CN104830983B - For detecting the nucleic acid sequence and its detection method of corn plant DBN9968 - Google Patents

Abstract

The present invention relates to a kind of for detecting the nucleic acid sequence and its detection method of corn plant DBN9968, and the nucleic acid sequence of the corn plant includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series.Corn plant DBN9968 of the present invention with preferable resistance and has preferable tolerance to glyphosate herbicidal to lepidopterous insects, on yield without influence, and detection method can quickly and accurately identify in biological sample whether include transgenic corn events DBN9968 DNA molecular.

Description

For detecting the nucleic acid sequence and its detection method of corn plant DBN9968

Technical field

The present invention relates to a kind of for detecting the nucleic acid sequence and its detection method of corn plant DBN9968, especially relates to And a kind of pair of insect it is resistant and be resistant to glyphosate herbicidal application transgenic corn events DBN9968 and for detecting In biological sample whether include specific transgenic corn events DBN9968 nucleic acid sequence and its detection method.

Background technique

Many areas are all main cereal crops to corn (Zea mays L.) in the world.Biotechnology has been applied In corn to improve its economical character and quality.Insect-resistant is an important economical character in maize production, especially To resistance of lepidopterous insects, such as corn borer, bollworm, armyworm etc..Corn can be by turning to the resistance of lepidopterous insects The method of gene makes the resistant gene of lepidopterous insects express and obtain in corn plant.Another important economical character It is herbicide tolerant, is especially resistant to glyphosate herbicidal.Corn can be by turning base to the tolerance of glyphosate herbicidal Because method obtain glyphosate herbicide tolerant type gene (such as EPSPS) due to expression in corn plant.

Known foreign gene is influenced in the intracorporal expression of plant by their chromosome location, it may be possible to due to dye Chromatin structure (such as heterochromatin) or transcription regulatory element (such as enhancer) are close to integration site.Thus, it usually needs screening is big The event of amount is possible to identify can be with commercialized event (event that the target gene imported obtains optimal expression). For example, having been observed that the expression quantity of quiding gene may have very big difference between event in plant and other organisms；? On the space of expression or time mode may there is also differences, such as the relative expression of transgenosis deposits between different plant tissues In difference, this species diversity shows that actual expression pattern may be with the transcriptional regulatory member in the gene construct according to importing Expression pattern desired by part is inconsistent.It is thus typically necessary to generate hundreds and thousands of different events and from these events Filter out the single incident with transgene expression amount and expression pattern desired for the purpose of being commercialized.With expected Transgene expression amount and the event of expression pattern can be used for seeping transgenosis by sexual cutcross using conventional breeding methods Enter into other genetic backgrounds.The transgene expression for maintaining original transformant by the offspring that this Crossing system generates is special Sign.It may insure that there is reliable gene expression in many kinds using this strategy pattern, and these kinds can be well Adapt to local growth conditions.

It will be beneficial that the presence of particular event, which is able to detect, so that whether the offspring for determining sexual hybridization includes target gene 's.In addition, the method for detection particular event also will be helpful to abide by relevant laws and regulations, such as the food from recombination crops It needs to obtain official approval before putting goods on the market and be marked.It is detected by any well known polynucleotides detection method The presence of transgenosis is all possible, such as polymerase chain reaction (PCR)

Summary of the invention

The object of the present invention is to provide a kind of for detecting the nucleic acid sequence and its detection method of corn plant DBN9968, Transgenic corn events DBN9968 with preferable resistance and has preferable tolerance to glyphosate herbicidal to insect, and Detection method can quickly and accurately identify whether the DNA comprising specific transgenic corn events DBN9968 divides in biological sample Son.

To achieve the above object, the present invention provides a kind of nucleic acid sequence, in SEQ ID NO:3 or its complementary series extremely At least 11 continuous nucleotide in few 11 continuous nucleotide, and/or SEQ ID NO:4 or its complementary series.

Preferably, the nucleic acid sequence include SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its Complementary series.

Further, the nucleic acid sequence include SEQ ID NO:3 or its complementary series, and/or SEQ ID NO:4 or its Complementary series.

Further, the nucleic acid sequence includes SEQ ID NO:5 or its complementary series.

The SEQ ID NO:1 or its complementary series are 5 ' ends in transgenic corn events DBN9968 in insetion sequence End is located at the sequence that a length near insertion junction is 22 nucleotide, the SEQ ID NO:1 or its complementary sequence Column span the DNA sequence dna of the flanking genomic DNA sequence of corn insertion point and 5 ' ends of insetion sequence, comprising described SEQ ID NO:1 or its complementary series can be accredited as the presence of transgenic corn events DBN9968.The SEQ ID NO:2 Or its complementary series is to be located near insertion junction in transgenic corn events DBN9968 in 3 ' ends of insetion sequence A length be 22 nucleotide sequence, the SEQ ID NO:2 or its complementary series span 3 ' ends of insetion sequence The DNA sequence at end and the flanking genomic DNA sequence of corn insertion point include the SEQ ID NO:2 or its complementary sequence Column can be accredited as the presence of transgenic corn events DBN9968.

In the present invention, the nucleic acid sequence can be inserted into sequence for the SEQ ID NO:3 or its complementary series transgenic Any portion of at least 11 or more continuous polynucleotides (the first nucleic acid sequence) of column, or be the SEQ ID Any portion of at least 11 or more of 5 ' flank corn gene group DNA regions are continuous more in NO:3 or its complementary series Nucleotide (second nucleotide sequence).The nucleic acid sequence may further be derived from or be complementary to comprising the complete SEQ to be same A part of the SEQ ID NO:3 of ID NO:1.When the first nucleic acid sequence is used together with second nucleotide sequence, these Nucleic acid sequence includes DNA primer group in the DNA cloning method for generating amplified production.Using DNA primer in DNA cloning side The amplified production generated in method is can to diagnose transgenic corn events when including the amplified production of SEQ ID NO:1 The presence of DBN9968 or its offspring.Well known to those skilled in the art, the first and second nucleic acid sequences need not be only by DNA group At the mixture or DNA, RNA or other that may also comprise RNA, DNA and RNA are not as one or more polymerase templates Nucleotide or its analog combination.In addition, heretofore described probe or primer should be at least about 11,12,13, 14, the length of 15,16,17,18,19,20,21 or 22 continuous nucleotides, can be selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, nucleotide described in SEQ ID NO:4 and SEQ ID NO:5.When selected from SEQ ID NO:3, When nucleotide shown in SEQ ID NO:4 and SEQ ID NO:5, the probe and primer can be at least about 21 for length A to about 50 or more continuous nucleotides.The SEQ ID NO:3 or its complementary series are transgenic corn events It is located at the sequence that a length near insertion junction is 984 nucleotide in 5 ' ends of insetion sequence in DBN9968 Column, the SEQ ID NO:3 or its complementary series by 821 nucleotide corn flanking genomic DNA sequence (SEQ ID The nucleotide 1-821 of NO:3), DBN10124 construct DNA sequence dna (the nucleotide 822- of SEQ ID NO:3 of 64 nucleotide 885) and the 3 ' end DNA sequences of the tNos of 99 nucleotide (rouge alkali synthetase) transcription terminator (SEQ ID NO:3's Nucleotide 886-984) composition, transgenic corn events can be accredited as comprising the SEQ ID NO:3 or its complementary series The presence of DBN9968.

The nucleic acid sequence can be any of the SEQ ID NO:4 or its complementary series transgenic insetion sequence The continuous polynucleotides (third nucleic acid sequence) of partial at least 11 or more, or for the SEQ ID NO:4 or its mutually Any portion of at least 11 or more the continuous polynucleotides the (the 4th in 3 ' flank corn gene group DNA regions in complementary series Nucleic acid sequence).The nucleic acid sequence may further be derived from or be complementary to comprising the complete SEQ ID NO:2's to be same A part of the SEQ ID NO:4.When third nucleic acid sequence is used together with the 4th nucleic acid sequence, these nucleic acid sequences It include DNA primer group in the DNA cloning method for generating amplified production.It is generated using DNA primer in DNA cloning method Amplified production be that can diagnose transgenic corn events DBN9968 or thereafter when including the amplified production of SEQ ID NO:2 The presence in generation.The SEQ ID NO:4 or its complementary series are in transgenic corn events DBN9968 the 3 ' of insetion sequence End be located at insertion junction near a length be 1465 nucleotide sequence, the SEQ ID NO:4 or its mutually Complementary series is by the t35S terminator sequence (the nucleotide 1-62 of SEQ ID NO:4) of 62 nucleotide, 121 nucleotide The corn integration site of DBN10124 construct DNA sequence dna (the nucleotide 63-183 of SEQ ID NO:4) and 1282 nucleotide Flanking genomic DNA sequence (the nucleotide 184-1465 of SEQ ID NO:4) composition, includes the SEQ ID NO:4 or it is mutual Complementary series can be accredited as the presence of transgenic corn events DBN9968.

The SEQ ID NO:5 or its complementary series are that the length of characterization transgenic corn events DBN9968 is 9428 The sequence of nucleotide, the genome and genetic elements for specifically including are as shown in table 1.Comprising the SEQ ID NO:5 or its mutually Complementary series can be accredited as the presence of transgenic corn events DBN9968.

The genome and genetic elements that table 1, SEQ ID NO:5 include

The nucleic acid sequence or its complementary series can be used in DNA cloning method to generate amplicon, the inspection of the amplicon Survey diagnosis biological sample transgenic corn event DBN9968 or the presence of its offspring；The nucleic acid sequence or its complementary series It can be used in nucleotide detection method, to detect the presence of biological sample transgenic corn event DBN9968 or its offspring.

To achieve the above object, the present invention also provides a kind of test sample transgenic corn event DBN9968's Method existing for DNA, comprising:

Contact sample to be tested in nucleic acid amplification reaction at least two primers；

Carry out nucleic acid amplification reaction；

Detect the presence of amplified production；

The amplified production include in SEQ ID NO:3 or its complementary series at least 11 continuous nucleotide or At least 11 continuous nucleotide in SEQ ID NO:4 or its complementary series.

Further, the amplified production includes 1-11 or 12-22 in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleotides in position continuous nucleotide or SEQ ID NO:2 or its complementary series.

Further, the amplified production include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its mutually Complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

In the above-mentioned technical solutions, the primer includes at least one nucleic acid sequence.

Specifically, the primer includes the first primer and the second primer, the first primer be selected from SEQ ID NO:8 and SEQ ID NO:10；Second primer is selected from SEQ ID NO:9 and SEQ ID NO:11.

To achieve the above object, the present invention also provides the DNA of test sample transgenic corn event DBN9968 a kind of Existing method, comprising:

Contact sample to be tested with probe, the probe includes at least 11 in SEQ ID NO:3 or its complementary series At least 11 continuous nucleotide in continuous nucleotide or SEQ ID NO:4 or its complementary series；

Hybridize the sample to be tested and the probe under stringent hybridization conditions；

Detect the hybridisation events of the sample to be tested and the probe.

The stringent condition can in 6 × SSC (sodium citrate), 0.5%SDS (lauryl sodium sulfate) solution, Hybridize at 65 DEG C, is then respectively washed film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS.

Further, the probe includes 1-11 or 12-22 companies in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleotides in continuous nucleotide or SEQ ID NO:2 or its complementary series.

Further, the probe includes SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary sequence Column, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

Selectively, at least one fluorophor label of at least one described probe.

To achieve the above object, the present invention also provides a kind of test sample transgenic corn event DBN9968's Method existing for DNA, comprising:

Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:3 or In its complementary series at least 11 continuous nucleotide or SEQ ID NO:4 or its complementary series at least 11 it is continuous Nucleotide；

Hybridize the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions；

The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then are assisted by marker Breeding analysis is to determine that insect-resistant and/or herbicide tolerant and marker nucleic acid molecules are chain on science of heredity.

Further, the marker nucleic acid molecules include 1-11 or in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleosides in 12-22 continuous nucleotides or SEQ ID NO:2 or its complementary series Acid.

Further, the marker nucleic acid molecules include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 Or its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

To achieve the above object, the present invention also provides a kind of DNA detection kit, including at least one DNA molecular, The DNA molecular include in the homologous sequence or its complementary series of SEQ ID NO:3 at least 11 continuous nucleotide or At least 11 continuous nucleotide, can be used as transgenosis in the homologous sequence or its complementary series of SEQ ID NO:4 Corn event DBN9968 or its offspring have the DNA primer or probe of specificity.

Further, the DNA molecular includes 1-11 or 12-22 in SEQ ID NO:1 or its complementary series 1-11 or 12-22 continuous nucleotides in continuous nucleotide or SEQ ID NO:2 or its complementary series.

Further, the DNA molecular includes the homologous sequence or its complementary series, SEQ ID of SEQ ID NO:1 The homologous sequence of NO:2 or its complementary series, the homologous sequence of SEQ ID NO:6 or its complementary series or SEQ ID NO:7 Homologous sequence or its complementary series.To achieve the above object, the present invention also provides a kind of plant cells, include coding elder brother The nucleic acid sequence of worm resistance Cry1Ab albumen, the nucleic acid sequence for encoding glyphosate herbicide tolerance EPSPS albumen and given zone The nucleic acid sequence in domain, the nucleic acid sequence of the specific region include SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or Sequence shown in SEQ ID NO:7.

To achieve the above object, the present invention also provides a kind of protection corn plants from the method for insect infestations, including At least one transgenic corn plant cell is provided in the diet of target insect, the transgenic corn plant cell is in its base Because in group all comprising selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, At least one of sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence, the rotaring gene corn plant of ingesting are thin The target insect of born of the same parents is suppressed the corn plant of further ingesting.

To achieve the above object, protect corn plant from the damage as caused by herbicide the present invention also provides a kind of Method, the crop field of at least one rotaring gene corn plant is planted including that will be applied to containing effective dose glyphosate herbicidal In, the rotaring gene corn plant includes selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO in its genome: 3, at least one of SEQ ID NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence, The rotaring gene corn plant has the tolerance to glyphosate herbicidal.

