression pattern desired by part is inconsistent.It is thus typically necessary to generate hundreds and thousands of different events and from these events Filter out the single incident with transgene expression amount and expression pattern desired for the purpose of being commercialized.With expected Transgene expression amount and the event of expression pattern can be used for seeping transgenosis by sexual cutcross using conventional breeding methods Enter into other genetic backgrounds.The transgene expression for maintaining original transformant by the offspring that this Crossing system generates is special Sign.It may insure that there is reliable gene expression in many kinds using this strategy pattern, and these kinds can be well Adapt to local growth conditions.

It will be beneficial that the presence of particular event, which is able to detect, so that whether the offspring for determining sexual hybridization includes target gene 's.In addition, the method for detection particular event also will be helpful to abide by relevant laws and regulations, such as the food from recombination crops It needs to obtain official approval before putting goods on the market and be marked.It is detected by any well known polynucleotides detection method The presence of transgenosis be all it is possible, such as polymerase chain reaction (PCR) or using polynucleotide probes DNA hybridization.This A little detection methods are usually focused on common genetic elements, such as promoter, terminator, marker gene etc..Therefore, unless with The sequence of the transgenosis DNA of insertion adjacent chromosomal DNA (" flanking DNA ") be it is known, above-mentioned this method cannot It is enough in and distinguishes different events, especially those events generated with identical DNA construct.So at present often using across The pair of primers for having got over the transgenosis of insertion and the junction of flanking DNA identifies transgenosis particular event by PCR, has The second primer said to body the first primer for being contained within insetion sequence and be contained in insetion sequence.

Summary of the invention

The object of the present invention is to provide a kind of for detecting the nucleic acid sequence and its detection method of corn plant DBN9508, Transgenic corn events DBN9508 with preferable resistance and has preferable tolerance to glufosinate-ammonium herbicide to insect, and Detection method can quickly and accurately identify in biological sample whether include transgenic corn events DBN9508 DNA molecular.

To achieve the above object, the present invention provides a kind of nucleic acid sequences, have SEQ ID NO:3 or its complementary series In 1-873 at least 11 continuous nucleotide and SEQ ID NO:3 or its complementary series 874-1292 at least 11 continuous nucleotide；And/or at least 11 continuous nucleosides in SEQ ID NO:4 or its complementary series 1-553 At least 11 continuous nucleotide in acid and SEQ ID NO:4 or its complementary series 554-1028.

Preferably, the nucleic acid sequence has 22-25 in SEQ ID NO:3 or its complementary series 1-873 a continuous Nucleotide and SEQ ID NO:3 or its complementary series 874-1292 in 22-25 continuous nucleotide；And/or SEQ 22-25 continuous nucleotide and SEQ ID NO:4 or its complementary series in ID NO:4 or its complementary series 1-553 22-25 continuous nucleotide in 554-1028.

Preferably, the nucleic acid sequence include SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its Complementary series.

The SEQ ID NO:1 or its complementary series are 5 ' ends in transgenic corn events DBN9508 in insetion sequence End is located at the sequence that a length near insertion junction is 22 nucleotide, the SEQ ID NO:1 or its complementary sequence Column span the DNA sequence dna of the flanking genomic DNA sequence of corn insertion point and 5 ' ends of insetion sequence, comprising described SEQ ID NO:1 or its complementary series can be accredited as the presence of transgenic corn events DBN9508.The SEQ ID NO:2 Or its complementary series is to be located near insertion junction in transgenic corn events DBN9508 in 3 ' ends of insetion sequence A length be 22 nucleotide sequence, the SEQ ID NO:2 or its complementary series span 3 ' ends of insetion sequence The DNA sequence at end and the flanking genomic DNA sequence of corn insertion point include the SEQ ID NO:2 or its complementary sequence Column can be accredited as the presence of transgenic corn events DBN9508.

Preferably, the nucleic acid sequence include SEQ ID NO:3 or its complementary series, and/or SEQ ID NO:4 or its Complementary series.

In the present invention, the nucleic acid sequence can be inserted into sequence for T-DNA in the SEQ ID NO:3 or its complementary series Any portion of at least 11 or more continuous polynucleotides (the first nucleic acid sequence) of column, or be the SEQ ID Any portion of at least 11 or more of 5 ' flank corn gene group DNA regions are continuous more in NO:3 or its complementary series Nucleotide (second nucleotide sequence).The nucleic acid sequence may further be derived from or be complementary to comprising the complete SEQ to be same A part of the SEQ ID NO:3 of ID NO:1.When the first nucleic acid sequence is used together with second nucleotide sequence, these Nucleic acid sequence can be used as DNA primer in the DNA cloning method for generating amplified production.Expanded using DNA primer in DNA The amplified production generated in increasing method is can to diagnose transgenic corn events when including the amplified production of SEQ ID NO:1 The presence of DBN9508 or its offspring.The SEQ ID NO:3 or its complementary series be in transgenic corn events DBN9508 5 ' ends of T-DNA insetion sequence are located at the sequence that a length near insertion junction is 1292 nucleotide, described SEQ ID NO:3 or its complementary series by 873 nucleotide 5 ' flanking sequence of the Maize genome (nucleosides of SEQ ID NO:3 Acid 1-873), DBN10707 construct DNA sequence dna (the nucleotide 874- of SEQ ID NO:3 of 203 nucleotide 1076) and 216 nucleotide tNos (rouge alkali synthetase) transcription terminator the DNA sequence dna (core of SEQ ID NO:3 Thuja acid 1077-1292) composition, transgenic corns can be accredited as comprising the SEQ ID NO:3 or its complementary series The presence of event DBN9508.

The nucleic acid sequence can be any portion of T-DNA insetion sequence in the SEQ ID NO:4 or its complementary series At least 11 or more the continuous polynucleotides (third nucleic acid sequence) divided, or be the SEQ ID NO:4 or its complementation Any portion of at least 11 or more continuous polynucleotides (the 4th cores in 3 ' flank corn gene group DNA regions in sequence Acid sequence).The nucleic acid sequence may further be derived from or be complementary to the institute comprising the complete SEQ ID NO:2 to be same State a part of SEQ ID NO:4.When third nucleic acid sequence is used together with the 4th nucleic acid sequence, these nucleic acid sequences can As DNA primer in the DNA cloning method for generating amplified production.It is produced using DNA primer in DNA cloning method Raw amplified production be when including the amplified production of SEQ ID NO:2 can diagnose transgenic corn events DBN9508 or its The presence of offspring.The SEQ ID NO:4 or its complementary series are in transgenic corn events DBN9508 in insetion sequence 3 ' ends are located at the sequence that a length near T-DNA insertion junction is 1028 nucleotide, the SEQ ID NO: 4 or its complementary series by 271 nucleotide pr35S transcriptional initiation sequence (1-271, the nucleotide of SEQ ID NO:4), The DBN10707 construct DNA sequence dna (272-553, the nucleotide of SEQ ID NO:4) of 282 nucleotide and 475 cores 3 ' the flanking sequence of Maize genome (554-1028, the nucleotide of SEQ ID NO:4) of thuja acid forms, and includes the SEQ ID NO:4 or its complementary series can be accredited as the presence of transgenic corn events DBN9508.

Further, the nucleic acid sequence includes SEQ ID NO:5 or its complementary series.

The SEQ ID NO:5 or its complementary series are that the length of characterization transgenic corn events DBN9508 is 8772 The sequence of nucleotide, the genome and genetic elements for specifically including are as shown in table 1.Comprising the SEQ ID NO:5 or its mutually Complementary series can be accredited as the presence of transgenic corn events DBN9508.

The genome and genetic elements that table 1, SEQ ID NO:5 include

Well known to those skilled in the art, the first, second, third and fourth nucleic acid sequence need not be only made of DNA, May also comprise RNA, DNA and RNA mixture or DNA, RNA or other not as one or more polymerase templates core The combination of thuja acid or its analog.In addition, heretofore described probe or primer should be at least about 11,12,13,14, 15, the length of 16,17,18,19,20,21 or 22 continuous nucleotides, can be selected from SEQ ID NO:1, SEQ ID NO: 2, nucleotide described in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5.When selected from SEQ ID NO:3, SEQ When nucleotide shown in ID NO:4 and SEQ ID NO:5, the probe and primer can be at least about 21 for length and arrive About 50 or more continuous nucleotides.

The nucleic acid sequence or its complementary series can be used for generate amplicon in DNA cloning method, and the amplicon is used In the presence of detection biological sample transgenic corn event DBN9508 or its offspring；The nucleic acid sequence or its complementary series It can be used in method of detection of nucleotides, to detect the presence of biological sample transgenic corn event DBN9508 or its offspring.

To achieve the above object, the present invention also provides a kind of test sample transgenic corn event DBN9508's Method existing for DNA, comprising:

Contact sample to be tested in nucleic acid amplification reaction at least two primers for expanding target amplification product；

Carry out nucleic acid amplification reaction；With

Detect the presence of the target amplification product；

The target amplification product includes the nucleic acid sequence.

Preferably, the target amplification product include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its mutually Complementary series, SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.

Specifically, the primer includes the first primer and the second primer, and the first primer is selected from SEQ ID NO:1, SEQ ID NO:8 and SEQ ID NO:10；Second primer is selected from SEQ ID NO:2, SEQ ID NO:9 and SEQ ID NO:11.

Contact sample to be tested with probe, the probe includes the nucleic acid sequence；

Hybridize the sample to be tested and the probe under stringent hybridization conditions；With

Detect the hybridisation events of the sample to be tested and the probe.

The stringent condition can in 6 × SSC (sodium citrate), 0.5%SDS (lauryl sodium sulfate) solution, Hybridize at 65 DEG C, is then respectively washed film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS.

Preferably, the probe include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.

Optionally, at least one fluorophor label of at least one described probe.

Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include the nucleic acid sequence；

Hybridize the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions；

The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then are assisted by marker Breeding analysis is to determine that insect-resistant and/or herbicide tolerant and marker nucleic acid molecules are chain on science of heredity.

Preferably, the marker nucleic acid molecules include at least one selected from the following: SEQ ID NO:1 or its complementation Sequence, SEQ ID NO:2 or its complementary series, and/or SEQ ID NO:6-11 or its complementary series.

To achieve the above object, the present invention also provides a kind of DNA detection kit, including at least one DNA molecular, The DNA molecular includes the nucleic acid sequence, and can be used as has transgenic corn events DBN9508 or its offspring One of DNA primer of specificity or probe.

Preferably, the DNA molecular includes SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary sequence Column, SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.

To achieve the above object, the present invention also provides a kind of plant cells, include coding insect-resistant Vip3Aa albumen Nucleic acid sequence, encode glufosinate-ammonium herbicide tolerant PAT albumen nucleic acid sequence and specific region nucleic acid sequence, it is described The nucleic acid sequence of specific region includes SEQ ID NO:1, SEQ ID NO:2, shown in SEQ ID NO:6 and/or SEQ ID NO:7 Sequence.

Preferably, nucleic acid sequence of the plant cell comprising coding insect-resistant Vip3Aa albumen, coding glufosinate-ammonium are removed The nucleic acid sequence of careless agent tolerance PAT albumen and the nucleic acid sequence of specific region, the nucleic acid sequence of the specific region include Sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4.

Preferably, the plant cell successively includes 1077-8015 SEQ ID NO:1, SEQ ID NO:5 nucleic acid Sequence and SEQ ID NO:2, or include sequence shown in SEQ ID NO:5.

To achieve the above object, the present invention also provides a kind of protection corn plants from the method for insect infestations, including At least one transgenic corn plant cell is provided in the diet of target insect, the transgenic corn plant cell is in its base Because including sequence shown in SEQ ID NO:1 and/or SEQ ID NO:2, the transgenic corn plant cell of ingesting in group Target insect is suppressed the rotaring gene corn plant of further ingesting.

Preferably, the transgenic corn plant cell includes SEQ ID NO:3 and/or SEQ ID in its genome Sequence shown in NO:4.

Preferably, the transgenic corn plant cell successively includes SEQ ID NO:1, SEQ ID in its genome 1077-8015 nucleic acid sequences of NO:5 and SEQ ID NO:2, or include SEQ ID NO:5.

To achieve the above object, protect corn plant from the damage as caused by herbicide the present invention also provides a kind of Or the method for the big Tanaka weeds of control maize planting plant, including effective dose glufosinate-ammonium herbicide will be contained and be applied to kind The big Tanaka of at least one rotaring gene corn plant is planted, the rotaring gene corn plant includes SEQ ID in its genome Sequence shown in NO:1 and/or SEQ ID NO:2, the rotaring gene corn plant have tolerance to glufosinate-ammonium herbicide.

Preferably, the rotaring gene corn plant includes SEQ ID NO:3 and/or SEQ ID NO:4 in its genome Shown in sequence.

Preferably, the rotaring gene corn plant successively includes SEQ ID NO:1, SEQ ID NO:5 in its genome 1077-8015 nucleic acid sequences and SEQ ID NO:2, or include sequence shown in SEQ ID NO:5.

To achieve the above object, the present invention also provides it is a kind of culture it is resistant to insect and/or tolerance glufosinate-ammonium remove The method of the corn plant of careless agent, comprising:

An at least corn seed is planted, includes coding insect-resistant Vip3Aa egg in the genome of the corn seed The nucleic acid sequence of white nucleic acid sequence and/or the nucleic acid sequence and specific region that encode glufosinate-ammonium herbicide tolerant PAT albumen Include nucleic acid sequence shown in SEQ ID NO:5 in the genome of column or the corn seed；

The corn seed is set to grow up to plant；

The plant described in target insect infestations and/or the plant described in effective dose glufosinate-ammonium herbicide spray, Harvest the plant compared with the plant of other nucleic acid sequences for not having specific region with the plant injury weakened；

The nucleic acid sequence of the specific region is sequence shown in SEQ ID NO:1 and/or SEQ ID NO:2；It is preferred that Ground, the nucleic acid sequence of the specific region are sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4.

To achieve the above object, the present invention also provides it is a kind of generate it is resistant to insect and/or to glufosinate-ammonium weeding The method that agent has the plant of tolerance, including the coding insect-resistant that will include in the first corn plant genome The nucleic acid of the nucleic acid sequence of Vip3Aa albumen and/or the nucleic acid sequence of coding glufosinate tolerant PAT albumen and specific region Sequence, or by nucleic acid sequence shown in the SEQ ID NO:5 for including in the first corn plant genome, introduce second Corn plant, to generate a large amount of progeny plants；The progeny plant with the nucleic acid sequence of the specific region is selected, And the progeny plant is resistant to insect and/or has tolerance to glufosinate-ammonium herbicide；The nucleic acid of the specific region Sequence is sequence shown in SEQ ID NO:1 and/or SEQ ID NO:2；Preferably, the nucleic acid sequence of the specific region is Sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4.

Preferably, the method includes transgenic corn events DBN9508 and lacking insect-resistant and/or glufosinate-ammonium The plant of tolerance carries out sexual hybridization, to generate a large amount of progeny plants, selects the nucleic acid with the specific region The progeny plant of sequence；The nucleic acid sequence of the specific region includes shown in SEQ ID NO:1 and/or SEQ ID NO:2 Sequence；Preferably, the nucleic acid sequence of the specific region includes sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4 Column.

To achieve the above object, the present invention also provides a kind of agricultural product for being produced from transgenic corn events DBN9508 Or commodity, the agricultural product or commodity be hominy grits, maize flour, corn oil, corn silk, cornstarch, corn gluten, Corn-dodger, cosmetics or filler.

In nucleic acid sequence and its detection method of the present invention for detecting corn plant, defined below and method can be with Preferably definition is of the invention and those skilled in the art is instructed to implement the present invention, unless otherwise mentioned, according to this field The conventional usage of those of ordinary skill understands term.

" corn " refers to maize (Zea mays), and all plant varieties including that can mate with corn, Including field corn kind.

The "comprising", "comprising" or " containing " refer to " including but not limited to ".

