CN109868273A - For detecting the nucleic acid sequence and its detection method of corn plant DBN9501 - Google Patents
For detecting the nucleic acid sequence and its detection method of corn plant DBN9501 Download PDFInfo
- Publication number
- CN109868273A CN109868273A CN201910280088.XA CN201910280088A CN109868273A CN 109868273 A CN109868273 A CN 109868273A CN 201910280088 A CN201910280088 A CN 201910280088A CN 109868273 A CN109868273 A CN 109868273A
- Authority
- CN
- China
- Prior art keywords
- seq
- nucleic acid
- dna
- sequence
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H5/00—Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
- A01H5/10—Seeds
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01H—NEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
- A01H6/00—Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
- A01H6/46—Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
- A01N57/18—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-carbon bonds
- A01N57/20—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-carbon bonds containing acyclic or cycloaliphatic radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Environmental Sciences (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Developmental Biology & Embryology (AREA)
- Biophysics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Physiology (AREA)
- Analytical Chemistry (AREA)
- Plant Pathology (AREA)
- Agronomy & Crop Science (AREA)
- Pest Control & Pesticides (AREA)
- Dentistry (AREA)
- Mycology (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Cell Biology (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to a kind of for detecting the nucleic acid sequence and its detection method of corn plant DBN9501, and the nucleic acid sequence includes SEQ ID NO:1 or its complementary series or SEQ ID NO:2 or its complementary series.Corn plant DBN9501 of the present invention with preferable resistance and has preferable tolerance to glufosinate-ammonium herbicide to lepidopterous insects, on yield without influence, and detection method can quickly and accurately identify in biological sample whether include transgenic corn events DBN9501 DNA molecular.
Description
Technical field
The present invention relates to the transgenic crops in field of plant molecular biology, especially agricultural biotechnologies research
Breeding field.In particular it relates to the transgenic corn events of insect-resistant and glufosinate-ammonium herbicide tolerant
DBN9501 and for detect in biological sample whether include specific transgenic corn events DBN9501 nucleic acid sequence and its inspection
Survey method.
Background technique
Many areas are all main cereal crops to corn (Zea mays L.) in the world.Biotechnology has been applied
In corn to improve its economical character and quality.Insect-resistant is an important economical character in maize production, especially
To resistance of lepidopterous insects, such as corn borer, bollworm, black cutworm etc..Corn can lead to the resistance of lepidopterous insects
Crossing transgene method makes the resistant gene of lepidopterous insects express and obtain in corn plant.Another important agronomy
Character is herbicide tolerant, such as has successful corn transformation event NK603, GA21, the main growing area of the corns such as U.S.
It plants extensively in domain.It is noted that glufosinate-ammonium herbicide is different from the mechanism of action of glyphosate herbicidal, for life of going out
Property contact killing type herbicide, and can be used as a kind of means of effectively management glyphosate-resistant weeds.Corn is to glufosinate-ammonium weeding
The tolerance of agent can make glufosinate-ammonium herbicide-tolerant gene (such as pat) table in corn plant by transgene method
It reaches and obtains.
Known foreign gene is influenced in the intracorporal expression of plant by their chromosome location, it may be possible to due to dye
Chromatin structure (such as heterochromatin) or transcription regulatory element (such as enhancer) are close to integration site.Thus, it usually needs screening is big
The event of amount is possible to identify can be with commercialized event (event that the target gene imported obtains optimal expression).
For example, having been observed that the expression quantity of quiding gene may have very big difference between event in plant and other organisms;?
On the space of expression or time mode may there is also differences, such as the relative expression of transgenosis deposits between different plant tissues
In difference, this species diversity shows that actual expression pattern may be with the transcriptional regulatory member in the gene construct according to importing
Expression pattern desired by part is inconsistent.It is thus typically necessary to generate hundreds and thousands of different events and from these events
Filter out the single incident with transgene expression amount and expression pattern desired for the purpose of being commercialized.With expected
Transgene expression amount and the event of expression pattern can be used for seeping transgenosis by sexual cutcross using conventional breeding methods
Enter into other genetic backgrounds.The transgene expression for maintaining original transformant by the offspring that this Crossing system generates is special
Sign.It may insure that there is reliable gene expression in many kinds using this strategy pattern, and these kinds can be very well
The local growth conditions of adaptation.
It will be beneficial that the presence of particular event, which is able to detect, so that whether the offspring for determining sexual hybridization includes target gene
's.In addition, the method for detection particular event also will be helpful to abide by relevant laws and regulations, such as the food from recombination crops
It needs to obtain official approval before putting goods on the market and be marked.It is detected by any well known polynucleotides detection method
The presence of transgenosis be all it is possible, such as polymerase chain reaction (PCR) or using polynucleotide probes DNA hybridization.This
A little detection methods are usually focused on common genetic elements, such as promoter, terminator, marker gene etc..Therefore, unless with
The sequence of the transgenosis DNA of insertion adjacent chromosomal DNA (" flanking DNA ") be it is known, above-mentioned this method cannot
It is enough in and distinguishes different events, especially those events generated with identical DNA construct.So at present often using across
The pair of primers for having got over the transgenosis of insertion and the junction of flanking DNA identifies transgenosis particular event by PCR, has
The second primer said to body the first primer for being contained within insetion sequence and be contained in insetion sequence.
Summary of the invention
The object of the present invention is to provide a kind of for detecting the nucleic acid sequence and its detection method of corn plant DBN9501,
Transgenic corn events DBN9501 with preferable resistance and has preferable tolerance to glufosinate-ammonium herbicide to insect, and
Detection method can quickly and accurately identify in biological sample whether include transgenic corn events DBN9501 DNA molecular.
To achieve the above object, the present invention provides a kind of nucleic acid sequences, have SEQ ID NO:3 or its complementary series
In 1-384 at least 11 at least 11 continuous nucleotide and SEQ ID NO:3 or its complementary series 385-768
A continuous nucleotide;And/or at least 11 continuous nucleotide in SEQ ID NO:4 or its complementary series 1-564,
With at least 11 continuous nucleotide in SEQ ID NO:4 or its complementary series 565-1339.
Preferably, the nucleic acid sequence has 22-25 in SEQ ID NO:3 or its complementary series 1-384 a continuous
Nucleotide and SEQ ID NO:3 or its complementary series 385-768 in 22-25 continuous nucleotide;And/or SEQ
22-25 continuous nucleotide and SEQ ID NO:4 or its complementary series in ID NO:4 or its complementary series 1-564
22-25 continuous nucleotide in 565-1339.
Preferably, the nucleic acid sequence include SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its
Complementary series.
The SEQ ID NO:1 or its complementary series are 5 ' ends in transgenic corn events DBN9501 in insetion sequence
End is located at the sequence that a length near insertion junction is 22 nucleotide, the SEQ ID NO:1 or its complementary sequence
Column span the DNA sequence dna of the flanking genomic DNA sequence of corn insertion point and 5 ' ends of insetion sequence, comprising described
SEQ ID NO:1 or its complementary series can be accredited as the presence of transgenic corn events DBN9501.The SEQ ID NO:2
Or its complementary series is to be located near insertion junction in transgenic corn events DBN9501 in 3 ' ends of insetion sequence
A length be 22 nucleotide sequence, the SEQ ID NO:2 or its complementary series span 3 ' ends of insetion sequence
The DNA sequence at end and the flanking genomic DNA sequence of corn insertion point include the SEQ ID NO:2 or its complementary sequence
Column can be accredited as the presence of transgenic corn events DBN9501.
Preferably, the nucleic acid sequence include SEQ ID NO:3 or its complementary series, and/or SEQ ID NO:4 or its
Complementary series.
In the present invention, the nucleic acid sequence can be inserted into sequence for T-DNA in the SEQ ID NO:3 or its complementary series
Any portion of at least 11 or more continuous polynucleotides (the first nucleic acid sequence) of column, or be the SEQ ID
Any portion of at least 11 or more of 5 ' flank corn gene group DNA regions are continuous more in NO:3 or its complementary series
Nucleotide (second nucleotide sequence).The nucleic acid sequence may further be derived from or be complementary to comprising the complete SEQ to be same
A part of the SEQ ID NO:3 of ID NO:1.When the first nucleic acid sequence is used together with second nucleotide sequence, these
Nucleic acid sequence can be used as DNA primer in the DNA cloning method for generating amplified production.Expanded using DNA primer in DNA
The amplified production generated in increasing method is can to diagnose transgenic corn events when including the amplified production of SEQ ID NO:1
The presence of DBN9501 or its offspring.The SEQ ID NO:3 or its complementary series be in transgenic corn events DBN9501
5 ' ends of T-DNA insetion sequence are located at the sequence that a length near insertion junction is 768 nucleotide, described
SEQ ID NO:3 or its complementary series by 384 nucleotide 5 ' flanking sequence of the Maize genome (nucleosides of SEQ ID NO:3
Acid 1-384), DBN10707 construct DNA sequence dna (the nucleotide 385-552 of SEQ ID NO:3 of 168 nucleotide
Position) and 216 nucleotide tNos (rouge alkali synthetase) transcription terminator the DNA sequence dna (nucleotide of SEQ ID NO:3
553-768) composition, transgenic corn events can be accredited as comprising the SEQ ID NO:3 or its complementary series
The presence of DBN9501.
The nucleic acid sequence can be any portion of T-DNA insetion sequence in the SEQ ID NO:4 or its complementary series
At least 11 or more the continuous polynucleotides (third nucleic acid sequence) divided, or be the SEQ ID NO:4 or its complementation
Any portion of at least 11 or more continuous polynucleotides (the 4th cores in 3 ' flank corn gene group DNA regions in sequence
Acid sequence).The nucleic acid sequence may further be derived from or be complementary to the institute comprising the complete SEQ ID NO:2 to be same
State a part of SEQ ID NO:4.When third nucleic acid sequence is used together with the 4th nucleic acid sequence, these nucleic acid sequences can
As DNA primer in the DNA cloning method for generating amplified production.It is produced using DNA primer in DNA cloning method
Raw amplified production be when including the amplified production of SEQ ID NO:2 can diagnose transgenic corn events DBN9501 or its
The presence of offspring.The SEQ ID NO:4 or its complementary series are in transgenic corn events DBN9501 in insetion sequence
3 ' ends are located at the sequence that a length near T-DNA insertion junction is 1339 nucleotide, the SEQ ID NO:
4 or its complementary series by 271 nucleotide pr35S transcriptional initiation sequence (1-271, the nucleotide of SEQ ID NO:4),
The DBN10707 construct DNA sequence dna (272-564, the nucleotide of SEQ ID NO:4) of 293 nucleotide and 775 cores
3 ' the flanking sequence of Maize genome (565-1339, the nucleotide of SEQ ID NO:4) of thuja acid forms, and includes the SEQ
ID NO:4 or its complementary series can be accredited as the presence of transgenic corn events DBN9501.
Further, the nucleic acid sequence includes SEQ ID NO:5 or its complementary series.
The SEQ ID NO:5 or its complementary series are that the length of characterization transgenic corn events DBN9501 is 8559
The sequence of nucleotide, the genome and genetic elements for specifically including are as shown in table 1.Comprising the SEQ ID NO:5 or its mutually
Complementary series can be accredited as the presence of transgenic corn events DBN9501.
The genome and genetic elements that table 1, SEQ ID NO:5 include
Well known to those skilled in the art, the first, second, third and fourth nucleic acid sequence need not be only made of DNA,
May also comprise RNA, DNA and RNA mixture or DNA, RNA or other not as one or more polymerase templates core
The combination of thuja acid or its analog.In addition, heretofore described probe or primer should be at least about 11,12,13,14,
15, the length of 16,17,18,19,20,21 or 22 continuous nucleotides, can be selected from SEQ ID NO:1, SEQ ID NO:
2, nucleotide described in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5.When selected from SEQ ID NO:3, SEQ
When nucleotide shown in ID NO:4 and SEQ ID NO:5, the probe and primer can be at least about 21 for length and arrive
About 50 or more continuous nucleotides.
The nucleic acid sequence or its complementary series can be used for generate amplicon in DNA cloning method, and the amplicon is used
In the presence of detection biological sample transgenic corn event DBN9501 or its offspring;The nucleic acid sequence or its complementary series
It can be used in method of detection of nucleotides, to detect the presence of biological sample transgenic corn event DBN9501 or its offspring.
To achieve the above object, the present invention also provides a kind of test sample transgenic corn event DBN9501's
Method existing for DNA, comprising:
Contact sample to be tested in nucleic acid amplification reaction at least two primers for expanding target amplification product;
Carry out nucleic acid amplification reaction;With
Detect the presence of the target amplification product;
The target amplification product includes the nucleic acid sequence.
Preferably, the target amplification product include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its mutually
Complementary series, SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.
Specifically, the primer includes the first primer and the second primer, and the first primer is selected from SEQ ID NO:1, SEQ
ID NO:8 and SEQ ID NO:10;Second primer is selected from SEQ ID NO:2, SEQ ID NO:9 and SEQ ID NO:11.
To achieve the above object, the present invention also provides a kind of test sample transgenic corn event DBN9501's
Method existing for DNA, comprising:
Contact sample to be tested with probe, the probe includes the nucleic acid sequence;
Hybridize the sample to be tested and the probe under stringent hybridization conditions;With
Detect the hybridisation events of the sample to be tested and the probe.
The stringent condition can in 6 × SSC (sodium citrate), 0.5%SDS (lauryl sodium sulfate) solution,
Hybridize at 65 DEG C, is then respectively washed film 1 time with 2 × SSC, 0.1%SDS and 1 × SSC, 0.1%SDS.
Preferably, the probe include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary series,
SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.
Optionally, at least one fluorophor label of at least one described probe.
To achieve the above object, the present invention also provides a kind of test sample transgenic corn event DBN9501's
Method existing for DNA, comprising:
Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include the nucleic acid sequence;
Hybridize the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions;
The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then are assisted by marker
Breeding analysis is to determine that insect-resistant and/or herbicide tolerant and marker nucleic acid molecules are chain on science of heredity.
Preferably, the marker nucleic acid molecules include at least one selected from the following: SEQ ID NO:1 or its complementation
Sequence, SEQ ID NO:2 or its complementary series, and/or SEQ ID NO:6-11 or its complementary series.
To achieve the above object, the present invention also provides a kind of DNA detection kit, including at least one DNA molecular,
The DNA molecular includes the nucleic acid sequence, and can be used as has transgenic corn events DBN9501 or its offspring
One of DNA primer of specificity or probe.
Preferably, the DNA molecular includes SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary sequence
Column, SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.
To achieve the above object, the present invention also provides a kind of plant cells, include coding insect-resistant Vip3Aa albumen
Nucleic acid sequence, encode glufosinate-ammonium herbicide tolerant PAT albumen nucleic acid sequence and specific region nucleic acid sequence, it is described
The nucleic acid sequence of specific region includes SEQ ID NO:1, SEQ ID NO:2, shown in SEQ ID NO:6 and/or SEQ ID NO:7
Sequence.
Preferably, nucleic acid sequence of the plant cell comprising coding insect-resistant Vip3Aa albumen, coding glufosinate-ammonium are removed
The nucleic acid sequence of careless agent tolerance PAT albumen and the nucleic acid sequence of specific region, the nucleic acid sequence of the specific region include
Sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4.
Preferably, the plant cell successively includes 553-7491 SEQ ID NO:1, SEQ ID NO:5 nucleic acid sequences
Column and SEQ ID NO:2, or include sequence shown in SEQ ID NO:5.
To achieve the above object, the present invention also provides a kind of protection corn plants from the method for insect infestations, including
At least one transgenic corn plant cell is provided in the diet of target insect, the transgenic corn plant cell is in its base
Because including sequence shown in SEQ ID NO:1 and/or SEQ ID NO:2, the transgenic corn plant cell of ingesting in group
Target insect is suppressed the rotaring gene corn plant of further ingesting.
Preferably, the transgenic corn plant cell includes SEQ ID NO:3 and/or SEQ ID in its genome
Sequence shown in NO:4.
Preferably, the transgenic corn plant cell successively includes SEQ ID NO:1, SEQ ID in its genome
553-7491 nucleic acid sequences of NO:5 and SEQ ID NO:2, or include SEQ ID NO:5.
To achieve the above object, protect corn plant from the damage as caused by herbicide the present invention also provides a kind of
Or the method for the big Tanaka weeds of control maize planting plant, including effective dose glufosinate-ammonium herbicide will be contained and be applied to kind
The big Tanaka of at least one rotaring gene corn plant is planted, the rotaring gene corn plant includes SEQ ID in its genome
Sequence shown in NO:1 and/or SEQ ID NO:2, the rotaring gene corn plant have tolerance to glufosinate-ammonium herbicide.
Preferably, the rotaring gene corn plant includes SEQ ID NO:3 and/or SEQ ID NO:4 in its genome
Shown in sequence.
Preferably, the rotaring gene corn plant successively includes SEQ ID NO:1, SEQ ID NO:5 in its genome
553-7491 nucleic acid sequences and SEQ ID NO:2, or include sequence shown in SEQ ID NO:5.
To achieve the above object, the present invention also provides it is a kind of culture it is resistant to insect and/or tolerance glufosinate-ammonium remove
The method of the corn plant of careless agent, comprising:
An at least corn seed is planted, includes coding insect-resistant Vip3Aa egg in the genome of the corn seed
The nucleic acid sequence of white nucleic acid sequence and/or the nucleic acid sequence and specific region that encode glufosinate-ammonium herbicide tolerant PAT albumen
Include nucleic acid sequence shown in SEQ ID NO:5 in the genome of column or the corn seed;
The corn seed is set to grow up to plant;
The plant described in target insect infestations and/or the plant described in effective dose glufosinate-ammonium herbicide spray,
Harvest the plant compared with the plant of other nucleic acid sequences for not having specific region with the plant injury weakened;
The nucleic acid sequence of the specific region is sequence shown in SEQ ID NO:1 and/or SEQ ID NO:2;It is preferred that
Ground, the nucleic acid sequence of the specific region are sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4.