To achieve the above object, the present invention also provides it is a kind of control maize planting plant big Tanaka weeds method, The big Tanaka of at least one rotaring gene corn plant is planted including that will be applied to containing effective dose glyphosate herbicidal, it is described Rotaring gene corn plant includes selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID in its genome At least one of NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence, it is described to turn base Because corn plant has the tolerance to glyphosate herbicidal.

To achieve the above object, the present invention also provides a kind of method of culture corn plant resistant to insect, Include:

An at least corn seed is planted, includes coding insect-resistant Cry1Ab egg in the genome of the corn seed The nucleic acid sequence of white nucleic acid sequence and specific region；

The corn seed is set to grow up to plant；

The plant described in target insect infestations harvests the plant phase for the nucleic acid sequence for not having specific region with other Than having the plant of the plant injury weakened；

The nucleic acid sequence of the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID At least one of NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.

To achieve the above object, the present invention also provides the corns that a kind of culture has tolerance to glyphosate herbicidal The method of plant, comprising:

An at least corn seed is planted, includes coding glyphosate herbicide tolerant in the genome of the corn seed The property nucleic acid sequence of EPSPS albumen and the nucleic acid sequence of specific region；

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the core of specific region with other The plant of acid sequence compares the plant with the plant injury weakened；

The nucleic acid sequence of the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID At least one of NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.

To achieve the above object, a kind of resistant to insect the present invention also provides culture and tolerance glyphosate removes The method of the corn plant of careless agent, comprising:

An at least corn seed is planted, includes coding insect-resistant Cry1Ab egg in the genome of the corn seed White nucleic acid sequence, the nucleic acid sequence of coding glyphosate herbicide tolerance EPSPS albumen and the nucleic acid sequence of specific region；

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the core of specific region with other The plant of acid sequence compares the plant with the plant injury weakened, the plant pair insect with the plant injury weakened Feeding damage it is also resistant；

The nucleic acid sequence of the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID At least one of NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.

To achieve the above object, the present invention also provides a kind of method for generating the plant resistant to insect, Nucleic acid sequence from coding insect-resistant Cry1Ab albumen to the genome of the plant and specific region including introducing The nucleic acid sequence of nucleic acid sequence, the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID At least one of NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 nucleic acid sequence.

Specifically, the method for generating the plant resistant to insect includes:

Transgenic corn events DBN9968 first parental maize plant resistant to insect is resisted with insect is lacked Second parental maize plant sexual hybridization of property, to generate a large amount of progeny plants；

The progeny plant described in target insect infestations；

It selects to have compared with the plant of other nucleic acid sequences for not having specific region described in the plant injury weakened Progeny plant；

The transgenic corn events DBN9968 include in its genome selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, at least one in sequence shown in SEQ ID NO:6 and SEQ ID NO:7 Kind nucleic acid sequence.

To achieve the above object, the present invention also provides a kind of corns for generating and having tolerance to glyphosate herbicidal The method of plant, the nucleic acid sequence including introducing coding glyphosate tolerant EPSPS albumen into the genome of the plant The nucleic acid sequence of the nucleic acid sequence of column and specific region, the specific region is selected from SEQ ID NO:1, SEQ ID NO:2, SEQ At least one of ID NO:3, SEQ ID NO:4, SEQ ID NO:5, sequence shown in SEQ ID NO:6 and SEQ ID NO:7 core Acid sequence.

Specifically, the method for generating the plant for having tolerance to glyphosate herbicidal includes:

By to glyphosate herbicidal have tolerance the first parental maize plant of transgenic corn events DBN9968 with The the second parental maize plant sexual hybridization for lacking glyphosate tolerant, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate herbicidal；

The progeny plant of selection tolerance glyphosate；

The transgenic corn events DBN9968 include in its genome selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, at least one in sequence shown in SEQ ID NO:6 and SEQ ID NO:7 Kind nucleic acid sequence.

To achieve the above object, and tolerance Gyphosate herbicice resistant to insect is generated the present invention also provides a kind of The method of the plant of agent application, comprising:

By the first parental maize plant of transgenic corn events DBN9968 of glyphosate tolerance and insect-resistant with lack Second parental maize plant sexual hybridization of glyphosate tolerant and/or insect-resistant, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate；

The progeny plant of selection tolerance glyphosate, is resistant to ingest damage of the progeny plant to insect of glyphosate Hurt also resistant；

The transgenic corn events DBN9968 include in its genome selected from SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, at least one in sequence shown in SEQ ID NO:6 and SEQ ID NO:7 Kind nucleic acid sequence.

To achieve the above object, the present invention also provides a kind of multicores comprising SEQ ID NO:1 or SEQ ID NO:2 The composition of thuja acid, the composition are corn flour, maize flour, corn oil, corn silk or cornstarch.

To achieve the above object, the present invention also provides a kind of multicores comprising SEQ ID NO:1 or SEQ ID NO:2 The agricultural product or commodity of thuja acid, the agricultural product or commodity be corn flour, maize flour, corn oil, cornstarch, corn gluten, Corn-dodger, cosmetics or filler.

In nucleic acid sequence and its detection method of the present invention for detecting corn plant, defined below and method can be with Preferably definition is of the invention and those skilled in the art is instructed to implement the present invention, unless otherwise mentioned, according to this field The conventional usage of those of ordinary skill understands term.

" corn " refers to maize (Zea mays), and all plant varieties including that can mate with corn, Including field corn kind.

The "comprising" refers to " including but not limited to ".

Term " plant " includes that whole plant, plant cell, plant organ, plant protoplast, plant can therefrom again It is complete in raw plant cell tissue cultures, plant callus, vegetation bed (plant clumps) and plant or plant part Whole plant cell, the plant part such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stalk, root, the tip of a root, flower Medicine etc..The part for the genetically modified plants being interpreted as in the scope of the invention includes but is not limited to plant cell, protoplast, group It knits, callus, embryo and flower, stem, fruit, Ye Hegen, the above plant part are originated from advance with DNA molecular of the invention turn Genetically modified plants that are changing and being therefore at least partly made of transgenic cell or its filial generation.

Term " gene " refers to the nucleic acid fragment of expression specific protein, including adjusting sequence (5 ' the non-volumes before coded sequence Code sequence) and coded sequence after adjusting sequence (3 ' non-coding sequence)." natural gene ", which refers to, is naturally found to have its own Adjust the gene of sequence." mosaic gene " refer to be not natural gene any gene, it includes non-natural discovery adjusting and Coded sequence." endogenous gene " refers to natural gene, and the natural gene is located in organism genome its natural place. " foreign gene " is the alien gene being not present in the existing genome for being biology and originally, also refers to and leads through Transgenic procedures Enter the gene of recipient cell.Foreign gene may include the natural gene or mosaic gene of insertion non-native organism." turn base Cause " is the gene that genome is had been incorporated by Transformation Program.The site that recombinant DNA has been inserted into Plant Genome can To be known as " insertion point " or " target site ".

" flanking DNA " may include the genome being naturally present in the organism of such as plant or pass through conversion process External source (heterologous) DNA of introducing, such as segment relevant to transformation event.Therefore, flanking DNA may include natural and external source The combination of DNA.In the present invention, " flanking region " or " flanking sequence " or " genome frontier district " or " genome border sequence " Refer to the base-pair of at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,2500 or 5000 or Longer sequence, be located at initial external source insertion DNA molecular immediately upstream or downstream and with initial external source insertion DNA point Son is adjacent.When the flanking region is located at downstream, it is referred to as " left margin flank " or " 3 ' flank " or " 3 ' genome sides Battery limit (BL) " or " 3 ' border sequence of genome " etc..When the flanking region is located at upstream, be referred to as " right margin flank " or " 5 ' flank " or " 5 ' genome frontier district " or " 5 ' border sequence of genome " etc..

The Transformation Program of the random integration of exogenous DNA is caused to will lead to the transformant containing different flanking regions, the difference Flanking region is that each transformant institute specificity contains.When recombinant DNA is introduced into plant by conventional hybridization, flanking region It does not usually change.Transformant also can containing between heterologous insertion DNA and the section of genomic DNA or two sections of genomic DNAs it Between or two sections of allogeneic dna sequence DNAs between unique engagement." engagement " is the point of two specific DNA fragmentation connections.For example, engagement It is present in the position of insert DNA connection flanking DNA.Junction is also present in the organism of conversion, two of them DNA piece Section linking together in a manner of modifying and be found from native organism." engagement DNA " refers to the DNA comprising junction.

The present invention provides the referred to as transgenic corn events of DBN9968 and its offspring, the transgenic corn events DBN9968 is corn plant DBN9968 comprising the Plants and Seeds of transgenic corn events DBN9968 and its plant are thin Born of the same parents or its renewable part, the plant part of the transgenic corn events DBN9968, including but not limited to cell, pollen, Ovule, flower, bud, root, stem, silk, inflorescence, ear fringe, leaf and the product from corn plant DBN9968, such as corn flour, jade Rice and flour, corn oil, corn pulp, corn silk, cornstarch and the biomass for staying in corn crop field.

Transgenic corn events DBN9968 of the present invention contains a DNA construct, when it is expressed in plant cell When, the transgenic corn events DBN9968 obtains the resistance to insect and the tolerance to glyphosate herbicidal.The DNA Construct includes two concatenated expression cassettes, first expression cassette include suitable promoter for being expressed in plant and Suitable polyadenylation signal sequence, the promoter are operably connected the nucleic acid sequence of Cry1Ab albumen, described The nucleic acid sequence of Cry1Ab albumen is mainly resistant to lepidopterous insects.Second expression cassette includes for the table in plant The suitable promoter and suitable polyadenylation signal sequence reached, the promoter, which is operably connected, encodes 5- alkene Alcohol-pyruvoyl shikimic acid -3- phosphate synthase (EPSPS) gene, the nucleic acid sequence of the EPSPS albumen is to Gyphosate herbicice Agent has tolerance.Further, the promoter can be the suitable promoter that separates from plant, including composing type, lure Conductivity type and/or tissue-specific promoter, the suitable promoter include but is not limited to cauliflower mosaic virus (CaMV) 35S Promoter, figwort mosaic virus (FMV) 35S promoter, ubiquitin protein (Ubiquitin) promoter, actin (Actin) Promoter, soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) promoter, octopine close At enzyme (OCS) promoter, Cestrum (Cestrum) yellow leaf curl virus promoter, patatin (Patatin) promoter, ribulose-1,5-bisphosphate, 5- diphosphonic acid carboxylase/oxygenase (RuBisCO) promoter, glutathione S-transferase Enzyme (GST) promoter, E9 promoter, GOS promoter, alcA/alcR promoter, Agrobacterium rhizogenes (Agrobacterium Rhizogenes) RolD promoter and Arabidopsis (Arabidopsis thaliana) Suc2 promoter.The polyadenosine Polyadenylation signal sequence can be the suitable polyadenylation signal sequence to work in plant, the suitable polyadenosine Polyadenylation signal sequence includes but is not limited to close from soil Agrobacterium (Agrobacterium tumefaciens) nopaline At the polyadenylation signal sequence of enzyme (NOS) gene, derive from cauliflower mosaic virus (CaMV) 35S terminator, source In the polyadenylation signal sequence of protease-inhibitor Ⅱ (PIN II) gene and from alpha-tubulin (α- Tubulin) the polyadenylation signal sequence of gene.

In addition, the expression cassette can also include other genetic elements, the genetic elements include but is not limited to increase Hadron and signal peptide/transit peptides.The expression of gene can be enhanced in the enhancer, and the enhancer includes but is not limited to, Tobacco etch virus (TEV) translates activity factor, CaMV35S enhancer and FMV35S enhancer.Signal peptide/the transit peptides Cry1Ab albumen and/or EPSPS Protein transport can be guided to extracellular or intracellular specific organelle or compartment, example Such as, chloroplaset is targeted using encoding chloroplast transit peptide sequence, or utilizes ' KDEL ' to retain sequence and targets endoplasmic reticulum.

The Cry1Ab gene can be from thuringiensis (Bacillus thuringiensis, abbreviation Bt) In it is isolated, and can by optimization codon or in other ways change Cry1Ab gene nucleotide sequence, with Achieve the purpose that the stability and utilizability that increase transcript in transformed cells.

" Lepidoptera ", scientific name Lepidoptera, including moth, two class insect of butterfly are one of agriculture and forestry injurious insect at most Mesh, such as corn borer, bollworm, east armyworm, 2 committee noctuid insect, dichocrocis punctiferalis.

5- enol-pyrovyl shikimic acid -3- phosphate synthase (EPSPS) gene can be from soil Agrobacterium It is isolated in (Agrobacterium tumefaciens sp.) CP4 bacterial strain, and can by optimization codon or In other ways change coding EPSPS gene polynucleotides, with reach increase transformed cells in transcript stability and can The purpose of usability.5- enol-pyrovyl shikimic acid -3- phosphate synthase (EPSPS) gene can also be used as selective mark Remember gene.

" glyphosate " refers to the salt of N- phosphonomethylglycine and it, and being handled with " glyphosate herbicidal " is to instigate It is handled with any one containing the herbicide formulations of glyphosate.It is sweet to certain grass in order to reach ebd The selection of phosphine preparation utilization rate is no more than the technical ability of common agronomic technique personnel.Weeding using any one containing glyphosate Agent formulation processing contains the field of the vegetable material from transgenic corn events DBN9968, will control in the field Weed growth, and do not influence from transgenic corn events DBN9968 vegetable material growth or yield.

The DNA construct is introduced in plant using method for transformation, and the method for transformation includes but is not limited to agriculture Bacillus (Agrobacterium) mediated transformation method, Gene Knock-out Mice and pollen tube channel conversion method.

The Agrobacterium_mediated method is the common method of Plant Transformation.The exogenous DNA gram that will be introduced into plant Between the grand left and right boundary consensus sequence to carrier, i.e. the area T-DNA.The carrier is transformed into agrobatcerium cell, with Afterwards, the agrobatcerium cell is organized for infection plant, and the area T-DNA of the carrier comprising exogenous DNA is inserted into plant In genome.

The Gene Knock-out Mice is with carrier bombardment plant cell (the biological bullet that particle mediates comprising exogenous DNA Hit conversion).