Term " plant " includes that whole plant, plant cell, plant organ, plant protoplast, plant can therefrom again It is complete in raw plant cell tissue cultures, plant callus, vegetation bed (plant clumps) and plant or plant part Whole plant cell, the plant part such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stalk, root, the tip of a root, flower Medicine etc..The part for the genetically modified plants being interpreted as in the scope of the invention includes but is not limited to plant cell, protoplast, group It knits, callus, embryo and flower, stem, fruit, Ye Hegen, the above plant part are originated from advance with DNA molecular of the invention turn Genetically modified plants that are changing and being therefore at least partly made of transgenic cell or its filial generation.

Term " gene " refers to the nucleic acid fragment of expression specific protein, including adjusting sequence (5 ' the non-volumes before coded sequence Code sequence) and coded sequence after adjusting sequence (3 ' non-coding sequence)." natural gene ", which refers to, is naturally found to have its own Adjust the gene of sequence." mosaic gene " refer to be not natural gene any gene, it includes non-natural discovery adjusting and Coded sequence." endogenous gene " refers to natural gene, and the natural gene is located in organism genome its natural place. " foreign gene " is the alien gene being not present in the existing genome for being biology and originally, also refers to and leads through Transgenic procedures Enter the gene of recipient cell.Foreign gene may include the natural gene or mosaic gene of insertion non-native organism." turn base Cause " is the gene that genome is had been incorporated by Transformation Program.The site that recombinant DNA has been inserted into Plant Genome can To be known as " insertion point " or " target site ".

" flanking DNA " may include the genome being naturally present in the organism of such as plant or pass through conversion process External source (heterologous) DNA of introducing, such as segment relevant to transformation event.Therefore, flanking DNA may include natural and external source The combination of DNA.In the present invention, " flanking DNA " be also known as " flanking region " or " flanking sequence " or " flanking genomic sequence " or " flanking genomic dna ", refer at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000, 2500 or 5000 base-pairs or longer sequence, be located at initial external source insertion DNA molecular immediately upstream or downstream and with Initial external source insertion DNA molecular is adjacent.When the flanking region is located at downstream, it is referred to as " 3 ' flank " or " right margin side Wing " etc..When the flanking region is located at upstream, it is referred to as " 5 ' flank " or " left margin flank " etc..

The Transformation Program of the random integration of exogenous DNA is caused to will lead to the transformant containing different flanking regions, the difference Flanking region is that each transformant institute specificity contains.When recombinant DNA is introduced into plant by conventional hybridization, flanking region It does not usually change.Transformant also can containing between heterologous insertion DNA and the section of genomic DNA or two sections of genomic DNAs it Between or two sections of allogeneic dna sequence DNAs between unique engagement." engagement " is the point of two specific DNA fragmentation connections.For example, engagement It is present in the position of insert DNA connection flanking DNA.Junction is also present in the organism of conversion, two of them DNA piece Section linking together in a manner of modifying and be found from native organism." engaging zones " or " junction sequence ", which refer to, includes The DNA at junction.

The present invention provides the referred to as transgenic corn events of DBN9508 and its offspring, the transgenic corn events DBN9508 is also known as corn plant DBN9508 comprising the Plants and Seeds of transgenic corn events DBN9508 and its plant Cell or its renewable part, the plant part of the transgenic corn events DBN9508, including but not limited to cell, flower Powder, ovule, flower, bud, root, stem, silk, inflorescence, ear fringe, leaf and the product from corn plant DBN9508, such as Corn Crude Powder, maize flour, corn oil, corn pulp, corn silk, cornstarch and the biomass for staying in corn crop field.

Transgenic corn events DBN9508 of the present invention contains a DNA construct, when it is expressed in plant cell When, the transgenic corn events DBN9508 obtains the resistance to insect and the tolerance to glufosinate-ammonium herbicide.The DNA Construct includes two concatenated expression cassettes, first expression cassette include suitable promoter for being expressed in plant and Suitable polyadenylation signal sequence, the promoter are operably connected the nucleic acid sequence of Vip3Aa19 albumen, described The nucleic acid sequence of Vip3Aa19 albumen is mainly resistant to lepidopterous insects.Second expression cassette includes in plant The suitable promoter of expression and suitable polyadenylation signal sequence, the promoter, which is operably connected, encodes phosphine The gene of silk rhzomorph N- acetyltransferase (phosphinothricin N-acetyltransferase, PAT), the PAT The nucleic acid sequence of albumen has tolerance to glufosinate-ammonium herbicide.Further, the promoter can be to separate from plant Suitable promoter, including composing type, induction type and/or tissue-specific promoter, the suitable promoter includes but unlimited In cauliflower mosaic virus (CaMV) 35S promoter, figwort mosaic virus (FMV) 35S promoter, ubiquitin protein (Ubiquitin) promoter, actin (Actin) promoter, soil Agrobacterium (Agrobacterium Tumefaciens) rouge alkali synthetase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum (Cestrum) yellow leaf curl virus promoter, patatin (Patatin) promoter, ribulose-1,5-bisphosphate, 5- bis- Phosphoric acid Carboxylase/oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS are opened Mover, alcA/alcR promoter, Agrobacterium rhizogenes (Agrobacterium rhizogenes) RolD promoter and arabidopsis Belong to (Arabidopsis thaliana) Suc2 promoter.The polyadenylation signal sequence can be to act as in plant Suitable polyadenylation signal sequence, the suitable polyadenylation signal sequence includes but is not limited to source Believe in the Polyadenylation of soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene Number sequence, from cauliflower mosaic virus (CaMV) 35S terminator, from protease-inhibitor Ⅱ (PIN II) gene Polyadenylation signal sequence and the polyadenylation signal sequence for deriving from alpha-tubulin (α-tubulin) gene.

In addition, the expression cassette can also include other genetic elements, the genetic elements include but is not limited to increase Hadron and signal peptide/transit peptides.The enhancer can include but is not limited to the expression of enchancer, the enhancer, Tobacco etch virus (TEV) translates activity factor, CaMV35S enhancer and FMV35S enhancer.Signal peptide/the transit peptides Vip3Aa19 albumen and/or PAT Protein transport can be guided to extracellular or intracellular specific organelle or compartment, example Such as, chloroplaset is targeted using encoding chloroplast transit peptide sequence, or utilizes ' KDEL ' to retain sequence and targets endoplasmic reticulum.

The Vip3Aa19 gene can be from thuringiensis (Bacillus thuringiensis, abbreviation Bt isolated in), and the nucleotides sequence of Vip3Aa19 gene can be changed by optimization codon or in other ways Column, to achieve the purpose that increase the stability and utilizability of transcript in transformed cells.

" Lepidoptera (Lepidoptera) ", including moth, two class insect of butterfly are a most mesh of agriculture and forestry injurious insect, Such as black cutworm, bollworm, prodenia litura, 2 committee noctuid insect, dichocrocis punctiferalis.

Phosphinothricin N-acetyl transferase (PAT) gene can be from streptomycete (Streptomyces Viridochromogenes) the enzyme of strain isolation is catalyzed L-phosphinothricin by acetylation and is converted into its inactive form, with Plant is assigned to the tolerance of glufosinate-ammonium herbicide.Phosphinothricin (PTC, 2- amino -4- methylphosphine-butyric acid) is paddy The inhibitor of glutamine synzyme.PTC is antibiotic 2- amino -4- methylphosphine acyl-alanyl-alanine structural units, this three Peptide (PTT) has resisting gram-positive and gramnegative bacterium and antimycotic Botrytis cinerea (Botrytis cinerea) Activity.Phosphinothricin N-acetyl transferase (PAT) gene can also be used as selected marker.

" glufosinate-ammonium " also known as glufosinate refer to 2- amino -4- [hydroxyl (methyl) phosphono] butyric acid ammonium, with " careless ammonium Phosphine herbicide " processing, which refers to, to be handled using any one containing the herbicide formulations of glufosinate-ammonium.In order to reach effective biology Learn dosage and to certain glufosinate-ammonium preparation utilization rate selection be no more than common agronomic technique personnel technical ability.Use any one Herbicide formulations processing of the kind containing glufosinate-ammonium contains the field of the vegetable material from transgenic corn events DBN9508 Ground will control the weed growth in the field, and not influence the plant material from transgenic corn events DBN9508 The growth or yield of material.

The DNA construct is introduced in plant using method for transformation, and the method for transformation includes but is not limited to agriculture Bacillus (Agrobacterium) mediated transformation method, Gene Knock-out Mice and pollen tube channel conversion method.

The Agrobacterium_mediated method is the common method of Plant Transformation.The exogenous DNA gram that will be introduced into plant Between the grand left and right boundary consensus sequence to carrier, i.e. the area T-DNA.The carrier is transformed into agrobatcerium cell, with Afterwards, the agrobatcerium cell is organized for infection plant, and the area T-DNA of the carrier comprising exogenous DNA is inserted into plant In genome.

The Gene Knock-out Mice is with carrier bombardment plant cell (the biological bullet that particle mediates comprising exogenous DNA Hit conversion).

The pollen tube channel conversion method be formed by after being pollinated using plant natural pollen tube channel (also known as flower Tube cell guides tissue), through megarchidium channel, exogenous DNA is carried into blastular.

After conversion, it is necessary to have from the plant tissue regenerating plants of conversion, and using suitable label selection The offspring of exogenous DNA.

DNA construct is the combination that DNA molecular is interconnected, and this combination provides one or more expression cassettes. DNA construct preferably can the self-replacation in bacterial cell, and contain different restriction endonuclease sites matter Grain, contained restriction endonuclease sites provide functioning gene element, i.e. promoter, introne, leading sequence for importing Column, coded sequence, 3 ' terminator regions and other sequences DNA molecule.Expression cassette contained in DNA construct includes mentioning Genetic elements necessary to transcription for mRNA, the expression cassette can be designed as the table in prokaryotic cell or eukaryocyte It reaches.Expression cassette of the invention is designed to most preferably express in plant cell.

Transgenosis " event " is as obtained from converting plant cell with heterologous DNA construct, that is, includes at least one Expression of nucleic acid box containing target gene is inserted into Plant Genome to generate plant population by transgene method, then The raw plant population, and selection have the specific plant of insertion specific gene group site feature.Term " event " refer to containing The original transformant of allogeneic dna sequence DNA and the offspring of the transformant.Term " event " also refers to original transformant and containing allogeneic dna sequence DNA Offspring obtained from sexual hybridization is carried out between other kind individuals, even if coming from after be returned repeatedly with backcross parent The same chromosome location in filial generation is existed in the insertion DNA and flanking genomic dna of original transformant parent. Term " event " also refers to the DNA sequence dna from original transformant, the DNA sequence dna include insertion DNA and with insertion the close phase of DNA Adjacent flanking genomic sequence, which, which is expected, is transferred in filial generation, and the filial generation is by the parental department containing insertion DNA (such as filial generation of original transformant and its selfing generation) carries out sexual hybridization with the parental department without containing insertion DNA and generates, And the filial generation receives the insertion DNA comprising target gene.

" recombination ", which refers to, in the present invention generally can not find in nature and therefore by manual intervention generation The form of DNA and/or albumen and/or organism.This manual intervention can produce recombinant DNA molecule and/or recombinant plant.Institute To state " recombinant DNA molecules ", which be by two kinds of artificial combination, is in other cases that isolated sequence section obtains, such as logical It crosses chemical synthesis or operates isolated nucleic acid segment by genetic engineering technology.It is well-known for carrying out the technology of nucleic-acid manipulation 's.

Term " transgenosis " includes any cell, cell line, callus, tissue, plant part or plant, above Genotype due to heterologous nucleic acids presence and change, " transgenosis " include the Transgenics initially changed in this way and The offspring individual generated by initial Transgenics by sexual hybridization or vegetative propagation.In the present invention, term " transgenosis " It does not include being changed by (chromosome or extrachromosomal) of conventional plant breeding method or the natural genome that event occurs Become, for example random allogamy of the natural generation event, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant swivel base Or spontaneous mutation.

" heterologous " refers to that the first molecule is not found usually and the second molecular combinations in nature in the present invention.For example, Molecule can be originated from the first species and be inserted into the genome of the second species.Therefore this molecule is heterologous for host And it is artificially introduced in the genome of host cell.

Cultivate transgenic corn events resistant to lepidopterous insects and that there is tolerance to glufosinate-ammonium herbicide DBN9508 passes through following steps: making the first parental corn plants and the second parental corn plants sexual hybridization first, to produce Given birth to the first generation progeny plant of multiplicity, first parental corn plants by cultivation transgenic corn event DBN9508 and The corn plant of its offspring forms, and transgenic corn events DBN9508 and its offspring are of the invention to squama wing by utilizing Mesh insect it is resistant and to glufosinate-ammonium herbicide have tolerance expression cassette convert obtained from, the second parent is beautiful Rice plant lacks to the resistance of lepidopterous insects and/or has tolerance to glufosinate-ammonium herbicide；Then it selects to Lepidoptera elder brother The invasion of worm are resistant and/or have the progeny plant of tolerance to glufosinate-ammonium herbicide, can cultivate to Lepidoptera Insect is resistant and has the corn plant of tolerance to glufosinate-ammonium herbicide.These steps, which may further include, makes squama The progeny plant and the second parental corn plants or third parental corn plants of homopterous insect resistance and/or glufosinate tolerant It is returned, then by applying or passing through molecular labeling relevant to character with lepidopteran insect infestation, glufosinate-ammonium herbicide Object (DNA points of the bond site that 5 ' ends and 3 ' ends such as comprising insetion sequence in transgenic corn events DBN9508 identify Son) identification select filial generation, to generate resistant to lepidopterous insects and there is tolerance to glufosinate-ammonium herbicide Corn plant.

It will also be appreciated that two different genetically modified plants can also mate to generate containing there are two independent, separation The offspring of the foreign gene of formula addition.It is all pure for the available foreign gene added to two of the selfing of appropriate offspring The Progeny plants of zygote.As previously described to the backcrossing of parental plant and be also with the cutcross of non-transgenic plant can be with It is contemplated that vegetative propagation is also same.

Term " probe " is the nucleic acid molecules of one section of separation, is combined with conventional detectable label or report point above Son, for example, radioactive isotope, ligand, chemiluminescent agent or enzyme.This probe is complementary with a chain of target nucleic acid , in the present invention, probe is complementary with a DNA chain from transgenic corn events DBN9508 genome, no matter the base Because group DNA is the plant for being also derived from transgenic corn events DBN9508 from transgenic corn events DBN9508 or seed Object or seed or extract.Probe of the invention not only includes DNA or ribonucleic acid, further include specifically with Target dna sequence combines and can be used for detecting the existing polyamide and other probe materials of the target dna sequence.

Term " primer " is the nucleic acid molecules of one section of separation, is hybridized by nucleic acid, annealed combination to complementary target In DNA chain, heterozygote is formed between primer and target dna chain, then under the action of polymerase (such as DNA polymerase), Along target dna chain extension.Primer pair of the invention is related to its application in target nucleic acid sequence amplification, for example, passing through polymerization Enzyme chain reaction (PCR) or other conventional nucleic acid amplification methods.

The length of probe and primer is usually 11 polynucleotides or more, preferably 18 polynucleotides or more, More preferably 24 polynucleotides or more, most preferably 30 polynucleotides or more.This probe and primer are in height Specifically hybridize under degree stringent hybridization condition with target sequence.Although being different from target dna sequence and to target dna sequence Keep hybridization ability probe can design by conventional method, however, it is preferred to, the present invention in probe and The continuous nucleic acid of primer and target sequence has complete DNA sequence dna identity.

It can be determined by conventional method based on the primer and probe of flanking genomic dna and insetion sequence of the invention, For example, by separating corresponding DNA molecular from from the vegetable material of transgenic corn events DBN9508, and determining should The nucleic acid sequence of DNA molecular.The DNA molecular includes transgene insert sequence and Maize genome flanking sequence, the DNA The segment of molecule may be used as primer or probe.

