CN107475300B

CN107475300B - Construction method and application of Ifit3-eKO1 gene knockout mouse animal model

Info

Publication number: CN107475300B
Application number: CN201710839228.3A
Authority: CN
Inventors: 李冬; 吴军录; 权文强
Original assignee: Shanghai Tongji Hospital
Current assignee: Shanghai Tongji Hospital
Priority date: 2017-09-18
Filing date: 2017-09-18
Publication date: 2020-04-21
Anticipated expiration: 2037-09-18
Also published as: CN107475300A

Abstract

The invention relates to a method for establishing an Ifit3-eKO1 gene knockout mouse model, which belongs to the technical field of biology and comprises the following steps: step one, determining specific target sites sgRNA1 and sgRNA2 of a gene to be knocked out of an Ifit3-eKO1 mouse, and transcribing the sgRNA2 and Cas9 nuclease in vitro into mRNA; and step two, microinjecting the active sgRNA and Cas9RNA into a fertilized egg of a mouse to obtain an Ifit3-eKO1 gene knockout mouse. Its advantages are: the invention uses CRISPR/Cas9 gene knockout technology to establish a mouse animal model of Ifit3-eKO1 gene knockout for the first time, and provides a convenient, reliable and economic animal model for researching the action of Ifit3 in tumorigenesis and development.

Description

Construction method and application of Ifit3-eKO1 gene knockout mouse animal model

Technical Field

The invention relates to the technical field of biology, in particular to a construction method and application of an Ifit3-eKO1 gene knockout mouse animal model.

Background

The Ifit3 gene, also called RIG-G gene (retinoic acid-induced gene G), is a gene capable of being induced to express by all-trans retinoic acid (ATRA) cloned from the cell line NB4 of Acute Promyelocytic Leukemia (APL), is located on chromosome 10, q24, and encodes a protein containing 490 amino acid residues, and the molecular weight is about 60000.

Although Ifit3 was originally cloned from the acute promyelocytic leukemia cell line NB4, bioinformatics analysis indicated that Ifit3 is a member of the interferon inducible gene family. Research reports that Ifit3 can be significantly induced and expressed by ATRA in NB4 cells, and can also be rapidly induced and expressed by interferon in various tumor cells, including myeloid leukemia cell lines such as NB4, HL-60 and U937, and solid tumor cells such as cervical cancer cell line Hela, non-small cell lung cancer cell lines H460 and A549, head and neck squamous cancer cells. At present, the most direct and effective method for gene function research is to establish transgenic and/or gene knockout animal models.

The technology of regularly clustered interspaced short palindromic repeats (CRISPR/Cas9) is established based on immune system modification in bacteria and archaea, target DNA sequence recognition is carried out through guide RNA (sgRNA) mediated endonuclease Cas9 protein, DNA double-strand break is caused, damaged DNA is repaired in a homologous recombination or non-homologous end connection mode, and therefore multiple modifications such as gene site-directed knockout, knock-in and gene correction are achieved on a target site.

Due to the characteristics of high specificity, simple molecular construction and short flow, the CRISPR/Cas9 technology is rapidly developed in recent years. Two key factors are required for gene knockout using CRISPR/Cas9 technology, first the effective sgRNA guide sequence, and then the presence of Cas9 protein. Compared with a Zinc Finger Nuclease (ZFN) technology and a transcription-like effector nuclease (TALEN) technology, the gene has more and more extensive application due to the advantages of specificity, high efficiency, simplicity in design and the like of target gene targeted editing, and shows strong genome editing activity in bacteria, mammalian cells, zebrafish, mice, rats and the like.

Therefore, in the research, Cas9mRNA and sgRNA are obtained by a CRISPR/Cas9 technology in an in-vitro transcription mode to construct a mouse model for stably knocking out Ifit3-eKO1 genes, and a good foundation is laid for further researching the function of Ifit 3.

Chinese patent document CN107043787A discloses a construction method for obtaining a MARF1 site-directed mutagenesis mouse model based on CRISPR/Cas 9. Chinese patent document CN104293831A discloses a method for establishing a hypertension mouse model based on CRISPR/Cas9 gene knockout technology. Chinese patent document CN105950639A discloses a preparation method of a staphylococcus aureus CRISPR/Cas9 system and application thereof in constructing a gene modified mouse model. Chinese patent document CN106172238A discloses a method for establishing a miR-124 gene knockout mouse animal model by using a Crispr/cas9 gene knockout technology. However, no report is found about the construction method of an animal model of an Ifit3-eKO1 gene knockout mouse.