The pollen tube channel conversion method be formed by after being pollinated using plant natural pollen tube channel (also known as flower Tube cell guides tissue), through megarchidium channel, exogenous DNA is carried into blastular.

After conversion, it is necessary to have from the plant tissue regenerating plants of conversion, and using suitable label selection The offspring of exogenous DNA.

DNA construct is the combination that DNA molecular is interconnected, and this combination provides one or more expression cassettes. DNA construct preferably can the self-replacation in bacterial cell, and contain different restriction endonuclease sites matter Grain, contained restriction endonuclease sites provide functioning gene element, i.e. promoter, introne, leading sequence for importing Column, coded sequence, 3 ' terminator regions and other sequences DNA molecule.Expression cassette contained in DNA construct includes mentioning Genetic elements necessary to transcription for mRNA, the expression cassette can be designed as the table in prokaryotic cell or eukaryocyte It reaches.Expression cassette of the invention is designed to most preferably express in plant cell.

Transgenosis " event " is as obtained from converting plant cell with heterologous DNA construct, that is, includes at least one Expression of nucleic acid box containing target gene is inserted into Plant Genome to generate plant population by transgene method, then The raw plant population, and selection have the specific plant of insertion specific gene group site feature.Term " event " refers to including different The original transformant of source DNA and the offspring of the transformant.Term " event " also refers to transformant and other product containing allogeneic dna sequence DNA Offspring obtained from sexual hybridization is carried out between kind individual, even if after be returned repeatedly with backcross parent, from conversion The insertion DNA and flanking genomic dna of body parent exists in the same chromosome location in filial generation.Term " event " Also refer to the DNA sequence dna from original transformant, the DNA sequence dna include insertion DNA and with the close adjacent flank base of insertion DNA Because of a group sequence, which, which is expected, is transferred in filial generation, and the filial generation is by (such as original turn of parental department containing insertion DNA Change the filial generation of body and its selfing generation) sexual hybridization is carried out with the parental department without containing insertion DNA and is generated, and the filial generation connects By the insertion DNA comprising target gene.

" recombination ", which refers to, in the present invention generally can not find in nature and therefore by manual intervention generation The form of DNA and/or albumen and/or organism.This manual intervention can produce recombinant DNA molecules and/or recombinant plant.Institute To state " recombinant DNA molecules ", which be by two kinds of artificial combination, is in other cases that isolated sequence section obtains, such as logical It crosses chemical synthesis or operates isolated nucleic acid segment by genetic engineering technology.It is well-known for carrying out the technology of nucleic-acid manipulation 's.

Term " transgenosis " includes any cell, cell line, callus, tissue, plant part or plant, above Genotype due to heterologous nucleic acids presence and change, " transgenosis " include the Transgenics initially changed in this way and The offspring individual generated by initial Transgenics by sexual hybridization or vegetative propagation.In the present invention, term " transgenosis " It does not include being changed by (chromosome or extrachromosomal) of conventional plant breeding method or the natural genome that event occurs Become, for example random allogamy of the natural generation event, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant swivel base Or spontaneous mutation.

" heterologous " refers to that the first molecule is not found usually and the second molecular combinations in nature in the present invention.For example, Molecule can be originated from the first species and be inserted into the genome of the second species.Therefore this molecule is heterologous for host And it is artificially introduced in the genome of host cell.

Cultivate transgenic corn events resistant to lepidopterous insects and that there is tolerance to glyphosate herbicidal DBN9968 passes through following steps: making the first parental corn plants and the second parental corn plants sexual hybridization first, to produce Given birth to the first generation progeny plant of multiplicity, first parental corn plants by cultivation transgenic corn event DBN9968 and The corn plant of its offspring forms, and transgenic corn events DBN9968 and its offspring are of the invention to squama wing by utilizing Mesh insect it is resistant and to glyphosate herbicidal have tolerance expression cassette convert obtained from, the second parent is beautiful Rice plant lacks to the resistance of lepidopterous insects and/or has tolerance to glyphosate herbicidal；Then it selects to Lepidoptera elder brother The invasion of worm are resistant and/or have the progeny plant of tolerance to glyphosate herbicidal, can cultivate to Lepidoptera elder brother Worm is resistant and has the corn plant of tolerance to glyphosate herbicidal.These steps, which may further include, makes squama wing The progeny plant and the second parental corn plants or third parental corn plants of mesh insect-resistant and/or glyphosate tolerant into Row backcrossing, then by applying or passing through molecular marked compound relevant to character with lepidopteran insect infestation, glyphosate herbicidal (DNA molecular for the bond site that 5 ' ends and 3 ' ends such as comprising insetion sequence in transgenic corn events DBN9968 identify) Identification select filial generation, to generate jade to lepidopterous insects resistant and that there is tolerance to glyphosate herbicidal Rice plant.

It will also be appreciated that two different genetically modified plants can also hybridize to generate containing there are two independent, separation The offspring of the foreign gene of formula addition.It is all pure for the available foreign gene added to two of the selfing of appropriate offspring The Progeny plants of zygote.As previously described to the backcrossing of parental plant and be also with the cutcross of non-transgenic plant can be with It is contemplated that vegetative propagation is also same.

Term " probe " is the nucleic acid molecules of one section of separation, is combined with conventional detectable label or report point above Son, for example, radioactive isotope, ligand, chemiluminescent agent or enzyme.This probe is complementary with a chain of target nucleic acid , in the present invention, probe is complementary with a DNA chain from transgenic corn events DBN9968 genome, no matter the base Because group DNA is the plant for being also derived from transgenic corn events DBN9968 from transgenic corn events DBN9968 or seed Object or seed or extract.Probe of the invention not only includes DNA or ribonucleic acid, further include specifically with Target dna sequence combines and can be used for detecting the existing polyamide and other probe materials of the target dna sequence.

Term " primer " is the nucleic acid molecules of one section of separation, is hybridized by nucleic acid, annealed combination to complementary target In DNA chain, heterozygote is formed between primer and target dna chain, then under the action of polymerase (such as archaeal dna polymerase), Along target dna chain extension.Primer pair of the invention is related to its application in target nucleic acid sequence amplification, for example, passing through polymerization Enzyme chain reaction (PCR) or other conventional nucleic acid amplification methods.

The length of probe and primer is usually 11 polynucleotides or more, preferably 18 polynucleotides or more, More preferably 24 polynucleotides or more, most preferably 30 polynucleotides or more.This probe and primer are in height Specifically hybridize under degree stringent hybridization condition with target sequence.Although being different from target dna sequence and to target dna sequence Keep hybridization ability probe can design by conventional method, however, it is preferred to, the present invention in probe and The continuous nucleic acid of primer and target sequence has complete DNA sequence dna identity.

It can be determined by conventional method based on the primer and probe of flanking genomic dna and insetion sequence of the invention, For example, by separating corresponding DNA molecular from from the vegetable material of transgenic corn events DBN9968, and determining should The nucleic acid sequence of DNA molecular.The DNA molecular includes transgene insert sequence and Maize genome flank region, the DNA The segment of molecule may be used as primer or probe.

Nucleic acid probe and primer of the invention hybridizes with target dna sequence under strict conditions.Any conventional nucleic acid is miscellaneous It hands over or amplification method may be used to identify in sample from the presence of the DNA of transgenic corn events DBN9968.Nucleic acid Molecule or its segment can carry out specific hybrid with other nucleic acid molecules in any case.As the present invention uses, if Two nucleic acid molecules can form antiparallel double-strandednucleic acid structure, so that it may say that the two nucleic acid molecules are able to carry out to each other Specific hybrid.If two nucleic acid molecules show complete complementarity, claiming one of nucleic acid molecules is another core " complement " of acid molecule.As the present invention uses, when each nucleotide and another nucleic acid point of a nucleic acid molecules The correspondence nucleotide mutual added time of son, then the two nucleic acid molecules is claimed to show " complete complementarity ".If two nucleic acid molecules energy Enough with enough stability phase mutual crosses to make them anneal under the conditions of at least conventional " low stringent " and tie each other It closes, then the two nucleic acid molecules are referred to as " minimum level is complementary ".Similarly, if two nucleic acid molecules can be with enough steady Qualitative phase mutual cross then claims the two nucleic acid to make them anneal and be bonded to each other under the conditions of conventional " height is stringent " Molecule has " complementarity ".Deviateing from complete complementarity can permit, as long as this deviation not exclusively prevents two points Son forms duplex structure.In order to enable a nucleic acid molecules as primer or probe, it is only necessary to guarantee that it has in sequence and fill The complementarity divided, so that stable duplex structure can be formed under used specific solvent and salinity.

As the present invention uses, substantially homologous sequence is one section of nucleic acid molecules, and the nucleic acid molecules are in high stringency Specific hybrid can occur with the complementary strand of another section of nucleic acid molecules to match down.Promote the suitable stringent of DNA hybridization Condition is then used under the conditions of 50 DEG C for example, about being handled under the conditions of 45 DEG C with 6.0 × sodium chloride/sodium citrate (SSC) 2.0 × SSC washing, these conditions are well known to those skilled in the art.For example, salinity in washing step can be with About 2.0 × SSC, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C selected from Low stringency conditions.In addition, purge step Temperature condition in rapid can be increased to about 65 DEG C of high stringency from about 22 DEG C of room temperature of Low stringency conditions.Temperature Condition and salinity can all change, can also one of them remain unchanged and another variable changes.It is preferred that Ground, a nucleic acid molecules of the invention can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID Specific hybrid occurs for any segment of one or more nucleic acid molecules or its complementary series or above-mentioned sequence in NO:7.More Preferably, a nucleic acid molecules of the invention under high stringency with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, in SEQ ID NO:6 and SEQ ID NO:7 one or more nucleic acid molecules or Specific hybrid occurs for any segment of its complementary series or above-mentioned sequence.In the present invention, preferred marker nucleic acid point Son has SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned Any segment of sequence.Another preferred marker nucleic acid molecules of the present invention and SEQ ID NO:1, SEQ ID NO:2, SEQ ID Any segment of NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned sequence has 80% to 100% or 90% to arrive 100% sequence identity.SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 may be used as planting Marker in object breeding method is to identify the offspring of genetic cross.Probe can be by any with hybridizing for target dna molecule A kind of method being well known to those skilled in the art is detected, these methods include but is not limited to fluorescent marker, radiation Property label, antibody class label and chemiluminescent labeling.

About the amplification (for example, passing through PCR) for using specific amplimer to carry out target nucleic acid sequence, " stringent item Part " refers to the condition for only allowing primer pair target nucleic acid sequence to hybridize in the hot amplified reaction of DNA, has and target The primer of the corresponding wild-type sequence of nucleic acid sequence (or its complementary series), can in conjunction with the target nucleic acid sequence, and It is preferred that unique amplified production is generated, amplified production, that is, amplicon.

Term " specific binding (target sequence) " refers to probe under stringent hybridization conditions or primer only and comprising target Target sequence in the sample of sequence hybridizes.

As the present invention uses, " by the DNA of amplification " or " amplicon " refer to the target as nucleic acid-templated a part The nucleic acid amplification product of nucleic acid sequence.For example, in order to determine corn plant whether by containing transgenic corn events of the present invention DBN9968 is generated by sexual hybridization mode, or whether the corn sample acquired from field includes transgenic corn events Whether DBN9968 or corn extract, such as coarse powder, powder or oil include transgenic corn events DBN9968, from corn plant The DNA that tissue sample or extract extract can be generated by using the nucleic acid amplification method of primer pair for transgenosis jade The presence of the DNA of rice event DBN9968 is diagnostic amplicon.The primer pair includes one and derives from Plant Genome In the flanking sequence adjacent with the exogenous DNA insertion point of insertion the first primer, and the exogenous DNA from insertion Two primers.Amplicon has certain length and sequence, and the sequence is also diagnosis to the transgenic corn events DBN9968 Property.The length range of amplicon can be the combination length of primer pair plus a nucleotide base pair, preferably add about five Ten nucleotide bases pair more preferably add about 250 nucleotide bases pair, most preferably add about 450 cores Thuja acid base-pair or more.

Optionally, primer pair can include entire insert to generate from the flanking genomic sequence of the insertion two sides DNA Enter the amplicon of nucleotide sequence.One in the primer pair of plant genome sequences can be located at away from insertion DNA sequence At a certain distance from column, which may range from a nucleotide base to about 20,000 nucleotide bases pair.Term The use of " amplicon " has been particularly intended to exclude the primer dimer formed in the hot amplified reaction of DNA.

Nucleic acid amplification reaction can be realized by any nucleic acid amplification reaction method known in the art, including be gathered Polymerase chain reacts (PCR).Various nucleic acid amplification methods have been well-known to those skilled in the art.PCR amplification method is Develop to the genomic DNA of amplifiable 22kb and the phage DNA of 42kb.These methods and other DNA cloning of this field Method can be used for the present invention.The exogenous DNA sequence of insertion and flanking DNA sequence from transgenic corn events DBN9968 It can be right after amplification by being expanded using genome of the provided primer sequence to transgenic corn events DBN9968 PCR amplification or the DNA of clone carry out the DNA sequencing of standard.

DNA detection kit based on DNA cloning method contains DNA primer molecule, they are under reaction condition appropriate On specific hybrid to target dna and expand diagnostic amplicon.Kit can provide the detection method based on Ago-Gel Or many methods of checkout and diagnosis amplicon known in the art.Containing with SEQ ID NO:3 or SEQ ID NO:4 Maize genome area any part is homologous or complementary and any portion with the transgenosis insert district of SEQ ID NO:5 It is provided by the present invention for dividing the kit of homologous or complementary DNA primer.Particularly identify useful in DNA cloning method Primer pair be SEQ ID NO:8 and SEQ ID NO:9, amplification and 5 ' transgenosis/base of transgenic corn events DBN9968 Because of a part of homologous diagnostic amplicon in group area, wherein amplicon includes SEQ ID NO:1.As its of DNA primer Its DNA molecular can be selected from SEQ ID NO:5.