Nucleic acid probe and primer of the invention hybridizes with target dna sequence under strict conditions.Any conventional nucleic acid is miscellaneous It hands over or amplification method may be used to identify in sample from the presence of the DNA of transgenic corn events DBN9508.Nucleic acid Molecule or its segment can carry out specific hybrid with other nucleic acid molecules in any case.As the present invention uses, if Two nucleic acid molecules can form antiparallel double-strandednucleic acid structure, so that it may say that the two nucleic acid molecules are able to carry out to each other Specific hybrid.If two nucleic acid molecules show complete complementarity, claiming one of nucleic acid molecules is another core " complement " of acid molecule.As the present invention uses, when each nucleotide and another nucleic acid point of a nucleic acid molecules The correspondence nucleotide mutual added time of son, then the two nucleic acid molecules is claimed to show " complete complementarity ".If two nucleic acid molecules It can be with enough stability phase mutual crosses to make them anneal under the conditions of at least conventional " low stringent " and tie each other It closes, then the two nucleic acid molecules are referred to as " minimum level is complementary ".Similarly, if two nucleic acid molecules can be with enough steady Qualitative phase mutual cross then claims the two nucleic acid to make them anneal and be bonded to each other under the conditions of conventional " height is stringent " Molecule has " complementarity ".Deviateing from complete complementarity can permit, as long as this deviation not exclusively prevents two points Son forms duplex structure.In order to enable a nucleic acid molecules as primer or probe, it is only necessary to guarantee that it has in sequence and fill The complementarity divided, so that stable duplex structure can be formed under used specific solvent and salinity.

As the present invention uses, substantially homologous sequence is one section of nucleic acid molecules, and the nucleic acid molecules are in high stringency Specific hybrid can occur with the complementary strand of another section of nucleic acid molecules to match down.Promote the suitable stringent of DNA hybridization Condition is then used under the conditions of 50 DEG C for example, about being handled under the conditions of 45 DEG C with 6.0 × sodium chloride/sodium citrate (SSC) 2.0 × SSC washing, these conditions are well known to those skilled in the art.For example, salinity in washing step can be with About 2.0 × SSC, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C selected from Low stringency conditions.In addition, purge step Temperature condition in rapid can be increased to about 65 DEG C of high stringency from about 22 DEG C of room temperature of Low stringency conditions.Temperature Condition and salinity can all change, can also one of them remain unchanged and another variable changes.It is preferred that Ground, a nucleic acid molecules of the invention can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID Specific hybrid occurs for any segment of one or more nucleic acid molecules or its complementary series or above-mentioned sequence in NO:7.More Preferably, a nucleic acid molecules of the invention under high stringency with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, in SEQ ID NO:6 and SEQ ID NO:7 one or more nucleic acid molecules or Specific hybrid occurs for any segment of its complementary series or above-mentioned sequence.In the present invention, preferred marker nucleic acid point Son has SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned Any segment of sequence.Another preferred marker nucleic acid molecules of the present invention and SEQ ID NO:1, SEQ ID NO:2, SEQ ID Any segment of NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned sequence has 80% to 100% or 90% to arrive 100% sequence identity.SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 may be used as planting Marker in object breeding method is to identify the offspring of genetic cross.Probe can be by any with hybridizing for target dna molecule A kind of method being well known to those skilled in the art is detected, these methods include but is not limited to fluorescent marker, radiation Property label, antibody class label and chemiluminescent labeling.

About the amplification (for example, passing through PCR) for using specific amplimer to carry out target nucleic acid sequence, " stringent item Part " refers to the condition for only allowing primer pair target nucleic acid sequence to hybridize in the hot amplified reaction of DNA, has and target The primer of the corresponding wild-type sequence of nucleic acid sequence (or its complementary series), can in conjunction with the target nucleic acid sequence, and It is preferred that unique amplified production is generated, amplified production, that is, amplicon.

Term " specific binding (target sequence) " refers to probe under stringent hybridization conditions or primer only and comprising target Target sequence in the sample of sequence hybridizes.

As the present invention uses, " amplicon " refers to that the nucleic acid of the target nucleic acid sequence as nucleic acid-templated a part expands Increase production object.For example, in order to determine whether corn plant is sexual miscellaneous by passing through containing transgenic corn events DBN9508 of the present invention Friendship mode generates, or acquisition from the corn sample in field whether include transgenic corn events DBN9508 or corn extract, Such as whether coarse powder, face or oil include transgenic corn events DBN9508, are extracted from corn plant tissue sample or extract DNA the DNA for transgenic corn events DBN9508 can be generated by using the nucleic acid amplification method of primer pair In the presence of being diagnostic amplicon.The primer pair includes one and is inserted into Plant Genome with the exogenous DNA of insertion The first primer of the adjacent flanking sequence in site, and the second primer of the exogenous DNA from insertion.Amplicon has certain Length and sequence, the sequence are also diagnostic to the transgenic corn events DBN9508.The length range of amplicon The combination length of primer pair be can be plus a nucleotide base pair, preferably add about 50 nucleotide bases pair, it is more excellent Choosing adds about 250 nucleotide bases pair, most preferably plus about 450 nucleotide bases to or more.

Optionally, primer pair can include entire insert to generate from the flanking genomic sequence of the insertion two sides DNA Enter the amplicon of nucleotide sequence.One in the primer pair of plant genome sequences can be located at away from insertion DNA sequence At a certain distance from column, which may range from a nucleotide base to about 20,000 nucleotide bases pair.Term The use of " amplicon " has been particularly intended to exclude the primer dimer formed in the hot amplified reaction of DNA.

Nucleic acid amplification reaction can be realized by any nucleic acid amplification reaction method known in the art, including be gathered Polymerase chain reacts (PCR).Various nucleic acid amplification methods have been well-known to those skilled in the art.PCR amplification method is Develop to the phage DNA of the amplifiable up to genomic DNA of 22kb and up to 42kb.Its of these methods and this field He can be used for the present invention at DNA cloning method.The exogenous DNA array of insertion and side from transgenic corn events DBN9508 Wing DNA sequence dna can be by being expanded using genome of the provided primer sequence to transgenic corn events DBN9508 Increase, carries out the DNA sequencing of standard after amplification to the DNA of PCR amplification or clone.

DNA detection kit based on DNA cloning method contains the DNA molecular as primer, they are in reaction appropriate Under the conditions of on specific hybrid to target dna and expand diagnostic amplicon.Kit can provide the inspection based on Ago-Gel Many methods of survey method or checkout and diagnosis amplicon known in the art.Containing with SEQ ID NO:3 or SEQ ID Any part of the Maize genome of NO:4 is homologous or complementary and any with the transgenosis insert district of SEQ ID NO:5 The kit of homeologous or the DNA primer of complementation is provided by the present invention.Particularly identifying has in DNA cloning method Primer pair is SEQ ID NO:8 and SEQ ID NO:9,5 ' transgenosis of amplification and transgenic corn events DBN9508 A part of homologous diagnostic amplicon of/genomic region, wherein amplicon includes SEQ ID NO:1.As DNA primer Other DNA moleculars can be selected from SEQ ID NO:5.

Amplicon caused by these methods can be detected by multiple technologies.One of method is hereditary point It analyzes (Genetic Bit Analysis), this method devises one across insertion DNA sequence dna and adjacent flanking genomes The DNA oligonucleotide chain of DNA sequence dna.The oligonucleotide chain is fixed in the micropore of a microwell plate, to target area into (primer is respectively used in insetion sequence and in adjacent flanking genomic sequence) after row PCR amplification, single stranded PCR products It can be hybridized with fixed oligonucleotide chain, and the template as single base extension, which uses Archaeal dna polymerase and ddNTPs for next expected base specific markers.It can be obtained by fluorescence or ELISA class method As a result.Signal represents the presence of insertion/flanking sequence, illustrates that amplification, hybridization and single base extension are successful.

Another method is pyrosequencing techniques (Pyrosequencing).This method devises one across insertion The oligonucleotide chain of DNA sequence dna and adjacent genomic DNA binding site.By the single-stranded of the oligonucleotide chain and target area PCR product (in insetion sequence and adjacent flanking genomic sequence in respectively use a primer) hybridized, then and Archaeal dna polymerase, ATP, sulfonyl enzyme, luciferase, apyrase, adenosine -5 '-phosphorus sulfate and luciferin It is incubated together.It is separately added into dNTPs, measures the optical signal of generation.Optical signal represents the presence of insertion/flanking sequence, It illustrates amplification, hybridization and single base or polybase base extension is successful.

Chen etc. (genome research (Genome Res.) 9:492-498,1999) description Fluorescence polarization be also It can be used for detecting a kind of method of amplicon of the present invention.Need to design in this way one across insertion DNA sequence dna and The oligonucleotide chain of adjacent genomic DNA binding site.By the single stranded PCR products of the oligonucleotide chain and target area ( A primer is respectively used in insetion sequence and in adjacent flanking genomic sequence) hybridized, then with archaeal dna polymerase with And a kind of ddNTP of fluorescent marker is incubated together.Single base extension will lead to insertion ddNTP.This insertion can use Luminoscope measures the change of its polarization.The change of polarization represents the presence of insertion/flanking sequence, illustrate amplification, hybridization and Single base extension is successful.

Taqman is described as a kind of detect and is mentioned with method existing for quantitative analysis DNA sequence dna, this method in manufacturer It is discussed in detail in the operation instruction of confession.It is now briefly described as follows, designs one across insertion DNA sequence and adjacent gene The FRET oligonucleotide probe of group flank binding site.The FRET probe and PCR primer are (in insetion sequence and adjacent side A primer is respectively used in wing genome sequence) circular response is carried out in the presence of heat-stabilised poly synthase and dNTPs.FRET is visited The hybridization of needle leads to the division of fluorescence part and quencher moieties and the release of fluorescence part on FRET probe.Fluorescence signal Generation represents the presence of insertion/flanking sequence, illustrates amplification and hybridization is successful.

Based on Hybridization principle, for detecting the suitable technology for deriving from the vegetable material of transgenic corn events DBN9508 It can also include Southern blot hybridization (Southern blot), Northern blot hybridization (Northern blot) and original Position hybridization (in situ hybridization).Particularly, the suitable technology includes incubating probe and sample, is washed to move Except whether unbonded probe and detection probe have hybridized.The detection method depends on the appended type marked of probe, For example, can detecte radiolabeled probe by X-ray exposure and imaging, or is converted by substrate and realize color change It can detecte the probe of enzyme label.

Tyangi etc. (Nature Biotechnol (Nature Biotech.) 14:303-308,1996) describes molecular labeling Application in Sequence Detection.It is briefly described as follows, designs one across insertion DNA sequence dna and adjacent flanking genomic knot Close the FRET oligonucleotide probe at position.The unique texture of the FRET probe causes it to contain secondary structure, the secondary structure energy It is enough that fluorescence part and quencher moieties are kept in short distance.The FRET probe and PCR primer are (in insetion sequence and adjacent A primer is respectively used in flanking genomic sequence) circular response is carried out in the presence of heat-stabilised poly synthase and dNTPs.By The hybridization of successful PCR amplification, FRET probe and target sequence leads to the forfeiture of probe secondary structure, to make fluorescence part It is spatially separated with quencher moieties, generates fluorescence signal.The generation of fluorescence signal represents insertion/flanking sequence In the presence of, illustrate amplification and hybridization be successful.

The method of other descriptions, such as microfluid (microfluidics) provide the side of separation and DNA amplification sample Method and equipment.Photoinitiator dye is for detecting and measuring specific DNA molecular.Comprising for detecting DNA molecule electronic sensor or In conjunction with specific DNA molecular receive pearl and thus can be detected receive test tube (nanotube) equipment for detecting DNA of the invention Molecule is useful.

Method that composition and DNA detection field of the present invention describes or known can be used to develop DNA inspection Test agent box.The kit is conducive to identify the DNA that whether there is transgenic corn events DBN9508 in sample, can be with For cultivating the corn plant of the DNA containing transgenic corn events DBN9508.The kit can containing DNA primer or Probe at least part for being derived from or being complementary to SEQ ID NO:1,2,3,4 or 5, or contains other DNA primers or spy Needle, with being derived from or being complementary to DNA contained in the genetically modified element of DNA, these DNA sequence dnas can be used for DNA expansion Increase reaction, or as the probe in DNA hybridization method.It is containing in the corn genome and illustrate in Fig. 1 and table 1 The DNA structure of transgene insert sequence and Maize genome binding site includes: being located at the jade of 5 ' end of transgene insert sequence Rice plant DBN9508 flanking genomes region, a part of insetion sequence of the left boundary area (LB) from Agrobacterium, the For one expression cassette by containing 1 promoter of Maize Ubiquitin gene (prZmUbi1), the glufosinate-ammonium for being operably connected to streptomycete is resistance to By on the phosphinothricin N-acetyl transferase (cPAT) of property, and it is operably connected to the transcription terminator of nopaline synthase (tNos) it is formed on, second expression cassette is opened by the cauliflower mosaic virus 35S of the tandem sequence repeats containing enhancer region Mover (pr35S) is operably connected on maize Heat Shock 70kDa albumen introne (iZmHSP70), is operably connected Onto the Vip3Aa19 albumen (cVip3Aa19) of the insect-resistant of bacillus thuringiensis, and it is operably connected to nopaline It is formed, a part of insetion sequence in the right side boundary region (RB) from Agrobacterium on the transcription terminator (tNos) of synthase, And it is located at the corn plant DBN9508 flanking genomes region (SEQ ID NO:5) of 3 ' end of transgene insert sequence.? In DNA cloning method, the DNA molecular as primer can be to be inserted into from transgenic corn events DBN9508 transgenic Any part of sequence is also possible to the Maize genome flanking DNA sequence from transgenic corn events DBN9508 Any part.

Transgenic corn events DBN9508 can be combined with other transgenic maize varieties, such as herbicide is (as grass is sweet Phosphine, dicamba etc.) tolerance transgenic maize varieties, or carry the transgenic maize varieties of other anti insect genes.It is all this The various combinations of a little difference transgenic events, the breeding together with transgenic corn events DBN9508 of the invention can provide Resist a variety of insect pests and resists the improvement hybrid transgenic corn variety of a variety of herbicides.These kinds are compared to non-transgenic kind The superior features such as yield promotion can be showed with the transformed variety of unisexuality shape.

Transgenic corn events DBN9508 of the present invention is resistant to the feeding damage of lepidoptera pest, and is resistant to The phytotoxic effects of the agriculture herbicide of Glufosinate-ammoniumpesticideng.The plant expression bacillus thuringiensis of the dual character Vip3Aa19 albumen provides the resistance to lepidoptera pest (such as black cutworm) feeding damage, and expresses the grass of streptomycete Phosphinothricin N-acetyl transferase (PAT) albumen of ammonium phosphine resistance assigns plant to the tolerance of glufosinate-ammonium.Duality 1) shape corn has the advantages that from the economic loss as caused by lepidoptera pest (such as black cutworm, bollworm etc.), Black cutworm, bollworm etc. are the primary pests of corn-growing regions；2) apply the agriculture herbicide of Glufosinate-ammoniumpesticideng to corn crop Ability for broad-spectrum weeding control；3) corn yield does not reduce.In addition, coding insect-resistant and glufosinate tolerant The transgenosis of shape interlocks in same DNA section, and is present in the single base of transgenic corn events DBN9508 genome Because on seat, this point provides the breeding efficiency of enhancing and makes it possible to track reproductive population and its filial generation with molecular labeling In transgenic insert.Simultaneously SEQ ID NO:1 or its complementary series in detection method, SEQ ID NO:2 or Its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series can be used as DNA and draw Object or probe to generate the amplified production for being diagnosed as transgenic corn events DBN9508 or its offspring, and can quickly, it is accurate, The stable presence for identifying the vegetable material from transgenic corn events DBN9508.