To achieve the above object, the present invention also provides it is a kind of generate it is resistant to insect and/or to glufosinate-ammonium weeding
The method that agent has the plant of tolerance, including the coding insect-resistant that will include in the first corn plant genome
The nucleic acid of the nucleic acid sequence of Vip3Aa albumen and/or the nucleic acid sequence of coding glufosinate tolerant PAT albumen and specific region
Sequence, or by nucleic acid sequence shown in the SEQ ID NO:5 for including in the first corn plant genome, introduce second
Corn plant, to generate a large amount of progeny plants;The progeny plant with the nucleic acid sequence of the specific region is selected,
And the progeny plant is resistant to insect and/or has tolerance to glufosinate-ammonium herbicide;The nucleic acid of the specific region
Sequence is sequence shown in SEQ ID NO:1 and/or SEQ ID NO:2;Preferably, the nucleic acid sequence of the specific region is
Sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4.
Preferably, the method includes transgenic corn events DBN9501 and lacking insect-resistant and/or glufosinate-ammonium
The plant of tolerance carries out sexual hybridization, to generate a large amount of progeny plants, selects the nucleic acid with the specific region
The progeny plant of sequence;The nucleic acid sequence of the specific region includes shown in SEQ ID NO:1 and/or SEQ ID NO:2
Sequence;Preferably, the nucleic acid sequence of the specific region includes sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4
Column.
To achieve the above object, the present invention also provides a kind of agricultural product for being produced from transgenic corn events DBN9501
Or commodity, the agricultural product or commodity be hominy grits, maize flour, corn oil, corn silk, cornstarch, corn gluten,
Corn-dodger, cosmetics or filler.
In nucleic acid sequence and its detection method of the present invention for detecting corn plant, defined below and method can be with
Preferably definition is of the invention and those skilled in the art is instructed to implement the present invention, unless otherwise mentioned, according to this field
The conventional usage of those of ordinary skill understands term.
" corn " refers to maize (Zea mays), and all plant varieties including that can mate with corn,
Including field corn kind.
The "comprising", " including " or " containing " refer to " including but not limited to ".
Term " plant " includes that whole plant, plant cell, plant organ, plant protoplast, plant can therefrom again
It is complete in raw plant cell tissue cultures, plant callus, vegetation bed (plant clumps) and plant or plant part
Whole plant cell, the plant part such as embryo, pollen, ovule, seed, leaf, flower, branch, fruit, stalk, root, the tip of a root, flower
Medicine etc..The part for the genetically modified plants being interpreted as in the scope of the invention includes but is not limited to plant cell, protoplast, group
It knits, callus, embryo and flower, stem, fruit, Ye Hegen, the above plant part are originated from advance with DNA molecular of the invention turn
Genetically modified plants that are changing and being therefore at least partly made of transgenic cell or its filial generation.
Term " gene " refers to the nucleic acid fragment of expression specific protein, including adjusting sequence (5 ' the non-volumes before coded sequence
Code sequence) and coded sequence after adjusting sequence (3 ' non-coding sequence)." natural gene ", which refers to, is naturally found to have its own
Adjust the gene of sequence." mosaic gene " refer to be not natural gene any gene, it includes non-natural discovery adjusting and
Coded sequence." endogenous gene " refers to natural gene, and the natural gene is located in organism genome its natural place.
" foreign gene " is the alien gene being not present in the existing genome for being biology and originally, also refers to and leads through Transgenic procedures
Enter the gene of recipient cell.Foreign gene may include the natural gene or mosaic gene of insertion non-native organism." turn base
Cause " is the gene that genome is had been incorporated by Transformation Program.The site that recombinant DNA has been inserted into Plant Genome can
To be known as " insertion point " or " target site ".
" flanking DNA " may include the genome being naturally present in the organism of such as plant or pass through conversion process
External source (heterologous) DNA of introducing, such as segment relevant to transformation event.Therefore, flanking DNA may include natural and external source
The combination of DNA.In the present invention, " flanking DNA " be also known as " flanking region " or " flanking sequence " or " flanking genomic sequence " or
" flanking genomic dna ", refer at least 3,5,10,11,15,20,50,100,200,300,400,1000,1500,2000,
2500 or 5000 base-pairs or longer sequence, be located at initial external source insertion DNA molecular immediately upstream or downstream and with
Initial external source insertion DNA molecular is adjacent.When the flanking region is located at downstream, it is referred to as " 3 ' flank " or " right margin side
Wing " etc..When the flanking region is located at upstream, it is referred to as " 5 ' flank " or " left margin flank " etc..
The Transformation Program of the random integration of exogenous DNA is caused to will lead to the transformant containing different flanking regions, the difference
Flanking region is that each transformant institute specificity contains.When recombinant DNA is introduced into plant by conventional hybridization, flanking region
It does not usually change.Transformant also can containing between heterologous insertion DNA and the section of genomic DNA or two sections of genomic DNAs it
Between or two sections of allogeneic dna sequence DNAs between unique engagement." engagement " is the point of two specific DNA fragmentation connections.For example, engagement
It is present in the position of insert DNA connection flanking DNA.Junction is also present in the organism of conversion, two of them DNA piece
Section linking together in a manner of modifying and be found from native organism." engaging zones " or " junction sequence ", which refer to, includes
The DNA at junction.
The present invention provides the referred to as transgenic corn events of DBN9501 and its offspring, the transgenic corn events
DBN9501 is also known as corn plant DBN9501 comprising the Plants and Seeds of transgenic corn events DBN9501 and its plant
Cell or its renewable part, the plant part of the transgenic corn events DBN9501, including but not limited to cell, flower
Powder, ovule, flower, bud, root, stem, silk, inflorescence, ear fringe, leaf and the product from corn plant DBN9501, such as Corn Crude
Powder, maize flour, corn oil, corn pulp, corn silk, cornstarch and the biomass for staying in corn crop field.
Transgenic corn events DBN9501 of the present invention contains a DNA construct, when it is expressed in plant cell
When, the transgenic corn events DBN9501 obtains the resistance to insect and the tolerance to glufosinate-ammonium herbicide.The DNA
Construct includes two concatenated expression cassettes, first expression cassette include suitable promoter for being expressed in plant and
Suitable polyadenylation signal sequence, the promoter are operably connected the nucleic acid sequence of Vip3Aa19 albumen, described
The nucleic acid sequence of Vip3Aa19 albumen is mainly resistant to lepidopterous insects.Second expression cassette includes in plant
The suitable promoter of expression and suitable polyadenylation signal sequence, the promoter, which is operably connected, encodes phosphine
The gene of silk rhzomorph N- acetyltransferase (phosphinothricin N-acetyltransferase, PAT), the PAT
The nucleic acid sequence of albumen has tolerance to glufosinate-ammonium herbicide.Further, the promoter can be to separate from plant
Suitable promoter, including composing type, induction type and/or tissue-specific promoter, the suitable promoter includes but unlimited
In cauliflower mosaic virus (CaMV) 35S promoter, figwort mosaic virus (FMV) 35S promoter, ubiquitin protein
(Ubiquitin) promoter, actin (Actin) promoter, soil Agrobacterium (Agrobacterium
Tumefaciens) rouge alkali synthetase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum
(Cestrum) yellow leaf curl virus promoter, patatin (Patatin) promoter, ribulose-1,5-bisphosphate, 5- bis-
Phosphoric acid Carboxylase/oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS are opened
Mover, alcA/alcR promoter, Agrobacterium rhizogenes (Agrobacterium rhizogenes) RolD promoter and arabidopsis
Belong to (Arabidopsis thaliana) Suc2 promoter.The polyadenylation signal sequence can be to act as in plant
Suitable polyadenylation signal sequence, the suitable polyadenylation signal sequence includes but is not limited to source
Believe in the Polyadenylation of soil Agrobacterium (Agrobacterium tumefaciens) rouge alkali synthetase (NOS) gene
Number sequence, from cauliflower mosaic virus (CaMV) 35S terminator, from protease-inhibitor Ⅱ (PIN II) gene
Polyadenylation signal sequence and the polyadenylation signal sequence for deriving from alpha-tubulin (α-tubulin) gene.
In addition, the expression cassette can also include other genetic elements, the genetic elements include but is not limited to increase
Hadron and signal peptide/transit peptides.The enhancer can include but is not limited to the expression of enchancer, the enhancer,
Tobacco etch virus (TEV) translates activity factor, CaMV35S enhancer and FMV35S enhancer.Signal peptide/the transit peptides
Vip3Aa19 albumen and/or PAT Protein transport can be guided to extracellular or intracellular specific organelle or compartment, example
Such as, chloroplaset is targeted using encoding chloroplast transit peptide sequence, or utilizes ' KDEL ' to retain sequence and targets endoplasmic reticulum.
The Vip3Aa19 gene can be from thuringiensis (Bacillus thuringiensis, abbreviation
Bt isolated in), and the nucleotides sequence of Vip3Aa19 gene can be changed by optimization codon or in other ways
Column, to achieve the purpose that increase the stability and utilizability of transcript in transformed cells.
" Lepidoptera (Lepidoptera) ", including moth, two class insect of butterfly are a most mesh of agriculture and forestry injurious insect,
Such as black cutworm, bollworm, prodenia litura, 2 committee noctuid insect, dichocrocis punctiferalis.
Phosphinothricin N-acetyl transferase (PAT) gene can be from streptomycete (Streptomyces
Viridochromogenes) the enzyme of strain isolation is catalyzed L-phosphinothricin by acetylation and is converted into its inactive form, with
Plant is assigned to the tolerance of glufosinate-ammonium herbicide.Phosphinothricin (PTC, 2- amino -4- methylphosphine-butyric acid) is paddy
The inhibitor of glutamine synzyme.PTC is antibiotic 2- amino -4- methylphosphine acyl-alanyl-alanine structural units, this three
Peptide (PTT) has resisting gram-positive and gramnegative bacterium and antimycotic Botrytis cinerea (Botrytis cinerea)
Activity.Phosphinothricin N-acetyl transferase (PAT) gene can also be used as selected marker.
" glufosinate-ammonium " also known as glufosinate refer to 2- amino -4- [hydroxyl (methyl) phosphono] butyric acid ammonium, with " careless ammonium
Phosphine herbicide " processing, which refers to, to be handled using any one containing the herbicide formulations of glufosinate-ammonium.In order to reach effective biology
Learn dosage and to certain glufosinate-ammonium preparation utilization rate selection be no more than common agronomic technique personnel technical ability.Use any one
Herbicide formulations processing of the kind containing glufosinate-ammonium contains the field of the vegetable material from transgenic corn events DBN9501
Ground will control the weed growth in the field, and not influence the plant material from transgenic corn events DBN9501
The growth or yield of material.
The DNA construct is introduced in plant using method for transformation, and the method for transformation includes but is not limited to agriculture
Bacillus (Agrobacterium) mediated transformation method, Gene Knock-out Mice and pollen tube channel conversion method.
The Agrobacterium_mediated method is the common method of Plant Transformation.The exogenous DNA gram that will be introduced into plant
Between the grand left and right boundary consensus sequence to carrier, i.e. the area T-DNA.The carrier is transformed into agrobatcerium cell, with
Afterwards, the agrobatcerium cell is organized for infection plant, and the area T-DNA of the carrier comprising exogenous DNA is inserted into plant
In genome.
The Gene Knock-out Mice is with carrier bombardment plant cell (the biological bullet that particle mediates comprising exogenous DNA
Hit conversion).
The pollen tube channel conversion method be formed by after being pollinated using plant natural pollen tube channel (also known as flower
Tube cell guides tissue), through megarchidium channel, exogenous DNA is carried into blastular.
After conversion, it is necessary to have from the plant tissue regenerating plants of conversion, and using suitable label selection
The offspring of exogenous DNA.
DNA construct is the combination that DNA molecular is interconnected, and this combination provides one or more expression cassettes.
DNA construct preferably can the self-replacation in bacterial cell, and contain different restriction endonuclease sites matter
Grain, contained restriction endonuclease sites provide functioning gene element, i.e. promoter, introne, leading sequence for importing
Column, coded sequence, 3 ' terminator regions and other sequences DNA molecule.Expression cassette contained in DNA construct includes mentioning
Genetic elements necessary to transcription for mRNA, the expression cassette can be designed as the table in prokaryotic cell or eukaryocyte
It reaches.Expression cassette of the invention is designed to most preferably express in plant cell.
Transgenosis " event " is as obtained from converting plant cell with heterologous DNA construct, that is, includes at least one
Expression of nucleic acid box containing target gene is inserted into Plant Genome to generate plant population by transgene method, then
The raw plant population, and selection have the specific plant of insertion specific gene group site feature.Term " event " refer to containing
The original transformant of allogeneic dna sequence DNA and the offspring of the transformant.Term " event " also refers to original transformant and containing allogeneic dna sequence DNA
Offspring obtained from sexual hybridization is carried out between other kind individuals, even if coming from after be returned repeatedly with backcross parent
The same chromosome location in filial generation is existed in the insertion DNA and flanking genomic dna of original transformant parent.
Term " event " also refers to the DNA sequence dna from original transformant, the DNA sequence dna include insertion DNA and with insertion the close phase of DNA
Adjacent flanking genomic sequence, which, which is expected, is transferred in filial generation, and the filial generation is by the parental department containing insertion DNA
(such as filial generation of original transformant and its selfing generation) carries out sexual hybridization with the parental department without containing insertion DNA and generates,
And the filial generation receives the insertion DNA comprising target gene.
" recombination ", which refers to, in the present invention generally can not find in nature and therefore by manual intervention generation
The form of DNA and/or albumen and/or organism.This manual intervention can produce recombinant DNA molecule and/or recombinant plant.Institute
To state " recombinant DNA molecules ", which be by two kinds of artificial combination, is in other cases that isolated sequence section obtains, such as logical
It crosses chemical synthesis or operates isolated nucleic acid segment by genetic engineering technology.It is well-known for carrying out the technology of nucleic-acid manipulation
's.
Term " transgenosis " includes any cell, cell line, callus, tissue, plant part or plant, above
Genotype due to heterologous nucleic acids presence and change, " transgenosis " include the Transgenics initially changed in this way and
The offspring individual generated by initial Transgenics by sexual hybridization or vegetative propagation.In the present invention, term " transgenosis "
It does not include being changed by (chromosome or extrachromosomal) of conventional plant breeding method or the natural genome that event occurs
Become, for example random allogamy of the natural generation event, non-recombinant virus infection, non-recombinant Bacterial Transformation, non-recombinant swivel base
Or spontaneous mutation.
" heterologous " refers to that the first molecule is not found usually and the second molecular combinations in nature in the present invention.For example,
Molecule can be originated from the first species and be inserted into the genome of the second species.Therefore this molecule is heterologous for host
And it is artificially introduced in the genome of host cell.
Cultivate transgenic corn events resistant to lepidopterous insects and that there is tolerance to glufosinate-ammonium herbicide
DBN9501 passes through following steps: making the first parental corn plants and the second parental corn plants sexual hybridization first, to produce
Given birth to the first generation progeny plant of multiplicity, first parental corn plants by cultivation transgenic corn event DBN9501 and
The corn plant of its offspring forms, and transgenic corn events DBN9501 and its offspring are of the invention to squama wing by utilizing
Mesh insect it is resistant and to glufosinate-ammonium herbicide have tolerance expression cassette convert obtained from, the second parent is beautiful
Rice plant lacks to the resistance of lepidopterous insects and/or has tolerance to glufosinate-ammonium herbicide;Then it selects to Lepidoptera elder brother
The invasion of worm are resistant and/or have the progeny plant of tolerance to glufosinate-ammonium herbicide, can cultivate to Lepidoptera
Insect is resistant and has the corn plant of tolerance to glufosinate-ammonium herbicide.These steps, which may further include, makes squama
The progeny plant and the second parental corn plants or third parental corn plants of homopterous insect resistance and/or glufosinate tolerant
It is returned, then by applying or passing through molecular labeling relevant to character with lepidopteran insect infestation, glufosinate-ammonium herbicide
Object (DNA points of the bond site that 5 ' ends and 3 ' ends such as comprising insetion sequence in transgenic corn events DBN9501 identify
Son) identification select filial generation, to generate resistant to lepidopterous insects and there is tolerance to glufosinate-ammonium herbicide
Corn plant.
It will also be appreciated that two different genetically modified plants can also mate to generate containing there are two independent, separation
The offspring of the foreign gene of formula addition.It is all pure for the available foreign gene added to two of the selfing of appropriate offspring
The Progeny plants of zygote.As previously described to the backcrossing of parental plant and be also with the cutcross of non-transgenic plant can be with
It is contemplated that vegetative propagation is also same.
Term " probe " is the nucleic acid molecules of one section of separation, is combined with conventional detectable label or report point above
Son, for example, radioactive isotope, ligand, chemiluminescent agent or enzyme.This probe is complementary with a chain of target nucleic acid
, in the present invention, probe is complementary with a DNA chain from transgenic corn events DBN9501 genome, no matter the base
Because group DNA is the plant for being also derived from transgenic corn events DBN9501 from transgenic corn events DBN9501 or seed
Object or seed or extract.Probe of the invention not only includes DNA or ribonucleic acid, further include specifically with
Target dna sequence combines and can be used for detecting the existing polyamide and other probe materials of the target dna sequence.
Term " primer " is the nucleic acid molecules of one section of separation, is hybridized by nucleic acid, annealed combination to complementary target
In DNA chain, heterozygote is formed between primer and target dna chain, then under the action of polymerase (such as DNA polymerase),
Along target dna chain extension.Primer pair of the invention is related to its application in target nucleic acid sequence amplification, for example, passing through polymerization
Enzyme chain reaction (PCR) or other conventional nucleic acid amplification methods.
The length of probe and primer is usually 11 polynucleotides or more, preferably 18 polynucleotides or more,
More preferably 24 polynucleotides or more, most preferably 30 polynucleotides or more.This probe and primer are in height
Specifically hybridize under degree stringent hybridization condition with target sequence.Although being different from target dna sequence and to target dna sequence
Keep hybridization ability probe can design by conventional method, however, it is preferred to, the present invention in probe and
The continuous nucleic acid of primer and target sequence has complete DNA sequence dna identity.
It can be determined by conventional method based on the primer and probe of flanking genomic dna and insetion sequence of the invention,
For example, by separating corresponding DNA molecular from from the vegetable material of transgenic corn events DBN9501, and determining should
The nucleic acid sequence of DNA molecular.The DNA molecular includes transgene insert sequence and Maize genome flanking sequence, the DNA
The segment of molecule may be used as primer or probe.