Amplicon caused by these methods can be detected by multiple technologies.One of method is Genetic Bit Analysis, this method devise one across the DNA of insertion DNA sequence dna and adjacent flanking genomic DNA sequence widow Nucleotide chain.The oligonucleotide chain is fixed in the micropore of a microwell plate, after carrying out PCR amplification to target area ( A primer is respectively used in insetion sequence and in adjacent flanking genomic sequence), single stranded PCR products can be with fixed few core Thuja acid chain is hybridized, and the template as single base extension, under which has used archaeal dna polymerase and be The ddNTPs of one expected base specific markers.Result can be obtained by fluorescence or ELISA class method.Signal represents The presence of insertion/flanking sequence illustrates that amplification, hybridization and single base extension are successful.

Another method is Pyrosequencing (pyrosequencing) technology.This method devises one across insertion The oligonucleotide chain of DNA sequence dna and adjacent genomic DNA binding site.By the single-stranded of the oligonucleotide chain and target area PCR product (in insetion sequence and adjacent flanking genomic sequence in respectively use a primer) hybridized, then and Archaeal dna polymerase, ATP, sulfonyl enzyme, luciferase, apyrase, adenosine -5 '-phosphorus sulfate and luciferin It is incubated together.It is separately added into dNTPs, measures the optical signal of generation.Optical signal represents the presence of insertion/flanking sequence, It illustrates amplification, hybridization and single base or polybase base extension is successful.

Chen etc. (genome research (Genome Res.) 9:492-498,1999) description Fluorescence polarization be also It can be used for detecting a kind of method of amplicon of the present invention.Need to design in this way one across insertion DNA sequence dna and The oligonucleotide chain of adjacent genomic DNA binding site.By the single stranded PCR products of the oligonucleotide chain and target area ( A primer is respectively used in insetion sequence and in adjacent flanking genomic sequence) hybridized, then with archaeal dna polymerase with And a kind of ddNTP of fluorescent marker is incubated together.Single base extension will lead to insertion ddNTP.This insertion can use Luminoscope measures the change of its polarization.The change of polarization represents the presence of insertion/flanking sequence, illustrate amplification, hybridization and Single base extension is successful.

Taqman is described as a kind of detect and is mentioned with method existing for quantitative analysis DNA sequence dna, this method in manufacturer It is discussed in detail in the operation instruction of confession.It is now briefly illustrated below, designs one across insertion DNA sequence dna and adjacent The FRET oligonucleotide probe of flanking genomic binding site.The FRET probe and PCR primer are (in insetion sequence and adjacent Flanking genomic sequence in respectively use a primer) in the presence of heat-stabilised poly synthase and dNTPs carry out circular response. The hybridization of FRET probe leads to the division of fluorescence part and quencher moieties and the release of fluorescence part on FRET probe.Fluorescence The generation of signal represents the presence of insertion/flanking sequence, illustrates amplification and hybridization is successful.

Based on Hybridization principle, for detecting the suitable technology for deriving from the vegetable material of transgenic corn events DBN9968 It can also include Southern blot hybridization, Northern blot hybridization and in situ hybridization.Particularly, the suitable technology packet It includes and incubates probe and sample, wash to remove whether unbonded probe and detection probe have hybridized.The detection method Depending on the type of label appended by probe, for example, radiolabeled probe can detecte by X-ray exposure and imaging, or The probe for realizing that color change can detecte enzyme label is converted by substrate.

Tyangi etc. (Nature Biotechnol (Nat.Biotech.) 14:303-308,1996) describes molecular labeling and exists Application in Sequence Detection.It is briefly described as follows, designs one and combined across insertion DNA sequence dna and adjacent flanking genomic The FRET oligonucleotide probe at position.The unique texture of the FRET probe causes it to contain secondary structure, which can Fluorescence part and quencher moieties are kept in short distance.The FRET probe and PCR primer are (in insetion sequence and adjacent side A primer is respectively used in wing genome sequence) circular response is carried out in the presence of heat-stabilised poly synthase and dNTPs.By at The hybridization of the PCR amplification of function, FRET probe and target sequence leads to the forfeiture of probe secondary structure, thus make fluorescence part and Quencher moieties spatially separate, and generate fluorescence signal.The generation of fluorescence signal represents insertion/flanking sequence and deposits Illustrating amplification and hybridization is successful.

The method of other descriptions, such as microfluid (microfluidics) provide the side of separation and DNA amplification sample Method and equipment.Photoinitiator dye is for detecting and measuring specific DNA molecular.Comprising for detecting DNA molecule electronic sensor or In conjunction with specific DNA molecular receive pearl and thus can be detected receive test tube (nanotube) equipment for detecting DNA of the invention Molecule is useful.

Method that composition and DNA detection field of the present invention describes or known can be used to develop DNA inspection Test agent box.The kit is conducive to identify the DNA that whether there is transgenic corn events DBN9968 in sample, can be with For cultivating the corn plant of the DNA containing transgenic corn events DBN9968.The kit can containing DNA primer or Probe at least part for being derived from or being complementary to SEQ ID NO:1,2,3,4 or 5, or contains other DNA primers or spy Needle, with being derived from or being complementary to DNA contained in the genetically modified element of DNA, these DNA sequence dnas can be used for DNA cloning Reaction, or as the probe in DNA hybridization method.Turn that be containing in the corn genome and illustrating in Fig. 1 and table 1 The DNA structure of gene inserts and Maize genome binding site includes: being located at the corn of 5 ' end of transgene insert sequence DBN9968 flanking genomes region, a part of insetion sequence of the left boundary area (LB) from Agrobacterium, first table Up to box by the cauliflower mosaic virus 35 S promoter (pr35S) of the tandem sequence repeats containing enhancer region, it is operably connected Onto maize Heat Shock 70kDa albumen introne (iZmHSP70), the insect for being operably connected to bacillus thuringiensis is anti- On the Cry1Ab albumen (cCry1Ab) of property, and it is operably connected on the transcription terminator (tNos) of nopaline synthase and group At second expression cassette is operably connected to arabidopsis EPSPS leaf by 1 promoter of rice actin (prOsAct1) On green body transit peptides (spAtCTP2), it is operably connected to the 5- alkene of the glyphosate tolerant of Agrobacterium CP4 bacterial strain On alcohol-pyruvoyl shikimic acid -3- phosphate synthase (cEPSPS), and it is operably connected to cauliflower mosaic virus 35S terminator (t35S) it forms on, a part of insetion sequence in the right side boundary region (RB) from Agrobacterium, and is inserted positioned at transgenosis Enter the corn plant DBN9968 flanking genomes region (SEQ ID NO:5) of 3 ' end of sequence.In DNA cloning method, make It can be any part from transgenic corn events DBN9968 transgenic insetion sequence for the DNA molecular of primer, It is also possible to any part from the region of DNA domain of flank Maize genome in transgenic corn events DBN9968.

Transgenic corn events DBN9968 can be combined with other transgenic maize varieties, such as herbicide is (such as careless ammonium Phosphine, dicamba etc.) tolerance corn, or carry the transgenic maize varieties of other anti insect genes.All these differences turn base Because of the various combinations of event, the breeding together with transgenic corn events DBN9968 of the invention can provide and resist a variety of insect pests And resist the improvement hybrid transgenic corn variety of a variety of herbicides.These kinds are compared to non-transgenic kind and unisexuality shape Transformed variety can show the superior features such as yield promotion.

The present invention provides a kind of for detecting the nucleic acid sequence and its detection method of corn plant, transgenic corns thing Part DBN9968's is resistant to the feeding damage of lepidoptera pest, and is resistant to the plant of the agriculture herbicide containing glyphosate Object toxic effect.The Cry1Ab albumen of the plant expression bacillus thuringiensis of the dual character, provides to squama wing The resistance of mesh pest (such as Ostrinia furnacalis) feeding damage, and express the 5- alkene of the glyphosate resistance of Agrobacterium strains CP4 Alcohol-pyruvoyl shikimic acid -3- phosphate synthase (EPSPS) albumen assigns plant to the tolerance of glyphosate.Dual character is beautiful 1) rice is had the advantages that from being passed through as caused by lepidoptera pest (such as Ostrinia furnacalis, east armyworm and dichocrocis punctiferalis etc.) Ji loss, Ostrinia furnacalis, east armyworm and dichocrocis punctiferalis etc. are the primary pests of corn-growing regions；2) apply containing glyphosate Agriculture herbicide is used for the ability that broad-spectrum weeding controls to corn crop；3) corn yield does not reduce.In addition, coding insect The gene linkage of resistance and glyphosate tolerant character is present in transgenic corn events in same DNA section On the term single gene seat of DBN9968 genome, this point provide the breeding efficiency of enhancing and make it possible to molecular labeling come Track the transgenic insert in reproductive population and its filial generation.Simultaneously in detection method SEQ ID NO:1 or its mutually Complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its mutually Complementary series can be used as DNA primer or probe to generate the amplification production for being diagnosed as transgenic corn events DBN9968 or its offspring Object, and the presence for identifying the vegetable material from transgenic corn events DBN9968 that can be quick, accurate, stable.

BRIEF DESCRIPTION OF THE SEQUENCES

The insertion point and corn of 5 ' transgenic fragments in SEQ ID NO:1 transgenic corn events DBN9968

11 nucleotide of every side of genomic DNA；

The insertion point and corn of 3 ' transgenic fragments in SEQ ID NO:2 transgenic corn events DBN9968

11 nucleotide of every side of genomic DNA；

It is located at insertion in 5 ' ends of insetion sequence in SEQ ID NO:3 transgenic corn events DBN9968 to connect

A length for closing near sites is the sequence of 984 nucleotide；

It is located at insertion in 3 ' ends of insetion sequence in SEQ ID NO:4 transgenic corn events DBN9968 to connect

A length for closing near sites is the sequence of 1465 nucleotide；

The flank maize genomic sequence of the entire T-DNA sequence of SEQ ID NO:5,5 ' and 3 '；

SEQ ID NO:6 is located at the sequence inside SEQ ID NO:3, spans DBN10124 construct DNA

Sequence and tNos transcription terminator；

SEQ ID NO:7 is located at the sequence inside SEQ ID NO:4, span t35S transcription terminator and

DBN10124 construct DNA sequence dna；

The first primer of SEQ ID NO:8 amplification SEQ ID NO:3；

The second primer of SEQ ID NO:9 amplification SEQ ID NO:3；

The first primer of SEQ ID NO:10 amplification SEQ ID NO:4；

The second primer of SEQ ID NO:11 amplification SEQ ID NO:4；

Primer on 5 ' flanking genomic sequence of SEQ ID NO:12；

The primer of SEQ ID NO:13 and SEQ ID NO:12 pairing being located on T-DNA；

Primer on 3 ' flanking genomic sequence of SEQ ID NO:14 can detecte with SEQ ID NO:12 pairing

Transgenosis is homozygote or heterozygote；

The primer of SEQ ID NO:15 and SEQ ID NO:14 pairing being located on T-DNA；

The primer 1 of SEQ ID NO:16 Taqman detection Cry1Ab；

The primer 2 of SEQ ID NO:17 Taqman detection Cry1Ab；

The probe 1 of SEQ ID NO:18 Taqman detection Cry1Ab；

The primer 3 of SEQ ID NO:19 Taqman detection EPSPS；

The primer 4 of SEQ ID NO:20 Taqman detection EPSPS；

The probe 2 of SEQ ID NO:21 Taqman detection EPSPS；

The first primer of SEQ ID NO:22 corn endogenous gene Ubiquitin；

The second primer of SEQ ID NO:23 corn endogenous gene Ubiquitin；

The probe of Cry1Ab in SEQ ID NO:24 Southern hybridization check；

The probe of EPSPS in SEQ ID NO:25 Southern hybridization check；

SEQ ID NO:26 is located at the primer on T-DNA, consistent with the direction ID NO:13 SEQ；

SEQ ID NO:27 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains

Flanking sequence；

SEQ ID NO:28 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains

Flanking sequence；

SEQ ID NO:29 is located at the primer on T-DNA, consistent with the direction ID NO:15 SEQ；

SEQ ID NO:30 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains

Flanking sequence；

SEQ ID NO:31 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains

Flanking sequence.

Below by drawings and examples, technical scheme of the present invention will be described in further detail.

Detailed description of the invention

Fig. 1 is the transgenosis insertion of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9968 The structural schematic diagram of sequence and Maize genome binding site；

Fig. 2 is that recombinant expression of the present invention for the nucleic acid sequence and its detection method that detect corn plant DBN9968 carries The structural schematic diagram of body DBN10124；

Fig. 3 is the present invention for detecting the nucleic acid sequence of corn plant DBN9968 and its transgenic corns of detection method Field efficacy figure of the event DBN9968 in lobus cardiacus phase and spinning phase inoculation Ostrinia furnacalis；

Fig. 4 is the present invention for detecting the nucleic acid sequence of corn plant DBN9968 and its transgenic corns of detection method The field efficacy figure of event DBN9968 inoculation east armyworm；

Fig. 5 is the present invention for detecting the nucleic acid sequence of corn plant DBN9968 and its transgenic corns of detection method The field efficacy figure of event DBN9968 inoculation bollworm；

Fig. 6 is the present invention for detecting the nucleic acid sequence of corn plant DBN9968 and its transgenic corns of detection method Field efficacy figure of event DBN9968 under the conditions of dichocrocis punctiferalis naturally-occurring；

Fig. 7 is the present invention for detecting the nucleic acid sequence of corn plant DBN9968 and its transgenic corns of detection method Field efficacy figure of event DBN9968 under the conditions of beet armyworm naturally-occurring.

Specific embodiment

Further illustrate the present invention for detecting the nucleic acid sequence of corn plant DBN9968 below by specific embodiment And its technical solution of detection method.

First embodiment, clone and conversion

1.1, carrier cloning

Recombinant expression carrier DBN10124 (as shown in Figure 2) is constructed using the gene clone technology of standard.The carrier DBN10124 includes two concatenated transgene expression cassettes, and first expression cassette is by the tandem sequence repeats containing enhancer region Cauliflower mosaic virus 35 S promoter (pr35S) is operably connected to maize Heat Shock 70kDa albumen introne (iZmHSP70) it on, is operably connected on the Cry1Ab albumen (cCry1Ab) of the insect-resistant of bacillus thuringiensis, And it is operably connected on the transcription terminator (tNos) of nopaline synthase and forms；Second expression cassette is moved by rice flesh 1 promoter of albumen (prOsAct1) is operably connected on arabidopsis EPSPS chloroplast transit peptides (spAtCTP2), can It is operatively coupled to the 5- enol-pyrovyl shikimic acid -3- phosphate synthase of the glyphosate tolerant of Agrobacterium CP4 bacterial strain (cEPSPS) it on, and is operably connected on cauliflower mosaic virus 35S terminator (t35S) and forms.