BRIEF DESCRIPTION OF THE SEQUENCES

It is located at insertion junction in 5 ' end of insetion sequence in SEQ ID NO:1 transgenic corn events DBN9508 A neighbouring length is the sequence of 22 nucleotide, wherein 1-11 nucleotide and 12-22 are located at for nucleotide The two sides of insertion point on Maize genome；

It is located at insertion junction in 3 ' end of insetion sequence in SEQ ID NO:2 transgenic corn events DBN9508 A neighbouring length is the sequence of 22 nucleotide, wherein 1-11 nucleotide and 12-22 are located at for nucleotide The two sides of insertion point on Maize genome；

It is located at insertion joint portion in 5 ' ends of insetion sequence in SEQ ID NO:3 transgenic corn events DBN9508 A length near position is the sequence of 1292 nucleotide；

It is located at insertion joint portion in 3 ' ends of insetion sequence in SEQ ID NO:4 transgenic corn events DBN9508 A length near position is the sequence of 1028 nucleotide；

The Maize genome flanking sequence of the end of the entire T-DNA sequence of SEQ ID NO:5,5 ' and 3 '；

SEQ ID NO:6 is located at the sequence on SEQ ID NO:3, spans left boundary area (LB) and tNos transcription Termination sequence；

SEQ ID NO:7 is located at the sequence on SEQ ID NO:4, spans pr35S transcriptional initiation sequence and right edge Battery limit (BL) domain (RB)；

The first primer of SEQ ID NO:8 amplification SEQ ID NO:3；

The second primer of SEQ ID NO:9 amplification SEQ ID NO:3；

The first primer of SEQ ID NO:10 amplification SEQ ID NO:4；

The second primer of SEQ ID NO:11 amplification SEQ ID NO:4；

Primer on 5 ' flanking genomic sequence of SEQ ID NO:12；

The primer of SEQ ID NO:13 and SEQ ID NO:12 pairing being located on T-DNA；

Primer on 3 ' flanking genomic sequence of SEQ ID NO:14 can detecte with SEQ ID NO:12 pairing and turn Gene is homozygote or heterozygote；

The primer of SEQ ID NO:15 and SEQ ID NO:14 pairing being located on T-DNA；

The first primer of SEQ ID NO:16 Taqman detection Vip3Aa19 gene；

Second primer of SEQ ID NO:17 Taqman detection Vip3Aa19 gene；

The probe of SEQ ID NO:18 Taqman detection Vip3Aa19 gene；

The first primer of SEQ ID NO:19 Taqman detection pat gene；

Second primer of SEQ ID NO:20 Taqman detection pat gene；

The probe of SEQ ID NO:21 Taqman detection pat gene；

The first primer of SEQ ID NO:22 corn endogenous gene SSIIb；

The second primer of SEQ ID NO:23 corn endogenous gene SSIIb；

The probe of Vip3Aa19 gene in SEQ ID NO:24 Southern hybridization check；

The probe of pat gene in SEQ ID NO:25 Southern hybridization check；

SEQ ID NO:26 is located at the primer on T-DNA, consistent with the direction ID NO:13 SEQ；

SEQ ID NO:27 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains flank sequence Column；

SEQ ID NO:28 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains flank sequence Column；

SEQ ID NO:29 is located at the primer on T-DNA, consistent with the direction ID NO:15 SEQ；

SEQ ID NO:30 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains flank sequence Column；

SEQ ID NO:31 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains flank sequence Column.

Below by drawings and examples, technical scheme of the present invention will be described in further detail.

Detailed description of the invention

Fig. 1 is the transgenosis insertion of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9508 The structural schematic diagram of sequence and Maize genome junction, and the nucleic acid sequence phase for detecting corn plant DBN9508 To the schematic diagram of position (relative position schematic diagram refers to B73RefGen v3)；

Fig. 2 is that recombinant expression of the present invention for the nucleic acid sequence and its detection method that detect corn plant DBN9508 carries The structural schematic diagram of body DBN10707；

Fig. 3 is the present invention for detecting the nucleic acid sequence of corn plant DBN9508 and its transgenic corns of detection method Field efficacy figure of event DBN9508 under the conditions of black cutworm naturally-occurring；

Fig. 4 is the present invention for detecting the nucleic acid sequence of corn plant DBN9508 and its transgenic corns of detection method The field efficacy figure of event DBN9508 inoculation bollworm；

Fig. 5 is the present invention for detecting the nucleic acid sequence of corn plant DBN9508 and its transgenic corns of detection method Field efficacy figure of event DBN9508 under the conditions of prodenia litura naturally-occurring；

Fig. 6 is the present invention for detecting the nucleic acid sequence of corn plant DBN9508 and its transgenic corns of detection method Field efficacy figure of event DBN9508 under the conditions of beet armyworm naturally-occurring.

Specific embodiment

Further illustrate the present invention for detecting the nucleic acid sequence of corn plant DBN9508 below by specific embodiment And its technical solution of detection method.

First embodiment, clone and conversion

1.1, carrier cloning

Recombinant expression carrier DBN10707 (as shown in Figure 2) is constructed using Standard gene cloning techniques.The carrier DBN10707 includes two concatenated transgene expression cassettes, and first expression cassette is by the tandem sequence repeats containing enhancer region Cauliflower mosaic virus 35 S promoter (pr35S) is operably connected to 70 kDa albumen introne of maize Heat Shock (iZmHSP70) on, it is operably connected to the Vip3Aa19 albumen (cVip3Aa19) of the insect-resistant of bacillus thuringiensis On, and be operably connected on the transcription terminator (tNos) of nopaline synthase and form；Second expression cassette is by containing jade Rice 1 promoter of ubiquitin gene (prZmUbi1), is operably connected to the phosphinothricin N- second of the glufosinate tolerant of streptomycete On acyltransferase (cPAT), and it is operably connected on the transcription terminator (tNos) of nopaline synthase and forms.

The carrier DBN10707 is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA with liquid nitrogen method； Cat.No:18313-015 in), and it is thin to converting by selected marker of 4- [hydroxyl (methyl) phosphono]-DL- high lactamine Born of the same parents screen.

1.2, Plant Transformation

It is converted using conventional Agrobacterium infestation method, by institute in the maize immature embryos of sterile culture and the present embodiment 1.1 The Agrobacterium stated co-cultures, and the T-DNA in the recombinant expression carrier DBN10707 of building is transferred to maize chromosome group In, to generate transgenic corn events DBN9508.

For the corn transformation of mediated by agriculture bacillus, briefly, immature rataria is separated from corn, it is outstanding with Agrobacterium Supernatant liquid contacts rataria, and wherein Agrobacterium can be by the nucleotides sequence biographies of the nucleotide sequence of Vip3Aa19 gene and pat gene It is handed at least one cell (step 1: infecting step) of one of rataria, in this step, it is outstanding that rataria preferably immerses Agrobacterium Supernatant liquid (OD₆₆₀=0.4-0.6, infect culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L, Glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH 5.3)) in open Dynamic inoculation.Rataria and Agrobacterium co-culture one period (3 days) (step 2: co-culturing step).Preferably, rataria is infecting After step solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, AS 100mg/L, 2,4-D 1mg/L, agar 8g/L, pH 5.8) on cultivate.After the stage of co-cultivation herein, there can be a choosing " recovery " step of selecting property.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/ L, sucrose 30g/L, 2,4-D 1mg/L, cephalosporin 250mg/L, plant gel 3g/L, pH 5.8) at least exist it is a kind of oneself Know the antibiotic (cephalosporin 150-250mg/L) for inhibiting Agrobacterium growth, does not add the selective agent (step of vegetable transformant 3: recovering step).Preferably, rataria is cultivated on having antibiotic but the not solid medium of selective agent, to eliminate Agrobacterium And convalescence is provided for infected cell.Then, (4- [hydroxyl (methyl) phosphono]-DL- is high containing selective agent for the rataria of inoculation Alanine) culture medium on the transformed calli (step 4: selection step) cultivating and select to grow.Preferably, rataria In screening solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, cephalo for having selective agent Mycin 250mg/L, 4- [hydroxyl (methyl) phosphono]-DL- high lactamine 10mg/L, 2,4-D 1mg/L, plant gel 3g/L, PH 5.8) on cultivate, cause conversion cell selective growth.Then, at plant, (step 5: regeneration walks callus regeneration Suddenly), it is preferable that (MS differential medium and MS are raw in solid medium for the callus grown on the culture medium containing selective agent Root culture medium) on culture with aftergrowth.

The resistant calli that screening obtains is transferred to the MS differential medium, and (MS salt 4.3g/L, MS vitamin are done Casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, cephalosporin 250mg/L, 4- [hydroxyl (methyl) phosphono Base]-DL- high lactamine 5mg/L, plant gel 3g/L, pH 5.8) on, differentiation is cultivated at 25 DEG C of temperature.What is differentiated is small Seedling is transferred to the MS root media, and (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, cephalo are mould Plain 250mg/L, 1 mg/L of indole-3-acetic acid, plant gel 3g/L, pH 5.8) on, it is cultivated at 25 DEG C of temperature to about 10cm high, Hot-house culture is moved to solid.In the greenhouse, 16h is cultivated at 28 DEG C of temperature daily, cultivates 8h at 20 DEG C of temperature.

1.3, the identification and screening of transgenic event

200 separate transgenic T are generated altogether₀Single plant.

It may cause the influence on economical character (such as short to plant since genetic transformation, gene are inserted into etc. Slightly, blade grow thickly, floral leaf, blade to life, spinning loose powder is abnormal or solid difference etc.), therefore independent turn base for above-mentioned 200 Because of T₀Single plant is sent into greenhouse and transplants and cultivated, to identify transgenosis T₀Single plant is in different times (jointing stage in seedling stage-, jointing Loose powder phase phase-and maturity period pustulation period -) Agronomic, altogether obtain 136 normal transgenosis of Agronomic T₀Single plant.

Pass through TaqMan^TMAbove-mentioned 136 transgenic corn plants of analysis detection whether there is the Vip3Aa19 that singly copies and Pat gene, and vector backbone sequence is free of, 83 transgenosis T are obtained altogether₀Single plant；It is analyzed by transgenic insert locus, altogether Screen that 28 two sides T-DNA sequences are complete, T-DNA is not inserted into the important gene of Maize genome, gene insertion does not have There is the transgenosis T for generating new open reading frame (ORF)₀Single plant；By to major target insect (such as black cutworm, cotton boll Worm, prodenia litura or beet armyworm) evaluation of resistance and compare, screen the good transgenosis T of 13 insect-resistants altogether₀It is single Strain；By the evaluation to glufosinate-ammonium herbicide tolerant and compare, it is good to screen 12 glufosinate-ammonium herbicide tolerants altogether Transgenosis T₀Single plant；In the case where different generations, different geographical environments and/or different background material, by transgenosis Whether economical character, molecular biology, target insect resistance, glufosinate tolerant of plant etc. can stablize hereditary progress Screening, have selected transgenic corn events DBN9508 be it is excellent, have single copy transgenosis (referring to second embodiment), Good insect-resistant, glufosinate-ammonium herbicide tolerant and Agronomic (referring to the 5th embodiment and sixth embodiment).

Second embodiment carries out transgenic corn events DBN9508 detection with TaqMan

It takes the blade about 100mg of transgenic corn events DBN9508 as sample, uses plant DNA extraction kit (DNeasy Plant Maxi Kit, Qiagen) extracts its genomic DNA, passes through Taqman fluorescence probe quantitative PCR method Detect the copy number of Vip3Aa19 gene and pat gene.Simultaneously using wild-type corn plant as control, according to the method described above It is tested and analyzed.Experiment sets 3 repetitions, is averaged.

The specific method is as follows:

Step 1, blade (after the pollination) 100mg for taking transgenic corn events DBN9508, are ground into mortar with liquid nitrogen Homogenate, each sample take 3 repetitions；

Step 2 extracts above-mentioned sample using plant DNA extraction kit (DNeasy Plant Maxi Kit, Qiagen) The genomic DNA of product, specific method refer to its product description；

Step 3 measures above-mentioned sample with ultramicrospectrophotometer (NanoDrop 2000, Thermo Scientific) The genomic DNA concentration of product；

Step 4, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the range of the concentration value is 80- 100ng/μL；

Step 5, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR method, by being copied known to identification The sample of shellfish number is as standard items, and using the sample of wild-type corn plant as control, 3 repetitions of each sample take it average Value；Fluorescence quantification PCR primer and probe sequence are respectively:

Following primer and probe is used to detect Vip3Aa19 gene order:

Primer 1:cgaatacagaaccctgtcggc is as shown in SEQ ID NO:16 in sequence table；

Primer 2: cgtgaggaaggtctcagaaatgac is as shown in SEQ ID NO:17 in sequence table；

Probe 1:cgacgatggcgtgtatatgcctcttgg is as shown in SEQ ID NO:18 in sequence table；

Following primer and probe is used to detect pat gene order:

Primer 3:gagggtgttgtggctggtattg is as shown in SEQ ID NO:19 in sequence table；

Primer 4:tctcaactgtccaatcgtaagcg is as shown in SEQ ID NO:20 in sequence table；

Probe 2:cttacgctgggccctggaaggctag is as shown in SEQ ID NO:21 in sequence table；

PCR reaction system are as follows:

50 × the primer/probe mixture includes each 45 μ L of every kind of primer of 1mM concentration, the probe 50 of 100 μM of concentration μ L and 860 μ 1 × TE of L buffers (10mM Tris-HCl, 1mM EDTA, pH8.0), and at 4 DEG C, it is housed in amber tube In.

PCR reaction condition are as follows:

Utilize quick real-time fluorescence quantitative PCR system software (Applied Biosystems 7900HT Fast Real- Time PCR System SDS v2.3, Applied Biosystems) analysis data, the results showed that the transgenosis of acquisition is beautiful Rice event DBN9508 is single copy.

3rd embodiment, the insertion point for analyzing transgenic corn events DBN9508

3.1, extracting genome DNA

DNA is extracted according to CTAB (cetyl trimethylammonium bromide) method routinely used: taking 2g transgenic corn events After the young leaflet tablet of DBN9508 is pulverized in liquid nitrogen, the DNA that 0.5mL is preheated in 65 DEG C of temperature is added and extracts CTAB buffering Liquid (20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediamine tetra-acetic acid), extremely with NaOH tune pH 8.0) after, mixing well, 65 DEG C of extracting 90min of Yu Wendu；0.5 times of volume of phenol and 0.5 times of volume of chloroform is added, overturns mixed It is even；10min is centrifuged under 12000 rpm (revolutions per minute) revolving speed；2 times of volume dehydrated alcohols are added, softly in Aspirate supernatant Shake centrifuge tube, 4 DEG C of standing 30min of Yu Wendu；It is centrifuged 10min again under 12000rpm revolving speed；DNA is collected to tube bottom；Abandon supernatant Liquid, the ethyl alcohol for being 70% with 1mL mass concentration, washing precipitating；5min is centrifuged under 12000 rpm revolving speeds；Vacuum is drained or super Net platform drying；DNA is precipitated and dissolved in suitable TE buffer, is stored under the conditions of -20 DEG C of temperature.

3.2, the analysis of flanking DNA sequence

Concentration mensuration is carried out to the DNA sample of said extracted, is located at the concentration of sample to be tested between 80-100 ng/ μ L. With restriction enzyme Kpn I (5 ' end analysis) and Spe I (3 ' end analysis) difference digestion genomic DNA.Each digestion system 26.5 μ L genomic DNAs of middle addition, the above-mentioned restriction enzyme of 0.5 μ L and the 3 μ L enzyme cutting buffering liquid (restriction enzymes of use It is the enzyme and its matched buffer or Generic buffer of NEB company, now claims NEBCutSmart), digestion 1h.To digestion knot 70 μ L dehydrated alcohols are added into digestion system by Shu Hou, and 7min is centrifuged under ice bath 30min, 12000rpm revolving speed, abandon supernatant, Drying, is added 8.5 μ L distilled waters, 1 10 × T of μ L later₄DNA ligase buffer (NEB T4DNA Ligase Reaction Buffer, specific formula may have access to the website NEB or with reference to https: //www.neb.com/products/ restriction-endonucleases、 https://www.neb.com/products/b0202-t4-dna-ligase- ) and 0.5 μ L T reaction-buffer₄DNA ligase is stayed overnight in 4 DEG C of temperature connections.It is carried out with a series of nested primers 5 ' end of PCR amplification separation and 3 ' end genomic DNAs.Specifically, the primer combination of 5 ' end genomic DNA of separation includes SEQ ID NO:13 and SEQ ID NO:26 is as the first primer, and SEQ ID NO:27 and SEQ ID NO:28 is as the second primer, SEQ ID NO:13 is as sequencing primer.3 ' end genome DNA primer combination of separation includes SEQ ID NO:15 and SEQ ID NO:29 As the first primer, SEQ ID NO:30 and SEQ ID NO:31 draws as the second primer, SEQ ID NO:15 as sequencing Object, PCR reaction condition are as shown in table 3.