Nucleic acid probe and primer of the invention hybridizes with target dna sequence under strict conditions.Any conventional nucleic acid is miscellaneous
It hands over or amplification method may be used to identify in sample from the presence of the DNA of transgenic corn events DBN9501.Nucleic acid
Molecule or its segment can carry out specific hybrid with other nucleic acid molecules in any case.As the present invention uses, if
Two nucleic acid molecules can form antiparallel double-strandednucleic acid structure, so that it may say that the two nucleic acid molecules are able to carry out to each other
Specific hybrid.If two nucleic acid molecules show complete complementarity, claiming one of nucleic acid molecules is another core
" complement " of acid molecule.As the present invention uses, when each nucleotide and another nucleic acid point of a nucleic acid molecules
The correspondence nucleotide mutual added time of son, then the two nucleic acid molecules is claimed to show " complete complementarity ".If two nucleic acid molecules
It can be with enough stability phase mutual crosses to make them anneal under the conditions of at least conventional " low stringent " and tie each other
It closes, then the two nucleic acid molecules are referred to as " minimum level is complementary ".Similarly, if two nucleic acid molecules can be with enough steady
Qualitative phase mutual cross then claims the two nucleic acid to make them anneal and be bonded to each other under the conditions of conventional " height is stringent "
Molecule has " complementarity ".Deviateing from complete complementarity can permit, as long as this deviation not exclusively prevents two points
Son forms duplex structure.In order to enable a nucleic acid molecules as primer or probe, it is only necessary to guarantee that it has in sequence and fill
The complementarity divided, so that stable duplex structure can be formed under used specific solvent and salinity.
As the present invention uses, substantially homologous sequence is one section of nucleic acid molecules, and the nucleic acid molecules are in high stringency
Specific hybrid can occur with the complementary strand of another section of nucleic acid molecules to match down.Promote the suitable stringent of DNA hybridization
Condition is then used under the conditions of 50 DEG C for example, about being handled under the conditions of 45 DEG C with 6.0 × sodium chloride/sodium citrate (SSC)
2.0 × SSC washing, these conditions are well known to those skilled in the art.For example, salinity in washing step can be with
About 2.0 × SSC, 50 DEG C to high stringency of about 0.2 × SSC, 50 DEG C selected from Low stringency conditions.In addition, purge step
Temperature condition in rapid can be increased to about 65 DEG C of high stringency from about 22 DEG C of room temperature of Low stringency conditions.Temperature
Condition and salinity can all change, can also one of them remain unchanged and another variable changes.It is preferred that
Ground, a nucleic acid molecules of the invention can under moderate stringency, such as at about 2.0 × SSC and about 65 DEG C with SEQ
ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6 and SEQ ID
Specific hybrid occurs for any segment of one or more nucleic acid molecules or its complementary series or above-mentioned sequence in NO:7.More
Preferably, a nucleic acid molecules of the invention under high stringency with SEQ ID NO:1, SEQ ID NO:2, SEQ ID
NO:3, SEQ ID NO:4, SEQ ID NO:5, in SEQ ID NO:6 and SEQ ID NO:7 one or more nucleic acid molecules or
Specific hybrid occurs for any segment of its complementary series or above-mentioned sequence.In the present invention, preferred marker nucleic acid point
Son has SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned
Any segment of sequence.Another preferred marker nucleic acid molecules of the present invention and SEQ ID NO:1, SEQ ID NO:2, SEQ ID
Any segment of NO:6 or SEQ ID NO:7 or its complementary series or above-mentioned sequence has 80% to 100% or 90% to arrive
100% sequence identity.SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 may be used as planting
Marker in object breeding method is to identify the offspring of genetic cross.Probe can be by any with hybridizing for target dna molecule
A kind of method being well known to those skilled in the art is detected, these methods include but is not limited to fluorescent marker, radiation
Property label, antibody class label and chemiluminescent labeling.
About the amplification (for example, passing through PCR) for using specific amplimer to carry out target nucleic acid sequence, " stringent item
Part " refers to the condition for only allowing primer pair target nucleic acid sequence to hybridize in the hot amplified reaction of DNA, has and target
The primer of the corresponding wild-type sequence of nucleic acid sequence (or its complementary series), can in conjunction with the target nucleic acid sequence, and
It is preferred that unique amplified production is generated, amplified production, that is, amplicon.
Term " specific binding (target sequence) " refers to probe under stringent hybridization conditions or primer only and comprising target
Target sequence in the sample of sequence hybridizes.
As the present invention uses, " amplicon " refers to that the nucleic acid of the target nucleic acid sequence as nucleic acid-templated a part expands
Increase production object.For example, in order to determine whether corn plant is sexual miscellaneous by passing through containing transgenic corn events DBN9501 of the present invention
Friendship mode generates, or acquisition from the corn sample in field whether include transgenic corn events DBN9501 or corn extract,
Such as whether coarse powder, face or oil include transgenic corn events DBN9501, are extracted from corn plant tissue sample or extract
DNA the DNA for transgenic corn events DBN9501 can be generated by using the nucleic acid amplification method of primer pair
In the presence of being diagnostic amplicon.The primer pair includes one and is inserted into Plant Genome with the exogenous DNA of insertion
The first primer of the adjacent flanking sequence in site, and the second primer of the exogenous DNA from insertion.Amplicon has certain
Length and sequence, the sequence are also diagnostic to the transgenic corn events DBN9501.The length range of amplicon
The combination length of primer pair be can be plus a nucleotide base pair, preferably add about 50 nucleotide bases pair, more preferably
In addition about 250 nucleotide bases pair, most preferably plus about 450 nucleotide bases to or more.
Optionally, primer pair can include entire insert to generate from the flanking genomic sequence of the insertion two sides DNA
Enter the amplicon of nucleotide sequence.One in the primer pair of plant genome sequences can be located at away from insertion DNA sequence
At a certain distance from column, which may range from a nucleotide base to about 20,000 nucleotide bases pair.Term
The use of " amplicon " has been particularly intended to exclude the primer dimer formed in the hot amplified reaction of DNA.
Nucleic acid amplification reaction can be realized by any nucleic acid amplification reaction method known in the art, including be gathered
Polymerase chain reacts (PCR).Various nucleic acid amplification methods have been well-known to those skilled in the art.PCR amplification method is
Develop to the phage DNA of the amplifiable up to genomic DNA of 22kb and up to 42kb.Its of these methods and this field
He can be used for the present invention at DNA cloning method.The exogenous DNA array of insertion and side from transgenic corn events DBN9501
Wing DNA sequence dna can be by being expanded using genome of the provided primer sequence to transgenic corn events DBN9501
Increase, carries out the DNA sequencing of standard after amplification to the DNA of PCR amplification or clone.
DNA detection kit based on DNA cloning method contains the DNA molecular as primer, they are in reaction appropriate
Under the conditions of on specific hybrid to target dna and expand diagnostic amplicon.Kit can provide the inspection based on Ago-Gel
Many methods of survey method or checkout and diagnosis amplicon known in the art.Containing with SEQ ID NO:3 or SEQ ID
Any part of the Maize genome of NO:4 is homologous or complementary and any with the transgenosis insert district of SEQ ID NO:5
The kit of homeologous or the DNA primer of complementation is provided by the present invention.Particularly identifying has in DNA cloning method
Primer pair is SEQ ID NO:8 and SEQ ID NO:9,5 ' transgenosis of amplification and transgenic corn events DBN9501
A part of homologous diagnostic amplicon of/genomic region, wherein amplicon includes SEQ ID NO:1.As DNA primer
Other DNA moleculars can be selected from SEQ ID NO:5.
Amplicon caused by these methods can be detected by multiple technologies.One of method is hereditary point
It analyzes (Genetic Bit Analysis), this method devises one across insertion DNA sequence dna and adjacent flanking genomes
The DNA oligonucleotide chain of DNA sequence dna.The oligonucleotide chain is fixed in the micropore of a microwell plate, to target area into
(primer is respectively used in insetion sequence and in adjacent flanking genomic sequence) after row PCR amplification, single stranded PCR products
It can be hybridized with fixed oligonucleotide chain, and the template as single base extension, which uses
Archaeal dna polymerase and ddNTPs for next expected base specific markers.It can be obtained by fluorescence or ELISA class method
As a result.Signal represents the presence of insertion/flanking sequence, illustrates that amplification, hybridization and single base extension are successful.
Another method is pyrosequencing techniques (Pyrosequencing).This method devises one across insertion
The oligonucleotide chain of DNA sequence dna and adjacent genomic DNA binding site.By the single-stranded of the oligonucleotide chain and target area
PCR product (in insetion sequence and adjacent flanking genomic sequence in respectively use a primer) hybridized, then and
Archaeal dna polymerase, ATP, sulfonyl enzyme, luciferase, apyrase, adenosine -5 '-phosphorus sulfate and luciferin
It is incubated together.It is separately added into dNTPs, measures the optical signal of generation.Optical signal represents the presence of insertion/flanking sequence,
It illustrates amplification, hybridization and single base or polybase base extension is successful.
Chen etc. (genome research (Genome Res.) 9:492-498,1999) description Fluorescence polarization be also
It can be used for detecting a kind of method of amplicon of the present invention.Need to design in this way one across insertion DNA sequence dna and
The oligonucleotide chain of adjacent genomic DNA binding site.By the single stranded PCR products of the oligonucleotide chain and target area (
A primer is respectively used in insetion sequence and in adjacent flanking genomic sequence) hybridized, then with archaeal dna polymerase with
And a kind of ddNTP of fluorescent marker is incubated together.Single base extension will lead to insertion ddNTP.This insertion can use
Luminoscope measures the change of its polarization.The change of polarization represents the presence of insertion/flanking sequence, illustrate amplification, hybridization and
Single base extension is successful.
Taqman is described as a kind of detect and is mentioned with method existing for quantitative analysis DNA sequence dna, this method in manufacturer
It is discussed in detail in the operation instruction of confession.It is now briefly described as follows, designs one across insertion DNA sequence and adjacent gene
The FRET oligonucleotide probe of group flank binding site.The FRET probe and PCR primer are (in insetion sequence and adjacent side
A primer is respectively used in wing genome sequence) circular response is carried out in the presence of heat-stabilised poly synthase and dNTPs.FRET is visited
The hybridization of needle leads to the division of fluorescence part and quencher moieties and the release of fluorescence part on FRET probe.Fluorescence signal
Generation represents the presence of insertion/flanking sequence, illustrates amplification and hybridization is successful.
Based on Hybridization principle, for detecting the suitable technology for deriving from the vegetable material of transgenic corn events DBN9501
It can also include Southern blot hybridization (Southern blot), Northern blot hybridization (Northern blot) and original
Position hybridization (in situ hybridization).Particularly, the suitable technology includes incubating probe and sample, is washed to move
Except whether unbonded probe and detection probe have hybridized.The detection method depends on the appended type marked of probe,
For example, can detecte radiolabeled probe by X-ray exposure and imaging, or is converted by substrate and realize color change
It can detecte the probe of enzyme label.
Tyangi etc. (Nature Biotechnol (Nature Biotech.) 14:303-308,1996) describes molecular labeling
Application in Sequence Detection.It is briefly described as follows, designs one across insertion DNA sequence dna and adjacent flanking genomic knot
Close the FRET oligonucleotide probe at position.The unique texture of the FRET probe causes it to contain secondary structure, the secondary structure energy
It is enough that fluorescence part and quencher moieties are kept in short distance.The FRET probe and PCR primer are (in insetion sequence and adjacent
A primer is respectively used in flanking genomic sequence) circular response is carried out in the presence of heat-stabilised poly synthase and dNTPs.By
The hybridization of successful PCR amplification, FRET probe and target sequence leads to the forfeiture of probe secondary structure, to make fluorescence part
It is spatially separated with quencher moieties, generates fluorescence signal.The generation of fluorescence signal represents insertion/flanking sequence
In the presence of, illustrate amplification and hybridization be successful.
The method of other descriptions, such as microfluid (microfluidics) provide the side of separation and DNA amplification sample
Method and equipment.Photoinitiator dye is for detecting and measuring specific DNA molecular.Comprising for detecting DNA molecule electronic sensor or
In conjunction with specific DNA molecular receive pearl and thus can be detected receive test tube (nanotube) equipment for detecting DNA of the invention
Molecule is useful.
Method that composition and DNA detection field of the present invention describes or known can be used to develop DNA inspection
Test agent box.The kit is conducive to identify the DNA that whether there is transgenic corn events DBN9501 in sample, can be with
For cultivating the corn plant of the DNA containing transgenic corn events DBN9501.The kit can containing DNA primer or
Probe at least part for being derived from or being complementary to SEQ ID NO:1,2,3,4 or 5, or contains other DNA primers or spy
Needle, with being derived from or being complementary to DNA contained in the genetically modified element of DNA, these DNA sequence dnas can be used for DNA expansion
Increase reaction, or as the probe in DNA hybridization method.It is containing in the corn genome and illustrate in Fig. 1 and table 1
The DNA structure of transgene insert sequence and Maize genome binding site includes: being located at the jade of 5 ' end of transgene insert sequence
Rice plant DBN9501 flanking genomes region, a part of insetion sequence of the left boundary area (LB) from Agrobacterium, the
For one expression cassette by containing 1 promoter of Maize Ubiquitin gene (prZmUbi1), the glufosinate-ammonium for being operably connected to streptomycete is resistance to
By on the phosphinothricin N-acetyl transferase (cPAT) of property, and it is operably connected to the transcription terminator of nopaline synthase
(tNos) it is formed on, second expression cassette is opened by the cauliflower mosaic virus 35S of the tandem sequence repeats containing enhancer region
Mover (pr35S) is operably connected on maize Heat Shock 70kDa albumen introne (iZmHSP70), is operably connected
Onto the Vip3Aa19 albumen (cVip3Aa19) of the insect-resistant of bacillus thuringiensis, and it is operably connected to nopaline
It is formed, a part of insetion sequence in the right side boundary region (RB) from Agrobacterium on the transcription terminator (tNos) of synthase,
And it is located at the corn plant DBN9501 flanking genomes region (SEQ ID NO:5) of 3 ' end of transgene insert sequence.?
In DNA cloning method, the DNA molecular as primer can be to be inserted into from transgenic corn events DBN9501 transgenic
Any part of sequence is also possible to the Maize genome flanking DNA sequence from transgenic corn events DBN9501
Any part.
Transgenic corn events DBN9501 can be combined with other transgenic maize varieties, such as herbicide is (as grass is sweet
Phosphine, dicamba etc.) tolerance transgenic maize varieties, or carry the transgenic maize varieties of other anti insect genes.It is all this
The various combinations of a little difference transgenic events, the breeding together with transgenic corn events DBN9501 of the invention can provide
Resist a variety of insect pests and resists the improvement hybrid transgenic corn variety of a variety of herbicides.These kinds are compared to non-transgenic kind
The superior features such as yield promotion can be showed with the transformed variety of unisexuality shape.
Transgenic corn events DBN9501 of the present invention is resistant to the feeding damage of lepidoptera pest, and is resistant to
The phytotoxic effects of the agriculture herbicide of Glufosinate-ammoniumpesticideng.The plant expression bacillus thuringiensis of the dual character
Vip3Aa19 albumen provides the resistance to lepidoptera pest (such as black cutworm) feeding damage, and expresses the grass of streptomycete
Phosphinothricin N-acetyl transferase (PAT) albumen of ammonium phosphine resistance assigns plant to the tolerance of glufosinate-ammonium.Duality
1) shape corn has the advantages that from the economic loss as caused by lepidoptera pest (such as black cutworm, bollworm etc.),
Black cutworm, bollworm etc. are the primary pests of corn-growing regions;2) apply the agriculture herbicide of Glufosinate-ammoniumpesticideng to corn crop
Ability for broad-spectrum weeding control;3) corn yield does not reduce.In addition, coding insect-resistant and glufosinate tolerant
The transgenosis of shape interlocks in same DNA section, and is present in the single base of transgenic corn events DBN9501 genome
Because on seat, this point provides the breeding efficiency of enhancing and makes it possible to track reproductive population and its filial generation with molecular labeling
In transgenic insert.Simultaneously SEQ ID NO:1 or its complementary series in detection method, SEQ ID NO:2 or
Its complementary series, SEQ ID NO:6 or its complementary series or SEQ ID NO:7 or its complementary series can be used as DNA and draw
Object or probe to generate the amplified production for being diagnosed as transgenic corn events DBN9501 or its offspring, and can quickly, it is accurate,
The stable presence for identifying the vegetable material from transgenic corn events DBN9501.
BRIEF DESCRIPTION OF THE SEQUENCES
It is attached positioned at insertion junction in 5 ' end of insetion sequence in SEQ ID NO:1 transgenic corn events DBN9501
A close length is the sequence of 22 nucleotide, wherein 1-11 nucleotide and 12-22 are that nucleotide is located at jade
The two sides of insertion point on rice genome;
It is attached positioned at insertion junction in 3 ' end of insetion sequence in SEQ ID NO:2 transgenic corn events DBN9501
A close length is the sequence of 22 nucleotide, wherein 1-11 nucleotide and 12-22 are that nucleotide is located at jade
The two sides of insertion point on rice genome;
It is located at insertion junction in 5 ' ends of insetion sequence in SEQ ID NO:3 transgenic corn events DBN9501
A neighbouring length is the sequence of 768 nucleotide;
It is located at insertion junction in 3 ' ends of insetion sequence in SEQ ID NO:4 transgenic corn events DBN9501
A neighbouring length is the sequence of 1339 nucleotide;
The Maize genome flanking sequence of the end of the entire T-DNA sequence of SEQ ID NO:5,5 ' and 3 ';
SEQ ID NO:6 is located at the sequence on SEQ ID NO:3, spans left boundary area (LB) and tNos transcription
Termination sequence;
SEQ ID NO:7 is located at the sequence on SEQ ID NO:4, spans pr35S transcriptional initiation sequence and right side boundary
Region (RB);
The first primer of SEQ ID NO:8 amplification SEQ ID NO:3;
The second primer of SEQ ID NO:9 amplification SEQ ID NO:3;
The first primer of SEQ ID NO:10 amplification SEQ ID NO:4;
The second primer of SEQ ID NO:11 amplification SEQ ID NO:4;
Primer on 5 ' flanking genomic sequence of SEQ ID NO:12;
The primer of SEQ ID NO:13 and SEQ ID NO:12 pairing being located on T-DNA;
Primer on 3 ' flanking genomic sequence of SEQ ID NO:14 can detecte with SEQ ID NO:12 pairing and turn
Gene is homozygote or heterozygote;
The primer of SEQ ID NO:15 and SEQ ID NO:14 pairing being located on T-DNA;
The first primer of SEQ ID NO:16 Taqman detection Vip3Aa19 gene;
Second primer of SEQ ID NO:17 Taqman detection Vip3Aa19 gene;
The probe of SEQ ID NO:18 Taqman detection Vip3Aa19 gene;
The first primer of SEQ ID NO:19 Taqman detection pat gene;
Second primer of SEQ ID NO:20 Taqman detection pat gene;
The probe of SEQ ID NO:21 Taqman detection pat gene;
The first primer of SEQ ID NO:22 corn endogenous gene SSIIb;
The second primer of SEQ ID NO:23 corn endogenous gene SSIIb;
The probe of Vip3Aa19 gene in SEQ ID NO:24 Southern hybridization check;
The probe of pat gene in SEQ ID NO:25 Southern hybridization check;
SEQ ID NO:26 is located at the primer on T-DNA, consistent with the direction ID NO:13 SEQ;
SEQ ID NO:27 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains flank sequence
Column;
SEQ ID NO:28 is located at the primer on T-DNA, contrary with SEQ ID NO:13, is used as and obtains flank sequence
Column;
SEQ ID NO:29 is located at the primer on T-DNA, consistent with the direction ID NO:15 SEQ;
SEQ ID NO:30 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains flank sequence
Column;
SEQ ID NO:31 is located at the primer on T-DNA, contrary with SEQ ID NO:15, is used as and obtains flank sequence
Column.