Disclosure of Invention

The invention aims to provide a method for constructing an animal model of an Ifit3-eKO1 gene knockout mouse aiming at the defects in the prior art.

The second purpose of the invention is to provide the application of the construction method of the animal model of the Ifit3-eKO1 gene knockout mouse.

The third purpose of the invention is to provide a cell for knocking out the Ifit3-eKO1 gene.

The fourth purpose of the invention is to provide sgRNA for constructing an Ifit3-eKO1 gene knockout mouse model based on CRISPR/Cas9 gene knockout technology.

A fifth object of the present invention is to provide use of the sgRNA described above.

In order to achieve the purpose, the invention adopts the technical scheme that: a method for establishing an Ifit3-eKO1 gene knockout mouse model, which is based on CRISPR/Cas9 gene knockout technology, and comprises the following steps:

step one, determining specific target sites sgRNA1 and sgRNA2 of a gene to be knocked out of an Ifit3-eKO1 mouse, and transcribing the sgRNA2 and Cas9 nuclease in vitro into mRNA;

and step two, microinjecting the active sgRNA and Cas9RNA into a fertilized egg of a mouse to obtain an Ifit3-eKO1 gene knockout mouse.

Further, sgRNA1 is shown in SEQ ID NO. 2, and sgRNA2 is shown in SEQ ID NO. 3.

Further, the second step in the method is as follows:

(1) ovulation promotion and in-vitro fertilization of the mouse, and fertilized egg cultivation;

(2) microinjecting the active sgRNA and Cas9RNA into a fertilized egg of a mouse;

(3) fertilized egg in vitro culture, receptor implantation and targeted gene modified animal culture.

Further, the method comprises the following steps:

(1) determining a target point to be knocked out of the Ifit3-eKO1 gene, and transcribing sgRNA and Cas9 nuclease mRNA in vitro;

(2) ovulation promotion of a mouse, in-vitro fertilization and fertilized egg microinjection;

(3) transplanting the fertilized eggs survived after injection into a pseudopregnant female mouse to produce a mouse, namely an F0 generation mouse;

(4) extracting tail DNA of the F0 mouse, performing PCR amplification and sequencing the product;

(5) mating the positive mouse with a wild type heteromouse to obtain an F1 generation heterozygote mouse;

(6) and hybridizing the heterozygote mice of the F1 generation to obtain homozygote mice of the F2 generation, namely the mouse animal model.

Further, the method also comprises a third step, wherein the third step is as follows: an animal model of an Ifit3-eKO1 knock-out mouse was identified.

Further, the third step in the method is the following steps:

transplanting the fertilized eggs survived after injection into a pseudopregnant female mouse to produce a mouse, namely an F0 generation mouse;

extracting tail DNA of the F0 mouse, amplifying by PCR and sequencing the product;

mating the positive mouse with a wild type heteromouse to obtain an F1 generation heterozygote mouse;

and hybridizing the heterozygote mice of the F1 generation to obtain homozygote mice of the F2 generation, namely the mouse animal model.

In order to achieve the second object, the invention adopts the technical scheme that: the method is applied to tumor research.

In order to achieve the third object, the invention adopts the technical scheme that: the Ifit3-eKO1 gene knocked-out cell of the mouse animal model obtained by the method.

In order to achieve the fourth object, the invention adopts the technical scheme that: an sgRNA of an Ifit3-eKO1 gene knockout mouse model is constructed based on CRISPR/Cas9 gene knockout technology, wherein sgRNA1 is shown as SEQ ID NO. 2, and sgRNA2 is shown as SEQ ID NO. 3.

In order to achieve the fifth object, the invention adopts the technical scheme that: application of sgRNA in establishment of gene-deficient mice

The invention has the advantages that:

according to the invention, a CRISPR/Cas9 gene knockout technology is used, a mouse animal model for Ifit3-eKO1 gene knockout is established for the first time, and successful implementation of the project provides a convenient, reliable and economic animal model for researching the effect of Ifit3 in tumorigenesis and development.

Drawings

FIG. 1 is a schematic diagram of CRISPR/Cas9 gene knockout mouse model establishment.

Figure 2 is a schematic diagram of CRISPR/Cas9 gene knockout design strategy.

Fig. 3 shows the results of in vitro transcription Cas9, sgRNA electrophoresis.

FIG. 4 shows the alignment of the results of the pre-and post-knockout sequencing of the F1 generation type 1 mouse gene.