Above-mentioned pcr amplification reaction amplified production obtained is electrophoresis on 2.0% Ago-Gel to divide in mass fraction From pcr amplification product, then using plastic recovery kit (QIAquick Gel Extraction Kit, catalogue #_28704, Qiagen Inc., Valencia, CA) from agarose matrix separate target fragment.Then the pcr amplification product of purifying is sequenced It (for example, using ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyzes (for example, using DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

5 ' and 3 ' flanking sequences and junction sequence are confirmed using standard pcr.5 ' flanking sequences and junction sequence can make Come with SEQ ID NO:8 or SEQ ID NO:12, combination S EQ ID NO:9, SEQ ID NO:13 or SEQ ID NO:26 true Recognize.SEQ ID NO:11 or SEQ ID NO:14, combination S EQ ID NO:10, SEQ can be used in 3 ' flanking sequences and junction sequence ID NO:15 or SEQ ID NO:29 confirms.PCR reaction system and amplification condition are as shown in table 2 and table 3.Art technology Personnel will be understood that other primer sequences can also be used for confirmation flanking sequence and junction sequence.

The DNA sequencing of pcr amplification product provides the DNA that can be used for designing other DNA moleculars, other described DNA divide Son can be used for identifying the corn plant or seed for deriving from transgenic corn events DBN9508 as primer and probe.

It was found that 1-873, the nucleotide displays in SEQ ID NO:5 are maize genomic sequence in transgenic corns The left margin flank (5 ' flanking sequence) of event DBN9508 insetion sequence, in the nucleotide 8298-8772 of SEQ ID NO:5 Position display is right margin flank (3 ' flank sequences of the maize genomic sequence in transgenic corn events DBN9508 insetion sequence Column).5 ' junction sequences are listed in SEQ ID NO:1, and 3 ' junction sequences are listed in SEQ ID NO:2.

3.3, PCR zygosity determination

Junction sequence is relatively short polynucleotide molecule, is new DNA sequence dna, when in polynucleotide tests and analyzes It is diagnostic for the DNA of transgenic corn events DBN9508 when detecting.In SEQ ID NO:1 and SEQ ID NO:2 Junction sequence is the insertion point of transgenic corn events DBN9508 transgenic segment and every side of corn gene group DNA 11 polynucleotides.Longer or shorter polynucleotides junction sequence can be from SEQ ID NO:3 or SEQ ID NO:4 Selection.Junction sequence (5 ' the join domain SEQ ID join domain SEQ ID of NO:1 and 3 ' NO:2) is used as DNA probe or work It is useful in DNA detection method for DNA primer molecule.Junction sequence SEQ ID NO:6 and SEQ ID NO:7 is also to turn New DNA sequence dna in gene corn event DBN9508 can also be used as DNA probe or turn as DNA primer Molecular Detection The presence of gene corn event DBN9508DNA.The SEQ ID NO:6 (902-1100, the nucleotide of SEQ ID NO:3) across DBN10707 construct DNA sequence dna and tNos transcription terminator, the SEQ ID NO:7 (core of SEQ ID NO:4 are got over Thuja acid 257-456) span pr35S transcriptional initiation sequence and DBN10707 construct DNA sequence dna.

In addition, amplicon is generated by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4, The diagnostic amplicon of transgenic corn events DBN9508 is generated when the primer is in PCR method.

Specifically, pcr amplification product is generated from 5 ' ends of transgene insert sequence, which is to include source Flank is in the genome at 5 ' ends of T-DNA insetion sequence in the genome of the vegetable material of transgenic corn events DBN9508 A part of DNA.This pcr amplification product includes SEQ ID NO:3.In order to carry out PCR amplification, design and flank are in turning base Because the genomic dna sequence hybridization at 5 ' ends of insetion sequence primer 5 (SEQ ID NO:8) and paired be located at T- The primer 6 (SEQ ID NO:9) of tNos transcription terminator in DNA insetion sequence.

Pcr amplification product is generated from 3 ' ends of transgene insert sequence, which includes to derive from transgenosis In the genome of the vegetable material of corn event DBN9508 flank in T-DNA insetion sequence 3 ' end genomic DNAs one Part.This pcr amplification product includes SEQ ID NO:4.In order to carry out PCR amplification, design is located in T-DNA insetion sequence The primer 7 (SEQ ID NO:10) of pr35S transcriptional initiation sequence and paired and flank are in the 3 ' of transgene insert sequence The primer 8 (SEQ ID NO:11) of the genomic dna sequence hybridization of end.

The DNA cloning condition illustrated in table 2 and table 3 can be used for above-mentioned PCR zygosity test to generate transgenic corns The diagnostic amplicon of event DBN9508.The detection of amplicon can be by using Stratagene Robocycler, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradient thermal cycler etc. are carried out, or logical It crosses method known to those skilled in the art and equipment carries out.

Table 2,5 ' end transgenic insertions/genome engaging zones identification for transgenic corn events DBN9508 PCR step and reaction mixture condition

Table 3, thermal cycler amplification condition

It lightly mixes, if not having hot top on thermal cycler, 1-2 drop mine can be added above each reaction solution Object oil.Using the loop parameter in table 3 in Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or PCR is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler Reaction.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be transported under the mode of calculating Row.Ramp rates (ramp speed) are set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.

The results showed that primer 5 and 6 (SEQ ID NO:8 and 9), when it is used in transgenic corn events DBN9508 When in the PCR reaction of genomic DNA, the amplified production of 1292bp segment is generated, when it is used in unconverted corn gene group DNA When in the PCR reaction of non-DBN9508 corn gene group DNA, no segment is amplified；Primer 7 and 8 (SEQ ID NO:10 and 11), when it is used in the PCR reaction of transgenic corn events DBN9508 genomic DNA, the amplification of 1028bp segment is generated Product, when in the PCR reaction that it is used in unconverted corn gene group DNA and non-DBN9508 corn gene group DNA, without piece Section is amplified.

PCR zygosity determination can also be used in identification from transgenic corn events DBN9508 material be homozygote or It is heterozygote.Primer 9 (SEQ ID NO:12), primer 10 (SEQ ID NO:13) and primer 11 (SEQ ID NO:14) are used The diagnostic amplicon of transgenic corn events DBN9508 is generated in amplified reaction.The DNA cloning illustrated in table 4 and table 5 Condition can be used for above-mentioned zygosity test to generate the diagnostic amplicon of transgenic corn events DBN9508.

Table 4, zygosity determination reaction solution

The thermal cycler amplification condition of table 5, zygosity determination

Using the loop parameter in table 5 Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) Or it is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler PCR reaction.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be under the mode of calculating Operation.Ramp rates (ramp speed) are set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.

In the amplified reaction, the biological sample containing template DNA, which contains, diagnoses the sample transgenic corn event DBN9508 there are the DNA of situation.Or amplified reaction will be produced by the biological sample containing the DNA from Maize genome Raw two different DNA cloning, the DNA from Maize genome is relative in transgenic corn events DBN9508 The corresponding allele of existing insertion DNA is heterozygosis.The two different amplicons will correspond to beautiful from wild type The first amplicon (SEQ ID NO:12 and SEQ ID NO:14) and diagnosis transgenic corn events of rice genomic locus DBN9508DNA there are the second amplicon of situation (SEQ ID NO:12 and SEQ ID NO:13).It only generates and corresponds to needle To the maize dna sample of the single amplicon of the second amplicon of heterozygous genes group description, the diagnosable determination sample transfer base Because of the presence of corn event DBN9508, and the sample is as being inserted into DNA relative to present in rotaring gene corn plant DBN9508 Corresponding allele is produced by homozygous corn seed.

It should be noted that the primer pair of transgenic corn events DBN9508 is used to transgenic corn events DBN9508 genomic DNA is diagnostic amplicon.These primer pairs include but is not limited to (the SEQ ID NO:8 of primer 5 and 6 With 9) and primer 7 and 8 (SEQ ID NO:10 and 11), in the DNA cloning method.In addition, for expanding corn One control primer 12 and 13 (SEQ ID NO:22 and 23) of endogenous gene is included, one as reaction condition A inherent standard.Analysis to transgenic corn events DBN9508DNA extracting sample should include a transgenic corns thing The assaypositive tissue DNA extract of part DBN9508 compares, and one derives from the negative DNA of non-transgenic corn event DBN9508 Extract control and a negative control without containing template maize dna extract.It, can be with other than these primer pairs Using any primer pair from SEQ ID NO:3 or its complementary series or SEQ ID NO:4 or its complementary series, when it To be generated when being used for DNA amplification reaction respectively for the tissue from transgenic event corn plant DBN9508 be diagnosis The amplicon comprising SEQ ID NO:1 or SEQ ID NO:2 of property.The DNA cloning condition illustrated in table 2- table 5 can be used for The diagnostic amplicon of transgenic corn events DBN9508 is generated using suitable primer pair.When in DNA cloning method When test generate to transgenic corn events DBN9508 be diagnostic amplicon, presumption contain transgenic corn events The corn plant of DBN9508 or the extract of seed DNA, or from the product of transgenic corn events DBN9508, can be with It is used as the template of amplification, to determine whether there is transgenic corn events DBN9508.

Fourth embodiment detects transgenic corn events DBN9508 using Southern blot hybridization

4.1, it is extracted for the DNA of Southern blot hybridization

Using mortar and pestle, about 5-10g leaf tissue is ground in liquid nitrogen.In 20mL CTAB lysis buffer (100mM Tris-HCl pH 8.0,20mM EDTA pH 8.0,1.4M NaCl, 0.2%v/v β-dredge base ethyl alcohol, 2%w/v CTAB the leaf tissue in) after resuspension 4-5g grinding, in 65 DEG C of incubation 60min of temperature.During incubation, every 10min is by sample Product are mixed by inversion once.After incubation, isometric phenol/chloroform/isoamyl alcohol (25:24:1) is added, is gently mixed by inversion progress Extracting is centrifuged 20min with revolving speed 4000rpm.Water intaking mutually repeats to extract primary with isometric chloroform/isoamyl alcohol (24:1).Again Isometric isopropanol is added after collecting water phase, in -20 DEG C of placement 1h of temperature to precipitate DNA after mixing, then with revolving speed 4000rpm Centrifugation 5min obtains DNA precipitating, is then resuspended in 1mL TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0) Floating DNA precipitating.In order to degrade, any existing RNA incubates DNA and 40 μ L 10mg/mL RNase A at 37 DEG C of temperature 30min is centrifuged 5min with 4000rpm, and is 3M sodium acetate (pH 5.2) and 2 times of anhydrous second of volume in 0.1 times of volumetric concentration In the presence of alcohol, DNA is precipitated with revolving speed 12000rpm centrifugation 10min.After discarding supernatant, with the 1mL of 70% (v/v) Ethanol washing precipitates, and re-dissolves DNA in 1mL TE buffer after drying at room temperature.

4.2, enzymic digestion is limited

The base of above-mentioned sample is measured with ultramicrospectrophotometer (NanoDrop 2000, Thermo Scientific) Because of a group DNA concentration.

In 100 μ L reaction systems, 5 μ g DNA are digested every time, are digested respectively with restriction enzyme Nco I and Nde I The partial sequence of genomic DNA, the gene of the Vip3Aa19 using on T-DNA and pat gene is as probe.For every kind of enzyme, appropriate At a temperature of overnight incubation digest.Utilize SpeedVac (speed Vacuum, Thermo Scientific sample is rotated) to reduce volume to 20 μ L.

4.3, gel electrophoresis

Bromophenol blue sample-loading buffer is added to each sample in the present embodiment 4.2, and each sample is added On sample to the 0.7%TAE Ago-Gel containing ethidium bromide, in TAE electrophoretic buffer (40mM Tris- acetic acid, 2mM EDTA, pH 8.5) in electrophoretic separation, at voltage 20V running gel stay overnight.

After electrophoresis, with 0.25M HCl treatment gel 10min so that DNA depurination, then uses denaturing liquid respectively (1.5M NaCl, 0.5M NaOH) and neutralizer (1.5M NaCl, 0.5M Tris-HCl, pH 7.2) treatment gel is each 30min.Pour into 5 × SSC (3M NaCl, 0.3M sodium citrate, pH 7.0) in porcelain dish, cost one piece of glass plate, then according to It is secondary to put the filter paper bridge soaked, gel, positively charged nylon membrane (Roche, Cat.No. 11417240001), three filter paper, paper Tower, weight.After transferring film is stayed overnight at room temperature, rinses nylon membrane 2 times in deionized water, pass through UV crosslinking instrument (UVP, UV Crosslinker CL-1000) DNA is fixed on film.

4.4, hybridize

It is prepared with the DNA sequence dna that PCR amplification is suitble to for probe.The DNA probe is SEQ ID NO:24 or SEQ ID NO:25, or it is homologous or complementary with above-mentioned Sequence.With DNA Labeling and Detection Starter Kit II kit (Roche, Cat.No.11585614910) carries out the DIG label of probe, Southern blot hybridization, washes film etc. Operation, specific method refer to its product description.Finally use X mating plate (Roche, Cat.No.11666916001) detection probe In conjunction with position.

Include two kinds of control samples on each Southern: (1) DNA from negative (unconverted) segregant is used In identify it is any can be with element-specific probe hybridization endogenous corn sequence；(2) DNA from negative segregant, wherein The DBN10707 plasmid of Nco I- digestion is introduced, amount is based on probe length and is equivalent to a copy number, as hybridization Positive control and the sensitivity for being used to illustrate experiment.

The evidence that hybridization data provides confirmation supports TaqMan^TMPCR analysis, i.e. corn plant DBN9508 contain Single copy of Vip3Aa19 gene and pat gene.Using the Vip3Aa19 gene probe, Nco I and Ned I enzymatic hydrolysis produce respectively The single band of raw size about 9.5 kb and 7.5 kb；Using the pat gene probe, Nco I and Ned I enzymatic hydrolysis generate respectively The single band of size about 2.3 kb and 8 kb, this shows that Vip3Aa19 gene and each copy of pat gene are present in corn In plant DBN9508.In addition, not obtaining hybridising band for skeleton probe, illustrate not having in the conversion process any DBN10707 vector backbone sequence enters in corn plant DBN9508 genome.

The insect-resistant detection of 5th embodiment, event

5.1, the bioassay of corn plant DBN9508

By transgenic corn events DBN9508 and wild-type corn plant (non-transgenic, NGM) 2 plants respectively to small Cutworm (Agrotis ypsilon Rottemberg, BCW), prodenia litura (Spodoptera litura, TCW), beet night Moth (Spodoptera exigua, BAW), pink rice borer (Sesamia inferens, PSB), striped stem borer (Chilo Sacchariphagus, SGB) and chilotraea infuscatellus (Chilo infuscatellus, MSB) carry out biometric as follows It is fixed:

The new of transgenic corn events DBN9508 and wild-type corn plant (non-transgenic, NGM) 2 plants is taken respectively Fresh leaves (V3-V4 period), it is clean with aseptic water washing and blotted the water on blade with gauze, then maize leaf is gone Except vein, while it being cut into the strip of about 1 cm of cm × 3, after taking 1-3 piece (determining blade quantity according to insect appetite) to cut Strip blade is put on the filter paper of round plastic culture dish bottom, and the filter paper is soaked with distilled water, is put in each culture dish The newly hatched larvae of 5-10 artificial feedings, after worm tries culture dish capping, in 26-28 DEG C of temperature, relative humidity 70%-80%, light Statistical result after being placed 3 days under conditions of period (light dark) 16:8.Count larvae development progress, the death rate and blade injury rate Three Xiang Zhibiao are obtained resistance total score (full marks 300 divide): the resistance total score=100 × death rate+[100 × death rate+90 × (just Incubate borer population/connect borer population)+60 × (just incubate-negative control borer population/and connect borer population)+10 × (negative control borer population/connect borer population)]+100 × (1- blade injury rate).Wherein, connect borer population and refer to the quantity for connecing worm, i.e., every ware 5 or 10 (depending on insect food ingestion and It is fixed)；Larvae development progress has passed through the embodiment of resistance total score formula；Blade injury rate refers to be accounted for by the blade area of pests The ratio of the blade gross area.Respectively from transgenic corn events DBN9508 and wild-type corn plant (non-transgenic, NGM) 5 plants are selected to be tested, every plant is repeated 6 times.As a result as shown in table 6 and table 7.