Below by drawings and examples, technical scheme of the present invention will be described in further detail.
Detailed description of the invention
Fig. 1 is the transgenosis insertion of nucleic acid sequence and its detection method of the present invention for detecting corn plant DBN9501
The structural schematic diagram of sequence and Maize genome junction, and the nucleic acid sequence phase for detecting corn plant DBN9501
To the schematic diagram of position (relative position schematic diagram refers to B73RefGen v3);
Fig. 2 is that recombinant expression of the present invention for the nucleic acid sequence and its detection method that detect corn plant DBN9501 carries
The structural schematic diagram of body DBN10707;
Fig. 3 is the present invention for detecting the nucleic acid sequence of corn plant DBN9501 and its transgenic corns of detection method
Field efficacy figure of event DBN9501 under the conditions of black cutworm naturally-occurring;
Fig. 4 is the present invention for detecting the nucleic acid sequence of corn plant DBN9501 and its transgenic corns of detection method
The field efficacy figure of event DBN9501 inoculation bollworm;
Fig. 5 is the present invention for detecting the nucleic acid sequence of corn plant DBN9501 and its transgenic corns of detection method
Field efficacy figure of event DBN9501 under the conditions of prodenia litura naturally-occurring;
Fig. 6 is the present invention for detecting the nucleic acid sequence of corn plant DBN9501 and its transgenic corns of detection method
Field efficacy figure of event DBN9501 under the conditions of beet armyworm naturally-occurring.
Specific embodiment
Further illustrate the present invention for detecting the nucleic acid sequence of corn plant DBN9501 below by specific embodiment
And its technical solution of detection method.
First embodiment, clone and conversion
1.1, carrier cloning
Recombinant expression carrier DBN10707 (as shown in Figure 2) is constructed using Standard gene cloning techniques.The carrier
DBN10707 includes two concatenated transgene expression cassettes, and first expression cassette is by the tandem sequence repeats containing enhancer region
Cauliflower mosaic virus 35 S promoter (pr35S) is operably connected to maize Heat Shock 70kDa albumen introne
(iZmHSP70) on, it is operably connected to the Vip3Aa19 albumen (cVip3Aa19) of the insect-resistant of bacillus thuringiensis
On, and be operably connected on the transcription terminator (tNos) of nopaline synthase and form;Second expression cassette is by containing jade
Rice 1 promoter of ubiquitin gene (prZmUbi1), is operably connected to the phosphinothricin N- second of the glufosinate tolerant of streptomycete
On acyltransferase (cPAT), and it is operably connected on the transcription terminator (tNos) of nopaline synthase and forms.
The carrier DBN10707 is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA with liquid nitrogen method;
Cat.No:18313-015 in), and it is thin to converting by selected marker of 4- [hydroxyl (methyl) phosphono]-DL- high lactamine
Born of the same parents screen.
1.2, Plant Transformation
It is converted using conventional Agrobacterium infestation method, by institute in the maize immature embryos of sterile culture and the present embodiment 1.1
The Agrobacterium stated co-cultures, and the T-DNA in the recombinant expression carrier DBN10707 of building is transferred to maize chromosome group
In, to generate transgenic corn events DBN9501.
For the corn transformation of mediated by agriculture bacillus, briefly, immature rataria is separated from corn, it is outstanding with Agrobacterium
Supernatant liquid contacts rataria, and wherein Agrobacterium can be by the nucleotides sequence biographies of the nucleotide sequence of Vip3Aa19 gene and pat gene
It is handed at least one cell (step 1: infecting step) of one of rataria, in this step, it is outstanding that rataria preferably immerses Agrobacterium
Supernatant liquid (OD660=0.4-0.6, infect culture medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 68.5g/L,
Glucose 36g/L, acetosyringone (AS) 40mg/L, 2,4- dichlorphenoxyacetic acid (2,4-D) 1mg/L, pH 5.3)) in open
Dynamic inoculation.Rataria and Agrobacterium co-culture one period (3 days) (step 2: co-culturing step).Preferably, rataria is infecting
After step solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 20g/L, glucose 10g/L,
AS 100mg/L, 2,4-D 1mg/L, agar 8g/L, pH 5.8) on cultivate.After the stage of co-cultivation herein, there can be a choosing
" recovery " step of selecting property.In " recovery " step, recovery media (MS salt 4.3g/L, MS vitamin, casein 300mg/
L, sucrose 30g/L, 2,4-D 1mg/L, cephalosporin 250mg/L, plant gel 3g/L, pH 5.8) at least exist it is a kind of oneself
Know the antibiotic (cephalosporin 150-250mg/L) for inhibiting Agrobacterium growth, does not add the selective agent (step of vegetable transformant
3: recovering step).Preferably, rataria is cultivated on having antibiotic but the not solid medium of selective agent, to eliminate Agrobacterium
And convalescence is provided for infected cell.Then, (4- [hydroxyl (methyl) phosphono]-DL- is high containing selective agent for the rataria of inoculation
Alanine) culture medium on the transformed calli (step 4: selection step) cultivating and select to grow.Preferably, rataria
In screening solid medium (MS salt 4.3g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, cephalo for having selective agent
Mycin 250mg/L, 4- [hydroxyl (methyl) phosphono]-DL- high lactamine 10mg/L, 2,4-D 1mg/L, plant gel 3g/L,
PH 5.8) on cultivate, cause conversion cell selective growth.Then, at plant, (step 5: regeneration walks callus regeneration
Suddenly), it is preferable that (MS differential medium and MS are raw in solid medium for the callus grown on the culture medium containing selective agent
Root culture medium) on culture with aftergrowth.
The resistant calli that screening obtains is transferred to the MS differential medium, and (MS salt 4.3g/L, MS vitamin are done
Casein 300mg/L, sucrose 30g/L, 6-benzyladenine 2mg/L, cephalosporin 250mg/L, 4- [hydroxyl (methyl) phosphono
Base]-DL- high lactamine 5mg/L, plant gel 3g/L, pH 5.8) on, differentiation is cultivated at 25 DEG C of temperature.What is differentiated is small
Seedling is transferred to the MS root media, and (MS salt 2.15g/L, MS vitamin, casein 300mg/L, sucrose 30g/L, cephalo are mould
Plain 250mg/L, 1 mg/L of indole-3-acetic acid, plant gel 3g/L, pH 5.8) on, it is cultivated at 25 DEG C of temperature to about 10cm high,
Hot-house culture is moved to solid.In the greenhouse, 16h is cultivated at 28 DEG C of temperature daily, cultivates 8h at 20 DEG C of temperature.
1.3, the identification and screening of transgenic event
200 separate transgenic T are generated altogether0Single plant.
It may cause the influence on economical character (such as short to plant since genetic transformation, gene are inserted into etc.
Slightly, blade grow thickly, floral leaf, blade to life, spinning loose powder is abnormal or solid difference etc.), therefore independent turn base for above-mentioned 200
Because of T0Single plant is sent into greenhouse and transplants and cultivated, to identify transgenosis T0Single plant is in different times (jointing stage in seedling stage-, jointing
Loose powder phase phase-and maturity period pustulation period -) Agronomic, altogether obtain 136 normal transgenosis of Agronomic
T0Single plant.
Pass through TaqManTMAbove-mentioned 136 transgenic corn plants of analysis detection whether there is the Vip3Aa19 that singly copies and
Pat gene, and vector backbone sequence is free of, 83 transgenosis T are obtained altogether0Single plant;It is analyzed by transgenic insert locus, altogether
Screen that 28 two sides T-DNA sequences are complete, T-DNA is not inserted into the important gene of Maize genome, gene insertion does not have
There is the transgenosis T for generating new open reading frame (ORF)0Single plant;By to major target insect (such as black cutworm, cotton boll
Worm, prodenia litura or beet armyworm) evaluation of resistance and compare, screen the good transgenosis T of 13 insect-resistants altogether0It is single
Strain;By the evaluation to glufosinate-ammonium herbicide tolerant and compare, it is good to screen 12 glufosinate-ammonium herbicide tolerants altogether
Transgenosis T0Single plant;In the case where different generations, different geographical environments and/or different background material, by transgenosis
Whether economical character, molecular biology, target insect resistance, glufosinate tolerant of plant etc. can stablize hereditary progress
Screening, have selected transgenic corn events DBN9501 be it is excellent, have single copy transgenosis (referring to second embodiment),
Good insect-resistant, glufosinate-ammonium herbicide tolerant and Agronomic (referring to the 5th embodiment and sixth embodiment).
Second embodiment carries out transgenic corn events DBN9501 detection with TaqMan
It takes the blade about 100mg of transgenic corn events DBN9501 as sample, uses plant DNA extraction kit
(DNeasy Plant Maxi Kit, Qiagen) extracts its genomic DNA, passes through Taqman fluorescence probe quantitative PCR method
Detect the copy number of Vip3Aa19 gene and pat gene.Simultaneously using wild-type corn plant as control, according to the method described above
It is tested and analyzed.Experiment sets 3 repetitions, is averaged.
The specific method is as follows:
Step 1, blade (after the pollination) 100mg for taking transgenic corn events DBN9501, are ground into mortar with liquid nitrogen
Homogenate, each sample take 3 repetitions;
Step 2 extracts above-mentioned sample using plant DNA extraction kit (DNeasy Plant Maxi Kit, Qiagen)
The genomic DNA of product, specific method refer to its product description;
Step 3 measures above-mentioned sample with ultramicrospectrophotometer (NanoDrop 2000, Thermo Scientific)
The genomic DNA concentration of product;
Step 4, the genomic DNA concentration of the above-mentioned sample of adjustment to same concentration value, the range of the concentration value is 80-
100ng/μL;
Step 5, the copy number that sample is identified using Taqman fluorescence probe quantitative PCR method, by being copied known to identification
The sample of shellfish number is as standard items, and using the sample of wild-type corn plant as control, 3 repetitions of each sample take it average
Value;Fluorescence quantification PCR primer and probe sequence are respectively:
Following primer and probe is used to detect Vip3Aa19 gene order:
Primer 1:cgaatacagaaccctgtcggc is as shown in SEQ ID NO:16 in sequence table;
Primer 2: cgtgaggaaggtctcagaaatgac is as shown in SEQ ID NO:17 in sequence table;
Probe 1:cgacgatggcgtgtatatgcctcttgg is as shown in SEQ ID NO:18 in sequence table;
Following primer and probe is used to detect pat gene order:
Primer 3:gagggtgttgtggctggtattg is as shown in SEQ ID NO:19 in sequence table;
Primer 4:tctcaactgtccaatcgtaagcg is as shown in SEQ ID NO:20 in sequence table;
Probe 2:cttacgctgggccctggaaggctag is as shown in SEQ ID NO:21 in sequence table;
PCR reaction system are as follows:
50 × the primer/probe mixture includes each 45 μ L of every kind of primer of 1mM concentration, the probe 50 of 100 μM of concentration
μ L and 860 μ 1 × TE of L buffers (10mM Tris-HCl, 1mM EDTA, pH8.0), and at 4 DEG C, it is housed in amber tube
In.
PCR reaction condition are as follows:
Utilize quick real-time fluorescence quantitative PCR system software (Applied Biosystems 7900HT Fast Real-
Time PCR System SDS v2.3, Applied Biosystems) analysis data, the results showed that the transgenosis of acquisition is beautiful
Rice event DBN9501 is single copy.
3rd embodiment, the insertion point for analyzing transgenic corn events DBN9501
3.1, extracting genome DNA
DNA is extracted according to CTAB (cetyl trimethylammonium bromide) method routinely used: taking 2g transgenic corn events
After the young leaflet tablet of DBN9501 is pulverized in liquid nitrogen, the DNA that 0.5mL is preheated in 65 DEG C of temperature is added and extracts CTAB buffering
Liquid (20g/L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM EDTA (ethylenediamine tetra-acetic acid), extremely with NaOH tune pH
8.0) after, mixing well, 65 DEG C of extracting 90min of Yu Wendu;0.5 times of volume of phenol and 0.5 times of volume of chloroform is added, overturns mixed
It is even;10min is centrifuged under 12000 rpm (revolutions per minute) revolving speed;2 times of volume dehydrated alcohols are added, softly in Aspirate supernatant
Shake centrifuge tube, 4 DEG C of standing 30min of Yu Wendu;It is centrifuged 10min again under 12000rpm revolving speed;DNA is collected to tube bottom;Abandon supernatant
Liquid, the ethyl alcohol for being 70% with 1mL mass concentration, washing precipitating;5min is centrifuged under 12000 rpm revolving speeds;Vacuum is drained or super
Net platform drying;DNA is precipitated and dissolved in suitable TE buffer, is stored under the conditions of -20 DEG C of temperature.
3.2, the analysis of flanking DNA sequence
Concentration mensuration is carried out to the DNA sample of said extracted, is located at the concentration of sample to be tested between 80-100 ng/ μ L.
With restriction enzyme Kpn I (5 ' end analysis) and Spe I (3 ' end analysis) difference digestion genomic DNA.Each digestion system
26.5 μ L genomic DNAs of middle addition, the above-mentioned restriction enzyme of 0.5 μ L and the 3 μ L enzyme cutting buffering liquid (restriction enzymes of use
It is the enzyme and its matched buffer or Generic buffer of NEB company, now claims NEBCutSmart), digestion 1h.To digestion knot
70 μ L dehydrated alcohols are added into digestion system by Shu Hou, and 7min is centrifuged under ice bath 30min, 12000rpm revolving speed, abandon supernatant,
Drying, is added 8.5 μ L distilled waters, 1 10 × T of μ L later4DNA ligase buffer (NEB T4 DNA Ligase
Reaction Buffer, specific formula may have access to the website NEB or with reference to https: //www.neb.com/products/
restriction-endonucleases、 https://www.neb.com/products/b0202-t4-dna-ligase-
) and 0.5 μ L T reaction-buffer4DNA ligase is stayed overnight in 4 DEG C of temperature connections.It is carried out with a series of nested primers
5 ' end of PCR amplification separation and 3 ' end genomic DNAs.Specifically, the primer combination of 5 ' end genomic DNA of separation includes SEQ ID
NO:13 and SEQ ID NO:26 is as the first primer, and SEQ ID NO:27 and SEQ ID NO:28 is as the second primer, SEQ
ID NO:13 is as sequencing primer.3 ' end genome DNA primer combination of separation includes SEQ ID NO:15 and SEQ ID NO:29
As the first primer, SEQ ID NO:30 and SEQ ID NO:31 draws as the second primer, SEQ ID NO:15 as sequencing
Object, PCR reaction condition are as shown in table 3.
Above-mentioned pcr amplification reaction amplified production obtained is electrophoresis on 2.0% Ago-Gel to divide in mass fraction
From pcr amplification product, then using plastic recovery kit (QIAquick Gel Extraction Kit, catalogue #_28704,
Qiagen Inc., Valencia, CA) from agarose matrix separate target fragment.Then the pcr amplification product of purifying is sequenced
It (for example, using ABI PrismTM 377, PE Biosystems, Foster City, CA) and analyzes (for example, using
DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).
5 ' and 3 ' flanking sequences and junction sequence are confirmed using standard pcr.5 ' flanking sequences and junction sequence can make
Come with SEQ ID NO:8 or SEQ ID NO:12, combination S EQ ID NO:9, SEQ ID NO:13 or SEQ ID NO:26 true
Recognize.SEQ ID NO:11 or SEQ ID NO:14, combination S EQ ID NO:10, SEQ can be used in 3 ' flanking sequences and junction sequence
ID NO:15 or SEQ ID NO:29 confirms.PCR reaction system and amplification condition are as shown in table 2 and table 3.Art technology
Personnel will be understood that other primer sequences can also be used for confirmation flanking sequence and junction sequence.
The DNA sequencing of pcr amplification product provides the DNA that can be used for designing other DNA moleculars, other described DNA divide
Son can be used for identifying the corn plant or seed for deriving from transgenic corn events DBN9501 as primer and probe.
It was found that 1-384, the nucleotide displays in SEQ ID NO:5 are maize genomic sequence in transgenic corns
The left margin flank (5 ' flanking sequence) of event DBN9501 insetion sequence, in the nucleotide 7785-8559 of SEQ ID NO:5
Position display is right margin flank (3 ' flank sequences of the maize genomic sequence in transgenic corn events DBN9501 insetion sequence
Column).5 ' junction sequences are listed in SEQ ID NO:1, and 3 ' junction sequences are listed in SEQ ID NO:2.