The carrier DBN10124 is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA with liquid nitrogen method； Cat.No:18313-015 in), and with 5- enol-pyrovyl shikimic acid -3- phosphate synthase (EPSPS) for selected marker pair Transformed cells are screened.

1.2, Plant Transformation

It is converted using conventional Agrobacterium infestation method, by institute in the maize immature embryos of sterile culture and the present embodiment 1.1 The Agrobacterium stated co-cultures, and the T-DNA in the recombinant expression carrier DBN10124 of building is transferred to maize chromosome group In, to generate transgenic corn events DBN9968.

For the corn transformation of mediated by agriculture bacillus, briefly, immature rataria is separated from corn, it is outstanding with Agrobacterium Supernatant liquid contacts rataria, and wherein Agrobacterium can be by the nucleotides sequence biographies of the nucleotide sequence of Cry1Ab gene and EPSPS gene It is handed at least one cell (step 1: infecting step) of one of rataria, in this step, it is outstanding that rataria preferably immerses Agrobacterium Supernatant liquid (OD₆₆₀=0.4-0.6, infect culture medium (4.3 g/L, MS vitamin of MS salt, casein 300mg/L, sucrose 68.5g/L, Glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH 5.3)) in open Dynamic inoculation.Rataria and Agrobacterium co-culture one period (3 days) (step 2: co-culturing step).Preferably, rataria is infecting After step solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L, Acetosyringone (AS) 100mg/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 1mg/L, agar 8g/L, pH 5.8) on cultivate.? After this co-cultivation stage, there can be " recovery " step of a selectivity.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, 2,4 dichlorophenoxyacetic acid (2,4-D) 1mg/L, plant are solidifying Glue 3g/L, pH 5.8) at least in the presence of it is a kind of oneself know and inhibit the antibiotic (cephalosporin) of Agrobacterium growth, do not add plant The selective agent (step 3: recovering step) of transformant.Preferably, rataria is having antibiotic but the not solid medium of selective agent Upper culture, to eliminate Agrobacterium and provide convalescence for infected cell.Then, the rataria of inoculation is in (N- (the phosphine carboxylic containing selective agent Methyl) glycine) culture medium on the transformed calli (step 4: selection step) cultivating and select to grow.Preferably, Rataria have selective agent screening solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, N- (phosphine carboxymerhyl) glycine 0.25mol/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 1mg/L, plant gel 3g/L, pH 5.8) it is cultivated on, leads to the cell selective growth of conversion.Then, at plant, (step 5: regeneration walks callus regeneration Suddenly), it is preferable that (MS differential medium and MS are raw in solid medium for the callus grown on the culture medium containing selective agent Root culture medium) on culture with aftergrowth.

The resistant calli that screening obtains is transferred to the MS differential medium, and (MS salt 4.3g/L, MS vitamin are done Casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, N- (phosphine carboxymerhyl) glycine 0.125mol/L, plant are solidifying Glue 3g/L, pH 5.8) on, differentiation is cultivated at 25 DEG C.It differentiates the seedling come and is transferred to MS root media (the MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, indole-3-acetic acid 1mg/L, agar 8g/L, pH 5.8) On, culture moves to hot-house culture to solid to about 10 cm high at 25 DEG C.In the greenhouse, it is cultivated 16 hours at 28 DEG C daily, It is cultivated 8 hours at 20 DEG C.

1.3, the identification and screening of transgenic event

770 separate transgenic T are generated altogether₀Single plant.

Pass through TaqMan^TMAnalysis (referring to second embodiment), which detects regenerated transgenic corn plant, whether there is Cry1Ab and EPSPS gene, and characterize the copy number of insect-resistant and glyphosate herbicide tolerance strain.According to purpose base The copy number of cause, good insect-resistant, glyphosate herbicide tolerance and Agronomic (referring to the 5th embodiment and Sixth embodiment), by screening, the event DBN9968 of having selected be it is excellent, there is single copy transgenosis, good insect Resistance, glyphosate herbicide tolerance and Agronomic (participating in the 5th embodiment and sixth embodiment).

Second embodiment carries out transgenic corn events DBN9968 detection with TaqMan

Take the blade about 100mg of transgenic corn events DBN9968 as sample, with the DNeasy Plant of Qiagen Maxi Kit extracts its genomic DNA, and the copy of Cry1Ab and EPSPS is detected by Taqman fluorescence probe quantitative PCR method Number.Simultaneously using wild-type corn plant as control, tested and analyzed according to the method described above.Experiment sets 3 repetitions, makes even Mean value.

The specific method is as follows:

Step 11, the blade 100mg for taking transgenic corn events DBN9968, are ground into homogenate with liquid nitrogen in mortar, often A sample takes 3 repetitions；

Step 12, the genomic DNA that above-mentioned sample is extracted using the DNeasy Plant Mini Kit of Qiagen, specifically Method refers to its product description；

Step 13, the genomic DNA for measuring above-mentioned sample with NanoDrop 2000 (Thermo Scientific) are dense Degree；

Step 14, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the range of the concentration value is 80- 100ng/μl；

Step 15, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR method, by known to identification The sample of copy number is as standard items, and using the sample of wild-type corn plant as control, 3 repetitions of each sample take it flat Mean value；Fluorescence quantification PCR primer and probe sequence are respectively:

Following primer and probe is used to detect Cry1Ab gene order:

Primer 1:CGAACTACGACTCCCGCAC is as shown in SEQ ID NO:16 in sequence table；

Primer 2: GTAGATTTCGCGGGTCAGTTG is as shown in SEQ ID NO:17 in sequence table；

Probe 1:CTACCCGATCCGCACCGTGTCC is as shown in SEQ ID NO:18 in sequence table；

Following primer and probe is used to detect EPSPS gene order:

Primer 3:CTGGAAGGCGAGGACGTCATCAATA is as shown in SEQ ID NO:19 in sequence table；

Primer 4:TGGCGGCATTGCCGAAATCGAG is as shown in SEQ ID NO:20 in sequence table；

Probe 2:ATGCAGGCGATGGGCGCCCGCATCCGTA is as shown in SEQ ID NO:21 in sequence table；

PCR reaction system are as follows:

50 × the primer/probe mixture includes each 45 μ L of every kind of primer of 1mM concentration, the probe 50 of 100 μM of concentration μ L and 860 μ L 1 × TE buffers, and at 4 DEG C, it is housed in amber tube.

PCR reaction condition are as follows:

Data are analyzed using SDS2.3 software (Applied Biosystems), obtain the transgenic corns thing singly copied Part DBN9968.

3rd embodiment, transgenic corn events DBN9968 detection

3.1, extracting genome DNA

DNA is extracted according to CTAB (cetyl trimethylammonium bromide) method routinely used: taking 2 grams of tender transgenosis After the blade of corn event DBN9968 is pulverized in liquid nitrogen, the DNA that 0.5mL is preheated in 65 DEG C of temperature is added and extracts CTAB Buffer (20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediamine tetra-acetic acid), with NaOH tune pH To 8.0), after mixing well, in 65 DEG C of extracting 90min of temperature；0.5 times of volume of phenol is added, 0.5 times of volume of chloroform overturns mixed It is even；10min is centrifuged under 12000 rpm (revolutions per minute) revolving speed；2 times of volume dehydrated alcohols are added, softly in Aspirate supernatant Centrifuge tube is shaken, in 4 DEG C of standing 30min of temperature；It is centrifuged 10min again under 12000rpm revolving speed；DNA is collected to tube bottom；Abandon supernatant Liquid, the ethyl alcohol for being 70% with 1mL mass concentration, washing precipitating；5min is centrifuged under 12000 rpm revolving speeds；Vacuum is drained or super Net platform drying；DNA is precipitated and dissolved in suitable TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0), is stored in Under the conditions of -20 DEG C of temperature.

3.2, the analysis of flanking DNA sequence

Concentration mensuration is carried out to the DNA sample of said extracted, is located at the concentration of sample to be tested between 80-100ng/ μ L. With restriction enzyme Sac I, Kpn I, Xma I, Nhe I (5 ' end analysis) and Spe I, Pst I, the BssH II selected (3 ' end analysis) difference digestion genomic DNA.26.5 μ L genomic DNAs, the 0.5 above-mentioned selection of μ L are added in each digestion system Restriction enzyme and 3 μ L enzyme cutting buffering liquids out, digestion 1 hour.After to digestion, 70 μ are added into digestion system L dehydrated alcohol, ice bath 30min, revolving speed 12000rpm are centrifuged 7min, abandon supernatant, and 8.5 μ L distilled water (dd are added in drying later H₂O)、 1μL 10X T₄Buffer and 0.5 μ L T₄Ligase is stayed overnight in 4 DEG C of temperature connections.With a series of nested primers into Row PCR amplification separates 5 ' and 3 ' transgenosis/genomic DNA.Specifically, 5 ' transgenosis of separation/genomic DNA primer combination packet SEQ ID NO:13, SEQ ID NO:26 are included as the first primer, SEQ ID NO:27, SEQ ID NO:28 draw as second Object, SEQ ID NO:13 is as sequencing primer.Separate the combination of 3 ' transgenosis/genomic DNA primer include SEQ ID NO:15, SEQ ID NO:29 is as the first primer, and SEQ ID NO:30, SEQ ID NO:31 are as the second primer, SEQ ID NO:15 As sequencing primer, PCR reaction condition is as shown in table 3.

Amplicon obtained electrophoresis on 2.0% Ago-Gel is then used with separating PCR reactant QIAquick Gel extracts kit (catalogue #_28704, Qiagen Inc., Valencia, CA) is separated from agarose matrix Target fragment.Then the PCR product of purifying is sequenced (for example, ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyze (for example, DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

5 ' and 3 ' flanking sequences and junction sequences are confirmed using standard pcr.5 ' flanking sequences and junction sequences can make Come with SEQ ID NO:8 or SEQ ID NO:12, combination S EQ ID NO:9, SEQ ID NO:13 or SEQ ID NO:26 true Recognize.SEQ ID NO:11 or SEQ ID NO:14, combination S EQ ID NO:10, SEQ can be used in 3 ' flanking sequences and junction sequences ID NO:15 or SEQ ID NO:29 confirms.PCR reaction system and amplification condition are as shown in table 2 and table 3.Art technology Personnel will be understood that other primer sequences can also be used for confirmation flanking sequence and junction sequences.

The DNA sequencing of PCR product provides the DNA that can be used for designing other DNA moleculars, other described DNA moleculars are made The identification of the corn plant or seed from transgenic corn events DBN9968 is used for for primer and probe.

It was found that 1-984, the nucleotide displays in SEQ ID NO:5 are maize genomic sequence in transgenic corns thing The right margin flank (5 ' flanking sequence) of part DBN9968 insetion sequence, 8147-9428, nucleotide in SEQ ID NO:5 are aobvious Show the left margin flank (3 ' flanking sequence) for being maize genomic sequence in transgenic corn events DBN9968 insetion sequence. 5 ' junction sequences are listed in SEQ ID NO:1, and 3 ' junction sequences are listed in SEQ ID NO:2.

3.3, PCR zygosity determination

Junction sequence is relatively short polynucleotide molecule, is new DNA sequence dna, when in polynucleotide tests and analyzes It is diagnostic for the DNA of transgenic corn events DBN9968 when detecting.In SEQ ID NO:1 and SEQ ID NO:2 Junction sequence is the insertion point of transgenic corn events DBN9968 transgenic segment and every side of corn gene group DNA 11 polynucleotides.Longer or shorter polynucleotides junction sequence can be from SEQ ID NO:3 or SEQ ID NO:4 Selection.Junction sequence (5 ' the join domain SEQ ID join domain SEQ ID of NO:1 and 3 ' NO:2) is used as DNA probe or work It is useful in DNA detection method for DNA primer molecule.Junction sequence SEQ ID NO:6 and SEQ ID NO:7 is also to turn New DNA sequence dna in gene corn event DBN9968 can also be used as DNA probe or turn as DNA primer Molecular Detection The presence of gene corn event DBN9968DNA.The SEQ ID NO:6 (822-984, the nucleotide of SEQ ID NO:3) across DBN10124 construct DNA sequence dna and tNos transcription terminator, the SEQ ID NO:7 (core of SEQ ID NO:4 are got over Thuja acid 1-183) span t35S transcription terminator and DBN10124 construct DNA sequence dna.

In addition, amplicon is generated by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4, The diagnostic amplicon of transgenic corn events DBN9968 is generated when the primer is in PCR method.

Specifically, PCR product is generated from 5 ' ends of transgene insert sequence, which is to turn base comprising deriving from Because in the genome of the vegetable material of corn event DBN9968 flank in the genomic DNA of 5 ' ends of T-DNA insetion sequence A part.This PCR product includes SEQ ID NO:3.In order to carry out PCR amplification, design and flank in transgenosis insertion sequence The primer 5 (SEQ ID NO:8) of the genomic dna sequence hybridization of 5 ' ends of column and paired it is located at transgenosis t35S The primer 6 (SEQ ID NO:9) of transcription terminator.

PCR product is generated from 3 ' ends of transgene insert sequence, which includes to derive from transgenic corns thing Flank is in a part of the genomic DNA of 3 ' ends of T-DNA insetion sequence in the genome of the vegetable material of part DBN9968. This PCR product includes SEQ ID NO:4.In order to carry out PCR amplification, design and flank in 3 ' ends of transgene insert sequence The primer 8 (SEQ ID NO:11) of the genomic dna sequence hybridization at end and the paired 3 ' ends positioned at insert The primer 7 (SEQ IDNO:10) of tNos transcription terminator.

The DNA cloning condition illustrated in table 2 and table 3 can be used for above-mentioned PCR zygosity test to generate transgenic corns The diagnostic amplicon of event DBN9968.The detection of amplicon can be by using the Stratagene as shown in table 3 Robocycler, MJ Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradien thermal cycle Instrument etc. carries out, or carries out by methods known to those skilled in the art with equipment.