FIG. 5 is an alignment of the results of pre-and post-knockout sequencing of the F1 generation 2 mouse gene.

FIG. 6 is the electrophoresis band diagram of the F2 mouse PCR identification.

FIG. 7 is a PCR sequencing identification map of F2 mouse.

Detailed Description

The following detailed description of the present invention will be made with reference to the accompanying drawings.

The implementation class relates to a method for establishing an Ifit3-eKO1 gene knockout mouse model based on a CRISPR/Cas9 gene knockout technology, and the technical route is shown in figure 1.

Second, the basic information of the gene is surely knocked out

1. Knockout gene name (MGI No.: ifit3(1101055)

2. Knocking out the address link of MGI gene: http:// www.informatics.jax.org/marker/MGI 1101055

3. Knock-out gene name (Ensembl): ifit3(ENSMUSG00000074896)

4. Knocking out the Ensembl website address link of the gene: http:// asia. ensembles. org/Mus _ musculus/Gene/Summary? g ═ ENSMUSG 00000074896; r 19:34583531 and 34588731; t ═ ENSMUST00000102825

5. Knock-out of the targeted transcript (Ensembl No.: ifit3-001(ENSMUST00000102825.3)

Knock out targeted exon: exon2

Thirdly, a scheme of designing a strategy for CRISPR/Cas9 gene knockout is shown in FIG. 2.

And fourthly, confirming the upstream and downstream sequence information of the gene knockout site, wherein the upstream and downstream sequence information is shown as SEQ ID NO 1.

Fifthly, determining specific target sites sgRNA1 and sgRNA2 of a gene to be knocked out of an Ifit3-eKO1 mouse, linearizing and purifying the DNA, and transcribing the DNA and Cas9 nuclease into mRNA in vitro; the sgrnas were purified to a purity suitable for transgene injection. The sequence of the sgRNA1 is shown as SEQ ID NO. 2; the sequence of the sgRNA2 is shown in SEQ ID NO. 3; in vitro transcription Cas9, sgRNA electrophoresis results are shown in fig. 3.

SEQ ID NO:2：GGGTCATGGGTATAGAACCGG

SEQ ID NO:3：CTAGGAGAGGCCAAGAAATCAGG

Sixthly, the sgRNA and Cas9 nuclease mRNA in the step five are subjected to in vitro transcription and then injected into fertilized eggs, the fertilized eggs which survive after injection are transplanted into a pseudopregnant female mouse, and the born embryo-transplanted mouse is the F0 mouse.

Seventhly, after the mouse is born for 3 weeks, the tail of the mouse is cut, DNA is extracted and PCR amplification is carried out, products are connected through a T-vector and sequenced, and the positive F0 generation positive mouse is: no. 22 (the mutated genome sequence is shown as SEQ ID NO:4) and No. 42 (the mutated genome sequence is shown as SEQ ID NO: 5).

Eighth, positive F0 mouse PCR identification method:

1. primer information:

primer and method for producing the same	Sequence 5' ->3'	Primer types
			I	CACCTGGCCCCTTCTGGATA	Forward
II	GCTGGCCTGCTGCTTACCTTA	Reverse

2. Reaction system:

reaction components	Volume (μ l)
		ddH2O	31
PrimeStar GXL PCR Buffer	10
		2.5mMdNTP	4
Primer I(20pmol/μl)	1
		Primer II(20pmol/μl)	1
PrimeStar GXL DNA Polymerase*	2
		Tail genomic DNA	1
Total up to	50

*PrimeStar GXL(TaKaRa，Code No：R050A)

3. Reaction conditions are as follows:

step (ii) of	Temperature (. degree.C.)	Time of day	Remarks for note
				1	98	2 minutes	-
2	98	10 seconds	-
				3	63	15 seconds	-
4	68	4 minutes	Step 2-4, repeat 35 times
				5	68	5 minutes	-
6	12	-	Holding

Nine and F1 mouse generations obtaining and genotype identification

Positive F0 generation mice No. 22 and No. 42 were selected to mate with wild type C57BL/6J mice respectively, and the obtained F1 generation heterozygote mice had 2 types, which are respectively: type 1 knock-out, 2513 base pairs deleted; knockout type 2, 2527 base pairs deleted; the identification method is the same as that of F0 mouse.