3.3, PCR zygosity determination
Junction sequence is relatively short polynucleotide molecule, is new DNA sequence dna, when in polynucleotide tests and analyzes
It is diagnostic for the DNA of transgenic corn events DBN9501 when detecting.In SEQ ID NO:1 and SEQ ID NO:2
Junction sequence is the insertion point of transgenic corn events DBN9501 transgenic segment and every side of corn gene group DNA
11 polynucleotides.Longer or shorter polynucleotides junction sequence can be from SEQ ID NO:3 or SEQ ID NO:4
Selection.Junction sequence (5 ' the join domain SEQ ID join domain SEQ ID of NO:1 and 3 ' NO:2) is used as DNA probe or work
It is useful in DNA detection method for DNA primer molecule.Junction sequence SEQ ID NO:6 and SEQ ID NO:7 is also to turn
New DNA sequence dna in gene corn event DBN9501 can also be used as DNA probe or turn as DNA primer Molecular Detection
The presence of gene corn event DBN9501DNA.The SEQ ID NO:6 (385-574, the nucleotide of SEQ ID NO:3) across
DBN10707 construct DNA sequence dna and tNos transcription terminator, the SEQ ID NO:7 (core of SEQ ID NO:4 are got over
Thuja acid 252-451) span pr35S transcriptional initiation sequence and DBN10707 construct DNA sequence dna.
In addition, amplicon is generated by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4,
The diagnostic amplicon of transgenic corn events DBN9501 is generated when the primer is in PCR method.
Specifically, pcr amplification product is generated from 5 ' ends of transgene insert sequence, which is to include source
Flank is in the genome at 5 ' ends of T-DNA insetion sequence in the genome of the vegetable material of transgenic corn events DBN9501
A part of DNA.This pcr amplification product includes SEQ ID NO:3.In order to carry out PCR amplification, design and flank are in turning base
Because the genomic dna sequence hybridization at 5 ' ends of insetion sequence primer 5 (SEQ ID NO:8) and paired be located at T-
The primer 6 (SEQ ID NO:9) of tNos transcription terminator in DNA insetion sequence.
Pcr amplification product is generated from 3 ' ends of transgene insert sequence, which includes to derive from transgenosis
In the genome of the vegetable material of corn event DBN9501 flank in T-DNA insetion sequence 3 ' end genomic DNAs one
Part.This pcr amplification product includes SEQ ID NO:4.In order to carry out PCR amplification, design is located in T-DNA insetion sequence
The primer 7 (SEQ ID NO:10) of pr35S transcriptional initiation sequence and paired and flank are in the 3 ' of transgene insert sequence
The primer 8 (SEQ ID NO:11) of the genomic dna sequence hybridization of end.
The DNA cloning condition illustrated in table 2 and table 3 can be used for above-mentioned PCR zygosity test to generate transgenic corns
The diagnostic amplicon of event DBN9501.The detection of amplicon can be by using Stratagene Robocycler, MJ
Engine, Perkin-Elmer 9700 or Eppendorf Mastercycler Gradient thermal cycler etc. are carried out, or logical
It crosses method known to those skilled in the art and equipment carries out.
Table 2,5 ' end transgenic insertions/genome engaging zones identification for transgenic corn events DBN9501
PCR step and reaction mixture condition
Table 3, thermal cycler amplification condition
It lightly mixes, if not having hot top on thermal cycler, 1-2 drop mine can be added above each reaction solution
Object oil.Using the loop parameter in table 3 in Stratagene Robocycler (Stratagene, La Jolla, CA), MJ
Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or
PCR is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler
Reaction.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be transported under the mode of calculating
Row.Ramp rates (ramp speed) are set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.
The results showed that primer 5 and 6 (SEQ ID NO:8 and 9), when it is used in transgenic corn events DBN9501
Genomic DNA PCR reaction in when, generate 768bp segment amplified production, when its be used in unconverted corn gene group DNA and
When in the PCR reaction of non-DBN9501 corn gene group DNA, no segment is amplified;Primer 7 and 8 (SEQ ID NO:10 and
11), when it is used in the PCR reaction of transgenic corn events DBN9501 genomic DNA, the amplification of 1339bp segment is generated
Product, when in the PCR reaction that it is used in unconverted corn gene group DNA and non-DBN9501 corn gene group DNA, without piece
Section is amplified.
PCR zygosity determination can also be used in identification from transgenic corn events DBN9501 material be homozygote or
It is heterozygote.Primer 9 (SEQ ID NO:12), primer 10 (SEQ ID NO:13) and primer 11 (SEQ ID NO:14) are used
The diagnostic amplicon of transgenic corn events DBN9501 is generated in amplified reaction.The DNA cloning illustrated in table 4 and table 5
Condition can be used for above-mentioned zygosity test to generate the diagnostic amplicon of transgenic corn events DBN9501.
Table 4, zygosity determination reaction solution
The thermal cycler amplification condition of table 5, zygosity determination
Using the loop parameter in table 5 in Stratagene Robocycler (Stratagene, La Jolla, CA), MJ
Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA) or
PCR is carried out on Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler
Reaction.MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be transported under the mode of calculating
Row.Ramp rates (ramp speed) are set as maximum value when 9700 thermal cycler of Perkin-Elmer is run.
In the amplified reaction, the biological sample containing template DNA, which contains, diagnoses the sample transgenic corn event
DBN9501 there are the DNA of situation.Or amplified reaction will be produced by the biological sample containing the DNA from Maize genome
Raw two different DNA cloning, the DNA from Maize genome is relative in transgenic corn events DBN9501
The corresponding allele of existing insertion DNA is heterozygosis.The two different amplicons will correspond to beautiful from wild type
The first amplicon (SEQ ID NO:12 and SEQ ID NO:14) and diagnosis transgenic corn events of rice genomic locus
DBN9501 DNA there are the second amplicon of situation (SEQ ID NO:12 and SEQ ID NO:13).It only generates and corresponds to needle
To the maize dna sample of the single amplicon of the second amplicon of heterozygous genes group description, the diagnosable determination sample transfer base
Because of the presence of corn event DBN9501, and the sample is as being inserted into DNA relative to present in rotaring gene corn plant DBN9501
Corresponding allele is produced by homozygous corn seed.
It should be noted that the primer pair of transgenic corn events DBN9501 is used to transgenic corn events
DBN9501 genomic DNA is diagnostic amplicon.These primer pairs include but is not limited to (the SEQ ID NO:8 of primer 5 and 6
With 9) and primer 7 and 8 (SEQ ID NO:10 and 11), in the DNA cloning method.In addition, for expanding corn
One control primer 12 and 13 (SEQ ID NO:22 and 23) of endogenous gene is included, one as reaction condition
A inherent standard.Analysis to transgenic corn events DBN9501 DNA extracting sample should include a transgenic corns thing
The assaypositive tissue DNA extract of part DBN9501 compares, and one derives from the negative DNA of non-transgenic corn event DBN9501
Extract control and a negative control without containing template maize dna extract.It, can be with other than these primer pairs
Using any primer pair from SEQ ID NO:3 or its complementary series or SEQ ID NO:4 or its complementary series, when it
To be generated when being used for DNA amplification reaction respectively for the tissue from transgenic event corn plant DBN9501 be diagnosis
The amplicon comprising SEQ ID NO:1 or SEQ ID NO:2 of property.The DNA cloning condition illustrated in table 2- table 5 may be used to
The diagnostic amplicon of transgenic corn events DBN9501 is generated with suitable primer pair.It is surveyed when in DNA cloning method
When examination generate to transgenic corn events DBN9501 be diagnostic amplicon, presumption contain transgenic corn events
The corn plant of DBN9501 or the extract of seed DNA, or from the product of transgenic corn events DBN9501, can be with
It is used as the template of amplification, to determine whether there is transgenic corn events DBN9501.
Fourth embodiment detects transgenic corn events DBN9501 using Southern blot hybridization
4.1, it is extracted for the DNA of Southern blot hybridization
Using mortar and pestle, about 5-10g leaf tissue is ground in liquid nitrogen.In 20mL CTAB lysis buffer
(100mM Tris-HCl pH 8.0,20mM EDTA pH 8.0,1.4M NaCl, 0.2%v/v β-dredge base ethyl alcohol, 2%w/v
CTAB the leaf tissue in) after resuspension 4-5g grinding, in 65 DEG C of temperature 60 min of incubation.During incubation, every 10min is by sample
Product are mixed by inversion once.After incubation, isometric phenol/chloroform/isoamyl alcohol (25:24:1) is added, is gently mixed by inversion progress
Extracting is centrifuged 20min with revolving speed 4000rpm.Water intaking mutually repeats to extract primary with isometric chloroform/isoamyl alcohol (24:1).Again
Isometric isopropanol is added after collecting water phase, in -20 DEG C of placement 1h of temperature to precipitate DNA after mixing, then with revolving speed 4000rpm
Centrifugation 5min obtains DNA precipitating, is then resuspended in 1mL TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0)
Floating DNA precipitating.In order to degrade, any existing RNA incubates DNA and 40 μ L 10mg/mL RNase A at 37 DEG C of temperature
30min is centrifuged 5min with 4000rpm, and is 3M sodium acetate (pH 5.2) and 2 times of anhydrous second of volume in 0.1 times of volumetric concentration
In the presence of alcohol, DNA is precipitated with revolving speed 12000rpm centrifugation 10min.After discarding supernatant, with the 1mL of 70% (v/v)
Ethanol washing precipitates, and re-dissolves DNA in 1mL TE buffer after drying at room temperature.
4.2, enzymic digestion is limited
The base of above-mentioned sample is measured with ultramicrospectrophotometer (NanoDrop 2000, Thermo Scientific)
Because of a group DNA concentration.
In 100 μ L reaction systems, 5 μ g DNA are digested every time, are digested respectively with restriction enzyme Nco I and Nde I
The partial sequence of genomic DNA, the gene of the Vip3Aa19 using on T-DNA and pat gene is as probe.For every kind of enzyme, appropriate
At a temperature of overnight incubation digest.Utilize SpeedVac (speed Vacuum, Thermo
Scientific sample is rotated) to reduce volume to 20 μ L.
4.3, gel electrophoresis
Bromophenol blue sample-loading buffer is added to each sample in the present embodiment 4.2, and each sample is added
On sample to the 0.7%TAE Ago-Gel containing ethidium bromide, in TAE electrophoretic buffer (40mM Tris- acetic acid, 2mM
EDTA, pH 8.5) in electrophoretic separation, at voltage 20V running gel stay overnight.
After electrophoresis, with 0.25M HCl treatment gel 10min so that DNA depurination, then uses denaturing liquid respectively
(1.5M NaCl, 0.5M NaOH) and neutralizer (1.5M NaCl, 0.5M Tris-HCl, pH 7.2) treatment gel is each
30min.Pour into 5 × SSC (3M NaCl, 0.3M sodium citrate, pH 7.0) in porcelain dish, cost one piece of glass plate, then according to
It is secondary to put the filter paper bridge soaked, gel, positively charged nylon membrane (Roche, Cat.No. 11417240001), three filter paper, paper
Tower, weight.After transferring film is stayed overnight at room temperature, rinses nylon membrane 2 times in deionized water, pass through UV crosslinking instrument (UVP, UV
Crosslinker CL-1000) DNA is fixed on film.
4.4, hybridize
It is prepared with the DNA sequence dna that PCR amplification is suitble to for probe.The DNA probe is SEQ ID NO:24 or SEQ ID
NO:25, or it is homologous or complementary with above-mentioned Sequence.With DNA Labeling and Detection Starter Kit
II kit (Roche, Cat.No.11585614910) carries out the DIG label of probe, Southern blot hybridization, washes film etc.
Operation, specific method refer to its product description.Finally use X mating plate (Roche, Cat.No.11666916001) detection probe
In conjunction with position.
Include two kinds of control samples on each Southern: (1) DNA from negative (unconverted) segregant is used
In identify it is any can be with element-specific probe hybridization endogenous corn sequence;(2) DNA from negative segregant, wherein
The DBN10707 plasmid of Nco I- digestion is introduced, amount is based on probe length and is equivalent to a copy number, as hybridization
Positive control and the sensitivity for being used to illustrate experiment.
The evidence that hybridization data provides confirmation supports TaqManTMPCR analysis, i.e. corn plant DBN9501 contain
Single copy of Vip3Aa19 gene and pat gene.Using the Vip3Aa19 gene probe, Nco I and Ned I enzymatic hydrolysis produce respectively
The single band of raw size about 11kb and 9kb;Using the pat gene probe, Nco I and Ned I enzymatic hydrolysis generate size about respectively
The single band of 8.5kb and 1.3kb, this shows that Vip3Aa19 gene and each copy of pat gene are present in corn plant
In DBN9501.In addition, not obtaining hybridising band for skeleton probe, illustrate there is not any DBN10707 in the conversion process
Vector backbone sequence enters in corn plant DBN9501 genome.
The insect-resistant detection of 5th embodiment, event
5.1, the bioassay of corn plant DBN9501
By transgenic corn events DBN9501 and wild-type corn plant (non-transgenic, NGM) 2 plants respectively to small
Cutworm (Agrotis ypsilon Rottemberg, BCW), prodenia litura (Spodoptera litura, TCW), beet
Noctuid (Spodoptera exigua, BAW), pink rice borer (Sesamia inferens, PSB), striped stem borer (Chilo
Sacchariphagus, SGB) and chilotraea infuscatellus (Chilo infuscatellus, MSB) carry out biometric as follows
It is fixed:
The new of transgenic corn events DBN9501 and wild-type corn plant (non-transgenic, NGM) 2 plants is taken respectively
Fresh leaves (V3-V4 period), it is clean with aseptic water washing and blotted the water on blade with gauze, then maize leaf is gone
Except vein, while it being cut into the strip of about 1cm × 3cm, the length after taking 1-3 piece (determining blade quantity according to insect appetite) to cut
Blade strip is put on the filter paper of round plastic culture dish bottom, and the filter paper is soaked with distilled water, puts 5- in each culture dish
The newly hatched larvae of 10 artificial feedings, after worm tries culture dish capping, in 26-28 DEG C of temperature, relative humidity 70%-80%, light week
Statistical result after being placed 3 days under conditions of phase (light dark) 16:8.Count larvae development progress, the death rate and blade injury rate three
Item index, obtains resistance total score (full marks 300 divide): the resistance total score=100 × death rate+[100 × death rate+90 × it (just incubates
Borer population/connect borer population)+60 × (just incubate-negative control borer population/and connect borer population)+10 × (negative control borer population/connect borer population)]+100 ×
(1- blade injury rate).Wherein, it connects borer population and refers to the quantity for connecing worm, i.e., every ware 5 or 10 (depending on the food ingestion of pest);
Larvae development progress has passed through the embodiment of resistance total score formula;Blade injury rate, which refers to, accounts for blade by the blade area of pests
The ratio of the gross area.5 plants are selected respectively from transgenic corn events DBN9501 and wild-type corn plant (non-transgenic, NGM)
It is tested, every plant is repeated 6 times.As a result as shown in table 6 and table 7.
Pest-resistant bioassay results-death rate (%) of table 6, transgenic corn events DBN9501
Pest-resistant bioassay results-resistance total score (dividing) of table 7, transgenic corn events DBN9501
The result shows that: transgenic corn events DBN9501 is to black cutworm, prodenia litura, beet armyworm, pink rice borer, sorghum
Snout moth's larva and chilotraea infuscatellus all have preferable resistance, and the test worm death rate of transgenic corn events DBN9501 and resistance total score are equal
It is significantly higher than NGM.
5.2, the field efficacy of transgenic corn events DBN9501
The seed of transgenic corn events DBN9501 and wild-type corn plant (non-transgenic, NGM) 2 plants are set
It is handled for 2, RANDOMIZED BLOCK DESIGN, 3 repetitions, plot area 30m are pressed in each processing2(5m × 6m), line-spacing 60cm, strain
Away from 25cm, conventional cultivation management, the time of infertility does not spray insecticide.Different insects connect the interval for having 2m between worm experimental plot,
Avoid diffusion of the insect between different community.(1) black cutworm
Only natural INFESTATION (natural insect pest occurrence condition: smallly is carried out in the more serious area of black cutworm naturally-occurring
It is first brood of larvae that tiger, which causes damages, is suitable for that situation easily occurs in environmental condition, if temperature is at 16-26 DEG C, relative humidity
For 80-90%, soil moisture content 15-20%;Furthermore when first generation adult lures a certain amount of, such as 20 or more).In maize seedling
Phase, material it is long to V2-V3 or so when plant be developed to the exhibition 2-3 leaf phase, start whether plant occurs in follow-up investigation NGM
It wilts, when the wilting plant rhizosphere of NGM nearby occurs to be mostly that 4-6 age high instar larvae endangers, by strain investigation black cutworm to jade
The rate that causes harm (rate that causes harm=by the plant quantity of pests/total plant quantity × 100%) of rice plant.Transgenosis is beautiful
The results are shown in Table 8 for resistance of the rice event DBN9501 to black cutworm.
To the resistance result of black cutworm under the conditions of table 8, transgenic corn events DBN9501 natural INFESTATION
The result shows that: under the conditions of black cutworm naturally-occurring, compared with NGM, black cutworm is to transgenic corn events
Thus it is preferable anti-to illustrate that transgenic corn events DBN9501 has black cutworm for the rate significant decrease of causing harm of DBN9501
Property, field efficacy of transgenic corn events DBN9501 under the conditions of black cutworm naturally-occurring is as shown in Figure 3.
(2) bollworm (Helicoverpa armigera Hubner, CBW)
Artificial Inoculation of Anoplophora glabripennis is carried out in the corn silking phase, is connect worm 2 times, every cell Artificial Inoculation of Anoplophora glabripennis is no less than 40 plants, in every plant of corn
Newly hatched larvae about 20 of artificial feeding are met in filigree, after connecing worm 3 days, connect worm for the second time, connect borer population amount with for the first time.It is connecing
After worm 14-21 days, length is killed by strain investigation female fringe percentage of injury, each female fringe survival larva number, female fringe.It usually connects 14 after worm
It is instituted an inquiry, if the rank that causes harm of NGM reaches sense or high sense, is considered as effectively, if investigation can suitably be postponed by not reaching,
But appropriate level is still not up within 21 days after connecing worm, then this connects worm and is considered as in vain.According to female fringe percentage of injury, survival larva number, female
Fringe is killed length (cm), calculates each cell corn ear period bollworm to the rank average value of causing harm of female fringe, judgment criteria such as table 9
It is shown, then by the judgment of standard corn ear period of table 10 to the resistance level of bollworm.Transgenic corn events DBN9501 is spat
The silk phase is as shown in table 11 to the resistance result of bollworm.