Table 2,5 ' transgenic insertions/genome engaging zones identification for transgenic corn events DBN9968 PCR step and reaction mixture condition

Table 3, Perkin-Elmer9700 thermal cycler condition

It lightly mixes, if not having hot top on thermal cycler, 1-2 drop mine can be added above each reaction solution Object oil.Using following loop parameter (table 3) in Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or PCR is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run under the mode of calculating. Cooling rate (ramp speed) is set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.

The results showed that primer 5 and 6 (SEQ ID NO:8 and 9), when it is used in transgenic corn events DBN9968 Genomic DNA PCR reaction in when, generate 984bp segment amplified production, when its be used in unconverted corn gene group DNA and When in the PCR reaction of non-DBN9968 corn gene group DNA, no segment is amplified；Primer 7 and 8 (SEQ ID NO:10 and 11), when it is used in the PCR reaction of transgenic corn events DBN9968 genomic DNA, the amplification of 1465bp segment is generated Product, when in the PCR reaction that it is used in unconverted corn gene group DNA and non-DBN9968 corn gene group DNA, without piece Section is amplified.

PCR zygosity determination can also be used in identification from transgenic corn events DBN9968 material be homozygote or It is heterozygote.Primer 9 (SEQ ID NO:12), primer 10 (SEQ ID NO:13) and primer 11 (SEQ ID NO:14) are used The diagnostic amplicon of transgenic corn events DBN9968 is generated in amplified reaction.The DNA cloning illustrated in table 4 and table 5 Condition can be used for above-mentioned zygosity test to generate the diagnostic amplicon of transgenic corn events DBN9968.

Table 4, zygosity determination reaction solution

Table 5, zygosity determination Perkin-Elmer9700 thermal cycler condition

Using following loop parameter (table 5) Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) Or it is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler PCR.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be transported under the mode of calculating Row.Cooling rate (ramp speed) is set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.

In the amplified reaction, the biological sample containing template DNA, which contains, diagnoses the sample transgenic corn event DBN9968 there are the DNA of situation.Or reaction will generate two by the biological sample containing the DNA from Maize genome A different DNA cloning, the DNA from Maize genome in transgenic corn events DBN9968 relative to existing The corresponding allele of insertion DNA be heterozygosis.The two different amplicons, which will correspond to, derives from wild-type corn base Because group locus the first amplicon and diagnosis transgenic corn events DBN9968 DNA there are the second amplicons of situation. The maize dna sample for corresponding to the single amplicon of the second amplicon for the description of heterozygous genes group is only generated, it is diagnosable true The presence of fixed sample transgenic corn event DBN9968, and the sample is by relative to rotaring gene corn plant DBN9968 Present in the corresponding allele of insertion DNA be produced by homozygous corn seed.

It should be noted that the primer pair of transgenic corn events DBN9968 is used to transgenic corn events DBN9968 genomic DNA is diagnostic amplicon.These primer pairs include but is not limited to (the SEQ ID NO:8 of primer 5 and 6 With 9) and primer 7 and 8 (SEQ ID NO:10 and 11), in the DNA cloning method.In addition, for expanding corn One control primer 12 and 13 (SEQ ID NO:22 and 23) of endogenous gene is included, one as reaction condition Inherent standard.Analysis to transgenic corn events DBN9968DNA extracting sample should include a transgenic corn events The assaypositive tissue DNA extract of DBN9968 compares, and a negative DNA from non-transgenic corn event DBN9968 takes out Extract control and a negative control without containing template maize dna extract.Other than these primer pairs, it can also make With any primer pair from SEQ ID NO:3 or SEQ ID NO:4 or its complementary series, when they are used for DNA cloning Being generated respectively when reaction for the tissue from transgenic event corn plant DBN9968 is diagnostic comprising SEQ ID The amplicon of NO:1 or SEQ ID NO:2.The DNA cloning condition illustrated in table 2- table 5 is used for suitable primer pair To generate the diagnostic amplicon of transgenic corn events DBN9968.It generates when being tested in DNA cloning method to turning base Because corn event DBN9968 be diagnostic amplicon, presumption contain the corn comprising transgenic corn events DBN9968 The extract of plant or seed DNA, or from the product of transgenic corn events DBN9968, it is used as the mould of amplification Plate, to determine whether there is transgenic corn events DBN9968.

Fourth embodiment carries out transgenic corn events DBN9968 detection by Southern blot hybridization

4.1, it is extracted for the DNA of Southern blot hybridization

Southern engram analysis is carried out using T4, T5 generation homozygous transformation event.Using mortar and pestle, in liquid nitrogen 10g plant tissue is arrived in middle grinding about 5.In 12.5mL Extraction buffer A (0.2M Tris pH 8.0,50mM EDTA, 0.25M NaCl, 0.1%v/v β-dredges base ethyl alcohol, 2.5%w/v Polyvinyl-pyrrolidone) in resuspension plant tissue, with 4000rpm from The heart 10 minutes (2755g).After discarding supernatant, 2.5mL Extraction buffer B (0.2M Tris pH 8.0,50mM EDTA, 0.5M NaCl, 1%v/v β-dredges base ethyl alcohol, 2.5%w/v Polyvinyl-pyrrolidone, 3% flesh aminoacyl, 20% ethyl alcohol) in be resuspended It drifts along shallow lake, and is incubated 30 minutes at 37 DEG C.It is primary with asepsis ring mixing sample during incubation.After incubation, the bodies such as addition Long-pending chloroform/isoamyl alcohol (24:1) was gently mixed by being inverted, with 4000rpm centrifugation 20 minutes.Collection water-bearing layer, and It adds after 0.54 volume isopropanol with 4000rpm centrifugation 5 minutes to precipitate DNA.Supernatant is discarded, and in 500 μ L TE Resuspension DNA precipitating.For any existing RNA that degrades, at 37 DEG C, DNA and 1 μ L 30mg/mL RNAase A is incubated 30 Minute, with 4000rpm centrifugation 5 minutes, and in the presence of 0.5 volume 7.5M ammonium acetate and 0.54 volume isopropanol, By being centrifuged 10 minutes precipitating DNA with 14000rpm.After discarding supernatant, washed with the ethyl alcohol that 500 μ L mass fractions are 70% Precipitating, and after making it dry in 100 μ L TE resuspension.

4.2, enzymic digestion is limited

Utilize spectrophotometer or fluorometric quantification detection DNA concentration (utilizing 1 × TNE and Hoechst dyestuff).

In 100 μ L reaction systems, 5 μ g DNA are digested every time.Distinguished with restriction enzyme EcoR V and HindIII The partial sequence of digested genomic dna, the Cry1Ab using on T-DNA and EPSPS are as probe.For every kind of enzyme, in temperature appropriate Be incubated overnight digest under degree.Using SpeedVac (speed vacuum) rotation sample to reduce volume extremely 30μL。

4.3, gel electrophoresis

Bromophenol blue Loading Dye is added to each sample in the present embodiment 4.2, and by each sample pipetting volume It onto 0.7% Ago-Gel containing ethidium bromide, is separated by electrophoresis in TBE electrophoretic buffer, the electrophoresis coagulating under 20 volts Glue is stayed overnight.

Gel is washed in 0.25M HCl 15 minutes so that DNA depurination, is then washed with water.It is miscellaneous to set Southern trace It hands over as follows: placing 20 thick drying trace paper in disk, place 4 thin drying trace paper again thereon.In 0.4M NaOH In moisten 1 thin trace paper in advance, and be placed on the pile, then place 1 it is wet in advance in 0.4M NaOH Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B).Gel is seated in top, it is ensured that solidifying There is no bubble between glue and film.3 trace paper in addition impregnated in advance are placed on gel top, and are filled out with 0.4M NaOH Full buffer disk.With the wick connection gel stack and buffer disk being immersed in 0.4M NaOH in advance, DNA is transferred to On film.DNA transfer in about 4 hours is carried out at room temperature.It after transfer, is rinsed Hybond film 10 seconds in 2 × SSC, DNA is logical UV crosslinking is crossed in conjunction with film.

4.4, hybridize

It is prepared with the DNA sequence dna that PCR amplification is suitble to for probe.The DNA probe is SEQ ID NO:24 and SEQ ID NO:25, or it is homologous or complementary with above-mentioned Sequence.25ng DNA probe is boiled 5 minutes in 45 μ L TE, on ice It places 7 minutes, is then transferred into Rediprime II (Amersham Pharmacia Biotech, #RPN1633) test tube. 5 μ l are added to Rediprime test tube³²P label dCTP after, 37 DEG C incubation probe 15 minutes.According to the explanation of manufacturer Book is centrifuged by micro- centrifugation G-50 pillar (Amersham Pharmacia Biotech, #27-5330-01), to remove not The dNTPs of incorporation purifies the probe.Probe activity is measured using scintillation counter.

By in 65 DEG C of Church prehybridization solution (500mM Na with 20mL pre-heating₃P0₄, 1mM EDTA, 7%SDS, 1%BSA) moisten the Hybond film 30 minutes, the prehybridization Hybond film.Boil the probe of label 5 minutes, and on ice It places 10 minutes.Appropriate probe (every 1mL pre-hybridization buffer 1,000,000 times countings) is added to pre-hybridization buffer, in 65 DEG C of mistakes Night is hybridized.Second day, hybridization buffer is discarded, with 1 (40mM Na of 20mL Church rinse solution₃P0₄, 1mM EDTA, 5% SDS, 0.5%BSA) rinsing after, at 65 DEG C, wash film 20 minutes in 150mL Church rinse solution 1.With (the 40mM Na of Church rinse solution 2₃P0₄, 1mM EDTA, 1%SDS) and it repeats the process 2 times.The film is exposed to phosphorus screen or X The position that mating plate is combined with detection probe.

Include three kinds of control samples on each Southern: (1) DNA of the segregant from negative (unconverted), For identify it is any can be with element-specific probe hybridization endogenous corn sequence；(2) DNA from negative segregant, In introduce Hind III- digestion DBN10124, amount be based on probe length be equivalent to a copy number, with explanation examining When surveying the individual gene copy in Maize genome, the sensitivity of the experiment；(3) one is equivalent to based on probe length to copy The DBN10124 plasmid of the Hind III- digestion of shellfish number, as the positive control hybridized and for illustrating the sensitive of experiment Degree.

The evidence that hybridization data provides confirmation supports TaqMan^TMPCR analysis, i.e. corn plant DBN9968 contain Single copy of Cry1Ab and EPSPS gene., using the Cry1Ab probe, EcoR V and Hind III enzymatic hydrolysis generate size respectively The single band of about 17kb and 13kb；Using the EPSPS probe, EcoR V and Hind III enzymatic hydrolysis generate size about respectively The single band of 10kb and 4.5kb.This shows that each copy of Cry1Ab and EPSPS is present in corn transformation event DBN9968 In.

The insect-resistant detection of 5th embodiment, event

5.1, the bioassay of corn plant DBN9968

By transgenic corn events DBN9968 and wild-type corn plant (non-transgenic, NGM) 2 plants respectively to Asia Continent corn borer (Ostrinia furnacalis, ACB), dichocrocis punctiferalis (Conogethes punctiferalis, YPM), 2 points of committees Noctuid (Athetis lepigone, LPG), pink rice borer (Sesamia inferens, PSB), east armyworm (Mythimna Seperata, OAW), prodenia litura (Spodoptera litura, TCW), striped rice borer (Chilo suppressalis, SSB), bollworm (Helicoverpa armigera, CBW) and beet armyworm (Spodoptera exigua, BAW) are according to such as Lower method carries out bioassay:

The new of transgenic corn events DBN9968 and wild-type corn plant (non-transgenic, NGM) 2 plants is taken respectively Fresh leaves (V3-V4 period), it is clean with aseptic water washing and blotted the water on blade with gauze, then maize leaf is gone Except vein, while it being cut into the strip of about 1cm × 3cm, the length after taking 1-3 piece (determining blade quantity according to insect appetite) to cut Blade strip is put on the filter paper of round plastic culture dish bottom, and the filter paper is soaked with distilled water, puts 10 in each culture dish The newly hatched larvae of head artificial feeding, after worm tries culture dish capping, in 26-28 DEG C of temperature, relative humidity 70%-80%, photoperiod Statistical result after being placed 3 days under conditions of (light dark) 16:8.Ostrinia furnacalis counts the death rate, is fought by corrected mortality Property level identified, corrected mortality (%)=(1- survival number/connect borer population-wild type control death rate)/(1- wild type Compare the death rate) × 100%.Three other insect statistical larvae development progresses, the death rate and blade injury rate indexs obtain Resistance total score (full marks 300 divide): resistance total score=100 × corrected mortality+[100 × death rate+90 × (just incubate borer population/it connects Worm sum)+60 × (just incubate-negative control borer population/and connect worm sum)+10 × (negative control borer population/connect worm sum)]+100 × (1- blade injury rate).5 are selected respectively from transgenic corn events DBN9968 and wild-type corn plant (non-transgenic, NGM) Strain is tested, and every plant is repeated 6 times.As a result as shown in table 6 and table 7.

Pest-resistant bioassay results-death rate (%) of table 6, transgenic corn events DBN9968

Pest-resistant bioassay results-resistance total score of table 7, transgenic corn events DBN9968

The result shows that: transgenic corn events DBN9968 is to Ostrinia furnacalis, dichocrocis punctiferalis, 2 committee noctuid insect, pink rice borer, east Square armyworm, prodenia litura, striped rice borer, bollworm and beet armyworm all have preferable resistance, and transgenic corn events The test worm death rate and resistance total score of DBN9968 is significantly higher than NGM.