Knock-out type 1: 2513 base pairs deletion

Mouse number	Genotype(s)	Sex	Date of birth	Parent
					26	He(-2513)	♀	2017-1-9	22#

Knock-out type 2: 2527 base pairs are deleted

Mouse number	Genotype(s)	Sex	Date of birth	Parent
					34	He(-2527)	♂	2017-1-9	42#
37	He(-2527)	♀	2017-1-9	42#

Tenth, genotype comparison analysis of knockout F1 mouse:

1. in the strain of mice, the target gene exon2 is completely deleted before and after gene knockout, so that the gene function is deleted;

2. the sequence analysis after the knockout of the genotype 1 (2513 base pairs are deleted) is shown as SEQ ID NO: 6. The sequencing results after knockdown are shown in FIG. 4;

3. the sequence analysis after the knockout of type 2 (deletion of 2527 base pairs) genotype is shown as SEQ ID NO: 7. The sequencing results after knockdown are shown in figure 5;

sbjct is the wild-type genome sequence, and Query is the actual sequencing result.

And eleven, hybridizing the F1 generation heterozygote mice to obtain F2 generation homozygote mice, namely the mouse animal model.

Identification of twelve, F2 generation homozygous mice:

1. because the sequences of the genes Ifit3 and Ifit3b and the sequence similarity between the upstream and downstream are extremely high, the Ifit3 fragment can hardly be amplified independently.

2. The identification scheme is as follows: the mouse genome was amplified using primers I, II, and wild type mice had only large bands. Both heterozygote and homozygote mice have two bands in size, and since the deletion fragment reaches 2.5kb, the size fragments are very different, as shown in FIG. 6.

Thirteen, to distinguish heterozygote and homozygote, large band sequencing needs to be recovered, and the interpretation is based on a 'peak shape graph' of a sequencing result and not sequence information of the sequencing result; the sequencing primer is CACAGCTGAAGTGCCATTTC, and the sequencing result shows that the single Ifit3b gene peak type is homozygote mouse; the mouse was heterozygous having a mixed peak pattern of the Ifit3 gene and the Ifit3b gene as a result of the sequencing, as shown in FIG. 7.

The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and additions can be made without departing from the method of the present invention, and these modifications and additions should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> Shanghai city Hospital of same economic nature

Construction method and application of <120> Ifit3-eKO1 gene knockout mouse animal model

<130>/

<160>7

<170>PatentIn version 3.3

<210>1

<211>2907

<212>DNA

<213> mouse (Mus musculus)