Pest-resistant bioassay results-death rate (%) of table 6, transgenic corn events DBN9508

Pest-resistant bioassay results-resistance total score (dividing) of table 7, transgenic corn events DBN9508

The result shows that: transgenic corn events DBN9508 is to black cutworm, prodenia litura, beet armyworm, pink rice borer, sorghum Snout moth's larva and chilotraea infuscatellus all have preferable resistance, and the test worm death rate of transgenic corn events DBN9508 and resistance total score are equal It is significantly higher than NGM.

5.2, the field efficacy of transgenic corn events DBN9508

The seed of transgenic corn events DBN9508 and wild-type corn plant (non-transgenic, NGM) 2 plants are set It is handled for 2, RANDOMIZED BLOCK DESIGN, 3 repetitions, plot area 30m are pressed in each processing²(5 m × 6m), line-spacing 60cm, strain Away from 25cm, conventional cultivation management, the time of infertility does not spray insecticide.Different insects connect the interval for having 2m between worm experimental plot, Avoid diffusion of the insect between different community.

(1) black cutworm

Only natural INFESTATION (natural insect pest occurrence condition: smallly is carried out in the more serious area of black cutworm naturally-occurring It is first brood of larvae that tiger, which causes damages, is suitable for that situation easily occurs in environmental condition, if temperature is at 16-26 DEG C, relative humidity For 80-90%, soil moisture content 15-20%；Furthermore when first generation adult lures a certain amount of, such as 20 or more).In maize seedling Phase, material it is long to V2-V3 or so when plant be developed to the exhibition 2-3 leaf phase, start whether plant occurs in follow-up investigation NGM It wilts, when the wilting plant rhizosphere of NGM nearby occurs to be mostly that 4-6 age high instar larvae endangers, by strain investigation black cutworm to jade The rate that causes harm (rate that causes harm=by the plant quantity of pests/total plant quantity × 100%) of rice plant.Transgenosis is beautiful The results are shown in Table 8 for resistance of the rice event DBN9508 to black cutworm.

To the resistance result of black cutworm under the conditions of table 8, transgenic corn events DBN9508 natural INFESTATION

The result shows that: under the conditions of black cutworm naturally-occurring, compared with NGM, black cutworm is to transgenic corn events Thus it is preferable anti-to illustrate that transgenic corn events DBN9508 has black cutworm for the rate significant decrease of causing harm of DBN9508 Property, field efficacy of transgenic corn events DBN9508 under the conditions of black cutworm naturally-occurring is as shown in Figure 3.

(2) bollworm (Helicoverpa armigera Hubner, CBW)

Artificial Inoculation of Anoplophora glabripennis is carried out in the corn silking phase, is connect worm 2 times, every cell Artificial Inoculation of Anoplophora glabripennis is no less than 40 plants, in every plant of corn Newly hatched larvae about 20 of artificial feeding are met in filigree, after connecing worm 3 days, connect worm for the second time, connect borer population amount with for the first time.It is connecing After worm 14-21 days, length is killed by strain investigation female fringe percentage of injury, each female fringe survival larva number, female fringe.It usually connects 14 after worm It is instituted an inquiry, if the rank that causes harm of NGM reaches sense or high sense, is considered as effectively, if investigation can suitably be postponed by not reaching, But appropriate level is still not up within 21 days after connecing worm, then this connects worm and is considered as in vain.According to female fringe percentage of injury, survival larva number, female Fringe is killed length (cm), calculates each cell corn ear period bollworm to the rank average value of causing harm of female fringe, judgment criteria such as table 9 It is shown, then by the judgment of standard corn ear period of table 10 to the resistance level of bollworm.Transgenic corn events DBN9508 is spat The silk phase is as shown in table 11 to the resistance result of bollworm.

Table 9, maize ear are caused harm the grade scale of degree by bollworm

Female fringe is killed rank	Symptom description
		0	Female fringe is not aggrieved
1	Only filigree is killed
		2	Fringe top is killed 1cm
3+	Every increase 1cm is killed under fringe top, killed rank increases by 1 grade accordingly
		…N

Table 10, maize ear are to the Evaluation standard of resistance of bollworm

Female fringe is killed rank average value	Resistance level
		0-1.0	Highly resistance (HR)
1.1-3.0	Anti- (R)
		3.1-5.0	In resist (MR)
5.1-7.0	Feel (S)
		≥7.1	Height sense (HS)

Table 11, transgenic corn events DBN9508 spinning phase are to the resistance result of bollworm

The result shows that: under conditions of artificial infection, the female fringe percentage of injury of transgenic corn events DBN9508, larva are deposited Number, the killed length of female fringe and female fringe living are killed rank and are substantially less than NGM, thus illustrate transgenic corn events DBN9508 to cotton Earworm resists (MR) horizontal in being in, and the field efficacy that transgenic corn events DBN9508 is inoculated with bollworm is as shown in Figure 4.

(3) prodenia litura

Only natural INFESTATION is carried out in the more serious area of prodenia litura naturally-occurring (natural insect pest occurrence condition: to cause harm Peak period is in the 7-9 month, and pest development optimum temperature is at 28-30 DEG C).After first occur insect pest 10-15 days, and NGM is mostly 4-6 When age high instar larvae endangers, by strain investigation prodenia litura to the rate that causes harm of the plant (rate that causes harm=by the corn of pests Plant quantity/total plant quantity × 100%).Resistance result such as table 12 institute of the transgenic corn events DBN9508 to prodenia litura Show.

To the resistance result of prodenia litura under the conditions of table 12, transgenic corn events DBN9508 natural INFESTATION

The result shows that: under the conditions of prodenia litura naturally-occurring, compared with NGM, prodenia litura is to transgenic corn events Thus it is preferable anti-to illustrate that transgenic corn events DBN9508 has prodenia litura for the rate significant decrease of causing harm of DBN9508 Property, field efficacy of transgenic corn events DBN9508 under the conditions of prodenia litura naturally-occurring is as shown in Figure 5.

(4) beet armyworm

Experimental design and test method are substantially consistent with the evaluation resistance of prodenia litura as described above.Unlike, After first discovery insect pest 10-15 days, and when NGM is mostly that 4-5 age high instar larvae endangers, beet armyworm is investigated to corn by strain The rate that causes harm (rate that causes harm=by the plant quantity of pests/total plant quantity × 100%) of plant.Transgenic corns Event DBN9508 is as shown in table 13 to the resistance result of beet armyworm.

To the resistance result of beet armyworm under the conditions of table 13, transgenic corn events DBN9508 natural INFESTATION

The result shows that: under the conditions of beet armyworm naturally-occurring, compared with NGM, beet armyworm is to transgenic corn events Thus it is preferable anti-to illustrate that transgenic corn events DBN9508 has beet armyworm for the rate significant decrease of causing harm of DBN9508 Property, field efficacy of transgenic corn events DBN9508 under the conditions of beet armyworm naturally-occurring is as shown in Figure 6.

What is particularly worth mentioning is that according to Chinese patent (application) the 201310289848.6th, 201310573441.6, 201410806573.3, the content and the application transgenosis recorded in 201510259396.6, No. 201610006375.8 are beautiful The field effect and its bioassay results to insect of rice event DBN9508, shows the application transgenic corn events DBN9508 realizes the method and/or purposes of control pest, specially pink rice borer, prodenia litura, chilotraea infuscatellus, striped stem borer and peach Eat into snout moth's larva；Namely control pink rice borer, prodenia litura, grain may be implemented in the rotaring gene corn plant of any expression Vip3Aa19 albumen Grey snout moth's larva, striped stem borer and/or dichocrocis punctiferalis pest method and/or purposes.

The herbicide tolerant detection of sixth embodiment, event

This test selects to protect and tries to be sprayed up to (Basta) herbicide (the glufosinate ammonium salt aqua that effective component is 18%) It applies.Using RANDOMIZED BLOCK DESIGN, 3 repetitions.Plot area is 15m²(5m × 3m), line-spacing 60cm, spacing in the rows 25cm are conventional to plant Training management has the wide isolation strip of 1m between cell.Transgenic corn events DBN9508 is subjected to following 2 kinds of processing: (1) not being sprayed It applies, while processing (2) spray herbicide, sprays isometric clear water；(2) by 800g a.i./ha, (a.i./ha refers to " active ingredient per hectare ") dosage in the V2-V3 leaf phase sprays guarantor's examination up to herbicide.It should be noted that glufosinate-ammonium herbicide (such as Basta) is contact killing type herbicide, if field may occur in which phytotoxicity shape if local accumulation medical fluid is excessive using misoperation, Not there are problems for transgenic corn events DBN9508 tolerance；Different content and the glufosinate-ammonium herbicide of dosage form are converted into Equivalent effective component glufosinate-ammonium is stated to be suitable for draw a conclusion.

The 1 week and 2 weeks investigation symptom of chemical damage after medication respectively, and harvest when measure cell yield；Symptom of chemical damage point Grade is as shown in table 14.Use the aggrieved rate of herbicide as the index of the herbicide tolerant of evaluation transformation event, specifically, weeding The aggrieved rate of agent (%)=∑ (aggrieved strain number × number of levels at the same level)/(total strain number × highest level)；Wherein the aggrieved rate of herbicide is Refer to that the aggrieved rate of glufosinate-ammonium, the aggrieved rate of glufosinate-ammonium are 2 weeks after handling according to glufosinate-ammonium phytotoxicity investigation results and determination, and by The aggrieved rate of herbicide (glufosinate-ammonium) differentiates corn to the tolerance level of herbicide.The corn yield of each cell is that weighing is each small The niblet total output (weight) of 3 rows among area, volume variance between the different disposal degree of progress in the form of yield percentage Amount, yield percentage (%)=spraying yield/do not spray yield.Transgenic corn events DBN9508 is to herbicide tolerant Result and corn yield result it is as shown in Table 15.

Table 14, glufosinate-ammonium herbicide are to the grade scale of corn phytotoxicity degree

Phytotoxicity rank	Symptom description
		1	Growth is normal, without any damage symptoms
2	Slight phytotoxicity, phytotoxicity are less than 10%
		3	Medium phytotoxicity can restore later, not influence yield
4	Phytotoxicity is heavier, it is difficult to restore, cause the underproduction
		5	Phytotoxicity is serious, cannot restore, and causes the obvious underproduction or total crop failure

Table 15, transgenic corn events DBN9508 are to the result and corn yield result of glufosinate-ammonium herbicide tolerant

As a result illustrate, in terms of the aggrieved rate of glufosinate-ammonium herbicide: transgenic corn events DBN9508 is in glufosinate-ammonium weeding Aggrieved rate is 0 under agent (800g a.i./ha) processing；There is transgenic corn events DBN9508 good glufosinate-ammonium to remove as a result, Careless agent tolerance.

In terms of yield: transgenic corn events DBN9508 is not spraying and is spraying 2 kinds of 800g a.i./ha glufosinate-ammonium Handling lower yield does not have notable difference, and after spraying glufosinate-ammonium herbicide, the yield of transgenic corn events DBN9508 slightly has Increase, further demonstrates that transgenic corn events DBN9508 has good glufosinate-ammonium herbicide tolerant as a result,.

7th embodiment

Such as agricultural product or commodity can be produced by transgenic corn events DBN9508.If in the agricultural product or commodity In detect enough expression quantity, the agricultural product or commodity are expected containing can diagnose transgenic corn events DBN9508 material Expect the nucleotide sequence present in the agricultural product or commodity.The agricultural product or commodity include but is not limited to corn oil, jade Rice coarse powder, maize flour, corn gluten, corn-dodger, cornstarch and will as food source for animal consumption it is any its Its food or additionally as the ingredient in swelling agent or make-up composition for cosmetic use etc..Based on probe or primer pair Nucleic acid detection method and/or kit can be developed to detect such as SEQ ID NO:1 or SEQ ID in biological sample The nucleotide sequence of transgenic corn events DBN9508 is derived from shown in NO:2, wherein probe sequence or primer sequence are selected from The sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 or Its part, to diagnose the presence of transgenic corn events DBN9508.

In conclusion transgenic corn events DBN9508 of the present invention has preferable resistance to lepidopterous insects, simultaneously To glufosinate-ammonium herbicide tolerance with higher, on yield without influence, and detection method can quickly and accurately identify biology In sample whether include transgenic corn events DBN9508 DNA molecular.

Seed corresponding to transgenic corn events DBN9508 is protected according to budapest treaty on January 23rd, 2019 Ensconce China Committee for Culture Collection of Microorganisms's common micro-organisms center (abbreviation CGMCC, address: Chaoyang District, Beijing City north The institute 3 of occasion West Road 1, Institute of Microorganism, Academia Sinica, postcode 100101), classification naming: corn (Zea mays) is protected Hiding number is CGMCC No.17100, preservation state: survival.Preserved material will be 30 years in depository's preservation.

It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng It is described the invention in detail according to preferred embodiment, those skilled in the art should understand that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit and scope of the technical solution of the present invention.

Sequence table

<110>Beijing Da Bei Nong Bioisystech Co., Ltd

<120>for detecting the nucleic acid sequence and its detection method of corn plant DBN9508

<130> DBNBC146

<160> 31

<170> SIPOSequenceListing 1.0

<210> 2

<211> 22

<212> DNA

<213>being located at a length near female coupling portions position in 5 ' ends of insetion sequence in DBN9508 is 22 nucleotide Sequence (Artificial Sequence)

<400> 2

aactgtgata tattgtggtg ta 22

<210> 2

<211> 22

<212> DNA

<213>being located at a length near insertion junction in 3 ' end of insetion sequence in DBN9508 is 22 nucleotide Sequence (Artificial Sequence)

<400> 2

tcccgccttc aggatttata at 22

<210> 3

<211> 1292

<212> DNA

<213>being located at a length near insertion junction in 5 ' ends of insetion sequence in DBN9508 is 1292 cores The sequence (Artificial Sequence) of thuja acid

<400> 3

ccctcgacac ccagttttct gcagaagctc ccaagcgcag agcctttcct cctcttcttc 60

caagcgcgtg cgttcctccc acggagccaa gctccccttg ctcggacgcc atagcttcga 120

aggccgcccc cctgcgtgtc gggtggacgc cagtcgggct cccccatggc cgaagctaac 180

gtcccctgct cctccacggc ggcgggtcgg cgcaggcacc cactccgatg gcgcctctgc 240

tcctcccatc cagggcgtcc gaactcctct cctttttcct ccccgctcgg agctctgcta 300

tggcttctcc catggcgcct tcccccagcg ggattcctcc tctcccatgg aaatcagcag 360

ccctacaggg agcctctccc cacgccctcg gatgcttccc tgtcggcgca actccctccc 420

aaggccgggg cccccttccc cagcactctt cttcatctgc gcagaaatgg tggcgagccc 480

ttttccctcc tcctctgcgc tctggccgag ccactgctcc caggccgagt tttctccagc 540

gccgcgcttc accttcatgt ggtgagctga ctagcaggag cgagctccct cctccacacg 600

ctggtcagga ctgggagttt gctactgctt ggaagctgct cgatgaaatg gttgacgggc 660

ggttgcgtgt ctatgctcgt gctgcacgcc ctgctgctcc ccatggctgt cacaagatcc 720

aacagcctcg acatcccctc agcgtcgtgt gcgttgcccg atttgtagcg cctgcgcgtc 780

gtcgtcgaaa cccatggtga gacctcactg tcccgtgctt ttcgtgttcg attaaatgcc 840

cgcaccaatg aatcgtataa taaactgtga tatattgtgg tgtaaacaaa ttgacgctta 900

gacaacttaa taacacattg cggatacggc caggcgcgtc cctgttaacg tcctaactag 960

ctaaactagg tacagattgc gaggctcacg aggcgatcct ggccgcgtga cagtcgcgtg 1020

cgaggctctt gactaagtag gcggccgcgt gcacttaatt aagaattccc tgcagggatc 1080

tagtaacata gatgacaccg cgcgcgataa tttatcctag tttgcgcgct atattttgtt 1140

ttctatcgcg tattaaatgt ataattgcgg gactctaatc ataaaaaccc atctcataaa 1200

taacgtcatg cattacatgt taattattac atgcttaacg taattcaaca gaaattatat 1260

gataatcatc gcaagaccgg caacaggatt ca 1292

<210> 4

<211> 1028

<212> DNA

<213>being located at a length near insertion junction in 3 ' ends of insetion sequence in DBN9508 is 1028 cores The sequence (Artificial Sequence) of thuja acid