5.2, the field effect of transgenic corn events DBN9968

The seed of transgenic corn events DBN9968 and wild-type corn plant (non-transgenic, NGM) 2 plants are set It is handled for 2, each processing is by pressing RANDOMIZED BLOCK DESIGN, 3 repetitions, plot area 30m²(5m × 6m), line-spacing 60cm, Spacing in the rows 25cm, conventional cultivation management, the time of infertility do not spray insecticide.Different insects connect between worm experimental plot between having 2m Every avoiding diffusion of the insect between different community.(1) Ostrinia furnacalis

It is manually connect in corn lobus cardiacus phase (toy trumpet mouth phase, plant are developed to the exhibition 6-8 leaf phase) and spinning phase respectively Worm respectively connects worm 2 times.Every cell Artificial Inoculation of Anoplophora glabripennis is no less than 40 plants, connects the first of artificial feeding in every plant of corn lobus cardiacus/filigree and incubates Larva about 60, after connecing worm 3 days, worm is connect for the second time, connects borer population amount with for the first time.After connecing worm 14-21 days, investigated by strain beautiful The killed situation of rice.It is instituted an inquiry within 14 days after usually connecing worm, if the rank that causes harm of negative control material (NGM) reaches sense or high sense, Then it is considered as effectively, if investigation can suitably be postponed by not reaching, but still be not up to appropriate level in 21 days after connecing worm, then this connects worm It is invalid to be considered as.The lobus cardiacus phase connects worm investigation plant middle and upper part blade by Ostrinia furnacalis feeding situation；The spinning phase adjusts after connecing worm It looks into female fringe and is killed degree and the killed situation of plant.Each processing randomly selects 15-20 plants/row.

The lobus cardiacus phase: Ostrinia furnacalis is recorded by the description in table 8 by strain and eats leaf level.Ostrinia furnacalis is calculated to each Processing blade is caused harm the average value of degree (food leaf level): averagely food leaf level=∑ (food leaf level × rank plant number)/ Investigate total strain number.According to the average value of food leaf level, each processing is divided to the resistance level of Ostrinia furnacalis, such as table 9.Turn The gene corn event DBN9968 lobus cardiacus phase is as shown in table 12 to the resistance result of Ostrinia furnacalis.

The spinning phase: according to female fringe be killed situation, channel quantity, channel length of tunnel (cm) and survival instar larvae and Amount of survival calculates each cell ear period Ostrinia furnacalis and is killed rank average value, judgment criteria such as 10 institute of table to the resistance of female fringe Show, then by the judgment of standard corn ear period of table 11 to the resistance level of Ostrinia furnacalis.Transgenic corn events DBN9968 The spinning phase is as shown in table 13 to the resistance result of Ostrinia furnacalis.

Table 8, Ostrinia furnacalis cause harm the grade scale of degree to corn lobus cardiacus

Eat leaf level	Symptom description
		1	Only there is 1-2 aperture≤1mm worm channel on individual blades
2	Only there is 3-6 aperture≤1mm worm channel on individual blades
		3	A small number of blades have 7 or more apertures≤1mm worm channel
4	There is 1-2 aperture≤2mm worm channel on individual blades
		5	There is 3-6 aperture≤2mm worm channel on a small number of blades
6	Partial blade has 7 or more apertures≤2mm worm channel
		7	There is 1-2 aperture to be greater than the worm channel of 2mm on a small number of blades
8	There is 3-6 aperture to be greater than the worm channel of 2mm on partial blade
		9	There are 7 or more apertures to be greater than the worm channel of 2mm on most of blade

Table 9, corn are to the evaluation criterion of Ostrinia furnacalis resistance

The lobus cardiacus phase eats leaf level average value	Resistance level
		1.0-2.9	Highly resistance (HR)
3.0-4.9	Anti- (R)
		5.0-6.9	In resist (MR)
7.0-8.9	Feel (S)
		9.0	Height sense (HS)

Table 10, corn ear period are caused harm the grade scale of degree by Ostrinia furnacalis

Female fringe is killed	Symptom description
		Grade 1 is not	Female fringe is not aggrieved
2	Filigree killed < 50%
		3	Most of filigree killed >=50%；There are larvae alive, age≤2 ages
4	Fringe point is killed≤1cm；There are larvae alive, age≤3 ages
		5	Fringe point is killed≤2cm；Or have larvae alive, age≤4 ages；Length of tunnel≤2cm
6	Fringe point is killed≤3cm；Or have larvae alive, age > 4 ages；Length of tunnel≤4cm
		7	Fringe point is killed≤4cm；Length of tunnel≤6cm
8	Fringe point is killed≤5cm；Length of tunnel≤8cm
		9	Fringe point is killed > 5cm；Length of tunnel > 8cm

Table 11, corn ear period are to the Evaluation standard of resistance of Ostrinia furnacalis

Female fringe is killed rank average value	Resistance level
		1.0-2.0	Highly resistance (HR)
2.1-3.0	Anti- (R)
		3.1-5.0	In resist (MR)
5.1-7.0	Feel (S)
		≥7.1	Height sense (HS)

Table 12, transgenic corn events DBN9968 lobus cardiacus phase are to the resistance result of Ostrinia furnacalis

Table 13, transgenic corn events DBN9968 spinning phase are to the resistance result of Ostrinia furnacalis

The result shows that: either the lobus cardiacus phase still spins the phase, and transgenic corn events DBN9968 is equal to Ostrinia furnacalis With preferable resistance level；The food leaf level average value of lobus cardiacus phase, transgenic corn events DBN9968 are substantially less than NGM. The spinning phase, it is equal that female fringe percentage of injury, larvae alive number, length of tunnel and the female fringe of transgenic corn events DBN9968 is killed rank Substantially less than NGM.Transgenic corn events DBN9968 is inoculated with the field efficacy of Ostrinia furnacalis such as in lobus cardiacus phase and spinning phase Shown in Fig. 3.

(2) east armyworm

Experimental design and test method are substantially consistent with the evaluation resistance of Ostrinia furnacalis as described above.Different It is only to carry out Artificial Inoculation of Anoplophora glabripennis in the corn lobus cardiacus phase (plant is developed to the exhibition 4-6 leaf phase), connect worm 2 times, in every plant of corn core Leaf meets second instar larvae about 20 of artificial feeding.After connecing worm 3 days, worm is connect for the second time, connects borer population amount with for the first time.Connecing worm 14 After it, investigation maize leaf is caused harm degree by east armyworm.Caused harm degree according to maize leaf by east armyworm, is calculated Each cell east armyworm causes harm the average value of rank (food leaf level) to maize leaf, and judgment criteria is as shown in table 14, then By the judgment of standard corn of table 15 to the resistance level of east armyworm.The transgenic corn events DBN9968 lobus cardiacus phase is glutinous to east The resistance result of worm is as shown in table 16.

Table 14, maize leaf are caused harm the grade scale of degree by east armyworm

Eat leaf level	Symptom description
		1	Blade is without killed, or only has needle prick shape (≤1mm) worm channel on blade
2	Only there is a small amount of shell hole size (≤5mm) worm channel on individual blades
		3	A small number of blades have shell hole size (≤5mm) worm channel
4	(≤10mm) is incised on individual blades
		5	(≤10mm) is incised on a small number of blades
6	(≤10mm) is incised on partial blade
		7	Individual blade-sections have sheet to incise (≤10mm) by feeding on a small number of blades
8	A small number of blades have sheet to incise (≤10mm) by feeding on partial blade
		9	Most of blade is by feeding

Table 15, corn are to the Evaluation standard of resistance of east armyworm

The lobus cardiacus phase eats leaf level average value	Resistance level
		1.0-2.0	Highly resistance (HR)
2.1-4.0	Anti- (R)
		4.1-6.0	In resist (MR)
6.1-8.0	Feel (S)
		8.1-9.0	Height sense (HS)

Table 16, transgenic corn events DBN9968 lobus cardiacus phase are to the resistance result of east armyworm

The result shows that: transgenic corn events DBN9968 has preferable resistance level, and transgenosis to east armyworm Corn event DBN9968's incises ratio and food leaf level substantially less than NGM, transgenic corn events DBN9968 inoculation east The field efficacy of square armyworm is as shown in Figure 4.

(3) bollworm

Experimental design and test method are substantially consistent with the evaluation resistance of Ostrinia furnacalis as described above.Different It is only to carry out Artificial Inoculation of Anoplophora glabripennis in the corn silking phase, connect worm 2 times, the newly hatched larvae of artificial feeding is connect in every plant of corn capillament about 20, after connecing worm 3 days, worm is connect for the second time, connects borer population amount with for the first time.It is killed by strain investigation female fringe after connecing worm 14-21 days Rate, each female fringe survival larva number, female fringe are killed length.It is instituted an inquiry within 14 days after usually connecing worm, if negative control material (NGM) the rank that causes harm reaches sense or high sense, then is considered as effectively, if investigation can suitably be postponed by not reaching, but connects after worm 21 days It is still not up to appropriate level, then this connects worm and is considered as in vain.Length is killed according to female fringe percentage of injury, survival larva number, female fringe (cm), each cell corn ear period bollworm is calculated to the rank average value of causing harm of female fringe, and judgment criteria is as shown in table 17, then By the judgment of standard corn ear period of table 18 to the resistance level of bollworm.Transgenic corn events DBN9968 spins the phase to cotton boll The resistance result of worm is as shown in table 19.

Table 17, maize ear are caused harm the grade scale of degree by bollworm

Female fringe is killed rank	Symptom description
		0	Female fringe is not aggrieved
1	Only filigree is killed
		2	Fringe top is killed 1cm
3+	Every increase 1cm is killed under fringe top, killed rank increases by 1 grade accordingly
		…N

Table 18, maize ear are to the Evaluation standard of resistance of bollworm

Female fringe is killed rank average value	Resistance level
		0-1.0	Highly resistance (HR)
1.1-3.0	Anti- (R)
		3.1-5.0	In resist (MR)
5.1-7.0	Feel (S)
		≥7.1	Height sense (HS)

Table 19, transgenic corn events DBN9968 spinning phase are to the resistance result of bollworm

The result shows that: transgenic corn events DBN9968 has preferable resistance level to bollworm, and transgenosis is beautiful The female fringe percentage of injury of rice event DBN9968, larvae alive number, female fringe are killed length and female fringe is killed rank and is substantially less than NGM, Transgenic corn events DBN9968 is inoculated with the field efficacy of bollworm as shown in Fig. 5.

(4) dichocrocis punctiferalis

Experimental design and test method are substantially consistent with the evaluation resistance of Ostrinia furnacalis as described above.Different It is that corn only carries out natural INFESTATION in the more serious area of dichocrocis punctiferalis naturally-occurring.After first occur insect pest 14-21 days, And NGM is when being mostly that 4-5 age high instar larvae endangers, by strain investigation dichocrocis punctiferalis to the rate that causes harm of plant.Transgenic corn events DBN9968 is as shown in table 20 to the resistance result of dichocrocis punctiferalis.

To the resistance result of dichocrocis punctiferalis under the conditions of table 20, transgenic corn events DBN9968 natural INFESTATION

The result shows that: under the conditions of dichocrocis punctiferalis naturally-occurring, compared with NGM, dichocrocis punctiferalis is to transgenic corn events The rate significant decrease of causing harm of DBN9968, thus illustrates that transgenic corn events DBN9968 has preferable resistance to dichocrocis punctiferalis, Field efficacy of transgenic corn events DBN9968 under the conditions of dichocrocis punctiferalis naturally-occurring is as shown in Figure 6.

(5) beet armyworm

Experimental design and test method are substantially consistent with the evaluation resistance of Ostrinia furnacalis as described above.Different It is that corn only carries out natural INFESTATION in the more serious area of beet armyworm naturally-occurring.Occur insect pest 10-15 days first Afterwards, when and NGM is mostly that 4-6 age high instar larvae endangers, by strain investigation beet armyworm to the rate that causes harm of plant.Transgenosis is beautiful Rice event DBN9968 is as shown in table 21 to the resistance result of beet armyworm.

To the resistance result of beet armyworm under the conditions of table 21, transgenic corn events DBN9968 natural INFESTATION

The result shows that: under the conditions of beet armyworm naturally-occurring, compared with NGM, beet armyworm is to transgenic corn events Thus it is preferable anti-to illustrate that transgenic corn events DBN9968 has beet armyworm for the rate significant decrease of causing harm of DBN9968 Property, field efficacy of transgenic corn events DBN9968 under the conditions of beet armyworm naturally-occurring is as shown in Figure 7.

What is particularly worth mentioning is that be 201210509817.2 according to Chinese patent (application) number, 201210511214.6, the content recorded in 201310576970.1,201310578129.6 and 201310681139.2, and The field effect and its bioassay results to insect of the application transgenic corn events DBN9968, shows that the application turns base Because corn event DBN9968 realizes the method and/or purposes of control pest, specially 2 committee noctuid insect, dichocrocis punctiferalis, twill Noctuid, pink rice borer and east armyworm；Namely 2 points of control may be implemented in the rotaring gene corn plant of any expression Cry1Ab albumen The method and/or purposes of committee noctuid, dichocrocis punctiferalis, prodenia litura, pink rice borer and/or east armyworm pest.

The herbicide tolerant detection of sixth embodiment, event

This test selects agriculture to be sprayed up to herbicide (41% glyphosate-isopropylammonium aqua).It is set using random district's groups Meter, 3 repetitions.Plot area is 15m²(5m × 3m), line-spacing 60cm, spacing in the rows 25cm, conventional cultivation management have between cell The wide isolation strip of 1m.Transgenic corn events DBN9968 is carried out to following 2 kinds of processing respectively: 1) not being sprayed；2) 1680g is pressed A.e./ha dosage sprays agriculture up to herbicide in the V3 leaf phase, then sprays agriculture again by same dose in the V8 phase up to herbicide.It needs It is noted that the form that different content and the glyphosate herbicidal of dosage form are converted into equivalent glyphosate is suitable for following knot By.

The 1 week and 2 weeks investigation symptom of chemical damage after medication respectively, and harvest when measure cell yield.Symptom of chemical damage point Grade is as shown in table 22.Use the aggrieved rate of herbicide as the index of evaluation index assessment transformation event herbicide tolerant, specifically Ground, the aggrieved rate of herbicide (%)=∑ (aggrieved strain number × number of levels at the same level)/(total strain number × highest level)；Wherein herbicide Aggrieved rate refers to that the aggrieved rate of glyphosate, the aggrieved rate of glyphosate are 2 weeks after handling according to glyphosate phytotoxicity investigation results and determine 's.The corn yield of each cell is the niblet total output (weight) for weighing 3 rows among each cell, the production between different disposal Amount difference is measured in the form of yield percentage, and yield percentage (%)=spraying yield/does not spray yield.Transgenosis Corn event DBN9968 is as shown in table 23 to the result and corn yield result of herbicide tolerant.