<400>1

gtcctcttct ttctgaggtg cacctgccac cttgtaaatt agaacaggga taaagaatga 60

caacctctga aattatacta tgtttctgtc ctgaatcata agcagctttt gcagatgatt 120

aaagtgcaaa attgcaggga attcaagatt cttgaatcaa taaatctaag gcaaggctaa 180

gaagggtcat gggtatagaa ccggttgaaa aggaccacag atttgttata tacatgctga 240

aaagggagta atacttactt gtggatgaag tagtccccag caaggcttcc attccttcag 300

tgtaggaaaa acctcctgca ctggctgtgt gaatctgttc atgggaacta ccacaaatgt 360

atgtcaggtg gaagagagga aagggtgcag acttaaagtg gaatgtttaa ttggagtttc 420

aggtctgaga aattggccat tagaaaggag aggcagaaaa taaacatctc caagagtaca 480

tggctcacat tgtcatgact ccgacaccca aaaaaaggtg gttaattttt caatgtcctg 540

aggctccatc cagttaccat gcaaaattaa acatcacaag ttacacaaga tttgtgggtg 600

ctcatcacag tgaccatgtt tttttttccg ccacagtgag gtcaaccggg aatctctgga 660

agcgatcctt ccacagctga agtgccattt cacctggaat ttattcaggg aaggaagtat 720

gtccagtcat atggaagaca gggtgtgcaa ccaggtcgaa catttaaact ctgaggagaa 780

ggcaacaatg tatgacttat tggcctacat aaagcaccta gatggcgaaa gcaaggccgc 840

cctggagtgc ttagggcaag ctgaagattt aaggaagtca gagcacaatg atcaatcaga 900

aattcgtcga ctggtcacct ggggaaacta cgcctggatc tactatcaca tgggccgtct 960

ctcagaagct caggcttacg ttgacaaggt gagacaagtt tgccaaaagt ttgcgaatcc 1020

ttacagcatg gaatgcccag aacttgaatg tgaggaagga tggacacgcc taaagtgtgg 1080

aagaaatgaa cgagcaaaaa tgtgctttga aaaggctcta gaagagaagc caaaggaccc 1140

agagtgctcc tctgggatgg ccatcgccat gttccgccta gaagaaaaac ctgagaagca 1200

gttctccgtg gatgctctga agcaggccat ggagttgaat cctcagaacc agtacctgaa 1260

agttctcctg gccctgaaac tgctgaggat gggagaagaa gctgaagggg agcgattgat 1320

taaagatgct ttggggaaag ctcctaatca aacggatgtc ctccaaaagg cagctcagtt 1380

ttacaagaaa aagggtaacc tagacagagc tattgagtta cttggaaaag cactgcgatc 1440

cacagtgaac aacagtcctc tctactcttt ggtcatgtgc cgttacaggg aaatactgga 1500

gcagctacag aataaaggag atgctgacag cagtgagaga agacagagga tggcagaact 1560

gagacgatta acgatggagt tcatgcagaa gactcttcag aggaggcgaa gtcctttgaa 1620

ctcctactca gatctcatcg atttcccgga agtagagaga tgctatcaga tggtcatcag 1680

taaggagagc cccgatgttg aggaagaaga cctctatgag cgctattgca acctccagga 1740

gtaccacagg aagtctgaag acctcgcagc cctggagtgt ttgttgcaat ttcccagaaa 1800

tgaaaggtca atcgagaagg aagaggttaa agagcaaaca tagcaagcag atcttaacct 1860

ccagtagcaa attgtggtgg attcttggca gttgcaggga taaaggagtg gctgaatggt 1920

tttggggttt gggaggcaac gcactttggg gcacaggcag gcttttcctg gcaccatgaa 1980

cctgaggaca accggaagtg tgtcagagtg cagacagaca gtctctcagc tctgtactgt 2040

gagacagatg tgctgtggag tgctgcttat ggggagaatg tgctgaaaaa agcatgagcc 2100

ttcctgccaa ggattgctga caaactgctc ttgattgttt ctttaaggaa ctgctttctc 2160

tccctgactc ctctgctcat cctagccata caattttcca gtcagcaaac ctcattacta 2220

atcatgtagg gaatggagct taaagcagac agagcacctt ttgatcacat tttttttctc 2280

tgcaataaat gacaactccc aacaaaattc actcttgttt cttcattcca tttcactgta 2340

gttgcttaag cctgaaggat taacctttgc ctaaggctag aatattcttt gcacatcatt 2400

tttgtattct actgtggttt tagggctgtg tgtgtgtgag tgtgtgtgtg tgtgtgtgtg 2460

tgtgtgtgtg tgtgtgtgtt tgtgtatccc taagaatgat tctaaagtta acatatatgc 2520

caaatagaaa ttgtagaata aatgtaaaag tttcaatcaa aatacagtct tttgtgtggt 2580

ggtaagagac agcaaaataa tacagtctta ttaagtctca gtgtttcttc ttttatcatt 2640

tggggaacct tataagacct ctctacccct ttctgaagaa acaatggcag ttttgctagg 2700

agaggccaag aaatcaggtg gggaaacatg gtggggaatc ctagtggtac atgatgggaa 2760

gtgcaggagg atggacatga tcaatatttg ttatacacat ggatgaaaat ttcccagtct 2820

tttcaaggtc cttcctctgc taagatgatt ggaaattgtg aatgctcatc agagtatcaa 2880

aacacaggtg ttttagcatc tatgtct 2907

<210>2

<211>21

<212>DNA

<213> Artificial sequence

<400>2

gggtcatggg tatagaaccg g 21

<210>3

<211>23

<212>DNA

<213> Artificial sequence

<400>3

ctaggagagg ccaagaaatc agg 23

<210>4

<211>394

<212>DNA

<213> mouse (Mus musculus)

<400>4

gtcctcttct ttctgaggtg cacctgccac cttgtaaatt agaacaggga taaagaatga 60

caacctctga aattatacta tgtttctgtc ctgaatcata agcagctttt gcagatgatt 120

aaagtgcaaa attgcaggga attcaagatt cttgaatcaa taaatctaag gcaaggctaa 180

gaagggtcat gggtataggg agaggcgggg aaacatggtg gggaatccta gtggtacatg 240

atgggaagtg caggaggatg gacatgatca atatttgtta tacacatgga tgaaaatttc 300

ccagtctttt caaggtcctt cctctgctaa gatgattgga aattgtgaat gctcatcaga 360

gtatcaaaac acaggtgttt tagcatctat gtct 394

<210>5

<211>380

<212>DNA

<213> mouse (Mus musculus)

<400>5

gtcctcttct ttctgaggtg cacctgccac cttgtaaatt agaacaggga taaagaatga 60

caacctctga aattatacta tgtttctgtc ctgaatcata agcagctttt gcagatgatt 120

aaagtgcaaa attgcaggga attcaagatt cttgaatcaa taaatctaag gcaaggctaa 180

gaagggtcag gtggggaaac atggtgggga atcctagtgg tacatgatgg gaagtgcagg 240

aggatggaca tgatcaatat ttgttataca catggatgaa aatttcccag tcttttcaag 300

gtccttcctc tgctaagatg attggaaatt gtgaatgctc atcagagtat caaaacacag 360

gtgttttagc atctatgtct 380

<210>6

<211>394

<212>DNA

<213> mouse (Mus musculus)

<400>6

gtcctcttct ttctgaggtg cacctgccac cttgtaaatt agaacaggga taaagaatga 60

caacctctga aattatacta tgtttctgtc ctgaatcata agcagctttt gcagatgatt 120

aaagtgcaaa attgcaggga attcaagatt cttgaatcaa taaatctaag gcaaggctaa 180

gaagggtcat gggtataggg agaggcgggg aaacatggtg gggaatccta gtggtacatg 240

atgggaagtg caggaggatg gacatgatca atatttgtta tacacatgga tgaaaatttc 300

ccagtctttt caaggtcctt cctctgctaa gatgattgga aattgtgaat gctcatcaga 360

gtatcaaaac acaggtgttt tagcatctat gtct 394

<210>7

<211>380

<212>DNA

<213> mouse (Mus musculus)

<400>7

gtcctcttct ttctgaggtg cacctgccac cttgtaaatt agaacaggga taaagaatga 60

caacctctga aattatacta tgtttctgtc ctgaatcata agcagctttt gcagatgatt 120

aaagtgcaaa attgcaggga attcaagatt cttgaatcaa taaatctaag gcaaggctaa 180

gaagggtcag gtggggaaac atggtgggga atcctagtgg tacatgatgg gaagtgcagg 240

aggatggaca tgatcaatat ttgttataca catggatgaa aatttcccag tcttttcaag 300

gtccttcctc tgctaagatg attggaaatt gtgaatgctc atcagagtat caaaacacag 360

gtgttttagc atctatgtct 380

Claims

1. A method for establishing an Ifit3-eKO1 gene knockout mouse model is characterized in that the method is based on CRISPR/Cas9 gene knockout technology, and the method comprises the following steps:

step one, determining specific target sites sgRNA1 and sgRNA2 of a gene to be knocked out of an Ifit3-eKO1 mouse, and transcribing the sgRNA2 and Cas9 nuclease mRNA into mRNA in vitro;

step two, ovulation promotion and in-vitro fertilization of the mouse, and microinjection of fertilized eggs;

extracting tail DNA of the F0 mouse 3 weeks after birth, carrying out PCR amplification and sequencing the product;

hybridizing the heterozygote mice of the F1 generation to obtain homozygote mice of the F2 generation, namely a mouse animal model;

step three: transplanting the fertilized eggs survived after injection into a pseudopregnant female mouse to produce a mouse, namely an F0 generation mouse;

sgRNA1 is as set forth in SEQ ID NO:2, sgRNA2 is as set forth in SEQ ID NO:3 is shown in the specification;

the PCR amplification method in the second step is as follows:

primer information:

primer and method for producing the same Sequence 5'- - > 3' Primer types I CACCTGGCCCCTTCTGGATA Forward II GCTGGCCTGCTGCTTACCTTA Reverse

Reaction system:

reaction components Volume (μ l) ddH2O 31 PrimeStar GXL PCR Buffer 10 2.5mMdNTP 4 Primer I(20pmol/μl) 1 Primer II(20pmol/μl) 1 PrimeStar GXL DNA Polvmerase* 2 Tail genomic DNA 1 Total up to 50

Reaction conditions are as follows:

。

2. An sgRNA for constructing an Ifit3-eKO1 gene knockout mouse model based on CRISPR/Cas9 gene knockout technology is characterized in that sgRNA1 is shown as SEQ ID NO:2, sgRNA2 is as set forth in SEQ ID NO:3, respectively.

3. The sgRNA of claim 2, for use in establishing a gene-deficient mouse.