Table 9, maize ear are caused harm the grade scale of degree by bollworm
Female fringe is killed rank | Symptom description |
0 | Female fringe is not aggrieved |
1 | Only filigree is killed |
2 | Fringe top is killed 1cm |
3+ | Every increase 1cm is killed under fringe top, killed rank increases by 1 grade accordingly |
…N |
Table 10, maize ear are to the Evaluation standard of resistance of bollworm
Female fringe is killed rank average value | Resistance level |
0-1.0 | Highly resistance (HR) |
1.1-3.0 | Anti- (R) |
3.1-5.0 | In resist (MR) |
5.1-7.0 | Feel (S) |
≥7.1 | Height sense (HS) |
Table 11, transgenic corn events DBN9501 spinning phase are to the resistance result of bollworm
The result shows that: under conditions of artificial infection, the female fringe percentage of injury of transgenic corn events DBN9501, larva are deposited
Number, the killed length of female fringe and female fringe living are killed rank and are substantially less than NGM, thus illustrate transgenic corn events DBN9501 to cotton
The resistance level of earworm is in anti-(R) rank, and transgenic corn events DBN9501 is inoculated with field efficacy such as Fig. 4 institute of bollworm
Show.
(3) prodenia litura
Only natural INFESTATION is carried out in the more serious area of prodenia litura naturally-occurring (natural insect pest occurrence condition: to cause harm
Peak period is in the 7-9 month, and pest development optimum temperature is at 28-30 DEG C).After first occur insect pest 10-15 days, and NGM is mostly 4-6
When age high instar larvae endangers, by strain investigation prodenia litura to the rate that causes harm of the plant (rate that causes harm=by the corn of pests
Plant quantity/total plant quantity × 100%).Resistance result such as table 12 institute of the transgenic corn events DBN9501 to prodenia litura
Show.
To the resistance result of prodenia litura under the conditions of table 12, transgenic corn events DBN9501 natural INFESTATION
The result shows that: under the conditions of prodenia litura naturally-occurring, compared with NGM, prodenia litura is to transgenic corn events
Thus it is preferable anti-to illustrate that transgenic corn events DBN9501 has prodenia litura for the rate significant decrease of causing harm of DBN9501
Property, field efficacy of transgenic corn events DBN9501 under the conditions of prodenia litura naturally-occurring is as shown in Figure 5.
(4) beet armyworm
Experimental design and test method are substantially consistent with the evaluation resistance of prodenia litura as described above.Unlike,
After first discovery insect pest 10-15 days, and when NGM is mostly that 4-5 age high instar larvae endangers, beet armyworm is investigated to corn by strain
The rate that causes harm (rate that causes harm=by the plant quantity of pests/total plant quantity × 100%) of plant.Transgenic corns
Event DBN9501 is as shown in table 13 to the resistance result of beet armyworm.
To the resistance result of beet armyworm under the conditions of table 13, transgenic corn events DBN9501 natural INFESTATION
The result shows that: under the conditions of beet armyworm naturally-occurring, compared with NGM, beet armyworm is to transgenic corn events
Thus it is preferable anti-to illustrate that transgenic corn events DBN9501 has beet armyworm for the rate significant decrease of causing harm of DBN9501
Property, field efficacy of transgenic corn events DBN9501 under the conditions of beet armyworm naturally-occurring is as shown in Figure 6.
What is particularly worth mentioning is that according to Chinese patent (application) the 201310289848.6th, 201310573441.6,
201410806573.3, the content and the application transgenosis recorded in 201510259396.6, No. 201610006375.8 are beautiful
The field effect and its bioassay results to insect of rice event DBN9501, shows the application transgenic corn events
DBN9501 realizes the method and/or purposes of control pest, specially pink rice borer, prodenia litura, chilotraea infuscatellus, striped stem borer and peach
Eat into snout moth's larva;Namely control pink rice borer, prodenia litura, grain may be implemented in the rotaring gene corn plant of any expression Vip3Aa19 albumen
Grey snout moth's larva, striped stem borer and/or dichocrocis punctiferalis pest method and/or purposes.
The herbicide tolerant detection of sixth embodiment, event
This test selects to protect and tries to be sprayed up to (Basta) herbicide (the glufosinate ammonium salt aqua that effective component is 18%)
It applies.Using RANDOMIZED BLOCK DESIGN, 3 repetitions.Plot area is 15m2(5m × 3m), line-spacing 60cm, spacing in the rows 25cm are conventional to plant
Training management has the wide isolation strip of 1m between cell.Transgenic corn events DBN9501 is subjected to following 2 kinds of processing: (1) not being sprayed
It applies, while processing (2) spray herbicide, sprays isometric clear water;(2) by 800g a.i./ha, (a.i./ha refers to
" active ingredient per hectare ") dosage in the V2-V3 leaf phase sprays guarantor's examination up to herbicide.It should be noted that glufosinate-ammonium herbicide
(such as Basta) is contact killing type herbicide, if field may occur in which phytotoxicity shape if local accumulation medical fluid is excessive using misoperation,
Not there are problems for transgenic corn events DBN9501 tolerance;Different content and the glufosinate-ammonium herbicide of dosage form are converted into
Equivalent effective component glufosinate-ammonium is stated to be suitable for draw a conclusion.
The 1 week and 2 weeks investigation symptom of chemical damage after medication respectively, and harvest when measure cell yield;Symptom of chemical damage point
Grade is as shown in table 14.Use the aggrieved rate of herbicide as the index of the herbicide tolerant of evaluation transformation event, specifically, weeding
The aggrieved rate of agent (%)=∑ (aggrieved strain number × number of levels at the same level)/(total strain number × highest level);Wherein the aggrieved rate of herbicide is
Refer to that the aggrieved rate of glufosinate-ammonium, the aggrieved rate of glufosinate-ammonium are 2 weeks after handling according to glufosinate-ammonium phytotoxicity investigation results and determination, and by
The aggrieved rate of herbicide (glufosinate-ammonium) differentiates corn to the tolerance level of herbicide.The corn yield of each cell is that weighing is each small
The niblet total output (weight) of 3 rows among area, volume variance between the different disposal degree of progress in the form of yield percentage
Amount, yield percentage (%)=spraying yield/do not spray yield.Transgenic corn events DBN9501 is to herbicide tolerant
Result and corn yield result it is as shown in Table 15.
Table 14, glufosinate-ammonium herbicide are to the grade scale of corn phytotoxicity degree
Phytotoxicity rank | Symptom description |
1 | Growth is normal, without any damage symptoms |
2 | Slight phytotoxicity, phytotoxicity are less than 10% |
3 | Medium phytotoxicity can restore later, not influence yield |
4 | Phytotoxicity is heavier, it is difficult to restore, cause the underproduction |
5 | Phytotoxicity is serious, cannot restore, and causes the obvious underproduction or total crop failure |
Table 15, transgenic corn events DBN9501 are to the result and corn yield result of glufosinate-ammonium herbicide tolerant
As a result illustrate, in terms of the aggrieved rate of glufosinate-ammonium herbicide: transgenic corn events DBN9501 is in glufosinate-ammonium weeding
Aggrieved rate is 0 under agent (800g a.i./ha) processing;There is transgenic corn events DBN9501 good glufosinate-ammonium to remove as a result,
Careless agent tolerance.
In terms of yield: transgenic corn events DBN9501 is not spraying and is spraying 2 kinds of 800g a.i./ha glufosinate-ammonium
Handling lower yield does not have notable difference, and after spraying glufosinate-ammonium herbicide, the yield of transgenic corn events DBN9501 slightly has
Increase, further demonstrates that transgenic corn events DBN9501 has good glufosinate-ammonium herbicide tolerant as a result,.
7th embodiment
Such as agricultural product or commodity can be produced by transgenic corn events DBN9501.If in the agricultural product or commodity
In detect enough expression quantity, the agricultural product or commodity are expected containing can diagnose transgenic corn events DBN9501 material
Expect the nucleotide sequence present in the agricultural product or commodity.The agricultural product or commodity include but is not limited to corn oil, jade
Rice coarse powder, maize flour, corn gluten, corn-dodger, cornstarch and will as food source for animal consumption it is any its
Its food or additionally as the ingredient in swelling agent or make-up composition for cosmetic use etc..Based on probe or primer pair
Nucleic acid detection method and/or kit can be developed to detect such as SEQ ID NO:1 or SEQ ID in biological sample
The nucleotide sequence of transgenic corn events DBN9501 is derived from shown in NO:2, wherein probe sequence or primer sequence are selected from
The sequence as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5 or
Its part, to diagnose the presence of transgenic corn events DBN9501.
In conclusion transgenic corn events DBN9501 of the present invention has preferable resistance to lepidopterous insects, simultaneously
To glufosinate-ammonium herbicide tolerance with higher, on yield without influence, and detection method can quickly and accurately identify biology
In sample whether include transgenic corn events DBN9501 DNA molecular.
Seed corresponding to transgenic corn events DBN9501 is protected according to budapest treaty on January 23rd, 2019
Ensconce China Committee for Culture Collection of Microorganisms's common micro-organisms center (abbreviation CGMCC, address: Chaoyang District, Beijing City north
The institute 3 of occasion West Road 1, Institute of Microorganism, Academia Sinica, postcode 100101), classification naming: corn (Zea mays) is protected
Hiding number is CGMCC No.17099.Preserved material will be 30 years in depository's preservation.
It should be noted last that the above examples are only used to illustrate the technical scheme of the present invention and are not limiting, although ginseng
It is described the invention in detail according to preferred embodiment, those skilled in the art should understand that, it can be to the present invention
Technical solution be modified or replaced equivalently, without departing from the spirit and scope of the technical solution of the present invention.
Sequence table
<110>Beijing Da Bei Nong Bioisystech Co., Ltd
<120>for detecting the nucleic acid sequence and its detection method of corn plant DBN9501
<130> DBNBC145
<160> 31
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213>being located at a length near insertion junction in 5 ' end of insetion sequence in DBN9501 is 22 nucleotide
Sequence (Artificial Sequence)
<400> 1
ggggaaaagt taataacaca tt 22
<210> 2
<211> 22
<212> DNA
<213>being located at a length near insertion junction in 3 ' end of insetion sequence in DBN9501 is 22 nucleotide
Sequence (Artificial Sequence)
<400> 2
gtttaaacta tcagtgtaac ta 22
<210> 3
<211> 768
<212> DNA
<213>being located at a length near insertion junction in 5 ' ends of insetion sequence in DBN9501 is 768 cores
The sequence (Artificial Sequence) of thuja acid
<400> 3
tgtccggcat acctgttcat catttaaata atctaacacg gagtgtcctt tcttgagtga 60
cgcgccaaac ggtgtacttc tgttgtttct tgagtgacat aaaatggtgt acttctatta 120
cctaaggcat aattctaatt tataaagaga aggtaataca gccacaaatt agtaacatct 180
aagcaaatac agcactgctt ctggaaattt tatcatctat attcagtaag ctaaacccag 240
ccactattaa gtttcatgat tttatcatat gaaaaaaaaa tccaaagaaa ccatacggtt 300
atcaaaaact tagaaaaaca ggatgccttt ttgccaaagg gatttgatag acctttattt 360
ttcaggaaaa acaggggaaa agttaataac acattgcgga tacggccagg cgcgtccctg 420
ttaacgtcct aactagctaa actaggtaca gattgcgagg ctcacgaggc gatcctggcc 480
gcgtgacagt cgcgtgcgag gctcttgact aagtaggcgg ccgcgtgcac ttaattaaga 540
attccctgca gggatctagt aacatagatg acaccgcgcg cgataattta tcctagtttg 600
cgcgctatat tttgttttct atcgcgtatt aaatgtataa ttgcgggact ctaatcataa 660
aaacccatct cataaataac gtcatgcatt acatgttaat tattacatgc ttaacgtaat 720
tcaacagaaa ttatatgata atcatcgcaa gaccggcaac aggattca 768
<210> 4
<211> 1339
<212> DNA
<213>being located at a length near insertion junction in 3 ' ends of insetion sequence in DBN9501 is 1339 cores
The sequence (Artificial Sequence) of thuja acid
<400> 4
caatcggacc atcacatcaa tccacttgct ttgaagacgt ggttggaacg tcttcttttt 60
ccacgatgct cctcgtgggt gggggtccat ctttgggacc actgtcggca gaggcatctt 120
caacgatggc ctttccttta tcgcaatgat ggcatttgta ggagccacct tccttttcca 180
ctatcttcac aataaagtga cagatagctg ggcaatggaa tccgaggagg tttccggata 240
ttaccctttg ttgaaaagtc tcaatcggac caagcttatt taaatggtac cttaattaag 300
tgcacgttta aactacctag tcagtgccgt tgagagcgta gctgcgactt agcggcctcg 360
tctgcgaagt cggtgaggct agtgccacta attagtcatt agtttaatac aaatccacct 420
gcggccaatt cctgcagcgt tgcggttctg tcagttccaa acgtaaaacg gcttgtcccg 480
cgtcatcggc gggggtcata acgtgactcc cttaattctc cgctcatgat cagattgtcg 540
tttcccgcct tcagtttaaa ctatcagtgt aactataaat ggtatagtag tccggatttt 600
gtttccgaat aaagaaatgt tcaatgtatt tgaaatgatc aatagatact caaattatat 660
gattagcaag cttaaataga gttttttttt caggtccatt tcttttcctt agattacaga 720
agcaccataa cacattccaa aagtaattgc atgcacccaa gaatctgcta atgttccaag 780
tgttgaaaac aaccaaaact gtacttatca cttaatgaaa tacatggcac aaacaaaaaa 840
aaaaactgaa tatgcctgcg aacatagcag aagtggttgt catgtactag aaacattatt 900
gtgtcttcga acaagctgct catataatgg aagatggttc tttgcaacaa aaaccctgaa 960
cctgtaaagc aaatgagaag gacaattaag cataaataaa ggtgcaataa cacaagggaa 1020
caaaccacta aaccaatgtt ttaaagttgc ccgactaatc gtgattactc aaccttattg 1080
cagcacgatt aggattaggc tgtacgacac gactagggtg attagaactc ggatcgtctg 1140
actaatcatg attaaacggt gattagtcat cggactagga gttcaaccca ctaacctgag 1200
ccgcctgact ttttttttgg gccggaccac agtgggtaag gtttttttat tttctcttga 1260
caaaaccctg tctgccctag gatacgaacg tatcatgtac ctacagccga cggctccagt 1320
tcgcggcttt cctcctatc 1339
<210> 5
<211> 8559
<212> DNA
<213>the Maize genome flanking sequence (Artificial Sequence) of the end of entire T-DNA sequence, 5 ' and 3 '
<400> 5
tgtccggcat acctgttcat catttaaata atctaacacg gagtgtcctt tcttgagtga 60
cgcgccaaac ggtgtacttc tgttgtttct tgagtgacat aaaatggtgt acttctatta 120
cctaaggcat aattctaatt tataaagaga aggtaataca gccacaaatt agtaacatct 180
aagcaaatac agcactgctt ctggaaattt tatcatctat attcagtaag ctaaacccag 240
ccactattaa gtttcatgat tttatcatat gaaaaaaaaa tccaaagaaa ccatacggtt 300
atcaaaaact tagaaaaaca ggatgccttt ttgccaaagg gatttgatag acctttattt 360
ttcaggaaaa acaggggaaa agttaataac acattgcgga tacggccagg cgcgtccctg 420
ttaacgtcct aactagctaa actaggtaca gattgcgagg ctcacgaggc gatcctggcc 480
gcgtgacagt cgcgtgcgag gctcttgact aagtaggcgg ccgcgtgcac ttaattaaga 540
attccctgca gggatctagt aacatagatg acaccgcgcg cgataattta tcctagtttg 600
cgcgctatat tttgttttct atcgcgtatt aaatgtataa ttgcgggact ctaatcataa 660
aaacccatct cataaataac gtcatgcatt acatgttaat tattacatgc ttaacgtaat 720
tcaacagaaa ttatatgata atcatcgcaa gaccggcaac aggattcaat cttaagaaac 780
tttattgcca aatgtttgaa cgatcactag ttcagatctg ggtaactggc ctaactggcc 840
ttggaggagc tggcaactca aaatcccttt gccaaaaacc aacatcatgc catccaccat 900