Table 22, glyphosate herbicidal are to the grade scale of corn phytotoxicity degree

Phytotoxicity rank	Symptom description
		1	Growth is normal, without any damage symptoms
2	Slight phytotoxicity, phytotoxicity are less than 10%
		3	Medium phytotoxicity can restore later, not influence yield
4	Phytotoxicity is heavier, it is difficult to restore, cause the underproduction
		5	Phytotoxicity is serious, cannot restore, and causes the obvious underproduction or total crop failure

Table 23, transgenic corn events DBN9968 are to the result and corn yield result of glyphosate herbicide tolerance

As a result illustrate, in terms of herbicide (glyphosate) aggrieved rate: 1) transgenic corn events DBN9968 is in glyphosate Aggrieved rate is essentially 0 under herbicide (1680g a.e./ha) processing, and transgenic corn events DBN9968 has good as a result, Glyphosate herbicide tolerance.

In terms of yield: transgenic corn events DBN9968 is not spraying and is spraying 2 kinds of 1680g a.e./ha glyphosate Handling lower yield does not have notable difference, and after spraying glyphosate herbicidal, the yield of transgenic corn events DBN9968 is basic It does not reduce, further demonstrates that transgenic corn events DBN9968 has good glyphosate herbicide tolerance as a result,.

7th embodiment

Such as agricultural product or commodity can be produced by transgenic corn events DBN9968.If in the agricultural product or commodity In detect enough expression quantity, the agricultural product or commodity are expected containing can diagnose transgenic corn events DBN9968 material Expect the nucleotide sequence present in the agricultural product or commodity.The agricultural product or commodity include but is not limited to corn oil, jade Rice coarse powder, maize flour, corn gluten, corn-dodger, cornstarch and will as food source for animal consumption it is any its Its food or additionally as the ingredient in swelling agent or make-up composition for cosmetic use etc..Based on probe or primer pair Nucleic acid detection method and/or kit can be developed to detect such as SEQ ID NO:1 or SEQ ID in biological sample Transgenic corn events DBN9968 nucleotide sequence shown in NO:2, wherein probe sequence or primer sequence are selected from such as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, sequence shown in SEQ ID NO:4 and SEQ ID NO:5 turn base with diagnosis Because of the presence of corn event DBN9968.

In conclusion transgenic corn events DBN9968 of the present invention has preferable resistance to lepidopterous insects, simultaneously To glyphosate herbicidal tolerance with higher, on yield without influence, and detection method can quickly and accurately identify biology In sample whether include transgenic corn events DBN9968 DNA molecular.

Seed corresponding to transgenic corn events DBN9968 is deposited in China Microbiological on December 24th, 2014 Culture presevation administration committee common micro-organisms center (abbreviation CGMCC, address: Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Number, Institute of Microorganism, Academia Sinica, postcode 100101), classification naming: corn (Zea mays), deposit number is CGMCC No.10291.Preserved material will be 30 years in depository's preservation.

It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng It is described the invention in detail according to preferred embodiment, those skilled in the art should understand that, it can be to the present invention Technical solution be modified or replaced equivalently, without departing from the spirit and scope of the technical solution of the present invention.

Claims (26)

1. a kind of nucleic acid sequence, which is characterized in that including SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or Its complementary series, the nucleic acid sequence be originated from transgenic corn events DBN9968, the transgenic corn events DBN9968 with The form of seed and to be preserved in China Committee for Culture Collection of Microorganisms with deposit number CGMCC No.10291 commonly micro- Bio-Centers.

2. nucleic acid sequence according to claim 1, which is characterized in that the nucleic acid sequence include SEQ ID NO:3 or its Complementary series, and/or SEQ ID NO:4 or its complementary series.

3. nucleic acid sequence according to claim 2, which is characterized in that the nucleic acid sequence include SEQ ID NO:5 or its Complementary series.

4. a kind of method existing for DNA of test sample transgenic corn event DBN9968 characterized by comprising

Contact sample to be tested in nucleic acid amplification reaction at least two primers；

Carry out nucleic acid amplification reaction；

Detect the presence of amplified production；

The amplified production includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its complementary series；

The amplified production is originated from transgenic corn events DBN9968, and the transgenic corn events DBN9968 is with the shape of seed Formula and China Committee for Culture Collection of Microorganisms's common micro-organisms center is preserved in deposit number CGMCC No.10291.

5. method existing for the DNA of test sample transgenic corn event DBN9968 according to claim 4, feature It is, the amplified production further includes SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.

6. method existing for the DNA of test sample transgenic corn event DBN9968 according to claim 4 or 5, special Sign is that described two primers include SEQ ID NO:8 and SEQ ID NO:9 or SEQ ID NO:10 and SEQ ID NO: 11。

7. a kind of method existing for DNA of test sample transgenic corn event DBN9968 characterized by comprising

Contact sample to be tested with probe, the probe includes SEQ ID NO:1 or its complementary series or SEQ ID NO: 2 or its complementary series, the source probe transgenic corn event DBN9968, the transgenic corn events DBN9968 is to plant Son form and China Committee for Culture Collection of Microorganisms's commonly micro- life is preserved in deposit number CGMCC No.10291 Object center；

Hybridize the sample to be tested and the probe under stringent hybridization conditions；

Detect the hybridisation events of the sample to be tested and the probe.

8. method existing for the DNA of test sample transgenic corn event DBN9968 according to claim 7, feature It is, the probe further includes SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

9. special according to method existing for the DNA of the test sample transgenic corn event DBN9968 of claim 7 or 8 Sign is that at least one described probe is marked at least one fluorophor.

10. a kind of method existing for DNA of test sample transgenic corn event DBN9968 characterized by comprising

Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include SEQ ID NO:1 or it is mutual Complementary series or SEQ ID NO:2 or its complementary series, the marker nucleic acid molecules are originated from transgenic corn events DBN9968, the transgenic corn events DBN9968 are preserved in the form of seed and with deposit number CGMCC No.10291 China Committee for Culture Collection of Microorganisms's common micro-organisms center；

Hybridize the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions；

The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then pass through marker assistant breeding point Analysis is to determine that insect-resistant and/or herbicide tolerant and marker nucleic acid molecules are chain on science of heredity.

11. method existing for the DNA of test sample transgenic corn event DBN9968 according to claim 10, special Sign is that the marker nucleic acid molecules further include SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or it is mutual Complementary series.

12. a kind of DNA detection kit, which is characterized in that including at least one DNA molecular, the DNA molecular includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series, can be used as transgenic corn events DBN9968 or its offspring have one of DNA primer of specificity or probe；The DNA molecular is originated from transgenic corn events DBN9968, the transgenic corn events DBN9968 are preserved in the form of seed and with deposit number CGMCC No.10291 China Committee for Culture Collection of Microorganisms's common micro-organisms center.

13. DNA detection kit according to claim 12, which is characterized in that further include when the DNA molecular is as probe SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series.

14. a kind of protection corn plant is from the method for insect infestations, which is characterized in that including being provided in the diet of target insect At least one transgenic corn plant cell, the transgenic corn plant cell successively include SEQ ID in its genome NO:1,886-8025 nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:2 or the transgenic corn plant cell Genome in include SEQ ID NO:5；Ingest the transgenic corn plant cell target insect be suppressed further ingest The corn plant.

15. a kind of method for protecting corn plant from the damage as caused by herbicide, which is characterized in that including that will contain effectively Dosage glyphosate herbicidal is applied to the big Tanaka for planting at least one rotaring gene corn plant, and the rotaring gene corn plant exists Successively comprising SEQ ID NO:1,886-8025 nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:2 in its genome, or It include SEQ ID NO:5 in the genome of rotaring gene corn plant described in person；The rotaring gene corn plant has to glyphosate The tolerance of herbicide.

16. a kind of method for the big Tanaka weeds for controlling maize planting plant, which is characterized in that including effective dose grass will be contained Sweet phosphine herbicide is applied to the big Tanaka for planting at least one rotaring gene corn plant, and the rotaring gene corn plant is in its gene It successively include SEQ ID NO:1,886-8025 nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:2 or described in group It include SEQ ID NO:5 in the genome of rotaring gene corn plant；The rotaring gene corn plant has to glyphosate herbicidal Tolerance.

17. a kind of method for the corn plant that culture is resistant to insect characterized by comprising

An at least corn seed is planted, includes the nucleic acid sequence of specific region, the spy in the genome of the corn seed The nucleic acid sequence for determining region successively includes SEQ ID NO:1,886-8025 nucleic acid sequences of SEQ ID NO:5 and SEQ ID The nucleic acid sequence of NO:2 or the specific region includes SEQ ID NO:5；

The corn seed is set to grow up to plant；

The plant described in target insect infestations harvests compared with the plant of other nucleic acid sequences for not having the specific region The plant of plant injury with decrease.

18. a kind of method that culture has the corn plant of tolerance to glyphosate herbicidal characterized by comprising

An at least corn seed is planted, includes the nucleic acid sequence of specific region, the spy in the genome of the corn seed The nucleic acid sequence for determining region successively includes SEQ ID NO:1,886-8025 nucleic acid sequences of SEQ ID NO:5 and SEQ ID The nucleic acid sequence of NO:2 or the specific region includes SEQ ID NO:5；

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of the specific region with other The plant of sequence compares the plant with the plant injury weakened.

19. a kind of method for cultivating corn plant that is resistant to insect and being resistant to glyphosate herbicidal, which is characterized in that Include:

An at least corn seed is planted, includes the nucleic acid sequence of specific region, the spy in the genome of the corn seed The nucleic acid sequence for determining region successively includes SEQ ID NO:1,886-8025 nucleic acid sequences of SEQ ID NO:5 and SEQ ID The nucleic acid sequence of NO:2 or the specific region includes SEQ ID NO:5；

The corn seed is set to grow up to plant；

The plant is sprayed with effective dose glyphosate herbicidal, harvest does not have the nucleic acid of the specific region with other The plant of sequence compares the plant with the plant injury weakened, and the plant pair insect with the plant injury weakened is taken the photograph Food damage is also resistant.

20. a kind of method for generating the plant resistant to insect, which is characterized in that including will successively be wrapped in genome The plant of ID containing SEQ NO:1, SEQ ID NO:5 886-8025 nucleic acid sequences and SEQ ID NO:2, with another kind Plant hybridization, to generate a large amount of progeny plants；Selecting genome includes the progeny plant of the nucleic acid sequence of specific region, The nucleic acid sequence of the specific region successively include SEQ ID NO:1,886-8025 nucleic acid sequences of SEQ ID NO:5 and The nucleic acid sequence of SEQ ID NO:2 or the specific region includes SEQ ID NO:5, and the progeny plant is to insect It ingests with the plant injury weakened.

21. generating the method for the plant resistant to insect according to claim 20 characterized by comprising

By to resistant the first parental maize plant of transgenic corn events DBN9968 of insect with lack the of insect-resistant Two parental maize plant sexual hybridizations, to generate a large amount of progeny plants；

The progeny plant described in target insect infestations；

It selects to have compared with the plant of other nucleic acid sequences for not having the specific region described in the plant injury weakened Progeny plant；

The transgenic corn events DBN9968 is preserved in China in the form of seed and with deposit number CGMCC No.10291 Microbiological Culture Collection administration committee common micro-organisms center.

22. a kind of method for generating the plant that there is tolerance to glyphosate herbicidal, which is characterized in that including by gene Successively the corn comprising SEQ ID NO:1,886-8025 nucleic acid sequences of SEQ ID NO:5 and SEQ ID NO:2 is planted in group Strain, hybridizes with another plant, to generate a large amount of progeny plants；Selecting genome includes the nucleic acid sequence of specific region Progeny plant, the nucleic acid sequence of the specific region successively includes SEQ ID NO:1, SEQ ID NO:5 886-8025 The nucleic acid sequence of nucleic acid sequence and SEQ ID NO:2 or the specific region includes SEQ ID NO:5, and the filial generation is planted Strain has glyphosate tolerant.

23. the generation according to claim 22 has the method for the plant of tolerance, feature to glyphosate herbicidal It is, comprising:

By first parental maize plant of transgenic corn events DBN9968 to glyphosate herbicidal with tolerance and lack grass Second parental maize plant sexual hybridization of sweet phosphine tolerance, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate herbicidal；

The progeny plant of selection tolerance glyphosate；

The transgenic corn events DBN9968 is preserved in China in the form of seed and with deposit number CGMCC No.10291 Microbiological Culture Collection administration committee common micro-organisms center.

24. a kind of method for generating plant that is resistant to insect and being resistant to glyphosate herbicidal application, feature exist In, comprising:

By the first parental maize plant of transgenic corn events DBN9968 of glyphosate tolerance and insect-resistant and lack glyphosate Second parental maize plant sexual hybridization of tolerance and/or insect-resistant, to generate a large amount of progeny plants；

The progeny plant is handled with glyphosate；

The progeny plant of selection tolerance glyphosate, the progeny plant for being resistant to glyphosate also have the feeding damage of insect Resistance；

The transgenic corn events DBN9968 is preserved in China in the form of seed and with deposit number CGMCC No.10291 Microbiological Culture Collection administration committee common micro-organisms center.

25. a kind of composition for being produced from transgenic corn events DBN9968, which is characterized in that the composition be corn flour, Maize flour, corn oil, corn silk or cornstarch；The transgenic corn events DBN9968 is in the form of seed and to protect Hiding number CGMCC No.10291 is preserved in China Committee for Culture Collection of Microorganisms's common micro-organisms center.

26. a kind of agricultural product or commodity for being produced from transgenic corn events DBN9968, which is characterized in that the agricultural product or Commodity are corn flour, maize flour, corn oil, cornstarch, corn gluten, corn-dodger, cosmetics or filler；The transgenosis Corn event DBN9968 is preserved in Chinese microorganism strain preservation in the form of seed and with deposit number CGMCC No.10291 Administration committee's common micro-organisms center.