<400> 4

caatcggacc atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt 60

ccacgatgct cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt 120

caacgatggc ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca 180

ctatcttcac aataaagtga cagatagctg ggcaatggaa tccgaggagg tttccggata 240

ttaccctttg ttgaaaagtc tcaatcggac caagcttatt taaatggtac cttaattaag 300

tgcacgttta aactacctag tcagtgccgt tgagagcgta gctgcgactt agcggcctcg 360

tctgcgaagt cggtgaggct agtgccacta attagtcatt agtttaatac aaatccacct 420

gcggccaatt cctgcagcgt tgcggttctg tcagttccaa acgtaaaacg gcttgtcccg 480

cgtcatcggc gggggtcata acgtgactcc cttaattctc cgctcatgat cagattgtcg 540

tttcccgcct tcaggattta taatttatat taatgtgatt tggttgatgg cacacatata 600

aatatggtgt atattggtgt tgaacatgtg tgactatgat ggatcaattg cgtgtcgcga 660

gggtggttcg cggaagtatt agttatttgt taaaaacact tcgtcgtaaa gtattgtgtt 720

agttgtggta aatttaataa agcgtaaagc ctgcttggta atttccacag tcggctaaga 780

tgtttgtcta tgttaaaaat attttatgta ttcattgtag tgtaggatag agtggatcga 840

agatataaat tatgtgacat gtgattagtg ttttttaaga tgagatgtgc gaatgatcga 900

ttagtttttc attgtctagt cgataaatgt tgtcgtaatt aattgtgcta aaattggtca 960

tgagaatgca gtgggcacgt ggtgtgtttg gatgtgacaa gtagattgga agtgtggggt 1020

ctgtcgaa 1028

<210> 5

<211> 8772

<212> DNA

<213>the Maize genome flanking sequence (Artificial Sequence) of the end of entire T-DNA sequence, 5 ' and 3 '

<400> 5

ccctcgacac ccagttttct gcagaagctc ccaagcgcag agcctttcct cctcttcttc 60

caagcgcgtg cgttcctccc acggagccaa gctccccttg ctcggacgcc atagcttcga 120

aggccgcccc cctgcgtgtc gggtggacgc cagtcgggct cccccatggc cgaagctaac 180

gtcccctgct cctccacggc ggcgggtcgg cgcaggcacc cactccgatg gcgcctctgc 240

tcctcccatc cagggcgtcc gaactcctct cctttttcct ccccgctcgg agctctgcta 300

tggcttctcc catggcgcct tcccccagcg ggattcctcc tctcccatgg aaatcagcag 360

ccctacaggg agcctctccc cacgccctcg gatgcttccc tgtcggcgca actccctccc 420

aaggccgggg cccccttccc cagcactctt cttcatctgc gcagaaatgg tggcgagccc 480

ttttccctcc tcctctgcgc tctggccgag ccactgctcc caggccgagt tttctccagc 540

gccgcgcttc accttcatgt ggtgagctga ctagcaggag cgagctccct cctccacacg 600

ctggtcagga ctgggagttt gctactgctt ggaagctgct cgatgaaatg gttgacgggc 660

ggttgcgtgt ctatgctcgt gctgcacgcc ctgctgctcc ccatggctgt cacaagatcc 720

aacagcctcg acatcccctc agcgtcgtgt gcgttgcccg atttgtagcg cctgcgcgtc 780

gtcgtcgaaa cccatggtga gacctcactg tcccgtgctt ttcgtgttcg attaaatgcc 840

cgcaccaatg aatcgtataa taaactgtga tatattgtgg tgtaaacaaa ttgacgctta 900

gacaacttaa taacacattg cggatacggc caggcgcgtc cctgttaacg tcctaactag 960

ctaaactagg tacagattgc gaggctcacg aggcgatcct ggccgcgtga cagtcgcgtg 1020

cgaggctctt gactaagtag gcggccgcgt gcacttaatt aagaattccc tgcagggatc 1080

tagtaacata gatgacaccg cgcgcgataa tttatcctag tttgcgcgct atattttgtt 1140

ttctatcgcg tattaaatgt ataattgcgg gactctaatc ataaaaaccc atctcataaa 1200

taacgtcatg cattacatgt taattattac atgcttaacg taattcaaca gaaattatat 1260

gataatcatc gcaagaccgg caacaggatt caatcttaag aaactttatt gccaaatgtt 1320

tgaacgatca ctagttcaga tctgggtaac tggcctaact ggccttggag gagctggcaa 1380

ctcaaaatcc ctttgccaaa aaccaacatc atgccatcca ccatgcttgt atccagctgc 1440

gcgcaatgta ccccgggctg tgtatcccaa agcctcatgc aacctaacag atggatcgtt 1500

tggaaggcct ataacagcaa ccacagactt aaaaccttgc gcctccatag acttaagcaa 1560

atgtgtgtac aatgtggatc ctaggcccaa cctttgatgc ctatgtgaca cgtaaacagt 1620

actctcaact gtccaatcgt aagcgttcct agccttccag ggcccagcgt aagcaatacc 1680

agccacaaca ccctcaacct cagcaaccaa ccaagggtat ctatcttgca acctctctag 1740

atcatcaatc cactcttgtg gtgtttgtgg ctctgtccta aagttcactg tagacgtctc 1800

aatgtaatgg ttaacgatat cacaaaccgc ggccatatca gctgctgtag ctggcctaat 1860

ctcaactggt ctcctctccg gagacatggt accctgcaga agtaacacca aacaacaggg 1920

tgagcatcga caaaagaaac agtaccaagc aaataaatag cgtatgaagg cagggctaaa 1980

aaaatccaca tatagctgct gcatatgcca tcatccaagt atatcaagat caaaataatt 2040

ataaaacata cttgtttatt ataatagata ggtactcaag gttagagcat atgaatagat 2100

gctgcatatg ccatcatgta tatgcatcag taaaacccac atcaacatgt atacctatcc 2160

tagatcgata tttccatcca tcttaaactc gtaactatga agatgtatga cacacacata 2220

cagttccaaa attaataaat acaccaggta gtttgaaaca gtattctact ccgatctaga 2280

acgaatgaac gaccgcccaa ccacaccaca tcatcacaac caagcgaaca aaaagcatct 2340

ctgtatatgc atcagtaaaa cccgcatcaa catgtatacc tatcctagat cgatatttcc 2400

atccatcatc ttcaattcgt aactatgaat atgtatggca cacacataca gatccaaaat 2460

taataaatcc accaggtagt ttgaaacaga attctactcc gatctagaac gaccgcccaa 2520

ccagaccaca tcatcacaac caagacaaaa aaaagcatga aaagatgacc cgacaaacaa 2580

gtgcacggca tatattgaaa taaaggaaaa gggcaaacca aaccctatgc aacgaaacaa 2640

aaaaaatcat gaaatcgatc ccgtctgcgg aacggctaga gccatcccag gattccccaa 2700

agagaaacac tggcaagtta gcaatcagaa cgtgtctgac gtacaggtcg catccgtgta 2760

cgaacgctag cagcacggat ctaacacaaa cacggatcta acacaaacat gaacagaagt 2820

agaactaccg ggccctaacc atggaccgga acgccgatct agagaaggta gagagggggg 2880

gggggggagg acgagcggcg taccttgaag cggaggtgcc gacgggtgga tttgggggag 2940

atctggttgt gtgtgtgtgc gctccgaaca acacgaggtt ggggaaagag ggtgtggagg 3000

gggtgtctat ttattacggc gggcgaggaa gggaaagcga aggagcggtg ggaaaggaat 3060

cccccgtagc tgccggtgcc gtgagaggag gaggaggccg cctgccgtgc cggctcacgt 3120

ctgccgctcc gccacgcaat ttctggatgc cgacagcgga gcaagtccaa cggtggagcg 3180

gaactctcga gaggggtcca gaggcagcga cagagatgcc gtgccgtctg cttcgcttgg 3240

cccgacgcga cgctgctggt tcgctggttg gtgtccgtta gactcgtcga cggcgtttaa 3300

caggctggca ttatctactc gaaacaagaa aaatgtttcc ttagtttttt taatttctta 3360

aagggtattt gtttaatttt tagtcacttt attttattct attttatatc taaattatta 3420

aataaaaaaa ctaaaataga gttttagttt tcttaattta gaggctaaaa tagaataaaa 3480

tagatgtact aaaaaaatta gtctataaaa accattaacc ctaaacccta aatggatgta 3540

ctaataaaat ggatgaagta ttatataggt gaagctattt gcaaaaaaaa aggagaacac 3600

atgcacacta aaaagataaa actgtagagt cctgttgtca aaatactcaa ttgtccttta 3660

gaccatgtct aactgttcat ttatatgatt ctctaaaaca ctgatattat tgtagtacta 3720

tagattatat tattcgtaga gtaaagttta aatatatgta taaagataga taaactgcac 3780

ttcaaacaag tgtgacaaaa aaaatatgtg gtaatttttt ataacttaga catgcaatgc 3840

tcattatctc tagagagggg cacgaccggg tcacgctgca ctgcaggccc taggatttaa 3900

gtgactaggg tcacgtgact ctagtcactt actggcgcgc cgatctagta acatagatga 3960

caccgcgcgc gataatttat cctagtttgc gcgctatatt ttgttttcta tcgcgtatta 4020

aatgtataat tgcgggactc taatcataaa aacccatctc ataaataacg tcatgcatta 4080

catgttaatt attacatgct taacgtaatt caacagaaat tatatgataa tcatcgcaag 4140

accggcaaca ggattcaatc ttaagaaact ttattgccaa atgtttgaac gatctcactt 4200

gatgctcacg tcgtaaaaat gaacaatggg gccgccgtag aggttattcc cttgggacag 4260

ttcgatataa aagttgtcct tctcaaactt cgtggtgaac atttctgaca catccttagc 4320

gccagacatg tatctcttct cgaagaggac ttcccgcgag ttcctgatgc gcacattcgc 4380

gtcgccggaa actgaaaaat agactctgta ggtagagaac gaatccagtt ggaggttctg 4440

cttcagaatg cctctcccgc cctggtaaag cgtcagggtg ttccccgaga tattcgtgct 4500

gccagtggat gtccagttat tggtgttaat cagctcgggg ctcaggagct tctcgctagg 4560

ggagatttcg agaatgatga agttgtcgcc ccaggcctca tcgccattct gggacttgag 4620

aataagatag acccccttca ggtcagtgcc agttgtgaac ctcttattga ttgtctggta 4680

gtcctccagg ttgttgttag tatcttcgta atggatgtac cctgtgttct catccttgag 4740

gtggatgctt ggcttgccct tcacagtata ttgaatcacg tattctgtct tcggcttcag 4800

cttgtcgcca atgaactggg agatgccacc atccttatgc acatagagcg ccttagtgcc 4860

attcaccccg cctgtgtggt caacgtatgc gttcttattg ttagccttcc acggttccag 4920

attatcttcc tcaattgacc cgttctccac aatattggag atgaagcctg atggcggaac 4980

gatcagcttc gtttccttgt tagagaggtc ggtggcaagc agcagctccc tgaggtagct 5040

cttgcacgta agggtgatca ggcgggagtt ctcatctgcc tggagcccaa agccattgat 5100

gggcgtgagg aaggtctcag aaatgacccc aagaggcata tacacgccat cgtcgttcgc 5160

cgacagggtt ctgtattcgg cctcggatga ttcgaccttc ttcttgttga ggtcgatctc 5220

gcccgtagac gaatcataga agttagccgt cacctcgtac cggagtgtct tcatcttctt 5280

cgtaaagtca atcttggtga tcacgtattc gttggggaag acaatattgt tcgtatagta 5340

gatttgctcg gactgatcag ggcaaagcag cttatccatg tcgccgtaga taacctctga 5400

cagagaatcc ttgtccactt gataattctg cttgagcttc gcctcgtaga ccttcagcac 5460

ggtaattgag tcgttagaaa tctcgaaccc gatgagcgca tggccaggct tggcctcaac 5520

gatcatcttt gcatcttcgt cggagccctt gaccttagcg tagtttggat tagaaaaagt 5580

gttcgagagt gtcggaagga tattcacgcg gaactcctcc ttctccttgt tcaggtgctc 5640

gttcatgatg gaggtgtaat cgatgtctgc gaggccgagg agcttgcggc aggtggtcag 5700

cgtgagaaac gcttgggcct ggagtgcggt gaggacgata aggaagttgt aaacattccc 5760

gacctccgag ccgctcgtct taacgttctc cttggtgatc agttccgatg cagtcttgag 5820

agcgctccgc ccaaaaagat tgttgcccac cataacgtcg tggaacgtgt tcaggtaaaa 5880

ctcgaagcca tcgacgtcat tcttggtcac ggacttcgcc agctcagtga gttctgtaag 5940

ctcatccagg atgtcggctg gtgagccatc cttcttgacc ttgctggaag tttctgtagc 6000

aaaagtgagt tcctcgaact tctcattcac atacttgatc ctctggtacg ccggtgtaat 6060

ctccgtcagg gtgctgttga tgaggacgtt cacattaatg atatccagct tgtccgagat 6120

ttcttgaagc tgcttgctca gatactcaat ttgaagggac agcgcgtagt tctgcttcat 6180

gacgtccgag agcatgctag taatctttgg gaggtacacg cgaagcattg tgttgatggc 6240

gtcgagctta ttgttcacat cattaagaac ttggttctgc tcatttgcaa tcttgaggat 6300

ctccttagac agttctgtgt tgagattccc ctgagcgatg aggtcgttaa gtgacccatt 6360

cacgccgtcc agcttgccag agatatcgtt caggagttgc tgattcttaa gaatctcgtc 6420

gagcgtaaga tccccgccag tgtctgtctt gaagatcatg ttcataatgt ccttgatccc 6480

cgtagcaaac ccatagatgc cattaaagta gtcaataaag gagggaagtg cccgtgtgga 6540

gagcttggtg ttgttcttgt tcatactagt ggccgcttgg tatctgcatt acaatgaaat 6600

gagcaaagac tatgtgagta acactggtca acactaggga gaaggcatcg agcaagatac 6660

gtatgtaaag agaagcaata tagtgtcagt tggtagatac tagataccat caggaggtaa 6720

ggagagcaac aaaaaggaaa ctctttattt ttaaattttg ttacaacaaa caagcagatc 6780

aatgcatcaa aatactgtca gtacttattt cttcagacaa caatatttaa aacaagtgca 6840

tctgatcttg acttatggtc acaataaagg agcagagata aacatcaaaa tttcgtcatt 6900

tatatttatt ccttcaggcg ttaacaattt aacagcacac aaacaaaaac agaataggaa 6960

tatctaattt tggcaaataa taagctctgc agacgaacaa attattatag tatcgcctat 7020

aatatgaatc cctatactat tgacccatgt agtatgaagc ctgtgcctaa attaacagca 7080

aacttctgaa tccaagtgcc ctataacacc aacatgtgct taaataaata ccgctaagca 7140

ccaaattaca catttctcgt attgctgtgt aggttctatc ttcgtttcgt actaccatgt 7200

ccctatattt tgctgctaca aaggacggca agtaatcagc acaggcagaa cacgatttca 7260

gagtgtaatt ctagatccag ctaaaccact ctcagcaatc accacacaag agagcattca 7320

gagaaacgtg gcagtaacaa aggcagaggg cggagtgagc gcgtaccgaa gacggttctg 7380

ctagagtcag cttgtcagcg tgtcctctcc aaatgaaatg aacttcctta tatagaggaa 7440

gggtcttgcg aaggatagtg ggattgtgcg tcatccctta cgtcagtgga gatatcacat 7500

caatccactt gctttgaaga cgtggttgga acgtcttctt tttccacgat gctcctcgtg 7560

ggtgggggtc catctttggg accactgtcg gcagaggcat cttcaacgat ggcctttcct 7620

ttatcgcaat gatggcattt gtaggagcca ccttcctttt ccactatctt cacaataaag 7680

tgacagatag ctgggcaatg gaatccgagg aggtttccgg atattaccct ttgttgaaaa 7740

gtctcaatcg gaccatcaca tcaatccact tgctttgaag acgtggttgg aacgtcttct 7800

ttttccacga tgctcctcgt gggtgggggt ccatctttgg gaccactgtc ggcagaggca 7860

tcttcaacga tggcctttcc tttatcgcaa tgatggcatt tgtaggagcc accttccttt 7920

tccactatct tcacaataaa gtgacagata gctgggcaat ggaatccgag gaggtttccg 7980

gatattaccc tttgttgaaa agtctcaatc ggaccaagct tatttaaatg gtaccttaat 8040

taagtgcacg tttaaactac ctagtcagtg ccgttgagag cgtagctgcg acttagcggc 8100

ctcgtctgcg aagtcggtga ggctagtgcc actaattagt cattagttta atacaaatcc 8160

acctgcggcc aattcctgca gcgttgcggt tctgtcagtt ccaaacgtaa aacggcttgt 8220

cccgcgtcat cggcgggggt cataacgtga ctcccttaat tctccgctca tgatcagatt 8280

gtcgtttccc gccttcagga tttataattt atattaatgt gatttggttg atggcacaca 8340

tataaatatg gtgtatattg gtgttgaaca tgtgtgacta tgatggatca attgcgtgtc 8400

gcgagggtgg ttcgcggaag tattagttat ttgttaaaaa cacttcgtcg taaagtattg 8460

tgttagttgt ggtaaattta ataaagcgta aagcctgctt ggtaatttcc acagtcggct 8520

aagatgtttg tctatgttaa aaatatttta tgtattcatt gtagtgtagg atagagtgga 8580

tcgaagatat aaattatgtg acatgtgatt agtgtttttt aagatgagat gtgcgaatga 8640

tcgattagtt tttcattgtc tagtcgataa atgttgtcgt aattaattgt gctaaaattg 8700

gtcatgagaa tgcagtgggc acgtggtgtg tttggatgtg acaagtagat tggaagtgtg 8760

gggtctgtcg aa 8772

<210> 6

<211> 199

<212> DNA

<213>sequence being located on SEQ ID NO:3, spans left boundary area (LB and tNos transcription terminator Artificial Sequence)

<400> 6

acaacttaat aacacattgc ggatacggcc aggcgcgtcc ctgttaacgt cctaactagc 60

taaactaggt acagattgcg aggctcacga ggcgatcctg gccgcgtgac agtcgcgtgc 120

gaggctcttg actaagtagg cggccgcgtg cacttaatta agaattccct gcagggatct 180

agtaacatag atgacaccg 199

<210> 7

<211> 200

<212> DNA

<213>sequence being located on SEQ ID NO:4, spans pr35S transcriptional initiation sequence and right side boundary region (RBArtificial Sequence)

<400> 7

agtctcaatc ggaccaagct tatttaaatg gtaccttaat taagtgcacg tttaaactac 60

ctagtcagtg ccgttgagag cgtagctgcg acttagcggc ctcgtctgcg aagtcggtga 120

ggctagtgcc actaattagt cattagttta atacaaatcc acctgcggcc aattcctgca 180

gcgttgcggt tctgtcagtt 200

<210> 8

<211> 20

<212> DNA

<213>the first primer (Artificial Sequence) of SEQ ID NO:3 is expanded

<400> 8

ccctcgacac ccagttttct 20

<210> 9

<211> 20

<212> DNA

<213>the second primer (Artificial Sequence) of SEQ ID NO:3 is expanded

<400> 9

tgaatcctgt tgccggtctt 20

<210> 10

<211> 20

<212> DNA

<213>the first primer (Artificial Sequence) of SEQ ID NO:4 is expanded

<400> 10

ttcgacagac cccacacttc 20

<210> 11

<211> 21

<212> DNA

<213>the second primer (Artificial Sequence) of SEQ ID NO:4 is expanded

<400> 11

caatcggacc atcacatcaa t 21

<210> 12

<211> 18

<212> DNA

Primer (Artificial Sequence) on<213>5 ' flanking genomic sequences

<400> 12

catcccctca gcgtcgtg 18

<210> 13

<211> 20

<212> DNA

<213>primer (Artificial Sequence) being located on T-DNA matched with SEQ ID NO:12

<400> 13

gccgtatccg caatgtgtta 20

<210> 14

<211> 21

<212> DNA

Primer on<213>3 ' flanking genomic sequences, can detecte transgenosis with SEQ ID NO:12 pairing is homozygote Or heterozygote (Artificial Sequence)

<400> 14

catagacaaa catcttagcc g 21

<210> 15

<211> 20

<212> DNA

<213>primer (Artificial Sequence) being located on T-DNA matched with SEQ ID NO:14

<400> 15

cgttgagagc gtagctgcga 20

<210> 16

<211> 21

<212> DNA

<213>Taqman detects the first primer (Artificial Sequence) of Vip3Aa19 gene

<400> 16

cgaatacaga accctgtcgg c 21

<210> 17

<211> 24

<212> DNA

<213>Taqman detects the second primer (Artificial Sequence) of Vip3Aa19 gene

<400> 17

cgtgaggaag gtctcagaaa tgac 24

<210> 18

<211> 27

<212> DNA

<213>Taqman detects the probe (Artificial Sequence) of Vip3Aa19 gene

<400> 18

cgacgatggc gtgtatatgc ctcttgg 27

<210> 19

<211> 22

<212> DNA

<213>Taqman detects the first primer (Artificial Sequence) of pat gene

<400> 19

gagggtgttg tggctggtat tg 22

<210> 20

<211> 23

<212> DNA

<213>Taqman detects the second primer (Artificial Sequence) of pat gene

<400> 20

tctcaactgt ccaatcgtaa gcg 23

<210> 21

<211> 25

<212> DNA

<213>Taqman detects the probe (Artificial Sequence) of pat gene

<400> 21

cttacgctgg gccctggaag gctag 25

<210> 22

<211> 21

<212> DNA

<213>the first primer (Artificial Sequence) of corn endogenous gene SSIIb

<400> 22

cggtggatgc taaggctgat g 21

<210> 23

<211> 23

<212> DNA

<213>the second primer (Artificial Sequence) of corn endogenous gene SSIIb

<400> 23

aaagggccag gttcattatc ctc 23

<210> 24

<211> 348

<212> DNA

<213>in Southern hybridization check Vip3Aa19 gene probe (Artificial Sequence)

<400> 24

tctcaagtcc cagaatggcg atgaggcctg gggcgacaac ttcatcattc tcgaaatctc 60

ccctagcgag aagctcctga gccccgagct gattaacacc aataactgga catccactgg 120

cagcacgaat atctcgggga acaccctgac gctttaccag ggcgggagag gcattctgaa 180

gcagaacctc caactggatt cgttctctac ctacagagtc tatttttcag tttccggcga 240

cgcgaatgtg cgcatcagga actcgcggga agtcctcttc gagaagagat acatgtctgg 300

cgctaaggat gtgtcagaaa tgttcaccac gaagtttgag aaggacaa 348

<210> 25

<211> 310

<212> DNA

<213>in Southern hybridization check pat gene probe (Artificial Sequence)

<400> 25

cagacttaaa accttgcgcc tccatagact taagcaaatg tgtgtacaat gtggatccta 60

ggcccaacct ttgatgccta tgtgacacgt aaacagtact ctcaactgtc caatcgtaag 120

cgttcctagc cttccagggc ccagcgtaag caataccagc cacaacaccc tcaacctcag 180

caaccaacca agggtatcta tcttgcaacc tctctagatc atcaatccac tcttgtggtg 240

tttgtggctc tgtcctaaag ttcactgtag acgtctcaat gtaatggtta acgatatcac 300

aaaccgcggc 310

<210> 26

<211> 20

<212> DNA

<213>primer being located on T-DNA, it is consistent with the direction ID NO:13 SEQ (Artificial Sequence)

<400> 26

gcgcgcaaac taggataaat 20

<210> 27

<211> 20

<212> DNA

<213>primer being located on T-DNA, it is contrary with SEQ ID NO:13, it is used as and obtains flanking sequence (Artificial Sequence)

<400> 27

ccagccacaa caccctcaac 20

<210> 28

<211> 22

<212> DNA

<400> 28

gtggtgtttg tggctctgtc ct 22

<210> 29

<211> 22

<212> DNA

<213>primer being located on T-DNA, it is consistent with the direction ID NO:15 SEQ (Artificial Sequence)

<400> 29

tgctttgaag acgtggttgg aa 22

<210> 30

<211> 20

<212> DNA

<213>primer being located on T-DNA, it is contrary with SEQ ID NO:15, it is used as and obtains flanking sequence (Artificial Sequence)

<400> 30

ctgctccttt attgtgacca 20

<210> 31

<211> 20

<212> DNA

<400> 31

tatcttgctc gatgccttct 20

Claims

1. a kind of nucleic acid sequence, which is characterized in that have in SEQ ID NO:3 or its complementary series 1-873 at least 11 In continuous nucleotide and SEQ ID NO:3 or its complementary series 874-1292 at least 11 continuous nucleotide, and/or At least 11 continuous nucleotide and SEQ ID NO:4 or its complementary sequence in SEQ ID NO:4 or its complementary series 1-553 Arrange at least 11 continuous nucleotide in 554-1028；

Preferably, the nucleic acid sequence has 22-25 continuous core in SEQ ID NO:3 or its complementary series 1-873 22-25 continuous nucleotide, and/or SEQ ID in thuja acid and SEQ ID NO:3 or its complementary series 874-1292 22-25 continuous nucleotide and SEQ ID NO:4 or its complementary series 554- in NO:4 or its complementary series 1-553 22-25 continuous nucleotide in 1028；

Preferably, the nucleic acid sequence includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its complementary sequence Column；

Preferably, the nucleic acid sequence includes SEQ ID NO:3 or its complementary series, and/or SEQ ID NO:4 or its complementary sequence Column.

2. nucleic acid sequence according to claim 1, which is characterized in that the nucleic acid sequence include SEQ ID NO:5 or its Complementary series.

3. a kind of method existing for DNA of test sample transgenic corn event DBN9508 characterized by comprising

Carry out nucleic acid amplification reaction；With

Detect the presence of the target amplification product；

The target amplification product includes nucleic acid sequence as claimed in claim 1 or 2；Preferably, the target amplification product includes SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.

4. method existing for the DNA of test sample transgenic corn event DBN9508 according to claim 3, feature Be, the primer includes the first primer and the second primer, the first primer be selected from SEQ ID NO:1, SEQ ID NO:8 and SEQ ID NO:10；Second primer is selected from SEQ ID NO:2, SEQ ID NO:9 and SEQ ID NO:11.

5. a kind of method existing for DNA of test sample transgenic corn event DBN9508 characterized by comprising

Contact sample to be tested with probe, the probe includes nucleic acid sequence described in claim 1；Preferably, the probe Comprising SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series, And/or SEQ ID NO:7 or its complementary series；

Detect the hybridisation events of the sample to be tested and the probe.

6. method existing for the DNA of test sample transgenic corn event DBN9508 according to claim 5, feature It is, at least one fluorophor label of at least one described probe.

7. a kind of method existing for DNA of test sample transgenic corn event DBN9508 characterized by comprising

Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include nucleic acid described in claim 1 Sequence；Preferably, the marker nucleic acid molecules include at least one selected from the following: SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, and/or SEQ ID NO:6-11 or its complementary series；

The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then pass through marker assistant breeding point Analysis is to determine that insect-resistant and/or herbicide tolerant and marker nucleic acid molecules are chain on science of heredity.

8. a kind of DNA detection kit, which is characterized in that including at least one DNA molecular, the DNA molecular is wanted comprising right 1 nucleic acid sequence is sought, can be used as there is the DNA of specificity to draw transgenic corn events DBN9508 or its offspring One of object or probe；Preferably, the DNA molecular include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its mutually Complementary series, SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.

9. a kind of protection corn plant is from the method for insect infestations, which is characterized in that including being provided in the diet of target insect At least one transgenic corn plant cell, the transgenic corn plant cell include SEQ ID NO:1 in its genome And/or sequence shown in SEQ ID NO:2, the target insect for the transgenic corn plant cell of ingesting, which is suppressed, further to ingest The rotaring gene corn plant；

Preferably, the transgenic corn plant cell includes SEQ ID NO:3 and/or SEQ ID NO:4 in its genome Shown in sequence；

Preferably, the transgenic corn plant cell successively includes SEQ ID NO:1, SEQ ID NO:5 in its genome 1077-8015 nucleic acid sequences and SEQ ID NO:2, or include sequence shown in SEQ ID NO:5.

10. a kind of protect corn plant from the big Tanaka weeds of the damage as caused by herbicide or control maize planting plant Method, which is characterized in that be applied at least one transgenic corns plant of plantation including effective dose glufosinate-ammonium herbicide will be contained The big Tanaka of object, the rotaring gene corn plant include shown in SEQ ID NO:1 and/or SEQ ID NO:2 in its genome Sequence, the rotaring gene corn plant to glufosinate-ammonium herbicide have tolerance；

Preferably, the rotaring gene corn plant includes shown in SEQ ID NO:3 and/or SEQ ID NO:4 in its genome Sequence；

Preferably, the rotaring gene corn plant is in its genome successively comprising SEQ ID NO:1, SEQ ID NO:5 the 1077-8015 nucleic acid sequences and SEQ ID NO:2, or include sequence shown in SEQ ID NO:5.

11. a kind of method for cultivating resistant to insect and/or tolerance glufosinate-ammonium herbicide corn plant, feature exist In, comprising:

Plant an at least corn seed, the core comprising coding insect-resistant Vip3Aa albumen in the genome of the corn seed The nucleic acid sequence of the nucleic acid sequence and specific region of acid sequence and/or coding glufosinate-ammonium herbicide tolerant PAT albumen, or Include nucleic acid sequence shown in SEQ ID NO:5 in the genome of the corn seed；

The corn seed is set to grow up to plant；

The plant described in target insect infestations and/or the plant described in effective dose glufosinate-ammonium herbicide spray, harvest There is the plant of the plant injury weakened compared with the plant for the nucleic acid sequence that other do not have specific region；

The nucleic acid sequence of the specific region is sequence shown in SEQ ID NO:1 and/or SEQ ID NO:2；Preferably, described The nucleic acid sequence of specific region is sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4.

12. a kind of method for generating plant resistant to insect and/or that there is tolerance to glufosinate-ammonium herbicide, Be characterized in that, including will include in the first corn plant genome coding insect-resistant Vip3Aa albumen nucleic acid sequence and/ Or the nucleic acid sequence of glufosinate tolerant PAT albumen and the nucleic acid sequence of specific region are encoded, or first corn is planted Nucleic acid sequence shown in the SEQ ID NO:5 for including in object genome introduces the second corn plant, plants to generate a large amount of filial generations Strain；The progeny plant with the nucleic acid sequence of the specific region is selected, and the progeny plant is resistant to insect And/or there is tolerance to glufosinate-ammonium herbicide；The nucleic acid sequence of the specific region is SEQ ID NO:1 and/or SEQ ID Sequence shown in NO:2；Preferably, the nucleic acid sequence of the specific region is shown in SEQ ID NO:3 and/or SEQ ID NO:4 Sequence；

Preferably, the method includes transgenic corn events DBN9508 and lacking insect-resistant and/or glufosinate tolerant Plant carry out sexual hybridization, to generate a large amount of progeny plants, select the nucleic acid sequence with the specific region The progeny plant；

The progeny plant is handled with target insect infestations and/or with glufosinate-ammonium；

Select the progeny plant resistant to insect and/or that there is tolerance to glufosinate-ammonium herbicide.

13. a kind of agricultural product or commodity for being produced from transgenic corn events DBN9508, which is characterized in that the agricultural product or Commodity are hominy grits, maize flour, corn oil, corn silk, cornstarch, corn gluten, corn-dodger, cosmetics or filling Agent.