gcttgtatcc agctgcgcgc aatgtacccc gggctgtgta tcccaaagcc tcatgcaacc 960
taacagatgg atcgtttgga aggcctataa cagcaaccac agacttaaaa ccttgcgcct 1020
ccatagactt aagcaaatgt gtgtacaatg tggatcctag gcccaacctt tgatgcctat 1080
gtgacacgta aacagtactc tcaactgtcc aatcgtaagc gttcctagcc ttccagggcc 1140
cagcgtaagc aataccagcc acaacaccct caacctcagc aaccaaccaa gggtatctat 1200
cttgcaacct ctctagatca tcaatccact cttgtggtgt ttgtggctct gtcctaaagt 1260
tcactgtaga cgtctcaatg taatggttaa cgatatcaca aaccgcggcc atatcagctg 1320
ctgtagctgg cctaatctca actggtctcc tctccggaga catggtaccc tgcagaagta 1380
acaccaaaca acagggtgag catcgacaaa agaaacagta ccaagcaaat aaatagcgta 1440
tgaaggcagg gctaaaaaaa tccacatata gctgctgcat atgccatcat ccaagtatat 1500
caagatcaaa ataattataa aacatacttg tttattataa tagataggta ctcaaggtta 1560
gagcatatga atagatgctg catatgccat catgtatatg catcagtaaa acccacatca 1620
acatgtatac ctatcctaga tcgatatttc catccatctt aaactcgtaa ctatgaagat 1680
gtatgacaca cacatacagt tccaaaatta ataaatacac caggtagttt gaaacagtat 1740
tctactccga tctagaacga atgaacgacc gcccaaccac accacatcat cacaaccaag 1800
cgaacaaaaa gcatctctgt atatgcatca gtaaaacccg catcaacatg tatacctatc 1860
ctagatcgat atttccatcc atcatcttca attcgtaact atgaatatgt atggcacaca 1920
catacagatc caaaattaat aaatccacca ggtagtttga aacagaattc tactccgatc 1980
tagaacgacc gcccaaccag accacatcat cacaaccaag acaaaaaaaa gcatgaaaag 2040
atgacccgac aaacaagtgc acggcatata ttgaaataaa ggaaaagggc aaaccaaacc 2100
ctatgcaacg aaacaaaaaa aatcatgaaa tcgatcccgt ctgcggaacg gctagagcca 2160
tcccaggatt ccccaaagag aaacactggc aagttagcaa tcagaacgtg tctgacgtac 2220
aggtcgcatc cgtgtacgaa cgctagcagc acggatctaa cacaaacacg gatctaacac 2280
aaacatgaac agaagtagaa ctaccgggcc ctaaccatgg accggaacgc cgatctagag 2340
aaggtagaga gggggggggg gggaggacga gcggcgtacc ttgaagcgga ggtgccgacg 2400
ggtggatttg ggggagatct ggttgtgtgt gtgtgcgctc cgaacaacac gaggttgggg 2460
aaagagggtg tggagggggt gtctatttat tacggcgggc gaggaaggga aagcgaagga 2520
gcggtgggaa aggaatcccc cgtagctgcc ggtgccgtga gaggaggagg aggccgcctg 2580
ccgtgccggc tcacgtctgc cgctccgcca cgcaatttct ggatgccgac agcggagcaa 2640
gtccaacggt ggagcggaac tctcgagagg ggtccagagg cagcgacaga gatgccgtgc 2700
cgtctgcttc gcttggcccg acgcgacgct gctggttcgc tggttggtgt ccgttagact 2760
cgtcgacggc gtttaacagg ctggcattat ctactcgaaa caagaaaaat gtttccttag 2820
tttttttaat ttcttaaagg gtatttgttt aatttttagt cactttattt tattctattt 2880
tatatctaaa ttattaaata aaaaaactaa aatagagttt tagttttctt aatttagagg 2940
ctaaaataga ataaaataga tgtactaaaa aaattagtct ataaaaacca ttaaccctaa 3000
accctaaatg gatgtactaa taaaatggat gaagtattat ataggtgaag ctatttgcaa 3060
aaaaaaagga gaacacatgc acactaaaaa gataaaactg tagagtcctg ttgtcaaaat 3120
actcaattgt cctttagacc atgtctaact gttcatttat atgattctct aaaacactga 3180
tattattgta gtactataga ttatattatt cgtagagtaa agtttaaata tatgtataaa 3240
gatagataaa ctgcacttca aacaagtgtg acaaaaaaaa tatgtggtaa ttttttataa 3300
cttagacatg caatgctcat tatctctaga gaggggcacg accgggtcac gctgcactgc 3360
aggccctagg atttaagtga ctagggtcac gtgactctag tcacttactg gcgcgccgat 3420
ctagtaacat agatgacacc gcgcgcgata atttatccta gtttgcgcgc tatattttgt 3480
tttctatcgc gtattaaatg tataattgcg ggactctaat cataaaaacc catctcataa 3540
ataacgtcat gcattacatg ttaattatta catgcttaac gtaattcaac agaaattata 3600
tgataatcat cgcaagaccg gcaacaggat tcaatcttaa gaaactttat tgccaaatgt 3660
ttgaacgatc tcacttgatg ctcacgtcgt aaaaatgaac aatggggccg ccgtagaggt 3720
tattcccttg ggacagttcg atataaaagt tgtccttctc aaacttcgtg gtgaacattt 3780
ctgacacatc cttagcgcca gacatgtatc tcttctcgaa gaggacttcc cgcgagttcc 3840
tgatgcgcac attcgcgtcg ccggaaactg aaaaatagac tctgtaggta gagaacgaat 3900
ccagttggag gttctgcttc agaatgcctc tcccgccctg gtaaagcgtc agggtgttcc 3960
ccgagatatt cgtgctgcca gtggatgtcc agttattggt gttaatcagc tcggggctca 4020
ggagcttctc gctaggggag atttcgagaa tgatgaagtt gtcgccccag gcctcatcgc 4080
cattctggga cttgagaata agatagaccc ccttcaggtc agtgccagtt gtgaacctct 4140
tattgattgt ctggtagtcc tccaggttgt tgttagtatc ttcgtaatgg atgtaccctg 4200
tgttctcatc cttgaggtgg atgcttggct tgcccttcac agtatattga atcacgtatt 4260
ctgtcttcgg cttcagcttg tcgccaatga actgggagat gccaccatcc ttatgcacat 4320
agagcgcctt agtgccattc accccgcctg tgtggtcaac gtatgcgttc ttattgttag 4380
ccttccacgg ttccagatta tcttcctcaa ttgacccgtt ctccacaata ttggagatga 4440
agcctgatgg cggaacgatc agcttcgttt ccttgttaga gaggtcggtg gcaagcagca 4500
gctccctgag gtagctcttg cacgtaaggg tgatcaggcg ggagttctca tctgcctgga 4560
gcccaaagcc attgatgggc gtgaggaagg tctcagaaat gaccccaaga ggcatataca 4620
cgccatcgtc gttcgccgac agggttctgt attcggcctc ggatgattcg accttcttct 4680
tgttgaggtc gatctcgccc gtagacgaat catagaagtt agccgtcacc tcgtaccgga 4740
gtgtcttcat cttcttcgta aagtcaatct tggtgatcac gtattcgttg gggaagacaa 4800
tattgttcgt atagtagatt tgctcggact gatcagggca aagcagctta tccatgtcgc 4860
cgtagataac ctctgacaga gaatccttgt ccacttgata attctgcttg agcttcgcct 4920
cgtagacctt cagcacggta attgagtcgt tagaaatctc gaacccgatg agcgcatggc 4980
caggcttggc ctcaacgatc atctttgcat cttcgtcgga gcccttgacc ttagcgtagt 5040
ttggattaga aaaagtgttc gagagtgtcg gaaggatatt cacgcggaac tcctccttct 5100
ccttgttcag gtgctcgttc atgatggagg tgtaatcgat gtctgcgagg ccgaggagct 5160
tgcggcaggt ggtcagcgtg agaaacgctt gggcctggag tgcggtgagg acgataagga 5220
agttgtaaac attcccgacc tccgagccgc tcgtcttaac gttctccttg gtgatcagtt 5280
ccgatgcagt cttgagagcg ctccgcccaa aaagattgtt gcccaccata acgtcgtgga 5340
acgtgttcag gtaaaactcg aagccatcga cgtcattctt ggtcacggac ttcgccagct 5400
cagtgagttc tgtaagctca tccaggatgt cggctggtga gccatccttc ttgaccttgc 5460
tggaagtttc tgtagcaaaa gtgagttcct cgaacttctc attcacatac ttgatcctct 5520
ggtacgccgg tgtaatctcc gtcagggtgc tgttgatgag gacgttcaca ttaatgatat 5580
ccagcttgtc cgagatttct tgaagctgct tgctcagata ctcaatttga agggacagcg 5640
cgtagttctg cttcatgacg tccgagagca tgctagtaat ctttgggagg tacacgcgaa 5700
gcattgtgtt gatggcgtcg agcttattgt tcacatcatt aagaacttgg ttctgctcat 5760
ttgcaatctt gaggatctcc ttagacagtt ctgtgttgag attcccctga gcgatgaggt 5820
cgttaagtga cccattcacg ccgtccagct tgccagagat atcgttcagg agttgctgat 5880
tcttaagaat ctcgtcgagc gtaagatccc cgccagtgtc tgtcttgaag atcatgttca 5940
taatgtcctt gatccccgta gcaaacccat agatgccatt aaagtagtca ataaaggagg 6000
gaagtgcccg tgtggagagc ttggtgttgt tcttgttcat actagtggcc gcttggtatc 6060
tgcattacaa tgaaatgagc aaagactatg tgagtaacac tggtcaacac tagggagaag 6120
gcatcgagca agatacgtat gtaaagagaa gcaatatagt gtcagttggt agatactaga 6180
taccatcagg aggtaaggag agcaacaaaa aggaaactct ttatttttaa attttgttac 6240
aacaaacaag cagatcaatg catcaaaata ctgtcagtac ttatttcttc agacaacaat 6300
atttaaaaca agtgcatctg atcttgactt atggtcacaa taaaggagca gagataaaca 6360
tcaaaatttc gtcatttata tttattcctt caggcgttaa caatttaaca gcacacaaac 6420
aaaaacagaa taggaatatc taattttggc aaataataag ctctgcagac gaacaaatta 6480
ttatagtatc gcctataata tgaatcccta tactattgac ccatgtagta tgaagcctgt 6540
gcctaaatta acagcaaact tctgaatcca agtgccctat aacaccaaca tgtgcttaaa 6600
taaataccgc taagcaccaa attacacatt tctcgtattg ctgtgtaggt tctatcttcg 6660
tttcgtacta ccatgtccct atattttgct gctacaaagg acggcaagta atcagcacag 6720
gcagaacacg atttcagagt gtaattctag atccagctaa accactctca gcaatcacca 6780
cacaagagag cattcagaga aacgtggcag taacaaaggc agagggcgga gtgagcgcgt 6840
accgaagacg gttctgctag agtcagcttg tcagcgtgtc ctctccaaat gaaatgaact 6900
tccttatata gaggaagggt cttgcgaagg atagtgggat tgtgcgtcat cccttacgtc 6960
agtggagata tcacatcaat ccacttgctt tgaagacgtg gttggaacgt cttctttttc 7020
cacgatgctc ctcgtgggtg ggggtccatc tttgggacca ctgtcggcag aggcatcttc 7080
aacgatggcc tttcctttat cgcaatgatg gcatttgtag gagccacctt ccttttccac 7140
tatcttcaca ataaagtgac agatagctgg gcaatggaat ccgaggaggt ttccggatat 7200
taccctttgt tgaaaagtct caatcggacc atcacatcaa tccacttgct ttgaagacgt 7260
ggttggaacg tcttcttttt ccacgatgct cctcgtgggt gggggtccat ctttgggacc 7320
actgtcggca gaggcatctt caacgatggc ctttccttta tcgcaatgat ggcatttgta 7380
ggagccacct tccttttcca ctatcttcac aataaagtga cagatagctg ggcaatggaa 7440
tccgaggagg tttccggata ttaccctttg ttgaaaagtc tcaatcggac caagcttatt 7500
taaatggtac cttaattaag tgcacgttta aactacctag tcagtgccgt tgagagcgta 7560
gctgcgactt agcggcctcg tctgcgaagt cggtgaggct agtgccacta attagtcatt 7620
agtttaatac aaatccacct gcggccaatt cctgcagcgt tgcggttctg tcagttccaa 7680
acgtaaaacg gcttgtcccg cgtcatcggc gggggtcata acgtgactcc cttaattctc 7740
cgctcatgat cagattgtcg tttcccgcct tcagtttaaa ctatcagtgt aactataaat 7800
ggtatagtag tccggatttt gtttccgaat aaagaaatgt tcaatgtatt tgaaatgatc 7860
aatagatact caaattatat gattagcaag cttaaataga gttttttttt caggtccatt 7920
tcttttcctt agattacaga agcaccataa cacattccaa aagtaattgc atgcacccaa 7980
gaatctgcta atgttccaag tgttgaaaac aaccaaaact gtacttatca cttaatgaaa 8040
tacatggcac aaacaaaaaa aaaaactgaa tatgcctgcg aacatagcag aagtggttgt 8100
catgtactag aaacattatt gtgtcttcga acaagctgct catataatgg aagatggttc 8160
tttgcaacaa aaaccctgaa cctgtaaagc aaatgagaag gacaattaag cataaataaa 8220
ggtgcaataa cacaagggaa caaaccacta aaccaatgtt ttaaagttgc ccgactaatc 8280
gtgattactc aaccttattg cagcacgatt aggattaggc tgtacgacac gactagggtg 8340
attagaactc ggatcgtctg actaatcatg attaaacggt gattagtcat cggactagga 8400
gttcaaccca ctaacctgag ccgcctgact ttttttttgg gccggaccac agtgggtaag 8460
gtttttttat tttctcttga caaaaccctg tctgccctag gatacgaacg tatcatgtac 8520
ctacagccga cggctccagt tcgcggcttt cctcctatc 8559
<210> 6
<211> 190
<212> DNA
<213>sequence being located on SEQ ID NO:3, spans left boundary area (LB and tNos transcription terminator
Artificial Sequence)
<400> 6
aataacacat tgcggatacg gccaggcgcg tccctgttaa cgtcctaact agctaaacta 60
ggtacagatt gcgaggctca cgaggcgatc ctggccgcgt gacagtcgcg tgcgaggctc 120
ttgactaagt aggcggccgc gtgcacttaa ttaagaattc cctgcaggga tctagtaaca 180
tagatgacac 190
<210> 7
<211> 200
<212> DNA
<213>sequence being located on SEQ ID NO:4, spans pr35S transcriptional initiation sequence and right side boundary region
(RBArtificial Sequence)
<400> 7
tgaaaagtct caatcggacc aagcttattt aaatggtacc ttaattaagt gcacgtttaa 60
actacctagt cagtgccgtt gagagcgtag ctgcgactta gcggcctcgt ctgcgaagtc 120
ggtgaggcta gtgccactaa ttagtcatta gtttaataca aatccacctg cggccaattc 180
ctgcagcgtt gcggttctgt 200
<210> 8
<211> 21
<212> DNA
<213>the first primer (Artificial Sequence) of SEQ ID NO:3 is expanded
<400> 8
tgtccggcat acctgttcat c 21
<210> 9
<211> 20
<212> DNA
<213>the second primer (Artificial Sequence) of SEQ ID NO:3 is expanded
<400> 9
tgaatcctgt tgccggtctt 20
<210> 10
<211> 20
<212> DNA
<213>the first primer (Artificial Sequence) of SEQ ID NO:4 is expanded
<400> 10
gataggagga aagccgcgaa 20
<210> 11
<211> 21
<212> DNA
<213>the second primer (Artificial Sequence) of SEQ ID NO:4 is expanded
<400> 11
caatcggacc atcacatcaa t 21
<210> 12
<211> 22
<212> DNA
Primer (Artificial Sequence) on<213>5 ' flanking genomic sequences
<400> 12
tgccaaaggg atttgataga cc 22
<210> 13
<211> 20
<212> DNA
<213>primer (Artificial Sequence) being located on T-DNA matched with SEQ ID NO:12
<400> 13
gccgtatccg caatgtgtta 20
<210> 14
<211> 21
<212> DNA
Primer on<213>3 ' flanking genomic sequences, can detecte transgenosis with SEQ ID NO:12 pairing is homozygote
Or heterozygote (Artificial Sequence)
<400> 14
ttttggaatg tgttatggtg c 21
<210> 15
<211> 20
<212> DNA
<213>primer (Artificial Sequence) being located on T-DNA matched with SEQ ID NO:14
<400> 15
cgttgagagc gtagctgcga 20
<210> 16
<211> 21
<212> DNA
<213>Taqman detects the first primer (Artificial Sequence) of Vip3Aa19 gene
<400> 16
cgaatacaga accctgtcgg c 21
<210> 17
<211> 24
<212> DNA
<213>Taqman detects the second primer (Artificial Sequence) of Vip3Aa19 gene
<400> 17
cgtgaggaag gtctcagaaa tgac 24
<210> 18
<211> 27
<212> DNA
<213>Taqman detects the probe (Artificial Sequence) of Vip3Aa19 gene
<400> 18
cgacgatggc gtgtatatgc ctcttgg 27
<210> 19
<211> 22
<212> DNA
<213>Taqman detects the first primer (Artificial Sequence) of pat gene
<400> 19
gagggtgttg tggctggtat tg 22
<210> 20
<211> 23
<212> DNA
<213>Taqman detects the second primer (Artificial Sequence) of pat gene
<400> 20
tctcaactgt ccaatcgtaa gcg 23
<210> 21
<211> 25
<212> DNA
<213>Taqman detects the probe (Artificial Sequence) of pat gene
<400> 21
cttacgctgg gccctggaag gctag 25
<210> 22
<211> 21
<212> DNA
<213>the first primer (Artificial Sequence) of corn endogenous gene SSIIb
<400> 22
cggtggatgc taaggctgat g 21
<210> 23
<211> 23
<212> DNA
<213>the second primer (Artificial Sequence) of corn endogenous gene SSIIb
<400> 23
aaagggccag gttcattatc ctc 23
<210> 24
<211> 348
<212> DNA
<213>in Southern hybridization check Vip3Aa19 gene probe (Artificial Sequence)
<400> 24
tctcaagtcc cagaatggcg atgaggcctg gggcgacaac ttcatcattc tcgaaatctc 60
ccctagcgag aagctcctga gccccgagct gattaacacc aataactgga catccactgg 120
cagcacgaat atctcgggga acaccctgac gctttaccag ggcgggagag gcattctgaa 180
gcagaacctc caactggatt cgttctctac ctacagagtc tatttttcag tttccggcga 240
cgcgaatgtg cgcatcagga actcgcggga agtcctcttc gagaagagat acatgtctgg 300
cgctaaggat gtgtcagaaa tgttcaccac gaagtttgag aaggacaa 348
<210> 25
<211> 310
<212> DNA
<213>in Southern hybridization check pat gene probe (Artificial Sequence)
<400> 25
cagacttaaa accttgcgcc tccatagact taagcaaatg tgtgtacaat gtggatccta 60
ggcccaacct ttgatgccta tgtgacacgt aaacagtact ctcaactgtc caatcgtaag 120
cgttcctagc cttccagggc ccagcgtaag caataccagc cacaacaccc tcaacctcag 180
caaccaacca agggtatcta tcttgcaacc tctctagatc atcaatccac tcttgtggtg 240
tttgtggctc tgtcctaaag ttcactgtag acgtctcaat gtaatggtta acgatatcac 300
aaaccgcggc 310
<210> 26
<211> 20
<212> DNA
<213>primer being located on T-DNA, it is consistent with the direction ID NO:13 SEQ (Artificial Sequence)
<400> 26
gcgcgcaaac taggataaat 20
<210> 27
<211> 20
<212> DNA
<213>primer being located on T-DNA, it is contrary with SEQ ID NO:13, it is used as and obtains flanking sequence
(Artificial Sequence)
<400> 27
ccagccacaa caccctcaac 20
<210> 28
<211> 22
<212> DNA
<213>primer being located on T-DNA, it is contrary with SEQ ID NO:13, it is used as and obtains flanking sequence
(Artificial Sequence)
<400> 28
gtggtgtttg tggctctgtc ct 22
<210> 29
<211> 22
<212> DNA
<213>primer being located on T-DNA, it is consistent with the direction ID NO:15 SEQ (Artificial Sequence)
<400> 29
tgctttgaag acgtggttgg aa 22
<210> 30
<211> 20
<212> DNA
<213>primer being located on T-DNA, it is contrary with SEQ ID NO:15, it is used as and obtains flanking sequence
(Artificial Sequence)
<400> 30
ctgctccttt attgtgacca 20
<210> 31
<211> 20
<212> DNA
<213>primer being located on T-DNA, it is contrary with SEQ ID NO:15, it is used as and obtains flanking sequence
(Artificial Sequence)
<400> 31
tatcttgctc gatgccttct 20
Claims (13)
1. a kind of nucleic acid sequence, which is characterized in that have in SEQ ID NO:3 or its complementary series 1-384 at least 11
In continuous nucleotide and SEQ ID NO:3 or its complementary series 385-768 at least 11 continuous nucleotide, and/or
At least 11 continuous nucleotide and SEQ ID NO:4 or its complementary sequence in SEQ ID NO:4 or its complementary series 1-564
Arrange at least 11 continuous nucleotide in 565-1339;
Preferably, the nucleic acid sequence has 22-25 continuous core in SEQ ID NO:3 or its complementary series 1-384
22-25 continuous nucleotide, and/or SEQ ID NO in thuja acid and SEQ ID NO:3 or its complementary series 385-768:
4 or its complementary series 1-564 in the continuous nucleotide of 22-25 and SEQ ID NO:4 or its complementary series 565-
22-25 continuous nucleotide in 1339;
Preferably, the nucleic acid sequence includes SEQ ID NO:1 or its complementary series, and/or SEQ ID NO:2 or its complementary sequence
Column;
Preferably, the nucleic acid sequence includes SEQ ID NO:3 or its complementary series, and/or SEQ ID NO:4 or its complementary sequence
Column.
2. nucleic acid sequence according to claim 1, which is characterized in that the nucleic acid sequence include SEQ ID NO:5 or its
Complementary series.
3. a kind of method existing for DNA of test sample transgenic corn event DBN9501 characterized by comprising
Contact sample to be tested in nucleic acid amplification reaction at least two primers for expanding target amplification product;
Carry out nucleic acid amplification reaction;With
Detect the presence of the target amplification product;
The target amplification product includes nucleic acid sequence as claimed in claim 1 or 2;Preferably, the target amplification product includes
SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series, and/or
SEQ ID NO:7 or its complementary series.
4. method existing for the DNA of test sample transgenic corn event DBN9501 according to claim 3, feature
Be, the primer includes the first primer and the second primer, the first primer be selected from SEQ ID NO:1, SEQ ID NO:8 and
SEQ ID NO:10;Second primer is selected from SEQ ID NO:2, SEQ ID NO:9 and SEQ ID NO:11.
5. a kind of method existing for DNA of test sample transgenic corn event DBN9501 characterized by comprising
Contact sample to be tested with probe, the probe includes nucleic acid sequence described in claim 1;Preferably, the probe
Comprising SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its complementary series, SEQ ID NO:6 or its complementary series,
And/or SEQ ID NO:7 or its complementary series;
Hybridize the sample to be tested and the probe under stringent hybridization conditions;With
Detect the hybridisation events of the sample to be tested and the probe.
6. method existing for the DNA of test sample transgenic corn event DBN9501 according to claim 5, feature
It is, at least one fluorophor label of at least one described probe.
7. a kind of method existing for DNA of test sample transgenic corn event DBN9501 characterized by comprising
Contact sample to be tested with marker nucleic acid molecules, the marker nucleic acid molecules include nucleic acid described in claim 1
Sequence;Preferably, the marker nucleic acid molecules include at least one selected from the following: SEQ ID NO:1 or its complementary series,
SEQ ID NO:2 or its complementary series, and/or SEQ ID NO:6-11 or its complementary series;
Hybridize the sample to be tested and the marker nucleic acid molecules under stringent hybridization conditions;
The hybridisation events of the sample to be tested and the marker nucleic acid molecules are detected, and then pass through marker assistant breeding point
Analysis is to determine that insect-resistant and/or herbicide tolerant and marker nucleic acid molecules are chain on science of heredity.
8. a kind of DNA detection kit, which is characterized in that including at least one DNA molecular, the DNA molecular is wanted comprising right
1 nucleic acid sequence is sought, can be used as there is the DNA of specificity to draw transgenic corn events DBN9501 or its offspring
One of object or probe;Preferably, the DNA molecular include SEQ ID NO:1 or its complementary series, SEQ ID NO:2 or its mutually
Complementary series, SEQ ID NO:6 or its complementary series, and/or SEQ ID NO:7 or its complementary series.
9. a kind of protection corn plant is from the method for insect infestations, which is characterized in that including being provided in the diet of target insect
At least one transgenic corn plant cell, the transgenic corn plant cell include SEQ ID NO:1 in its genome
And/or sequence shown in SEQ ID NO:2, the target insect for the transgenic corn plant cell of ingesting, which is suppressed, further to ingest
The rotaring gene corn plant;
Preferably, the transgenic corn plant cell includes SEQ ID NO:3 and/or SEQ ID NO:4 in its genome
Shown in sequence;
Preferably, the transgenic corn plant cell successively includes SEQ ID NO:1, SEQ ID NO:5 in its genome
553-7491 nucleic acid sequences and SEQ ID NO:2, or include sequence shown in SEQ ID NO:5.
10. a kind of protect corn plant from the big Tanaka weeds of the damage as caused by herbicide or control maize planting plant
Method, which is characterized in that be applied at least one transgenic corns plant of plantation including effective dose glufosinate-ammonium herbicide will be contained
The big Tanaka of object, the rotaring gene corn plant include shown in SEQ ID NO:1 and/or SEQ ID NO:2 in its genome
Sequence, the rotaring gene corn plant to glufosinate-ammonium herbicide have tolerance;
Preferably, the rotaring gene corn plant includes shown in SEQ ID NO:3 and/or SEQ ID NO:4 in its genome
Sequence;
Preferably, the rotaring gene corn plant is in its genome successively comprising SEQ ID NO:1, SEQ ID NO:5 the
553-7491 nucleic acid sequences and SEQ ID NO:2, or include sequence shown in SEQ ID NO:5.
11. a kind of method for cultivating resistant to insect and/or tolerance glufosinate-ammonium herbicide corn plant, feature exist
In, comprising:
Plant an at least corn seed, the core comprising coding insect-resistant Vip3Aa albumen in the genome of the corn seed
The nucleic acid sequence of the nucleic acid sequence and specific region of acid sequence and/or coding glufosinate-ammonium herbicide tolerant PAT albumen, or
Include nucleic acid sequence shown in SEQ ID NO:5 in the genome of the corn seed;
The corn seed is set to grow up to plant;
The plant described in target insect infestations and/or the plant described in effective dose glufosinate-ammonium herbicide spray, harvest
There is the plant of the plant injury weakened compared with the plant for the nucleic acid sequence that other do not have specific region;
The nucleic acid sequence of the specific region is sequence shown in SEQ ID NO:1 and/or SEQ ID NO:2;Preferably, described
The nucleic acid sequence of specific region is sequence shown in SEQ ID NO:3 and/or SEQ ID NO:4.
12. a kind of method for generating plant resistant to insect and/or that there is tolerance to glufosinate-ammonium herbicide,
Be characterized in that, including will include in the first corn plant genome coding insect-resistant Vip3Aa albumen nucleic acid sequence and/
Or the nucleic acid sequence of glufosinate tolerant PAT albumen and the nucleic acid sequence of specific region are encoded, or first corn is planted
Nucleic acid sequence shown in the SEQ ID NO:5 for including in object genome introduces the second corn plant, plants to generate a large amount of filial generations
Strain;The progeny plant with the nucleic acid sequence of the specific region is selected, and the progeny plant is resistant to insect
And/or there is tolerance to glufosinate-ammonium herbicide;The nucleic acid sequence of the specific region is SEQ ID NO:1 and/or SEQ ID
Sequence shown in NO:2;Preferably, the nucleic acid sequence of the specific region is shown in SEQ ID NO:3 and/or SEQ ID NO:4
Sequence;
Preferably, the method includes transgenic corn events DBN9501 and lacking insect-resistant and/or glufosinate tolerant
Plant carry out sexual hybridization, to generate a large amount of progeny plants, select the nucleic acid sequence with the specific region
The progeny plant;
The progeny plant is handled with target insect infestations and/or with glufosinate-ammonium;
Select the progeny plant resistant to insect and/or that there is tolerance to glufosinate-ammonium herbicide.
13. a kind of agricultural product or commodity for being produced from transgenic corn events DBN9501, which is characterized in that the agricultural product or
Commodity are hominy grits, maize flour, corn oil, corn silk, cornstarch, corn gluten, corn-dodger, cosmetics or filling
Agent.
Priority Applications (6)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910280088.XA CN109868273B (en) | 2019-04-09 | 2019-04-09 | Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof |
MX2021010933A MX2021010933A (en) | 2019-04-09 | 2020-02-21 | Nucleic acid sequence for detecting maize plant dbn9501 and detection method therefor. |
BR112021000302-9A BR112021000302A2 (en) | 2019-04-09 | 2020-02-21 | NUCLEIC ACID SEQUENCE, METHOD FOR DETECTING THE PRESENCE OF THE DNA FROM THE DBN9501 TRANSMENING CORN EVENT IN A SAMPLE, DNA DETECTION KIT, METHODS TO PROTECT A CORN PLANT, METHOD OF CREATING A RESISTANT CORN PLANT / LARGE CORN PLANT TO THE HERBICIDE GLUFOSINATE AND AGRICULTURAL PRODUCT OR COMMODITY DERIVED FROM THE GMN CORN EVENT DBN9501 |
PCT/CN2020/076208 WO2020207125A1 (en) | 2019-04-09 | 2020-02-21 | Nucleic acid sequence for detecting maize plant dbn9501 and detection method therefor |
ARP200100835A AR118492A1 (en) | 2019-04-09 | 2020-03-26 | NUCLEIC ACID SEQUENCES AND METHODS TO DETECT DBN9501 CORN PLANT |
ZA2021/04864A ZA202104864B (en) | 2019-04-09 | 2021-07-12 | Nucleic acid sequence for detecting maize plant dbn9501 and detection method therefor |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201910280088.XA CN109868273B (en) | 2019-04-09 | 2019-04-09 | Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN109868273A true CN109868273A (en) | 2019-06-11 |
CN109868273B CN109868273B (en) | 2023-02-03 |
Family
ID=66922273
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201910280088.XA Active CN109868273B (en) | 2019-04-09 | 2019-04-09 | Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof |
Country Status (6)
Country | Link |
---|---|
CN (1) | CN109868273B (en) |
AR (1) | AR118492A1 (en) |
BR (1) | BR112021000302A2 (en) |
MX (1) | MX2021010933A (en) |
WO (1) | WO2020207125A1 (en) |
ZA (1) | ZA202104864B (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020207125A1 (en) * | 2019-04-09 | 2020-10-15 | 北京大北农生物技术有限公司 | Nucleic acid sequence for detecting maize plant dbn9501 and detection method therefor |
CN113151533A (en) * | 2021-01-27 | 2021-07-23 | 隆平生物技术(海南)有限公司 | Transgenic maize event LP007-6 and methods of detecting same |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112852801B (en) * | 2021-01-27 | 2023-08-08 | 隆平生物技术(海南)有限公司 | Transgenic corn event LP007-1 and detection method thereof |
CN112877454B (en) * | 2021-01-27 | 2023-08-08 | 隆平生物技术(海南)有限公司 | Transgenic corn event LP007-3 and detection method thereof |
CN116144672B (en) * | 2022-09-23 | 2023-11-07 | 隆平生物技术(海南)有限公司 | Transgenic corn event LP026-1 and detection method thereof |
CN116676304B (en) * | 2023-07-20 | 2023-09-26 | 隆平生物技术(海南)有限公司 | Transgenic corn event LP016-1 and detection method thereof |
CN116694627B (en) * | 2023-07-26 | 2023-09-29 | 隆平生物技术(海南)有限公司 | Transgenic corn event LP035-1 and detection method thereof |
CN116694629B (en) * | 2023-07-31 | 2023-09-29 | 隆平生物技术(海南)有限公司 | Transgenic corn event LP038-1 and detection method thereof |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103039494A (en) * | 2012-12-05 | 2013-04-17 | 北京大北农科技集团股份有限公司 | Method for controlling pests |
CN103555716A (en) * | 2013-11-06 | 2014-02-05 | 北京大北农科技集团股份有限公司 | Intron sequence for enhancing expression and application of intron sequence |
CN104878092A (en) * | 2015-04-30 | 2015-09-02 | 北京大北农科技集团股份有限公司 | Nucleic acid sequence for detecting corn plant DBN9953 and detecting method thereof |
CN104878096A (en) * | 2015-04-30 | 2015-09-02 | 北京大北农科技集团股份有限公司 | Nucleotide sequence for detecting herbicide-tolerant corn plant DBN9868 and detection method thereof |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101402996A (en) * | 2008-11-06 | 2009-04-08 | 东北农业大学 | High throughput five-nest type PCR transgenic detection method for finely processed product of food crop |
BR112012015692A2 (en) * | 2009-12-23 | 2015-08-25 | Bayer Intelectual Property Gmbh | Hppds inhibitor herbicide tolerant plants. |
UA111592C2 (en) * | 2010-07-07 | 2016-05-25 | Сінгента Партісіпейшнс Аг | METHOD OF CONTROL ABOUT SOLID WIND PESTS |
CN103719136A (en) * | 2013-11-15 | 2014-04-16 | 北京大北农科技集团股份有限公司 | Pest control method |
CN109868273B (en) * | 2019-04-09 | 2023-02-03 | 北京大北农生物技术有限公司 | Nucleic acid sequence for detecting corn plant DBN9501 and detection method thereof |
-
2019
- 2019-04-09 CN CN201910280088.XA patent/CN109868273B/en active Active
-
2020
- 2020-02-21 MX MX2021010933A patent/MX2021010933A/en unknown
- 2020-02-21 WO PCT/CN2020/076208 patent/WO2020207125A1/en active Application Filing
- 2020-02-21 BR BR112021000302-9A patent/BR112021000302A2/en unknown
- 2020-03-26 AR ARP200100835A patent/AR118492A1/en unknown
-
2021
- 2021-07-12 ZA ZA2021/04864A patent/ZA202104864B/en unknown
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103039494A (en) * | 2012-12-05 | 2013-04-17 | 北京大北农科技集团股份有限公司 | Method for controlling pests |
CN103555716A (en) * | 2013-11-06 | 2014-02-05 | 北京大北农科技集团股份有限公司 | Intron sequence for enhancing expression and application of intron sequence |
CN104878092A (en) * | 2015-04-30 | 2015-09-02 | 北京大北农科技集团股份有限公司 | Nucleic acid sequence for detecting corn plant DBN9953 and detecting method thereof |
CN104878096A (en) * | 2015-04-30 | 2015-09-02 | 北京大北农科技集团股份有限公司 | Nucleotide sequence for detecting herbicide-tolerant corn plant DBN9868 and detection method thereof |
Non-Patent Citations (2)
Title |
---|
J. LIU 等: "Identification of vip3A-type genes from Bacillus thuringiensis strains and characterization of a novel vip3A-type gene", 《LETTERS IN APPLIED MICROBIOLOGY》 * |
SANDEEP KUMAR 等: "A combinatorial bidirectional and bicistronic approach for coordinated multi‑gene expression in corn", 《PLANT MOL BIOL》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2020207125A1 (en) * | 2019-04-09 | 2020-10-15 | 北京大北农生物技术有限公司 | Nucleic acid sequence for detecting maize plant dbn9501 and detection method therefor |
CN113151533A (en) * | 2021-01-27 | 2021-07-23 | 隆平生物技术(海南)有限公司 | Transgenic maize event LP007-6 and methods of detecting same |
CN113151533B (en) * | 2021-01-27 | 2023-08-08 | 隆平生物技术(海南)有限公司 | Transgenic corn event LP007-6 and detection method thereof |
Also Published As
Publication number | Publication date |
---|---|
BR112021000302A2 (en) | 2021-04-06 |
WO2020207125A1 (en) | 2020-10-15 |
MX2021010933A (en) | 2021-10-13 |
ZA202104864B (en) | 2022-05-25 |
AR118492A1 (en) | 2021-10-20 |
CN109868273B (en) | 2023-02-03 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104830847B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9936 | |
CN109868273A (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9501 | |
CN104878091B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9978 | |
CN112852801B (en) | Transgenic corn event LP007-1 and detection method thereof | |
CN116144818B (en) | Transgenic corn event LP026-2 and detection method thereof | |
CN104830845B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9878 | |
CN104878094B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9888 | |
CN104830846B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9898 | |
CN109971880A (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9508 | |
CN111247255B (en) | Nucleic acid sequence for detecting soybean plant DBN8007 and detection method thereof | |
CN104878092B (en) | Nucleic acid sequence and its detection method for detecting corn plant DBN9953 | |
CN110144363A (en) | Pest-resistant herbicide-resistant corn transformation event | |
CN111406117B (en) | Nucleic acid sequence for detecting soybean plant DBN8002 and detection method thereof | |
CN104878096B (en) | For detecting the nucleic acid sequence and its detection method of herbicide tolerant corn plant DBN9868 | |
CN116144817A (en) | Transgenic corn event LP026-4 and detection method thereof | |
CN104878095B (en) | Nucleic acid sequence and its detection method for detecting herbicide tolerant corn plant DBN9858 | |
CN116144671A (en) | Transgenic corn event LP026-3 and detection method thereof | |
CN104830983B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9968 | |
CN114787389A (en) | Nucleic acid sequence for detecting soybean plant DBN8205 and detection method thereof | |
CN116144672B (en) | Transgenic corn event LP026-1 and detection method thereof | |
CN104846084B (en) | For detecting the nucleic acid sequence and its detection method of corn plant DBN9927 | |
CN104878097B (en) | Nucleic acid sequence and its detection method for detecting corn plant DBN9981 | |
CN113980958B (en) | Transgenic corn event LP007-8 and detection method thereof | |
CN116640761B (en) | Transgenic maize event LP018-1 and detection method thereof | |
RU2815214C2 (en) | Nucleic acid sequence for detecting corn plant dbn9501 and method of its detection |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |